Tai Ji Quan: An overview of its history, health benefits, and cultural value
Directory of Open Access Journals (Sweden)
Yucheng Guo
2014-03-01
Full Text Available Tai Ji Quan is considered to be a part of traditional Chinese Wushu (a martial art and comprises various styles that have evolved historically from the Chen, Yang, Wǔ, Wú, and Sun families (schools. Recent simplification of the original classic styles has made Tai Ji Quan easier to adopt in practice. Thus, the traditional legacy of using Tai Ji Quan for self-defense, mindful nurturing of well-being, and fitness enhancement has been expanded to more contemporary applications that focus on promoting physical and mental health, enhancing general well-being, preventing chronic diseases, and being an effective clinical intervention for diverse medical conditions. As the impact of Tai Ji Quan on physical performance and health continues to grow, there is a need to better understand its historical impact and current status. This paper provides an overview of the evolution of Tai Ji Quan in China, its functional utility, and the scientific evidence of its health benefits, as well as how it has been a vehicle for enhancing cultural understanding and exchanging between East and West.
Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing
2014-01-01
Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).
Energy Technology Data Exchange (ETDEWEB)
NONE
2012-11-01
The Swedish Energy Agency is responsible for the Swedish government program for the Clean Development Mechanism (CDM) and Joint Implementation (JI). CDM and JI is the Kyoto Protocol's two project-based flexible mechanisms. This program focuses on participation in individual CDM- and JI-projects and on participation in multilateral CDM- and JI- funds. In the report the Swedish Energy Agency, on behalf of the Government, presents a proposal for developed reporting for the CDM- and JI-program. Furthermore, issues related to how CDM and JI can assist in meeting the Swedish climate objective by 2020 are discussed. Also, the role for potential new flexible mechanisms under UN Climate Convention is mentioned.
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...
Li, Fuzhong
2014-03-01
Tai Ji Quan, developed as a martial art, has traditionally served multiple purposes, including self-defense, competition/performance, and health promotion. With respect to health, the benefits historically and anecdotally associated with Tai Ji Quan are now being supported by scientific and clinical research, with mounting evidence indicating its potential value in preventing and managing various diseases and improving well-being and quality of life in middle-aged and older adults. The research findings produced to date have both public health significance and clinical relevance. However, because of its roots in the martial arts, transforming traditional Tai Ji Quan movements and training approaches into contemporary therapeutic programs and functional applications is needed to maximize its ultimate utility. This paper addresses this issue by introducing Tai Ji Quan: Moving for Better Balance , a functional therapy that involves the use of Tai Ji Quan principles and Yang-style-based movements to form an innovative, contemporary therapeutic approach that integrates motor, sensory, and cognitive components to improve postural control, gait, and mobility for older adults and those who have neurodegenerative movement impairments. It provides a synergy of traditional and contemporary Tai Ji Quan practice with the ultimate goal of improving balance and gait, enhancing performance of daily functional tasks, and reducing incidence of falls among older adults.
Directory of Open Access Journals (Sweden)
Fuzhong Li
2014-03-01
Full Text Available Tai Ji Quan, developed as a martial art, has traditionally served multiple purposes, including self-defense, competition/performance, and health promotion. With respect to health, the benefits historically and anecdotally associated with Tai Ji Quan are now being supported by scientific and clinical research, with mounting evidence indicating its potential value in preventing and managing various diseases and improving well-being and quality of life in middle-aged and older adults. The research findings produced to date have both public health significance and clinical relevance. However, because of its roots in the martial arts, transforming traditional Tai Ji Quan movements and training approaches into contemporary therapeutic programs and functional applications is needed to maximize its ultimate utility. This paper addresses this issue by introducing Tai Ji Quan: Moving for Better Balance, a functional therapy that involves the use of Tai Ji Quan principles and Yang-style-based movements to form an innovative, contemporary therapeutic approach that integrates motor, sensory, and cognitive components to improve postural control, gait, and mobility for older adults and those who have neurodegenerative movement impairments. It provides a synergy of traditional and contemporary Tai Ji Quan practice with the ultimate goal of improving balance and gait, enhancing performance of daily functional tasks, and reducing incidence of falls among older adults.
Horseshoes in modified Chen's attractors
International Nuclear Information System (INIS)
Huang Yan; Yang Xiaosong
2005-01-01
In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map
Multifactor Regulation of the MdtJI Polyamine Transporter in Shigella.
Directory of Open Access Journals (Sweden)
Adriano Leuzzi
Full Text Available The polyamine profile of Shigella, the etiological agent of bacillary dysentery in humans, differs markedly from that of E. coli, its innocuous commensal ancestor. Pathoadaptive mutations such as the loss of cadaverine and the increase of spermidine favour the full expression of the virulent phenotype of Shigella. Spermidine levels affect the expression of the MdtJI complex, a recently identified efflux pump belonging to the small multi-drug resistance family of transporters. In the present study, we have addressed the regulation of the mdtJI operon in Shigella by asking which factors influence its expression as compared to E. coli. In particular, after identifying the mdtJI promoter by primer extension analysis, in vivo transcription assays and gel-retardation experiments were carried out to get insight on the silencing of mdtJI in E. coli. The results indicate that H-NS, a major nucleoid protein, plays a key role in repressing the mdtJI operon by direct binding to the regulatory region. In the Shigella background mdtJI expression is increased by the high levels of spermidine typically found in this microorganism and by VirF, the plasmid-encoded regulator of the Shigella virulence regulatory cascade. We also show that the expression of mdtJI is stimulated by bile components. Functional analyses reveal that MdtJI is able to promote the excretion of putrescine, the spermidine precursor. This leads us to consider the MdtJI complex as a possible safety valve allowing Shigella to maintain spermidine to a level optimally suited to survival within infected macrophages and, at the same time, prevent toxicity due to spermidine over-accumulation.
How to Integrate Tai Ji Quan into Physical Education Programs
Lu, Chunlei
2008-01-01
Tai ji quan, also known as "tai chi," is an ancient Chinese exercise characterized by soft, slow, and meditative movements. It consists of a set of continuous, evenly paced, carefully choreographed, but natural, body shifts. "Tai ji" is an ancient Chinese philosophy, while "tai ji quan" refers to a type of physical activity based on tai ji…
Titanisierung von Implantatoberflächen
Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.
Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.
DEFF Research Database (Denmark)
Gimpel, Denise
been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...
CDM and JI in View of the Sustainability Debate
Schoot Uiterkamp, A.J.M.
2001-01-01
Clean Development Mechanism (CDM), Joint Implementation (JI) and emissions trading are the three flexible instruments incorporated in the Kyoto Protocol. This paper presents a critical assessment of the sustainability of energy-related technology innovation and transfer in the context of CDM and JI.
Tai Ji Quan, the brain, and cognition in older adults
Directory of Open Access Journals (Sweden)
Yu-Kai Chang
2014-03-01
Full Text Available The relationship between physical activity (PA and cognition has received much attention recently. While evidence of improved cognition following PA has consistently been observed, the majority of studies have spotlighted aerobic exercise and the effects of other modes of PA, such as Tai Ji Quan, on cognition have received limited attention. This article provides a brief review of the literature concerning the influence of Tai Ji Quan on cognition in older adults, including those with intact cognition and those with cognitive impairment. In addition, this review proposes potential mechanisms (cardiovascular fitness, motor fitness, movement coordination, social interaction, and meditation statuses as well brain structure and function evaluated from a neuroimaging perspective that may explain the Tai Ji Quan–cognition relationship. Finally, we present suggestions for future research. In conclusion, Tai Ji Quan, with its multi-faceted characteristics, shows promise as a mode of PA for enhancing cognition, as well as brain health, in older adults. Based on the findings in this review, further exploration of the effects of Tai Ji Quan on cognition in older adults is warranted.
International Nuclear Information System (INIS)
Hughes, B.D.; Frankel, N.E.; Ninham, B.W.
1990-01-01
An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs
Stability analysis of distributed order fractional chen system.
Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.
Stability Analysis of Distributed Order Fractional Chen System
Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508
Energy Technology Data Exchange (ETDEWEB)
NONE
2012-11-01
The report is an annual report of the Swedish CDM [Clean Development Mechanism] and JI [Joint Implementation]program for 2011. The report shows aims and goals of the business and the work of individual CDM and JI projects and multilateral funds which have been performed over the entire duration of life and especially during 2011. The report presents volume orders, deliveries of emission reduction units as well as the volumes expected to be needed for the fulfillment of the national target by 2020. The report also includes information about the average price for the emission reductions as well as alternative costs.
Complete synchronization of two Chen-Lee systems
International Nuclear Information System (INIS)
Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T
2008-01-01
This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach
[Effects of long-term Tai Ji Quan exercise on automatic nervous modulation in the elderly].
Guo, Feng
2015-03-01
To examine the effects of long-term Tai Ji Quan (Chinnese Traditional Exercise) on automatic nervous modulation in the elders. The 18 subjects from Tai Ji Quan exercise class in Liaoning University of Retired Veteran Cadres were assigned into long-term Tai Ji Quan exercise group including 10 subjects and novice group including 8 subjects. Electrocardiography, respiratory and blood pressure data were collected on the following time points: at rest before Tai Ji Qhuan exercise and 30 min or 60 min after Tai Ji Quan exercise. The subjects at rest state in the long-term Tai Ji Quan exercise group showed higher than the subjects in the novice group in resperitory rate (RR), standard deviations of normal to normal intervals (SDNN), total power (TP), low frequency power (LFP), high frequency power (HFP), normalized high frequency power (nHFP), but lower in LFP/HFP, systolic and diastolic blood pressure, and heart rate. At rest state the respiratory rate of subjects in long-term Tai Ji Quan exercise group was significantly lower than the novices. After Tai Ji Quan exercise, TP, nHFP, LFP/HFP, heart rate and systolic pressure showed significantly changes, and the change level of Tai Ji Quan on these indices was larger in Tai Ji Quan exercise group than that in the novice group. Long-term Tai Ji Quan exercise can improve vagal modulations, and tend to reduce the sympathetic modulations.
Czech Academy of Sciences Publication Activity Database
Färber, Vratislav (ed.)
2007-01-01
Roč. 18, č. 4 (2007), s. 163-170 ISSN 0862-6928 R&D Projects: GA ČR GA405/05/2152 Institutional research plan: CEZ:AV0Z90560517 Keywords : Kamil Fiala * Jiří Karásek ze Lvovic * Arnošt Procházka * Jiřina Böhmová * Antnoní Trýb Subject RIV: AJ - Letters, Mass-media, Audiovision
CDM and JI in View of the Sustainability Debate
Schoot Uiterkamp, A.J.M.
2001-01-01
Clean Development Mechanism (CDM), Joint Implementation (JI) and emissions trading are the three flexible instruments incorporated in the Kyoto Protocol. This paper presents a critical assessment of the sustainability of energy-related technology innovation and transfer in the context of CDM and JI. The rebound effect is discussed by comparing intended and unintended project and process outcomes. Attention is given to the role of nations and key actors like multinationals in achieving sustain...
Eine praktische Anwendung von CMC-Flächen in der Bionik
Apeltauer, Christian
2011-01-01
Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...
Mechanical analysis of Chen chaotic system
International Nuclear Information System (INIS)
Liang, Xiyin; Qi, Guoyuan
2017-01-01
The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.
2012-08-06
K2-2 COMPUTATIONAL STUDY OF EXTERNAL FIXATION DEVICES SURFACE HEATING IN 1.5T AND 3T MRI SYSTEMS Yan Liu*1, Jianxiang Shen1, Ji Chen1, Wolfgang...communications have been ex- panding rapidly with the proliferation of consumer wireless devices such as smart phones, tablet PCs, handheld gaming devices, and...Computational Study of External Fixation Devices Surface Heating in 1.5T and 3T MRI Systems Yan Liu* (1) , Jianxiang Shen (1) , Ji Chen (1) , and
Rufertová, Kamila
2010-01-01
Jiří Wolker, a poet born at the beginning of the 20th century, enjoyed great popularity among literary critics as well as readers. The reception of his work was marked with controversial interpretations, which resulted in the critical movement Dosti Wolkera (Enough Wolker) in 1925. Wolker's work has been described as "Proletarian", but his lyrical writings achieved high quality and there is much more in it. Jiří Wolker had been appreciated as a very talented and hard-working personality. He b...
On a conjecture of Chen-Guo-Wang
Ning, Bo; Zheng, Yu
2015-01-01
Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...
Jičín - město pohádky a cestovní ruch
Šarbortová, Kateřina
2011-01-01
The bachelor's thesis deals with Jičín and festival Jičín - the town of fairytale. First chapter characterizes the importance of tourism, types of tourism, its destination and marketing in tourism. The following part deals with Královéhradecký region, the town of Jičín and its tourist attractions. The next chapter describes festival Jičín - the town of fairytale. The last chapter analyses the influence of the festival on tourism of the town and its surroundings.
DEFF Research Database (Denmark)
Gimpel, Denise
Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...
Gurav, S D; Gilibili, R R; Jeniffer, S; Mohd, Z; Giri, S; Govindarajan, R; Srinivas, N R; Mullangi, R
2012-01-01
JI-101, chemically 1-[1-(2-amino-pyridin-4-ylmethyl)-1H-indol-4-yl]-3-(5-bromo-2-methoxy-phenyl)-urea hydrochloride, is a novel orally active kinase inhibitor, which has shown potent in vitro and in vivo anticancer activity against a variety of cancer cell lines and xenografts. It is currently entering Phase II clinical development for the treatment of solid tumors. The aim of the study is to assess the metabolic stability of JI-101 in various pre-clinical and human liver microsomes, to identify the major CYPs (cytochrome β450) involved in the metabolism of JI-101 and identification of putative metabolites. We have also studied the pharmacokinetics, tissue distribution and excretion of JI-101 in Sprague Dawley rats. JI-101 was found to be stable in various liver microsomes tested. JI-101 is highly permeable and not a substrate for P-gp (permeability glycoprotein). JI-101 excreted through bile along with its mono- and di-hydroxy metabolites. Following oral administration, JI-101 was rapidly absorbed, reaching Cmax within 2 h. The t½ of JI-101 with intravenous and oral route was found to be 1.75 ± 0.79 and 2.66 ± 0.13 h, respectively. The Cl and Vd by intravenous route for JI-101 were found to be 13.0 ± 2.62 mL/min/kg and 2.11 ± 1.42 L/kg, respectively. The tissue distribution of JI-101 was extensive with rapid and preferred uptake into lung tissue. Overall, the oral bioavailability of JI-101 is 55% and the primary route of elimination for JI-101 is feces. © Georg Thieme Verlag KG Stuttgart · New York.
Acupuncture (針灸 Zhēn Jiǔ – An Emerging Adjunct in Routine Oral Care
Directory of Open Access Journals (Sweden)
Devanand Gupta
2014-10-01
Full Text Available Acupuncture (針灸 Zhēn Jiǔ (‘acus’ (needle+‘punctura’ (to puncture is the stimulation of specific points along the skin of the body involving various methods such as penetration by thin needles or the application of heat, pressure, or laser light. Acupuncture (針灸 Zhēn Jiǔ aims to treat a range of medical and dental ailments, though is most commonly used for pain relief. This article reviews about the various possible roles of acupuncture (針灸 Zhēn Jiǔ in clinical dental practice. Acupuncture (針灸 Zhēn Jiǔ has potential in supplementing conventional treatment procedures by its diverse applicability outreach. Role of acupuncture (針灸 Zhēn Jiǔ in dental practice has been well supported by clinical trials. Its role in alleviating facial pain, pre-operative and post-operative dental pain has led to its widespread application. Its role as sole analgesic for treatment procedure has to be tested. It's It is a thought that acupuncture (針灸 Zhēn Jiǔ may prove an indispensible supplement to conventional treatment modalities and more of clinical trials and studies are required to prove the efficacy. Acupuncture (針灸 Zhēn Jiǔ is not a miracle cure and is not going to replace the drill. However, the technique can be a supplement to conventional treatments in TMDs, facial pain, pain management Sjoegrens syndrome, and in phobias and anxiety. The application and use of Acupuncture (針灸 Zhēn Jiǔ comes with some side effects. Proper training needs to be obtained before commencement of any procedure related to acupuncture (針灸 Zhēn Jiǔ. Various training programs are offered to train clinical practitioners the apt method to use acupuncture (針灸 Zhēn Jiǔ.
Poster - Thurs Eve-16: Just-in-time tomography (JiTT).
Pang, G; Rowlands, J A
2008-07-01
Soft-tissue target motion is one of the main concerns in high-precision radiation therapy. Cone beam computed tomography (CBCT) has been developed recently to image soft-tissue targets in the treatment room for image-guided radiation therapy. However, due to its relatively long image acquisition time the CBCT approach cannot provide images of the target at the instant of the treatment and thus is not adequate for imaging targets with intrafraction motion. In this work, a new concept for image-guided radiation therapy- just-in-time tomography (JiTT) - is introduced. Differing from CBCT, JiTT takes much less time to generate the needed tomographical, beam's-eye-view images of the treatment target at the right moment to guide the radiation therapy treatment. A system to achieve JiTT is proposed and its feasibility is investigated. Research supported by Siemens. © 2008 American Association of Physicists in Medicine.
Adaptive synchronization of hyperchaotic Chen system with uncertain parameters
International Nuclear Information System (INIS)
Park, Ju H.
2005-01-01
This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme
Mechanisms of all-trans retinoic acid-induced differentiation of acute ...
Indian Academy of Sciences (India)
Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...
Chaos in the fractional order Chen system and its control
International Nuclear Information System (INIS)
Li Chunguang; Chen Guanrong
2004-01-01
In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied
A simple observer of the generalized Chen chaotic systems
International Nuclear Information System (INIS)
Sun, Y.-J.
2009-01-01
In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.
The age grading and the Chen-Ruan cup product
DEFF Research Database (Denmark)
A. Hepworth, Richard
2010-01-01
We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....
Long-term prospects of CDM and JI; Langfristige Perspektiven von CDM und JI
Energy Technology Data Exchange (ETDEWEB)
Cames, Martin; Anger, Niels; Boehringer, Christoph; Harthan, Ralph O.; Schneider, Lambert [Oeko-Institut, Berlin (Germany)
2007-07-15
This study analyses whether Germany should use the flexible mechanisms under the Kyoto protocol or whether it should continue to achieve its greenhouse gas reduction targets by dint of domestic policies and measures. It estimates the future potential of the project-based Kyoto mechanisms (CDM and JI) and the impacts of its use on the German and the global economy, using an integrated-assessment model. In a Delphi survey, the expectations of international experts on the future prospects of the project-based Kyoto mechanisms are assessed. The study finishes with an analysis of options for promoting the use of the flexible mechanisms in Germany and concludes that the Federal Government of Germany should establish a project-based mechanisms fund of 25 to 50 million Kyoto units to cover the compliance uncertainties due to unexpected temperature or business cycle variations. (orig.) [German] Diese Studie untersucht, ob Deutschland die flexiblen Mechanismen unter dem Kyoto-Protokoll nutzen sollte oder weiterhin seine Treibhausgasreduktionsziele durch inlaendische Politiken und Massnahmen erreichen sollte. Das kuenftige Potenzial der projektbezogenen Kyoto-Mechanismen (CDM und JI) wird untersucht und die Auswirkungen von deren Nutzung auf die deutsche und globale Wirtschaft werden mit einem Integrated-Assessment-Modell abgeschaetzt. In einer Delphi-Befragung werden die Erwartungen internationaler Experten in Hinblick auf die kuenftigen Perspektiven der projektbezogenen Kyoto- Mechanismen ermittelt. Abschliessend werden Moeglichkeiten zur Foerderung der Nutzung der flexiblen Mechanismen in Deutschland analysiert, mit der Schlussfolgerung, dass die Bundesregierung einen 25 bis 50 Millionen Kyoto-Einheiten umfassenden Fonds fuer projektbezogene Mechanismen einrichten sollte, um die Unsicherheiten bei der Erfuellung des Kyoto-Ziels infolge unerwarteter Temperaturschwankungen oder einer Aenderung der Konjunkturentwicklung abzudecken. (orig.)
Woerdman, E.
The Kyoto protocol allows developed countries to achieve cost-effective greenhouse gas emission reductions abroad by means of international emissions trading (IET), joint implementation (JI) and the clean development mechanism (CDM). The article argues that JI and CDM projects will be more
Immunogenicity of novel sulfadimethoxide conjugates | Chen ...
African Journals Online (AJOL)
Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...
Alternative implementation of the chaotic Chen-Lee system
International Nuclear Information System (INIS)
Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.
2009-01-01
The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.
Wang, Yuhong; Tang, Cuiqing; Cheng, Shuang; Cui, Guimei; Zhang, Ruiling; Zhang, Zhiyong; Xie, Lingyin; Lin, Yongxiong; Hao, Wei
2015-02-01
To investigate the efficacy and safety of Ji-Tai tablet and Ji-Tai tablet combined with buprenorphine in the treatment of patients with acute withdrawal syndrome of mild heroin dependence. A total of 150 patients with mild heroin dependence were recruited, and were randomly assigned to a Ji-Tai tablet group (n=50), a Ji-Tai tablet combined with buprenorphine group (n=50) and a control group (n=50) during a 10-day clinical trial. Opiate withdrawal scale (OWS) was used to measure the severity of withdrawal symptoms. Anxiety symptoms assessments were made at 0 day (baseline), the day 5 (middle), and the day 10 (end) by the Hamilton anxiety scale (HAMA). Symptoms were assessed before and 1 h or 2 h after medication each day. The total withdrawal symptoms scores and the daily reduction rate were used to measure the effect of Ji-Tai tablet vs Ji- Tai tablet plus buprenorphine. Safety evaluation was carried out by the following measures: baseline of treatment, drug side effects after the treatment, vital signs (blood pressure, heart rate, and respiration rate), laboratory examination (routine blood and urine tests and the liver and kidney function tests), and electrocardiograms. A total of 142 mild heroin dependence patients performed the experiments (including 48 in the Ji-Tai tablet group, 48 in the Ji-Tai tablet with buprenorphine group and 46 in the control group). The scores of baseline withdrawal symptoms were 43.520±19.786, 42.640±17.648 and 47.100±24.450, respectively, with no significant differences among the 3 groups (all P>0.05 ). During the 10-day treatment, the reduction rate of acute withdrawal symptoms scores increased daily, the acute withdrawal syndrome scores and the anxiety symptoms scores declined from day 0 to day 10, there was also no significant difference among the 3 groups (all P>0.05). Ji-Tai tablet did not affect vital signs such as blood pressure, heart rate, and respiration rate. Ji-Tai tablet or Ji-Tai tablet combined with buprenorphine
Hopf bifurcation analysis of Chen circuit with direct time delay feedback
International Nuclear Information System (INIS)
Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu
2010-01-01
Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit
Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems
International Nuclear Information System (INIS)
Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.
2009-01-01
This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.
Parametric study of the fractional-order Chen-Lee system
International Nuclear Information System (INIS)
Tam, L.M.; Tou, W.M.S.
2008-01-01
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found
Parametric study of the fractional-order Chen-Lee system
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)
2008-08-15
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.
Czech Academy of Sciences Publication Activity Database
Skovajsa, Marek
2012-01-01
Roč. 48, č. 5 (2012), s. 1003-1008 ISSN 0038-0288 Institutional support: RVO:68378025 Keywords : Czech sociology * social theory * Jiří Musil (1928-2012) Subject RIV: AO - Sociology, Demography Impact factor: 0.652, year: 2012
Dynamics of fractional-ordered Chen system with delay
Indian Academy of Sciences (India)
Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...
Water footprint of Jing-Jin-Ji urban agglomeration in China
Zhao, D.
2017-12-01
A rapidly expanding economy and increasing water demand for economic production is placing enormous stress on water quantity and aquatic environment in Northern China, especially the so-called Jing-Jin-Ji (Beijing-Tianjin-Hebei) urban agglomeration. Several studies have focused on energy consumption, air pollution, CO2 emissions and regional blue water footprint (WF) following release of the Jing-Jin-Ji Integration Strategy by the China government. However, a comprehensive assessment distinguishing blue, green and grey WF amongst different industrial sectors, ascertaining how WF transfers internally and beyond the region and final demand consumption is not available. In this study, we quantified the WF and virtual water flow on a sectoral basis for the year 2010 through coupling the multi-regional input-output model (MRIO) with WF assessment. The results showed that Beijing and Tianjin are net importers of green, blue and grey water from Hebei and other provinces to support their needs. Conversely, Hebei exports all WF colors to Beijing, Tianjin and other provinces in China, more than 60% of WF is transferred as virtual water. For the overall Jing-Jin-Ji region a small amount of blue water (2,086 million m3) is exported, but huge amounts of green water (15,573 million m3) and grey water (30,620 million m3) are outsourced. A "Virtual Water Strategy" is one measure which could alleviate water stress at the regional scale, with consideration of financial compensation from water receiving regions made to water supplying regions for achieving water management targets. We also found that physical water transfer to Jing-Jin-Ji could not balance virtual blue water exports. Our research suggests that a continuation of an export-based economic development model will worsen Hebei's water stress. Reducing the dependency of Hebei's sectoral economy on export of water intensive and low value added agricultural products may be one strategy to reduce the pressure on regional water
Comparing numerical methods for the solutions of the Chen system
International Nuclear Information System (INIS)
Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.
2007-01-01
In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given
Impulsive synchronization of Chen's hyperchaotic system
International Nuclear Information System (INIS)
Haeri, Mohammad; Dehghani, Mahsa
2006-01-01
In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated
Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.
2018-03-01
This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.
A journey through discrete mathematics a tribute to Jiří Matoušek
Nešetřil, Jaroslav; Thomas, Robin
2017-01-01
This collection of high-quality articles in the field of combinatorics, geometry, algebraic topology and theoretical computer science is a tribute to Jiří Matoušek, who passed away prematurely in March 2015. It is a collaborative effort by his colleagues and friends, who have paid particular attention to clarity of exposition – something Jirka would have approved of. The original research articles, surveys and expository articles, written by leading experts in their respective fields, map Jiří Matoušek’s numerous areas of mathematical interest.
Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge
Directory of Open Access Journals (Sweden)
Ana Maria Candela
2015-08-01
Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.
A numeric-analytic method for approximating the chaotic Chen system
International Nuclear Information System (INIS)
Mossa Al-sawalha, M.; Noorani, M.S.M.
2009-01-01
The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.
Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng
2015-12-11
Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.
Directory of Open Access Journals (Sweden)
Antariksa Antariksa
2003-01-01
Full Text Available In the early Edo period the number of memorial cloisters (tacchu increased, especially, at Daitoku-ji and Myôshin-ji temples. As a consequence, the hondô (kyakuden, hojo were further developed in all aspects of architectural style, interior design and plan. This study will attempt to clarify the types of plans at memorial cloisters of both temples, by analyzing the arrangement and composition of the sanctuary, during the Edo period. In that period, the requirement of the rooms was interlaced with the function, and even dependent upon everyday life and the activities of religious services.
How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)
Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.
2017-01-01
In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…
Yu, Lei; Derrick, Matthew; Ji, Haitao; Silverman, Richard B; Whitsett, Jennifer; Vásquez-Vivar, Jeannette; Tan, Sidhartha
2011-01-01
Cerebral palsy and death are serious consequences of perinatal hypoxia-ischemia (HI). Important concepts can now be tested using an animal model of cerebral palsy. We have previously shown that reactive oxygen and nitrogen species are produced in antenatal HI. A novel class of neuronal nitric oxide synthase (nNOS) inhibitors have been designed, and they ameliorate postnatal motor deficits when administered prior to the hypoxic-ischemic insult. This study asks how the new class of inhibitors, using JI-8 (K(i) for nNOS: 0.014 μM) as a representative, compare with the frequently used nNOS inhibitor 7-nitroindazole (7-NI; K(i): 0.09 ± 0.024 μM). A theoretical dose equivalent to 75 K(i) of JI-8 or equimolar 7-NI was administered to pregnant rabbit dams 30 min prior to and immediately after 40 min of uterine ischemia at 22 days gestation (70% term). JI-8 treatment resulted in a significant decrease in NOS activity (39%) in fetal brain homogenates acutely after HI, without affecting maternal blood pressure and heart rate. JI-8 treatment resulted in 33 normal kits, 2 moderately and 13 severely affected kits and 5 stillbirths, compared with 8 normal, 3 moderately affected and 5 severely affected kits and 10 stillbirths in the 7-NI group. In terms of neurobehavioral outcome, 7-NI was not different from saline treatment, while JI-8 was superior to saline and 7-NI in its protective effect (p JI-8 significantly improved the locomotion score over both saline and 7-NI scores. JI-8 was also significantly superior to saline in preserving smell, muscle tone and righting reflex function, but 7-NI did not show significant improvement. Furthermore, a 100-fold increase in the dose (15.75 μmol/kg) of 7-NI significantly decreased systolic blood pressure in the dam, while JI-8 did not. The new class of inhibitors such as JI-8 shows promise in the prevention of cerebral palsy and is superior to the previously more commonly used nNOS inhibitor. Copyright © 2011 S. Karger AG, Basel.
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe
Spinner, Kaspar H.
2014-01-01
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132
Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?
Fan, Ka-Wai
2018-01-01
This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.
Chaos control of Chen chaotic dynamical system
International Nuclear Information System (INIS)
Yassen, M.T.
2003-01-01
This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results
Marketingový plán fitness centra Expreska Jiřího z Poděbrad
Štěchová, Kristýna
2016-01-01
Title: The marketing plan of fitness center Expreska Jiřího z Poděbrad. Objectives: The main aim of the dimploma thesis is to construct a marketing plan for fitness center Expreska Jiřího z Poděbrad for the year 2017. The proposed marketing strategy, including the implementation plan will be directed to achieve marketing and business goals of the organization. Methods: For analysis of the microenvironment is used Porter matrix. Analysis of macroenvironment is done with the help of PEST analys...
TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET
Directory of Open Access Journals (Sweden)
Denis Dolinar
2015-12-01
Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.
Li, Fuzhong; Harmer, Peter
2015-07-30
Exercise is effective in reducing falls in people with Parkinson disease. However, information on the cost effectiveness of this approach is lacking. We conducted a cost-effectiveness analysis of Tai Ji Quan for reducing falls among patients with mild-to-moderate Parkinson disease. We used data from a previous intervention trial to analyze resource use costs related to intervention delivery and number of falls observed during a 9-month study period. Cost effectiveness was estimated via incremental cost-effectiveness ratio (ICER) in which Tai Ji Quan was compared with 2 alternative interventions (Resistance training and Stretching) on the primary outcome of per fall prevented and the secondary outcome of per participant quality-adjusted life years (QALY) gained. We also conducted subgroup and sensitivity analyses. Tai Ji Quan was more effective than either Resistance training or Stretching; it had the lowest cost and was the most effective in improving primary and secondary outcomes. Compared with Stretching, Tai Ji Quan cost an average of $175 less for each additional fall prevented and produced a substantial improvement in QALY gained at a lower cost. Results from subgroup and sensitivity analyses showed no variation in cost-effectiveness estimates. However, sensitivity analyses demonstrated a much lower ICER ($27) when only intervention costs were considered. Tai Ji Quan represents a cost-effective strategy for optimizing spending to prevent falls and maximize health gains in people with Parkinson disease. While these results are promising, they warrant further validation.
Chaos synchronization between Chen system and Genesio system
International Nuclear Information System (INIS)
Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao
2007-01-01
This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes
Energy Technology Data Exchange (ETDEWEB)
Park, Choong Ki; Kim, Heung Cheol; Ahn, Bum Gyu; Park, Man Soo; Hwang, Woo Cheol; Choi, Cheol Soon; Kang, Ik Won [College of Medicine, Hallym University, Chunchon (Korea, Republic of); Kim, Man Goo [Kangwon National University, Chunchon (Korea, Republic of)
1994-07-15
To identify the main toxic gas released from salted radish in rice bran(Dan-Mu-Ji) and to introduce the radiological findings of the patient who was exposed to the gas. Chest radiographs and CT scans of one survivor among three men who were exposed to the gas from Dan-Mu-Ji were reviewed. Gas obtained from the closed bottle containing Dan-Mu-Ji was analyzed by using the gas chromatography. The radiographic examinations of the survivor were suggestive of pulmonary edema with it's rapidly improving consideration in both lung. The headspace gas within the bottle containing Dan-Mu-Ji was mainly composed with carbon dioxide, ethyl alcohol and hydrogen sulfide, of which hydrogen sulfide was considered the main toxic gas released. Under the anaerobic condition, Dan-Mu-Ji released toxic hydrogen sulfide. Inhalation of hydrogen sulfide might produce non-cardiogenic pulmonary edema.
Climate Change Policy Measures in Japan: NEDO's Activities to Promote CDM/JI
International Nuclear Information System (INIS)
Fukasawa, Kazunori; Seki, Kazuhiko; Sakurai, Takeshi
2004-01-01
The Kyoto Protocol, which obliges developed countries to reduce emissions of greenhouse gases (GHG), was adopted at the third session of the conference of the parties to the United Nations Framework Convention on Climate Change (UNFCCC) in Kyoto, Japan, on I I December 1997. Japan subsequently ratified the Kyoto Protocol in 2002 and is required thereunder to reduce GHG emissions by 6% below 1990 levels by 2008-2012. Japan, having already tackled development and promotion of energy conservation technologies after the second oil crisis, emits the lowest level of CO 2 of developed countries approximately 9.4 tons per capita in the year 2000. Consequently, Japan is able to contribute to CO 2 emissions reduction in developing economies as well as in economies in transition by application of Japan's energy conservation technologies. Because the Clean Development Mechanism (CDM) and Joint implementation (JI) of the Kyoto Mechanisms are efficient tools, the Japanese government's policy towards emission reduction makes active use of CDM/JI, thereby supporting domestic efforts in realizing Japan's reduction commitment. The Ministry of Economy, Trade and Industry (METI) of Japan is one of the key ministries to administer Governmental policy making on climate change, and is undertaking establishment of a system to facilitate the Kyoto Mechanisms. The New Energy and Industrial Technology Development Organization (NEDO), under the jurisdiction of METI, supports CDM and JI project activities implemented by Japanese private sector enterprises. In this report, the authors briefly introduce climate change policy measures in Japan and NEDO's activities to promote CDM/Jl. (Author)
Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter
Directory of Open Access Journals (Sweden)
Yee Hooi Min
2016-01-01
Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.
LBA-ECO CD-06 Physical, Political, and Hydrologic Maps, Ji-Parana River Basin, Brazil
National Aeronautics and Space Administration — ABSTRACT: This data set contains physical, hydrologic, political, demographic, and societal maps for the Ji-Parana River Basin, in the state of Rondonia, Brazil....
Directory of Open Access Journals (Sweden)
Qingguang Zhu
2016-09-01
Conclusion: Among older Chinese women with knee OA, a tailored Tai Ji Quan intervention improved gait outcomes. The intervention also improved overall function as indexed by the WOMAC and SPPB. These results support the use of Tai Ji Quan for older Chinese adults with knee OA to both improve their functional mobility and reduce pain symptomatology.
Just-in-time tomography (JiTT): a new concept for image-guided radiation therapy
International Nuclear Information System (INIS)
Pang, G; Rowlands, J A
2005-01-01
Soft-tissue target motion is one of the main concerns in high-precision radiation therapy. Cone beam computed tomography (CBCT) has been developed recently to image soft-tissue targets in the treatment room and guide the radiation therapy treatment. However, due to its relatively long image acquisition time the CBCT approach cannot provide images of the target at the instant of the treatment and thus it is not adequate for imaging targets with intrafraction motion. In this note, a new approach for image-guided radiation therapy-just-in-time tomography (JiTT)-is proposed. Differing from CBCT, JiTT takes much less time to generate the needed tomographical, beam's-eye-view images of the treatment target at the right moment to guide the radiation therapy treatment. (note)
LBA-ECO CD-06 Physical, Political, and Hydrologic Maps, Ji-Parana River Basin, Brazil
National Aeronautics and Space Administration — This data set contains physical, hydrologic, political, demographic, and societal maps for the Ji-Parana River Basin, in the state of Rondonia, Brazil. These data...
Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C
2016-07-01
Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.
Severe haze episodes and seriously polluted fog water in Ji'nan, China.
Wang, Xinfeng; Chen, Jianmin; Sun, Jianfeng; Li, Weijun; Yang, Lingxiao; Wen, Liang; Wang, Wenxing; Wang, Xinming; Collett, Jeffrey L; Shi, Yang; Zhang, Qingzhu; Hu, Jingtian; Yao, Lan; Zhu, Yanhong; Sui, Xiao; Sun, Xiaomin; Mellouki, Abdelwahid
2014-09-15
Haze episodes often hit urban cities in China recently. Here, we present several continuous haze episodes with extremely high PM2.5 levels that occurred over several weeks in early 2013 and extended across most parts of the northern and eastern China-far exceeding the Beijing-Tianjin-Hebei region. Particularly, the haze episode covered ~1 million km(2) on January 14, 2013 and the daily averaged PM2.5 concentration exceeded 360 μg m(-3) in Ji'nan. The observed maximum hourly PM2.5 concentration in urban Ji'nan reached 701 μg m(-3) at 7:00 am (local time) in January 30. During these haze episodes, several fog events happened and the concurrent fog water was found to be seriously polluted. For the fog water collected in Ji'nan from 10:00 pm in January 14 to 11:00 am in January 15, sulfate, nitrate, and ammonium were the major ions with concentrations of 1.54 × 10(6), 8.98 × 10(5), and 1.75 × 10(6) μeq L(-1), respectively, leading to a low in-situ pH of 3.30. The sulfate content in the fog sample was more than 544 times as high as those observed in other areas. With examination of the simultaneously observed data on PM2.5 and its chemical composition, the fog played a role in scavenging and removing fine particles from the atmosphere during haze episodes and thus was seriously contaminated. However, the effect was not sufficient to obviously cleanse air pollution and block haze episodes. Copyright © 2014 Elsevier B.V. All rights reserved.
An equilibrium point stabilization strategy for the Chen system
International Nuclear Information System (INIS)
Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo
2004-01-01
The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations
Generalized projective synchronization between Lorenz system and Chen's system
International Nuclear Information System (INIS)
Li Guohui
2007-01-01
On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well
Just-in-time tomography (JiTT): a new concept for image-guided radiation therapy
Energy Technology Data Exchange (ETDEWEB)
Pang, G; Rowlands, J A [Toronto-Sunnybrook Regional Cancer Centre, 2075 Bayview Avenue, Toronto M4N 3M5 (Canada); Imaging Research, Sunnybrook and Women' s College Health Sciences Centre, Departments of Radiation Oncology and Medical Biophysics, University of Toronto, Toronto (Canada)
2005-11-07
Soft-tissue target motion is one of the main concerns in high-precision radiation therapy. Cone beam computed tomography (CBCT) has been developed recently to image soft-tissue targets in the treatment room and guide the radiation therapy treatment. However, due to its relatively long image acquisition time the CBCT approach cannot provide images of the target at the instant of the treatment and thus it is not adequate for imaging targets with intrafraction motion. In this note, a new approach for image-guided radiation therapy-just-in-time tomography (JiTT)-is proposed. Differing from CBCT, JiTT takes much less time to generate the needed tomographical, beam's-eye-view images of the treatment target at the right moment to guide the radiation therapy treatment. (note)
Tai Ji Quan and global cognitive function in older adults with cognitive impairment: a pilot study.
Li, Fuzhong; Harmer, Peter; Liu, Yu; Chou, Li-Shan
2014-01-01
This study evaluated whether Tai Ji Quan: Moving for Better Balance (TJQMBB) could improve global cognitive function in older adults with cognitive impairment. Using a nonrandomized control group pretest-posttest design, participants aged ≥65 years who scored between 20 and 25 on the Mini-Mental State Examination (MMSE) were allocated into either a 14-week TJQMBB program (n=22) or a control group (n=24). The primary outcome was MMSE as a measure of global cognitive function with secondary outcomes of 50-ft speed walk, Timed Up&Go, and Activities-Specific Balance Confidence (ABC) scale. At 14 weeks, Tai Ji Quan participants showed significant improvement on MMSE (mean=2.26, pJi Quan participants performed significantly better compared to the controls in both physical performance and balance efficacy measures (p<0.05). Improvement in cognition as measured by MMSE was related to improved physical performance and balance efficacy. These results provide preliminary evidence of the utility of the TJQMBB program to promote cognitive function in older adults in addition to physical benefits. Copyright © 2014 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
Vehicle driving cycle performance of the spark-less di-ji hydrogen engine
Energy Technology Data Exchange (ETDEWEB)
Boretti, Alberto A. [School of Science and Engineering, University of Ballarat, PO Box663, Ballarat, VIC 3353 (Australia)
2010-05-15
The paper describes coupled CFD combustion simulations and CAE engine performance computations to describe the operation over the full range of load and speed of an always lean burn, Direct Injection Jet Ignition (DI-JI) hydrogen engine. Jet ignition pre-chambers and direct injection are enablers of high efficiencies and load control by quantity of fuel injected. Towards the end of the compression stroke, a small quantity of hydrogen is injected within the spark-less pre-chamber of the DI-JI engine, where it mixes with the air entering from the main chamber and auto-ignites because of the high temperature of the hot glow plug. Then, jets of partially combusted hot gases enter the main chamber igniting there in the bulk, over multiple ignition points, lean stratified mixtures of air and fuel. Engine maps of brake specific fuel consumption vs. speed and brake mean effective pressure are computed first. CAE vehicle simulations are finally performed evaluating the fuel consumption over emission cycles of a vehicle equipped with this engine. (author)
Genetic diversity and population structure of Chinese honeybees ...
African Journals Online (AJOL)
Genetic diversity and population structure of Chinese honeybees (Apis cerana) under microsatellite markers. T Ji, L Yin, G Chen. Abstract. Using 21 microsatellite markers and PCR method, the polymorphisms of 20 Apis cerana honeybee populations across China was investigated and the genetic structure and diversity of ...
Werner, Theresa L; Wade, Mark L; Agarwal, Neeraj; Boucher, Kenneth; Patel, Jesal; Luebke, Aaron; Sharma, Sunil
2015-12-01
JI-101 is an oral multi-kinase inhibitor that targets vascular endothelial growth factor receptor type 2 (VEGFR-2), platelet derived growth factor receptor β (PDGFR-β), and ephrin type-B receptor 4 (EphB4). None of the currently approved angiogenesis inhibitors have been reported to inhibit EphB4, and therefore, JI-101 has a novel mechanism of action. We conducted a pilot trial to assess the pharmacokinetics (PK), tolerability, and efficacy of JI-101 in combination with everolimus in advanced cancers, and pharmacodynamics (PD), tolerability, and efficacy of JI-101 in ovarian cancer. This was the first clinical study assessing anti-tumor activity of JI-101 in a combinatorial regimen. In the PK cohort, four patients received single agent 10 mg everolimus on day 1, 10 mg everolimus and 200 mg JI-101 combination on day 8, and single agent 200 mg JI-101 on day 15. In the PD cohort, eleven patients received single agent JI-101 at 200 mg twice daily for 28 day treatment cycles. JI-101 was well tolerated as a single agent and in combination with everolimus. No serious adverse events were observed. Common adverse events were hypertension, nausea, and abdominal pain. JI-101 increased exposure of everolimus by approximately 22%, suggestive of drug-drug interaction. The majority of patients had stable disease at their first set of restaging scans (two months), although no patients demonstrated a response to the drug per RECIST criteria. The novel mechanism of action of JI-101 is promising in ovarian cancer treatment and further prospective studies of this agent may be pursued in a less refractory patient population or in combination with cytotoxic chemotherapy.
Chen, Mengmeng; Wu, Sanmang; Lei, Yalin; Li, Shantong
2018-03-08
Jing-Jin-Ji region (i.e., Beijing, Tianjin, and Hebei) is China's key development region, but it is also the leading and most serious air pollution region in China. High fossil fuel consumption is the major source of both carbon dioxide (CO 2 ) emissions and air pollutants. Therefore, it is important to reveal the source of CO 2 emissions to control the air pollution in the Jing-Jin-Ji region. In this study, an interregional input-output model was applied to quantitatively estimate the embodied CO 2 transfer between Jing-Jin-Ji region and other region in China using China's interregional input-output data in 2010. The results indicated that there was a significant difference in the production-based CO 2 emissions in China, and furthermore, the Jing-Jin-Ji region and its surrounding regions were the main regions of the production-based CO 2 emissions in China. Hebei Province exported a large amount of embodied CO 2 to meet the investment, consumption, and export demands of Beijing and Tianjin. The Jing-Jin-Ji regions exported a great deal of embodied CO 2 to the coastal provinces of southeast China and imported it from neighboring provinces.
Chen, Weiming; Wu, Sanmang; Lei, Yalin; Li, Shantong
2017-04-15
Commodity trade between regions implies a large amount of energy transfer. As an important economic growth pole of China, the Jing-Jin-Ji area (Beijing-Tianjin-Hebei) is also one of the areas with the largest energy consumption in China. Moreover, the primary energy consumer goods in this area are fossil fuels, such as coal. This has led to serious air pollution in the area. Therefore, the reduction of energy consumption under the premise of maintaining sustained economic growth is an important task of the Jing-Jin-Ji area. In this study, an interprovincial input-output model was applied to quantitatively estimate the embodied energy transfer between Jing-Jin-Ji area and other provinces in China. The results indicated that the Metal and nonmetal mineral processing industry and the Electrical, gas and water industry in the Jing-Jin-Ji area exported a large amount of embodied energy to the Yangtze River Delta and the Pearl River Delta. However, the embodied energy export of the Jing-Jin-Ji area mainly exported by Hebei province. Beijing and Tianjin even have some net import of embodied energy. The embodied energy transfer between Tianjin, Hebei and other provinces was mainly driven by investment, while the main media of embodied energy transfer between Beijing and other provinces was consumption. Therefore, we suggest that the Jing-Jin-Ji area should further increase the degree of dependence on other provinces' energy-intensive products and reduce the export of energy-intensive products. In addition, there should be difference in the energy and industrial policies among Beijing, Tianjin and Hebei, and the problems of high energy consumption and high proportion of heavy industry in Hebei should be first resolved. Copyright © 2017 Elsevier B.V. All rights reserved.
From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium
Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz
2017-06-01
Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.
[Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].
Quan, Xiaohong; Li, Shuqian; Li, Ying
2017-03-12
Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.
Lü, Jiaojiao; Huang, Lingyan; Wu, Xie; Fu, Weijie; Liu, Yu
2017-05-01
The purpose of this study was to explore the effects of a 24-week Tai Ji Quan training program on sleep quality, quality of life, and physical performance among elderly Chinese women with knee osteoarthritis (OA). A 24-week randomized, controlled trial of 46 elderly women with knee OA. Participants were randomly assigned to either a Tai Ji Quan group (n = 23) or a control group (n = 23). Participants in the Tai Ji Quan group completed training sessions three times per week, while those in the control group had bi-weekly educational classes. The primary outcome was total score of the Pittsburgh Sleep Quality of Index (PSQI). Secondary outcomes were: seven subscales of the PSQI; sleep latency; total sleep time; sleep efficiency; physical component summary (PCS) and mental component summary (MCS) of the 36-item Short Form Health Survey (SF-36); Berg Balance Scale (BBS); and Timed Up and Go (TUG). Compared with the control group, participants in the Tai Ji Quan group had significantly improved primary outcome (global PSQI score, p = 0.006) and secondary outcomes, including three PSQI sub-scores (sleep latency, p = 0.031; sleep duration, p = 0.043; daytime dysfunction, p = 0.007), total sleep time (p = 0.033), and SF-36 PCS (p = 0.006). The Tai Ji Quan group also had significant improvements compared with baseline in three PSQI sub-scores (sleep latency, p = 0.031; habitual sleep efficiency, p = 0.049; sleep disturbance, p = 0.016), sleep latency (p = 0.003), BBS (p = 0.001), and TUG (p = 0.006). Tai Ji Quan training is an effective treatment approach to improve sleep quality and quality of life in elderly Chinese women with knee OA. Chinese Clinical Trial Registry (June 16, 2013): ChiCTR-TRC-13003264. Copyright © 2017 Elsevier B.V. All rights reserved.
Li, Bo; Han, Zeng-Lin; Tong, Lian-Jun
2009-05-01
By the methods of in situ investigation and regional ecological planning, the present ecological environment, ecosystem vulnerability, and ecological environment sensitivity in "Ji Triangle" Region were analyzed, and the ecological network of the study area was constructed. According to the ecological resources abundance degree, ecological recovery, farmland windbreak system, environmental carrying capacity, forestry foundation, and ecosystem integrity, the study area was classified into three regional ecological function ecosystems, i. e., east low hill ecosystem, middle plain ecosystem, and west plain wetland ecosystem. On the basis of marking regional ecological nodes, the regional ecological corridor (Haerbin-Dalian regional axis, Changchun-Jilin, Changchun-Songyuan, Jilin-Songyuan, Jilin-Siping, and Songyuan-Siping transportation corridor) and regional ecological network (one ring, three links, and three belts) were constructed. Taking the requests of regional ecological security into consideration, the ecological environment security system of "Ji Triangle" Region, including regional ecological conservation district, regional ecological restored district, and regional ecological management district, was built.
K jubileu prof. JUDr. Zdeňka Jičínského, DrSc
Czech Academy of Sciences Publication Activity Database
Grospič, Jiří
2009-01-01
Roč. 148, č. 5 (2009), s. 526-527 ISSN 0231-6625 Institutional research plan: CEZ:AV0Z70680506 Keywords : tribute to Zdeněk Jičínský * Czech lawyer * Czech politican Subject RIV: AG - Legal Sciences
Workshop Arboretum Volčji potok
Directory of Open Access Journals (Sweden)
Ana Kučan
2012-01-01
Full Text Available From its constitution onwards, the Volčji Potok Arboretum has been caught between various conflicting orientations. It is both a scientific, research and educational institution, and a cultural monument with exquisite garden and landscape design features and areas of great natural value and built cultural heritage, as well as commercial venue. At the same time, it functions as a park and an area for mass events, a garden centre and nursery. This variety of functions has helped Arboretum to survive the pressures of time; however, partial and uncoordinated interventions have threatened its original mission and its image and generated a number of conflicting situations. The workshop, organised on the initiative of the Institute for the Protection of Cultural Heritage of Slovenia, which involved students from the Faculty of Architecture and students from the Department of Landscape Architecture of the Biotechnical Faculty in mixed groups, generated eight proposals to solve some of the most urgent problems by introducing optimised development with clearly defined goals and priorities.
Investigation of JI and DI CMOS FXR response at different spectral energies
International Nuclear Information System (INIS)
Honnold, V.R.; Goldberg, M.; Schreiner, W.A.; Witteles, A.A.
1975-01-01
The transient response of both junction isolated (JI) and dielectrically isolated (DI) CMOS circuits has been investigated in three FXR environments of differing energy spectrums. The offset recovery times have been measured and analyzed for both structures. It is shown that while the DI circuit (HD4007) did not exhibit a four layer type latchup action, its transient response persisted for a time longer than is expected for this type of device. A possible mechanism for this observed response is developed and discussed. JI circuits (CD4007) exposed under the same conditions exhibited four layer device action and one sample at low spectral energies latched-up. The conditions for the latchup to occur including the four layer device paths are discussed. Finally, the dependence of the x-ray transient response on the spectral energy is considered. For the lower energy FXR source, latchup was observed in a CD4007 sample. This latchup was not observed at more than double the dose rate when a high energy FXR was used. This result is attributed to dose enhancement, and a device enhancement factor may also be involved. The dose enhancement factor is estimated from the work of Long, and points up the importance of accounting for the spectral energy content in simulating a given nuclear threat spectrum
Jeon, Jongwook; Jo, Changrock
2012-12-01
Imwon-Gyeongjeji which was created by Seo Yu-gu in the first half of the 19th century is a encyclopedia of practical use in rural life. It consists of 113 volumes, 16 fields, and 2.52 million total characters. Of these, the field of medicine comes 11th of the contents covering 28 volumes and 1.1 million characters. Its name is Inje-ji. This paper examines the academic background of Seo Yu-gu and his life work briefly, and investigates the characteristics of medical knowledge of late Joseon period contained in the Imwon-Gyeongjeji, Inje-ji Here, we made key comparisons especially with Dongui-Bogam, Joseon's leading medical book. Of the pioneers of medical history studies of Joseon, a Japanese researcher Miki Sakae has made a negative evaluation to Inje-ji. But after concrete investigation we have come to conclude as follows. First, familial ancestors of Seo Yu-gu were engaged in the introduction of foreign-language books, so Seo Yu-gu as an officer of proof-reading and editing of the various books, also had a lot of knowledge on the medical books ever in history. On this background and experience, for over 36 years from 1,806 retirement from official position to his death, he had compiled and edited Imwon-Gyeongjeji. Second, unlike Dongui-Bogam which included improving health skill, Inje-ji focused on curing medicine readily accessible from the major population of that time. Its main features are as follows: i) prescriptions directly linked to the diseases and symptoms, ii) greatly increased medicinal knowledge especially on infectious diseases and trauma, iii) detailed index easy to look up for prescription and iv) his 'own opinions'[an-seol] which can indicate relevant contents within the book and organically combines the whole knowledge in it. Third, "Inje-ji" utilizing medical books in China and Korea even those of Japan, collected more massively almost all the medical knowledge, new illness, herbs of local area, private prescription. Meanwhile Inje-ji modified
Leaf Extract in ICR Mice Fed High-Fat Diet
African Journals Online (AJOL)
Chen1,2, Rong-Ji Dai1,2, Yu-Lin Deng1,2 and Chong-Ming Wu3*. 1School of Life Science, Beijing Institute of Technology, Beijing 100081, 2Beijing BIT&GY Pharmaceutical R&D, Beijing 100081,. 3Institute of Medicinal Plant Development, Chinese Academy of Medical Science & Peking Union Medical College, Beijing.
Berlinale tõstab kilbile "Teekonna Guatanamosse" / Grete Nootre
Nootre, Grete
2006-01-01
56. Berliini filmifestivali programmidest ja filmidest - Suurbritannia poliitiline mängufilm "Teekond Guatanamosse" ("The Road to Guatanamo") : režissöörid Michael Winterbottom, Mat Whitecross, Hiina mängufilm "Lubadus" ("Wu ji") : režissöör Chen Kaige, Suurbritannia - Saksamaa "V nagu vendette" ("V for Vendette") : režissöör James McTeigue
Genetics Home Reference: Jackson-Weiss syndrome
... Jabs EW, Li X, Scott AF, Meyers G, Chen W, Eccles M, Mao JI, Charnas LR, Jackson CE, Jaye M. Jackson-Weiss and Crouzon syndromes are allelic with mutations in fibroblast growth factor receptor 2. Nat Genet. 1994 Nov;8(3):275-9. Erratum in: Nat Genet 1995 Apr;9(4):451. Citation on PubMed Robin ...
JiTTree: A Just-in-Time Compiled Sparse GPU Volume Data Structure
Labschutz, Matthias
2015-08-12
Sparse volume data structures enable the efficient representation of large but sparse volumes in GPU memory for computation and visualization. However, the choice of a specific data structure for a given data set depends on several factors, such as the memory budget, the sparsity of the data, and data access patterns. In general, there is no single optimal sparse data structure, but a set of several candidates with individual strengths and drawbacks. One solution to this problem are hybrid data structures which locally adapt themselves to the sparsity. However, they typically suffer from increased traversal overhead which limits their utility in many applications. This paper presents JiTTree, a novel sparse hybrid volume data structure that uses just-in-time compilation to overcome these problems. By combining multiple sparse data structures and reducing traversal overhead we leverage their individual advantages. We demonstrate that hybrid data structures adapt well to a large range of data sets. They are especially superior to other sparse data structures for data sets that locally vary in sparsity. Possible optimization criteria are memory, performance and a combination thereof. Through just-in-time (JIT) compilation, JiTTree reduces the traversal overhead of the resulting optimal data structure. As a result, our hybrid volume data structure enables efficient computations on the GPU, while being superior in terms of memory usage when compared to non-hybrid data structures.
JiTTree: A Just-in-Time Compiled Sparse GPU Volume Data Structure
Labschutz, Matthias; Bruckner, Stefan; Groller, M. Eduard; Hadwiger, Markus; Rautek, Peter
2015-01-01
Sparse volume data structures enable the efficient representation of large but sparse volumes in GPU memory for computation and visualization. However, the choice of a specific data structure for a given data set depends on several factors, such as the memory budget, the sparsity of the data, and data access patterns. In general, there is no single optimal sparse data structure, but a set of several candidates with individual strengths and drawbacks. One solution to this problem are hybrid data structures which locally adapt themselves to the sparsity. However, they typically suffer from increased traversal overhead which limits their utility in many applications. This paper presents JiTTree, a novel sparse hybrid volume data structure that uses just-in-time compilation to overcome these problems. By combining multiple sparse data structures and reducing traversal overhead we leverage their individual advantages. We demonstrate that hybrid data structures adapt well to a large range of data sets. They are especially superior to other sparse data structures for data sets that locally vary in sparsity. Possible optimization criteria are memory, performance and a combination thereof. Through just-in-time (JIT) compilation, JiTTree reduces the traversal overhead of the resulting optimal data structure. As a result, our hybrid volume data structure enables efficient computations on the GPU, while being superior in terms of memory usage when compared to non-hybrid data structures.
JiTTree: A Just-in-Time Compiled Sparse GPU Volume Data Structure.
Labschütz, Matthias; Bruckner, Stefan; Gröller, M Eduard; Hadwiger, Markus; Rautek, Peter
2016-01-01
Sparse volume data structures enable the efficient representation of large but sparse volumes in GPU memory for computation and visualization. However, the choice of a specific data structure for a given data set depends on several factors, such as the memory budget, the sparsity of the data, and data access patterns. In general, there is no single optimal sparse data structure, but a set of several candidates with individual strengths and drawbacks. One solution to this problem are hybrid data structures which locally adapt themselves to the sparsity. However, they typically suffer from increased traversal overhead which limits their utility in many applications. This paper presents JiTTree, a novel sparse hybrid volume data structure that uses just-in-time compilation to overcome these problems. By combining multiple sparse data structures and reducing traversal overhead we leverage their individual advantages. We demonstrate that hybrid data structures adapt well to a large range of data sets. They are especially superior to other sparse data structures for data sets that locally vary in sparsity. Possible optimization criteria are memory, performance and a combination thereof. Through just-in-time (JIT) compilation, JiTTree reduces the traversal overhead of the resulting optimal data structure. As a result, our hybrid volume data structure enables efficient computations on the GPU, while being superior in terms of memory usage when compared to non-hybrid data structures.
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Directory of Open Access Journals (Sweden)
Richard K. Payne
2016-03-01
Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.
Theoretical and experimental study of Chen chaotic system with notch filter feedback control
International Nuclear Information System (INIS)
Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen
2010-01-01
Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)
The Measurement of Urbanization Level Based on Entity Space: A Case Study of JingJinJi Region, China
Directory of Open Access Journals (Sweden)
Wen Fenghua
2017-01-01
Full Text Available On the basis of analyzing the pros and cons of different urbanization level measurement methods, this paper puts forward urbanization level measurement method based on entity space and then uses entity space data to describe the urbanization rate of various districts and counties of JingJinJi Region in 2005 and 2009. According to the analysis of time and space differences on such basis, JingJinJi may be divided from high to low order according to the urbanization rate of the entity space: central urban area, urban development area and suburb, which respectively bear different functions. According to the comparison of entity space urbanization rate and population urbanization rate in the aspects of sequence, primacy ratio, zipf index, etc., we find the non-intensive land use status quo of urban development area of JingJinJi and the feature that the distribution of entity space urbanization scale is much uniform than distribution of population urbanization scale. Accordingly, the paper puts forward the following suggestions : (1 The space construction should depend upon function division; (2 The urban development area should pay attention to the construction of the supporting facilities and meanwhile enhance land use rate; (3 The urban construction should be enhanced in small and middle regions and counties surrounding Beijing and Tianjin.
Maximilien Brice
2002-01-01
L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics. YOU-LIANG ZHENG. Articles written in Journal of Genetics. Volume 92 Issue 1 April 2013 pp 151-154 Research Note. Identification of 40k -secalin genes · Peng-Fei Qi Qing Chen Thérèse Ouellet Cheng-Xing Le Jia Ai Yu-Ming Wei Ji-Rui Wang You-Liang Zheng · More Details Fulltext ...
Duan, Shengnan; Qi, Wen; Zhang, Siwen; Huang, Kunkun; Yuan, Dan
2017-10-01
An ultra high performance liquid chromatography coupled with electrospray ionization quadrupole time-of-flight mass spectrometry method in both positive and negative ion modes was established in order to comprehensively investigate the major constituents in Wu Ji Bai Feng Pill. Briefly, a Waters ACQUITY UPLC HSS C 18 column was used to separate the aqueous extract of Wu Ji Bai Feng Pill. A total of 0.1% formic acid in acetonitrile and 0.1% aqueous formic acid v/v were used as the mobile phase. All analytes were determined using quadrupole time-of-flight mass spectrometry with electrospray ionization source in positive and negative ion modes. At length, a total of 173 components including flavones and their glycosides, monoterpene glycosides, triterpene saponins, phenethylalchohol glycosides, iridoid glycosides, phthalides, tanshinones, phenolic acids, sesquiterpenoids and cyclopeptides were identified or tentatively characterized in Wu Ji Bai Feng Pill in an analysis of 16.0 min based on the accurate mass and tandem mass spectrometry behaviors. The developed method is rapid and highly sensitive to characterize the chemical constituents of Wu Ji Bai Feng Pill, which could not only be used for chemical standardization and quality control of Wu Ji Bai Feng Pill, but also be helpful for further study in vivo metabolism of Wu Ji Bai Feng Pill. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Gurav, Sandip Dhondiram; Jeniffer, Sherine; Punde, Ravindra; Gilibili, Ravindranath Reddy; Giri, Sanjeev; Srinivas, Nuggehally R; Mullangi, Ramesh
2012-04-01
A general practice in bioanalysis is that, whatever the biological matrix the analyte is being quantified in, the validation is performed in the same matrix as per regulatory guidelines. In this paper, we are presenting the applicability of a validated LC-MS/MS method in rat plasma for JI-101, to estimate the concentrations of JI-101 in various tissues that were harvested in a rat tissue distribution study. A simple protein precipitation technique was used to extract JI-101 and internal standard from the tissue homogenates. The recovery of JI-101 in all the matrices was found to be >70%. Chromatographic separation was achieved using a binary gradient using mobile phase A (acetonitrile) and B (0.2% formic acid in water) at a flow rate of 0.30 mL/min on a Prodigy ODS column with a total run time of 4.0 min. The MS/MS ion transitions monitored were 466.1 → 265 for JI-101 and 180.1 → 110.1 for internal standard. The linearity range was 5.02-4017 ng/mL. The JI-101 levels were quantifiable in the various tissue samples harvested in this study. Therefore, the use of a previously validated JI-101 assay in plasma circumvented the tedious process of method development/validation in various tissue matrices. Copyright © 2011 John Wiley & Sons, Ltd.
Cryptanalysis on a modified Baptista-type cryptosystem with chaotic masking algorithm
International Nuclear Information System (INIS)
Chen Yong; Liao Xiaofeng
2005-01-01
Based on chaotic masking algorithm, an enhanced Baptista-type cryptosystem is proposed by Li et al. to resist all known attacks [S. Li, X. Mou, Z. Ji, J. Zhang, Y. Cai, Phys. Lett. A 307 (2003) 22; S. Li, G. Chen, K.-W. Wong, X. Mou, Y. Cai, Phys. Lett. A 332 (2004) 368]. In this Letter, we show that the second class bit extracting function in [S. Li, X. Mou, Z. Ji, J. Zhang, Y. Cai, Phys. Lett. A 307 (2003) 22] still leak partial information on the current chaotic state and reduce the security of cryptosystem. So, this type bit extracting function is not a good candidate for the masking algorithm
Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen
Thoma, Axel Michael
2017-01-01
Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.
Jonsson, J.E.; Afton, A.D.
2009-01-01
Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.
Huang, Weiping; Li, Naiqi
2015-03-01
Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.
The Impact of Land Use and Land Cover Change on Water Yield in the Jing- Jin-Ji Region in China
Li, Suxiao; Yang, Hong
2017-04-01
Water yield is one of the key ecosystem services sustaining both people's life and economic development. However, the water yield function is sensitive to anthropogenic activity especially the land use and land cover change (LUCC). Assessment of historical LUCC and its impact on water yield could benefit designing and implementing appropriate land use strategy that enhance the water yield capacity. Beijing (Jing) and its surrounding areas of Tianjin (Jin) and Hebei (Ji) is the political, cultural and economic center of China. The region is facing increasingly water crisis. Taking the Jing-Jin-Ji region as a study area, this study analyzed the historical LUCC and its impact on water yield by using the Integrated Valuation of Ecosystem Services and Tradeoffs (InVEST) model to spatially map and quantify the changes of water yield from 1995 to 2010. The results showed there was main decline in area of wetland and forest and increase in area of crop land and built up land. An abrupt decline in water yield was found for year 2000. The water yield was influenced to a great extent by precipitation and evapotranspiration, but the land use played an important role in the water yield capacity (water yield per unit area) through plant cover that affected evapotranspiration, soil water permeability and the capacity of holding the moisture content. By general ranking, the water yield capacity of different land use type was as follows: built-up>bare land>cropland> grassland>forest >wetland, which illustrated that the built-up and bare land had higher run off rate while the vegetation area had higher capacity to control surface run off to increase the groundwater. A good understanding of temporal-spatial allocation of historical LUCC and Water yield of the Jing-Jin-Ji region could help guide land use policy decisions that take into consideration of tradeoffs with respect to spatial distribution of ecosystem services amongst the three administrative entities (Jing-Jin-Ji) and
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Richard K. Payne
2016-01-01
Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...
Le jeu de la création : Le mangeur (2005 de Ying Chen
Directory of Open Access Journals (Sweden)
Nicole Dunham
2013-11-01
Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
International Nuclear Information System (INIS)
Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou
2008-01-01
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)
2008-11-15
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.
Návrh marketingové kampaně pro Knihovnu Jiřího Mahena v Brně
Matějková, Kateřina
2014-01-01
Subject of this bachelor thesis is design a marketing campaign to increase competitiveness and attendance in Knihovna Jiřího Mahena in Brno. The thesis describes and explains the issues relating to non-profit organizations, in particular governmental organizations. The theoretical part enlarged on ways to finance non-profit organizations, and customer relationship management. Pursuant to available information are compiled an internal and external analysis, an extensive marketing mix analysis ...
2011-11-16
... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...
Czech Academy of Sciences Publication Activity Database
Chvátal, Alexandr
2015-01-01
Roč. 24, č. 1 (2015), s. 1-25 ISSN 0964-704X Institutional support: RVO:68378041 Keywords : Jiří Procházka * neuroanatomy * nervous tissue Subject RIV: FH - Neurology Impact factor: 0.529, year: 2015
[Thoughts and methods of study on acupuncture medical history: an example of Mr. MA Ji-Xing].
Yang, Feng; Zhu, Ling
2014-03-01
Mr. MA Ji-xing has devoted himself into the study of acupuncture medical history for more than 70 years. As a result, a great work of Zhenjiuxue Tongshi (see text), History of Acupuncture-Moxibustion) has been completed. The author has expensively studied for history of acupuncture medicine in time and space. Base on abundant historical materials, deliberate textual research as well as strategically situated academic view, it is considered as a masterpiece of acupuncture on real significance. It is worthwhile to note that the book has a systematic and profound explanation on Bian-stone therapy, unearthed literature relics of acupuncture, the bronze figure or illustration of acupoint as well as special topics of Japan and Korea acupuncture history. Filled several gaps of the field, and explored some significant new paths of study, it laid the groundwork for the profound study and unscramble of traditional acupuncture theory as well as the investigation of the academic history, which is considered to have a profound and persistent influence. The careful sorting and profound digging of many distinguish thoughts and methods of Mr. MA Ji-xing in the study of acupuncture medical history has significant meaning in references and enlightenment of the future research on acupuncture medical history.
Numerical Modeling of a Jet Ignition Direct Injection (JI DI LPG Engine
Directory of Open Access Journals (Sweden)
Albert Boretti
2017-01-01
Full Text Available The paper presents indirectly validated simulations of the operation of a LPG engine fitted with Direct Injection (DI and Jet Ignition (JI. It is demonstrated that the engine may have diesel like efficiencies and load control by quantity of fuel injected. As the liquid propane quickly evaporates after injection in the main chamber, the main chamber mixture may be much closer to stoichiometry than a diesel for a better specific power at low engine speeds. This design also works at the high engine speeds impossible for the diesel, as combustion within the main chamber is controlled by the turbulent mixing rather than the vaporization and diffusion processes of the injected fuel of the diesel.
Cai, Siyi; Wang, Yangjun; Zhao, Bin; Wang, Shuxiao; Chang, Xing; Hao, Jiming
2017-02-15
In order to cope with heavy haze pollution in China, the Air Pollution Prevention and Control Action Plan including phased goals of the fine particulate matter (PM 2.5 ) was issued in 2013. In this study, China's emission inventories in the baseline 2012 and the future scenarios of 2017 and 2020 have been developed based on this Action Plan. Beijing-Tianjin-Hebei (Jing-Jin-Ji) region, one of the most polluted regions in China, was taken as a case to assess the impact of phased emission control measures on PM 2.5 concentration reduction using WRF-CMAQ model system. With the implementation of the Action Plan, the emissions of sulfur dioxide (SO 2 ), nitrogen oxides (NO X ) , PM 2.5 , non-methane volatile organic compound (NMVOC), and ammonia (NH 3 ) in 2017 will decrease by36%, 31%, 30%,12%, and -10% from the 2012 levels in Jing-Jin-Ji, respectively. In 2020, the emissions of SO 2 , NO X, PM 2.5 , NMVOC, and NH 3 will decrease by 40%, 44%, 40%, 22%, and -3% from the 2012 levels in Jing-Jin-Ji, respectively. Consequently, the ambient annual PM 2.5 concentration under the scenarios of 2017 and 2020 will be 28.3% and 37.8% lower than those in 2012, respectively. The Action Plan provided an effective approach to alleviate PM 2.5 pollution level in Jing-Jin-Ji region. However, emission control of NMVOC and NH 3 should be paid more attention and be strengthened in future. Meanwhile, emission control of NO x , SO 2 , NH 3 and NMVOC synergistically are highly needed in the future because multiple pollutants impact on PM 2.5 and O 3 concentrations nonlinearly. Copyright © 2016 Elsevier B.V. All rights reserved.
Quantum state-to-state dynamics for the quenching process of Br(2P1/2) + H2(v(i) = 0, 1, j(i) = 0).
Xie, Changjian; Jiang, Bin; Xie, Daiqian; Sun, Zhigang
2012-03-21
Quantum state-to-state dynamics for the quenching process Br((2)P(1/2)) + H(2)(v(i) = 0, 1, j(i) = 0) → Br((2)P(3/2)) + H(2)(v(f), j(f)) has been studied based on two-state model on the recent coupled potential energy surfaces. It was found that the quenching probabilities have some oscillatory structures due to the interference of reflected flux in the Br((2)P(1/2)) + H(2) and Br((2)P(3/2)) + H(2) channels by repulsive potential in the near-resonant electronic-to-vibrational energy transfer process. The final vibrational state resolved integral cross sections were found to be dominated by the quenching process Br((2)P(1/2)) + H(2)(v) → Br((2)P(3/2)) + H(2)(v+1) and the nonadiabatic reaction probabilities for Br((2)P(1/2)) + H(2)(v = 0, 1, j(i) = 0) are quite small, which are consistent with previous theoretical and experimental results. Our calculated total quenching rate constant for Br((2)P(1/2)) + H(2)(v(i) = 0, j(i) = 0) at room temperature is in good agreement with the available experimental data. © 2012 American Institute of Physics
Consumption-based Total Suspended Particulate Matter Emissions in Jing-Jin-Ji Area of China
Yang, S.; Chen, S.; Chen, B.
2014-12-01
The highly-industrialized regions in China have been facing a serious problem of haze mainly consisted of total suspended particulate matter (TSPM), which has attracted great attention from the public since it directly impairs human health and clinically increases the risks of various respiratory and pulmonary diseases. In this paper, we set up a multi-regional input-output (MRIO) model to analyze the transferring routes of TSPM emissions between regions through trades. TSPM emission from particulate source regions and sectors are identified by analyzing the embodied TSPM flows through monetary flow and carbon footprint. The track of TSPM from origin to end via consumption activities are also revealed by tracing the product supply chain associated with the TSPM emissions. Beijing-Tianjin-Hebei (Jing-Jin-Ji) as the most industrialized area of China is selected for a case study. The result shows that over 70% of TSPM emissions associated with goods consumed in Beijing and Tianjin occurred outside of their own administrative boundaries, implying that Beijing and Tianjin are net embodied TSPM importers. Meanwhile, 63% of the total TSPM emissions in Hebei Province are resulted from the outside demand, indicating Hebei is a net exporter. In addition, nearly half of TSPM emissions are the by-products related to electricity and heating supply and non-metal mineral products in Jing-Jin-Ji Area. Based on the model results, we provided new insights into establishing systemic strategies and identifying mitigation priorities to stem TSPM emissions in China. Keywords: total suspended particulate matter (TSPM); urban ecosystem modeling; multi-regional input-output (MRIO); China
Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju
2016-07-21
Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016
Research on Park Ji-Won in China%朴趾源研究在中国
Institute of Scientific and Technical Information of China (English)
张丽娜
2012-01-01
朴趾源研究是韩国古典文学研究的一个热点和重点。总体上看,研究队伍中名家济济,以汉文形式发表的研究成果较多。学界对朴趾源的研究主要集中在其思想、小说创作上,《热河日记》是研究的一个焦点。对于朴趾源诗歌、散文和《燕岩集》的整体研究有所欠缺,全面、系统、客观地研究评价朴趾源在韩国文学史、思想史上的地位的专著尚未出现。%Research on Park Ji-Won is a key and hit of Korean classical literature. On the whole, there are many famous experts in the field and lots of research achievements in Chinese. Academic studies focus on his ideas and novels, of which ReHe Diary is a focus. However, an overall study of his poetries, proses and YanYan Collection is not enough. Comprehensive, systematic and objective works have not yet appeared, which study and assess Park Ji -Won's position in the history of Korean literature and intellectual
Jiří Vacek: Slovanská knihovna – můj osud. Mozaika vzpomínek. Národní knihovna\
Czech Academy of Sciences Publication Activity Database
Hašková, Dana
2017-01-01
Roč. 86, č. 4 (2017), s. 523-525 ISSN 0037-6736 Institutional support: RVO:68378017 Keywords : Vacek, Jiří * The Slavonic Library * Memories Subject RIV: AB - History OBOR OECD: History (history of science and technology to be 6.3, history of specific sciences to be under the respective headings)
Security problems for a pseudorandom sequence generator based on the Chen chaotic system
Özkaynak, Fatih; Yavuz, Sırma
2013-09-01
Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.
Directory of Open Access Journals (Sweden)
Resha Maulida
2017-11-01
Full Text Available The purpose of this study was to determine the effect of Problem Solving learning model based Just in Time Teaching (JiTT on students' science process skills (SPS on structure and function of plant tissue concept. This research was conducted at State Senior High School in South Tangerang .The research conducted using the quasi-experimental with Nonequivalent pretest-Postest Control Group Design. The samples of this study were 34 students for experimental group and 34 students for the control group. Data was obtained using a process skill test instrument (essai type that has been tested for its validity and reliability. Result of data analysis by ANACOVA, show that there were significant difference of postest between experiment and control group, by controlling the pretest score (F = 4.958; p <0.05. Thus, the problem-solving learning based on JiTT proved to improve students’ SPS. The contribution of this treatment in improving the students’ SPS was 7.2%. This shows that there was effect of problem solving model based JiTT on students’ SPS on the Structure and function of plant tissue concept.
Directory of Open Access Journals (Sweden)
Kerri M. Winters-Stone
2014-03-01
Full Text Available Currently there are more than 13.7 million cancer survivors living in the U.S., and that figure is projected to increase by 31% in the next decade, adding another 4 million cancer survivors into the healthcare system. Cancer is largely a disease of aging, and the aging of the population will sharply raise the proportion of older cancer survivors, many of whom will be long-term survivors (5+ years post diagnosis. This review will address the potential utility of exercise to address three health problems that are of particular concern for the aging cancer survivor and the healthcare system, i.e., disability, falls, and cardiovascular disease, because the development of these age-related problems may be accelerated by cancer treatment. While there are many different modes of exercise that each produce specific adaptations, Tai Ji Quan may be a particularly suitable strategy to mitigate the development of age- and cancer-treatment-related problems. Based on studies in older adults without cancer, Tai Ji Quan produces musculoskeletal and cardiometabolic adaptations and is more easily performed by older adults due to its low energy cost and slower movement patterns. Since cancer survivors are mostly older, inactive, and often physically limited by the lingering side effects of treatment, they need to engage in safe, practical, and effective modes of exercise. The dearth of published controlled trials examining the efficacy of Tai Ji Quan to mitigate cancer-treatment-related musculoskeletal and cardiovascular side effects points to ample research opportunities to explore the application of this non-Western exercise modality to improve long-term outcomes for aging cancer survivors.
Effect of YangZheng XiaoJi Extract, DME-25, on endothelial cells and their response to Avastin.
Owen, Sioned; Gao, Y.; Zhi, X.; Wei, C.; Wu, Y.; Jiang, Wen Guo
2016-01-01
ackground: Angiogenesis is a cellular process that has been identified as a key target for therapy in solid cancer. However, over the course of anti-angiogenic therapies, cancer cells acquire resistance to these therapies after an initial period of success. DME-25 is an extract from Yang Zheng Xiao Ji, a traditional Chinese medicine that has been reported to benefit patients with cancer by alleviating chemotherapy-associated symptoms and possibly inhibiting key cancer cell traits. This study ...
Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state
Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro
2014-01-01
We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...
2010-10-07
... DEPARTMENT OF STATE [Public Notice: 7196] In the Matter of the Review of the Designation of Jemaah Islamiya (JI and Other Aliases) as a Foreign Terrorist Organization Pursuant to Section 219 of the Immigration and Nationality Act, as Amended Based upon a review of the Administrative Record assembled in this...
International Nuclear Information System (INIS)
Moreno M, A.; Moreno B, A.
2000-01-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
Chen CY; Yu NW; Huang TH; Wang WS; Fang JT
2018-01-01
Ching-Yen Chen,1–3 Nan-Wen Yu,2–4 Tien-Hao Huang,4 Wei-Shin Wang,4 Ji-Tseng Fang2,3,5 1Department of Psychiatry, Chang Gung Memorial Hospital, Keelung, Taiwan; 2School of Medicine, Chang Gung University, Taoyuan, Taiwan; 3Medical Education Research Center, Chang Gung Memorial Hospital, Taoyuan, Taiwan; 4Department of Psychiatry, Chang Gung Memorial Hospital, Linkou, Taiwan; 5Department of Nephrology, Chang Gung Memorial Hospital, Linkou, Taiwan Purpose: During medical school tra...
Chen,Ching-Yen; Yu,Nan-Wen; Huang,Tien-Hao; Wang,Wei-Shin; Fang,Ji-Tseng
2018-01-01
Ching-Yen Chen,1–3 Nan-Wen Yu,2–4 Tien-Hao Huang,4 Wei-Shin Wang,4 Ji-Tseng Fang2,3,5 1Department of Psychiatry, Chang Gung Memorial Hospital, Keelung, Taiwan; 2School of Medicine, Chang Gung University, Taoyuan, Taiwan; 3Medical Education Research Center, Chang Gung Memorial Hospital, Taoyuan, Taiwan; 4Department of Psychiatry, Chang Gung Memorial Hospital, Linkou, Taiwan; 5Department of Nephrology, Chang Gung Memorial Hospital, Linkou, Taiwan Purpose: During medical sc...
Energy Technology Data Exchange (ETDEWEB)
Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A
2000-07-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass
Liu, Jian-Liang; Yu, Chengjie
2017-10-01
In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.
Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau
Ju, J.
2013-12-01
Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of
Anticancer Principles from Medicinal Piper (胡椒 Hú Jiāo Plants
Directory of Open Access Journals (Sweden)
Yue-Hu Wang
2014-01-01
Full Text Available The ethnomedical uses of Piper (胡椒 Hú Jiāo plants as anticancer agents, in vitro cytotoxic activity of both extracts and compounds from Piper plants, and in vivo antitumor activity and mechanism of action of selected compounds are reviewed in the present paper. The genus Piper (Piperaceae contains approximately 2000 species, of which 10 species have been used in traditional medicines to treat cancer or cancer-like symptoms. Studies have shown that 35 extracts from 24 Piper species and 32 compounds from Piper plants possess cytotoxic activity. Amide alkaloids account for 53% of the major active principles. Among them, piplartine (piperlongumine shows the most promise, being toxic to dozens of cancer cell lines and having excellent in vivo activity. It is worthwhile to conduct further anticancer studies both in vitro and in vivo on Piper plants and their active principles.
Le jeu de la création : Le mangeur (2005) de Ying Chen
Nicole Dunham
2013-01-01
Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...
Pražský světící biskup? Jiří Ignác Pospíchal (1635–1699)
Czech Academy of Sciences Publication Activity Database
Pučalík, Marek
2015-01-01
Roč. 30, č. 1 (2015), s. 159-169 ISSN 0231-7494 R&D Projects: GA ČR(CZ) GA14-05167S Institutional support: RVO:67985963 Keywords : Jiří Ignác Pospíchal * the Knights of the Cross with the Red Star * Prague * Polná * bishop * archbishop Subject RIV: AB - History
Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system
International Nuclear Information System (INIS)
Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun
2012-01-01
In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)
Maddali Bongi, Susanna; Paoletti, Gianluca; Calà, Michael; Del Rosso, Angela; El Aoufy, Khadija; Mikhaylova, Svetlana
2016-08-01
Fibromyalgia Syndrome (FMS) is characterized by musculoskeletal pain, muscle tenderness leading to disability, impaired quality of life (QoL), fatigue and it is accompanied by sleep disorders and psychological distress. Mind body therapies (MBT), such as Tai Ji Quan (TJQ), use different techniques to facilitate the ability of the mind to influence disease characteristics and symptoms. Some studies showed that TJQ, in patients with rheumatic diseases, particularly FMS, improved QoL, disability and psychological distress. To evaluate the efficacy of TJQ on disability, QoL, fatigue, sleep and psychological distress in an Italian cohort of FMS patients. We enrolled 44 FMS patients: 22 patients (Experimental Group) participated to a course of Tai Ji Quan style of (2/week for 16 weeks); 22 patients (Control Group) participated to an educational course about FMS (2/week for 16 weeks). At baseline (T0) and at the end of treatment (T1), patients were assessed for disability [Fibromyalgia Impact Questionnaire (FIQ), Health Assessment Questionnaire (HAQ)], Quality of Life [Short-Form 36 (SF36)], fatigue [Functional Assessment of Chronic Illness-Fatigue (FACIT-F)], pain [Widespread Pain Index (WPI)], tenderness [Tender Points (TP)], Sleep Quality [Pittsburgh Sleep Quality Index (PSQI)] and mood disorders [Hospital Anxiety and Depression Scale (HADS)]. At T1 versus T0, patients of the Experimental Group showed a significant improvement in FIQ, FACIT, SF36 (Summary Physical Index, Physical activity, physical role, bodily pain, general health, vitality, emotional role limitations), in WPI, TP, PSQI (total, sleep duration, and sleep disturbance) and HADS (total score and anxiety subscale), while Patients in the Control Group did not improve in any parameter. In FMS patients TJQ, if performed by an expert physiotherapist, should be regarded as an effective rehabilitation method. Copyright © 2016 Elsevier Ltd. All rights reserved.
Ye, Lidan; Hudari, Mohammad Sufian Bin; Zhou, Xingding; Zhang, Dongxu; Li, Zhi; Wu, Jin Chuan
2013-06-01
Cost-effective conversion of lignocellulose hydrolysate to optically pure lactic acid is commercially attractive but very challenging. Bacillus coagulans JI12 was isolated from natural environment and used to produce L-lactic acid (optical purity > 99.5 %) from lignocellulose sugars and acid hydrolysate of oil palm empty fruit bunch (EFB) at 50 °C and pH 6.0 without sterilization of the medium. In fed-batch fermentation with 85 g/L initial xylose and 55 g/L xylose added after 7.5 h, 137.5 g/L lactic acid was produced with a yield of 98 % and a productivity of 4.4 g/L h. In batch fermentation of a sugar mixture containing 8.5 % xylose, 1 % glucose, and 1 % L-arabinose, the lactic acid yield and productivity reached 98 % and 4.8 g/L h, respectively. When EFB hydrolysate was used, 59.2 g/L of lactic acid was produced within 9.5 h at a yield of 97 % and a productivity of 6.2 g/L h, which are the highest among those ever reported from lignocellulose hydrolysates. These results indicate that B. coagulans JI12 is a promising strain for industrial production of L-lactic acid from lignocellulose hydrolysate.
Uso do res?duo da esta??o de tratamento de ?gua de Ji-Paran?/RO como material ciment?cio
Rocha, Maria Angelica Froes da
2016-01-01
O lodo ? um subproduto inevit?vel no tratamento da ?gua a ser fornecida a uma popula??o, sendo que a sua disposi??o final muitas vezes ? realizada de forma inadequada e n?o sustent?vel. A argamassa ? uma mistura de cimento, areia e ?gua. Este trabalho tem o objetivo de avaliar a substitui??o parcial do agregado mi?do pelo lodo produzido na esta??o de tratamento de ?gua de Ji-Paran? na produ??o de argamassa. A metodologia utilizada no presente estudo consistiu na coleta e secagem do lodo, cara...
Wormholes supported by phantom energy from Shan-Chen cosmological fluids
Energy Technology Data Exchange (ETDEWEB)
Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)
2016-03-15
In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)
Künnap, Ago, 1941-
2010-01-01
Arvustus: Gao Jingyi. Han yu yu bei Ou yu yan : Han yu yu Wula'er yu yan ji Yin Ou yu yan tong yuan tan jiu = Chinese language and languages of northern Europe. Beijing : Zhongguo she hui ke xue chu ban she, 2008
The conservation treatment of a contemporary collaged sculpture by Jiří Kolář (1914-2002
Directory of Open Access Journals (Sweden)
Jessica Crann
2010-11-01
Full Text Available Une sculpture représentant une pomme réalisée par collage de l’artiste tchèque Jiří Kolář et datant de 1972, a été soumise à un traitement de conservation-restauration. La sculpture présentait des dommages structurels causés par des facteurs externes ainsi que des surfaces encrassées. Les interrogations déontologiques soulevées lors de la restauration d’une œuvre d’art contemporain ont représenté un aspect important de l’étude. Par conséquent, la majeure partie des recherches a été dévolue à la compréhension du matériau et de la structure, celle des intentions de l’artiste,tout comme du concept et de la signification de l’œuvre. Ce travail a été étayé par une recherche scientifique ayant pour but d’évaluer l’efficacité du Triammonium citrate comme agent de nettoyage à base aqueuse, ainsi que par une analyse de la construction en trois dimensions de l’œuvre d’art.A collaged sculpture of an apple by the Czech artist Jiří Kolář, dated 1972 was presented for conservation. The sculpture suffered from structural damage caused by external factors and ingrained surface dirt. The ethical implications raised in conserving a contemporary artwork were an important aspect and subsequently an understanding of the materials and structure, the artist’s intentions, concept and meaning of the artwork formed a large part of the research. Combined with this was scientific research into the effectiveness of Tri-ammonium Citrate as an aqueous surface cleaning agent and analysing construction of 3-Dimensional artworks.
Lediane Fani Felzke; Dalva Felipe de Oliveira; Jania Maria de Paula
2014-01-01
The occupation of Rondônia, from the 1970s, occurred in a disorganized way, since it attracted an amount of migrants which was much bigger than the settling projects could sustain. The aim of this research was to analyze the circumstances in which the district of Nova Londrina was settled, utilizing for this reason a bibliographic survey, as well as the Oral History method. The arrival in Nova Londrina, Ji-Paraná, was highlighted by conflicts between the settlers and the settling company Cala...
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Giafferri, Xiaomin
2008-01-01
Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...
Directory of Open Access Journals (Sweden)
Whitney Webb
2012-05-01
Full Text Available The pragmatic, responsive, and syncretic nature of popular Chinese religion is well known and is thought to result, in part, from the religion’s close connection to the fluxes of the social system in which its adherents live. These characteristics often result in considerable change when the social fabric is greatly disrupted, such as in the immigration of Chinese to new and unfamiliar places. This process of change is commonly seen among Chinese deities. Tua Peh大伯 and Ji Peh 二伯 (in Hokkien dialect “First Uncle” and “Second Uncle”, two ghostly deities of popular Chinese Malaysian religion, are understood to have an ambiguous status in the Chinese pantheon as they possess characteristics of both gods and ghosts. In China, these figures were simply part of the otherworldly bureaucracy of the hell realm with a very limited role and were worshipped infrequently. In the past 20 years, their worship has become extremely ubiquitous, with many shrines and temples proliferating. Now a variety of people come to them for wealth, for healings, and for protection. This coincides during a time in which the economic situation of Chinese Malaysians has become more difficult which parallels a significant rise in political tensions between Malays and non-Malays. This has caused a shift towards favorability in the deities’ reputation, the demographics of their worshippers, and the reasons patrons seek their assistance. Overall, the elevation of Tua Ji Peh seems to work towards lending legitimacy to those desperately seeking efficacious aid in a increasingly discriminatory and poltically unstable environment with harsher realities.
Air quality assessment by contingent valuation in Ji'nan, China.
Wang, Yan; Zhang, Yi-Sheng
2009-02-01
Along with urbanization and environmental deterioration within China, many residents' desire for improved air quality has increased. To address this topic, this study focuses on the relationship between poor air quality and residents' willingness to pay for improved air quality in the city of Ji'nan. As a means of quantifying an individual's willingness to pay (WTP) for improved air quality, a contingent valuation method (CVM) was employed. A sample of 1500 residents was chosen, based on the stratified sampling method. The respondents' WTP was then elicited through a series of face-to-face interviews, conducted using a range of hypothetical, open-ended scenario questions. The results showed that 59.7% of respondents were able to express a positive WTP, and that the average WTP was 100 Chinese Yuan (CNY) per person, per year. In order to establish the relationship between endogenous variables and WTP, both a Probit model on the probability of a positive WTP, and a stepwise regression model were constructed. Most parameters in the econometric analysis demonstrated the expected results. It was found that annual household income, expenditure on the treatment of respiratory diseases and workers in the family significantly influenced WTP. The rates of positive WTP and the monetary amount were also larger for men than for women. Unlike developed countries, most respondents regard air quality improvement as a government responsibility in that more than 40% of respondents had no incentive to bear the costs of attempting to achieve better air quality, indicating a relatively low environmental consciousness.
Czech Academy of Sciences Publication Activity Database
Antošíková, Lucie; Budňák, J.; Schörkhuber, E.
-, č. 8 (2014), s. 13-32. ISBN 978-3-7069-0726-2. ISSN 1802-6419 Institutional support: RVO:68378068 Keywords : Gruša, Jiří * Beneš, Edvard * German-language essays * construction of national narratives * transcultural writing Subject RIV: AJ - Letters, Mass-media, Audiovision
Directory of Open Access Journals (Sweden)
Evelina Zagorskaitė
Full Text Available The epigenetic DNA modifications 5-methylcytosine (5mC and 5-hydroxymethylcytosine (5hmC in eukaryotes are recognized either in the context of double-stranded DNA (e.g., by the methyl-CpG binding domain of MeCP2, or in the flipped-out state (e.g., by the SRA domain of UHRF1. The SRA-like domains and the base-flipping mechanism for 5(hmC recognition are also shared by the recently discovered prokaryotic modification-dependent endonucleases of the MspJI and PvuRts1I families. Since the mechanism of modified cytosine recognition by many potential eukaryotic and prokaryotic 5(hmC "readers" is still unknown, a fast solution based method for the detection of extrahelical 5(hmC would be very useful. In the present study we tested base-flipping by MspJI- and PvuRts1I-like restriction enzymes using several solution-based methods, including fluorescence measurements of the cytosine analog pyrrolocytosine and chemical modification of extrahelical pyrimidines with chloroacetaldehyde and KMnO4. We find that only KMnO4 proved an efficient probe for the positive display of flipped out pyrimidines, albeit the method required either non-physiological pH (4.3 or a substitution of the target cytosine with thymine. Our results imply that DNA recognition mechanism of 5(hmC binding proteins should be tested using a combination of all available methods, as the lack of a positive signal in some assays does not exclude the base flipping mechanism.
The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed
Chen, Chi-ju
2017-04-01
Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop
Directory of Open Access Journals (Sweden)
Min-jung Kim
2006-12-01
Full Text Available Objectives : To investigate the effect of Ga-mee-Gwui-ryong-tang herbal acupuncture (GR-HA at GB39 and ST36 and the effect of Yuk-mee ji-hwang-tang herbal acupuncture (YM-HA at GB39 and KI10 on growth in mice. Methods : Mice were divided into 7 groups(n=10 ; saline-ST36, saline-GB39, saline-KI10, GR-HA-ST36 group treated with GR-HA at right ST36, GR-HA-GB39 group treated with GR-HA at right GB39, YM-HA-GB39 group treated with YM-HA at right GB39, YM-HA-KI10 group treated with YM-HA at right KI10. Saline-ST36 group, saline-GB39 group and saline-KI10 group were injected with saline at right ST36, GB39, KI10 respectively. Saline injection and HA were performed 3 times a week for 18 days. The length(total height, body length and tail length, weight and the protein efficiency ratio were measured as well as IGF-1 level in serum. Results : 1. GR-HA at GB39 and GR-HA at ST36 promoted growth in weight, tail length and total height but there was no statistical significance. 2. GR-HA at GB39 significantly promoted protein efficiency on the 14th day and GR-HA at ST36 on the 3rd day. 3. GR-HA at GB39 significantly increased serum IGF-1. GR-HA at ST36 increased IGF-1 slightly but with no statistical significance. 4. YM-HA at GB39 and YM-HA at KI10 promoted growth in weight, height, tail length and total height but there was no statistical relevance. 5. YM-HA at GB39 and YM-HA at KI10 significantly promoted protein efficiency on the 14th day. 6. YM-HA at GB39 and YM-HA at KI10 significantly increased serum IGF-1. Serum IGF-1 level of YM-HA-KI10 group was significantly higher than that of YM-HA-GB39 group. 7. Serum IGF-1 level of GR-HA-GB39 group was significantly higher than that of YM-HA-GB39 group. Conclusions : GR-HA and YM-HA both may promote growth. This study suggests that herbal acupuncture at GB39 is more effective with Gwui-ryong-tang than Yuk-mee ji-hwang-tang to promote growth. It also suggests that Yuk-mee ji-hwang-tang herbal acupuncture is more
Papīra darbi ka domāšanas veicinātāji pirmsskolā
Jevdokimova, Jūlija
2017-01-01
Jūlija J. (2017.) “Papīra darbi kā domāšanas veicinātāji pirmsskolā”. Kvalifikācijas darbs. Rīga: Latvijas Universitātes Pedagoģijas, psiholoģijas un mākslas fakultāte, 90 lpp, 16 att., 4 tab., bibl. 18 nos., latviešu, angļu val. Darbs sastāv no ievada, 5 nodaļām, secinājumiem un 16 pielikumiem. Autors ir vairākus mēnešus izgājis praksi pirmsskolas pedagoga amatā. Darbā ir veikts pētījums par domāšanas attīstību rokdarbu nodarbībās, veicot papīra darbus Darba mērķis ir izzināt un atklāt bēr...
The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...
Czech Academy of Sciences Publication Activity Database
Rapprich, V.; Cajz, Vladimír; Košťák, M.; Pécskay, Z.; Řídkošil, T.; Raška, P.; Radoň, M.
2007-01-01
Roč. 52, 3-4 (2007), s. 169-180 ISSN 0449-2560 R&D Projects: GA AV ČR IAA300130612 Institutional research plan: CEZ:AV0Z30130516 Keywords : cinder cone * Strombolian eruption * volcanic facies * erosion rate * Jičín Volcanic Field * Bohemian Paradise GeoPark Subject RIV: DB - Geology ; Mineralogy
He, Shuai; Mao, Xiangzhao; Liu, Pei; Lin, Hong; Du, Zuyuan; Lv, Ning; Han, Jichen; Qiu, Cuifang
2013-07-01
Over the last decade, considerable experimental evidence has supported the view that grape wine and South China rice wine are rich in diverse nutrients and have powerful antioxidant activity. However, little research has been carried out for North China rice wine, of which Ji Mo Lao Jiu (JMLJ) is the outstanding representative. In this study, the functional components and antioxidant activity of JMLJ were investigated. Twenty-eight free amino acids were found in JMLJ, much more than that previously reported in other Chinese rice wines (16-21). Functional oligosaccharides (5290.222 mg/L), total phenols (722.431 ± 10.970 mg/L), and mineral elements (9) were rich in JMLJ. When compared with synthetic antioxidants, such as butylated hydroxyanisole (BHA) and butylated hydroxytoluene (BHT), JMLJ showed effective 1,1-diphenyl-2-picryl-hydrazyl (DPPH) radical scavenging and reducing capacity. The results of this study lay the foundation for promoting the utilization of JMLJ and the development of North China rice wine in the food industry.
Directory of Open Access Journals (Sweden)
Yafei Li
2017-01-01
Full Text Available The article uses GIS spatial analysis and grid technologies to study the dynamic changes, hotspot regions, and driving forces in land use of the central core functional area of Jing-Jin-Ji. The research results are as follows: from 2000 to 2015, the main types of land use in the central core functional area of Jing-Jin-Ji are cultivated land, woodland, and built-up land. In the period of 2005–2010, the transfer between built-up land and cultivated land was frequent. The dynamic degree of single land use in unused land was highest. It also finds out that the dynamic degree of the integrated land use from 2005 to 2010 was higher. The center of gravity transfer of the dynamic degree of integrated land use was concentrated in research area. As for the hotspots, their number and scope are increasing, and the positions located in the edge of original main urban area and developed transportation network. The main characteristics of land use dynamic change in the study area are the rapid decrease of cultivated land area and rapid growth of built-up land. The spatial agglomeration of economic factors caused by human activities has an important influence on the spatial and temporal dynamic changes of land use.
Elksnītis, Daniels
2016-01-01
Bioloģiski vērtīgos un daļēji dabiskos zālājus būtiski ietekmē augsnes īpašības. No augsnes īpašībām ir atkarīga šo zālāju kvalitāte, apsaimniekošanas veids un līdz ar to arī to sniegtie ekosistēmu pakalpojumi. Bioloģiski vērtīgo un daļēji dabisko zālāju nozīme arvien pieaug, turklāt jau pagājušā gadsimta otrajā pusē sākās strauja to platību samazināšanās gan Latvijā, gan Eiropā kopumā. Tāpēc ir ļoti būtiski noskaidrot bioloģiski vērtīgo zālāju augšņu īpašību ietekmējošos faktorus gan lokālā,...
CERN Photo Service
2008-01-01
21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Directory of Open Access Journals (Sweden)
Xiaomin Giafferri
2008-12-01
Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.
辛弃疾的“事功派”思想及在稼轩词中的体现%Xin Qi-ji’s Utilitarianism Ethics Thought And influence on Jiaxuan Ci-poems
Institute of Scientific and Technical Information of China (English)
宋学达
2013-01-01
事功派哲学家陈亮与辛弃疾私交甚厚,其哲学思想必然会对辛弃疾产生影响,而历来对辛弃疾的研究中,似乎很少关注其思想哲学的相关问题。本文旨在论证辛弃疾的哲学思想乃是以陈亮为代表的事功派哲学一脉,并探讨事功派哲学对稼轩词艺术特质及词史地位所产生的深刻影响。%Chen Liang, the philosopher of Utilitarianism Ethics Thought, has a good relationship with Xin Qi-ji. So his philosophical thoughts certainly would have an influence on Xin Qiji. But in the past, on the study of Xin Qi-ji, we can seldom found researches concerning his thought of philosophy. This dissertation is aimed to argue that Xin's philosophical thoughts is a brunch of Chen’s Utilitarianism Ethics Thought and the latter had great influence on Jiaxuan Ci-Poems, including its artistic particularities and the status in Ci-poetry history.
He, Shuai; Mao, Xiangzhao; Liu, Pei; Lin, Hong; Du, Zuyuan; Lv, Ning; Han, Jichen; Qiu, Cuifang
2013-01-01
Over the last decade, considerable experimental evidence has supported the view that grape wine and South China rice wine are rich in diverse nutrients and have powerful antioxidant activity. However, little research has been carried out for North China rice wine, of which Ji Mo Lao Jiu (JMLJ) is the outstanding representative. In this study, the functional components and antioxidant activity of JMLJ were investigated. Twenty-eight free amino acids were found in JMLJ, much more than that previously reported in other Chinese rice wines (16–21). Functional oligosaccharides (5290.222 mg/L), total phenols (722.431 ± 10.970 mg/L), and mineral elements (9) were rich in JMLJ. When compared with synthetic antioxidants, such as butylated hydroxyanisole (BHA) and butylated hydroxytoluene (BHT), JMLJ showed effective 1,1-diphenyl-2-picryl-hydrazyl (DPPH) radical scavenging and reducing capacity. The results of this study lay the foundation for promoting the utilization of JMLJ and the development of North China rice wine in the food industry. PMID:24804035
Directory of Open Access Journals (Sweden)
Lediane Fani Felzke
2014-12-01
Full Text Available The occupation of Rondônia, from the 1970s, occurred in a disorganized way, since it attracted an amount of migrants which was much bigger than the settling projects could sustain. The aim of this research was to analyze the circumstances in which the district of Nova Londrina was settled, utilizing for this reason a bibliographic survey, as well as the Oral History method. The arrival in Nova Londrina, Ji-Paraná, was highlighted by conflicts between the settlers and the settling company Calama S/A. In spite of the company’s violence, the colonists resisted until there was an intervention from INCRA, through a land regularization program. In this context, the Urban Center for Rural Support (NUAR was implanted, intending to support the agricultural workers
He, Junyu; Christakos, George
2018-05-07
Long- and short-term exposure to PM 2.5 is of great concern in China due to its adverse population health effects. Characteristic of the severity of the situation in China is that in the Jing-Jin-Ji region considered in this work a total of 2725 excess deaths have been attributed to short-term PM 2.5 exposure during the period January 10-31, 2013. Technically, the processing of large space-time PM 2.5 datasets and the mapping of the space-time distribution of PM 2.5 concentrations often constitute high-cost projects. To address this situation, we propose a synthetic modeling framework based on the integration of (a) the Bayesian maximum entropy method that assimilates auxiliary information from land-use regression and artificial neural network (ANN) model outputs based on PM 2.5 monitoring, satellite remote sensing data, land use and geographical records, with (b) a space-time projection technique that transforms the PM 2.5 concentration values from the original spatiotemporal domain onto a spatial domain that moves along the direction of the PM 2.5 velocity spread. An interesting methodological feature of the synthetic approach is that its components (methods or models) are complementary, i.e., one component can compensate for the occasional limitations of another component. Insight is gained in terms of a PM 2.5 case study covering the severe haze Jing-Jin-Ji region during October 1-31, 2015. The proposed synthetic approach explicitly accounted for physical space-time dependencies of the PM 2.5 distribution. Moreover, the assimilation of auxiliary information and the dimensionality reduction achieved by the synthetic approach produced rather impressive results: It generated PM 2.5 concentration maps with low estimation uncertainty (even at counties and villages far away from the monitoring stations, whereas during the haze periods the uncertainty reduction was over 50% compared to standard PM 2.5 mapping techniques); and it also proved to be computationally very
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.
Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M
2014-10-01
The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.
Directory of Open Access Journals (Sweden)
Chih-Hung Ko
2005-12-01
Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.
Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling
Sepehrinia, Reza; Chalangari, Fartash
2018-03-01
The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.
2018-02-01
Retracted Review article: Nucleophagy in Human Disease: Beyond the Physiological Role. [Tohoku J. Exp. Med., 2018, 244 (1), 75-81. doi: 10.1620/tjem.244.75.] The above Review article was published online on January 27, 2018. Soon after its publication (on February 1, 2018), Dr. Nian Fu and Prof. Linxi Chen informed the Editor-in-Chief, The Tohoku Journal of Experimental Medicine (TJEM), about serious violation of publication ethics. Indeed, Dr. Nian Fu and Prof. Linxi Chen were astonished to find their names as coauthors of this Review article, because they were not involved in the submission process of this Review article and they do not know any of other coauthors. In addition, the Review article is similar to their unpublished manuscript. After a thorough investigation in accordance with the recommendations of the Committee on Publication Ethics (COPE), the Editor-in-Chief of TJEM decided to retract this Review article. The reasons for Retraction are summarized below: forged authors and an unexpected case of plagiarism. Forged authors: Dr. Nian Fu and Prof. Linxi Chen were added as co-authors of the Review article without their knowledge. In fact, the signature provided by Prof. Linxi Chen is apparently different from the signature of a coauthor, named Linxi Chen, on the AUTHORS’ RESPONSIBILITY FORM, provided by the corresponding author of the Review article. More critically, the signature provided by Dr. Nian Fu is completely different from the signature of Nian Fu, because the Chinese characters are different between the two signatures. In addition, the replies from three authors (Ming Zhou, Hongwen Ji and Yong Xia) clearly indicate that they misunderstand the identity of Dr. Nina Fu. We also attempted to contact two authors, named Nian Fu and Linxi Chen, via e-mail. As expected, the forged authors did not respond to our inquiries, despite that their e-mail addresses appear to be active. An unexpected case of plagiarism: This Review article is similar to the
Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n
Directory of Open Access Journals (Sweden)
Péter Bíró
2011-01-01
Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.
Felzke, Lediane Fani; Oliveira, Dalva Felipe de; Paula, Jania Maria de
2014-01-01
The occupation of Rondônia, from the 1970s, occurred in a disorganized way, since it attracted an amount of migrants which was much bigger than the settling projects could sustain. The aim of this research was to analyze the circumstances in which the district of Nova Londrina was settled, utilizing for this reason a bibliographic survey, as well as the Oral History method. The arrival in Nova Londrina, Ji-Paraná, was highlighted by conflicts between the settlers and the settling company Cala...
Czech Academy of Sciences Publication Activity Database
Bahenská, Marie; Jůnová Macková, Adéla
2017-01-01
Roč. 9, č. 2 (2017), s. 63-106 ISSN 1803-9448 R&D Projects: GA ČR GA15-03754S Institutional support: RVO:67985921 Keywords : Karel Vetterl * Jiří Horák * history of ethnology Subject RIV: AB - History OBOR OECD: History (history of science and technology to be 6.3, history of specific sciences to be under the respective headings)
Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.
2009-01-01
Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.
Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.
2008-01-01
We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.
Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan
Directory of Open Access Journals (Sweden)
M.-L. Lin
2005-01-01
Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.
Hirschheydt, Monika von
2015-01-01
Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014
Juturu, Veeresh; Wu, Jin Chuan
2018-03-01
Thermophilic Bacillus coagulans JI12 was used to ferment hemicellulose hydrolysate obtained by acid hydrolysis of oil palm empty fruit bunch at 50 °C and pH 6, producing 105.4 g/L of l-lactic acid with a productivity of 9.3 g/L/H by fed-batch fermentation under unsterilized conditions. Simultaneous saccharification and fermentation (SSF) was performed at pH 5.5 and 50 °C to convert both hemicellulose hydrolysate and cellulose-lignin complex in the presence of Cellic Ctec2 cellulases using yeast extract (20 g/L) as the nitrogen source, giving 114.0 g/L of l-lactic acid with a productivity of 5.7 g/L/H. The SSF was also conducted by replacing yeast extract with equal amount of dry Bakers' yeast, achieving 120.0 g/L of l-lactic acid with a productivity of 4.3 g/L/H. To the best of our knowledge, these lactic acid titers and productivities are the highest ever reported from lignocellulose hydrolysates. © 2017 International Union of Biochemistry and Molecular Biology, Inc.
Maximilien Brice
2012-01-01
6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.
Zhang, Wen-Yan; Lin, Chao-Yuan
2017-04-01
The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.
Directory of Open Access Journals (Sweden)
Hongyang Zhang
2016-01-01
Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.
Energy Technology Data Exchange (ETDEWEB)
NONE
2000-03-01
The third conference (COP3) of the United Nations Framework Convention on Climate Change held in December 1997 in Kyoto has adopted the Kyoto mechanisms (the 'discharge right transaction', the 'joint implementation (JI)' among advanced countries, and the 'clean development mechanism (CDM)' applied to developing countries). The Kyoto mechanisms are intended to provide flexibility to the methods to achieve the greenhouse effect gas reduction targets established in the Kyoto Protocol. The Kyoto mechanisms are considered to be implemented even during the year 2000, whose details are scheduled to be decided at COP6. Since the advanced countries have established the targets for reduction of greenhouse effect gas emission, governments and research institutes are taking various approaches. In addition, since the targets for reduction of greenhouse effect gas emission have been established, discussions are indispensable on methodology to establish the quantity of discharge and absorption of greenhouse effect gases (the so-called base line) when no project exists, as required to calculate the discharge reduction quantity as a result of implementing the project. The present survey has held study meetings attended by learned people, and compiled the results of the discussions. (NEDO)
Energy Technology Data Exchange (ETDEWEB)
Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)
2007-07-07
The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)
Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.
2017-09-01
Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007
Tuggle, B.N.; Crites, John L.
1984-01-01
Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.
Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li
2015-04-16
Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of
Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'
Directory of Open Access Journals (Sweden)
Kay Schaffer
2006-09-01
Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.
Impacts of Land-Use and Land-Cover Changes on Water Yield: A Case Study in Jing-Jin-Ji, China
Directory of Open Access Journals (Sweden)
Suxiao Li
2018-03-01
Full Text Available Knowing the impact of land-use and land-cover (LULC changes on the distribution of water yield (WY is essential for water resource management. Using the Integrated Valuation of Ecosystem Services and Tradeoffs (InVEST model, we investigated the spatial-temporal variations of WY from 1990 to 2015 in China’s northern semi-arid region of Beijing–Tianjin–Hebei (Jing-Jin-Ji. We quantified the combined effects of LULC dynamics and climatic variation on WY. Furthermore, we identified the relative contribution of main LULC types to WY. For our study region, the built-up area increased by 35.66% (5380 km2 during the study period. In the meantime, cropland, grassland, and wetland decreased continuously. The expansion of built-up area and decline of vegetated land led to an increase of 1047 million m3 (5.1% in total WY. The impacts of LULC changes on WY were mainly determined by the biophysical characteristics of LULC composition. Vegetated land has relatively lower WY coefficients due to higher rates of evapotranspiration and water infiltration. Built-up areas and bare land have higher WY coefficients as a result of their impermeable surface. The spatial-temporal analysis of WY with specification of WY coefficients by LULC types can facilitate integrated land-use planning and water resource management.
Vismane, Inese
2010-01-01
Maģistra darba tēma ir „Interneta sociālie tīkli draugiem.lv, mammam/tetiem.lv un twitter.com kā reklāmas nesēji Latvijā (2009.gads)”. Darba mērķis ir izpētīt Latvijas interneta sociālo tīklu vidi kā potenciāli augošu un reklāmai piemērotu, kā arī izpētīt pamanāmākos reklāmas gadījumus šajos portālos. Teorijas daļā tiek apskatīta Web 2.0 ēra, interneta reklāmas un sociālo mediju mārketinga īpatnības, sociālo tīklu fenomens un teorijas, Latvijas reklāmas tirgus un auditorija, kā arī sociāl...
Efficiently and easily integrating differential equations with JiTCODE, JiTCDDE, and JiTCSDE
Ansmann, Gerrit
2018-04-01
We present a family of Python modules for the numerical integration of ordinary, delay, or stochastic differential equations. The key features are that the user enters the derivative symbolically and it is just-in-time-compiled, allowing the user to efficiently integrate differential equations from a higher-level interpreted language. The presented modules are particularly suited for large systems of differential equations such as those used to describe dynamics on complex networks. Through the selected method of input, the presented modules also allow almost complete automatization of the process of estimating regular as well as transversal Lyapunov exponents for ordinary and delay differential equations. We conceptually discuss the modules' design, analyze their performance, and demonstrate their capabilities by application to timely problems.
The effects of Tai Ji Quan training on limits of stability in older adults
Directory of Open Access Journals (Sweden)
Li F
2014-08-01
Full Text Available Fuzhong Li1,2 1Oregon Research Institute, Eugene, OR, USA; 2Shanghai University of Sport, Shanghai, People’s Republic of ChinaBackground: Limits of stability, defined as the ability to maintain the center of gravity within the boundary of the base of support, is critically important for older adults in performing their activities of daily living. However, few exercise programs specifically tailored to enhance limits of stability exist. The primary purpose of this study was to determine whether a therapeutically designed intervention, Tai Ji Quan: Moving for Better Balance (TJQMBB, could improve limits of stability in older adults. A secondary purpose was to examine concomitant change in limits of stability and physical performance as a result of the intervention.Methods: A single-group design was used in which 145 community-dwelling older adults (average age: 75 years were enrolled in TJQMBB classes, participating twice weekly for 48 weeks. Primary outcome measures were three indicators of limits of stability (LOS (endpoint excursion, movement velocity, and directional control, with secondary measures of physical performance being Timed Up and Go and 50-foot speed walk (in seconds, which were assessed at baseline, 24 weeks, and 48 weeks. Changes in the repeated measures of outcome variables were analyzed via latent curve analysis.Results: At 48 weeks, a significant rate of change (improvement over time was observed in the three limits of stability indicators (endpoint execution: 8.30% LOS, P<0.001; movement velocity: 0.86 degrees/second, P<0.001; directional control: 6.79% of 100, P<0.001; all reached a threshold of real change as judged by the minimal detectable change values. Improvements in the three limits of stability measures were concomitantly correlated with improved (reduced times performance scores in the Timed Up and Go (-0.30, -0.45, and -0.55, respectively and 50-foot walk (-0.33, -0.49, and -0.41, respectively
Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar
2015-09-29
The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.
International Nuclear Information System (INIS)
Swisher, J.N.
1997-01-01
The UN Framework Convention of Climate Change (FCCC) allows for the Joint Implementation (JI) of measures to mitigate the emissions of greenhouse gases. The concept of JI refers to the implementation of such measures in one country with partial and/or technical support from another country, potentially fulfilling some of the supporting country's emission-reduction commitment under the FCCC. At present, all JI transactions are voluntary, and no country has claimed JI credit against existing FCCC commitments. Nevertheless, JI could have important implications for both the economic efficiency and the international equity of the implementation of the FCCC. The paper discusses some of the information needs of JI projects and seeks to clarify some of the common assumptions and arguments about JI. Issues regarding JI are distinguished according to those that are specific to JI as well as other types of regimes and transactions. The focus is on the position of developing countries and their potential risks and benefits regarding JI. 2 figs., 3 tabs., 35 refs
Teaching undergraduate biomechanics with Just-in-Time Teaching.
Riskowski, Jody L
2015-06-01
Biomechanics education is a vital component of kinesiology, sports medicine, and physical education, as well as for many biomedical engineering and bioengineering undergraduate programmes. Little research exists regarding effective teaching strategies for biomechanics. However, prior work suggests that student learning in undergraduate physics courses has been aided by using the Just-in-Time Teaching (JiTT). As physics understanding plays a role in biomechanics understanding, the purpose of study was to evaluate the use of a JiTT framework in an undergraduate biomechanics course. This two-year action-based research study evaluated three JiTT frameworks: (1) no JiTT; (2) mathematics-based JiTT; and (3) concept-based JiTT. A pre- and post-course assessment of student learning used the biomechanics concept inventory and a biomechanics concept map. A general linear model assessed differences between the course assessments by JiTT framework in order to evaluate learning and teaching effectiveness. The results indicated significantly higher learning gains and better conceptual understanding in a concept-based JiTT course, relative to a mathematics-based JiTT or no JiTT course structure. These results suggest that a course structure involving concept-based questions using a JiTT strategy may be an effective method for engaging undergraduate students and promoting learning in biomechanics courses.
Institute of Scientific and Technical Information of China (English)
杨杰
2016-01-01
学者多认为《声无哀乐论》是一篇艺术理论文献或者音乐美学文献,事实上它是一篇哲学文献。嵇康认为声音只有音阶节奏是否平和的体性,而没有哀乐的属性;哀乐是人的情感属性,平和的音乐只是宣导人本有的哀乐之情。他进一步认为音乐本身也没有德行、功用等“象”。他认为音乐是有教化作用的,首先要实行无为之政的良善政治,使得人心平和,产生平和之乐,二者相互涵养天下才会大治。与儒家以礼乐为主的乐教观不同,嵇康的乐教思想是以人心平和,从而实际上是以无为政治为首要目的的。因此嵇康的音乐理论最终指向的是乐教何以可能的政治哲学问题,《声论》是一篇政治哲学文献。%Most scholars regard No Funeral Music Theory as a literature about art theory or music aes‐thetics ,actually ,it is a literature about political philosophy .Ji Kang thinks that music only has the harmonious melody ,and has nothing to do with the human emotion related to political situation and other circumstances .The point is that grief and joy is the attribute of human emotion ,and the peace‐ful music only a tool to express this emotion .Furthermore ,he put forward that the music itself doesn't have the properties about virtue or function .He held the opinion that music had the function of in‐doctrination ,and we must carry out inaction in governance ,which drives everyone's emotion to a calm ,thus peaceful music being generated ,and the two sides promoting each other can eventually produce a well governed society .Different from Confucian view about music education ,Ji Kang regar‐ded inaction in governance is more important than music education .Therefore ,the finally aim of Ji kang's music theory is the possibility of music education ,which is a political problem ,as a conse‐quence ,No Funeral Music Theory is a literature about political philosophy .
Huang, L X
2017-11-28
This compilation process of Mian xue tang zhen jiu ji cheng ( Mian Xuetang ' s Synthetic Work of Acu - moxibustion )was quite mysterious, the book's advent coincidentally met with several major historical events which made its value of decoding its historical functions far beyond its academic value. The editor of this book is Le Xianyang, the founder of Tong Ren Tang. While compiling this book, he also made a replica of Ming-Dynasty's Zhengtong bronze statue. More than 200 years later, Le Jingyu, the 12th generation of the Le family revised Ming Tang Tu inherited from his ancestors and engraved Ming Tang Tu on the stone for its standardization. This great achievement of Le family was no less than the recasting of the Tiansheng bronze statue and the reengraving Tong ren shu xue zhen jiu tu jing ( Illustrated Manual of Acupuncture Points of the Bronze Figure ) by support of state power for building the Beijing Imperial Hospital in the eighth year of the Zhengtong reign (1443).
Energy Technology Data Exchange (ETDEWEB)
Burstroem von Malmborg, Fredrik [Royal Inst. of Tech., Stockholm (Sweden); Borgstroem, Truls; Dethlefsen, Ulrika; Kling, Aasa [Vattenfall AB, Stockholm (Sweden)
2002-12-01
At present, suggestions as for how a JI system would be designed and implemented are being worked out on a national level in Sweden and other countries. An important question in international and national climate policy and thus in work related to JI is how to engage companies. In order to make companies interested in investing and participating in JI, the mechanisms must be compatible with the ways in which companies work. Hence, knowledge and concern of conditions for those who are supposed to implement the politics in practice would be a key issue for the institutions that shape climate policy and JI systems. Given this background and the present situation regarding JI, this report aims at providing a business perspective on the prerequisites for implementing JI in Sweden. The main question addressed in the report is: What would make Swedish companies participate in JI projects? The study underlying this report covered three workshops where representatives of in all 15 Swedish companies from different industry sectors, by working in group, determined and discussed opportunities and obstacles for participation of companies in JI as well as concrete measures as for enabling such participation. From the empirical data collected we have found that Swedish companies, if not directly opposed to JI, play a waiting game at present regarding investments and participation in specific JI projects. According to the data, companies would invest and participate in JI projects if and only if it is found to be the most competitive of different alternatives for the company to meet its carbon dioxide emission restrictions or a profitable project. The former condition applies for companies with considerable CO{sub 2} emissions, the latter for companies with low or no such emissions. However, JI is currently perceived of as risky and associated with large uncertainties. The perceived uncertainties associated with JI participation are mainly related to indistinct and ambiguous
Just-in-Time Teaching in undergraduate physics courses: Implementation, learning, and perceptions
Dwyer, Jessica Hewitt
Regardless of discipline, a decades-long battle has ensued within nearly every classroom in higher education: instructors getting students to come to class prepared to learn. In response to this clash between teacher expectations and frequent student neglect, a group of four physics education researchers developed a reformed instructional strategy called Just-in-Time Teaching (JiTT). This dissertation investigates the following three areas: 1) the fidelity with which undergraduate physics instructors implement JiTT, 2) whether student performance predicts student perception of their instructor's fidelity of JiTT implementation, and 3) whether student perception of their instructor's fidelity of JiTT implementation correlates with student views of their physics course. A blend of quantitative data (e.g., students grades, inventory scores, and questionnaire responses) are integrated with qualitative data (e.g., individual faculty interviews, student focus group discussions, and classroom observations). This study revealed no statistically significant relationship between instructors who spent time on a predefined JiTT critical component and their designation as a JiTT user or non-user. While JiTT users implemented the pedagogy in accordance with the creators' intended ideal vision, many also had trouble reconciling personal concerns about their role as a JiTT adopter and the anticipated demand of the innovation. I recommend that this population of faculty members can serve as a JiTT model for other courses, disciplines, and/or institutions. Student performance was not a predictor of student perception instructor fidelity of JiTT implementation. Additionally, the majority of students in this study reported they read their textbook prior to class and that JiTT assignments helped them prepare for in-class learning. I found evidence that exposure to the JiTT strategy may correlate with a more favorable student view of their physics course. Finally, according to students
Joint implementation in the climate change convention
International Nuclear Information System (INIS)
Merkus, H.; Heintz, R.
1994-01-01
The United Nations Climate Change Convention offers developed countries the possibility to realize a part of their obligations elsewhere via financing of emission reduction activities. This so-called joint implementation (JI) enlarges the effectiveness of the international climate change policy. It is assumed that the marginal costs of the emission reductions differ between countries. The application of JI has benefits, but also bears risks. With regard to potential nett benefits and costs/risks it is of interest to distinguish between micro-effects (on a project level), macro-effects (on a national level) and global effects, focusing on JI between OECD countries and developing countries. Five comments on this tripartite are made: (1) it is important to gain insight in the JI potential; (2) JI can contribute to projects of a high development priority; (3) there is a chance that parties, involved in JI, claim more reductions (credits) than take place in reality (double counting); (4) there exists the risk of a delay of technological progress; and (5) the danger exists that JI causes a minor stimulus for developing countries to accept emission reduction obligations. A functional JI-system demands criteria that limits the risks and optimize the benefits. The main criteria concern verification of realized emission reductions; an acceptable balance between measures in one's own country and JI, for which three mechanisms are briefly discussed (partial credit entry, funds, and separated targets); and additionality of JI-financing. Side criteria are the monitoring, verification and control of the possession of the credits. Finally attention is paid to the role of the government in JI and further developments and chances for JI. 7 refs
Huo, Rui-li; Zhu, Ling; Yang, Feng
2015-08-01
In the initial stage (1950s) of the establishment of the People's Republic of China, the Pavlov's theory played an important influence on Chinese biology and medical science fields. At that time, many schools or colleges of traditional Chinese medicine were set up one after another, the first edition of teaching materials or textbook was complete, and a lot of advanced training courses and training classes were developed. In that specific period of "acupuncture scientification", Mr. MA Ji-xing, a professor from China Academy of Traditional Chinese Medicine, is a representative scholar who employed Pavlov's theory to make a scientific explanation about the underlying physiological mechanisms of acupuncture-moxibustion therapy. For example, he employed nerve network or nerve system to explain topical acupuncture stimulation and distal stimulation to induce local effect or distal curative effect, employed the cutaneous-visceral reflex to explain the therapeutic effect of acu-moxibustion for visceral disorders, used the viscera-cutaneous reflex to explain the tender point (sensitized region) or Ashi-point, used the "predominant factor mechanism" or excitation transfer of the stimulated non-sensitized cutaneous region close to the diseased locus to explain the pain-relief of acupuncture stimulation, used the stimulation strength, duration, frequency and distance (to the locus) to explain the needling reinforcing or reducing effect, and so on and so forth. He wrote many articles and books about acupuncturology, one of which was named Jianyao Zhenjiu Xue (Concise Acupuncturology), a well-known demonstration teaching material for advanced training courses, inducing a significant influence on the acu-moxibustion field in both academic field and clinical practice. Looking back this period of history may provide a helpful reference for current research on academic development of acupuncturology.
Directory of Open Access Journals (Sweden)
Alex Vladimir Krusche
2005-06-01
Full Text Available Este trabalho discute os efeitos das mudanças do uso do solo na biogequímica dos rios da bacia de drenagem do rio Ji-Paraná (Rondônia. Nesta região, a distribuição espacial do desmatamento e das propriedades do solo resultam em sinais diferentes, possibilitando a divisão dos sistemas fluviais em três grupos: rios com águas pobres em íons e baixo impacto; rios com conteúdo iônico intermediário e impacto médio e rios com elevados conteúdo iônico e impacto antropogênico. As características biogeoquímicas dos rios têm relação significativa com a área de pasto, melhor parâmetro para prever a condutividade elétrica (r² = 0,87 e as concentrações de sódio (r² = 0,75, cloreto (r² = 0,69, potássio (r² = 0,63, fosfato (r² = 0.78, nitrogênio inorgânico (r² = 0.52, carbono inorgânico (r² = 0.81 e carbono orgânico (rain ² = 0.51 dissolvidos. Cálcio e magnésio tiveram sua variância explicada pelas características do solo e pastagem. Nossos resultados indicam que as mudanças observadas na micro-escala constituem "sinais biogeoquímicos" gerados pelo processamento do material nas margens dos rios. A medida em que os rios evoluem para ordens superiores, os sinais persistentes nos canais fluviais estão mais associdados às características da bacia de drenagem (solos e uso da terra. Apesar dos efeitos das mudanças observadas no uso do solo não serem ainda detectáveis na macro-escala (bacia amazônica, a disrupção da estrutura e funcionamento dos ecossistemas é detectável nas micro e meso escalas, com alterações significativas na ciclagem de nutrientes nos ecossistemas fluviais.In this article we present the results of the effects of land use change on the river biogeochemistry of the Ji-Paraná basin (Rondônia. In this region, the spatial distribution of deforestation and soil properties result in different biogeochemical signals, allowing the division of the fluvial systems into three groups: rivers with
Directory of Open Access Journals (Sweden)
Song J
2017-03-01
Full Text Available Jingjing Song* Xiaoxi Fan* Zhongwei Zhao* Minjiang Chen* Weiqian Chen, Fazong Wu, Dengke Zhang, Li Chen, Jianfei Tu, Jiansong Ji Department of Interventional Radiology, Zhejiang University Lishui Hospital, The Fifth Affiliated Hospital of Wenzhou Medical University, Lishui Central Hospital, Lishui, Zhejiang, People’s Republic of China *These authors have contributed equally to this work Objectives: The objective of this study was to assess the efficacy of computed tomography (CT-guided 125I brachytherapy alone in improving the survival and quality of life of patients with unresectable locally advanced non-small-cell lung cancer (NSCLC after one cycle of first-line chemotherapy.Patients and methods: Sixteen patients with locally advanced NSCLC were treated with CT-guided 125I brachytherapy after one cycle of first-line chemotherapy (group A. Sixteen patients who received only best supportive care (group B were matched up with the patients in group A. Primary end point included survival, and secondary end point included assessment of safety, effectiveness of CT-guided 125I brachytherapy, and improvement in the quality of life.Results: The two groups were well balanced in terms of age, disease histology, tumor stage, tumor location, and performance status (P>0.05. The median follow-up time was 16 months (range, 3–30. The total tumor response rate was 75.0% in group A, which was significantly higher than that in group B (0.0% (P<0.01. The median progression-free survival time was 4.80 months for patients in group A and 1.35 months for patients in group B (P<0.001. Kaplan–Meier survival analysis showed that the median survival time of group A was 9.4±0.3 months versus 8.4±0.1 months in group B (P=0.013. Tumor-related symptoms of patients were significantly relieved, and the quality of life was markedly improved in group A than in group B.Conclusion: CT-guided 125I brachytherapy improved the survival of patients with locally advanced
New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae
Directory of Open Access Journals (Sweden)
Hua-yan Chen
2017-01-01
Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n
Schuller, Mary C; DaRosa, Debra A; Crandall, Marie L
2015-03-01
To assess use of the combined just-in-time teaching (JiTT) and peer instruction (PI) instructional strategy in a residency program's core curriculum. In 2010-2011, JiTT/PI was piloted in 31 core curriculum sessions taught by 22 faculty in the Northwestern University Feinberg School of Medicine's general surgery residency program. JiTT/PI required preliminary and categorical residents (n=31) to complete Web-based study questions before weekly specialty topic sessions. Responses were examined by faculty members "just in time" to tailor session content to residents' learning needs. In the sessions, residents answered multiple-choice questions (MCQs) using clickers and engaged in PI. Participants completed surveys assessing their perceptions of JiTT/PI. Videos were coded to assess resident engagement time in JiTT/PI sessions versus prior lecture-based sessions. Responses to topic session MCQs repeated in review sessions were evaluated to study retention. More than 70% of resident survey respondents indicated that JiTT/PI aided in the learning of key points. At least 90% of faculty survey respondents reported positive perceptions of aspects of the JiTT/PI strategy. Resident engagement time for JiTT/PI sessions was significantly greater than for prior lecture-based sessions (z=-2.4, P=.016). Significantly more review session MCQ responses were correct for residents who had attended corresponding JiTT/PI sessions than for residents who had not (chi-square=13.7; df=1; P<.001). JiTT/PI increased learner participation, learner retention, and the amount of learner-centered time. JiTT/PI represents an effective approach for meaningful and active learning in core curriculum sessions.
A framework for the assessment of the global potential of joint implementation
International Nuclear Information System (INIS)
Bollen, J.C.; Van Minnen, J.G.; Toet, A.M.C.; Kuik, O.J.; Bennis, M.
1995-09-01
Joint Implementation (JI) is a means for reaching cheaper solutions to CO 2 -emission reductions. The global potential for JI is defined as the portion of the necessary regional CO 2 -emission reductions to meet the goals defined for a target year that can be more cost-effectively implemented in other regions. The goals will come from multilateral negotiations and may be the starting point of any bilateral negotiation process concerning JI-agreements. The more the goals will take cost-effectiveness criteria into account the less scope there will be for additional JI-agreements. In cases where the goals are stricter, the globally required emission reductions will be larger and consequently larger emission reductions could be be achieved in other regions. However, as compared to the other cases presented in the report the potential for JI will be lower, since the potential is defined as a fraction of the necessary global emission reduction. JI could reduce the total costs of CO 2 -emission reduction by more than 75% compared to the situation without JI, depending on the initial distribution of CO 2 -targets, the target year and the scenario-assumptions. For donor countries the cost reductions could be more than 50%, even when it is assumed that the subsidies for emission reduction measures in receptor countries are 50% higher than the actual costs. In donor countries the resulting domestic CO 2 -emission reductions after JI could be more than 50% less than the original goals before JI. In comparison to other OECD regions (Japan, Oceania, and the United States), Western Europe's gains from JI are less. In other words, in a world market for JI projects, Western Europe could face strong competition. 7 figs., 25 tabs., 37 refs., 1 appendix
Yin, Juxin; Zhang, Daihui; Zhuang, Jianjian; Huang, Yi; Mu, Ying; Lv, Shaowu
2017-12-11
Panax ginseng is a traditional medicine. Fresh ginseng is one of the most important industries related to ginseng development, and fresh ginseng of varying ages has different medicinal properties. Previous research has not systematically reported the correlation between changes in key enzyme activity with changes in ginsenoside content in fresh ginseng over time. In this study, for the first time, we use ginseng samples of varying ages in Ji'an and systematically reported the changes in the activity of seven key enzymes (HMGR, FPS, SS, SE, DS, CYP450, and GT). We investigated the content of ginsenoside and gene expression of these key enzymes. Ginsenoside content was measured using HPLC. HPLC, GC-MS, and LC-MS were combined to measure the enzyme activity of the key enzymes. Quantitative PCR was used in the investigation of gene expression. By analyzing the correlation between the enzyme activity and the transcription level of the key enzymes with ginsenoside content, we found that DS and GT enzyme activities are significantly correlated with the ginsenoside content in different ages of ginseng. Our findings might provide a new strategy to discriminate between ginseng of different years. Meanwhile, this research provides important information for the in-depth study of ginsenoside biosynthesis.
Kuai, Le; Zhang, Jing-Ting; Deng, Yu; Xu, Shun; Xu, Xun-Zhe; Wu, Min-Feng; Guo, Dong-Jie; Chen, Yu; Wu, Ren-Jie; Zhao, Xing-Qiang; Nian, Hua; Li, Bin; Li, Fu-Lun
2018-01-29
Sheng-ji Hua-yu(SJHY) formula is one of the most useful Traditional Chinese medicine (TCM) in the treatment of the delayed diabetic wound. However, elucidating the related molecular biological mechanism of how the SJHY Formula affects excessive inflammation in the process of re-epithelialization of diabetic wound healing is a task urgently needed to be fulfilled. The objectives of this study is to evaluate the effect of antagonisic expression of pro-/anti-inflammatory factors on transforming growth factor-β(TGF-β) superfamily (activin and follistatin) in the process of re-epithelialization of diabetic wound healing in vivo, and to characterize the involvement of the activin/follistatin protein expression regulation, phospho-Smad (pSmad2), and Nuclear factor kappa B p50 (NF-kB) p50 in the diabetic wound healing effects of SJHY formula. SJHY Formula was prepared by pharmaceutical preparation room of Yueyang Hospital of Integrated Traditional Chinese and Western Medicine. Diabetic wound healing activity was evaluated by circular excision wound models. Wound healing activity was examined by macroscopic evaluation. Activin/follistatin expression regulation, protein expression of pSmad2 and NF-kB p50 in skin tissue of wounds were analyzed by Real Time PCR, Western blot, immunohistochemistry and hematoxylin and eosin (H&E) staining. Macroscopic evaluation analysis showed that wound healing of diabetic mice was delayed, and SJHY Formula accelerated wound healing time of diabetic mice. Real Time PCR analysis showed higher mRNA expression of activin/follistatin in diabetic delayed wound versus the wound in normal mice. Western Blot immunoassay analysis showed reduction of activin/follistatin proteins levels by SJHY Formula treatment 15 days after injury. Immunohistochemistry investigated the reduction of pSmad2 and NF-kB p50 nuclear staining in the epidermis of diabetic SJHY versus diabetic control mice on day 15 after wounding. H&E staining revealed that SJHY Formula
Pan, Jian-Song; Zhang, Wei; Yi, Wei; Guo, Guang-Can
2016-10-01
In a recent experiment (Z. Wu, L. Zhang, W. Sun, X.-T. Xu, B.-Z. Wang, S.-C. Ji, Y. Deng, S. Chen, X.-J. Liu, and J.-W. Pan, arXiv:1511.08170 [cond-mat.quant-gas]), a Raman-assisted two-dimensional spin-orbit coupling has been realized for a Bose-Einstein condensate in an optical lattice potential. In light of this exciting progress, we study in detail key properties of the system. As the Raman lasers inevitably couple atoms to high-lying bands, the behaviors of the system in both the single- and many-particle sectors are significantly affected. In particular, the high-band effects enhance the plane-wave phase and lead to the emergence of "roton" gaps at low Zeeman fields. Furthermore, we identify high-band-induced topological phase boundaries in both the single-particle and the quasiparticle spectra. We then derive an effective two-band model, which captures the high-band physics in the experimentally relevant regime. Our results not only offer valuable insights into the two-dimensional lattice spin-orbit coupling, but also provide a systematic formalism to model high-band effects in lattice systems with Raman-assisted spin-orbit couplings.
International Nuclear Information System (INIS)
Abu Steet, A.A.; Ayoub, R.R.; Bakhit, A.F.
2013-01-01
This article deals with the geology, structure, mineralogy and radioactivity of the alkali feldspar granites at wadi Ladid al-Ji,dan, north Eastern Desert of Egypt. Geologically, the area consists mainly of alkali feldspar granites. These granites are medium to coarse grained, pink to red in colour and form numbers of moderate to relatively high elevated outcrops. These rocks are altered in some parts due to secondary processes especially along the fault zones and contacts. The area displays primary and secondary structures. Primary structures comprise layering, volcanic flows, vesicular tops of lavas and volcanic bombs. The secondary structures are represented by exfoliation, joints and faults. The granites are dissected by several sets of joints predominating in the N-S direction, dipping 84°-88° mainly to west; E-W direction, dipping 70°-75° mainly to south and NW-SE direction, dipping 80°-82° to SW direction. The majority of joints are tension ones. These tension joints are commonly filled with quartz, feldspars, epidote, iron oxides, manganese oxides and aplite. The studied area is dissected by major regional faults. Along the fault zones; the granites are marked by fault breccia and alteration features, especially silicification, hematitization, kaolinitization and chloritization. The area is cutting by faults trending mainly in N-S, NE-SW and NNW-SSE directions. The average uranium and thorium contents of the alkali feldspar granites are 12 and 23 ppm and reaches up to 36 and 37 ppm in the normal pegmatites. In the anomalous pegmatites the maximum values recorded are 91 and 72 ppm. Generally, the averages of uranium and thorium contents in the studied pegmatites are higher than that of the world and Egyptian uraniferous pegmatites. The high uranium content in alkali feldspar granites is related to the presence of some accessory minerals such as zircon, fluorite and apatite but the high uranium content in the pegmatites is related to the presence of
African Journals Online (AJOL)
books, this one is based on a series of articles which origi- nally appeared in the ... Hospital Bone Bank at Harvard Medical School and has made a tremendous ... of Africa; and to the negative impact on the economy, due to direct and indirect ...
Joint implementation demo project between Denmark and Estonia - Phase 1. Final report
International Nuclear Information System (INIS)
2003-09-01
This project is meant to contribute to form the basis of co-operation between Denmark and Estonia as regards Joint Implementation (JI) and thus gather experience in preparation for practical use of JI. A number of questions can be raised for discussion within this project: What is the scope for JI? What is the role of the host country government? Will JI survive the emerging Emission Trading? The project report gives a status of the present situation within the area of JI both internationally and in Estonia, including a resume of the Estonian National Climate Programme. Furthermore, a stakeholder analysis is presented, along with an illustration of the effect of Joint Implementation in the various energy sectors. (BA)
2017-10-01
Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Loopealne, Elisa
2007-01-01
Tutvustus: Bristol, Piret. Nöörist ja seebist. Pärnu : Jumalikud Ilmutused, 2006. (Ji) ; Kivisildnik. Vägistatud jäämägi. Pärnu : Jumalikud Ilmutused, 2006. (Ji) ; Sild, Ivar. Spermaga ja puha. Pärnu : Jumalikud Ilmutused, 2006. (Ji) ; Meiel, Kaupo. Polügrafisti käsiraamat, 2006
He, Xijun; Dong, Yanbo; Wu, Yuying; Wei, Guodan; Xing, Lizhi; Yan, Jia
2017-08-01
To address the double pressure of scarce resources and regional industrial isomorphism, this paper applied the concepts of exergy and embodied resources based on economic input-output (I-O) data. We constructed the embodied resources networks among the regional industries of Beijing-Tianjin-Hebei (also known as Jing-Jin-Ji) in China. We analyzed the rules of embodied resources consumption in the area's industries, identified the core community structures, and studied the characteristics of industrial homogeneity through regional comparisons. The results showed that the dependence on scarce resources of industrial operations in Beijing was less than in Jin-Ji, while the dependence on finance, technology, information, and other service resources in Beijing was higher than in Jin-Ji. The I-O efficiency of embodied resources among industries and the agglomeration of correlation relationships in industries with large embodied resources were higher than in Jin-Ji. The industrial coincidence degree in the ;bridge; industries and in the core community in Jin-Ji was higher than in Jing-Jin and Jing-Ji, which means the industrial homogeneous competition of Jin-Ji was higher, too. This study makes a significant contribution toward promoting the dislocation development of regional industries, accelerating the coordination of resources, and reducing homogeneity competition.
75 FR 60761 - Government-Owned Inventions; Availability for Licensing
2010-10-01
... related to drug resistance. Inventors: Genbin Shi, Gary Shaw, Xinhua Ji (NCI). Patent Status: U.S... Publications: 1. Blaszczyk J, Shi G, Li Y, Yan H, Ji X. Reaction trajectory of pyrophosphoryl transfer...: 15016362]. 2. Blaszczyk J, Shi G, Yan H, Ji X. Catalytic center assembly of HPPK as revealed by the crystal...
An n-dimensional pseudo-differential operator involving the Hankel ...
Indian Academy of Sciences (India)
ji =0 bji x. 2 ji +μ+1/2 i. (x−1 i ∂/∂xi )ri + ji. (x. −μ−1/2 i φ(x1,..., xn)). ⎞. ⎠ ,. (1.8) where the bji are constants depending only on μ. For i = 1, 2,..., n, let (xi , yi , zi ) ...
Blogs and Wikis as Instructional Tools: A Social Software Adaptation of Just-in-Time Teaching
Higdon, Jude; Topaz, Chad
2009-01-01
Just-in-Time Teaching (JiTT) methodology uses Web-based tools to gather student responses to questions on preclass reading assignments. However, the technological requirements of JiTT and the content-specific nature of the questions may prevent some instructors from implementing it. Our own JiTT implementation uses publicly and freely available…
Development of the scintillator-based probe for fast-ion losses in the HL-2A tokamak
Zhang, Y. P.; Liu, Yi; Luo, X. B.; Isobe, M.; Yuan, G. L.; Liu, Y. Q.; Hua, Y.; Song, X. Y.; Yang, J. W.; Li, X.; Chen, W.; Li, Y.; Yan, L. W.; Song, X. M.; Yang, Q. W.; Duan, X. R.
2014-05-01
A new scintillator-based lost fast-ion probe (SLIP) has been developed and operated in the HL-2A tokamak [L. W. Yan, X. R. Duan, X. T. Ding, J. Q. Dong, Q. W. Yang, Yi Liu, X. L. Zou, D. Q. Liu, W. M. Xuan, L. Y. Chen, J. Rao, X. M. Song, Y. Huang, W. C. Mao, Q. M. Wang, Q. Li, Z. Cao, B. Li, J. Y. Cao, G. J. Lei, J. H. Zhang, X. D. Li, W. Chen, J. Chen, C. H. Cui, Z. Y. Cui, Z. C. Deng, Y. B. Dong, B. B. Feng, Q. D. Gao, X. Y. Han, W. Y. Hong, M. Huang, X. Q. Ji, Z. H. Kang, D. F. Kong, T. Lan, G. S. Li, H. J. Li, Qing Li, W. Li, Y. G. Li, A. D. Liu, Z. T. Liu, C. W. Luo, X. H. Mao, Y. D. Pan, J. F. Peng, Z. B. Shi, S. D. Song, X. Y. Song, H. J. Sun, A. K. Wang, M. X. Wang, Y. Q. Wang, W. W. Xiao, Y. F. Xie, L. H. Yao, D. L. Yu, B. S. Yuan, K. J. Zhao, G. W. Zhong, J. Zhou, J. C. Yan, C. X. Yu, C. H. Pan, Y. Liu, and the HL-2A Team, Nucl. Fusion 51, 094016 (2011)] to measure the losses of neutral beam ions. The design of the probe is based on the concept of the α-particle detectors on Tokamak Fusion Test Reactor (TFTR) using scintillator plates. The probe is capable of traveling across an equatorial plane port and sweeping the aperture angle rotationally with respect to the axis of the probe shaft by two step motors, in order to optimize the radial position and the collimator angle. The energy and the pitch angle of the lost fast ions can be simultaneously measured if the two-dimensional image of scintillation light intensity due to the impact of the lost fast ions is detected. Measurements of the fast-ion losses using the probe have been performed during HL-2A neutral beam injection discharges. The clear experimental evidence of enhanced losses of beam ions during disruptions has been obtained by means of the SLIP system. A detailed description of the probe system and the first experimental results are reported.
Development of the scintillator-based probe for fast-ion losses in the HL-2A tokamak
Energy Technology Data Exchange (ETDEWEB)
Zhang, Y. P., E-mail: zhangyp@swip.ac.cn; Liu, Yi; Yuan, G. L.; Song, X. Y.; Yang, J. W.; Li, X.; Chen, W.; Li, Y.; Yan, L. W.; Song, X. M.; Yang, Q. W.; Duan, X. R. [Southwestern Institute of Physics, P.O. Box 432, Chengdu 610041 (China); Luo, X. B.; Liu, Y. Q.; Hua, Y. [Institute of Nuclear Science and Technology, Sichuan University, Chengdu 610041 (China); Isobe, M. [National Institute for Fusion Science, 322-6 Oroshi-cho, Toki 509-5259 (Japan)
2014-05-15
A new scintillator-based lost fast-ion probe (SLIP) has been developed and operated in the HL-2A tokamak [L. W. Yan, X. R. Duan, X. T. Ding, J. Q. Dong, Q. W. Yang, Yi Liu, X. L. Zou, D. Q. Liu, W. M. Xuan, L. Y. Chen, J. Rao, X. M. Song, Y. Huang, W. C. Mao, Q. M. Wang, Q. Li, Z. Cao, B. Li, J. Y. Cao, G. J. Lei, J. H. Zhang, X. D. Li, W. Chen, J. Chen, C. H. Cui, Z. Y. Cui, Z. C. Deng, Y. B. Dong, B. B. Feng, Q. D. Gao, X. Y. Han, W. Y. Hong, M. Huang, X. Q. Ji, Z. H. Kang, D. F. Kong, T. Lan, G. S. Li, H. J. Li, Qing Li, W. Li, Y. G. Li, A. D. Liu, Z. T. Liu, C. W. Luo, X. H. Mao, Y. D. Pan, J. F. Peng, Z. B. Shi, S. D. Song, X. Y. Song, H. J. Sun, A. K. Wang, M. X. Wang, Y. Q. Wang, W. W. Xiao, Y. F. Xie, L. H. Yao, D. L. Yu, B. S. Yuan, K. J. Zhao, G. W. Zhong, J. Zhou, J. C. Yan, C. X. Yu, C. H. Pan, Y. Liu, and the HL-2A Team , Nucl. Fusion 51, 094016 (2011)] to measure the losses of neutral beam ions. The design of the probe is based on the concept of the α-particle detectors on Tokamak Fusion Test Reactor (TFTR) using scintillator plates. The probe is capable of traveling across an equatorial plane port and sweeping the aperture angle rotationally with respect to the axis of the probe shaft by two step motors, in order to optimize the radial position and the collimator angle. The energy and the pitch angle of the lost fast ions can be simultaneously measured if the two-dimensional image of scintillation light intensity due to the impact of the lost fast ions is detected. Measurements of the fast-ion losses using the probe have been performed during HL-2A neutral beam injection discharges. The clear experimental evidence of enhanced losses of beam ions during disruptions has been obtained by means of the SLIP system. A detailed description of the probe system and the first experimental results are reported.
Development of the scintillator-based probe for fast-ion losses in the HL-2A tokamak
International Nuclear Information System (INIS)
Zhang, Y. P.; Liu, Yi; Yuan, G. L.; Song, X. Y.; Yang, J. W.; Li, X.; Chen, W.; Li, Y.; Yan, L. W.; Song, X. M.; Yang, Q. W.; Duan, X. R.; Luo, X. B.; Liu, Y. Q.; Hua, Y.; Isobe, M.
2014-01-01
A new scintillator-based lost fast-ion probe (SLIP) has been developed and operated in the HL-2A tokamak [L. W. Yan, X. R. Duan, X. T. Ding, J. Q. Dong, Q. W. Yang, Yi Liu, X. L. Zou, D. Q. Liu, W. M. Xuan, L. Y. Chen, J. Rao, X. M. Song, Y. Huang, W. C. Mao, Q. M. Wang, Q. Li, Z. Cao, B. Li, J. Y. Cao, G. J. Lei, J. H. Zhang, X. D. Li, W. Chen, J. Chen, C. H. Cui, Z. Y. Cui, Z. C. Deng, Y. B. Dong, B. B. Feng, Q. D. Gao, X. Y. Han, W. Y. Hong, M. Huang, X. Q. Ji, Z. H. Kang, D. F. Kong, T. Lan, G. S. Li, H. J. Li, Qing Li, W. Li, Y. G. Li, A. D. Liu, Z. T. Liu, C. W. Luo, X. H. Mao, Y. D. Pan, J. F. Peng, Z. B. Shi, S. D. Song, X. Y. Song, H. J. Sun, A. K. Wang, M. X. Wang, Y. Q. Wang, W. W. Xiao, Y. F. Xie, L. H. Yao, D. L. Yu, B. S. Yuan, K. J. Zhao, G. W. Zhong, J. Zhou, J. C. Yan, C. X. Yu, C. H. Pan, Y. Liu, and the HL-2A Team , Nucl. Fusion 51, 094016 (2011)] to measure the losses of neutral beam ions. The design of the probe is based on the concept of the α-particle detectors on Tokamak Fusion Test Reactor (TFTR) using scintillator plates. The probe is capable of traveling across an equatorial plane port and sweeping the aperture angle rotationally with respect to the axis of the probe shaft by two step motors, in order to optimize the radial position and the collimator angle. The energy and the pitch angle of the lost fast ions can be simultaneously measured if the two-dimensional image of scintillation light intensity due to the impact of the lost fast ions is detected. Measurements of the fast-ion losses using the probe have been performed during HL-2A neutral beam injection discharges. The clear experimental evidence of enhanced losses of beam ions during disruptions has been obtained by means of the SLIP system. A detailed description of the probe system and the first experimental results are reported
International Nuclear Information System (INIS)
Luhmann, H.J.; Ott, H.E.; Beuermann, C.; Fischedick, M.; Hennicke, P.; Bakker, L.
1997-01-01
The study served to analyze the practical aspects of 'Joint Implementation' (JI) under the Framework Convention on Climate Change, in which measures to reduce greenhouse gas emissions are carried out jointly by several countries. As a first step, possible climate protection measures were assessed with respect to their suitability for JI and an overview of suitable JI projects was compiled. In a further step, carried out in cooperation with partners from industry, four specific projects (coal-fired power plant, solar-thermal power plant, cement factory, least-cost planning) were used to simulate JI. In this work, solutions were developed for the calculation of greenhouse gas emissions avoided as well as for project reporting. In addition, proposals were made with respect to the organizational and institutional design on an international JI mechanism. (orig.) [de
Energy Technology Data Exchange (ETDEWEB)
Matsuhashi, R.; Ishitani, H. [The University of Tokyo, Tokyo (Japan)
1998-10-01
In order to reduce greenhouse gas emissions, we have to introduce measures to suppress economic differences between developed countries (DC) and less developed countries (LDC) as well as accelerate technology improvement. In this sense, Joint Implementation (JI) is a promising measure not only to economically reduce greenhouse gas emissions, but also to facilitate technology transfer from DC to LDC. In this article, we first investigated JI strategies, in which LDC can improve industrial energy efficiency under financial support of DC. Strategies of countries involved in JI was represented with Stackelberg game. Analytical results revealed that JI activities may considerably be diminished in Stackelberg equilibrium, depending on shapes of the marginal cost functions of reducing CO2. Therefore we proposed measures to prevent the suppression of JI and quantitatively evaluated the potential of this improved JI system. As far as actual data on economy and industry are concerned, we used the ones of Japan and China, since China has been rapidly increasing its economic scale and greenhouse gas emissions. However implications from these analyses are useful also for other countries. 8 refs., 7 figs.
Monks, P D D; Connor, J N L; Bouakline, F
2009-04-23
We investigate methods for filtering reaction mechanisms in the angular scattering of the state-to-state reaction, H + D(2)(v(i) = 0, j(i) = 0, m(i) = 0) --> HD(v(f) = 3, j(f) = 0, m(f) = 0) + D, where v(i), j(i), and m(i) and v(f), j(f), and m(f) are initial and final vibrational, rotational, and helicity quantum numbers, respectively. The input to our filtrations is a new set of accurate quantum scattering matrix elements for total energies in the range 1.52-2.50 eV (in steps of 0.01 eV) and for total angular momentum quantum numbers in the range, 0-40, in steps of unity. We filter reaction mechanisms in both the energy domain and the time domain. The time-domain calculations employ the plane wave packet formulation of time-dependent scattering. The theoretical tools used are nearside-farside (NF) analysis of partial wave series for scattering amplitudes, together with NF local angular momentum (LAM) theory. An energy-domain LAM analysis reveals the existence of an important dynamical feature in the N scattering, a "trench" which bisects the (energy, angle) plane. We use the location of this trench to approximately filter two reaction mechanisms. Transformation to the time domain demonstrates that the two reaction mechanisms correspond to direct and delayed (by about 25 fs) scattering. Further analysis, including filtration in the time domain, shows that the pronounced LAM trench arises from the interference of the energy-domain analogues of the time-direct and time-delayed scattering. Our theory and results provide the first successful demonstration of reaction mechanism filtering carried out directly in the (energy, angle) domain. The calculations and results in this paper extend and complement earlier research reported by Monks, Connor, and Althorpe (Monks, P. D. D.; Connor, J. N. L.; Althorpe, S. C. J. Phys. Chem. A 2006, 110, 741; J. Phys. Chem. A 2007, 111, 10302).
Modelled glacier dynamics over the last quarter of a century at Jakobshavn Isbræ
DEFF Research Database (Denmark)
Muresan, Ioana Stefania; Khan, Shfaqat Abbas; Aschwanden, Andy
2016-01-01
Observations over the past 2 decades show substantial ice loss associated with the speed-up of marineterminating glaciers in Greenland. Here we use a regional three-dimensional outlet glacier model to simulate the behaviour of Jakobshavn Isbræ (JI) located in western Greenland. Our approach...... is to model and understand the recent behaviour of JI with a physical process-based model. Using atmospheric forcing and an ocean parametrization we tune our model to reproduce observed frontal changes of JI during 1990-2014. In our simulations, most of the JI retreat during 1990-2014 is driven by the ocean...
Modelled glacier dynamics over the last quarter of a century at Jakobshavn Isbræ
DEFF Research Database (Denmark)
Muresan, Ioana Stefania; Khan, Shfaqat Abbas; Aschwanden, Andy
2016-01-01
Observations over the past 2 decades show substantial ice loss associated with the speed-up of marineterminating glaciers in Greenland. Here we use a regional three-dimensional outlet glacier model to simulate the behaviour of Jakobshavn Isbræ (JI) located in western Greenland. Our approach...... is to model and understand the recent behaviour of JI with a physical process-based model. Using atmospheric forcing and an ocean parametrization we tune our model to reproduce observed frontal changes of JI during 1990-2014. In our simulations, most of the JI retreat during 1990-2014 is driven by the ocean...... parametrization used and the glacier's subsequent response, which is largely governed by bed geometry. In general, the study shows significant progress in modelling the temporal variability of the flow at JI. Our results suggest that the overall variability in modelled horizontal velocities is a response...
Zarecka, Tatjana
2007-01-01
Diplomarba tēma ir „Didaktisko spēļu izmantošana apkārtnes mācību stundās skolēniem ar vidēji smagiem un smagiem garīgās attīstības traucējumiem”. Pētījuma mērķis: Diplomdarbā teoretiskajā daļā tiek apskatītās pedagoģiskās atziņas par didaktiskajām spēlēm: pedagogus F.Frēbeļa, M.Montesori, K.Ušinska, J.Tihejevas, A.Sorokinas, A.Bondarenko, O.Svenne, I.Kapostas darbu apskats; tiek analizēts terminu „spēle” un „rotaļa” salidzinājums; tiek apskatīta didaktisko spēļu klasifikācija; tiek a...
Schmutz, J.A.; Laing, K.K.
2002-01-01
Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling
Russian energy efficiency projects: lessons learnt from Activities Implemented Jointly pilot phase
International Nuclear Information System (INIS)
Korppoo, Anna
2005-01-01
Russia needs to improve the efficiency of energy. Failure to do so will retard the economic recovery of the country, but the energy sector is lacking both domestic and foreign investments. JI projects could provide the underfinanced Russian energy sector with additional investments. AIJ pilot project experiences provide an overview of the potential difficulties for future JI projects. Institutional problems were the most important category. Most of these problems remain, and the lack of ratification of the Kyoto Protocol by Russia has formed a new very significant barrier. Implementation level problems caused some problems to AIJ projects, but they are likely to have less impact on the better prepared JI projects. The character of funding-related problems has changed: for AIJ projects the main problem was that emission reductions could not be credited, whereas future JI projects will experience more competition in the Kyoto market where the overall investment climate and the availability of local cofunding are more relevant. Therefore, the unfinished economic and energy sector reforms currently discourage JI investments. The project experiences so far have been dismal, and if Russian policy-makers cannot improve this performance, only few JI projects can be expected in the future
Lifescience Database Archive (English)
Full Text Available n sp|Q96JI7|SPTCS_HUMAN Spatacsin OS=Homo sapiens Align length 47 Score (bit) 32.....................done Score E Sequences producing significant alignments: (bits) Value sp|Q96JI7|SPTCS_HUMAN Spatacsi...e transporter-like protein 3 OS=Bos t... 30 6.4 >sp|Q96JI7|SPTCS_HUMAN Spatacsin OS=Homo sapiens GN=SPG11 PE
The Climate for Joint Implementation. Case Studies from Russia, Ukraine, and Poland
Energy Technology Data Exchange (ETDEWEB)
Evans, M.; Legro, S.; Popov, I. [Pacific Northwest National Laboratory, Washington, DC (United States)
2000-07-01
Joint implementation (JI) can provide flexibility in meeting Kyoto Protocol commitments, and 44 nations have already participated in the UN. Framework Convention on Climate Change - Activities Implemented Jointly (AIJ) pilot. This paper surveys JI policy and projects in three countries - Russia, Ukraine, and Poland - over the past five years and examines the effects of domestic institutions, foreign policy, and investment trends on JI in each country. The institutional and economic situation in the three nations differs greatly, and these distinctions have resulted in very different circumstances for AIJ projects, affecting both their number and scope. Poland has a well-defined set of rules and procedures for JI and its economy is quite strong. Ukraine has not yet established criteria or clear procedures for AIJ project reviews although it does have an Interagency Commission on Climate Change. Ukraine's economy declined by over 40% in the 1990s. Russia's economy has also declined, to a lesser extent. Russia does have a procedure for reviewing AIJ projects, though it has temporarily halted these reviews. Countries seeking JI investment can take several steps to improve the number and quality of AIJ projects that they receive. In the long term, governments can create macroeconornic stability and a solid legal investment basis to attract investment for JI and other areas. In the short term, however, governments can undertake several simple and inexpensive steps to promote JI. Establishing clear rules and procedures for AIJ projects is an important step. So too are clearly delegating responsibility for AIJ project review and providing a single JI point of contact in the government to which investors and project developers can turn. Gaining more experience in implementing AIJ projects now is important preparation for fully implementing the Kyoto Protocol beginning in 2008. 28 refs.
Energy Technology Data Exchange (ETDEWEB)
La Rovere, E.L.
1998-11-01
This paper addresses, from the Brazilian perspective, the main problems with Joint Implementation/Activities Implemented Jointly (JI/AIJ) between industrialized (Annex I) and developing (non-Annex I) countries, as defined by the United Nations Framework Convention on Climate Change (UNFCCC). Four possible GHG emissions abatement measures are presented for Brazil: forest protection, reforestation projects for carbon sequestration or charcoal manufacturing, use of ethanol produced from sugar cane as a car fuel, and electrical energy conservation through an increase in end-use efficiencies. These four case studies form the basis of a discussion regarding the validity of developing countries' concerns about JI/AIJ. Recommendations are offered for overcoming the present shortcomings of JI/AIJ in developing countries. The primary conclusion is that Annex I countries' funding of JI/AIJ projects in developing countries in return for GHG emissions credits is not the best means to implement the UNFCCC. However, JI/AIJ projects can be a productive means of preventing global climate change if combined with other measures, including GHG emissions reduction targets for all countries involved in JI/AIJ projects and limits on the percentage of industrialized countries' emissions reductions that can be met through projects in developing countries.
Directory of Open Access Journals (Sweden)
He ZH
2017-10-01
Full Text Available Zhi-Hui He,1 Yan Chen,2 Ping Chen,2 Sheng-Dong He,2 Hui-Hui Zeng,2 Ji-Ru Ye,2 Da Liu,2 Jun Cao3 1Intensive Care Unit, 2Department of Respiratory Medicine, Second Xiangya Hospital, Central South University, Changsha, 3Department of Respiratory Medicine, Hunan Provincial People’s Hospital, Changsha, China Background: There is a growing realization that COPD, or at least emphysema, involves several processes presenting in aging and cellular senescence. Endothelial progenitor cells (EPCs contribute to neovascularization and play an important role in the development of COPD. The gene for p16Ink4a is a major dominant senescence one. The aim of the present study was to observe changes in lung function, histomorphology of lung tissue, and expression of p16Ink4a in lung tissue and bone marrow-derived EPCs in emphysematous mice induced by cigarette-smoke extract (CSE, and further to search for a potential candidate agent protecting against emphysema induced by CSE. Materials and methods: An animal emphysema model was induced by intraperitoneal injection of CSE. 5-Aza-2'-deoxycytidine (5-Aza-CdR was administered to the emphysematous mice. Lung function and histomorphology of lung tissue were measured. The p16Ink4a protein and mRNA in EPCs and lung tissues were detected using Western blotting and quantitative reverse-transcription polymerase chain reaction, respectively. Results: CSE induced emphysema with increased p16Ink4a expression in lung tissue and bone marrow-derived EPCs. 5-Aza-CdR partly protected against emphysema, especially in the lung-morphology profile, and partly protest against the overexpression of p16Ink4a in EPCs and lung tissue induced by CSE. Conclusion: 5-Aza-CdR partly protected against emphysema in mice via suppressing p16Ink4a expression in EPCs and lung tissue. Keywords: 5-Aza-2'-deoxycytidine, cigarette smoke, emphysema, endothelial progenitor cells, p16Ink4a
Directory of Open Access Journals (Sweden)
Li Xi-Ying
2013-02-01
postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n
Directory of Open Access Journals (Sweden)
Daisaku Shimada
2015-09-01
beneficiaries. This paper examines the multi-level management of a semi-natural grassland at Tarōji, in Soni village, in Nara prefecture. In Soni village, members of the local community provide key management input, while local government at the village and prefecture levels share management costs.
Kinnunen U; Mäkikangas A; Mauno S; De Cuyper N; De Witte H
2014-01-01
This 2-year longitudinal study among 848 university employees investigated the individual development of perceived job insecurity (JI) in the context of changes occurring in the Finnish universities during the follow-up time. Adopting a person-oriented approach through latent profile analysis, 8 classes of employees with similar mean levels and mean-level changes in JI were identified. Two of these classes (75% of the participants) indicated stable (low, moderately high) JI, and the remaining...
Directory of Open Access Journals (Sweden)
Tian Li
2016-01-01
Full Text Available In this study, three schemes [Yonsei University (YSU, Mellor-Yamada-Janjic (MYJ, and Bougeault-Lacarrère (Boulac] were employed in the Weather Research and Forecasting/Chemistry (WRF-Chem model to simulate the severe haze that occurred in February 2014 in the Jing-Jin-Ji region and its surroundings. The PM2.5 concentration simulated using the three schemes, together with the meteorological factors closely related to PM2.5 (wind speed, local vertical diffusivity, and PBL height, was evaluated through comparison with observations. The results indicated that the eastern plain cities produced better simulation results than the western cities, and the cities under the eastern root of Taihang Mountain produced the worst results in simulating high PM2.5 concentration in haze. All three schemes simulated very similar variation trends of the surface PM2.5 concentration compared with observations. The diurnal variations of simulated surface PM2.5 were not as reasonable as their reflection of daily averaged variation. The simulated concentrations of surface PM2.5 using the YSU, MYJ, and Boulac schemes all showed large negative errors during daytime in polluted days due to their inefficient descriptions of local atmospheric stability or diffusion processes in haze. The lower ability of PBL schemes in distinguishing the diffusion between haze and clean days in the complex topography areas in China is an important problem for PM2.5 forecasting, which is worthy of being studied in detail.
Raudbetoonist vaade / Sveta Grigorjeva
Grigorjeva, Sveta, 1988-
2016-01-01
Arvustus: Billeneeve. Sügis nagu lõppev suhe : [luuletused]. Saarde ; Pärnu : [Jumalikud Ilmutused], 2015. (Ji ; 75) ; Ühe aknaga maailm : [luuletused]. Saarde ; Pärnu : [Jumalikud Ilmutused], 2016. (Ji ; 80)
Joint implementation in energy between the EU and Russia Out look and potential
International Nuclear Information System (INIS)
Laroui, F.; Tellegen, E.; Tourilova, K.
2004-01-01
At the seventh Conference of Parties in Marrakech (COP 7) a consensus was reached on the rules, the modalities and the guidelines of the flexibility mechanisms of the Kyoto Protocol. In this paper we assess the outlook and potential of one of the flexibility mechanisms, viz. joint implementation (JI) between the European Union and Russia. We show that both parties have all the incentives to start working on JI and we assess the biggest obstacle for implementing JI
Park, Yang-Kyu; Lee, Chul-in; Kabst, Rüdiger
2008-01-01
While the literature on the determinants of organizational commitment (OC) and job involvement (JI) is vast, little has been studied about the impact of human needs. In search for the institutional stars, this study examines whether human needs can serve a predictor for both high OC and high JI. Exploratory empirical results based on quantile regressions suggest that the needs for achievement, belonging, and power are more important than others in predicting OC and JI. In addition, the basic ...
Making Judges Independent – Some Proposals Regarding the Judiciary
Lars P. Feld; Stefan Voigt
2004-01-01
It is argued that an independent judiciary is a necessary condition for both individual liberty and economic prosperity. After having surveyed the literature dealing with how to arrange for an independent judiciary, the authors derive some additional policy implications by drawing on two indicators of judicial independence (JI) recently introduced by them. De facto JI has a robust and highly significant impact on economic growth. Individual components of both de jure and de facto JI on econom...
Energy Technology Data Exchange (ETDEWEB)
NONE
1998-03-01
Research was made to promote Activities Implemented Jointly Japan Program. Joint Implementation (JI) is the methodology for preventing global climate changes by collaboration of countries. The countries take cooperative actions for reduction, absorption and fixation of greenhouse gases, and effectively distribute the reduction credits among relevant parties. This was decided in the first session of the Conference of Parties (COP) held in March, 1995. In COP3, Japan`s assigned reduction amount in 2008-2012 was determined as 6% of the emission level in 1990. The protocol defines JI between parties as dealings of emission reduction units, and JI between developing countries as clean development mechanism. The rules for a base line and credit distribution are necessary before full-scale implementation. Although JI is regarded as an important cost-effective project, it is important to decide where and how the JI projects should been promoted. The present state and issues of the primary approved project of Japan Program are arranged. In particular, various terms related to developing countries remain to be solved. 21 figs., 32 tabs.
China Report, Political, Sociological and Military Affairs, No. 445.
1983-08-11
2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681
Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics
1998-07-01
Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62
Studi Pemanfaatan Jantung Pisang dan Ikan Gabus dalam Pembuatan Nugget
Pratiwi, Lisma; ', Yusmarini; Harun, Noviar
2016-01-01
The purpose of research is to identify the ratio influence of the banana's heart and the gabus fish concerning the result of nugget quality and the best formulation in making process of the banana's heart and the gabus fish nugget. This research was carried out experimentally by using Completely Randomized Design consisting of 5 treatments with 3 replications. The treatments consist of JI1 = (banana's heart 10 : gabus fish 90), JI2 = (banana's heart 15 : gabus fish 85), JI3 = (banana's heart ...
... Benz EJ Jr, Silberstein LE, Heslop HE, Weitz JI, Anastasi J, eds. Hematology: Basic Principles and Practice . ... Benz EJ Jr, Silberstein LE, Heslop HE, Weitz JI, Anastasi J, eds. Hematology: Basic Principles and Practice . ...
... Benz EJ Jr, Silberstein LE, Heslop HE, Weitz JI, Anastasi J, eds. Hematology: Basic Principles and Practice . ... Benz EJ Jr, Silberstein LE, Heslop HE, Weitz JI, Anastasi J, eds. Hematology: Basic Principles and Practice . ...
Genetics Home Reference: IRAK-4 deficiency
... Blanco JC, Salkowski C, Zhang S, Arditi M, Gallin JI, Vogel SN. Distinct mutations in IRAK-4 confer ... Ghonaium A, Day-Good NK, Holland SM, Gallin JI, Chapel H, Speert DP, Rodriguez-Gallego C, Colino ...
Sudo, Kyoko; Kobayashi, Jun; Noda, Shinichiro; Fukuda, Yoshiharu; Takahashi, Kenzo
2018-03-18
Elderly care is an emerging global issue threatening both developed and developing countries. The elderly in Japan increased to 26.7% of the population in 2015, and Japan is classified as a super-aged society. In this article, we introduce the financial aspects of the medical care and welfare services policy for the elderly in Japan. Japan's universal health insurance coverage system has been in place since 1961. Long-term care includes welfare services, which were separated from the medical care insurance scheme in 2000 when Japan was already recognized as an aging society. Since then, the percentage of the population over 65 has increased dramatically, with the productive-age population on the decrease. The Japanese government, therefore, is seeking to implement "The Community-based Integrated Care System" with the aim of building comprehensive up-to-the-end-of-life support services in each community. The system has four proposed elements: self-help (Ji-jo), mutual aid (Go-jo), social solidarity care (Kyo-jo), and government care (Ko-jo). From the financial perspective, as the government struggles against the financial burdens of an aging population, they are considering self-help and mutual aid. Based on Japan's present situation, both elements could lead to positive results. The Japanese government must also entrust the responsibility for implementing preventive support to municipalities through strongly required regional autonomy. As Japan has resolved this new challenge through several discussions over a long period of time, other aging countries could learn from the Japanese experience of solving barriers to healthcare policy for the elderly.
Institute of Scientific and Technical Information of China (English)
陳智超
2010-01-01
Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.
Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai
2013-01-01
van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis
Joint implementation: methodology and policy considerations
International Nuclear Information System (INIS)
Illum, Klaus; Meyer, N.I.
2004-01-01
The focus of the present paper is on joint implementation (JI) projects between countries in Western and Eastern Europe and especially on the problems of constructing credible references (baselines). A number of the present EU countries are anticipated to have severe problems in meeting their greenhouse gas reduction commitments and they have already announced that they shall take advantage of JI in this connection. As stated in the Kyoto Protocol, JI emission reductions must be real and measurable. However, in most cases the reductions obtained by a JI project do not occur at the project site but elsewhere in the energy system. Therefore, when a number of JI projects are implemented concurrently and other changes in the energy system take place over time, there is no way to measure the reductions obtained by individual projects. Because the emission reduction obtained is a property of the entire energy system, it cannot be estimated a priori on the basis of a project baseline alone. A baseline must refer to the national energy system of which the project is a part. It is argued in this paper that baselines should be derived from national energy systems databases and models, which serve to ensure that JI projects effectively contribute to the fulfillment of the Kyoto Protocol objectives. In addition, they should provide governments with comprehensive energy information systems needed to address long-term climate mitigation and energy demand and supply issues in a rational, least-cost manner. Compared to other climate mitigation costs and the costs of failure to meet the Kyoto commitments the costs involved in the preparation of the databases needed and the implementation of systems analysis and documentation programs will be small. If these costs are carried by national governments, the investors in JI projects will benefit from lower transaction costs
Jiang, Lixin; Probst, Tahira M
2017-04-01
Despite the prevalence of income inequality in today's society, research on the implications of income inequality for organizational research is scant. This study takes the first step to explore the contextual role of national- and state- level income inequality as a moderator in the relationship between individual-level job insecurity (JI) and burnout. Drawing from conservation of resource (COR) theory, we argue that income inequality at the country-level and state-level threatens one's obtainment of object (i.e., material coping) and condition (i.e., nonmaterial coping) resources, thus serving as an environmental stressor exacerbating one's burnout reactions to JI. The predicted cross-level interaction effect of income inequality was tested in 2 studies. Study 1 consisting of 23,778 individuals nested in 30 countries explored the moderating effect of country-level income inequality on the relationship between individual JI and exhaustion. Study 2 collected data from 402 employees residing in 48 states in the United States, and tested the moderating effect of state-level income inequality on the relationship between JI and burnout (i.e., emotional exhaustion and cynicism). Results of both studies converge to support the exacerbating role of higher-level income inequality on the JI -burnout relationship. Our findings contribute to the literature on psychological health disparities by exploring the contextual role of income inequality as a predictor of differential reactions to JI. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Reference: 291 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen
Genetics Home Reference: 3-beta-hydroxysteroid dehydrogenase deficiency
... for This Page Lutfallah C, Wang W, Mason JI, Chang YT, Haider A, Rich B, Castro-Magana ... A, Copeland KC, Chang YT, Lutfallah C, Mason JI. Carriers for type II 3beta-hydroxysteroid dehydrogenase (HSD3B2) ...
Joint implementation along two ways
International Nuclear Information System (INIS)
De Vos, R.
1997-01-01
In the test phase to the year 2000 joint implementation (JI) must prove to be a valuable tool for the climate change policy. The Dutch Ministries of Housing, Planning and Environmental Protection (VROM) and Economic Affairs (EZ) would like to form a basis for a JI-protocol during the Climate Conference in Kyoto, Japan, which will be held at the end of 1997. However, the Ministry of Development Cooperation wants to follow a more careful approach towards the cooperation with developing countries. Special attention is paid to a JI-project in Romania
Directory of Open Access Journals (Sweden)
Ni Q
2016-08-01
Full Text Available Qiang Ni, Wurong Chen, Lei Tong, Jue Cao, Chao Ji Department of Anesthesiology, Putuo Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, People’s Republic of China Abstract: In this study, ropivacaine chitosan-loaded microspheres for subcutaneous administration were developed. The systems were characterized in terms of surface morphology, particle size, encapsulation efficiency, and in vitro release behavior. Results showed that the microspheres had drug loading rate of 7.3% and encapsulation efficiency of 91.2%, and their average diameter was 2.62±0.76 µm. The morphology study revealed that the microspheres are uniform monodispersed spheres and did not form aggregates in aqueous solution. It was clearly observed that the release profile of ropivacaine microspheres exhibited a biphasic pattern: the initial burst release within the first 2 hours and a following slower and sustained release over a long time. In vivo, a greater area under the plasma concentration–time curve from 0 to t (AUC0–t was obtained from the microspheres (4.27-fold, than from the injection group, which indicated that there was a significantly improved systemic exposure to ropivacaine. Pharmacodynamics result showed that preparing ropivacaine as microsphere preparation could not only extend the drug effect time but also decrease the administration dosage. Keywords: ropivacaine, chitosan, microspheres, in vitro release, pharmacodynamics
DEFF Research Database (Denmark)
Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.
2014-01-01
(H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...
U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...
Directory of Open Access Journals (Sweden)
Gilvânia Lúcia de Oliveira Carvalho
2014-06-01
Full Text Available Os atributos geográficos relacionados à localização dos rebanhos e seus indicadores de qualidade do leite podem ser explorados em termos geoestatísticos para análise e identificação de áreas (territórios com características geográficas semelhantes e providas de correlação espacial para variáveis de interesse. O objetivo do presente estudo foi analisar a viabilidade da análise espacial para avaliação de indicadores de qualidade do leite. O trabalho foi desenvolvido com informações sobre as coordenadas geográficas, teores de gordura, proteína, lactose, contagem de células somáticas (CCS e contagem total de bactérias (CTB de 217 rebanhos localizados no Estado de Rondônia. A área de estudo foi de 25.088,40 km2, localizada na microrregião de Ji-Paraná. A dependência espacial para os indicadores de qualidade do leite foi avaliada por meio de semivariogramas. Havendo dependência espacial, estimaram-se valores do indicador em estudo para os locais não amostrados dentro do espaço, sem tendenciosidade e com variância mínima, pelo método denominado Krigagem, para interpolação de dados. Os resultados mostraram que houve dependência espacial para a gordura, lactose, estrato seco desengordurado (ESD, contagem de células somáticas (CCS e contagem total de bactérias (CTB. Foi observada uma dependência espacial fraca para gordura e ESD. Entretanto, foi identificada uma dependência espacial moderada para lactose, CCS e CTB. Sugere-se que a dependência espacial fraca e moderada encontrada no estudo foi devido ao número de fazendas incluídas no estudo até o momento. Os mapas gerados no estudo mostraram as áreas com valores diferenciados para os indicadores de qualidade do leite. A análise espacial dos indicadores de qualidade do leite mostrou ser uma ferramenta viável para avaliar a variação dos componentes do leite, CCS e CTB entre áreas de uma mesma região. As informações geradas por meio de mapas de
Directory of Open Access Journals (Sweden)
Wang Y
2015-11-01
Full Text Available Ying Wang,1,* Jin Yang,1,* Hui Liu,1 Ji-Rui Bi,1 Ying Liu,2 Yan-Yan Chen,2 Ji-Yu Cao,2 You-Jin Lu1 1Department of Respiratory Medicine, the Second Affiliated Hospital of Anhui Medical University, 2Department of Occupational Health and Environmental Health, School of Public Health, Anhui Medical University, Hefei, People’s Republic of China *These authors contributed equally to this work Abstract: In the last decade, osteopontin (OPN was identified as one of the important proteins that promote the metastasis of tumor. However, the association between OPN overexpression and clinical outcome of non-small-cell lung cancer (NSCLC was unclear. The purpose of this study is to investigate the role of OPN in NSCLC patients. A total of 13 studies are included to explore the relationship between the OPN elevation and the overall survival (OS and disease-free survival (DFS in NSCLC patients. We searched for related articles in PubMed, Web of Science, Google Scholar, and Cochrane Library databases, which were published before January 31, 2015. Hazard ratio (HR, odds ratio (OR, and 95% confidence interval (CI in the high OPN expression group compared with the low OPN expression group were calculated and analyzed. Primary results were summarized by using a fixed-effects model or a random-effects model. The stratified analyses in subgroups were also performed. Thirteen cohort studies, which involved 1,630 patients, were included. Subgroup analyses were performed by area and test method of OPN. We found that OPN was significantly associated with poor OS (HR =2.20, 95% CI 1.71–2.83, P<0.001 and DFS (HR =2.11, 95% CI 1.62–2.74, P<0.001 in NSCLC patients. OPN overexpression tended to be associated with the presence of advanced tumor TNM stage (III and IV (OR =2.57, 95% CI 1.61–4.11, P<0.001. The Egger’s test suggested that there was no publication bias in OS studies (P=0.062 and DFS studies (P=0.740. These data indicate that OPN seems to have a
Simultaneous estimation of QTL parameters for mapping multiple traits
Indian Academy of Sciences (India)
LIANG TONG
2018-03-13
XM ji ) denotes the conditional probability of the QTL genotype. X. ∗ ji (QiQi, Qiqi or ... random error of the ith trait value of the jth subject, with mean zero and ..... to adjust the conditional probabilities in table 1 when conducting ...
Indian Academy of Sciences (India)
Zeiger and Pratt 1973). Ji-X, X. A.E. (11). 3.1 Transfer integrals and covalency parameter. Using equation (8) Srivastava et al w (1979) have obtained the values of the transfer. Integrals from the experimental valu of Ji given in table 1.
A Framework for the Assessment of the Global Potential of Joint Implementation
Bollen JC; Minnen JG van; Toet AMC; Bennis M; Kuik OJ; MTV; VUA/IVM
1995-01-01
Joint Implementation (JI) is een instrument om op goedkopere wijze de mondiale CO2 uitstoot te verminderen. Het mondiale potentieel voor JI is gedefinieerd als de fractie van de noodzakelijke vermindering van regionale CO2 uitstoot om de uitstootdoelstelling in een bepaald zichtjaar te bereiken,
DsRed gene expression by doxycycline in porcine fibroblasts and ...
African Journals Online (AJOL)
DsRed gene expression by doxycycline in porcine fibroblasts and cloned embryos using transposon. SuJin Kim, JoonHo Moon, BegoRoibas da Torre, Islam M Saadeldin, JungTaek Kang, JiYei Choi, SolJi Park, Byeong-Chun Lee, Goo Jang Goo Jang ...
Domestic climate regimes and incentives for private sector involvement in joint implementation
Energy Technology Data Exchange (ETDEWEB)
NONE
1997-12-31
This report analyses how effective incentive structures can be put in place for private sector involvement in pilot projects (AIJ, Activities Implemented Jointly) and, in due time, joint implementation (JI). Due to the short time record of AIJ/JI experience, lessons are drawn from other related policy areas: studies of public/private interface in environmental- and climate policy in the Netherlands, USA, Norway and Costa Rica. The report concludes with status and prospects for private sector incentives in the pilot phase and then provides lessons and proposals for such incentives in a more mature and ambitious JI regime with crediting. 22 refs.
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-03-01
The paper conducted the demonstration of the multiplier effect of 'the model project for heightening of the international energy consumption efficiency, etc.' carried out by NEDO and its subsidiary project, 'the project on the basic survey for promotion of Joint Implementation (JI),' and the comparative study between these projects and the JI/CDM projects proposed in the world. In the quantitative evaluation of the multiplier effect, in the case of making the demonstration of the same technology in the same area both in the model project and the basic survey for promotion of JI, it becomes possible to grasp the CO2 reduction effect with high accuracy, but the CO2 reducible amount is small. Inversely, as to the technology for which the basic survey for promotion of JI is studied, but the model project is not carried out, it becomes possible to grasp the CO2 reduction effect with low accuracy, the CO2 reducible amount is large. In the comparison with the JI/CDM projects proposed in the world, the CO2 reduction amount was approximately $2.7 billion, 250 million tons, in the UNFCCC project, and approximately $5.0 billion, 500 million tons, in the IJ project. There was no very big difference in the cost effect. (NEDO)
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-03-01
The paper conducted the demonstration of the multiplier effect of 'the model project for heightening of the international energy consumption efficiency, etc.' carried out by NEDO and its subsidiary project, 'the project on the basic survey for promotion of Joint Implementation (JI),' and the comparative study between these projects and the JI/CDM projects proposed in the world. In the quantitative evaluation of the multiplier effect, in the case of making the demonstration of the same technology in the same area both in the model project and the basic survey for promotion of JI, it becomes possible to grasp the CO2 reduction effect with high accuracy, but the CO2 reducible amount is small. Inversely, as to the technology for which the basic survey for promotion of JI is studied, but the model project is not carried out, it becomes possible to grasp the CO2 reduction effect with low accuracy, the CO2 reducible amount is large. In the comparison with the JI/CDM projects proposed in the world, the CO2 reduction amount was approximately $2.7 billion, 250 million tons, in the UNFCCC project, and approximately $5.0 billion, 500 million tons, in the IJ project. There was no very big difference in the cost effect. (NEDO)
The Militia of Jin-Cha-Ji Border Area in the Anti-Japanese War Period%抗战时期晋察冀边区的民兵
Institute of Scientific and Technical Information of China (English)
栾盈菊
2013-01-01
晋察冀民兵是在共产党的动员和领导下建立和壮大起来的不脱离生产的群众武装。民兵的任务是进行游击战、配合部队作战和担任抗战勤务。民兵的军事战术有麻雀战、地雷战、地道战、扭击战和伏击战等。在民兵队伍中,由于有党的政治动员、党员的带头作用、有组织的军事政治教育和组织的民主性等原因,民兵成为打败日寇的重要力量,同时民兵也是主力军与游击队的助手,是主力军的重要兵源。%The militia of Jin-Cha-Ji border area was the armed masses without departing from the pro-duction,which was established and grew under the leadership of the Party.Its mission was to carry outguerrilla warfare,cooperate with the troops and act as war service.It had many tactics,such as sparrowwarfare,mine warfare,tunnel warfare,torsional warfare and ambush operation.Due to the Party’s politi-cal mobilization and the Party members’leading role,with organized military and political education anddemocratic nature of the organization,the militia was not only an important force to beat the Japanese,butalso assistant of the main force and the guerrillas,and the important sources for the recruits of the mainforce troops.
Bērnu mārketinga attīstība Latvijas lielāko pārtikas produktu ražotāju tirgus darbībās
Lūse, Ieva
2010-01-01
Uzņēmumi visā pasaulē arvien vairāk sāka apzināties bērnu potenciālu tirgū un aktivizē savu komunikāciju ar bērnu auditoriju. Bērni vienlaicīgi tirgū pilda vairākas lomas kā patērētāji, iniciatori, ietekmētāji un lēmēji par pirkumu un pircēji šodien un nākotnē, kļūstot par daudzu uzņēmumu produkcijas pamata patērētājiem. Ņemot vērā tēmas aktualitāti autore par maģistra darba mērķi izvirza apzināt un analizēt lielāko Latvijas pārtikas produktu ražotāju aktivitāti bērnu mārketing...
Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China
Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min
2018-01-01
Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422
Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae
Directory of Open Access Journals (Sweden)
Mingqiang Wang
2017-12-01
Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.
Matson, D. L.; Ransford, G. A.; Johnson, T. V.
1981-01-01
The existing ground-based measurements of Io's thermal emission at infrared wavelengths of 8.4, 10.6, and 21 microns have been reexamined. Present in these data is the signature of hot spots, presumably similar to the hot spots seen by the IRIS experiment on Voyager. It is possible to extract from these data the total amount of power radiated. Since the hot spots are believed to be a result of deep-seated activity in Io and since the remainder of Io's surface is an extraordinarily poor thermal conductor, the power radiated by the hot spots is essentially the total heat flow. The analysis yields a heat flow of 2 + or - 1 W/sq m. This value is tremendously large in comparison to the average heat flow of the earth (0.06 W/sq m) and the moon (0.02 W/sq m), but is characteristic of active geothermal areas on the earth. A heat flow this large requires that the interior of Io be at least partially molten on a global scale.
Mexico joins the venture: Joint Implementation and Greenhouse Gas Emissions
Energy Technology Data Exchange (ETDEWEB)
Imaz, M.; Gay, C.; Friedmann, R.; Goldberg, B.
1998-11-01
Joint Implementation (JI) and its pilot phase of Activities Implemented Jointly (AIJ) are envisioned as an economic way of reducing global emissions of greenhouse gases. This paper draws upon the Mexican experience with AIJ to identify Mexican concerns with AIJ/JI and proposed solutions to these. Three approved Mexican AIJ projects (Ilumex, Scolel Te, and Salicornia) are described in detail. The Ilurnex project promotes the use of compact fluorescent lamps in Mexican homes of the States of Jalisco and Nuevo Leon, to reduce electric demand. Scolel Te is a sustainable forest management project in Chiapas. Salicornia examines the potential for carbon sequestration with a Halophyte-based crop irrigated with saline waters in Sonora. These three projects are reviewed to clarify the issues and concerns that Mexico has with AIJ and JI and propose measures to deal with them. These initial Mexican AIJ projects show that there is a need for creation of standard project evaluation procedures, and criteria and institutions to oversee project design, selection, and implementation. Further JI development will be facilitated by national and international clarification of key issues such as additionality criteria, carbon-credit sharing, and valuation of non-GHG environmental and/or social benefits and impacts for AIJ projects. Mexico is concerned that JI funding could negatively impact official development assistance or that OECD countries will use JI to avoid taking significant GHG mitigation actions in their own countries. The lack of carbon credit trading in the AIJ stage must be removed to provide useful experience on how to share carbon credits. National or international guidelines are needed to ensure that a portion of the carbon credits is allocated to Mexico.
International Nuclear Information System (INIS)
Shishlov, Igor; Bellassen, Valentin; Leguet, Benoit
2012-01-01
Among the publications of CDC Climat Research, 'Climate Reports' offer in-depth analyses on a given subject. This issue addresses the following points: Based on specific projects rather than economy-wide emissions reductions, and driven by the demand from the installations covered by the European Union Emissions Trading Scheme (EU ETS), Joint Implementation (JI) turned out to be a largely private sector mechanism. Besides attracting private investors in GHG abatement projects, JI creates an opportunity for countries to exploit the arbitrage price spread between different carbon offsets: Emission Reduction Units (ERU), the credits issued from JI projects, trade with a premium of up to 50% over Assigned Amount Units (AAU), the country-level carbon allowances. Some countries, like for instance Ukraine, quickly realized the added value of JI and boosted its development, while in others, like Russia, JI lacked political support and efficient frameworks took time to be established. According to the ERU supply forecasting model developed by CDC Climat Research, Annex I countries are expected to generate up to 356 million ERUs for the first Kyoto commitment period. Around 80% of these credits shall originate from Russia and Ukraine, and up to 70 million shall be generated from countries participating in the EU ETS. Within the EU, JI has been used as a 'frontier mechanism': JI projects mostly explored abatement opportunities not covered by the scheme and, as highlighted by the case of nitrous oxide emissions from the production of nitric acid, played an important role in identifying abatement technologies and providing information to extend the scope of the EU ETS. One of the most complex issues related to JI is the practice of additionality. The cases of France and Ukraine demonstrate that the stakes associated with additionality may differ depending on a country's compliance position. In Ukraine, additionality was not perceived as a significant economic risk due to a
Radio-sensitizing effect of ethyl caffeate on nasopharyngeal ...
African Journals Online (AJOL)
3Department of Clinical Laboratory, The 5th People's Hospital of Ji'nan, Ji'nan ... Purpose: To investigate the radio-sensitizing effect of ethyl caffeate (ETF) on naso-pharyngeal ... malignant solid tumors of head and neck which ... Excess irradiation could result in severe side .... protein bands were probed with corresponding.
Inoue, Akiomi; Kawakami, Norito; Eguchi, Hisashi; Tsutsumi, Akizumi
2018-05-01
We examined the interaction effect of job insecurity (JI) and role ambiguity (RA) on psychological distress in Japanese employees. Overall, 2184 male and 805 female employees from two factories of a manufacturing company in Japan completed a self-administered questionnaire comprising the scales measuring JI (Job Content Questionnaire), RA (National Institute for Occupational Safety and Health Generic Job Stress Questionnaire), psychological distress (K6 scale), and potential confounders (i.e., age, education, family size, occupational class, and work shift). Taking psychological distress as a dependent variable, hierarchical multiple regression analyses were conducted by gender and employment status (i.e., permanent and non-permanent employees). An interaction term of JI × RA was included in the model. After adjusting for potential confounders, the main effects of JI and RA on psychological distress were significant regardless of gender or employment status. Furthermore, the significant interaction effect of JI × RA on psychological distress was observed among permanent male employees (β = 0.053, p = 0.010). Post hoc simple slope analyses showed that the simple slope of JI was greater at higher levels of RA (i.e., one standard deviation [SD] above the mean) (β = 0.300, p female employees. The present study suggests that higher levels of RA strengthen the association of JI with psychological distress, at least among Japanese permanent male employees.
Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)
African Journals Online (AJOL)
Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.
Construction of full-length cDNA library of white flower Salvia ...
African Journals Online (AJOL)
STORAGESEVER
2009-05-18
May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Chemical Sciences. HARI JI SINGH. Articles written in Journal of Chemical Sciences. Volume 123 Issue 5 September 2011 pp 733-741. Computational study on decomposition kinetics of CH3CFClO radical · Hari Ji Singh Bhupesh Kumar Mishra · More Details Abstract Fulltext PDF. The present ...
Wang, Mei-Ling; Chang, Shu-Chen
2016-06-01
Healthcare is a profession that requires a high level of emotional labor (EL). Nurses provide frontline services in hospitals and thus typically experience high levels of EL. The quality of services that nurses provide impacts on how patients evaluate the service quality of hospitals. The aim of this study is to explore the relationships among EL, job involvement (JI), and customer-oriented behavior (COB) in the context of the nursing profession. The participants in this study were nurses at eight hospitals, all located in Taiwan. This study used a self-reporting questionnaire. Research data were gathered at two discrete periods (A and B). Questionnaire A collected data on EL and JI, and Questionnaire B collected data on COB. Five hundred questionnaires were sent out to qualified participants, and 472 valid questionnaires were returned. Hierarchical regression analysis was used to test the hypotheses. The expression of positive emotion (EPE) and the suppression of negative emotion (SNE) were found to positively affect the patient-oriented COB. Furthermore, the EPE was found to positively affect the task-oriented COB. In terms of the moderating effect of JI, JI was found to relate positively to the EPE, patient-oriented COB, and task-oriented COB. In addition, higher values of JI were found to weaken the relationship between the SNE and the task-oriented COB. It has become an increasingly popular practice for hospital organizations to work to promote the COB of their nursing staffs. The results of this study prove empirically that a relationship exists among EL, COB, and JI in nurses. This study contributes to the related literature, enhances the knowledge of hospital and nursing administrators with regard to EL and COB, and offers a reference for hospital managers who are responsible for designing and executing multidisciplinary programs and for managing hospital-based human resources.
Carbon Taxes and Joint Implementation. An Applied General Equilibrium Analysis for Germany and India
Energy Technology Data Exchange (ETDEWEB)
Boehringer, C.; Loeschel, A. [Centre for European Economic Research ZEW, Mannheim (Germany); Conrad, K. [Department of Economics, Mannheim University, Mannheim (Germany)
2003-01-01
Germany has committed itself to reducing its carbon emissions by 25% in 2005 as compared to 1990 emission levels. To achieve this goal, the government has recently launched an environmental tax reform which entails a continuous increase in energy taxes in conjunction with a revenue-neutral cut in non-wage labor costs. This policy is supposed to yield a double dividend, reducing both, the problem of global warming and high unemployment rates. In addition to domestic actions, international treaties on climate protection allow for the supplementary use of flexible instruments to exploit cheaper emission reduction possibilities elsewhere. One concrete option for Germany would be to enter joint implementation (JI) with developing countries such as India where Germany pays emission reduction abroad rather than meeting its reduction target solely by domestic action. In this paper, we investigate whether an environmental tax reform cum JI provides employment and overall efficiency gains as compared to an environmental tax reform stand-alone. We address this question in the framework of a large-scale general equilibrium model for Germany and India where Germany may undertake JI with the Indian electricity sector. Our main finding is that JI offsets largely the adverse effects of carbon emission constraints on the German economy. JI significantly lowers the level of carbon taxes and thus reduces the total costs of abatement as well as negative effects on labor demand. In addition, JI triggers direct investment demand for energy efficient power plants produced in Germany. This provides positive employment effects and additional income for Germany. For India, joint implementation equips its electricity industry with scarce capital goods leading to a more efficient power production with lower electricity prices for the economy and substantial welfare gains.
Sayer, Ryan; Marshman, Emily; Singh, Chandralekha
2016-01-01
Just-in-Time Teaching (JiTT) is an instructional strategy involving feedback from students on prelecture activities in order to design in-class activities to build on the continuing feedback from students. We investigate the effectiveness of a JiTT approach, which included in-class concept tests using clickers in an upper-division quantum…
Adopting Just-in-Time Teaching in the Context of an Elementary Science Education Methodology Course
Osmond, Pamela; Goodnough, Karen
2011-01-01
In this self-study, Pamela, a new science teacher educator, adopted Just-in-Time Teaching (JiTT) in the context of an elementary science education methodology course. JiTT is a teaching and learning strategy involving interaction between web-based study assignments and face-to-face class sessions. Students respond electronically to web-based…
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.
The interactive learning toolkit: technology and the classroom
Lukoff, Brian; Tucker, Laura
2011-04-01
Peer Instruction (PI) and Just-in-Time-Teaching (JiTT) have been shown to increase both students' conceptual understanding and problem-solving skills. However, the time investment for the instructor to prepare appropriate conceptual questions and manage student JiTT responses is one of the main implementation hurdles. To overcome this we have developed the Interactive Learning Toolkit (ILT), a course management system specifically designed to support PI and JiTT. We are working to integrate the ILT with a fully interactive classroom system where students can use their laptops and smartphones to respond to ConcepTests in class. The goal is to use technology to engage students in conceptual thinking both in and out of the classroom.
Czech Academy of Sciences Publication Activity Database
Koller, M.; Chráska, Tomáš; Cinert, Jakub; Heczko, Oleg; Kopeček, Jaromír; Landa, Michal; Mušálek, Radek; Rameš, Michal; Seiner, Hanuš; Stráský, J.; Janeček, M.
2017-01-01
Roč. 126, July (2017), s. 351-357 ISSN 0264-1275 R&D Projects: GA ČR GB14-36566G Institutional support: RVO:61389021 ; RVO:68378271 ; RVO:61388998 Keywords : Metal–metal composites * Spark plasma sintering * Light metals * Ferromagnetic alloys * Mechanical properties Subject RIV: JI - Composite Materials; JI - Composite Materials (FZU-D); JI - Composite Materials (UT-L) OBOR OECD: Composites (including laminates, reinforced plastics, cermets, combined natural and synthetic fibre fabrics; Composites (including laminates, reinforced plastics, cermets, combined natural and synthetic fibre fabrics (FZU-D); Composites (including laminates, reinforced plastics, cermets, combined natural and synthetic fibre fabrics (UT-L) Impact factor: 4.364, year: 2016 https://www.sciencedirect.com/science/ article /pii/S0264127517303842?via%3Dih
Novak, Gregor M.
2011-01-01
This chapter provides an overview and implementation guidelines of Just-in-Time Teaching (JiTT), an interactive engagement pedagogy used across disciplines and across the academy, now in its fourteenth year. The heart of JiTT pedagogy is Web-based pre-instruction assignments called warm-ups, with some colorful local variations, such as GeoBytes in…
QTL analysis of kernel soluble sugar content in supersweet corn | Qi ...
African Journals Online (AJOL)
sweet corn population consisting of 208 F2 individuals from the cross Ji557 (sh2) × Ji165 (sh2). Density of the linkage groups varied from 2.2 cM to 65.3 cM, with an average of 13.0 2 cM between two adjacent markers. The map covered 1470.9 cM ...
African Journals Online (AJOL)
Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...
Energy Technology Data Exchange (ETDEWEB)
Trieb, F.; Nitsch, J.; Fischedick, M.; Luhmann, H.J.
1997-12-31
The term ``Joint implementation`` (JI) describes an international manageable tool to reduce the global emission of greenhouse gases, especially carbondioxide (CO{sub 2}). The principle idea of JI is based on the insight that it is of no importance where on earth CO{sub 2} is emitted or conserved. Hence it is only recommendable from the economic point of view to make investments at those locations where the highest conservation can be achieved by an equal use of capital. JI would help industrial countries to fulfil cost-effectively part of their obligation to reduce CO{sub 2} by higher investments in other countries (e.g. for the improvement of energy efficiency). Solar power plants meet all criteria of a successful JI-project approach and show several positive ecological and socio-economic side effects, which can lead in the medium term to environmentally friendly and economic electricity supply. One precondition is that the phase of market introduction will be soon followed by a phase of mass production which fully uses the present potential of this technology to reduce costs by approx. 50 %. The project THESUS on Crete is an important step towards market introduction and shows the importance of solar thermal power plants for climate protection. Above all it is an important European step towards a long-term energy supply. (orig./AKF) [Deutsch] Der Begriff `Joint Implementation` (JI) beinhaltet ein international handhabbares Instrumentarium zur Minderung des globalen Ausstosses von Treibhausgasen, insbesondere des Kohlendioxids (CO{sub 2}). Die Grundidee von JI beruht auf der Erkenntnis, dass es ohne Belang ist, an welcher Stelle der Erdoberflaeche CO{sub 2} emitiert oder eingespart wird. Aus oekonomischer Sichtweise liegt es daher nahe, Investitionen dort vorzunehmen, wo bei gleichem Kapitaleinsatz die groessten Einsparungen erzielt werden koennen. Mit JI koennten die Industrielaender einen Teil ihrer Verpflichtungen zur CO{sub 2}-Minderung durch verstaerkte
Ji, Y; Jin, H H; Wang, M D; Cao, W X; Bao, J L
2016-10-07
The retracted article is: Ji Y, Jin HH, Wang MD, Cao WX, et al. (2016). Methylation of the RASSFIA promoter in breast cancer. Genet. Mol. Res. 15: gmr.15028261. There are significant parts of this article (particularly, in the discussion section) that are copied from "Methylation of HIN-1, RASSF1A, RIL and CDH13 in breast cancer is associated with clinical characteristics, but only RASSF1A methylation is associated with outcome", by Jia Xu, Priya B Shetty, Weiwei Feng, Carol Chenault, Robert C Bast Jr, Jean-Pierre J Issa, Susan G Hilsenbeck and Yinhua Yu, published in BMC Cancer 2012; 12: 243. DOI: 10.1186/1471-2407-12-243. The first paragraphs of both discussions are identical. This is concerning. The abstract and introduction sections have much of their text plagiarized. Overall, there is high plagiarism detected. The GMR editorial staff was alerted and after a thorough investigation, we have strong reason to believe that the peer review process was failure and, after review and contacting the authors, the editors of Genetics and Molecular Research decided to retract the article in accordance with the recommendations of the Committee on Publication Ethics (COPE). The authors and their institutions were advised of this serious breach of ethics.
Directory of Open Access Journals (Sweden)
Zhilin Chen
2017-02-01
Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.
Reference: 418 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua
Simulation of HEAO 3 Background
2007-01-01
i i o iipp i i o iinn VdE A NaEEf VdE A NaEEfprod ji ji j R where i is a stable isotope in volume V, ai is its fractional abundance, i the...National Nuclear Data Center (NNDC), Brookhaven National Laboratory, Brookhaven, NY. [10] W. Nelson et al., ”The EGS4 code system ”, SLAC-Report-265
Wang, Zheng-Shan; Zhang, Qi-Cheng
2013-07-01
In the Wu xing da yi (The Gist of Five Phases), written by Xiao Ji of the Sui Dynasty, there were 9 quotations cited from Huang di nei jing (Inner Canon of Huangdi). By comparison with current version of Huang di nei jing, most of the descriptions are similar, yet still with some differences, such as yin-yang nature of the five zang visceras, the liver being the root of "pi ji", the spleen being the root of "cang lin" etc. Wu xing da yi epitomizes the books about yin-yang and five phases before the Sui Dynasty, while Xiao Ji's quotations from Huang di nei jing interpreted from the views of yin-yang and five phases, are different from the annotations of later ages.
Emission projections 2008-2012 versus national allocation plans II
International Nuclear Information System (INIS)
Neuhoff, Karsten; Ferrario, Federico; Grubb, Michael; Gabel, Etienne; Keats, Kim
2006-01-01
We compare the national allocation plans (NAPs), proposed and submitted by EU Member States as of October 2006, with our estimations for CO 2 emissions by the installations covered by these NAPs. The collective allocations proposed under phase II NAPs exceed the historic trend of emissions extrapolated forward. Using our projections we find, depending on uncertainty in fuel prices, economic growth rates, performance of the non-power sector and CDM/JI availability, a 15% chance of a 'dead market' with emissions below cap even at zero prices. With an expected inflow of committed CDM/JI credits of 100 MtCO 2 /year, allowance supply will exceed demand in 50% of cases without any carbon price, and in 80% of our euros20/tCO 2 scenarios. Banking of allowances towards post-2012 conditions could create additional demand, but this is difficult to anticipate and conditional on policy evolution. The proposed phase II NAPs would result in low prices and only small volumes of CDM/JI would enter the EU ETS. CDM/JI would almost exclusively be public-sector funded, placing the cost of Kyoto compliance entirely upon governments. (Author)
Indian Academy of Sciences (India)
Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...
Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...
African Journals Online (AJOL)
Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.
Project-Based Emissions Trading. The Impact of Institutional Arrangements on Cost-Effectiveness
International Nuclear Information System (INIS)
Woerdman, E.; Van der Gaast, W.
2001-01-01
In this paper we demonstrate that the institutional arrangement (or: design) of Joint Implementation (JI) and the Clean Development Mechanism (CDM) has a decisive impact on their cost-effectiveness. We illustrate our arguments by statistically analyzing the costs from 94 Activities Implemented Jointly (AIJ) pilot phase projects as well as by adjusting these data on the basis of simple mathematical formulas. These calculations explicitly take into account the institutional differences between JI (sinks, no banking) and the CDM (banking, no sinks) under the Kyoto Protocol and also show the possible effects on credit costs of alternative design options. However, our numerical illustrations should be viewed with caution, because AIJ is only to a limited extent representative of potential future JI and CDM projects and because credit costs are not credit prices. Some of the main figures found in this study are: an average cost figure per unit of emission reduction for AIJ projects of 46 dollar per ton of carbon dioxide equivalent ($/Mg CO 2 -eq), an average potential JI credit cost figure which is lowered to 37 $/Mg CO 2 -eq by introducing banking and an average of 6 $/Mg CO 2 -eq per credit for potential low-cost CDM projects which includes sinks. However, at CoP6 in November 2000 in The Hague (The Netherlands), the Parties to the Framework Convention on Climate Change (FCCC) did not (yet) reach consensus on the institutional details of the project-based mechanisms, such as the possible arrangement of early JI action or the inclusion of sinks under the CDM. 55 refs
Liu, Chaohui; Zhao, Guochun; Liu, Fulai; Cai, Jia
2018-04-01
The Wuhe complex is located at the southeastern margin of the North China Craton. The complex consists of metamorphosed Paleoproterozoic potassic granitoids and supracrustal rocks, of which the latter include the Fengyang and Wuhe groups. Meta-mafic rocks from the lower Wuhe Group have igneous zircon U-Pb ages of 2126 ± 37 Ma with εHf(t) values of -6.22 to +8.38, and xenocrystic zircons of 2.39-2.36 Ga, 2.55-2.54 Ga and 2.77-2.69 Ga. Geochemically, the meta-mafic rocks can be classified into two groups. Group 1 island arc tholeiites display flat to slightly right declined REE patterns and moderately negative Nb, Ta, Zr, and Ti anomalies. Group 2 mature arc calcalkaline basalts display strongly fractionated chondrite-normalized REE patterns and evidently negative Nb, Ta and Ti anomalies. These meta-mafic rocks formed by partial melting of sub-arc depleted mantle wedge which had been modified by slab-derived melts at an active continental margin. Depositional age of the group can be constrained in the period of 2.16-2.10 Ga based on ages of the youngest detrital zircons and latter intrusions. U-Pb ages of detrital zircons yield major age peaks of 2.69 Ga and 2.52 Ga, with minor peaks at 2.88 Ga, 2.78 Ga, 2.35 Ga and 2.17 Ga, most of which are derived from the late Mesoarchean to early Paleoproterozoic granitoids in the Wuhe complex and the Jiaodong Terrane. Metamorphic zircons in the marbles coexisting with garnet amphibolites or granulites occur as either single grains or overgrowth (or recrystallization) rims surrounding magmatic zircon cores and yield ages of 1882 ± 19 Ma to 1844 ± 15 Ma. The comparable ca. 2.1 Ga potassic granites with A-type granite affinity, the ca. 2.1 Ga meta-mafic rocks with arc-like geochemical features, the 2.1-1.9 Ga meta-sedimentary units and the 1.9-1.8 Ga subduction- and collision-related granulite-facies metamorphism suggest that the Wuhe complex and the Jiao-Liao-Ji Belt share the same late Paleoproterozoic tectonic evolution
Energy Technology Data Exchange (ETDEWEB)
Platonova, A
2005-02-01
This PhD thesis evaluates the perspectives of the oil and gas investment projects in the frame of the Joint Implementation mechanism in Russia. From the energy point of view, the relationships between climate policy and energy systems are described and the main sources of GHG emissions reductions in the Russian oil and gas sector are evaluated. From the environmental point of view, the JI is firstly considered as an economic instrument of the international climate agreements. Secondly, are demonstrated the characteristics of the JI perturbing his efficiency and his capacity to ensure the environmental quality of projects. Based on the specificities of Russian climate policy, two scenarios of its development are proposed to estimate the perspectives of JI in the oil and gas sector in the middle term. (author)
Oil and gas investment projects in the frame of the Kyoto protocol flexibility mechanisms in Russia
International Nuclear Information System (INIS)
Platonova, A.
2005-02-01
This PhD thesis evaluates the perspectives of the oil and gas investment projects in the frame of the Joint Implementation mechanism in Russia. From the energy point of view, the relationships between climate policy and energy systems are described and the main sources of GHG emissions reductions in the Russian oil and gas sector are evaluated. From the environmental point of view, the JI is firstly considered as an economic instrument of the international climate agreements. Secondly, are demonstrated the characteristics of the JI perturbing his efficiency and his capacity to ensure the environmental quality of projects. Based on the specificities of Russian climate policy, two scenarios of its development are proposed to estimate the perspectives of JI in the oil and gas sector in the middle term. (author)
Energy Technology Data Exchange (ETDEWEB)
Platonova, A
2005-02-01
This PhD thesis evaluates the perspectives of the oil and gas investment projects in the frame of the Joint Implementation mechanism in Russia. From the energy point of view, the relationships between climate policy and energy systems are described and the main sources of GHG emissions reductions in the Russian oil and gas sector are evaluated. From the environmental point of view, the JI is firstly considered as an economic instrument of the international climate agreements. Secondly, are demonstrated the characteristics of the JI perturbing his efficiency and his capacity to ensure the environmental quality of projects. Based on the specificities of Russian climate policy, two scenarios of its development are proposed to estimate the perspectives of JI in the oil and gas sector in the middle term. (author)
Just in Time to Flip Your Classroom
Lasry, Nathaniel; Dugdale, Michael; Charles, Elizabeth
2014-01-01
With advocates like Sal Khan and Bill Gates, flipped classrooms are attracting an increasing amount of media and research attention.2 We had heard Khan's TED talk and were aware of the concept of inverted pedagogies in general. Yet it really hit home when we accidentally flipped our classroom. Our objective was to better prepare our students for class. We set out to effectively move some of our course content outside of class and decided to tweak the Just-in-Time Teaching approach (JiTT).3 To our surprise, this tweak—which we like to call the flip-JiTT—ended up completely flipping our classroom. What follows is narrative of our experience and a procedure that any teacher can use to extend JiTT to a flipped classroom.
Indian Academy of Sciences (India)
Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.
National Research Council Canada - National Science Library
1993-01-01
...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...
Osama’s Wake: The Second Generation of Al Qaeda
2005-08-01
Hilweh refugee camp in Lebanon.28 • Abu Bakar Bashir, the Indonesian cleric and co-leader of the Jemaah Islamiya (JI). Bashir has close contacts...and Abu Bakar Bashir (JI) can generate the finances, find the sanctuary, and attract willing volunteers, they have the equal potential to become...fall of the Ottoman sultanate in his video message of October 2001.3 The current struggle against Western civilization is categorized by salafist
Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control
Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan
2014-03-01
This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.
Directory of Open Access Journals (Sweden)
Marianela Amador
2015-01-01
Full Text Available Entre las especies de barrenadores del banano, el picudo negro ( Cosmopolites sordidus es la plaga de mayor importancia económica en Costa Rica y a nivel mundial. El control de C. sordidus en sistemas intensivos de producción se basa principalmente en la aplicación de insecti - cidas, por lo que se necesita buscar alternativas biológicas, como el uso de nematodos entomo - patógenos (NEP. Se evaluó la susceptibilidad de Cosmopolites sordidus a Heterorhabditis ataca - mensis CIA-NE07. Se midió el efecto de inocular juveniles infectivos (JI de H. atacamensis sobre larvas y adultos de C. sordidus, in vitro y en cormos artificialmente infectados. Las larvas inoculadas con NEP presentaron mortalidad de 88% al segundo día y 100% al tercer día; no se observó mortalidad de adultos. Los tratamien - tos de 100, 500 y 1000 JI.larva -1 presentaron diferencias estadísticamente significativas con respecto al control y la DL50 fue de 52 JI.larva -1 . Cuando las larvas se colocaron dentro de los cormos, la DL50 aumentó a 375 JI.larva -1 . Los resultados indican que la cepa H. atacamensis CIA-NE07 es capaz de localizar e infectar larvas de picudo dentro del cormo de banano y alcanzar porcentajes de infección superiores al 80%, a 10 días de la inoculación en dosis de 1000 y 2000 JI.larva -1 . Los nematodos entomopatógenos cons - tituyen una alternativa viable a considerar dentro de los programas de manejo integrado del picudo negro, en cultivos como banano y plátano.
New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration
Directory of Open Access Journals (Sweden)
Jun Chen
2016-12-01
Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.
Joint Implementation, Clean Development Mechanism and Tradable Permits
Energy Technology Data Exchange (ETDEWEB)
Nielsen, L; Rose Olsen, K
2000-06-01
This report deals with international environmental instruments aimed at a cost-effective reduction of greenhouse gas emissions. More precisely the instruments mentioned in the Kyoto Protocol, namely Joint Implementation (JI), the Clean Development Mechanism (CDM) and Tradable Permits (TP). The report describes the background for the international co-operation on reducing the greenhouse gases and the background for the instruments. How the instruments work in theory and what the practical problems may be. What agents' incentives are when they engage in JI or CDM, and how the initiation of the instruments can be organised. The institutional frameworks for JI, CDM and TP are discussed. The report describes how the Kyoto instruments and the Kyoto commitments interact with other instruments and describe distributive effects between countries. It is analysed how the use of CDM may influence the developing countries incentives to participate in the coalition of committed countries. In the concluding chapter some recommendations on the use of JI, TP and CDM are given. The recommendations are a kind of dialog with especially the Norwegian and Swedish reports on tradable permits. Some of the issues described in this main report are analysed in separate working papers. The working papers are collected in an appendix to the main report. (au)
Joint Implementation, Clean Development Mechanism and Tradable Permits
Energy Technology Data Exchange (ETDEWEB)
Nielsen, L.; Rose Olsen, K.
2000-06-01
This report deals with international environmental instruments aimed at a cost-effective reduction of greenhouse gas emissions. More precisely the instruments mentioned in the Kyoto Protocol, namely Joint Implementation (JI), the Clean Development Mechanism (CDM) and Tradable Permits (TP). The report describes the background for the international co-operation on reducing the greenhouse gases and the background for the instruments. How the instruments work in theory and what the practical problems may be. What agents' incentives are when they engage in JI or CDM, and how the initiation of the instruments can be organised. The institutional frameworks for JI, CDM and TP are discussed. The report describes how the Kyoto instruments and the Kyoto commitments interact with other instruments and describe distributive effects between countries. It is analysed how the use of CDM may influence the developing countries incentives to participate in the coalition of committed countries. In the concluding chapter some recommendations on the use of JI, TP and CDM are given. The recommendations are a kind of dialog with especially the Norwegian and Swedish reports on tradable permits. Some of the issues described in this main report are analysed in separate working papers. The working papers are collected in an appendix to the main report. (au)
International Nuclear Information System (INIS)
Swisher, Joel N.; Renner, Frederick P.
1998-01-01
The UN Framework Convention on Climate Change (FCCC) allows for the joint implementation (JI) of measures to mitigate the emissions of greenhouse gases. The concept of JI refers to the implementation of such measures in one country with partial or full financial and/or technical support from another country, potentially fulfilling some of the supporting country's emission-reduction commitment under the FCCC. This paper addresses some key issues related to JI under the FCCC as they relate to the development of biomass energy projects for carbon offsets in developing countries. Issues include the reference case or baseline, carbon accounting and net carbon storage, potential project implementation barriers and risks, monitoring and verification, local agreements and host-country approval. All of these issues are important in project design and evaluation. We discuss briefly several case studies, which consist of a biomass-fueled co-generation projects under development at large sugar mills in the Philippines, India and Brazil, as potential JI projects. The case studies illustrate the benefits of bioenergy for reducing carbon emissions and some of the important barriers and difficulties in developing and crediting such projects. Results to date illustrate both the achievements and the difficulties of this type of project. (author)
Soil Behavior Under Blast Loading
2010-12-01
in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This
Nonsimplicity of certain universal C^*-algebras
Jeu, de M.F.E.; Elharti, R.; Pinto, P.R.
2017-01-01
Given n≥2" role="presentation">n≥2, zij∈T" role="presentation">zij∈T such that zij=z¯ji" role="presentation">zij=z¯ji for 1≤i,j≤n" role="presentation">1≤i,j≤n and zii=1" role="presentation">zii=1 for 1≤i≤n" role="presentation">1≤i≤n, and integers p1,…,pn≥1" role="presentation">p1,…,pn≥1, we show
Directory of Open Access Journals (Sweden)
Chen CY
2018-05-01
Full Text Available Ching-Yen Chen,1–3 Nan-Wen Yu,2–4 Tien-Hao Huang,4 Wei-Shin Wang,4 Ji-Tseng Fang2,3,5 1Department of Psychiatry, Chang Gung Memorial Hospital, Keelung, Taiwan; 2School of Medicine, Chang Gung University, Taoyuan, Taiwan; 3Medical Education Research Center, Chang Gung Memorial Hospital, Taoyuan, Taiwan; 4Department of Psychiatry, Chang Gung Memorial Hospital, Linkou, Taiwan; 5Department of Nephrology, Chang Gung Memorial Hospital, Linkou, Taiwan Purpose: During medical school training, increased stress, depression, and anxiety are common. Certain personality traits, particularly harm avoidance (HA, may increase the risk of psychopathological disorders, insomnia, and migraine among medical students. This study evaluated the role HA may play on levels of stress, depression, anxiety, and insomnia among Taiwanese medical students starting their fifth and final year of medical school.Patients and methods: A series of self-report questionnaires were used to measure the severity of anxiety, depression, and insomnia, as well as somatic symptoms, particularly migraine headache, among 143 Taiwanese fifth-year medical students (94 males and 49 females. Most had normal or mild levels of anxiety, depression, insomnia, and migraine.Results: HA personality trait was significantly associated with depression (all P ≤ 0.001 after adjusting for other factors. HA was not significantly associated with anxiety, insomnia, or migraine headache days.Conclusion: HA personality trait was significantly associated with depression among fifth-year medical students in Taiwan. Keywords: anxiety, depression, harm avoidance, psychological stress, sleep initiation and maintenance disorders, migraine, students, medical
Directory of Open Access Journals (Sweden)
Fan ZG
2016-03-01
Full Text Available Zhong-Guo Fan,1,* Xiao-Fei Gao,1,2,* Li-Wen Chen,1 Xiao-Bo Li,1,2 Ming-Xue Shao,1,2 Qian Ji,1 Hao Zhu,1 Yi-Zhi Ren,1 Shao-Liang Chen,1,2 Nai-Liang Tian1,2 1Department of Cardiology, Nanjing First Hospital, Nanjing Medical University, 2Department of Cardiology, Nanjing Heart Center, Nanjing, People’s Republic of China *These authors contributed equally to this work Background: The effects of intra-aortic balloon pump (IABP usage in patients with acute myocardial infarction remain controversial. This study sought to evaluate the outcomes of IABP usage in these patients.Methods: Medline, EMBASE, and other internet sources were searched for relevant clinical trials. The primary efficacy endpoints (in-hospital, midterm, and long-term mortality and secondary endpoints (reinfarction, recurrent ischemia, and new heart failure in the hospital as well as safety endpoints (severe bleeding requiring blood transfusion and stroke in-hospital were subsequently analyzed.Results: Thirty-three clinical trials involving 18,889 patients were identified. The risk of long-term mortality in patients suffering from acute myocardial infarction was significantly decreased following IABP use (odds ratio [OR] 0.66, 95% confidence interval [CI]: 0.48–0.91, P=0.010. Both in-hospital and midterm mortality did not differ significantly between the IABP use group and no IABP use group (in-hospital: OR 0.87, 95% CI: 0.59–1.28, P=0.479; midterm: OR 1.12, 95% CI: 0.53–2.38, P=0.768. IABP insertion was not associated with the risk reduction of reinfarction, recurrent ischemia, or new heart failure. However, IABP use increased the risk of severe bleeding requiring blood transfusion (OR 2.05, 95% CI: 1.29–3.25, P=0.002 and stroke (OR 1.71, 95% CI: 1.04–2.82, P=0.035. In the thrombolytic therapy and cardiogenic shock subgroups, reduced mortality rates following IABP use were observed.Conclusion: IABP insertion is associated with feasible benefits with respect to long
Digital Repository Service at National Institute of Oceanography (India)
Harji, R.R; Bhosle, N.B.; Garg, A.; Sawant, S.S.; Venkat, K.
Trench at 11,000 m. Deep Sea Research Part I: Oceanographic Research Papers 47, 1173- 1182. Fang, J., Kato, C., Sato, T., Chan, O., McKay, D., 2004. Biosynthesis and dietary uptake of polyunsaturated fatty acids by peizophilic bacteria. Comparative... lipids and community structure in estuaries. Aquatic Microbial Ecology 42, 105-117. Hedges, J.I., Keil, R.G., 1995. Sedimentary organic matter preservation: an assessment and speculative synthesis. Marine Chemistry 49, 81-115. Hedges, J.I., Keil, R...
Perspectives of joint implementation projects in Lithuania
Štreimikienė, Dalia; Mikalauskienė, Asta
2004-01-01
The paper deals with the perspectives of joint implementation (JI) projects in Lithuania. The analysis of flexible mechanisms under the Kyoto protocol including Jl benefits is presented in the paper. The main aim of the article is to analyze current macroeconomic environment which has impact on the JI perspectives in Lithuania and based on this analysis to define activities, measures and institutions necessary for the implementation of these projects. A very important issue in this context is...
A Robust and Resilient Network Design Paradigm for Region-Based Faults Inflicted by WMD Attack
2016-04-01
Infrastructure Mapping over Transport Software - Defined Networks (T- SDN )”, IEEE/OSA OFC, 2014 (invited for a special issue of OSA/IEEE JOCN) 23. L. Liu, J...Ji and C. Qiao “Survivable Virtual Infrastructure Mapping with Shared Protection in Transport Software - Defined Networks (T- SDNs )”, OECC, 2014. 25. S...483-493, 2014. 21. Z. Ye, X. Li, A. N. Patel, P. N. Ji, X. Cao, C. Qiao, “Upgrade-aware Virtual Infrastructure Mapping in Software - Defined Elastic
1983-06-01
Niven, J.I., McFarland, R.A., and Roughton, F.J. Variations in Visual Thresholds During Carbon Monoxide and Hypoxic Anoxia (abstract). Fed. Proc...and Niven, J.I. Visual Thresholds as an Index of the Modification of the Effects of Anoxia by Glucose. Am. J. Physiol. 144:378-88. 1945. 71... Diphosphoglycerate and Night Vision. Aviat. Space Environ. Med. 52(1):41-44. 1981. 100. Sexton, M., Malone, F. and Farnsworth, D. The Effect of Ultra- violet
Just-in-Time to Save Lives: A Pilot Study of Layperson Tourniquet Application.
Goolsby, Craig; Branting, Andrew; Chen, Elizabeth; Mack, Erin; Olsen, Cara
2015-09-01
The objective was to determine whether just-in-time (JiT) instructions increase successful tourniquet application by laypersons. This was a randomized pilot study conducted in August 2014. The study occurred at the Uniformed Services University campus in Bethesda, Maryland. A total of 194 volunteers without prior military service or medical training completed the study. The participant stood in front of a waist-down mannequin that had an exposed leg. An observer read a scenario card aloud that described a mass casualty event. The observer then asked the participant to apply a Combat Application Tourniquet (C-A-T) to the mannequin. Test participants received a 4 × 6-inch card, with JiT instructions, in addition to their C-A-T; controls received no instructions. Participants were randomized in a 3:1 ratio of instructions to no instructions. The study's primary outcome was the proportion of successfully applied tourniquets by participants receiving JiT instructions compared to participants not receiving instructions. Secondary outcomes included the time for successful tourniquet placement, reasons for failed tourniquet application, and participants' self-reported willingness and comfort using tourniquets in real-life settings. Just-in-time instructions more than doubled successful tourniquet placement. Participants supplied with JiT instructions placed a tourniquet successfully 44.14% of the time, compared to 20.41% of the time for controls without instructions (risk ratio = 2.16; 95% confidence interval = 1.21 to 3.87; p = 0.003). Just-in-time instructions increase laypeople's successful application of C-A-T. This pilot study provides evidence that JiT instructions may assist the lay public in providing effective point-of-injury hemorrhage control. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.
Kinetic investigation on enantioselective hydrolytic resolution of ...
African Journals Online (AJOL)
Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...
77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection
2012-02-27
... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...
1992-01-01
AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys
Partial neuroprotection by nNOS inhibition during profound asphyxia in preterm fetal sheep.
Drury, Paul P; Davidson, Joanne O; van den Heuij, Lotte G; Tan, Sidhartha; Silverman, Richard B; Ji, Haitao; Blood, Arlin B; Fraser, Mhoyra; Bennet, Laura; Gunn, Alistair Jan
2013-12-01
Preterm brain injury is partly associated with hypoxia-ischemia starting before birth. Excessive nitric oxide production during HI may cause nitrosative stress, leading to cell membrane and mitochondrial damage. We therefore tested the hypothesis that therapy with a new, selective neuronal nitric oxide synthase (nNOS) inhibitor, JI-10 (0.022mg/kg bolus, n=8), given 30min before 25min of complete umbilical cord occlusion was protective in preterm fetal sheep at 101-104day gestation (term is 147days), compared to saline (n=8). JI-10 had no effect on fetal blood pressure, heart rate, carotid and femoral blood flow, total EEG power, nuchal activity, temperature or intracerebral oxygenation on near-infrared spectroscopy during or after occlusion. JI-10 was associated with later onset of post-asphyxial seizures compared with saline (p<0.05), and attenuation of the subsequent progressive loss of cytochrome oxidase (p<0.05). After 7days recovery, JI-10 was associated with improved neuronal survival in the caudate nucleus (p<0.05), but not the putamen or hippocampus, and more CNPase positive oligodendrocytes in the periventricular white matter (p<0.05). In conclusion, prophylactic nNOS inhibition before profound asphyxia was associated with delayed onset of seizures, slower decline of cytochrome oxidase and partial white and gray matter protection, consistent with protection of mitochondrial function. © 2013.
Effects of water stress and seed mass on germination and ...
African Journals Online (AJOL)
enoh
2012-03-01
Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...
Blazar Sequence in Fermi Era Liang Chen
Indian Academy of Sciences (India)
Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...
The Combating Terrorism Center at West Point: Radical Islamic Ideology in Southeast Asia
2009-01-01
debriefing by the US, Guantanamo Bay 2008 . According to Nasir Abas, a Malaysian JI member, when Abu Bakar Ba’asyir visited the DI camp in Torkham on the...teachings and writings of prominent clerics; there is no equivalent of an Abu Bakar Bashir or Hashim Selamat, to say nothing of a Abu Muhammad al...9 of JI, Abu Bakar Ba’asyir and Abdullah Sungkar, have connections with al-Qa’ida and sent a number of Indonesians and Malaysians to train in Afghan
Ren, M.; Xu, X.; Ermolieva, T.; Cao, G.-Y.; Yermoliev, Y.
2018-01-01
China is the world’s largest iron and steel producer and Jing-Jin-Ji (Beijing-Tianjin-Hebei) region accounts for nearly 1/3 of the national iron and steel production, while it is facing serious air pollution. Among the top 10 worst polluted cities in China, seven were located in Hebei province in 2014. Recent years Jing-Jin-Ji region has been promoted iron & steel industry with green clean technology for accelerating sustainable economic transition. This paper tries to response the basic ques...
How Many Women Are Affected by or at Risk of Preeclampsia?
... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...
Proceedings – Mathematical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...
The validity and accuracy in foot-to-foot bioelectrical impedance ...
African Journals Online (AJOL)
The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...
Joint implementation as a cost-effective climate policy measure: a Chinese perspective
International Nuclear Information System (INIS)
1997-01-01
By analysing the macroeconomic and sectoral effects of carbon emission limits for China through a time-recursive dynamic computable general equilibrium model of the Chinese economy, the report shows that the carbon taxes required in China are much lower than those for both the industrialised countries and the world average in order to achieve the same percentage of emission reductions relative to the baseline. This provides the economic rationale for the development of JI projects with China. The report discusses in some detail potential areas for JI projects with China. Areas of most interest are related to those activities and options aimed at: (1) improving the efficiency of energy use, particularly at energy intensive energy sectors (e.g. iron and steel industry, chemical industry, building materials industry, and power industry) and devices (e.g. industrial boilers); (2) pushing efficient use of coal through increasing proportion of raw coal washed; popularizing domestic use of coal briquette; substitution of direct burning of coal by electricity through development of large-size, high-temperature and high-pressure efficient coal-fired power plants; expanding district heating systems and developing cogeneration; increased penetration of town gas into urban households; and through development of environmentally sound coal technologies; (3) speeding up the development of hydropower and nuclear power; and (4) developing renewables. The report addresses some operational aspects of JI from a Chinese perspective. Some JI projects are under discussion but the Chinese government has not yet approved any
Latest approaches of Kyoto protocol
International Nuclear Information System (INIS)
Matei, M.; Matei, L.
2005-01-01
Recently EURELECTRIC welcome the proposal of new EC Directive concerning the inclusion in the EU Emissions Trading Scheme (ETS) of credits from the project mechanisms - Joint Implementation (JI) and Clean Development Mechanism (CDM). The proposed Directive is an amendment to the EU Emissions Trading Directive adopted in June 2003. EURELECTRIC calls for unlimited use of credits in ETS. The draft Directive provides for the application of these mechanisms to begin as of 2008, on condition that the Kyoto Protocol does actually enter into force, an event which is still dependent on Russia's ratification. Such ratification has been subject to contradictory statements from the Russian Government, and the question of whether their signature to the Protocol is forthcoming is still fraught with uncertainty. Although it is not anticipated that significant quantities of JI or CDM certified credits will be available in the period 2005-2007, those that do become available would provide some additional liquidity in the emissions trading market. There is a direct relation between the coming ETS and electricity pricing: environmental policy is the driver, based on the need to switch to a low-carbon future and manage the necessary investments in a rational manner - and emissions trading is the best solution available. Romania has good opportunities to be involved in the greenhouse gases market, both in ETS and JI mechanisms. Some JI projects between Romanian and The Netherlands are already done or underway. (author)
Directory of Open Access Journals (Sweden)
Ji J
2012-06-01
Full Text Available Ji Jun, Ji Shang-Yi, Yang Jian-An, He Xia, Yang Xiao-Han, Ling Wen-Ping, Chen Xiao-LingDepartment of Pathology and Cardiovascular Surgery, Shenzhen Sun Yat-Sen Cardiovascular Hospital, Shenzhen, Guangdong, People's Republic of ChinaBackground: There are more than 300,000 prosthetic heart valve replacements each year worldwide. These patients are faced with a higher risk of thromboembolic events after heart valve surgery and long-term or even life-long anticoagulative and antiplatelet therapies are necessary. Some severe complications such as hemorrhaging or rebound thrombosis can occur when the therapy ceases. Tissue-type plasminogen activator (t-PA is a thrombolytic agent. One of the best strategies is gene therapy, which offers a local high expression of t-PA over a prolonged time period to avoid both systemic hemorrhaging and local rebound thrombosis. There are some issues with t-PA that need to be addressed: currently, there is no up-to-date report on how the t-PA gene targets the heart in vivo and the gene vector for t-PA needs to be determined.Aims: To fabricate an albumin nano-t-PA gene ultrasound-targeted agent and investigate its targeting effect on prevention of thrombosis after heart mechanic valve replacement under therapeutic ultrasound.Methods: A dog model of mechanical tricuspid valve replacement was constructed. A highly expressive t-PA gene plasmid was constructed and packaged by nanoparticles prepared with bovine serum albumin. This nanopackaged t-PA gene plasmid was further cross-linked to ultrasonic microbubbles prepared with sucrose and bovine serum albumin to form the ultrasonic-targeted agent for t-PA gene transfection. The agent was given intravenously followed by a therapeutic ultrasound treatment (1 MHz, 1.5 w/cm2, 10 minutes of the heart soon after valve replacement had been performed. The expression of t-PA in myocardium was detected with multiclonal antibodies to t-PA by the indirect immunohistochemical method
New St-chromosome-specific molecular markers for identifying ...
Indian Academy of Sciences (India)
et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...
LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities
Energy Technology Data Exchange (ETDEWEB)
Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2013-12-31
This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.
Gembiczká, Adriana
2010-01-01
Work describes methods of measuring discrimination in the labour market. All examples are apply to the problem of the gender discrimination. I describe the neoclassical model of discrimination and the statistical discrimination and the work explains how this models try to express the rate of discrimination. In the main part of work I consider Oaxaca model- this model is nowadays in innovated form uses for measuring discrimination most frequently. The work describes the derivation of the model...
Kirjastus JI esitles uusi raamatuid / Kaarel Kressa
Kressa, Kaarel, 1983-
2009-01-01
18. veebr. Kirjanike Majas Tallinnas esitleti luulekogusid: Kaus, Jan. Miniatuurid ; fs. Alasti ja elus ; Aru, Toomas F. Tahaks keppi Jääääre saatel, ehk, Georges Charles de Heeckeren d’Anthèsi pihtimus (Pärnu : Jumalikud Ilmutused, 2009)
坂井 , 信之; 今田 , 純雄; サカイ , ノブユキ; イマダ , スミオ; Nobuyuki, Sakai; Sumio, Imada
1998-01-01
This article is one of series that review psychological studies about eating behavior in humans and animals. In this paper, the role of olfaction on the food selection in humans and animals were reviewed. In our daily use of the words, the word "taste (A-JI)" includes both of the sensation that is arisen from the taste receptors on the mouth and of the sensation arisen from the olfactory receptors on the nasal cavity. We humans sometimes experience "The taste (A-JI) of the food is changed by ...
Institute of Scientific and Technical Information of China (English)
1999-01-01
The Fairy Lady of Wushan Mountain Yao Ji, youngest daughter of Emperor Yandi, sent to thesouth of Wushan Mountain in the Three Gorges, was named theFairy Lady of Wushan Mountain. When King Chu Huaiwangwas on a tour to Gaotang. he dreamed of the fair lady. Later,when King Chu Xiangwang was on the same tour, he too mether in a dream. Yao Ji grew a majestic plant, plucked it andmade it an iris. It was said that if stewed and eaten, the one whoate may chance to meet their lover in their dreams.
Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor
2015-09-01
Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4
The effects of reciprocal cross on inheritance of DNA methylation in ...
African Journals Online (AJOL)
enoh
2012-03-20
Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).
Pitfalls in VAR based return decompositions: A clarification
DEFF Research Database (Denmark)
Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten
in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...
Directory of Open Access Journals (Sweden)
Wang MS
2017-10-01
Full Text Available Ming-Shan Wang,1 Liang Chen,2 Ya-Qiong Xiong,2 Jing Xu,2 Ji-Peng Wang,2 Zi-Li Meng2 1Department of Oncology, Huaiyin Hospital of Huai’an City, Huai’an, China; 2Department of Respiration, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an, China Abstract: Actein (AT is a triterpene glycoside isolated from the rhizomes of Cimicifuga foetida that has been investigated for its antitumor effects. AT treatment leads to apoptosis in various cell types, including breast cancer cells, by regulating different signaling pathways. Iron oxide (Fe3O4 magnetic nanoparticles (MNPs are nanomaterials with biocompatible activity and low toxicity. In the present study, the possible benefits of AT in combination with MNPs on non-small-cell lung cancer (NSCLC were explored in in vitro and in vivo studies. AT-MNP treatment contributed to apoptosis in NSCLC cells, as evidenced by activation of the caspase 3-signaling pathway, which was accompanied by downregulation of the antiapoptotic proteins Bcl2 and BclXL, and upregulation of the proapoptotic signals Bax and Bad. The death receptors of TRAIL were also elevated following AT-MNP treatment in a p53-dependent manner. Furthermore, a mouse xenograft model in vivo revealed that AT-MNP treatment exhibited no toxicity and suppressed NSCLC growth compared to either AT or MNP monotherapies. In conclusion, this study suggests a novel therapy to induce apoptosis in suppressing NSCLC growth in a p53-dependent manner by combining AT with Fe3O4 MNPs. Keywords: actein, Fe3O4 magnetic nanoparticles, NSCLC, apoptosis, p53
Directory of Open Access Journals (Sweden)
Zhang JJ
2017-08-01
Full Text Available Jingjing Zhang,1,* Qing Ji,2,* Chunhua Jiao,3,* Lihua Ren,4 Ye Zhao,4 Yanfang Chen,4 Ruihua Shi,4 Yadong Feng4 1State Key Laboratory of Reproductive Medicine, Department of Prenatal Diagnosis, Obstetrics and Gynecology Hospital Affiliated to Nanjing Medical University, Nanjing, 2Department of Emergency, Jingjiang People’s Hospital, Jingjiang, 3Department of Gastroenterology, First Affiliated Hospital with Nanjing Medical University, 4Department of Gastroenterology, Zhongda Hospital, School of Medicine, Southeast University, Nanjing, People’s Republic of China *These authors contributed equally to this work Background: The clinical significance of insulin-like growth factor-II mRNA-binding protein-3 (IGF2BP3 in esophageal high-grade intraepithelial neoplasia (HGIN is not clear. This study was designed to characterize the expression of IGF2BP3 in HGIN. Patients and methods: IGF2BP3 expression was evaluated by Western blot analyses in 12 cases and by immunohistochemistry (IHC in 112 cases. The associations between IGF2BP3 expression in HGIN and the clinicopathological parameters were examined. Results: Moderate to strong IGF2BP3 expression was present in HGIN samples. Using IHC, it was found that IGF2BP3 was positive in 68 (60.71% cases. Intense IHC of IGF2BP3 in HGIN was associated with a deeper lesion depth, and the lesion depth was the only predictor of the positive expression of IGF2BP3. Conclusion: Our results suggested that IGF2BP3 may be a supplementary tissue marker for preoperative diagnosis of HGIN. Keywords: esophageal squamous cell carcinoma, precancerous lesion, immunohistochemistry detection, early diagnosis
Ji, Xuan-Ru; Cheng, Kuan-Chung; Chen, Yu-Ru; Lin, Tzu-Yu; Cheung, Chun Hei Antonio; Wu, Chia-Lin; Chiang, Hsueh-Cheng
2018-03-01
The endosomal-lysosomal system (ELS), autophagy, and ubiquitin-proteasome system (UPS) are cellular degradation pathways that each play a critical role in the removal of misfolded proteins and the prevention of the accumulation of abnormal proteins. Recent studies on Alzheimer's disease (AD) pathogenesis have suggested that accumulation of aggregated β-amyloid (Aβ) peptides in the AD brain results from a dysfunction in these cellular clearance systems. However, the specific roles of these pathways in the removal of Aβ peptides and the pathogenesis underlying AD are unclear. Our in vitro and in vivo genetic approaches revealed that ELS mainly removed monomeric β-amyloid42 (Aβ42), while autophagy and UPS clear oligomeric Aβ42. Although overproduction of phosphatidylinositol 4-phosphate-5 increased Aβ42 clearance, it reduced the life span of Aβ42 transgenic flies. Our behavioral studies further demonstrated impaired autophagy and UPS-enhanced Aβ42-induced learning and memory deficits, but there was no effect on Aβ42-induced reduction in life span. Results from genetic fluorescence imaging showed that these pathways were damaged in the following order: UPS, autophagy, and finally ELS. The results of our study demonstrate that different degradation pathways play distinct roles in the removal of Aβ42 aggregates and in disease progression. These findings also suggest that pharmacologic treatments that are designed to stimulate cellular degradation pathways in patients with AD should be used with caution.-Ji, X.-R., Cheng, K.-C., Chen, Y.-R., Lin, T.-Y., Cheung, C. H. A., Wu, C.-L., Chiang, H.-C. Dysfunction of different cellular degradation pathways contributes to specific β-amyloid42-induced pathologies.
Directory of Open Access Journals (Sweden)
Zhao TJ
2013-05-01
Full Text Available Tiejun Zhao,1 Hezhong Chen,1 Yuchao Dong,2 Jiajun Zhang,1 Haidong Huang,2 Ji Zhu,1 Wei Zhang21Institute of Cardiothoracic Surgery, 2Respiratory Department, Changhai Hospital, Shanghai, People's Republic of ChinaAbstract: In order to improve the therapeutic efficacy and minimize the side effects of lung cancer chemotherapy, the formulation of paclitaxel-loaded poly(glycolide-co-ε-caprolactone-b-D-α-tocopheryl polyethylene glycol 2000 succinate nanoparticles (PTX-loaded [PGA-co-PCL]-b-TPGS2k NPs was prepared. The novel amphiphilic copolymer (PGA-co-PCL-b-TPGS2k was synthesized by ring-opening polymerization and characterized by proton nuclear magnetic resonance spectroscopy and gel permeation chromatography. The PTX-loaded (PGA-co-PCL-b -TPGS2k NPs were characterized in terms of size, size distribution, zeta potential, drug encapsulation, surface morphology, and drug release. In vitro cellular uptakes of NPs were investigated with confocal laser scanning microscopy, indicating the coumarin 6-loaded (PGA-co-PCL-b -TPGS2k NPs could be internalized by human lung cancer A-549 cells. The antitumor effect of PTX-loaded NPs was evaluated, both in vitro and in vivo, on an A-549 cell tumor-bearing mouse model via intratumoral injection. The commercial PTX formulation Taxol was chosen as the reference. Experimental results showed that the PTX-loaded NPs possessed higher cytotoxicity and could effectively inhibit the growth of tumor. All the results suggested that amphiphilic copolymer (PGA-co-PCL-b -TPGS2k could act as a potential biological material for nanoformulation in the treatment of lung cancer.Keywords: (PGA-co-PCL-b TPGS2k, paclitaxel, nanoparticles, drug delivery, lung cancer
International Nuclear Information System (INIS)
Harmon, S; Wendelberger, B; Jeraj, R
2014-01-01
Purpose: Radiogenomics aims to establish relationships between patient genotypes and imaging phenotypes. An open question remains on how best to integrate information from these distinct datasets. This work investigates if similarities in genetic features across patients correspond to similarities in PET-imaging features, assessed with various clustering algorithms. Methods: [ 18 F]FDG PET data was obtained for 26 NSCLC patients from a public database (TCIA). Tumors were contoured using an in-house segmentation algorithm combining gradient and region-growing techniques; resulting ROIs were used to extract 54 PET-based features. Corresponding genetic microarray data containing 48,778 elements were also obtained for each tumor. Given mismatch in feature sizes, two dimension reduction techniques were also applied to the genetic data: principle component analysis (PCA) and selective filtering of 25 NSCLC-associated genes-ofinterest (GOI). Gene datasets (full, PCA, and GOI) and PET feature datasets were independently clustered using K-means and hierarchical clustering using variable number of clusters (K). Jaccard Index (JI) was used to score similarity of cluster assignments across different datasets. Results: Patient clusters from imaging data showed poor similarity to clusters from gene datasets, regardless of clustering algorithms or number of clusters (JI mean = 0.3429±0.1623). Notably, we found clustering algorithms had different sensitivities to data reduction techniques. Using hierarchical clustering, the PCA dataset showed perfect cluster agreement to the full-gene set (JI =1) for all values of K, and the agreement between the GOI set and the full-gene set decreased as number of clusters increased (JI=0.9231 and 0.5769 for K=2 and 5, respectively). K-means clustering assignments were highly sensitive to data reduction and showed poor stability for different values of K (JI range : 0.2301–1). Conclusion: Using commonly-used clustering algorithms, we found
Energy Technology Data Exchange (ETDEWEB)
Harmon, S; Wendelberger, B [University of Wisconsin-Madison, Madison, WI (United States); Jeraj, R [University of Wisconsin-Madison, Madison, WI (United States); University of Ljubljana (Slovenia)
2014-06-01
Purpose: Radiogenomics aims to establish relationships between patient genotypes and imaging phenotypes. An open question remains on how best to integrate information from these distinct datasets. This work investigates if similarities in genetic features across patients correspond to similarities in PET-imaging features, assessed with various clustering algorithms. Methods: [{sup 18}F]FDG PET data was obtained for 26 NSCLC patients from a public database (TCIA). Tumors were contoured using an in-house segmentation algorithm combining gradient and region-growing techniques; resulting ROIs were used to extract 54 PET-based features. Corresponding genetic microarray data containing 48,778 elements were also obtained for each tumor. Given mismatch in feature sizes, two dimension reduction techniques were also applied to the genetic data: principle component analysis (PCA) and selective filtering of 25 NSCLC-associated genes-ofinterest (GOI). Gene datasets (full, PCA, and GOI) and PET feature datasets were independently clustered using K-means and hierarchical clustering using variable number of clusters (K). Jaccard Index (JI) was used to score similarity of cluster assignments across different datasets. Results: Patient clusters from imaging data showed poor similarity to clusters from gene datasets, regardless of clustering algorithms or number of clusters (JI{sub mean}= 0.3429±0.1623). Notably, we found clustering algorithms had different sensitivities to data reduction techniques. Using hierarchical clustering, the PCA dataset showed perfect cluster agreement to the full-gene set (JI =1) for all values of K, and the agreement between the GOI set and the full-gene set decreased as number of clusters increased (JI=0.9231 and 0.5769 for K=2 and 5, respectively). K-means clustering assignments were highly sensitive to data reduction and showed poor stability for different values of K (JI{sub range}: 0.2301–1). Conclusion: Using commonly-used clustering algorithms
African Journal of Traditional, Complementary and Alternative ...
African Journals Online (AJOL)
Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.
Trend analysis and change point detection of annual and seasonal ...
Indian Academy of Sciences (India)
elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.
How Can Economies in Transition Pursue Emissions Trading or Joint Implementation?
International Nuclear Information System (INIS)
Missfeldt, F.; Villavicenco, A.
2002-07-01
Under the 1997 Kyoto Protocol, economies in transition are eligible for both emissions trading (Article 17) and joint implementation (Article 6). Guiding rules for implementing these mechanisms were decided through the Marrakech Accords in November 2001. These countries may benefit substantially from those mechanisms if they are implemented appropriately. However, with the departure of the USA from the Kyoto Protocol, the likely revenues from international emissions trading for the economies in transition are likely to be limited at least during the first commitment period. A key criterion on whether countries should undertake emissions trading is the comparison of projections of emissions until 2012 with the target under the Kyoto Protocol. For joint implementation, the investment climate and the emission reductions potential of a specific project are more important. Countries that are bound by the Kyoto Protocol need to implement a clear institutional structure, which includes a JI office or a position solely in charge of JI. Even if a country decides not to engage in JI, such an office could help guide possible foreign investors
A Survey of Spatial and Seasonal Water Isotope Variability on the Juneau Icefield, Alaksa
Dennis, D.; Carter, A.; Clinger, A. E.; Eads, O. L.; Gotwals, S.; Gunderson, J.; Hollyday, A. E.; Klein, E. S.; Markle, B. R.; Timms, J. R.
2015-12-01
The depletion of stable oxygen-hydrogen isotopes (δ18O and δH) is well correlated with temperature change, which is driven by variation in topography, climate, and atmospheric circulation. This study presents a survey of the spatial and seasonal variability of isotopic signatures on the Juneau Icefield (JI), Alaska, USA which spans over 3,000 square-kilometers. To examine small scale variability in the previous year's accumulation, samples were taken at regular intervals from snow pits and a one square-kilometer surficial grid. Surface snow samples were collected across the icefield to evaluate large scale variability, ranging approximately 1,000 meters in elevation and 100 kilometers in distance. Individual precipitation events were also sampled to track percolation throughout the snowpack and temperature correlations. A survey of this extent has never been undertaken on the JI. Samples were analyzed in the field using a Los Gatos laser isotope analyzer. This survey helps us better understand isotope fractionation on temperate glaciers in coastal environments and provides preliminary information on the suitability of the JI for a future ice core drilling project.
The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations
2011-09-01
properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman
Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings
2015-07-01
resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G
Evaluation of effectiveness in a novel wound healing ointment ...
African Journals Online (AJOL)
Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...
2014-09-18
22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen
A comparative study assessing a new tool for occluding ...
African Journals Online (AJOL)
0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...
The roles of electronic books in the transformation of learning and instruction
Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel
2014-01-01
Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies
2009-09-01
this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...
THREE NEW SPECIES OF CRAMBINAE(LEPIDOPTERA : PYRALIDAE) IN CHINA
Institute of Scientific and Technical Information of China (English)
CHENTie-mei; SONGShi-mei; YUANDe-cheng
2003-01-01
Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.
2011-09-01
applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D
Canivez, Gary L.; Kush, Joseph C.
2013-01-01
Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…
75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use
2010-01-28
... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...
¿Fueron manipulados los datos de Mendel? (Argumentos en contra)
Márquez-Sánchez, Fidel; Sahagún-Castellanos, Jaime
2005-01-01
Se discuten las opiniones de varios autores sobre la crítica de R. A. Fisher al ajuste de los datos de Mendel a sus hipótesis sobre la herencia en varios caracteres del chícharo (Pisum sativum). Datos demasiado buenos para ser ciertos, se ha argumentado. Tres autores basan su alegato en la forma inadecuada en que Fisher empleó la prueba de ji-cuadrada para sugerir que Mendel falseó sus datos experimentales. Otro autor señala cómo debe interpretarse el uso de la ji-cuadrada, ya que cuando se u...
Recovery of Indirect Costs in the Pricing of Equitable Adjustments and Terminations for Convenience
1988-05-01
HORNGREN , COST ACCOUNTING , A MANAGERIAL EMPHASIS, 21 (5th ed. 1982). 2 6FAR Part 31, Contract Cost Principles and Procedures. 2 7 L. ANDERSON...O WOIRECT COSTS /0 5. TYPE OF REPORT & PERIOD COVERED T$0, PEIK~ O ITPA3L-, AO s ~tjQr5 AfJI0 MS THESIS p O12T0MIPJTIOOZ P 0 o, CO V rJiC I rL)C .. S ... Accounting Standards (CAS) 13 C. The Cost Principles 14 D. Measurement of Cost 15 E. Accounting Systems 16 F. Allocation of Costs 17 1. Direct Costs
DEFF Research Database (Denmark)
Nielsen, L.; Olsen, K.R.
2000-01-01
). The report describes the background for the international co-operation on reducing the greenhouse gases and the background for the instruments. How the instruments work in theory and what the practical problemsmay be. What agents' incentives are when they engage in JI or CDM, and how the initiation...... the developing countries incentives to participate in the coalition of committed countries. In the concludingchapter some recommendations on the use of JI, TP and CDM are given. The recommendations are a kind of dialog with especially the Norwegian and Swedish reports on tradable permits. Some of the issues...
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...
A reviewof the pharmacologicalmechanism of traditional Chinese ...
African Journals Online (AJOL)
A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...
African Journal of Biotechnology - Vol 10, No 60 (2011)
African Journals Online (AJOL)
Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...
Three novel antioxidants from Cinnamomum plants | Cheng | African ...
African Journals Online (AJOL)
Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.
van Achterberg, Cornelis; Long, Khuat Dang
2010-01-01
Abstract The species of seventeen genera of Agathidinae (Braconidae) from Vietnam are revised: Agathis Latreille, 1804, Bassus Fabricius, 1804; Biroia Szépligeti, 1900; Braunsia Kriechbaumer, 1894; Camptothlipsis Enderlein, 1920; Coccygidium de Saussure, 1892; Coronagathis gen. n. (type species: Coronagathis cornifera sp. n.); Cremnops Foerster, 1862; Disophrys Foerster, 1862; Earinus Wesmael, 1837; Euagathis Szépligeti, 1900; Gyragathis gen. n. (type species: Gyragathis quyi sp. n.), Gyrochus Enderlein, 1920; Lytopylus Foerster, 1862; Therophilus Wesmael, 1837; Troticus Brullé, 1846, and Zelodia gen. n. (type species: Zelomorpha varipes van Achterberg & Maetô, 1990). Keys to the Vietnamese species are given. Sixty-five species are recognised, of which twelve species are newly recorded for Vietnam: Bassus albifasciatus (Watanabe, 1934), Coccygidium angostura (Bhat & Gupta, 1977), Cremnops atricornis (Smith, 1874), stat. n., Disophrys erythrocephala Cameron, 1900, Gyrochus yunnanensis Wang, 1984, Lytopylus romani (Shestakov, 1940), comb. n., Therophilus festivus (Muesebeck, 1953), comb. n., Therophilus javanus (Bhat & Gupta, 1977), comb. n., Therophilus lienhuachihensis (Chou & Sharkey, 1989), comb. n., Therophilus marshi (Bhat & Gupta, 1977), comb. n., Zelodia absoluta (Chen & Yang, 1998), comb. n. and Zelodia longidorsata (Bhat & Gupta, 1977), comb. n. Forty-two species are new to science: Agathis citrinisoma sp. n., Bassus albobasalis sp. n., Bassus albozonatus sp. n., Biroia soror sp. n., Braunsia bicolorata sp. n., Braunsia devriesi sp. n., Braunsia maculifera sp. n., Braunsia nigrapiculata sp. n., Braunsia pumatica sp. n., Camptothlipsis hanoiensis sp. n., Coronagathis cornifera sp. n., Earinus aurantius sp. n., Earinus brevistigmus sp. n., Euagathis flavosoma sp. n., Disophrys maculifera sp. n., Disophrys quymanhi sp. n., Disophrys rhinoides sp. n., Gyragathis quyi sp. n., Therophilus annuliferus sp. n., Therophilus cattienensis sp. n., Therophilus
Lateral strukturierte Oberflächen zur THz-Strahlmanipulation
Jahn, David; Koch, Martin (Prof. Dr.)
2018-01-01
Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...
C. Huang , G. Zhao , HW Zhang & YQ Chen
Indian Academy of Sciences (India)
the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.
Chaos synchronization of the fractional-order Chen's system
International Nuclear Information System (INIS)
Zhu Hao; Zhou Shangbo; He Zhongshi
2009-01-01
In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.
Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors
2008-04-01
Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...
The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica
Directory of Open Access Journals (Sweden)
Sollman Philip
2015-07-01
Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.
(DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs
2012-12-21
increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha
The effects of growth time on the quality of graphene synthesized by ...
Indian Academy of Sciences (India)
by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.
African Journals Online (AJOL)
Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...
Phase relation of LaFe11· 6Si1· 4 compounds annealed at different ...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science; Volume 35; Issue 2. Phase relation of LaFe11.6Si1.4 compounds annealed at different high-temperature and the magnetic property of LaFe11.6−CoSi1.4 compounds. Xiang Chen Yungui Chen Yongbai Tang. Volume 35 Issue 2 April 2012 pp 175-182 ...
Hsieh, Hui-Chen
2016-01-01
Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…
Fahey, Laura M.; Raff, Adam B.; Da Silva, Diane M.; Kast, W. Martin
2009-01-01
Human papillomavirus (HPV) type 16 infects the epithelial layer of cervical mucosa and is causally associated with the generation of cervical cancer. Langerhans cells (LC) are the resident antigen-presenting cells at the site of infection and therefore are responsible for initiating an immune response against HPV16. On the contrary, LC exposed to HPV16 do not induce a specific T cell immune response, which leads to the immune evasion of HPV16. Demonstrating that Toll-like receptor 7 (TLR7) and TLR8 are expressed on human LC, we hypothesized that imidazoquinolines would activate LC exposed to HPV16, leading to the induction of an HPV16-specific cell-mediated immune response. Surprisingly both phenotypic and functional hallmarks of activation are not observed when LC are exposed to HPV16 virus-like particles (VLP) and treated with imiquimod (TLR7 agonist). However, we found that LC are activated by 3M-002 (TLR8 agonist) and resiquimod (TLR8/7 agonist). LC exposed to HPV16 VLP and subsequently treated with 3M-002 or resiquimod highly up-regulate surface activation markers, secrete pro-inflammatory cytokines and chemokines, induce CCL21-directed migration, and initiate an HPV16-specific CD8+ T cell response. These data strongly indicate that 3M-002 and resiquimod are promising therapeutics for treatment of HPV-infections and HPV-induced cervical lesions. This is an author-produced version of a manuscript accepted for publication in The Journal of Immunology (The JI). The American Association of Immunologists, Inc. (AAI), publisher of The JI, holds the copyright to this manuscript. This version of the manuscript has not yet been copyedited or subjected to editorial proofreading by The JI; hence, it may differ from the final version published in The JI (online and in print). AAI (The JI) is not liable for errors or omissions in this author-produced version of the manuscript or in any version derived from it by the U.S. National Institutes of Health or any other third
Liu, Honggang; Zheng, Wenchen
2018-01-01
Electron paramagnetic resonance (EPR) is an important tool to study the complex interactions (e.g., exchange and magnetic dipole-dipole interactions) for a pair of lanthanide (Ln) ions in crystals. How to analyze these EPR spectra and obtain the strength of each interaction is a challenge for experimentalists. In this work, a general way of calculating the EPR lines for two magnetically equivalent Ln ions is given by us to solve this problem. In order to explain their EPR spectra and obtain exchange interaction parameters Ji (i = x, y, z) between them, we deduce the analytic formulas for computing the angular dependent EPR lines for such Ln pairs under the condition of weak coupling (|Ji| ≪ hv, where v is the microwave frequency in the EPR experiment) and set up the spin-Hamiltonian energy matrix that should be diagonalized to obtain these lines if intermediate (|Ji| ˜ hv) and strong (|Ji| > hv) couplings are encountered. To verify our method, the experimental EPR spectra for the Yb3+ doped BaY2F8 crystal are considered by us and the EPR lines from the isolated Yb3+ ion and Yb3+-Yb3+ pair with distance R equal to 0.371 nm are identified clearly. Moreover, exchange interaction parameters (Jx ≈ -0.04 cm-1, Jy ≈ -0.24 cm-1, and Jz ≈ -0.1 cm-1) for such a pair are also determined by our calculations. This case study demonstrates that the theoretical method given in this work would be useful and could be applied to understand interactions between Ln ions in crystals.
European Union-Emission Trading Scheme: outlook for the chemical industry
International Nuclear Information System (INIS)
Coussy, P.; Alberola, E.
2013-01-01
From 2013, under the European Union Emissions Trading Scheme (EU-ETS), Europe will cap its emissions of nitrous oxide (N 2 O) and per-fluorocarbons (PFC) from the chemical industry. Besides, 336 chemical industry facilities will be forced to limit their emissions at 45.8 million tons of CO 2 per year from 2013 to 2020. At date August 1, 2012, almost 70% of the carbon credits issued by the clean development mechanism (CDM) were carried out mainly through the destruction of hydro-fluorocarbons (HFC-23) (42%) and N 2 O (22%). The contribution of emission reductions through chemical processes in the Joint Implementation (JI) projects is smaller but still amounted to 32% of all projects. From 1 May 2013 the European Union will refuse CDM and JI credits from emission reductions of HFC-23 and N 2 O. The issues of the introduction of the chemical industry in the EU-ETS in the context of low CO 2 prices and limited validity of CDM and JI chemical projects are high. Therefore, domestic CO 2 emissions reductions from energy consumption of the chemistry sector will take a larger share. (authors)
Energy Technology Data Exchange (ETDEWEB)
Gonzalez, P.D.R. [Universidad de Castilla-La Mancha, Toledo (Spain). Facultad de Ciencias Juridicas y Sociales; Hernandez, F. [IEG CSIC, Madrid (Spain); Gual, M. [Universidad Pablo de olavide, Sevilla (Spain)
2005-10-01
EU energy/environmental policy has at least two major and interrelated goals: to increase the percentage of electricity from renewable energy sources (RES-E) and to control the emission of GHG cost efficiently. These two goals could be in conflict. This paper explores one aspect of this conflicting relationship, namely the effect that the use of the Kyoto Protocol project mechanisms (CDM/JI project) may have on the deployment of RES-E within EU borders. The main conclusion is that, under certain assumptions (i.e., no mandatory EU RES-E quota), CDM/JI projects might reduce the incentive to deploy RES-E within EU borders because they would allow European power companies to comply with GHG targets in a cheaper way than if they reduced emissions by investing in renewable electricity in Europe. This is problematic, since many benefits from renewable electricity are local and these would be gone. This situation would be different if a mandatory RES-E quota (combined with an EU-wide TGC scheme) was implemented. In this case, the RES-E target would be fulfilled and CDM/JI projects would only affect RES-E deployment exceeding the target. (author)
Chinese herbal dose in ancient and modern times: a comparative study.
He, Shimin
2013-04-01
Appropriate dose guarantees Chinese herb's safety and effectiveness. There are adult dose criteria for Chinese herbs in decoction in the Pharmacopoeia of the People's Republic of China (2010 Edition) at present. But Chinese herbs have been frequently used in much higher doses than the dose criteria. This study has been conducted to test the dependability of the dose criteria. Twenty Chinese herbs were selected as representatives and their adult doses in decoction in Bei Ji Qian Jin Yao Fang, a famous ancient literature, have been reviewed and compared with those in the Pharmacopoeia of the People's Republic of China (2010 Edition). The adult dose criteria for all these 20 Chinese herbs in the Pharmacopoeia of the People's Republic of China (2010 Edition) haven't covered those in Bei Ji Qian Jin Yao Fang. Furthermore, maximal adult doses in the dose criteria are much lower than those in Bei Ji Qian Jin Yao Fang. The dose criteria in the Pharmacopoeia of the People's Republic of China (2010 Edition) are not comprehensive enough. Studying ancient literatures is an effective method to gain precious Chinese herbs' dose data and helps for new dose criteria's establishment in the future.
International Nuclear Information System (INIS)
Rio Gonzalez, Pablo del; Hernandez, Felix; Gual, Miguel
2005-01-01
EU energy/environmental policy has at least two major and interrelated goals: to increase the percentage of electricity from renewable energy sources (RES-E) and to control the emission of GHG cost efficiently. These two goals could be in conflict. This paper explores one aspect of this conflicting relationship, namely the effect that the use of the Kyoto Protocol project mechanisms (CDM/JI project) may have on the deployment of RES-E within EU borders. The main conclusion is that, under certain assumptions (i.e., no mandatory EU RES-E quota), CDM/JI projects might reduce the incentive to deploy RES-E within EU borders because they would allow European power companies to comply with GHG targets in a cheaper way than if they reduced emissions by investing in renewable electricity in Europe. This is problematic, since many benefits from renewable electricity are local and these would be gone. This situation would be different if a mandatory RES-E quota (combined with an EU-wide TGC scheme) was implemented. In this case, the RES-E target would be fulfilled and CDM/JI projects would only affect RES-E deployment exceeding the target
1975-11-01
2l«^,«’) T>SL JI To «ATt JlOO «n «t* in. fTA * 3^ "PlbiA-e-*^ To wia •^ -IZ0"L6, (.21 >To «AUVK« ^-^STRlP^TiM e.ax>s «»I To RATft...8 C B E U^T^SJA ani« fMD ran © HMajrwelL "« TEftT COkTTRoL ’PAMB.V, ■•i’r^rT" I’» 1 Mj u 56- £ to i. — TOO*.« r7gi^iiiiniM.gi 4|ji»" mkd
UČITELJSKI NAZIVI IN STROKOVNA RAST UČITELJEV S POUDARKOM NA NARAVOSLOVJU
Lampret, Maja
2010-01-01
V diplomskem delu »Učiteljski nazivi in strokovna rast učiteljev s poudarkom na naravoslovju« sem skozi teoretično izhodišče opredelila kdo je učitelj in kakšne so njegove vloge ter proučila učiteljske nazive. Predstavila sem tudi zgodovino učiteljstva, učiteljev profesionalni razvoj in učiteljske nazive. V empiričnem delu naloge sem ugotavljala kdo učitelje največkrat predlaga za napredovanje v višji naziv, saj menim, da se učitelji za napredovanje v višji naziv pogosto predlagajo sami. Zani...
A Preliminary Analysis on the Dynamics of the Ms8.0 Great Wenchuan, Sichuan, China Earthquake
Zhang, W.
2008-12-01
On May 12, 2008, a huge earthquake with magnitude Ms8.0 occurred in the Wenhuan, Sichuan Province of China. This event was the most devastating earthquake in the mainland of China since the 1976 M7.8 Tangshan earthquake. It resulted in tremendous losses of life and property. So far, there are 69,181 persons killed, and 18,522 still missing. Due to occur in the mountainous area, this great earthquake and the following thousands aftershocks also caused many other geological disasters, such as landslide, mud-rock flow and "quake lakes" which formed by landslide-induced reservoirs. This earthquake occurred along the Longmenshan fault, as the result of motion on a northeast striking reverse fault or thrust fault on the northwestern margin of the Sichuan Basin. The earthquake's epicenter and focal-mechanism are consistent with it having occurred as the result of movement on the Longmenshan fault or a tectonically related fault. The earthquake reflects tectonic stresses resulting from the convergence of crustal material slowly moving from the high Tibetan Plateau, to the west, against strong crust underlying the Sichuan Basin and southeastern China. In this study, the spatial and temporal distribution of the stress on the fault plane of this great earthquake is estimated from the inversion results (Chen Ji, 2008) by solving the elastodynamic equations. Then, the dynamic source parameters are determined and the relations between the shear stress and the slip, the shear stress and the slip-rate for all grid positions on the fault are investigated. Finally, the frictional law for the source rupture is inferred from the dynamic source parameters. Based on the obtained dynamic source parameters, we try to rebuild the dynamic rupture process of this event and discuss the characteristics of this great earthquake.
Directory of Open Access Journals (Sweden)
Chen ZQ
2012-02-01
Full Text Available Zhi-Qiang Chen, Ying Liu, Ji-Hui Zhao, Lan Wang, Nian-Ping FengSchool of Pharmacy, Shanghai University of Traditional Chinese Medicine, Shanghai, People's Republic of ChinaBackground: Indirubin, isolated from the leaves of the Chinese herb Isatis tinctoria L, is a protein kinase inhibitor and promising antitumor agent. However, the poor water solubility of indirubin has limited its application. In this study, a supersaturatable self-microemulsifying drug delivery system (S-SMEDDS was developed to improve the oral bioavailability of indirubin.Methods: A prototype S-SMEDDS was designed using solubility studies and phase diagram construction. Precipitation inhibitors were selected from hydrophilic polymers according to their crystallization-inhibiting capacity through in vitro precipitation tests. In vitro release of indirubin from S-SMEDDS was examined to investigate its likely release behavior in vivo. The in vivo bioavailability of indirubin from S-SMEDDS and from SMEDDS was compared in rats.Results: The prototype formulation of S-SMEDDS comprised Maisine™ 35-1:Cremophor® EL:Transcutol® P (15:40:45, w/w/w. Polyvinylpyrrolidone K17, a hydrophilic polymer, was used as a precipitation inhibitor based on its better crystallization-inhibiting capacity compared with polyethylene glycol 4000 and hydroxypropyl methylcellulose. In vitro release analysis showed more rapid drug release from S-SMEDDS than from SMEDDS. In vivo bioavailability analysis in rats indicated that improved oral absorption was achieved and that the relative bioavailability of S-SMEDDS was 129.5% compared with SMEDDS.Conclusion: The novel S-SMEDDS developed in this study increased the dissolution rate and improved the oral bioavailability of indirubin in rats. The results suggest that S-SMEDDS is a superior means of oral delivery of indirubin.Keywords: supersaturatable self-microemulsifying drug delivery system, indirubin, bioavailability, oral drug delivery, hydrophilic polymer
Directory of Open Access Journals (Sweden)
Li FQ
2011-04-01
Full Text Available Feng-Qian Li1, Cheng Yan2, Juan Bi1, Wei-Lin Lv3, Rui-Rui Ji3, Xu Chen1, Jia-Can Su3, Jin-Hong Hu31Department of Pharmaceutics, Shanghai Eighth People’s Hospital, Shanghai, People’s Republic of China; 2Department of Pharmacy, Bethune International Peace Hospital, Shijiazhuang, People’s Republic of China; 3Changhai Hospital, Second Military Medical University, Shanghai, People’s Republic of ChinaAbstract: Scopolamine hydrobromide (SH-loaded microparticles were prepared from a colloidal fluid containing ionotropic-gelated chitosan nanoparticles using a spray-drying method. The spray-dried microparticles were then formulated into orally disintegrating tablets (ODTs using a wet granulation tablet formation process. A drug entrapment efficiency of about 90% (w/w and loading capacity of 20% (w/w were achieved for the microparticles, which ranged from 2 µm to 8 µm in diameter. Results of disintegration tests showed that the formulated ODTs could be completely dissolved within 45 seconds. Drug dissolution profiles suggested that SH is released more slowly from tablets made using the microencapsulation process compared with tablets containing SH that is free or in the form of nanoparticles. The time it took for 90% of the drug to be released increased significantly from 3 minutes for conventional ODTs to 90 minutes for ODTs with crosslinked microparticles. Compared with ODTs made with noncrosslinked microparticles, it was thus possible to achieve an even lower drug release rate using tablets with appropriate chitosan crosslinking. Results obtained indicate that the development of new ODTs designed with crosslinked microparticles might be a rational way to overcome the unwanted taste of conventional ODTs and the side effects related to SH’s intrinsic characteristics.Keywords: scopolamine hydrobromide, chitosan, nanoparticles-in-microparticles system, spray-drying, orally disintegrating tablets
Vehicle/Guideway Interaction in Maglev Systems
1992-03-01
Technology Division Materials and Components in Maglev Systems Technology Division Materials and Components Technology Division byY. Cai, S. S. Chen, and D. M...Transportation Systems Reports (UC-330, Vehicle/Guideway Interaction in Maglev Systems by Y. Cai and S. S. Chen Materials and Components Technology Division D. M...Surface Irregularities ...................................... 32 4 Vehicle/Guideway Interaction in Transrapid Maglev System .................. 34 4.1
Indian Academy of Sciences (India)
20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.
2010-02-19
... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...
Bioavailability of cadmium from soy isolate
International Nuclear Information System (INIS)
Lee, Y.H.; Fox, M.R.S.; Tao, S.H.
1986-01-01
Studies with 109 Cd showed that more Cd was taken up by duodenum (D) and jejunum-ileum (J-I) of Japanese Quail (JQ) with soy isolate (SI) than with casein gelatin (CG) diet. The purpose of this study was to compare the bioavailability of endogenous Cd from SI with CdCl 2 added to a CG diet. Day-old JQ were fed either SI or CG diet containing 121 ppb of Cd. Beginning at 7 d of age, 109 CdCl 2 was incorporated into both diets at 100 uci/kg and a group of birds from each diet was killed on 8, 9, 11, 14 and 21 d. Growth was normal with both diets and food intake was similar. Cd concentration (determined by ICAP and AAS furnace) was significantly higher with CG than with SI on all days in D and up to 11 d of age in J-I. Although much less Cd accumulated in liver and kidneys than in D and J-I, the levels were also higher with CG. Total Cd uptake by liver and kidneys increased gradually with CG whereas there was little increase with SI. Specific activity of Cd in D and J-I with CG remained the same throughout the experiment, but increased significantly with SI up to 11 d of age. The specific activity of Cd in liver and kidneys from both CG and SI increased with time but the rate was greater with SI. The patterns of specific activity indicate differences among tissues and between CG and SI for time required to reach equilibrium between 109 Cd and non-radioactive Cd. These data also show that endogenous Cd in SI is less bioavailable than CdCl 2 added to CG diet
On the Unsteady-Motion Theory of Magnetic Forces for Maglev
1993-11-01
DivisionEnergy Technology Division Forces for Maglev Energy Technology DivisionEnergy Technology Division by S. S. Chen, S. Zhu, and Y. Cai APQ 4 袲...On the Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S. Chen, S. Zhu, and Y. Cai Energy Technology Division November 1993 Work supported...vi On The Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S
On integral equation methods for electromagnetic scattering by biperiodic structures
Bugert, Beatrice
2014-01-01
In der vorliegenden Arbeit verwenden wir Integralgleichungsmethoden, um die Streuung von zeitharmonischen elektromagnetischen ebenen Wellen an biperiodischen mehrschichtigen Strukturen zu untersuchen. Solche Strukturen modellieren wir durch die vertikale Anordnung einer endlichen Anzahl an sich nicht schneidenden, polyedrisch Lipschitz regulären Grenzflächen. Wir unterscheiden Streuobjekte bestehend aus einer Oberfläche und solche bestehend aus mindestens zwei Oberflächen. Das elektromagnetis...
Ühinemise ja iseolemise vastuseis. Ideaalid ja reaalsus / Rein Tootmaa
Tootmaa, Rein
2001-01-01
Mängufilmid "Keiser ja palgamõrtsukas" ("Jing ke ci qin wang") : režissöör Chen Kaige : Jaapan-Hiina-Prantsusmaa 1999 ja "Tiiger ja draakon" ("Wo hu chang long") : režissöör Ang Lee : Hiina-Hongkong-Ameerika Ühendriigid 2000. Lisa : Aare Ermeli koostatud Chen Kaige ja Ang Lee loomingu lühikokkuvõtted. Kokkuvõte inglise keeles lk. 128
Long-run implications for developing countries of joint implementation of greenhouse gas mitigation
International Nuclear Information System (INIS)
Rose, A.; Bulte, E.; Folmer, H.
1999-01-01
Joint Implementation (JI) calls for cooperation between industrialized and developing countries in the mitigation of greenhouse gas (GHG) emissions. However, a major concern of potential host countries is that if they utilize their low-cost options for JI now, they will be left with only high cost options in the future, thereby penalizing them at a time when they may be obligated to mitigate GHGs themselves. This paper formalizes this hypothesis by utilizing an optimal control framework analogous to the Hotelling model of non-renewable resource extraction. The results are that cumulative abatement effects can impose costs on the future, but that they can be offset by technological change, market power, or compensation. 11 refs
DEFF Research Database (Denmark)
Henriksen, Knud; Sporring, Jon; Hornbæk, Kasper
2004-01-01
reviews and provides a mathematical foundation for virtual trackballs. The first, but still popular, virtual trackball was described by Chen et al. [CHECK END OF SENTENCE]. We show that the virtual trackball by Chen et al. does not rotate the object along the intended great circular arc on the virtual...... trackball and we give a correction. Another popular virtual trackball is Shoemake's quaternion implementation [CHECK END OF SENTENCE], which we show to be a special case of the virtual trackball by Chen et al.. Shoemake extends the scope of the virtual trackball to the full screen. Unfortunately, Shoemake......'s virtual trackball is inhomogeneous and discontinuous with consequences for usability. Finally, we review Bell's virtual trackball [CHECK END OF SENTENCE] and discuss studies of the usability of virtual trackballs....
Opinião do pai sobre o aleitamento materno
Directory of Open Access Journals (Sweden)
ROSINEIDE SANTANA DE BRITO
2006-01-01
Full Text Available Estudio cualitativo desarrollado en Natal/RN con 13 hombres cuyos hijos estaban en período de lactancia natural. Tuvo por objetivo verificar la opinión del padre sobre la lactancia materna. Los datos se obtuvieron a partir de entrevista parcialmente estructurada y tratados siguiendo la técnica de análisis temático propuesta por Bardin. Los padres atribuyeron valores importantes a la lactancia relacionándolos al hijoya la compañera. Con relación al niño, verificamos conocimiento acerca de los beneficios de la leche materna como un alimento nutritivo, que promueve el crecimiento JI desarrollo infantil, determina la salud actual y favorece la vinculación entre el niño JI su madre. Con relación a la compañera, los entrevistados dijeron que la lactancia materna contribuye para que se estable el vínculo afectivo zca entre lactante y progenitora, como también, para la realización de la maternidad. Por consiguiente, afirmamos que los padres expusieron opiniones positivas acerca de la lactancia materna, las cuales pueden favorecer la promoción JI contribuirpara el suceso de la lactancia materna.
Energy Technology Data Exchange (ETDEWEB)
Kapfhamer, D.; Sufalko, D.; Warren, S. [Univ. of Michigan, Ann Arbor, MI (United States)] [and others
1996-08-01
Jittery (ji) is a recessive mouse mutation on Chromosome 10 characterized by progressive ataxic gait, dystonic movements, spontaneus seizures, and death by dehydration/starvation before fertility. Recently, a viable neurological recessive mutation, hesitant, was discovered. It is characterized by hesitant, uncoordinated movements, exaggerated stepping of the hind limbs, and reduced fertility in males. In a complementation test and by genetic mapping we have shown here that hesitant and jittery are allelic. Using several large intersubspecific backcrosses and intercrosses we have genetically mapped ji near the marker Amh and microsatellite markers D10Mit7, D10Mit21, and D10Mit23. The linked region of mouse Chromosome 10 is homologous to human 19p13.3, to which several human ataxia loci have recently been mapped. By excluding genes that map to human 21q22.3 (Pfkl) and 12q23 (Nfyb), we conclude that jittery is not likely to be a genetic mouse model for human Unverricht-Lundborg progressive myoclonus epilepsy (EPM1) on 21q22.3 nor for spinocerebellar ataxia II (SCA2) on 12q22-q24. The closely linked markers presented here will facilitate positional cloning of the ji gene. 31 refs., 2 figs.
1989-05-17
brand , which symbolizes feudal autocracy, in that the new form has been posited in the hopes that reform can forcefully be implemented so as to...ucts; name- brand and high-quality products; products of energy, communications, transportation, and raw mate- rial industries; aid agriculture...1986 election. Chen Weiye fought a skillful battle although he had been seen as an underdog . The smashing victory of Chen Weiye and Huang Wentai plus
Viets, Carmen
2001-01-01
Faseroptische SERS-Sensoren wurden durch die Beschichtung der Endflächen von optischen Fasern mit rauhen Metallfilmen erzeugt. Zu den verschiedenen Präparationstechniken, die angewendet und verglichen wurden, gehörten das langsame Aufdampfen von Metall-Inselfilmen und das Bedampfen von Nanopartikeln, aufgerauhten oder elektronenlithographisch strukturierten Oberflächen mit Metallfilmen. Der Einfluß der Laserleistung auf die Messungen mit SERS-Sensoren wurde untersucht, und es wurden maximale ...
Unconventional Density Wave and Superfluidity in Cold Atom Systems
2014-06-01
Tsai, Chairperson Professor Kirill Shtengel Professor Vivek Aji 3 Copyright by Chen-Yen Lai 2014 4 The Dissertation of Chen-Yen Lai is approved...thank my dissertation committee members, Professor Vivek Aji and Pro- fessor Kirill Shtengel, for their help, kindness, insightful comments and...near balance to a stripe-CDW ( red ) as the imbalance increases. The insert shows the strong imbalance region, where single species p-wave majority
Quasi-Static Evolution, Catastrophe, and Failed Eruption of Solar Flux Ropes
2016-12-30
Ropes James Chen Beam Physics Branch Plasma Physics Division December 30, 2016 Approved for public release; distribution is unlimited. i REPORT...pressure gradient force combine to balance the major radial hoop force. The macroscopic forces on the flux ropes and onset conditions are quantified...Solar physics theory 67-4989-07 Quasi-Static Evolution, Catastrophe, and “Failed” Eruption of Solar Flux Ropes James Chen1 Plasma Physics Division
Aerial Logistics Management for Carrier Onboard Delivery
2016-09-01
NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY by Samuel L. Chen September 2016...AND SUBTITLE AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY 5. FUNDING NUMBERS 6. AUTHOR(S) Samuel L. Chen 7. PERFORMING ORGANIZATION NAME(S...delivery (COD) is the use of aircraft to transport people and cargo from a forward logistics site (FLS) to a carrier strike group (CSG). The goal of
The Role of Protein Elongation Factor eEF1A2 in Breast Cancer
2006-09-01
apoptosis . A summary of common EMT markers is listed in Table I. Importantly, these developmental regulators can induce EMT in a nondevelopmental...1978; Chen et al., 1997), apoptosis (Chen et al., 1997), and metabolic regulation (Bissell et al., 1977) has been known for decades, the molecular...marks the Spemann organizer in vertebrate gastrulation and is one of the fi rst identifi ed regulators of embryological patterning (De Robertis et al
Detection of metal fibres in cementitious composites based on signal and image processing approaches
Czech Academy of Sciences Publication Activity Database
Vala, J.; Hobst, L.; Kozák, Vladislav
2015-01-01
Roč. 10, č. 1 (2015), s. 39-46 ISSN 1991-8747 Institutional support: RVO:68081723 Keywords : Cementitious composites * Computational simulation * Non-destructive testing Subject RIV: JI - Composite Materials
Massive Star Formation: Accreting from Companion X. Chen1 ...
Indian Academy of Sciences (India)
Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...
Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...
African Journals Online (AJOL)
The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...
Food Fortification to Prevent and Control Iron Deficiency | Chen ...
African Journals Online (AJOL)
It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...
Chemische Reaktionen auf Oberflächen - eine SFG Studie
Kirsch, Harald
2014-01-01
This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...
Existence of positive periodic solution of mutualism system with several delays
International Nuclear Information System (INIS)
Wu Haihui; Xia Yonghui; Lin Muren
2008-01-01
In this paper, by using Mawhin coincidence degree, some sufficient conditions are obtained for the global existence of positive periodic solutions of a mutualism systems with bounded and unbounded delays. Our results generalize significantly improve those of Gopalsamy and He [Gopalsamy K, He XZ. Persistence, attractivity, and delay in facultative mutualism. J Math Anal Appl 1997;215:154-73], Yang et al. [Yang F, Jiang D, Ying A. Existence of positive solution of multidelays facultative mutualism system. J Eng Math 2002;3:64-8], Chen et al. [Chen FD, Shi JL, Chen XX. Periodicity in Lotka-Volterra facultative mutualism system with several delays. J Eng Math 2004;21(3)] and Xia and Lin [Xia YH, Lin M, Existence of positive periodic solution of mutualism system with infinite delays. Ann Diff Eqs 2005;21(3):448-53
Robust anonymous authentication scheme for telecare medical information systems.
Xie, Qi; Zhang, Jun; Dong, Na
2013-04-01
Patient can obtain sorts of health-care delivery services via Telecare Medical Information Systems (TMIS). Authentication, security, patient's privacy protection and data confidentiality are important for patient or doctor accessing to Electronic Medical Records (EMR). In 2012, Chen et al. showed that Khan et al.'s dynamic ID-based authentication scheme has some weaknesses and proposed an improved scheme, and they claimed that their scheme is more suitable for TMIS. However, we show that Chen et al.'s scheme also has some weaknesses. In particular, Chen et al.'s scheme does not provide user's privacy protection and perfect forward secrecy, is vulnerable to off-line password guessing attack and impersonation attack once user's smart card is compromised. Further, we propose a secure anonymity authentication scheme to overcome their weaknesses even an adversary can know all information stored in smart card.
Transparent and Stretchable High-Performance Supercapacitors Based on Wrinkled Graphene Electrodes
2013-12-18
2, 870–875. 38. Chen, T.; Dai, L. Carbon Nanomaterials for High- Performance Supercapacitors . Mater. Today 2013, 16, 272–280. 39. Stoller, M. D...High-Performance Supercapacitors Based onWrinkledGraphene Electrodes Tao Chen,† Yuhua Xue,† Ajit K. Roy,‡ and Liming Dai†,* †Center of Advanced Science...electrodes and the associated supercapacitor cells cannot be both trans- parent and stretchable.1318 It is highly desirable to integrate the
Wang, Xiaolin; Wang,Qingbing; Li,Jianfeng; An,Sai; Chen,Yi; Jiang,Chen
2015-01-01
Qingbing Wang,1,2 Jianfeng Li,3 Sai An,3 Yi Chen,1 Chen Jiang,3 Xiaolin Wang1,2 1Department of Interventional Radiology, Zhongshan Hospital, Fudan University, 2Shanghai Institute of Medical Imaging, 3Key Laboratory of Smart Drug Delivery, Ministry of Education, Department of Pharmaceutics, School of Pharmacy, Fudan University, Shanghai, People’s Republic of China Background: Gene therapy is a very promising technology for treatment of pancreatic ductal adenocarci...
2013-01-01
Mian BM. Hedgehog Signaling Pathway Activation in Bladder Transitional Cell Carcinoma (TCC). J Urol., 2010, 184(1):344-351. PMID: 20488474 3...Tanner MJ, Welliver RC Jr, Chen M, Shtutman M, Godoy A, Smith G, Mian BM, Buttyan R. Effects of Androgen Receptor and Androgen on Gene Expression in...activities. Proc. Natl. Acad. Sci. USA, 2012, 109(34):13799-804. PMID: 22869755 Manuscripts in Preparation 1. Chen M* (co-first author), Li N*, Carkner
CLEAR: Cross-Layer Exploration for Architecting Resilience
2017-03-01
unavailable, or in an economy mode (low resilience, low power mode) when ABFT is available. However, the overheads outweigh benefits (details in [Cheng 16b...layer r Design, Automation , & Test in Europe, 2010. [Chen 05] Chen, Z. and J. Dong table real number codes based on random m Lecture Notes in...tolerate soft errors in processor c ACM/EDAC/IEEE Design Automation Conf., 2016. [Cheng 16b] Cheng, E., et al. -layer exploration for architecting
Agent Reasoning Transparency: The Influence of Information Level on Automation-Induced Complacency
2017-06-30
automation performance using working memory capacity. Ergonomics . 2014;57(3):295–318. Barber D, Davis L, Nicholson D, Finkelstein N, Chen JYC. The...ELEMENT NUMBER 6. AUTHOR(S) Julia L Wright, Jessie YC Chen, Michael J Barnes, and Peter A Hancock 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK ...Appendix C. Cube Comparisons Test 131 Appendix D. Spatial Orientation Test 135 Appendix E. National Aeronautics and Space Administration-Task Load Index
LBA-ECO ND-01 Land Cover Classification, Rondonia, Brazil: 1975-2000
National Aeronautics and Space Administration — This data set provides a time series of land cover classifications for Ariquemes, Ji-Parana, and Luiza, research sites in Rondonia, Brazil. The land cover...
Yunyi Chen, Connie
2012-01-01
SUMMARY Climate change mitigation policy has evolved rapidly both internationally and domestically, especially since the introduction of Kyoto Protocol flexible mechanisms - Clean Development Mechanism (CDM), Joint Implementation (JI) and Emission Tradin
Czech Academy of Sciences Publication Activity Database
Stloukal, P.; Pekařová, S.; Kalendová, A.; Mattausch, H.; Laske, S.; Holzer, C.; Chitu, L.; Bodner, S.; Maier, G.; Šlouf, Miroslav; Koutný, M.
2015-01-01
Roč. 42, August (2015), s. 31-40 ISSN 0956-053X Institutional support: RVO:61389013 Keywords : composting * biodegradability * polylactic acid Subject RIV: JI - Composite Materials Impact factor: 3.829, year: 2015
Polysulfone-based anion exchange polymers for catalyst binders in alkaline electrolyzers
Czech Academy of Sciences Publication Activity Database
Schauer, Jan; Žitka, Jan; Pientka, Zbyněk; Křivčík, J.; Hnát, J.; Bouzek, K.
2015-01-01
Roč. 132, č. 40 (2015), 42581_1-42581_7 ISSN 0021-8995 Institutional support: RVO:61389013 Keywords : degradation * electrochemistry * membranes Subject RIV: JI - Composite Materials Impact factor: 1.866, year: 2015
Chen YC; Ho HO; Chiu CC; Sheu MT
2013-01-01
Ying-Chen Chen,1,* Hsiu-O Ho,1,* Chiao-Chi Chiu,1 Ming-Thau Sheu1,2 1School of Pharmacy, College of Pharmacy, Taipei Medical University, 2Clinical Research Center and Traditional Herbal Medicine Research Center, Taipei Medical University Hospital, Taipei, Taiwan*These authors contributed equally to this workAbstract: In this study, alendronate, the most commonly used biphosphonate for treating osteoporosis, was formulated as gastroretentive dosage form (GRDF) tablets to enhance its oral bioav...
Chen,Wei; Ju,Jing; Yang,Yehong; Wang,Hao; Chen,Wenjie; Zhao,Xuelan; Ye,Hongying; Zhang,Yu
2018-01-01
Wei Chen,1 Jing Ju,1 Yehong Yang,2 Hao Wang,3 Wenjie Chen,1 Xuelan Zhao,1 Hongying Ye,2 Yu Zhang1 1Department of Geriatrics, Huashan Hospital, Fudan University, Shanghai, China; 2Department of Endocrinology, Huashan Hospital, Fudan University, Shanghai, China; 3Core Center of Animal Facility, School of Medicine, Fudan University, Shanghai, China Introduction: Diabetic cardiomyopathy is characterized by an imbalance between myocyte death and regeneration mediated by the progressive loss of c...
Reforming China’s Criminal Procedure Law
Winckler, Hugo
2014-01-01
Sources:- Wang Jianxun, “The provisions of the reform of criminal procedural law legalising secret investigations are a step backwards,” Caijing wang, 5 September 2011.- Chen Youxi, “The legalisation of secret investigations is an important violation of political integrity,” Zhongguo wangluo dianshitai – CNTV web site, Opinion section, 27 November 2011.- Wu Zhehua, “Chen Weidong discusses reform of the criminal procedure law: Behind each article there is a story,” Zhongguoguangbo wang, 8 Marc...
Chen, Ming; Anderson, Erik; Hill, Geoffrey; Chen, John J; Patrianakos, Thomas
2015-01-01
Ming Chen,1 Erik Anderson,2 Geoffrey Hill,3 John J Chen,4 Thomas Patrianakos2 1Department of Surgery, University of Hawaii, Honolulu, HI, 2Department of Ophthalmology, John H Stroger, Jr Hospital of Cook County, Chicago, IL, 3Department of Ophthalmology, UT Southwestern Medical Center, Dallas, TX, 4Biostatistics Core, John A Burns School of Medicine, University of Hawaii, Honolulu, HI, USA Purpose: To compare cumulative dissipated energy between two phacoemulsification mac...
Chen, Ming; Sweeney, Henry W; Luke, Becky; Chen, Mindy; Brown, Mathew
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Chen, Ming
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Tung, Li-Chen; Lin, Chin-Kai; Hsieh, Ching-Lin; Chen, Ching-Chi; Huang, Chin-Tsan; Wang, Chun-Hou
2013-01-01
Li-Chen Tung,1,# Chin-Kai Lin,2,# Ching-Lin Hsieh,3,4 Ching-Chi Chen,1 Chin-Tsan Huang,1 Chun-Hou Wang5,6 1Department of Physical Medicine and Rehabilitation, Chi Mei Medical Center, Tainan, 2Program of Early Intervention, Department of Early Childhood Education, National Taichung University of Education, Taichung, 3School of Occupational Therapy, College of Medicine, National Taiwan University, Taipei, 4Department of Physical Medicine and Rehabilitation, National Taiwan University Hospital, ...
Lanthanide metal-organic frameworks
International Nuclear Information System (INIS)
Cheng, Peng
2015-01-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Lanthanide metal-organic frameworks
Energy Technology Data Exchange (ETDEWEB)
Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry
2015-03-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Description of execution time dynamics for a set of concurrent real-time tasks
Directory of Open Access Journals (Sweden)
Pedro Guevara López
2011-01-01
Full Text Available Un Sistema en Tiempo Real (STR implantado en una computadora digital, interactúa con el mundo físico a través del acondicionamiento de variables (sensores, actuadores convertidores Analógico/Digital A/D y Digital/ Analógico D/A y procesa sus peticiones mediante tareas en tiempo real (Ji: i¿Z+. Cada Ji está formada por un conjunto de instancias {ji,k: i, k¿Z+, i es el índice de la tarea, k es el índice de la instancia} con al menos tres restricciones temporales: tiempo de arribo, tiempo de ejecución y plazo (Li,k, Ci,k, Di,k. En este sentido, es importante proponer un modelo para reconstruir el comportamiento de los tiempos de ejecución Ci,k. El modelo propuesto es un ARMA con un estimador de parámetros basado en la variable instrumental. Los tiempos de ejecución fueron medidos experimentalmente en QNX Neutrino 6.5 utilizando un procesador Intel Core i7 de 2.66 GHz. Se presentan los antecedentes teóricos del modelado de tareas en tiempo real, las mediciones de tiempo de ejecución, el modelo de tiempos de ejecución, el estimador de parámetros con variable instrumental, la experimentación y los resultados.
A Study of Sasin-Animal Sky Map on Chonmunryucho
Directory of Open Access Journals (Sweden)
Hong-Jin Yang
2003-03-01
Full Text Available Chon-Mun-Ryu-Cho, written (edited by Lee Sun-Ji during the period of King Se-Jong, is a representative astronomy book of Cho-Sun (A.D. 1392 -1910 Dynasty. We find and study in the first page of the book; the description of 28 oriental constellations as a Sasin (four mythical oriental animals-animal sky map which is not widely known yet. The map consists of four groups of constellations, each of which represents the Sasin: Chang-Ryong (dragon, Baek-Ho (tigers with Ki-Rin [Oriental giraffe], Ju-Jak (Chinese phoenix, Hyun-Mu (a tortoise interwined with a snake. Each group (animals spans 2˜7 of 28 oriental constellations As we know from the illustration of the Chon-Sang-Yol-Cha-Bun-Ya-Ji-Do a representative sky map of Cho-Sun Dynasty, astronomy in Cho-Sun Dynasty is closely related to that in Go-Gu-Ryer (B.C. 37 -A.D. 668 Dynasty. Since these Sasin-animals appear in most mural paintings of Go-Gu-Ryer tombs, visualization of sky with these animal constellations could have been established as early as in Go-Gu-Ryer Dynasty. We also reconstruct this ''A Sasin-animal Korean sky map'' based on the shapes of the Sasin and Ki-Rin from Go-Gu-Ryer paintings and 28 oriental constellations in Chon-Sang-Yol-Cha-Bun-Ya-Ji-Do.
Tancova muzika v răkopisite na učitelja Irži Chartăl (1781–1849) ot Stara Paka
Czech Academy of Sciences Publication Activity Database
Vejvoda, Zdeněk
2015-01-01
Roč. 41, č. 4 (2015), s. 491-512 ISSN 0323-9861 Institutional support: RVO:68378076 Keywords : folk dance * ethnomusicology * ethnochoreology * Jiří Hartl * music collections Subject RIV: AC - Archeology, Anthropology, Ethnology
Filler Fraction Effect on Creep Response of Crosslinked Polyester Matrix with Mineral Filler
Czech Academy of Sciences Publication Activity Database
Hristova, J.; Minster, Jiří
Vol. 89, - (2003), s. 3329-3335 ISSN 0021-8995 Institutional research plan: CEZ:AV0Z2071913 Keywords : polyester composites * creep * ageing Subject RIV: JI - Composite Materials Impact factor: 1.017, year: 2003
Trends in Spina Bifida and Anencephalus in the United States, 1991-2006
... Picciano MF, Rader JI, et al. Blood folate levels: The latest NHANES results. NCHS data brief, no 6. Hyattsville, MD: National Center for Health Statistics. 2008. Martin JA, Hamilton BE, Sutton PD, Ventura ...
Jižní Sachalin: Rusko, Japonsko, SSSR/Rusko
Czech Academy of Sciences Publication Activity Database
Kolejka, Jaromír
2013-01-01
Roč. 127, č. 3 (2013), s. 1-5 ISSN 1214-083X Institutional support: RVO:68145535 Keywords : Karafuto * history * economy * population * present state Subject RIV: DE - Earth Magnetism, Geodesy, Geography http://zemces.sweb.cz/cislo127.htm
Joint implementation initiatives in South Africa: A case study of two energy-efficiency projects
Energy Technology Data Exchange (ETDEWEB)
Van Horen, C.; Simmonds, G.; Parker, G.
1998-11-01
This paper explores the issues pertinent to Joint Implementation (JI) in South Africa by examining two prototype potential projects on energy efficiency with the potential for reducing greenhouse gas (GHG) emissions. The first is an energy-efficient lighting project based on the public electricity utility, Eskom's plan for a compact fluorescent lighting program in the residential sector. The analysis indicates that the CFL program could avoid emissions of up to 243 thousand tons of carbon over the first five years, at negative cost (that is, with a positive economic return). The second project involves the delivery of passive solar, energy-efficient housing to a low-income township in the Western Cape Province, at an incremental capital cost of approximately $2.5m for the 6000 houses. In this case, the avoided GHG emissions over the first five years amount to between 14 and 20 tons of carbon, and over the 50 year life-span of the project it will result to 140 to 200 thousand tons of avoided emissions at a cost of $13 to $17 per ton. The housing project has significant non-GHG benefits such as savings on energy bills and health, which accrue to the low-income dwellers. A number of important JI-specific issues and concerns emerge with respect to the two projects, which can also be applied to other potential JI opportunities in the country generally. These include the issues of carbon credit sharing, for which a number of scenarios are suggested, as well as estimating unknown macroeconomic impacts, such as the effects of CFLs on the country's incandescent lighting industry. Findings from an examination of both potential projects conclude that capacity-building within the country is critical to ensure that the technology being transferred balances efficiency, cost and quality appropriate to the South African context. Finally, assessment and evaluation, monitoring and verification criteria and institutions are called for to guarantee measurable long
Anaforiniai įvardžiai - daiktavardžių variantai
Adelė Valeckienė
2011-01-01
АНАФОРИЧЕСКИЕ МЕСТОИМЕНИЯ - ВАРИАНТЫ ИМЕН СУЩЕСТВИТЕЛЬНЫХРезюмеВ статье рассматриваются системные отношения между анафорическими местоимениями как вариантами имен существительных.В литовском языке, кроме jis, ji, позиционными вариантами имен существительных являются также следующие местоимения анафорического значения: tas, ta, šis, ši, šitas, šita, anas, ana, tas pats, ta pati, (jis) pats, (ji) pati, jis visas, ji visa, jis vienas, ji viena, kuris, kuri, katras, katra и др. Когда упомянутые ...
Vaher, Vaapo, 1945-
2001-01-01
Sisu : Lloyd Alexander. Llyri loss; Lloyd Alexander. Rändur Taran; Skomantas. Teutoonide vang. Lühidalt ka Otfried Preussleri, Thorbjırn Egneri, Vitezlav Nezvali, Jỉi Trnka, Aino Perviku ja Ellen Niidu raamatutest
The combination of meltblown and electrospinning for bone tissue engineering
Czech Academy of Sciences Publication Activity Database
Erben, J.; Pilařová, K.; Sanetrník, F.; Chvojka, J.; Jenčová, V.; Blažková, L.; Havlíček, J.; Novák, O.; Mikeš, P.; Prosecká, Eva; Lukáš, D.; Kuželová Kostaková, E.
2015-01-01
Roč. 143, mar 15 (2015), s. 172-176 ISSN 0167-577X Institutional support: RVO:68378041 Keywords : meltblown * electrospinning * tissue engineering * polycaprolactone Subject RIV: JI - Composite Materials Impact factor: 2.437, year: 2015
Weight-loss surgery - after - what to ask your doctor
... Accessed February 2, 2017. Mechanick JI, Youdim A, Jones DB, et al. Clinical practice guidelines for the ... Elsevier; 2017:chap 47. Read More Body mass index Coronary heart disease Gastric bypass surgery Laparoscopic gastric ...
Weight-loss surgery and children
... to the extra body weight. The body mass index (BMI) measures below are used by many doctors ... Saunders; 2015:chap 29. Mechanick JI, Youdim A, Jones DB, et al. Clinical practice guidelines for the ...
Scattering of plane waves by rough surfaces in the sense of Born approximation
Arnold, Thomas
2014-01-01
Das Thema dieser Arbeit ist die Streuung elektromagnetischer ebener Wellen an rauen Oberflächen, also an ebenen Oberflächen mit glatten und beschränkten Störungen. Darüber hinaus wird ein kleiner Kontrast der Materialkonstanten zwischen dem Deckmaterial und dem Material unter der rauen Oberfläche angenommen. Unter diesen Voraussetzungen wird ein Fernfeld-Formel für das gestreute Feld mit Hilfe von Born-Approximation und Fourier-Techniken hergeleitet. Dieser Ansatz basiert auf einer Modifikati...
Distributed mechatronics controller for modular wall climbing robot
CSIR Research Space (South Africa)
Tlale, NS
2006-07-01
Full Text Available - climbing robot for inspection in nuclear power plants.”, Proc. IEEE Int. Conf. on Robotics and Automation, pp. 409-1414. (Chen 2001) Chen, D-. J., 2001, “Architecture for Systematic Development of Mechatronics Software Systems”, Licentiate Thesis... provide a more cost effective solution to the problem (Luk et al 1991). Such robots are termed service robots by the International Service Robot Association (ISRA) (Pransky 1996). They are defined as machines that sense, think, and act to benefit (or...
Bai,Fang; Yin,You; Chen,Ting; Chen,Jihui; Ge,Meixin; Lu,Yunshu; Xie,Fangyuan; Zhang,Jian; Wu,Kejin; Liu,Yan
2018-01-01
Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng...
Chen,Hong; Xu,Hong; Meng,Yugang; Zhang,Yun; Chen,Junying; Wei,Xiaoning
2016-01-01
Hong Chen,1 Hong Xu,1 Yu-gang Meng,1 Yun Zhang,2 Jun-ying Chen,1 Xiao-ning Wei1 1Department of Gynaecology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi, 2Department of Gynaecology, The People’s Hospital of Suzhou High Tech District, Suzhou, Jiangsu, People’s Republic of China Background: Uterine leiomyoma is one of the most common benign tumors in women. It dramatically decreases the quality of life in the affected women. However, there ...
Directory of Open Access Journals (Sweden)
Haoyu Liu
2017-03-01
Full Text Available A second species of Qingryllus Chen & Zheng is described and illustrated, Q. jiguanshanensis sp. n., from Sichuan, China. This new species is similar to Q. striofemorus Chen & Zheng, 1995, but differs from the latter by the posterior margin of pronotum being distinctly widened, the veins of tegmina yellowish-white only on lateral side of dorsal area, and the epiphallus distinctly widened posteriorly. A distribution map of the species of this genus and habitus photographs of the new species are presented.
Is the Chinese Army the Real Winner in PLA Reforms
2016-10-01
44 Commentary / The Chinese Army and PLA Reforms JFQ 83, 4th Quarter 2016 Is the Chinese Army the Real Winner in PLA Reforms? By Phillip C. Saunders...and John Chen G round force officers run China’s military, the People’s Liberation Army ( PLA ). About 70 percent of PLA soldiers serve in the PLA ...Saunders and Chen 45 services and arms of the PLA ” has meant reductions in “technologically backward” PLAA units and personnel increases for the other
Gauss Seidel-type methods for energy states of a multi-component Bose Einstein condensate
Chang, Shu-Ming; Lin, Wen-Wei; Shieh, Shih-Feng
2005-01-01
In this paper, we propose two iterative methods, a Jacobi-type iteration (JI) and a Gauss-Seidel-type iteration (GSI), for the computation of energy states of the time-independent vector Gross-Pitaevskii equation (VGPE) which describes a multi-component Bose-Einstein condensate (BEC). A discretization of the VGPE leads to a nonlinear algebraic eigenvalue problem (NAEP). We prove that the GSI method converges locally and linearly to a solution of the NAEP if and only if the associated minimized energy functional problem has a strictly local minimum. The GSI method can thus be used to compute ground states and positive bound states, as well as the corresponding energies of a multi-component BEC. Numerical experience shows that the GSI converges much faster than JI and converges globally within 10-20 steps.
Erding AS, Munchen, Germany. Revised Uniform Summary of Surface Weather Observations (RUSSWO)
1971-10-22
34TMAN FULL MONt’s/ MEAR . AN. FEB MAR. APR MAY JUN JUL AUG SEP OCT NOV AL MONT MONOALL S’" NOPALL ____ ____ * I!. _ _ .... G UWif , --- ° LiZLIK - _ ----I...0 .Ji , i -0 6,6 10i2 W 2,) 4.§ji 1,2 60 16,9 9,0 WNW .2 a .1Q .so ._1& NW .,8 . 7 ._ 1 ._ 1_3_ I_ gas -W -1 . .1 _ 4o9 VARl CALM ~3> ~c ~j5...OBSERVATIONS 1036 IV z . ’.. Z - ] | . --- U S A F E T A C . , 0 8 -5 ( O L -1 ) 0 9 v iv i S 11D I O N S O F T H IS .F O R M A X I O ,S O L . gA I 0. .1
The Jan Deyl Conservatory and 105 years since the opening of the Deyl Institute for the Blind
Czech Academy of Sciences Publication Activity Database
Vytlačil, Lukáš
č. 4 (2015), s. 18-20 ISSN 1211-0264 Institutional support: RVO:68378076 Keywords : conservatories * music schools * blind s * Jan Deyl * Jiří Drtina * Jan Deyl Conservatory Subject RIV: AL - Art, Architecture, Cultural Heritage
African Journals Online (AJOL)
user
2 Department of Mathematics, University of Botswana, Private Bag 0022, Goborone, ...... Special Functions of Applied Mathematics, Academic Press, New York. ... Shilesh Kumari is a research scholar doing her Ph. D. from Chhatrapati Sahu Ji ...
International Nuclear Information System (INIS)
Taherkhani, Farid; Akbarzadeh, Hamed; Feyzi, Mostafa; Rafiee, Hamid Reza
2015-01-01
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models
Energy Technology Data Exchange (ETDEWEB)
Taherkhani, Farid, E-mail: faridtaherkhani@gmail.com, E-mail: f.taherkhani@razi.ac.ir [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of); Akbarzadeh, Hamed [Hakim Sabzevari University, Department of Chemistry (Iran, Islamic Republic of); Feyzi, Mostafa; Rafiee, Hamid Reza [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of)
2015-01-15
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models.
Genetic diversity and population structure of Chinese honeybees ...
African Journals Online (AJOL)
user
2011-02-28
Feb 28, 2011 ... honeybees (Apis cerana) under microsatellite markers. Ting Ji, Ling Yin and ... from Apis mellifera introduced into China since 1896 (Yang, 2005). With the ..... Commercial and Feral Honey Bees in Western Australia. J. Econ.
Czech Academy of Sciences Publication Activity Database
Khunová, V.; Kelnar, Ivan; Liauw, C. M.; Lukáč, P.
2011-01-01
Roč. 18, č. 4 (2011), s. 357-370 ISSN 0927-6440 Institutional research plan: CEZ:AV0Z40500505 Keywords : nanocomposite * reactive processing * polyolefins Subject RIV: JI - Composite Materials Impact factor: 0.438, year: 2011
Bulletin of Materials Science | News
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science; Volume 39; Issue 1 .... Na + /B 3 + phosphor has a potential application in white light-emitting diodes based ... College of Mathematics and Physics, Jinggangshan University, Ji'an 343009, China ...
Li, Feng; Chen, Yan; Liu, Shubo; Qi, Jian; Wang, Weiying; Wang, Chenhua; Zhong, Ruiyue; Chen, Zhijun; Li, Xiaoming; Guan, Yuanzhou; Kong, Wei; Zhang, Yong
2017-01-01
Feng Li,1 Yan Chen,1,2 Shubo Liu,1 Jian Qi,1 Weiying Wang,1 Chenhua Wang,1 Ruiyue Zhong,1 Zhijun Chen,1 Xiaoming Li,1 Yuanzhou Guan,1 Wei Kong,1,2 Yong Zhang1,2 1National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, 2Key Laboratory for Molecular Enzymology and Engineering, the Ministry of Education, School of Life Sciences, Jilin University, Changchun, China Abstract: Zein-based nano/microparticles have been demonstrated to be promising carr...
International Nuclear Information System (INIS)
Hu Manfeng; Xu Zhenyuan; Zhang Rong; Hu Aihua
2007-01-01
Based on the active control idea and the invariance principle of differential equations, a general scheme of adaptive full state hybrid projective synchronization (FSHPS) and parameters identification of a class of chaotic (hyper-chaotic) systems with linearly dependent uncertain parameters is proposed in this Letter. With this effective scheme parameters identification and FSHPS of chaotic and hyper-chaotic systems can be realized simultaneously. Numerical simulations on the chaotic Chen system and the hyper-chaotic Chen system are presented to verify the effectiveness of the proposed scheme
2013-10-01
Wu K, Wang L, Jiao X, Ju X, Li Z, Ertel A, Addya S, McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. Androgen therapy resistant...Li Z, Hu J, Chen K, Wu J, Pestell RG. DACH1 inhibited prostate cancer cellular proliferation and Interleukon-6 signaling. AACR 103rd Annual Meeting...March 31 – April 4, 2012, Chicago, IL. Wang J, Cai S, Chen K, Sun Y, Li S, Pestell RG, Wu K. Regulation of AR transcriptional activity and
Directory of Open Access Journals (Sweden)
Martha C. Martínez Quintanilla
2017-04-01
Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.
Mapping of quantitative trait loci controlling Orobanche foetida Poir ...
African Journals Online (AJOL)
Mapping of quantitative trait loci controlling Orobanche foetida Poir. resistance in faba bean (Vicia faba L.) R Díaz-Ruiz, A Torres, MV Gutierrez, D Rubiales, JI Cubero, M Kharrat, Z Satovic, B Román ...
Creep-rupture strength prediction of an epoxy composite under tension
Czech Academy of Sciences Publication Activity Database
Krastev, R.K.; Zachariev, G.; Hristova, J.; Minster, Jiří
2009-01-01
Roč. 13, č. 2 (2009), s. 207-214 ISSN 1385-2000 Institutional research plan: CEZ:AV0Z20710524 Keywords : materials testing * creep * strength prediction Subject RIV: JI - Composite Materials Impact factor: 1.051, year: 2009
African Journals Online (AJOL)
Items 301 - 350 of 437 ... Vol 4, No 2 (2007), Rural telephony: challenges before the Nigerian Telecoms stakeholders and the citizenry, Abstract ... Vol 11, No 1 (2014), Strategies for marketing library services by ... JI Adeyomoye, P Adeniran.
Molecular cloning and characterization of a novel human kinase ...
Indian Academy of Sciences (India)
Unknown
LINGCHEN GUO, CHAONENG JI, SHAOHUA GU, KANG YING, HAIPENG CHENG,. XIAOGHUA NI ... minal LIM domain proteins that cantain a PDZ domain at the amino terminal ..... Taira M., Evrard J. L., Steinmetz A. and Dawid I. B. 1995.
Vliv vlastností tepelně ovlivněné oblasti podélného svaru na integritu plynovodního potrubí
Czech Academy of Sciences Publication Activity Database
Gajdoš, Lubomír; Šperl, Martin; Brynych, A.
2015-01-01
Roč. 95, č. 1 (2015), s. 4-10 ISSN 0032-1761 R&D Projects: GA TA ČR(CZ) TE02000162 Institutional support: RVO:68378297 Keywords : pipelines * heat affected zone * longitudinal weld Subject RIV: JI - Composite Materials
African Journal of Biotechnology - Vol 4, No 10 (2005)
African Journals Online (AJOL)
Agroeconomic evaluation of black Sigatoka resistant hybrid plantains under smallholder management systems · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. JI Lemchi, CI Ezedinma, M Tshiunza, M Tenkouano, BO Faturoti ...
Observed seasonal and intraseasonal variability of the East India ...
Indian Academy of Sciences (India)
Currents Analyses Real-time), ECCO2 (Estimating the Circulation and Climate ...... vessel management group for their support. ... Behringer D W, Ji M and Leetmaa A 1998 An improved .... productivity in the Bay of Bengal during fall and spring.
Evaluation of an HIV/AIDS peer education programme South African ...
African Journals Online (AJOL)
HIV I AIDS peer-education programme for its employees aimed at addressing the growing ..... m:JI education intervention in a mining community reports essentially no effect.17 ... yet to be determined. Such data are crucial for the development.
African Journal of Biotechnology - Vol 8, No 5 (2009)
African Journals Online (AJOL)
Mixed chemical-induced oxidative stress in occupational exposure in Nigerians · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. JI Anetor, SA Yaqub, GO Anetor, AC Nsonwu, FAA Adeniyi, S Fukushima ...
African Journals Online (AJOL)
Rotman. Pp. xxiv + 481. NLG480/US$245. Amsterdam: Elsevier. Science. 1998. ISBN 0-444-82608-4. New Trends ... Advances in Neutron Capture. Vol. I: Medicine and Physics. Vol. JI : Chemistry and Biology. * Edited by Borje Larsson, John.
Identification of salt-stress induced differentially expressed genes in ...
African Journals Online (AJOL)
Identification of salt-stress induced differentially expressed genes in barley leaves using the annealingcontrol- primer-based GeneFishing technique. S Lee, K Lee, K Kim, GJ Choi, SH Yoon, HC Ji, S Seo, YC Lim, N Ahsan ...
Convenient Reduction of Carbonyl Compounds to their ...
African Journals Online (AJOL)
NICO
Alcohols and their derivatives occupy an important position in organic synthesis. ... review also reveals that the reduction of carbonyl compounds ..... 1 H.B. Ji and Y.B. She, Green Oxidation and Reduction, China Petrochemi- cal Press, Beijing ...
Czech Academy of Sciences Publication Activity Database
Kuthanová, V.; Hausnerová, B.; Kitano, T.; Lapčíková, Monika; Sáha, P.
2011-01-01
Roč. 119, č. 2 (2011), s. 989-999 ISSN 0021-8995 Institutional research plan: CEZ:AV0Z40500505 Keywords : polymer composites * injection molded compression * morphology Subject RIV: JI - Composite Materials Impact factor: 1.289, year: 2011
Miranda, David A.; Sanchez, Melba J.; Forero, Oscar M.
2017-06-01
The implementation of the JiTT (Just in Time Teaching) strategy is presented to increase the previous preparation of students enrolled in the subject Physics Laboratory I offered at the Industrial University of Santander (UIS), Colombia. In this study, a laboratory preparation questionnaire (CPL) was applied as a tool for the implementation of JiTT combined with elements of mediated learning. It was found that the CPL allows to improve the students’ experience regarding the preparation of the laboratory and the development of the experimental session. These questionnaires were implemented in an academic manager (Moodle) and a web application (lab.ciencias.uis.edu.co) was used to publish the contents essential for the preparation of the student before each practical session. The most significant result was that the students performed the experimental session with the basic knowledge to improve their learning experience.
Andris Bojarevičs
2014-01-01
ANOTĀCIJA Promocijas darbs veidots kā paplašināts kopsavilkums par 18 zinātnisku publikāciju kopu, kas veltīta šķidru metālu kustības dinamikai noslēgtos tilpumos apstākļos, kad to ietekmē ārēji uzlikts magnētiskais lauks, kā pastāvīgs, tā arī laikā mainīgs. Praktiski visi darbi ir autora plānotu un realizētu fizikālu eksperimentālu modeļu izpētes izklāsts, kas iekļaujas magnētiskās hidrodinamikas jomā. Darbā atspoguļoti eksperimentālie rezultāti par dažādu ārēji rosinātu faktoru veidotu ...
General solution of superconvergent sum rules for scattering of I=1 reggeons on baryons
International Nuclear Information System (INIS)
Grigoryan, A.A.; Khachatryan, G.N.
1986-01-01
Superconvergent sum rules for reggeon-particle scattering are applied to scattering of reggeons α i (i=π, ρ, A 2 ) with isospin I=1 on baryons with strangeness S=-1. The saturation scheme of these sum rules is determined on the basis of experimental data. Two series of baryon resonances with arbitrary isospins I and spins J=I+1/2 and J=I-1/2 are predicted. A general solution for vertices of interaction of these resonances with α i is found. Predictions for coupling vertices B α i B'(B, B'=Λ, Σ, Σ * ) agree well with the experiment. It is shown that the condition of sum rules saturation by minimal number of resonances brings to saturation schemes resulting from experimental data. A general solution of sum rules for scattering of α i reggeons on Ξ and Ω hyperons is analyzed
A Brief Introduction of Air Traffic Management
Institute of Scientific and Technical Information of China (English)
1997-01-01
Air Traffic Management (ATM) started publication in 1995 by Air Traffic Management Bureau of CAAC. It is the first magazine about ATM field in CAAC. The chairman of Editorial Board of ATM is Mr. Bao Peide, Vice Minister of CAAC. Mr. Chen Ziye, Vice President of the 1st Research Institute of CAAC and Chen Xuhua, General Director of Air Traffic Management Bureau are vice chairmen of the editorial board, and six general directors of local air traffic management bureau and some professors and experts are members of the editorial board.
A glimpse into the littoral nutrient dynamics of a lake system connected to the sea
CSIR Research Space (South Africa)
Taljaard, Susan
2018-01-01
Full Text Available -situ sources are those situated in the floodplains of water bodies such as septic tank systems from low-lying developments (e.g. Chen, 1988; Fraterrigo and Downing, 2008). The smaller, dynamic and more linear nature of over 80% of South Africa’s estuaries... of agricultural watersheds in central Navarre (Spain). Agric. Water Manage. 95 1111–1128. https://doi.org/10.1016/j.agwat.2008.06.013 CHEN M (1988) Pollution of ground water by nutrients and fecal coliforms from lakeshore septic tank systems. Water Air Soil...
清末民初における『レ・ミゼラブル』の移入と日本 : 陳景韓訳「哀史之一節逸犯」を例として
梁, 艶; Liang, Yan
2011-01-01
Victor Hugo was introduced into China through his Japanese translations. However, the route of the reception of his masterpiece Les Misérables in China has not yet been explained clearly. In this paper, I will take Ai Shi Zhi Yi Jie Yi Fan, a Chinese translation by Chen Jinghan of a part of Les Misérables, as an example to see how Les Misérables was introduced into China. By examining Japanese translations of Les Misérables, I come to the conclusion that Chen was influenced by Kuroiwa Ruikô's...
The Secret of Guided Missile Re-Entry,
1986-06-25
I RD-PAI169 598 THE SECRET OF GUIDED MISSILE RE-ENTRY(U) FOREIGN / I TECHNOLOGY DIV NRIGHT-PATTERSON RFB OH J CHEN ET AL. I 25 JUN 96 FTD-ID(RS)T...TECHNOLOGY DIVISION THE SECRET OF GUIDED MISSILE RE-ENTRY by Chen Jingzhong, An Sehua J L 0 7 ’:;85’ ’ 0 *Approved for public release; Distribution...unlimite t d. :. 86 7 034.. FTD- ID(RS)T-0459-86 HUMAN TRANSLATION FTD-ID(RS)T-0459-86 25 June 1986 MICROFICHE NR: F - - 0Q 9? THE SECRET OF GUIDED
Initiation and Propagation of Coronal Mass Ejections P. F. Chen
Indian Academy of Sciences (India)
Introduction. Coronal mass ejections (CMEs) have been observed for over 30 years. They keep being an intriguing research topic, not only because they are now realized to be the major driver for space weather disturbances, which are intimately connected to human activities, but also because they themselves are full of ...
Die Beifuß-Ambrosie auf Ackerflächen - ein Problem?
Directory of Open Access Journals (Sweden)
Verschwele, Arnd
2014-07-01
Full Text Available Common ragweed (Ambrosia artemisiifolia is spreading on agricultural fields in Germany, mainly in Brandenburg and Bayern. Competitive crops like winter cereals and oilseed-rape can reduce growth of this plant better than spring crops. In maize or cereals a chemical control is possible, but problems may arise because of the late emergence of ragweed and its high ability to regrowth. In crops like sunflower or lupines herbicide choice is limited and thus preventive control measures are crucial. An integrated approach is needed in order to avoid yield losses and to stop the spreading of ragweed in Germany.
Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen
Directory of Open Access Journals (Sweden)
Ingrid Biermann
2003-03-01
Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.