Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules
Buyukdagli, Sahin
2016-01-01
We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...
Interactions Between Charged Macroions Mediated by Molecules with Rod-like Charged Structures
Directory of Open Access Journals (Sweden)
Bohinc, K.
2014-03-01
Full Text Available A short review of recent theoretical advances in studies of the interaction between highly charged systems embedded in a solution of rod-like molecules is presented. The system is theoretically described by the functional density theory, where the correlations within the rod-like molecules are accounted for. We show that for sufficiently long molecules and large surface charge densities, an attractive force between like-charged surfaces arises due to the spatially distributed charges within the molecules. The added salt has an influence on the condition for the attractive force between like-charged surfaces. The theoretical results are compared with Monte Carlo simulations. Many phenomena motivate the study of the interaction between like-charged surfaces (DNA condensation, virus aggregation, yeast flocculation, cohesion of cement paste.
International Nuclear Information System (INIS)
Hedegard, Per; Bjornholm, Thomas
2005-01-01
The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond
Mezey, Paul G.
2017-11-01
Two strongly related theorems on non-degenerate ground state electron densities serve as the basis of "Molecular Informatics". The Hohenberg-Kohn theorem is a statement on global molecular information, ensuring that the complete electron density contains the complete molecular information. However, the Holographic Electron Density Theorem states more: the local information present in each and every positive volume density fragment is already complete: the information in the fragment is equivalent to the complete molecular information. In other words, the complete molecular information provided by the Hohenberg-Kohn Theorem is already provided, in full, by any positive volume, otherwise arbitrarily small electron density fragment. In this contribution some of the consequences of the Holographic Electron Density Theorem are discussed within the framework of the "Nuclear Charge Space" and the Universal Molecule Model. In the Nuclear Charge Space" the nuclear charges are regarded as continuous variables, and in the more general Universal Molecule Model some other quantized parameteres are also allowed to become "de-quantized and then re-quantized, leading to interrelations among real molecules through abstract molecules. Here the specific role of the Holographic Electron Density Theorem is discussed within the above context.
Ateshian, Gerard A; Nims, Robert J; Maas, Steve; Weiss, Jeffrey A
2014-10-01
Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio ( www.febio.org ). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the
International Nuclear Information System (INIS)
Okuno, Kazuhiko
2007-04-01
Systematic cross section measurements for ion-molecule reactions in hydrogen systems and for charge transfer of multiply charged ions in low energy collisions with atoms and molecules have been performed continuously by the identical apparatus installed with an octo-pole ion beam guide (OPIG) since 1980 till 2004. Recently, all of accumulated cross section data for a hundred collision systems has been entered into CMOL and CHART of the NIFS atomic and molecular numerical database together with some related cross section data. In this present paper, complicated ion-molecule reactions in hydrogen systems are revealed and the brief outlines of specific properties in low energy charge transfer collisions of multiply charged ions with atoms and molecules are introduced. (author)
Interstellar Chemistry Gets More Complex With New Charged-Molecule Discovery
2007-07-01
Astronomers using data from the National Science Foundation's Robert C. Byrd Green Bank Telescope (GBT) have found the largest negatively-charged molecule yet seen in space. The discovery of the third negatively-charged molecule, called an anion, in less than a year and the size of the latest anion will force a drastic revision of theoretical models of interstellar chemistry, the astronomers say. Molecule formation Formation Process of Large, Negatively-Charged Molecule in Interstellar Space CREDIT: Bill Saxton, NRAO/AUI/NSF Click on image for page of graphics and detailed information "This discovery continues to add to the diversity and complexity that is already seen in the chemistry of interstellar space," said Anthony J. Remijan of the National Radio Astronomy Observatory (NRAO). "It also adds to the number of paths available for making the complex organic molecules and other large molecular species that may be precursors to life in the giant clouds from which stars and planets are formed," he added. Two teams of scientists found negatively-charged octatetraynyl, a chain of eight carbon atoms and one hydrogen atom, in the envelope of gas around an old, evolved star and in a cold, dark cloud of molecular gas. In both cases, the molecule had an extra electron, giving it a negative charge. About 130 neutral and about a dozen positively-charged molecules have been discovered in space, but the first negatively-charged molecule was not discovered until late last year. The largest previously-discovered negative ion found in space has six carbon atoms and one hydrogen atom. "Until recently, many theoretical models of how chemical reactions evolve in interstellar space have largely neglected the presence of anions. This can no longer be the case, and this means that there are many more ways to build large organic molecules in cosmic environments than have been explored," said Jan M. Hollis of NASA's Goddard Space Flight Center (GSFC). Ultraviolet light from stars can
Electron stereodynamics in coulomb explosion of molecules by slow highly charged ions
International Nuclear Information System (INIS)
Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko
2008-01-01
The three-center Coulombic over-the-barrier model is developed for Coulomb explosion of a homonuclear diatomic molecule in collisions with a slow (∼10 eV/amu) highly charged ion. A conventional two-step picture of multiple electron transfer followed by Coulomb explosion is far from appropriate because the molecule sets out to dissociate before the incident ion approaches the closest distance. We treat the formation of a quasi-molecule and its decay into the three moving atomic ions. Charge-asymmetric population between fragment ions observed in a triple-coincidence measurement is suggested to reflect the bond elongation during a collision. Collisions of Kr 8+ + N 2 are analyzed. (author)
First Principles Modeling and Interpretation of Ionization-Triggered Charge Migration in Molecules
Bruner, Adam; Hernandez, Sam; Mauger, Francois; Abanador, Paul; Gaarde, Mette; Schafer, Ken; Lopata, Ken
Modeling attosecond coherent charge migration in molecules is important for understanding initial steps of photochemistry and light harvesting processes. Ionization triggered hole migration can be difficult to characterize and interpret as the dynamics can be convoluted with excited states. Here, we introduce a real-time time-dependent density functional theory (RT-TDDFT) approach for modeling such dynamics from first principles. To isolate the specific hole dynamics from excited states, Fourier transform analysis and orbital occupations are used to provide a spatial hole representation in the frequency domain. These techniques are applied to hole transfer across a thiophene dimer as well as core-hole triggered valence motion in nitrosobenzene. This work was supported by U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under Award No. DE-SC0012462.
International Nuclear Information System (INIS)
Kim, Eunae; Yeom, Min Sun
2014-01-01
Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge
Optical Spectroscopy Of Charged Quantum Dot Molecules
Scheibner, M.; Bracker, A. S.; Stinaff, E. A.; Doty, M. F.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.
2007-04-01
Coupling between two closely spaced quantum dots is observed by means of photoluminescence spectroscopy. Hole coupling is realized by rational crystal growth and heterostructure design. We identify molecular resonances of different excitonic charge states, including the important case of a doubly charged quantum dot molecule.
International Nuclear Information System (INIS)
Aleksanyan, V.T.; Samvelyan, S.Kh.
1984-01-01
General principles of plotting the parametric theory of IR spectrum intensities of polyatomic molecules are outlined. The development of the effective charges model in this theory is considered and the mathematical formalism of the first approximation of the method of effective atom charges is described in detail. The results of calculations of charges distribution in the Mo(CO) 6 , W(CO) 6 , Cp 2 V, Cp 2 Ru and others (Cp-cyclopentadiene), performed in the frame work of the outlined scheme are presented. It is shown that in the investigated carbonyles the effective charge on oxygen and metal atoms is negative, on carbon atom - positive. In dicyclopentavienyl complexes the effective charge on the metal atom is positive and is not over 0.6e; charge values on hydrogen and carbon atoms do not exceed, 0.10-0.15e. The notions of ''electrovalence'' of coordination bond and charge distribution in the case of metallocenes are not correlated
DEFF Research Database (Denmark)
Meneau, Aurélie Y. B.; Olivier, Yoann; Backlund, Tomas
2016-01-01
In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld-effect tran......In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld......-effect transistor and CMS measurements as a function of temperature that in certain molecular semiconductors, such as solution-processible pentacene, charge carriers become trapped at low temperatures in environments in which the charges become highly localized on individual molecules, while in some other molecules...
Anisotropy in highly charged ion induced molecule fragmentation
International Nuclear Information System (INIS)
Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.
2006-01-01
Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)
Kar, Saptarshi; Smith, David W.; Gardiner, Bruce S.; Grodzinsky, Alan J.
2016-01-01
Inflammatory cytokines are key drivers of cartilage degradation in post-traumatic osteoarthritis. Cartilage degradation mediated by these inflammatory cytokines has been extensively investigated using in vitro experimental systems. Based on one such study, we have developed a computational model to quantitatively assess the impact of charged small molecules intended to inhibit IL-1 mediated cartilage degradation. We primarily focus on the simplest possible computational model of small molecular interaction with the IL-1 system—direct binding of the small molecule to the active site on the IL-1 molecule itself. We first use the model to explore the uptake and release kinetics of the small molecule inhibitor by cartilage tissue. Our results show that negatively charged small molecules are excluded from the negatively charged cartilage tissue and have uptake kinetics in the order of hours. In contrast, the positively charged small molecules are drawn into the cartilage with uptake and release timescales ranging from hours to days. Using our calibrated computational model, we subsequently explore the effect of small molecule charge and binding constant on the rate of cartilage degradation. The results from this analysis indicate that the small molecules are most effective in inhibiting cartilage degradation if they are either positively charged and/or bind strongly to IL-1α, or both. Furthermore, our results showed that the cartilage structural homeostasis can be restored by the small molecule if administered within six days following initial tissue exposure to IL-1α. We finally extended the scope of the computational model by simulating the competitive inhibition of cartilage degradation by the small molecule. Results from this model show that small molecules are more efficient in inhibiting cartilage degradation by binding directly to IL-1α rather than binding to IL-1α receptors. The results from this study can be used as a template for the design and
The effect of the charge density on the dipole moment of diatomic molecules
International Nuclear Information System (INIS)
Rosato, A.; Germano, J.S.E.
1986-01-01
The results of the calculation, using the Variational Cellular Method (VCM), of the electric dipole moment of several diatomic molecules are improved. In previous calculations, the electronic charge density was treated like a spherically symmetric function in the inscribed sphere within each cell and as being the same constant value for all intercellular regions. Since the results obtained with such an approximation have not been satisfactory, an improved approximation for the charge density in the intercellular regions is needed. It is considered that the charge density is still constant outside the inscribed sphere but with different values in each intercellular region. A new expression for the dipole moment is obtained, and applied to the diatomic molecules HF, CO, BF and CS. In addition, the corresponding dipole moment curves, potential energy curves and spectroscopic constants are calculated taking into consideration our approximation and the traditional approximation for the charge density. The results of the two models are compared with each other and with experimental results for all the molecules considered. (Author) [pt
Charge migration induced by attosecond pulses in bio-relevant molecules
International Nuclear Information System (INIS)
Calegari, Francesca; Castrovilli, Mattea C; Nisoli, Mauro; Trabattoni, Andrea; Palacios, Alicia; Ayuso, David; Martín, Fernando; Greenwood, Jason B; Decleva, Piero
2016-01-01
After sudden ionization of a large molecule, the positive charge can migrate throughout the system on a sub-femtosecond time scale, purely guided by electronic coherences. The possibility to actively explore the role of the electron dynamics in the photo-chemistry of bio-relevant molecules is of fundamental interest for understanding, and perhaps ultimately controlling, the processes leading to damage, mutation and, more generally, to the alteration of the biological functions of the macromolecule. Attosecond laser sources can provide the extreme time resolution required to follow this ultrafast charge flow. In this review we will present recent advances in attosecond molecular science: after a brief description of the results obtained for small molecules, recent experimental and theoretical findings on charge migration in bio-relevant molecules will be discussed. (topical review)
Modulation and Control of Charge Transport Through Single-Molecule Junctions.
Wang, Kun; Xu, Bingqian
2017-02-01
The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge
Park, Suehyun; Joo, Heesun; Kim, Jun Soo
2018-01-31
Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.
International Nuclear Information System (INIS)
Jean, Y.C.; Yu, C.; Wang, Y.Y.; Yeh, Y.Y.
1984-01-01
Rate constants for positronium atoms reacting chemically with charge-transfer molecules such as p-benzoquinone, nitrobenzene, and coenzyme Q-10 in a model bilayer membrane, dipalmitoylphosphatidylcholine (DPPC), have been measured at temperatures between 23 and 65 0 C. A strong variation of the positronium chemical reactivities, k/sub Ps/ was observed in these systems: k/sub Ps/ increases with increasing temperature until the pretransition temperature of the membrane reaches a maximum value near the main transition temperature and decreases at temperatures higher than the main transition temperature. This variation is interpreted in terms of fluidity and permeability changes associated with the phase transitions of membranes and in terms of charge-transfer-complex formation between the solubilized molecules and the polar head of the membrane. These results demonstrate that positronium and its annihilation characteristics can be employed to investigate charge transport phenomena and microstructural changes of real biological membranes
Charge transport properties of a twisted DNA molecule: A renormalization approach
Energy Technology Data Exchange (ETDEWEB)
Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2016-10-20
In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.
Directory of Open Access Journals (Sweden)
Oleg Meshcheryakov
2010-01-01
Full Text Available In humid air, the substantial charge-dipole attraction and electrostatic acceleration of surrounding water vapour molecules towards charged combustible nanoparticles cause intense electrostatic hydration and preferential oxidation of these nanoparticles by electrostatically accelerated polar water vapour molecules rather than nonaccelerated nonpolar oxygen gas molecules. Intense electrostatic hydration of charged combustible nanoparticles converts the nanoparticle's oxide-based shells into the hydroxide-based electrolyte shells, transforming these nanoparticles into reductant/air core-shell nanobatteries, periodically short-circuited by intraparticle field and thermionic emission. Partially synchronized electron emission breakdowns within trillions of nanoparticles-nanobatteries turn a cloud of charged nanoparticles-nanobatteries into a powerful radiofrequency aerosol generator. Electrostatic oxidative hydration and charge-catalyzed oxidation of charged combustible nanoparticles also contribute to a self-oscillating thermocycling process of evolution and periodic autoignition of inflammable gases near to the nanoparticle's surface. The described effects might be of interest for the improvement of certain nanotechnological heterophase processes and to better understand ball lightning phenomenon.
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
Mandapalli, Praveen K; Labala, Suman; Vanamala, Deekshith; Koranglekar, Manali P; Sakimalla, Lakshmi A; Venuganti, Venkata Vamsi K
2014-12-01
The objective of this study is to investigate the influence of charge of model small molecules on their encapsulation and release behavior in layer-by-layer microcapsules (LbL-MC). Poly(styrene sulfonate) and poly(ethylene imine) were sequentially adsorbed on calcium carbonate sacrificial templates to prepare LbL-MC. Model molecules with varying charge, anionic - ascorbic acid, cationic - imatinib mesylate (IM) and neutral - 5-fluorouracil were encapsulated in LbL-MC. Free and encapsulated LbL-MC were characterized using zetasizer, FTIR spectroscope and differential scanning calorimeter. The influence of IM-loaded LbL-MC on cell viability was studied in B16F10 murine melanoma cells. Furthermore, biodistribution of IM-loaded LbL-MC with and without PEGylation was studied in BALB/c mice. Results showed spherical LbL-MC of 3.0 ± 0.4 μm diameter. Encapsulation efficiency of LbL-MC increased linearly (R(2 )= 0.89-0.99) with the increase in solute concentration. Increase in pH from 2 to 6 increased the encapsulation of charged molecules in LbL-MC. Charged molecules showed greater encapsulation efficiency in LbL-MC compared with neutral molecule. In vitro release kinetics showed Fickian and non-Fickian diffusion of small molecules, depending on the nature of molecular interactions with LbL-MC. At 50 μM concentration, free IM showed significantly (p < 0.05) more cytotoxicity compared with IM-loaded LbL-MC. Biodistribution studies showed that PEGylation of LbL-MC decreased the liver and spleen uptake of IM-encapsulated LbL-MC. In conclusion, LbL-MC can be developed as a potential carrier for small molecules depending on their physical and chemical properties.
Directory of Open Access Journals (Sweden)
Rebecca Boll
2016-07-01
Full Text Available Ultrafast electron transfer in dissociating iodomethane and fluoromethane molecules was studied at the Linac Coherent Light Source free-electron laser using an ultraviolet-pump, X-ray-probe scheme. The results for both molecules are discussed with respect to the nature of their UV excitation and different chemical properties. Signatures of long-distance intramolecular charge transfer are observed for both species, and a quantitative analysis of its distance dependence in iodomethane is carried out for charge states up to I21+. The reconstructed critical distances for electron transfer are in good agreement with a classical over-the-barrier model and with an earlier experiment employing a near-infrared pump pulse.
Krishnan, M.
2017-05-01
We present a model for calculating the net and effective electrical charge of globular macromolecules and linear polyelectrolytes such as proteins and DNA, given the concentration of monovalent salt and pH in solution. The calculation is based on a numerical solution of the non-linear Poisson-Boltzmann equation using a finite element discretized continuum approach. The model simultaneously addresses the phenomena of charge regulation and renormalization, both of which underpin the electrostatics of biomolecules in solution. We show that while charge regulation addresses the true electrical charge of a molecule arising from the acid-base equilibria of its ionizable groups, charge renormalization finds relevance in the context of a molecule's interaction with another charged entity. Writing this electrostatic interaction free energy in terms of a local electrical potential, we obtain an "interaction charge" for the molecule which we demonstrate agrees closely with the "effective charge" discussed in charge renormalization and counterion-condensation theories. The predictions of this model agree well with direct high-precision measurements of effective electrical charge of polyelectrolytes such as nucleic acids and disordered proteins in solution, without tunable parameters. Including the effective interior dielectric constant for compactly folded molecules as a tunable parameter, the model captures measurements of effective charge as well as published trends of pKa shifts in globular proteins. Our results suggest a straightforward general framework to model electrostatics in biomolecules in solution. In offering a platform that directly links theory and experiment, these calculations could foster a systematic understanding of the interrelationship between molecular 3D structure and conformation, electrical charge and electrostatic interactions in solution. The model could find particular relevance in situations where molecular crystal structures are not available or
Large tunable image-charge effects in single-molecule junctions.
Perrin, M.L.; Verzijl, C.J.; Martin, C.A.; Shaikh, A.J.; Eelkema, R.; Esch, J.H. van; Ruitenbeek, J.M. van; Thijssen, J.M.; Zant, H.S. van der; Dulic, D.
2013-01-01
Metal/organic interfaces critically determine the characteristics of molecular electronic devices, because they influence the arrangement of the orbital levels that participate in charge transport. Studies on self-assembled monolayers show molecule-dependent energy-level shifts as well as
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules.
Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin; Huang, Yingzhou
2017-08-02
The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-M x (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-M x complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS.
International Nuclear Information System (INIS)
Usenko, A.S.
1995-01-01
The equilibrium space-inhomogeneous distributions of free and pair bound charged particles are calculated in the dipole approximation for the plasma-molecular cylinder and sphere. It is shown that the space and orientational distributions of charged particles and molecules in these systems are similar to those in the cases of plasma-molecular system restricted by one or two parallel planes. The influence of the parameters of outer medium and a plasma-molecular system on the space and orientational distributions of charged particles and molecules is studied in detail
About the correlation between atomic charge fluctuations in a molecule
International Nuclear Information System (INIS)
Pitanga, P.; Giambiagi, M.S. de; Giambiagi, M.
1987-01-01
In this note, the features of the correlation between the electronic charge fluctuations of a pair of atoms within a molecule are analised. Through Schwarz's inequality for random operators in the Hilbert space, the softness of an atom in a molecule is related to its valence and to the softness of the other atoms. It is concluded that in the general case this correlation (from which in turn stems the chemical bond) in non-linear. (author) [pt
Crystal growth of new charge-transfer salts based on π-conjugated donor molecules
Energy Technology Data Exchange (ETDEWEB)
Morherr, Antonia, E-mail: morherr@stud.uni-frankfurt.de [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Witt, Sebastian [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Chernenkaya, Alisa [Graduate School Materials Science in Mainz, 55128 Mainz (Germany); Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bäcker, Jan-Peter [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Schönhense, Gerd [Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bolte, Michael [Institut für anorganische Chemie, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Krellner, Cornelius [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany)
2016-09-01
New charge transfer crystals of π-conjugated, aromatic molecules (phenanthrene and picene) as donors were obtained by physical vapor transport. The melting behavior, optimization of crystal growth and the crystal structure are reported for charge transfer salts with (fluorinated) tetracyanoquinodimethane (TCNQ-F{sub x}, x=0, 2, 4), which was used as acceptor material. The crystal structures were determined by single-crystal X-ray diffraction. Growth conditions for different vapor pressures in closed ampules were applied and the effect of these starting conditions for crystal size and quality is reported. The process of charge transfer was investigated by geometrical analysis of the crystal structure and by infrared spectroscopy on single crystals. With these three different acceptor strengths and the two sets of donor materials, it is possible to investigate the distribution of the charge transfer systematically. This helps to understand the charge transfer process in this class of materials with π-conjugated donor molecules.
Energy Technology Data Exchange (ETDEWEB)
Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.
2016-07-15
We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.
Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule
Directory of Open Access Journals (Sweden)
Satoshi Ohmura
2016-01-01
Full Text Available Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC-triethylene glycol (TEG–C60 molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D+ and A- in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.
Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule
Energy Technology Data Exchange (ETDEWEB)
Ohmura, Satoshi, E-mail: s.ohmura.m4@cc.it-hiroshima.ac.jp [Research Center for Condensed Matter Physics, Department of Civil Engineering and Urban Design, Hiroshima Institute of Technology, Hiroshima 731-5193 (Japan); Tsuruta, Kenji [Department of Electrical and Electronic Engineering, Okayama University, Okayama 700-8530 (Japan); Shimojo, Fuyuki [Department of Physics, Kumamoto University, Kumamoto 860-8555 Japan (Japan); Nakano, Aiichiro [Collaboratory for Advanced Computing and Simulations, Department of Computer Science, Department of Physics & Astronomy, Department of Chemical Engineering & Materials Science, Department of Biological Sciences, University of Southern California, CA90089-024 (United States)
2016-01-15
Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC)-triethylene glycol (TEG)–C{sub 60} molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D{sup +} and A{sup -}) in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.
Modesto-Costa, Lucas; Borges, Itamar
2018-08-05
The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule is a prototypical system displaying twisted intramolecular (TICT) charge transfer effects. The ground and the first four electronic excited states (S 1 -S 4 ) in gas phase and upon solvation were studied. Charge transfer values as function of the torsion angle between the donor group (dimethylamine) and the acceptor moiety (benzonitrile) were explicitly computed. Potential energy curves were also obtained. The algebraic diagrammatic construction method at the second-order [ADC(2)] ab initio wave function was employed. Three solvents of increased polarities (benzene, DMSO and water) were investigated using discrete (average solvent electrostatic configuration - ASEC) and continuum (conductor-like screening model - COSMO) models. The results for the S 3 and S 4 excited states and the S 1 -S 4 charge transfer curves were not previously available in the literature. Electronic gas phase and solvent vertical spectra are in good agreement with previous theoretical and experimental results. In the twisted (90°) geometry the optical oscillator strengths have negligible values even for the S 2 bright state. Potential energy curves show two distinct pairs of curves intersecting at decreasing angles or not crossing in the more polar solvents. Charge transfer and electric dipole values allowed the rationalization of these results. The former effects are mostly independent of the solvent model and polarity. Although COSMO and ASEC solvent models mostly lead to similar results, there is an important difference: some crossings of the excitation energy curves appear only in the ASEC solvation model, which has important implications to the photochemistry of DMABN. Copyright © 2018 Elsevier B.V. All rights reserved.
Komsa, Darya N; Staroverov, Viktor N
2016-11-08
Standard density-functional approximations often incorrectly predict that heteronuclear diatomic molecules dissociate into fractionally charged atoms. We demonstrate that these spurious charges can be eliminated by adapting the shape-correction method for Kohn-Sham potentials that was originally introduced to improve Rydberg excitation energies [ Phys. Rev. Lett. 2012 , 108 , 253005 ]. Specifically, we show that if a suitably determined fraction of electron charge is added to or removed from a frontier Kohn-Sham orbital level, the approximate Kohn-Sham potential of a stretched molecule self-corrects by developing a semblance of step structure; if this potential is used to obtain the electron density of the neutral molecule, charge delocalization is blocked and spurious fractional charges disappear beyond a certain internuclear distance.
International Nuclear Information System (INIS)
Janev, R.K.; Kato, T.; Wang, J.G.
2001-05-01
The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C x H y charge exchange reactions from thermal energies up to several hundreds keV for all C x H y molecules with x=1, 2, 3 and 1 ≤ y ≤ 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)
Energy Technology Data Exchange (ETDEWEB)
Janev, R.K.; Kato, T. [National Inst. for Fusion Science, Toki, Gifu (Japan); Wang, J.G. [Department of Physics and Astronomy, University of Georgia, Athens (United States)
2001-05-01
The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C{sub x}H{sub y} charge exchange reactions from thermal energies up to several hundreds keV for all C{sub x}H{sub y} molecules with x=1, 2, 3 and 1 {<=} y {<=} 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)
Charge transport in polyguanine-polycytosine DNA molecules
International Nuclear Information System (INIS)
Wei, J H; Chan, K S
2007-01-01
A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules
Energy Technology Data Exchange (ETDEWEB)
Pan, Shanlin [Univ. of Alabama, Tuscaloosa, AL (United States)
2014-11-16
Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest that the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an
Eckenrode, Heather M; Jen, Shih-Hui; Han, Jun; Yeh, An-Gong; Dai, Hai-Lung
2005-03-17
Nonlinear optical probe, second harmonic generation (SHG), of the adsorption of the dye molecule malachite green (MG), in cationic form at pH polystyrene microspheres in aqueous solution is used to study the effect of surface charge and composition on molecular adsorption. Three types of polystyrene microspheres with different surface composition are investigated: (1) a sulfate terminated, anionic surface, (2) a neutral surface without any functional group termination, and (3) an amine terminated, cationic surface. The cationic dye was found to adsorb at all three surfaces, regardless of surface charge. The adsorption free energies, DeltaG's, measured for the three surfaces are -12.67, -12.39, and -10.46 kcal/mol, respectively, with the trend as expected from the charge interactions. The adsorption density on the anionic surface, where attractive charge-charge interaction dominates, is determined by the surface negative charge density. The adsorption densities on the neutral and cationic surfaces are on the other hand higher, perhaps as a result of a balance between minimizing repulsive charge interaction and maximizing attractive molecule-substrate and intermolecular interactions. The relative strength of the SH intensity per molecule, in combination of a model calculation, reveals that the C(2) axis of the MG molecule is nearly perpendicular to the surface on the anionic surface and tilts away from the surface norm when the surface is neutral and further away when cationic. Changing the pH of the solution may alter the surface charge and subsequently affect the adsorption configuration and SH intensity.
Surface-confined electroactive molecules for multistate charge storage information.
Mas-Torrent, M; Rovira, C; Veciana, J
2013-01-18
Bi-stable molecular systems with potential for applications in binary memory devices are raising great interest for device miniaturization. Particular appealing are those systems that operate with electrical inputs since they are compatible with existing electronic technologies. The processing of higher memory densities in these devices could be accomplished by increasing the number of memory states in each cell, although this strategy has not been much explored yet. Here we highlight the recent advances devoted to the fabrication of charge-storage molecular surface-confined devices exhibiting multiple states. Mainly, this goal has been realized immobilizing a variety (or a combination) of electroactive molecules on a surface, although alternative approaches employing non-electroactive systems have also been described. Undoubtedly, the use of molecules with chemically tunable properties and nanoscale dimensions are raising great hopes for the devices of the future in which molecules can bring new perspectives such as multistability.
Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep
2010-01-01
We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than
International Nuclear Information System (INIS)
Wells, E.; Carnes, K.D.; Tawara, H.; Ali, R.; Sidky, Emil Y.; Illescas, Clara; Ben-Itzhak, I.
2005-01-01
A coincidence time-of-flight technique coupled with projectile charge state analysis was used to study electron capture in collisions between slow highly charged ions and hydrogen molecules. We found single electron capture with no target excitation to be the dominant process for both C 6+ projectiles at a velocity of 0.8 atomic units and Ar 11+ projectiles at v 0.63 a.u. Double electron capture and transfer excitation, however, were found to be comparable and occur about 30% of the time relative to single capture. Most projectiles (96%) auto-ionize quickly following double capture into doubly excited states. The data are compared to classical and quantum mechanical model calculations
Bond charges and electronic charge transfer in ternary semiconductors
International Nuclear Information System (INIS)
Pietsch, U.
1986-01-01
By means of a simple molecule-theoretic model of 'linear superposition of two-electron molecules' the bond charges between nearest neighbours and the effective charges of ions are calculated for ternary zinc-blende structure alloys as well as chalcopyrite semiconductors. Taking into account both, the charge transfer among the ions caused by the differences of electronegativities of atoms used and between the bonds created by the internal stress of the lattice a nearly unvaried averaged bond charge amount of the alloy is found, but rather dramatically changed local bond charge parameters in comparison with the respective values of binary compounds used. This fact should influence the noncentral force interaction in such semiconductors. (author)
Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy
International Nuclear Information System (INIS)
Lee, Min Hyung; Song, Hyunwook
2013-01-01
We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects
The charge-asymmetric nonlocally determined local-electric (CANDLE) solvation model
Energy Technology Data Exchange (ETDEWEB)
Sundararaman, Ravishankar; Goddard, William A. [Joint Center for Artificial Photosynthesis, Pasadena, California 91125 (United States)
2015-02-14
Many important applications of electronic structure methods involve molecules or solid surfaces in a solvent medium. Since explicit treatment of the solvent in such methods is usually not practical, calculations often employ continuum solvation models to approximate the effect of the solvent. Previous solvation models either involve a parametrization based on atomic radii, which limits the class of applicable solutes, or based on solute electron density, which is more general but less accurate, especially for charged systems. We develop an accurate and general solvation model that includes a cavity that is a nonlocal functional of both solute electron density and potential, local dielectric response on this nonlocally determined cavity, and nonlocal approximations to the cavity-formation and dispersion energies. The dependence of the cavity on the solute potential enables an explicit treatment of the solvent charge asymmetry. With four parameters per solvent, this “CANDLE” model simultaneously reproduces solvation energies of large datasets of neutral molecules, cations, and anions with a mean absolute error of 1.8 kcal/mol in water and 3.0 kcal/mol in acetonitrile.
Anisotropic charge transport in large single crystals of π-conjugated organic molecules.
Hourani, Wael; Rahimi, Khosrow; Botiz, Ioan; Koch, Felix Peter Vinzenz; Reiter, Günter; Lienerth, Peter; Heiser, Thomas; Bubendorff, Jean-Luc; Simon, Laurent
2014-05-07
The electronic properties of organic semiconductors depend strongly on the nature of the molecules, their conjugation and conformation, their mutual distance and the orientation between adjacent molecules. Variations of intramolecular distances and conformation disturb the conjugation and perturb the delocalization of charges. As a result, the mobility considerably decreases compared to that of a covalently well-organized crystal. Here, we present electrical characterization of large single crystals made of the regioregular octamer of 3-hexyl-thiophene (3HT)8 using a conductive-atomic force microscope (C-AFM) in air. We find a large anisotropy in the conduction with charge mobility values depending on the crystallographic orientation of the single crystal. The smaller conduction is in the direction of π-π stacking (along the long axis of the single crystal) with a mobility value in the order of 10(-3) cm(2) V(-1) s(-1), and the larger one is along the molecular axis (in the direction normal to the single crystal surface) with a mobility value in the order of 0.5 cm(2) V(-1) s(-1). The measured current-voltage (I-V) curves showed that along the molecular axis, the current followed an exponential dependence corresponding to an injection mode. In the π-π stacking direction, the current exhibits a space charge limited current (SCLC) behavior, which allows us to estimate the charge carrier mobility.
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
Energy Technology Data Exchange (ETDEWEB)
Yao, Yi; Berkowitz, Max L., E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu; Kanai, Yosuke, E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu [Department of Chemistry, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599 (United States)
2015-12-28
The translational diffusivity of water in solutions of alkali halide salts depends on the identity of ions, exhibiting dramatically different behavior even in solutions of similar salts of NaCl and KCl. The water diffusion coefficient decreases as the salt concentration increases in NaCl. Yet, in KCl solution, it slightly increases and remains above bulk value as salt concentration increases. Previous classical molecular dynamics simulations have failed to describe this important behavior even when polarizable models were used. Here, we show that inclusion of dynamical charge transfer among water molecules produces results in a quantitative agreement with experiments. Our results indicate that the concentration-dependent diffusivity reflects the importance of many-body effects among the water molecules in aqueous ionic solutions. Comparison with quantum mechanical calculations shows that a heterogeneous and extended distribution of charges on water molecules around the ions due to ion-water and also water-water charge transfer plays a very important role in controlling water diffusivity. Explicit inclusion of the charge transfer allows us to model accurately the difference in the concentration-dependent water diffusivity between Na{sup +} and K{sup +} ions in simulations, and it is likely to impact modeling of a wide range of systems for medical and technological applications.
International Nuclear Information System (INIS)
Kimmel, Anna V.; Sushko, Peter V.; Shluger, Alexander L.; Kuklja, Maija M.
2007-01-01
The authors have calculated the electronic structure of individual 1,1-diamino-2,2-dinitroethylene molecules (FOX-7) in the gas phase by means of density functional theory with the hybrid B3LYP functional and 6-31+G(d,p) basis set and considered their dissociation pathways. Positively and negatively charged states as well as the lowest excited states of the molecule were simulated. They found that charging and excitation can not only reduce the activation barriers for decomposition reactions but also change the dominating chemistry from endo- to exothermic type. In particular, they found that there are two competing primary initiation mechanisms of FOX-7 decomposition: C-NO 2 bond fission and C-NO 2 to CONO isomerization. Electronic excitation or charging of FOX-7 disfavors CONO formation and, thus, terminates this channel of decomposition. However, if CONO is formed from the neutral FOX-7 molecule, charge trapping and/or excitation results in spontaneous splitting of an NO group accompanied by the energy release. Intramolecular hydrogen transfer is found to be a rare event in FOX-7 unless free electrons are available in the vicinity of the molecule, in which case HONO formation is a feasible exothermic reaction with a relatively low energy barrier. The effect of charged and excited states on other possible reactions is also studied. Implications of the obtained results to FOX-7 decomposition in condensed state are discussed
Ma, Jie; Wang, Lin-Wang
2015-03-01
Perovskite-based solar cells have achieved high solar-energy conversion efficiencies and attracted wide attentions nowadays. Despite the rapid progress in solar-cell devices, many fundamental issues of the hybrid perovskites have not been fully understood. Experimentally, it is well known that in CH3NH3PbI3, the organic molecules CH3NH3 are randomly orientated at the room temperature, but the impact of the random molecular orientation has not been investigated. Using linear-scaling ab-initiomethods, we have calculated the electronic structures of the tetragonal phase of CH3NH3PbI3 with randomly orientated organic molecules in large supercells up to ~20,000 atoms. Due to the dipole moment of the organic molecule, the random orientation creates a novel system with long-range potential fluctuations unlike alloys or other conventional disordered systems. We find that the charge densities of the conduction-band minimum and the valence-band maximum are localized separately in nanoscales due to the potential fluctuations. The charge localization causes electron-hole separation and reduces carrier recombination rates, which may contribute to the long carrier lifetime observed in experiments. We have also proposed a model to explain the charge localization.
Kümmel, Stephan
Being able to visualize the dynamics of electrons in organic materials is a fascinating perspective. Simulations based on time-dependent density functional theory allow to realize this hope, as they visualize the flow of charge through molecular structures in real-space and real-time. We here present results on two fundamental processes: Photoemission from organic semiconductor molecules and charge transport through molecular structures. In the first part we demonstrate that angular resolved photoemission intensities - from both theory and experiment - can often be interpreted as a visualization of molecular orbitals. However, counter-intuitive quantum-mechanical electron dynamics such as emission perpendicular to the direction of the electrical field can substantially alter the picture, adding surprising features to the molecular orbital interpretation. In a second study we calculate the flow of charge through conjugated molecules. The calculations show in real time how breaks in the conjugation can lead to a local buildup of charge and the formation of local electrical dipoles. These can interact with neighboring molecular chains. As a consequence, collections of ''molecular electrical wires'' can show distinctly different characteristics than ''classical electrical wires''. German Science Foundation GRK 1640.
Directory of Open Access Journals (Sweden)
Raúl García
2015-06-01
Full Text Available We describe the synthesis and single-molecule electrical transport properties of a molecular wire containing a π-extended tetrathiafulvalene (exTTF group and its charge-transfer complex with F4TCNQ. We form single-molecule junctions using the in situ break junction technique using a homebuilt scanning tunneling microscope with a range of conductance between 10 G0 down to 10−7 G0. Within this range we do not observe a clear conductance signature of the neutral parent molecule, suggesting either that its conductance is too low or that it does not form a stable junction. Conversely, we do find a clear conductance signature in the experiments carried out on the charge-transfer complex. Due to the fact we expected this species to have a higher conductance than the neutral molecule, we believe this supports the idea that the conductance of the neutral molecule is very low, below our measurement sensitivity. This idea is further supported by theoretical calculations. To the best of our knowledge, these are the first reported single-molecule conductance measurements on a molecular charge-transfer species.
Variational multiscale models for charge transport.
Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin
2012-01-01
This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle
Variational multiscale models for charge transport
Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin
2012-01-01
This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle
Lin, Meng-Kai; Nakayama, Yasuo; Zhuang, Ying-Jie; Wang, Chin-Yung; Pi, Tun-Wen; Ishii, Hisao; Tang, S.-J.
The key properties of organic films such as energy level alignment (ELA), work functions, and injection barriers are closely linked to this dipole layer. Using angle resolved photoemission spectroscopy (ARPES), we systemically investigate the coverage-dependent work functions and spectra line shapes of occupied molecular orbital states of a polar molecule, chloroaluminium phthalocyanine (ClAlPc), grown on Ag(111) to show that the orientations of the first ClAlPc layer can be manipulated via the molecule deposition rate and post annealing, causing ELA at organic-metal interface to differ for about 0.3 eV between Cl-up and Cl-down configuration. Moreover, by comparing the experimental results with the calculations based on both gas-phase model and realistic model of ClAlPc on Ag(111) , we evidence that the different orientations of ClAlPc dipole layers lead to different charge-transfer channels between ClAlPc and Ag, a key factor that controls the ELA at organic-metal interface.
Simple molecular model for the binding of antibiotic molecules to bacterial ion channels
Mafé, Salvador; Ramírez, Patricio; Alcaraz, Antonio
2003-10-01
A molecular model aimed at explaining recent experimental data by Nestorovich et al. [Proc. Natl. Acad. Sci. USA 99, 9789 (2002)] on the interaction of ampicillin molecules with the constriction zone in a channel of the general bacterial porin, OmpF (outer membrane protein F), is presented. The model extends T. L. Hill's theory for intermolecular interactions in a pair of binding sites [J. Am. Chem. Soc. 78, 3330 (1956)] by incorporating two binding ions and two pairs of interacting sites. The results provide new physical insights on the role of the complementary pattern of the charge distributions in the ampicillin molecule and the narrowest part of the channel pore. Charge matching of interacting sites facilitates drug binding. The dependence of the number of ampicillin binding events per second with the solution pH and salt concentration is explained qualitatively using a reduced number of fundamental concepts.
Model for screened, charge-regulated electrostatics of an eye lens protein: Bovine gammaB-crystallin
Wahle, Christopher W.; Martini, K. Michael; Hollenbeck, Dawn M.; Langner, Andreas; Ross, David S.; Hamilton, John F.; Thurston, George M.
2017-09-01
We model screened, site-specific charge regulation of the eye lens protein bovine gammaB-crystallin (γ B ) and study the probability distributions of its proton occupancy patterns. Using a simplified dielectric model, we solve the linearized Poisson-Boltzmann equation to calculate a 54 ×54 work-of-charging matrix, each entry being the modeled voltage at a given titratable site, due to an elementary charge at another site. The matrix quantifies interactions within patches of sites, including γ B charge pairs. We model intrinsic p K values that would occur hypothetically in the absence of other charges, with use of experimental data on the dependence of p K values on aqueous solution conditions, the dielectric model, and literature values. We use Monte Carlo simulations to calculate a model grand-canonical partition function that incorporates both the work-of-charging and the intrinsic p K values for isolated γ B molecules and we calculate the probabilities of leading proton occupancy configurations, for 4 Debye screening lengths from 6 to 20 Å. We select the interior dielectric value to model γ B titration data. At p H 7.1 and Debye length 6.0 Å, on a given γ B molecule the predicted top occupancy pattern is present nearly 20% of the time, and 90% of the time one or another of the first 100 patterns will be present. Many of these occupancy patterns differ in net charge sign as well as in surface voltage profile. We illustrate how charge pattern probabilities deviate from the multinomial distribution that would result from use of effective p K values alone and estimate the extents to which γ B charge pattern distributions broaden at lower p H and narrow as ionic strength is lowered. These results suggest that for accurate modeling of orientation-dependent γ B -γ B interactions, consideration of numerous pairs of proton occupancy patterns will be needed.
Fatayer, Shadi; Schuler, Bruno; Steurer, Wolfram; Scivetti, Ivan; Repp, Jascha; Gross, Leo; Persson, Mats; Meyer, Gerhard
2018-05-01
Intermolecular single-electron transfer on electrically insulating films is a key process in molecular electronics1-4 and an important example of a redox reaction5,6. Electron-transfer rates in molecular systems depend on a few fundamental parameters, such as interadsorbate distance, temperature and, in particular, the Marcus reorganization energy7. This crucial parameter is the energy gain that results from the distortion of the equilibrium nuclear geometry in the molecule and its environment on charging8,9. The substrate, especially ionic films10, can have an important influence on the reorganization energy11,12. Reorganization energies are measured in electrochemistry13 as well as with optical14,15 and photoemission spectroscopies16,17, but not at the single-molecule limit and nor on insulating surfaces. Atomic force microscopy (AFM), with single-charge sensitivity18-22, atomic-scale spatial resolution20 and operable on insulating films, overcomes these challenges. Here, we investigate redox reactions of single naphthalocyanine (NPc) molecules on multilayered NaCl films. Employing the atomic force microscope as an ultralow current meter allows us to measure the differential conductance related to transitions between two charge states in both directions. Thereby, the reorganization energy of NPc on NaCl is determined as (0.8 ± 0.2) eV, and density functional theory (DFT) calculations provide the atomistic picture of the nuclear relaxations on charging. Our approach presents a route to perform tunnelling spectroscopy of single adsorbates on insulating substrates and provides insight into single-electron intermolecular transport.
Multiple ionization dynamics of molecules in intense laser fields
International Nuclear Information System (INIS)
Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko
2005-01-01
A classical field-ionization model is developed for sequential multiple ionization of diatomic and linear triatomic molecules exposed to intense (∼ 10 15 W/cm 2 ) laser fields. The distance R ion of Coulomb explosion is calculated for a combination of fragment charges, by considering nonadiabatic excitation followed by field ionization associated with the inner and outer saddle points. For diatomic molecules (N 2 , NO, and I 2 ), the model explains behaviors observed in experiments, as R ion (21→31) ion (21→22) between competing charge-asymmetric and symmetric channels, and even-odd fluctuation along a principal pathway. For a triatomic molecule CO 2 , a comparison of the model with an experiment suggests that charge-symmetric (or nearly symmetric) channels are dominantly populated. (author)
Nossa, Javier; Islam, Fhokrul; Canali, Carlo; Pederson, Mark
2012-02-01
For device applications of single molecule magnets (SMMs) in high-density information storage and quantum-state control it is essential that the magnetic properties of the molecules remain stable under the influence of metallic contacts or surface environment. Recent tunneling experiments [1, 2] on N@C60 and Fe4 SMM have shown that these molecules preserve their magnetic characteristics when they are used as the central island of single-electron transistors. Although quantum spin models have been used extensively to study theoretically tunneling spectroscopy of SMMs, it has been shown recently that the orbital degrees of freedom, which is absent in spin models, can significantly affect the tunneling conductance [3]. In this work we present first-principles calculations of the neutral and charged states of N@C60 and Fe4 SMMs, and discuss a strategy to include their properties into a theory of quantum transport. We also present results of the magnetic anisotropy for the different charge states of Fe4 and discuss their relevance for experiments [2] in the sequential tunneling and cotunnelling regimes. [4pt] [1]. N. Roch et al., Phys. Rev. B 83, 081407 (2011). [0pt] [2]. A.S. Zyazin et al., Nano Lett. 10, 3307 (2010). [0pt] [3]. L. Michalak et al., Phys. Rev. Lett. 104, 017202 (2010).
Charge Transport in Conjugated Materials: From Theoretical Models to Experimental Systems
International Nuclear Information System (INIS)
Olivier, Yoann; Cornil, Jerome; Muccioli, Luca; Zannoni, Claudio
2008-01-01
Charge carrier mobility is the key quantity to characterize the charge transport properties in devices. Based on earlier work of Baessler and co-workers, we set up a Monte-Carlo approach that allows us to calculate mobility using transfer rates derived from Marcus theory. The parameters entering into the rate expression are evaluated by means of different quantum-chemical techniques. Our approach is applied here to a model one-dimensional system made of pentacene molecules as well as to real systems such as crystalline structures and columnar liquid crystal phases.
Detecting and identifying small molecules in a nanopore flux capacitor
International Nuclear Information System (INIS)
Bearden, Samuel; Zhang, Guigen; McClure, Ethan
2016-01-01
A new method of molecular detection in a metallic-semiconductor nanopore was developed and evaluated with experimental and computational methods. Measurements were made of the charging potential of the electrical double layer (EDL) capacitance as charge-carrying small molecules translocated the nanopore. Signals in the charging potential were found to be correlated to the physical properties of analyte molecules. From the measured signals, we were able to distinguish molecules with different valence charge or similar valence charge but different size. The relative magnitude of the signals from different analytes was consistent over a wide range of experimental conditions, suggesting that the detected signals are likely due to single molecules. Computational modeling of the nanopore system indicated that the double layer potential signal may be described in terms of disruption of the EDL structure due to the size and charge of the analyte molecule, in agreement with Huckel and Debye’s analysis of the electrical atmosphere of electrolyte solutions. (paper)
International Nuclear Information System (INIS)
Li Yun; Pan Lijia; Pu Lin; Shi Yi; Liu Chuan; Tsukagoshi, Kazuhito
2012-01-01
Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels. (paper)
Li, Yun; Liu, Chuan; Pan, Lijia; Pu, Lin; Tsukagoshi, Kazuhito; Shi, Yi
2012-01-01
Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels.
Gowda, Srivardhan Shivappa
Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was
Energy Technology Data Exchange (ETDEWEB)
Secker, Daniel
2008-06-03
The aim of the thesis at hand was to investigate dynamical behaviour in charge transport through organic molecules experimentally with the help of the mechanically controlled break junction (MCBJ) technique. the thesis concentrates on the complex interaction between the molecular contact configuration and the electronic structure. it is shown that by variation of the electrode distance and so by a manipulation of the molecule and contact configuration the electronic structure as well as the coupling between the molecule and the electrodes is affected. The latter statement is an additional hint how closely I-V-characteristics depend on the molecular contact configuration. Depending on the applied voltage and so the electric field there are two different configurations preferred by the molecular contact. A potential barrier between these two states is the origin of the hysteresis. A central part of the thesis is dealing with measurements of the current noise. Finally it can be concluded that the detailed discussion reveals the strong effect of dynamical interactions between the atomic configuration of the molecular contact and the electronic structure on the charge transport in single molecule junctions. (orig.)
Arbabi, Vahid; Pouran, Behdad; Weinans, Harrie; Zadpoor, Amir A
2016-06-14
Charged and uncharged solutes penetrate through cartilage to maintain the metabolic function of chondrocytes and to possibly restore or further breakdown the cartilage tissue in different stages of osteoarthritis. In this study the transport of charged solutes across the various zones of cartilage was quantified, taken into account the physicochemical interactions between the solute and the cartilage constituents. A multiphasic finite-bath finite element (FE) model was developed to simulate equine cartilage diffusion experiments that used a negatively charged contrast agent (ioxaglate) in combination with serial micro-computed tomography (micro-CT) to measure the diffusion. By comparing the FE model with the experimental data both the diffusion coefficient of ioxaglate and the fixed charge density (FCD) were obtained. In the multiphasic model, cartilage was divided into multiple (three) zones to help understand how diffusion coefficient and FCD vary across cartilage thickness. The direct effects of charged solute-FCD interaction on diffusion were investigated by comparing the diffusion coefficients derived from the multiphasic and biphasic-solute models. We found a relationship between the FCD obtained by the multiphasic model and ioxaglate partitioning obtained from micro-CT experiments. Using our multi-zone multiphasic model, diffusion coefficient of the superficial zone was up to ten-fold higher than that of the middle zone, while the FCD of the middle zone was up to almost two-fold higher than that of the superficial zone. In conclusion, the developed finite-bath multiphasic model provides us with a non-destructive method by which we could obtain both diffusion coefficient and FCD of different cartilage zones. The outcomes of the current work will also help understand how charge of the bath affects the diffusion of a charged molecule and also predict the diffusion behavior of a charged solute across articular cartilage. Copyright © 2016 Elsevier Ltd. All
Electron capture in ion-molecule collisions at intermediate energy
International Nuclear Information System (INIS)
Kumura, M.
1986-01-01
Recent progress of theoretical charge transfer study in ion-molecule collisions at the intermediate energy is reviewed. Concept of close and distant collisions obtained from extensive ion-atom collision studies is identified so that it can be utilized to model two distinct collision processes. For a close collision, explicit representation of the whole collision complex is necessary to describe collision dynamics correctly, while a model potential approach for molecule is appropriate for a distant collision. It is shown that these two distinct models are indeed capable of reproducing experimental charge transfer cross sections. Some remarks for further theoretical study of ion-molecule collisions are also given. 21 refs., 8 figs
Theory of Charged Quantum Dot Molecules
Ponomarev, I. V.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Ware, M. E.; Gammon, D.; Reinecke, T. L.; Korenev, V. L.
2006-03-01
Recent optical spectroscopy of excitonic molecules in coupled quantum dots (CQDs) tuned by electric field reveal a richer diversity in spectral line patterns than in their single quantum dot counterparts. We developed a theoretical model that allows us to classify energies and intensities of various PL transitions. In this approach the electric field induced resonance tunneling of the electron and hole states occurs at different biases due to the inherent asymmetry of CQDs. The truncated many-body basis configurations for each molecule are constructed from antisymmetrized products of single-particle states, where the electron occupies only one ground state level in single QD and the hole can occupy two lowest levels of CQD system. The Coulomb interaction between particles is treated with perturbation theory. As a result the observed PL spectral lines can be described with a small number of parameters. The theoretical predictions account well for recent experiments.
Murgich, Juan; Franco, Héctor J; San-Blas, Gioconda
2006-08-24
The molecular charge distribution of flucytosine (4-amino-5-fluoro-2-pyrimidone), uracil, 5-fluorouracil, and thymine was studied by means of density functional theory calculations (DFT). The resulting distributions were analyzed by means of the atoms in molecules (AIM) theory. Bonds were characterized through vectors formed with the charge density value, its Laplacian, and the bond ellipticity calculated at the bond critical point (BCP). Within each set of C=O, C-H, and N-H bonds, these vectors showed little dispersion. C-C bonds formed three different subsets, one with a significant degree of double bonding, a second corresponding to single bonds with a finite ellipticity produced by hyperconjugation, and a third one formed by a pure single bond. In N-C bonds, a decrease in bond length (an increase in double bond character) was not reflected as an increase in their ellipticity, as in all C-C bonds studied. It was also found that substitution influenced the N-C, C-O, and C-C bond ellipticity much more than density and its Laplacian at the BCP. The Laplacian of charge density pointed to the existence of both bonding and nonbonding maxima in the valence shell charge concentration of N, O, and F, while only bonding ones were found for the C atoms. The nonbonding maxima related to the sites for electrophilic attack and H bonding in O and N, while sites of nucleophilic attack were suggested by the holes in the valence shell of the C atoms of the carbonyl groups.
International Nuclear Information System (INIS)
Flood, Amar H.; Wong, Eric W.; Stoddart, J. Fraser
2006-01-01
The processes by which charge transfer can occur play a foundational role in molecular electronics. Here we consider simplified models of the transfer processes that could be present in bistable molecular switch tunnel junction (MSTJ) devices during one complete cycle of the device from its low- to high- and back to low-conductance state. The bistable molecular switches, which are composed of a monolayer of either switchable catenanes or rotaxanes, exist in either a ground-state co-conformation or a metastable one in which the conduction properties of the two co-conformations, when measured at small biases (+0.1 V), are significantly different irrespective of whether transport is dominated by tunneling or hopping. The voltage-driven generation (±2 V) of molecule-based redox states, which are sufficiently long-lived to allow the relative mechanical movements necessary to switch between the two co-conformations, rely upon unequal charge transfer rates on to and/or off of the molecules. Surface-enhanced Raman spectroscopy has been used to image the ground state of the bistable rotaxane in MSTJ-like devices. Consideration of these models provide new ways of looking at molecular electronic devices that rely, not only on nanoscale charge-transport, but also upon the bustling world of molecular motion in mechanically interlocked bistable molecules
Use of ionic model for analysis of intramolecular movement in alkali metal metaborate molecules
International Nuclear Information System (INIS)
Ezhov, Yu.S.; Vinogradov, V.S.
1978-01-01
To clear out the peculiarities of intramolecular movement in MBO 2 (where M=Li, Na, K, Rb, Cs) molecules the energy dependence of cation electrostatic interaction with BO 2 anion on the charge value of oxygen, values of the MOB valence angle and internuclear distance r(M-O) is calculated. The calculation results on the base of ionic model show that the minimum of potential energy function corresponds to angular configuration of the MBO 2 molecules. Parameters of potential function of deformation oscillation connected with the change of MOB angle, are evaluated
International Nuclear Information System (INIS)
Wells, E.; Ben-Itzhak, I.; Carnes, K.D.; Krishnamurthi, V.
1996-01-01
The ratio of double- to single-ionization (DI/SI) as well as the ratio of ionization-excitation to single-ionization (IE/SI) in hydrogen molecules was studied by examining the effect of the projectile charge on these processes. The DI/SI and IE/SI ratios were measured using the coincidence time of flight technique at a fixed velocity (1 MeV/amu) over a range of projectile charge states (q = 1-9,14,20). Preliminary results indicate that for a highly charged F 9+ projectile the DI/SI and IE/SI ratios are 6.8% and 24.7%, respectively, a large increase from the ratios of 0.13% and 1.95%, respectively, for H + projectiles. For low charge states, the DI/SI is negligible relative to the IE/SI ratio, while for more highly charged projectiles the DI/SI ratio becomes comparable to the IE/SI ratio. This indicates that double-ionization increases much more rapidly with projectile charge than ionization-excitation
International Nuclear Information System (INIS)
Freire-Nordi, Cristina S.; Nascimento, Otaciro R.; Vieira, Armando A.H.; Nakaie, Clovis R.
2006-01-01
The existence of a mucilaginous envelope, sheath or capsule is usual in many desmids, but few data concerning its function are available. Previous studies of the transport function and permeation of molecules through the algae capsules were done using the algae Spondylosium panduriforme and Nephrocytium lunatum, the Electron Paramagnetic Resonance (EPR) technique, and different spin labels. The results suggested that the capsule functions as a selective diffusion medium. In the present work charged and uncharged molecules (spin labels group A) and Staurastrum iversenii var. americanum (Desmids),whose alga presents a great mucilaginous capsule, were used. Charged nitroxide molecules similar to amino acids (spin labels group B) were also used allowing a better understanding of the electrostatic effect in the permeation process across the capsule. The role of the cell capsule in the solute diffusion was evaluated by determining the capsulated and decapsulated cell permeation times. The permeation times for all spin labels tested in the cells lacking capsules were always shorter than those containing this physical barrier. The decay times of spin labels group A observed for S. iversenii were compared to other studied algae. The results regarding the diffusion of charged spin labels group B suggested that the interaction of cell capsule occurs more strongly with negatively charged molecules than with positively charged ones. The results obtained in this work with spin labels group A confirm that the capsule is an essential structure for the cell, and that due to the polar interactions with the spin labels, it plays an important role in the selection of small molecules. Several parameters, mainly those of electrostatic nature, seem to control the permeation across the algal capsules of spin labels group B, showing that structures which are similar to amino acids could diffuse across the interior of the algal cell. (author)
X-ray Pump–Probe Investigation of Charge and Dissociation Dynamics in Methyl Iodine Molecule
Directory of Open Access Journals (Sweden)
Li Fang
2017-05-01
Full Text Available Molecular dynamics is of fundamental interest in natural science research. The capability of investigating molecular dynamics is one of the various motivations for ultrafast optics. We present our investigation of photoionization and nuclear dynamics in methyl iodine (CH3I molecule with an X-ray pump X-ray probe scheme. The pump–probe experiment was realized with a two-mirror X-ray split and delay apparatus. Time-of-flight mass spectra at various pump–probe delay times were recorded to obtain the time profile for the creation of high charge states via sequential ionization and for molecular dissociation. We observed high charge states of atomic iodine up to 29+, and visualized the evolution of creating these high atomic ion charge states, including their population suppression and enhancement as the arrival time of the second X-ray pulse was varied. We also show the evolution of the kinetics of the high charge states upon the timing of their creation during the ionization-dissociation coupled dynamics. We demonstrate the implementation of X-ray pump–probe methodology for investigating X-ray induced molecular dynamics with femtosecond temporal resolution. The results indicate the footprints of ionization that lead to high charge states, probing the long-range potential curves of the high charge states.
Excitation of atoms and molecules in collisions with highly charged ions
International Nuclear Information System (INIS)
Watson, R.L.
1991-01-01
Much of the work this year has been directed toward studies of charge exchange and ionization in single collisions of heavy ions with gaseous atoms and molecules. A study of the double ionization of He by high energy N 7+ ions, which began last year, was extended up in energy to 40 MeV/amu. These measurements verified the deviations from the predictions of theory observed in our previous work and indicated that the energy required to reach the limiting value of the ratio of double-to-single ionization cross sections may be as high as 70 MeV/amu
Era, Paavai; Jauhar, RO. MU.; Vinitha, G.; Murugakoothan, P.
2018-05-01
An organic nonlinear optical material, guanidinium tosylate was synthesized adopting slow evaporation method and the crystals were harvested from aqueous methanolic medium with dimensions 13 × 9 × 3 mm3. Constitution of crystalline material was confirmed by single crystal X-ray diffraction study. The title compound crystallizes in the monoclinic crystal system with space group P21/c. The UV-vis-NIR spectral study of the grown crystal exhibits high transparency of 80% in the entire visible region with lower cut-off wavelength at 282 nm. Optimized molecular geometry of the grown crystal was obtained using density functional theory (DFT) and the frontier energy gaps calculated from the DFT aids to understand the charge transfer taking place in the molecule. The dielectric properties were studied as a function of temperature and frequency to find the charge distribution within the crystal. The titular compound is thermally stable up to 230 °C assessed by thermogravimetric and differential thermal analysis. Anisotropy in the mechanical behavior was observed while measuring for individual planes. The laser induced surface damage threshold of the grown crystal was measured to be 0.344 GW/cm2 for 1064 nm Nd:YAG laser radiation. Z-scan technique confirms the third-order nonlinear optical property with the ascertained nonlinear refractive index (n2), nonlinear absorption coefficient (β) and third order nonlinear susceptibility (χ(3)). Optical limiting study divulges that the transmitted output power step-up linearly with the increase of the input power at lower power realms and saturates from the threshold 24.95 mW/cm2 and amplitude 0.23 mW/cm2.
Role of molecular charge in nucleocytoplasmic transport.
Directory of Open Access Journals (Sweden)
Alexander Goryaynov
Full Text Available Transport of genetic materials and proteins between the nucleus and cytoplasm of eukaryotic cells is mediated by nuclear pore complexes (NPCs. A selective barrier formed by phenylalanine-glycine (FG nucleoporins (Nups with net positive charges in the NPC allows for passive diffusion of signal-independent small molecules and transport-receptor facilitated translocation of signal-dependent cargo molecules. Recently, negative surface charge was postulated to be another essential criterion for selective passage through the NPC. However, the charge-driven mechanism in determining the transport kinetics and spatial transport route for either passive diffusion or facilitated translocation remains obscure. Here we employed high-speed single-molecule fluorescence microscopy with an unprecedented spatiotemporal resolution of 9 nm and 400 µs to uncover these mechanistic fundamentals for nuclear transport of charged substrates through native NPCs. We found that electrostatic interaction between negative surface charges on transiting molecules and the positively charged FG Nups, although enhancing their probability of binding to the NPC, never plays a dominant role in determining their nuclear transport mode or spatial transport route. A 3D reconstruction of transport routes revealed that small signal-dependent endogenous cargo protein constructs with high positive surface charges that are destined to the nucleus, rather than repelled from the NPC as suggested in previous models, passively diffused through an axial central channel of the NPC in the absence of transport receptors. Finally, we postulated a comprehensive map of interactions between transiting molecules and FG Nups during nucleocytoplasmic transport by combining the effects of molecular size, signal and surface charge.
Charge orders in organic charge-transfer salts
International Nuclear Information System (INIS)
Kaneko, Ryui; Valentí, Roser; Tocchio, Luca F; Becca, Federico
2017-01-01
Motivated by recent experimental suggestions of charge-order-driven ferroelectricity in organic charge-transfer salts, such as κ -(BEDT-TTF) 2 Cu[N(CN) 2 ]Cl, we investigate magnetic and charge-ordered phases that emerge in an extended two-orbital Hubbard model on the anisotropic triangular lattice at 3/4 filling. This model takes into account the presence of two organic BEDT-TTF molecules, which form a dimer on each site of the lattice, and includes short-range intramolecular and intermolecular interactions and hoppings. By using variational wave functions and quantum Monte Carlo techniques, we find two polar states with charge disproportionation inside the dimer, hinting to ferroelectricity. These charge-ordered insulating phases are stabilized in the strongly correlated limit and their actual charge pattern is determined by the relative strength of intradimer to interdimer couplings. Our results suggest that ferroelectricity is not driven by magnetism, since these polar phases can be stabilized also without antiferromagnetic order and provide a possible microscopic explanation of the experimental observations. In addition, a conventional dimer-Mott state (with uniform density and antiferromagnetic order) and a nonpolar charge-ordered state (with charge-rich and charge-poor dimers forming a checkerboard pattern) can be stabilized in the strong-coupling regime. Finally, when electron–electron interactions are weak, metallic states appear, with either uniform charge distribution or a peculiar 12-site periodicity that generates honeycomb-like charge order. (paper)
Charge transfer through single molecule contacts: How reliable are rate descriptions?
Directory of Open Access Journals (Sweden)
Denis Kast
2011-08-01
Full Text Available Background: The trend for the fabrication of electrical circuits with nanoscale dimensions has led to impressive progress in the field of molecular electronics in the last decade. However, a theoretical description of molecular contacts as the building blocks of future devices is challenging, as it has to combine the properties of Fermi liquids in the leads with charge and phonon degrees of freedom on the molecule. Outside of ab initio schemes for specific set-ups, generic models reveal the characteristics of transport processes. Particularly appealing are descriptions based on transfer rates successfully used in other contexts such as mesoscopic physics and intramolecular electron transfer. However, a detailed analysis of this scheme in comparison with numerically exact solutions is still elusive.Results: We show that a formulation in terms of transfer rates provides a quantitatively accurate description even in domains of parameter space where strictly it is expected to fail, e.g., at lower temperatures. Typically, intramolecular phonons are distributed according to a voltage driven steady state that can only roughly be captured by a thermal distribution with an effective elevated temperature (heating. An extension of a master equation for the charge–phonon complex, to effectively include the impact of off-diagonal elements of the reduced density matrix, provides very accurate solutions even for stronger electron–phonon coupling.Conclusion: Rate descriptions and master equations offer a versatile model to describe and understand charge transfer processes through molecular junctions. Such methods are computationally orders of magnitude less expensive than elaborate numerical simulations that, however, provide exact solutions as benchmarks. Adjustable parameters obtained, e.g., from ab initio calculations allow for the treatment of various realizations. Even though not as rigorously formulated as, e.g., nonequilibrium Green’s function
Charge exchange in slow collisions of multiply charged ions with atoms
International Nuclear Information System (INIS)
Presnyakov, L.P.; Uskov, D.B.; Janev, R.K.
1982-01-01
Single-electron charge exchange between ions having a charge Z>6 and atoms is considered at relative velocities v< Z/sup 1/2/. An analytic method is developed for the solution of a multilevel problem that is a generalization of the decay model and of the approximation of nonadiabatic coupling between two states. Expressions are obtained for the reaction-product distributions in the principal and angular quantum numbers. The calculated total cross sections agree well with the experimental data on charge exchange of hydrogen atoms and molecules with nuclei. The theory describes the oscillations of the total cross section against the background of a monotonic growth as the charge is increased
Maiti, Prabal K.; Bagchi, Biman
2009-12-01
In order to understand self-diffusion (D) of a charged, flexible, and porous nanoscopic molecule in water, we carry out very long, fully atomistic molecular dynamics simulation of PAMAM dendrimer up to eight generations in explicit salt water under varying pH. We find that while the radius of gyration (Rg) varies as N1/3, the self-diffusion constant (D ) scales, surprisingly, as N-α, with α =0.39 at high pH and 0.5 at neutral pH, indicating a dramatic breakdown of Stokes-Einstein relation for diffusion of charged nanoscopic molecules. The variation in D as a function of radius of gyration demonstrates the importance of treating water and ions explicitly in the diffusion process of a flexible nanoscopic molecule. In agreement with recent experiments, the self-diffusion constant increases with pH, revealing the importance of dielectric friction in the diffusion process. The shape of a dendrimer is found to fluctuate on a nanosecond time scale. We argue that this flexibility (and also the porosity) of the dendrimer may play an important role in determining the mean square displacement of the dendrimer and the breakdown of the Stokes-Einstein relation between diffusion constant and the radius.
Enhanced polarizability of aromatic molecules placed in the vicinity of silver clusters
International Nuclear Information System (INIS)
Mayer, A; Schatz, G C
2009-01-01
We use a charge-dipole interaction model to study the polarizability of aromatic molecules that are placed between two silver clusters. In particular we examine the enhancement in polarizability induced by the clusters at plasmon-like resonant frequencies of the cluster-molecule-cluster system. The model used for these simulations relies on representation of the atoms by both a net electric charge and a dipole. By relating the time variation of the atomic charges to the currents that flow through the bonds of the structures considered, a least-action principle can be formulated that enables the atomic charges and dipoles to be determined. We consider benzene, naphthalene and anthracene for this study, comparing the polarizability of these aromatic molecules when placed in the middle between two Ag 120 clusters, with their polarizability as isolated molecules. We find that the polarizability of these molecules is enhanced by the clusters, and this increases the electromagnetic coupling between the two clusters. This results in significant red-shifting (by up to 0.8 eV) of the lowest energy optical transition in the cluster-molecule-cluster system compared to plasmon-like excitation in the cluster-cluster system. The resulting resonant polarizability enhancement leads to an electromagnetic enhancement in surface-enhanced Raman scattering of over 10 6 .
Abdalla, S; Obaid, A; Al-Marzouki, F M
2017-12-01
function of temperature and frequency. Furthermore, in order to explain these data, we present a model describing the electrical conduction through DNA molecule: DNA is a classical semiconductor with charges, dipoles and ions that result in creation of localized energy-states (LESs) in the extended bands and in the energy gap of the DNA molecule. This model explains clearly the mechanism of charge transfer mechanism in the DNA, and it sheds light on why the charge transfer through the DNA can lead to insulating, semiconducting, or metallic behavior on the same time. The model considers charges on DNA, in the extended bands, either could be free to move under electric field or localized in potential wells/hills. Localization of charges in DNA is an intrinsic structural-property of this solitaire molecule. At all temperatures, the expected increase in thermal-induced charge is attributed to the delocalization of holes (or/and electrons) in potential hills (or/and potential wells) which accurately accounts for the total electric and dielectric behavior through DNA molecule. We succeeded to fit the experimental data to the proposed model with reasonable magnitudes of potential hills/wells that are in the energy range from 0.068 eV.
International Nuclear Information System (INIS)
Tsui, H.H.Y.
2001-01-01
Model intermolecular potentials are required for simulations of molecules in the gas, liquid, or solid phase. The widely used isotropic atom-atom model potentials are empirically fitted and based on the assumptions of transferability, combining rules and that atoms in molecules are spherical. This thesis develops a non-empirical method of modelling repulsion by applying the overlap model, which we show as a general non-empirical method of deriving repulsion potentials for a specific molecule. In this thesis, the repulsion parameters for an exponential atom-atom model potential are obtained from the ab initio charge density of a small organic molecule by making the assumption that the repulsion is proportional to the overlap of a pair of molecules. The proportionality constant is fixed by a limited number of intermolecular perturbation theory (IMPT) calculations. To complete the model potential, the electrostatic interaction is represented by a distributed multipole analysis, and the Slater-Kirkwood formula is used for the dispersion. These non-empirical potentials can reproduce experimental crystal structure when applied to crystal structure prediction of an oxyboryl derivative. A detailed study on further improving the overlap model was carried out for phenol-water, by including other minor intermolecular contributions of charge-transfer and penetration. High quality ab initio calculations on the complex were performed for use in comparison. To compare with experimental data, diffusion Monte Carlo simulations were performed with the potential, so that the effects of anharmonic zero-point motion on structure and energy of the system are included. When the system is too large for an IMPT calculation, the proportionality constant can be determined empirically by fitting the cell volume as shown in our study of crystal structures of chlorothalonil. This is used with an anisotropic repulsion model that has been derived for Cl and N atoms in chlorothalonil. This model
Extracting Models in Single Molecule Experiments
Presse, Steve
2013-03-01
Single molecule experiments can now monitor the journey of a protein from its assembly near a ribosome to its proteolytic demise. Ideally all single molecule data should be self-explanatory. However data originating from single molecule experiments is particularly challenging to interpret on account of fluctuations and noise at such small scales. Realistically, basic understanding comes from models carefully extracted from the noisy data. Statistical mechanics, and maximum entropy in particular, provide a powerful framework for accomplishing this task in a principled fashion. Here I will discuss our work in extracting conformational memory from single molecule force spectroscopy experiments on large biomolecules. One clear advantage of this method is that we let the data tend towards the correct model, we do not fit the data. I will show that the dynamical model of the single molecule dynamics which emerges from this analysis is often more textured and complex than could otherwise come from fitting the data to a pre-conceived model.
Model improvements to simulate charging in SEM
Arat, K. T.; Klimpel, T.; Hagen, C. W.
2018-03-01
Charging of insulators is a complex phenomenon to simulate since the accuracy of the simulations is very sensitive to the interaction of electrons with matter and electric fields. In this study, we report model improvements for a previously developed Monte-Carlo simulator to more accurately simulate samples that charge. The improvements include both modelling of low energy electron scattering and charging of insulators. The new first-principle scattering models provide a more realistic charge distribution cloud in the material, and a better match between non-charging simulations and experimental results. Improvements on charging models mainly focus on redistribution of the charge carriers in the material with an induced conductivity (EBIC) and a breakdown model, leading to a smoother distribution of the charges. Combined with a more accurate tracing of low energy electrons in the electric field, we managed to reproduce the dynamically changing charging contrast due to an induced positive surface potential.
Influence of capture to excited states of multiply charged ion beams colliding with small molecules
International Nuclear Information System (INIS)
Montenegro, P; Monti, J M; Fojón, O A; Hanssen, J; Rivarola, R D
2015-01-01
Electron capture by multiply charged ions impacting on small molecules is theoretically investigated. Particular attention is paid to the case of biological targets. The interest is focused on the importance of the transition to excited final states which can play a dominant role on the total capture cross sections. Projectiles at intermediate and high collision energies are considered. Comparison with existing experimental data is shown. (paper)
Directory of Open Access Journals (Sweden)
Thiago C. F. Gomes
2008-01-01
Full Text Available The first computational implementation that automates the procedures involved in the calculation of infrared intensities using the charge-charge flux-dipole flux model is presented. The atomic charges and dipoles from the Quantum Theory of Atoms in Molecules (QTAIM model was programmed for Morphy98, Gaussian98 and Gaussian03 programs outputs, but for the ChelpG parameters only the Gaussian programs are supported. Results of illustrative but new calculations for the water, ammonia and methane molecules at the MP2/6-311++G(3d,3p theoretical level, using the ChelpG and QTAIM/Morphy charges and dipoles are presented. These results showed excellent agreement with analytical results obtained directly at the MP2/6-311++G(3d,3p level of theory.
Paterson, Alexandra F.
2017-12-27
Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.
Paterson, Alexandra F.; Lin, Yen-Hung; Mottram, Alexander D.; Fei, Zhuping; Niazi, Muhammad Rizwan; Kirmani, Ahmad R.; Amassian, Aram; Solomeshch, Olga; Tessler, Nir; Heeney, Martin; Anthopoulos, Thomas D.
2017-01-01
Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.
Charge Pricing Optimization Model for Private Charging Piles in Beijing
Directory of Open Access Journals (Sweden)
Xingping Zhang
2017-11-01
Full Text Available This paper develops a charge pricing model for private charging piles (PCPs by considering the environmental and economic effects of private electric vehicle (PEV charging energy sources and the impact of PCP charging load on the total load. This model simulates users’ responses to different combinations of peak-valley prices based on the charging power of PCPs and user charging transfer rate. According to the regional power structure, it calculates the real-time coal consumption, carbon dioxide emissions reduction, and power generation costs of PEVs on the power generation side. The empirical results demonstrate that the proposed peak-valley time-of-use charging price can not only minimize the peak-valley difference of the total load but also improve the environmental effects of PEVs and the economic income of the power system. The sensitivity analysis shows that the load-shifting effect of PCPs will be more obvious when magnifying the number of PEVs by using the proposed charging price. The case study indicates that the proposed peak, average, and valley price in Beijing should be 1.8, 1, and 0.4 yuan/kWh, which can promote the large-scale adoption of PEVs.
Bardhan, Jaydeep P; Jungwirth, Pavel; Makowski, Lee
2012-09-28
Two mechanisms have been proposed to drive asymmetric solvent response to a solute charge: a static potential contribution similar to the liquid-vapor potential, and a steric contribution associated with a water molecule's structure and charge distribution. In this work, we use free-energy perturbation molecular-dynamics calculations in explicit water to show that these mechanisms act in complementary regimes; the large static potential (∼44 kJ/mol/e) dominates asymmetric response for deeply buried charges, and the steric contribution dominates for charges near the solute-solvent interface. Therefore, both mechanisms must be included in order to fully account for asymmetric solvation in general. Our calculations suggest that the steric contribution leads to a remarkable deviation from the popular "linear response" model in which the reaction potential changes linearly as a function of charge. In fact, the potential varies in a piecewise-linear fashion, i.e., with different proportionality constants depending on the sign of the charge. This discrepancy is significant even when the charge is completely buried, and holds for solutes larger than single atoms. Together, these mechanisms suggest that implicit-solvent models can be improved using a combination of affine response (an offset due to the static potential) and piecewise-linear response (due to the steric contribution).
Bardhan, Jaydeep P.; Jungwirth, Pavel; Makowski, Lee
2012-01-01
Two mechanisms have been proposed to drive asymmetric solvent response to a solute charge: a static potential contribution similar to the liquid-vapor potential, and a steric contribution associated with a water molecule's structure and charge distribution. In this work, we use free-energy perturbation molecular-dynamics calculations in explicit water to show that these mechanisms act in complementary regimes; the large static potential (∼44 kJ/mol/e) dominates asymmetric response for deeply buried charges, and the steric contribution dominates for charges near the solute-solvent interface. Therefore, both mechanisms must be included in order to fully account for asymmetric solvation in general. Our calculations suggest that the steric contribution leads to a remarkable deviation from the popular “linear response” model in which the reaction potential changes linearly as a function of charge. In fact, the potential varies in a piecewise-linear fashion, i.e., with different proportionality constants depending on the sign of the charge. This discrepancy is significant even when the charge is completely buried, and holds for solutes larger than single atoms. Together, these mechanisms suggest that implicit-solvent models can be improved using a combination of affine response (an offset due to the static potential) and piecewise-linear response (due to the steric contribution). PMID:23020318
Ghai, Ishan; Pira, Alessandro; Scorciapino, Mariano Andrea; Bodrenko, Igor; Benier, Lorraine; Ceccarelli, Matteo; Winterhalter, Mathias; Wagner, Richard
2017-03-16
A major challenge in the discovery of the new antibiotics against Gram-negative bacteria is to achieve sufficiently fast permeation in order to avoid high doses causing toxic side effects. So far, suitable assays for quantifying the uptake of charged antibiotics into bacteria are lacking. We apply an electrophysiological zero-current assay using concentration gradients of β-lactamase inhibitors combined with single-channel conductance to quantify their flux rates through OmpF. Molecular dynamic simulations provide in addition details on the interactions between the nanopore wall and the charged solutes. In particular, the interaction barrier for three β-lactamase inhibitors is surprisingly as low as 3-5 kcal/mol and only slightly above the diffusion barrier of ions such as chloride. Within our macroscopic constant field model, we determine that at a zero-membrane potential a concentration gradient of 10 μM of avibactam, sulbactam, or tazobactam can create flux rates of roughly 620 molecules/s per OmpF trimer.
Pirim, C.; Gann, R. D.; McLain, J. L.; Orlando, T. M.
2015-09-01
Electron-induced polymerization processes and charging events that can occur within Titan's atmosphere or on its surface were simulated using electron irradiation and dissociative electron attachment (DEA) studies of nitrogen-containing organic condensates. The DEA studies probe the desorption of H- from hydrogen cyanide (HCN), acetonitrile (CH3CN), and aminoacetonitrile (NH2CH2CN) ices, as well as from synthesized tholin materials condensed or deposited onto a graphite substrate maintained at low temperature (90-130 K). The peak cross sections for H- desorption during low-energy (3-15 eV) electron irradiation were measured and range from 3 × 10-21 to 2 × 10-18 cm2. Chemical and structural transformations of HCN ice upon 2 keV electron irradiation were investigated using X-ray photoelectron and Fourier-transform infrared spectroscopy techniques. The electron-beam processed materials displayed optical properties very similar to tholins produced by conventional discharge methods. Electron and negative ion trapping lead to 1011 charges cm-2 on a flat surface which, assuming a radius of 0.05 μm for Titan aerosols, is ∼628 charges/radius (in μm). The facile charge trapping indicates that electron interactions with nitriles and complex tholin-like molecules could affect the conductivity of Titan's atmosphere due to the formation of large negative ion complexes. These negatively charged complexes can also precipitate onto Titan's surface and possibly contribute to surface reactions and the formation of dunes.
Modeling Charge Collection in Detector Arrays
Hardage, Donna (Technical Monitor); Pickel, J. C.
2003-01-01
A detector array charge collection model has been developed for use as an engineering tool to aid in the design of optical sensor missions for operation in the space radiation environment. This model is an enhancement of the prototype array charge collection model that was developed for the Next Generation Space Telescope (NGST) program. The primary enhancements were accounting for drift-assisted diffusion by Monte Carlo modeling techniques and implementing the modeling approaches in a windows-based code. The modeling is concerned with integrated charge collection within discrete pixels in the focal plane array (FPA), with high fidelity spatial resolution. It is applicable to all detector geometries including monolithc charge coupled devices (CCDs), Active Pixel Sensors (APS) and hybrid FPA geometries based on a detector array bump-bonded to a readout integrated circuit (ROIC).
Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Kus, Mahmut; Okur, Salih; Demic, Şerafettin; Demirak, Kadir; Kurt, Mustafa; Icli, Sıddık
2016-05-01
A carboxylic group functioned charge transporting was synthesized and self-assembled on an indium tin oxide (ITO) anode. A typical electroluminescent device [modified ITO/TPD (50 nm)/Alq3 (60 nm)/LiF (2 nm)/(120 nm)] was fabricated to investigate the effect of the amino groups-small molecules interface on the characteristics of the device. The increase in the surface work function of ITO is expected to facilitate the hole injection from the ITO anode to the Hole Transport Layer (HTL) in electroluminescence. The modified electroluminescent device could endure a higher current and showed a much higher luminance than the nonmodified one. For the produced electroluminescent devices, the I-V characteristics, optical characterization and quantum yields were performed. The external quantum efficiency of the modified electroluminescent device is improved as the result of the presence of the amino groups-small molecules interface.
International Nuclear Information System (INIS)
Talik, N.A.; Yeoh, K.H.; Ng, C.Y.B.; Tan, C.Y.; Yap, B.K.
2016-01-01
We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN 6 has been used for tandem OLED. • The improvement attributes to the lower V bi and larger ΔV L in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.
Profiles of equilibrium constants for self-association of aromatic molecules.
Beshnova, Daria A; Lantushenko, Anastasia O; Davies, David B; Evstigneev, Maxim P
2009-04-28
Analysis of the noncovalent, noncooperative self-association of identical aromatic molecules assumes that the equilibrium self-association constants are either independent of the number of molecules (the EK-model) or change progressively with increasing aggregation (the AK-model). The dependence of the self-association constant on the number of molecules in the aggregate (i.e., the profile of the equilibrium constant) was empirically derived in the AK-model but, in order to provide some physical understanding of the profile, it is proposed that the sources for attenuation of the equilibrium constant are the loss of translational and rotational degrees of freedom, the ordering of molecules in the aggregates and the electrostatic contribution (for charged units). Expressions are derived for the profiles of the equilibrium constants for both neutral and charged molecules. Although the EK-model has been widely used in the analysis of experimental data, it is shown in this work that the derived equilibrium constant, K(EK), depends on the concentration range used and hence, on the experimental method employed. The relationship has also been demonstrated between the equilibrium constant K(EK) and the real dimerization constant, K(D), which shows that the value of K(EK) is always lower than K(D).
Thermally induced charge current through long molecules
Zimbovskaya, Natalya A.; Nitzan, Abraham
2018-01-01
In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.
Spectroscopy of Charged Quantum Dot Molecules
Stinaff, E. A.; Scheibner, M.; Bracker, A. S.; Ponomarev, I. V.; Ware, M. E.; Doty, M. F.; Reinecke, T. L.; Gammon, D.; Korenev, V. L.
2006-03-01
Spins of single charges in quantum dots are attractive for many quantum information and spintronic proposals. Scalable quantum information applications require the ability to entangle and operate on multiple spins in coupled quantum dots (CQDs). To further the understanding of these systems, we present detailed spectroscopic studies of InAs CQDs with control of the discrete electron or hole charging of the system. The optical spectrum reveals a pattern of energy anticrossings and crossings in the photoluminescence as a function of applied electric field. These features can be understood as a superposition of charge and spin configurations of the two dots and represent clear signatures of quantum mechanical coupling. The molecular resonance leading to these anticrossings is achieved at different electric fields for the optically excited (trion) states and the ground (hole) states allowing for the possibility of using the excited states for optically induced coupling of the qubits.
Charge Transport Processes in Molecular Junctions
Smith, Christopher Eugene
Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (chemically gated to modulate the transport. These results help advance our understanding of transport behavior in semiconducting molecular thin films, and open opportunities to engineer improved electronic functionality into molecular devices.
Charge-transport simulations in organic semiconductors
Energy Technology Data Exchange (ETDEWEB)
May, Falk
2012-07-06
In this thesis we have extended the methods for microscopic charge-transport simulations for organic semiconductors, where weak intermolecular interactions lead to spatially localized charge carriers, and the charge transport occurs as an activated hopping process between diabatic states. In addition to weak electronic couplings between these states, different electrostatic environments in the organic material lead to a broadening of the density of states for the charge energies which limits carrier mobilities. The contributions to the method development include (i) the derivation of a bimolecular charge-transfer rate, (ii) the efficient evaluation of intermolecular (outer-sphere) reorganization energies, (iii) the investigation of effects of conformational disorder on intramolecular reorganization energies or internal site energies and (iv) the inclusion of self-consistent polarization interactions for calculation of charge energies. These methods were applied to study charge transport in amorphous phases of small molecules used in the emission layer of organic light emitting diodes (OLED). When bulky substituents are attached to an aromatic core in order to adjust energy levels or prevent crystallization, a small amount of delocalization of the frontier orbital to the substituents can increase electronic couplings between neighboring molecules. This leads to improved charge-transfer rates and, hence, larger charge-mobility. We therefore suggest using the mesomeric effect (as opposed to the inductive effect) when attaching substituents to aromatic cores, which is necessary for example in deep blue OLEDs, where the energy levels of a host molecule have to be adjusted to those of the emitter. Furthermore, the energy landscape for charges in an amorphous phase cannot be predicted by mesoscopic models because they approximate the realistic morphology by a lattice and represent molecular charge distributions in a multipole expansion. The microscopic approach shows that
Cross-sections for inelastic collisions of fast charged particles with atoms and molecules
International Nuclear Information System (INIS)
Inokuti, M.
1987-01-01
Despite the long history of research, the current experimental data of the cross-sections, required for solving problems of radiological physics and dosimetry, are far from being complete or even satisfactory for tentative applications. Calculations are, in general, difficult and only in exceptional situations lead to reliable results. Thus, one practical approach to the cross-section determination is to test experimental data with general criteria. This is possible because cross-sections for various processes are related among themselves and with many other properties of atoms and molecules. For example, the Bethe theory indicates a close connection between photoabsorption and energy absorption by glancing collisions and puts many other useful constraints on the cross-section data. Development and use of these data constraints, first advanced by Platzman, can now be demonstrated in many examples. More recent studies concern the determination of the analytic expression most suitable for fitting the data on the oscillator strength distribution or the energy distribution of secondary electrons from ionizing collisions of charged particles. There are three areas to which major efforts should be directed: (1) Methods of absolute cross-section measurements, both for electron and ionic collisions, must be thoroughly reviewed so that sources of systematic errors may be identified and corrected. (2) Efforts should be devoted to the understanding of the data systematics, viz. the trends of cross-sections for a series of molecules. This is especially important because the variety of molecules relevant to radiological physics and radiation biology is so enormous that even the data presentation for each molecule will be impractical. (3) Electron and ionic collisions with molecules in condensed phases will be an important topic of study for years to come. Initial reports on efforts in this direction are encouraging. 49 refs
Energy Technology Data Exchange (ETDEWEB)
Talik, N.A., E-mail: azrina_talik@hotmail.com [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yeoh, K.H. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Centre for Photonics and Advanced Materials Research (CPR), Lee Kong Chian Faculty of Engineering and Science, University Tunku Abdul Rahman, 43000 Kajang, Selangor (Malaysia); Ng, C.Y.B. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Tan, C.Y. [Centre of Advanced Manufacturing & Material Processing (AMMP), Department of Mechanical Engineering, Faculty of Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yap, B.K., E-mail: kbyap@uniten.edu.my [Centre of Microelectronic and Nano Engineering (CeMNE), College of Engineering, Universiti Tenaga Nasional, 43000 Kajang, Selangor (Malaysia)
2016-01-15
We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN{sub 6} has been used for tandem OLED. • The improvement attributes to the lower V{sub bi} and larger ΔV{sub L} in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.
Directory of Open Access Journals (Sweden)
Ioan Bâldea
2016-03-01
Full Text Available As a sanity test for the theoretical method employed, studies on (steady-state charge transport through molecular devices usually confine themselves to check whether the method in question satisfies the charge conservation. Another important test of the theory’s correctness is to check that the computed current does not depend on the choice of the central region (also referred to as the “extended molecule”. This work addresses this issue and demonstrates that the relevant transport and transport-related properties are indeed invariant upon changing the size of the extended molecule, when the embedded molecule can be described within a general single-particle picture (namely, a second-quantized Hamiltonian bilinear in the creation and annihilation operators. It is also demonstrates that the invariance of nonequilibrium properties is exhibited by the exact results but not by those computed approximately within ubiquitous wide- and flat-band limits (WBL and FBL, respectively. To exemplify the limitations of the latter, the phenomenon of negative differential resistance (NDR is considered. It is shown that the exactly computed current may exhibit a substantial NDR, while the NDR effect is absent or drastically suppressed within the WBL and FBL approximations. The analysis done in conjunction with the WBLs and FBLs reveals why general studies on nonequilibrium properties require a more elaborate theoretical than studies on linear response properties (e.g., ohmic conductance and thermopower at zero temperature. Furthermore, examples are presented that demonstrate that treating parts of electrodes adjacent to the embedded molecule and the remaining semi-infinite electrodes at different levels of theory (which is exactly what most NEGF-DFT approaches do is a procedure that yields spurious structures in nonlinear ranges of current–voltage curves.
Charge migration and charge transfer in molecular systems
Directory of Open Access Journals (Sweden)
Hans Jakob Wörner
2017-11-01
Full Text Available The transfer of charge at the molecular level plays a fundamental role in many areas of chemistry, physics, biology and materials science. Today, more than 60 years after the seminal work of R. A. Marcus, charge transfer is still a very active field of research. An important recent impetus comes from the ability to resolve ever faster temporal events, down to the attosecond time scale. Such a high temporal resolution now offers the possibility to unravel the most elementary quantum dynamics of both electrons and nuclei that participate in the complex process of charge transfer. This review covers recent research that addresses the following questions. Can we reconstruct the migration of charge across a molecule on the atomic length and electronic time scales? Can we use strong laser fields to control charge migration? Can we temporally resolve and understand intramolecular charge transfer in dissociative ionization of small molecules, in transition-metal complexes and in conjugated polymers? Can we tailor molecular systems towards specific charge-transfer processes? What are the time scales of the elementary steps of charge transfer in liquids and nanoparticles? Important new insights into each of these topics, obtained from state-of-the-art ultrafast spectroscopy and/or theoretical methods, are summarized in this review.
International Nuclear Information System (INIS)
Olsen, Seth; McKenzie, Ross H.
2009-01-01
We propose a minimal model Hamiltonian for the electronic structure of a monomethine dye, in order to describe the photoisomerization of such dyes. The model describes interactions between three diabatic electronic states, each of which can be associated with a valence bond structure. Monomethine dyes are characterized by a charge-transfer resonance; the indeterminacy of the single-double bonding structure dictated by the resonance is reflected in a duality of photoisomerization pathways corresponding to the different methine bonds. The possible multiplicity of decay channels complicates mechanistic models of the effect of the environment on fluorescent quantum yields, as well as coherent control strategies. We examine the extent and topology of intersection seams between the electronic states of the dye and how they relate to charge localization and selection between different decay pathways. We find that intersections between the S 1 and S 0 surfaces only occur for large twist angles. In contrast, S 2 /S 1 intersections can occur near the Franck-Condon region. When the molecule has left-right symmetry, all intersections are associated with con- or disrotations and never with single bond twists. For asymmetric molecules (i.e., where the bridge couples more strongly to one end) the S 2 and S 1 surfaces bias torsion about different bonds. Charge localization and torsion pathway biasing are correlated. We relate our observations with several recent experimental and theoretical results, which have been obtained for dyes with similar structure.
Exploring Charge Transport in Guest Molecule Infiltrated Cu3(BTC)2 Metal Organic Framework
Energy Technology Data Exchange (ETDEWEB)
Leonard, Francois Leonard [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Stavila, Vitalie [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Allendorf, Mark D. [Sandia National Lab. (SNL-CA), Livermore, CA (United States)
2014-09-01
The goal of this Exploratory Express project was to expand the understanding of the physical properties of our recently discovered class of materials consisting of metal-organic frameworks with electroactive ‘guest’ molecules that together form an electrically conducting charge-transfer complex (molecule@MOF). Thin films of Cu3(BTC)2 were grown on fused silica using solution step-by-step growth and were infiltrated with the molecule tetracyanoquinodimethane (TCNQ). The infiltrated MOF films were extensively characterized using optical microscopy, scanning electron microscopy, Raman spectroscopy, electrical conductivity, and thermoelectric properties. Thermopower measurements on TCNQ@Cu3(BTC)2 revealed a positive Seebeck coefficient of ~400 μV/k, indicating that holes are the primary carriers in this material. The high value of the Seebeck coefficient and the expected low thermal conductivity suggest that molecule@MOF materials may be attractive for thermoelectric power conversion applications requiring low cost, solution-processable, and non-toxic active materials.
Accuracy of free energies of hydration using CM1 and CM3 atomic charges.
Udier-Blagović, Marina; Morales De Tirado, Patricia; Pearlman, Shoshannah A; Jorgensen, William L
2004-08-01
Absolute free energies of hydration (DeltaGhyd) have been computed for 25 diverse organic molecules using partial atomic charges derived from AM1 and PM3 wave functions via the CM1 and CM3 procedures of Cramer, Truhlar, and coworkers. Comparisons are made with results using charges fit to the electrostatic potential surface (EPS) from ab initio 6-31G* wave functions and from the OPLS-AA force field. OPLS Lennard-Jones parameters for the organic molecules were used together with the TIP4P water model in Monte Carlo simulations with free energy perturbation theory. Absolute free energies of hydration were computed for OPLS united-atom and all-atom methane by annihilating the solutes in water and in the gas phase, and absolute DeltaGhyd values for all other molecules were computed via transformation to one of these references. Optimal charge scaling factors were determined by minimizing the unsigned average error between experimental and calculated hydration free energies. The PM3-based charge models do not lead to lower average errors than obtained with the EPS charges for the subset of 13 molecules in the original study. However, improvement is obtained by scaling the CM1A partial charges by 1.14 and the CM3A charges by 1.15, which leads to average errors of 1.0 and 1.1 kcal/mol for the full set of 25 molecules. The scaled CM1A charges also yield the best results for the hydration of amides including the E/Z free-energy difference for N-methylacetamide in water. Copyright 2004 Wiley Periodicals, Inc.
Alqahtani, Obaid; Babics, Maxime; Gorenflot, Julien; Savikhin, Victoria; Ferron, Thomas; Balawi, Ahmed H.; Paulke, Andreas; Kan, Zhipeng; Pope, Michael; Clulow, Andrew J.; Wolf, Jannic Sebastian; Burn, Paul L.; Gentle, Ian R.; Neher, Dieter; Toney, Michael F.; Laquai, Fré dé ric; Beaujuge, Pierre; Collins, Brian A.
2018-01-01
The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.
Alqahtani, Obaid
2018-03-25
The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.
Improved Interaction Potentials for Charged Residues in Proteins
DEFF Research Database (Denmark)
Kepp, Kasper Planeta
2008-01-01
Electrostatic interactions dominate the structure and free energy of biomolecules. To obtain accurate free energies involving charged groups from molecular simulations, OPLS-AA parameters have been reoptimized using Monte Carlo free energy perturbation. New parameters fit a self-consistent, exper......Electrostatic interactions dominate the structure and free energy of biomolecules. To obtain accurate free energies involving charged groups from molecular simulations, OPLS-AA parameters have been reoptimized using Monte Carlo free energy perturbation. New parameters fit a self......, TIP4P or TIP3P; i.e., each water model requires specific water-charged molecule interaction potentials. New models (models 1 and 3) are thus described for both water models. Uncertainties in relative free energies of charged residues are ~2 kcal/mol with the new parameters, due to variations in system...
Yang, Bing
2014-12-04
Electronic delocalization effects have been proposed to play a key role in photocurrent generation in organic photovoltaic devices. Here, we study the role of charge delocalization on the nature of the charge-transfer (CT) states in the case of model complexes consisting of several pentacene molecules and one fullerene (C60) molecule, which are representative of donor/acceptor heterojunctions. The energies of the CT states are examined by means of time-dependent density functional theory (TD-DFT) using the long-range-corrected functional, ωB97X, with an optimized range-separation parameter, ω. We provide a general description of how the nature of the CT states is impacted by molecular packing (i.e., interfacial donor/acceptor orientations), system size, and intermolecular interactions, features of importance in the understanding of the charge-separation mechanism.
Electrochemical Single-Molecule Transistors with Optimized Gate Coupling
DEFF Research Database (Denmark)
Osorio, Henrry M.; Catarelli, Samantha; Cea, Pilar
2015-01-01
Electrochemical gating at the single molecule level of viologen molecular bridges in ionic liquids is examined. Contrary to previous data recorded in aqueous electrolytes, a clear and sharp peak in the single molecule conductance versus electrochemical potential data is obtained in ionic liquids....... These data are rationalized in terms of a two-step electrochemical model for charge transport across the redox bridge. In this model the gate coupling in the ionic liquid is found to be fully effective with a modeled gate coupling parameter, ξ, of unity. This compares to a much lower gate coupling parameter...
Experimental and theoretical data on ion-molecule-reactions relevant for plasma modelling
International Nuclear Information System (INIS)
Hansel, A.; Praxmarer, C.; Lindinger, W.
1995-01-01
Despite the fact that the rate coefficients of hundreds of ion-molecule-reactions have been published in the literature, much more data are required for the purpose of plasma modelling. Many ion molecule reactions have rate coefficients, k, as large as the collisional limiting value, k c , i.e. the rate coefficients k c at which ion-neutral collision complexes are formed are close to the actual rate coefficients observed. In the case of the interaction of an ion with a non polar molecule, k c , is determined by the Langevin limiting value k L being typically 10 -9 cm 3 s -1 . However, when ions react with polar molecules k c is predicted by the average dipole orientation (ADO) theory. These classical theories yield accurate rate coefficients at thermal and elevated temperatures for practically all proton transfer as well as for many charge transfer and hydrogen abstraction reactions. The agreement between experimental and calculated values is usually better than ±20% and in the case of proton transfer reactions the agreement seems to be even better as recent investigations have shown. Even the interaction of the permanent ion dipole with non polar and polar neutrals can be taken into account to predict reaction rate coefficients as has been shown very recently in reactions of the highly polar ion ArH 3 + with various neutrals
International Nuclear Information System (INIS)
Kumar Paul, Bijan; Samanta, Anuva; Kar, Samiran; Guchhait, Nikhil
2010-01-01
Intramolecular charge transfer (ICT) reaction has been investigated in 5-(4-dimethylamino-phenyl)-penta-2,4-dienoic acid methyl ester (DPDAME) using spectroscopic techniques. The molecule DPDAME shows local emission in non-polar solvent and dual emission in polar solvents. Solvatochromic effects on the Stokes shifted emission band clearly demonstrate the charge transfer character of the excited state. Quantum chemical calculations have been performed at Hartree-Fock (HF) and density functional theoretical (DFT) levels to correlate the experimental findings. Potential energy curves (PECs) for the ICT reaction have been evaluated along the donor twist angle at DFT and time dependent density functional theory (TDDFT) levels for the ground and excited states, respectively, using B3LYP hybrid functional and 6-31G** basis set. The solvent effects on the spectral properties have been explored theoretically at the same level with time dependent density functional theory-polarized continuum model (TDDFT-PCM) and the theoretical results are found to well substantiate the solvent polarity dependent Stokes shifted emission of DPDAME. Huge enhancement of dipole moment (Δμ=16.42 D) of the molecule following photoexcitation dictates the highly polar character of the excited state. Although elucidation of PECs does not exactly predict the operation of ICT according to twisted intramolecular charge transfer (TICT) model in DPDAME, lowering of vertical transition energy as a function of the donor twist coordinate scripts the occurrence of red shifted emission as observed experimentally.
Constrained-DFT method for accurate energy-level alignment of metal/molecule interfaces
Souza, A. M.
2013-10-07
We present a computational scheme for extracting the energy-level alignment of a metal/molecule interface, based on constrained density functional theory and local exchange and correlation functionals. The method, applied here to benzene on Li(100), allows us to evaluate charge-transfer energies, as well as the spatial distribution of the image charge induced on the metal surface. We systematically study the energies for charge transfer from the molecule to the substrate as function of the molecule-substrate distance, and investigate the effects arising from image-charge confinement and local charge neutrality violation. For benzene on Li(100) we find that the image-charge plane is located at about 1.8 Å above the Li surface, and that our calculated charge-transfer energies compare perfectly with those obtained with a classical electrostatic model having the image plane located at the same position. The methodology outlined here can be applied to study any metal/organic interface in the weak coupling limit at the computational cost of a total energy calculation. Most importantly, as the scheme is based on total energies and not on correcting the Kohn-Sham quasiparticle spectrum, accurate results can be obtained with local/semilocal exchange and correlation functionals. This enables a systematic approach to convergence.
Constrained-DFT method for accurate energy-level alignment of metal/molecule interfaces
Souza, A. M.; Rungger, I.; Pemmaraju, C. D.; Schwingenschlö gl, Udo; Sanvito, S.
2013-01-01
We present a computational scheme for extracting the energy-level alignment of a metal/molecule interface, based on constrained density functional theory and local exchange and correlation functionals. The method, applied here to benzene on Li(100), allows us to evaluate charge-transfer energies, as well as the spatial distribution of the image charge induced on the metal surface. We systematically study the energies for charge transfer from the molecule to the substrate as function of the molecule-substrate distance, and investigate the effects arising from image-charge confinement and local charge neutrality violation. For benzene on Li(100) we find that the image-charge plane is located at about 1.8 Å above the Li surface, and that our calculated charge-transfer energies compare perfectly with those obtained with a classical electrostatic model having the image plane located at the same position. The methodology outlined here can be applied to study any metal/organic interface in the weak coupling limit at the computational cost of a total energy calculation. Most importantly, as the scheme is based on total energies and not on correcting the Kohn-Sham quasiparticle spectrum, accurate results can be obtained with local/semilocal exchange and correlation functionals. This enables a systematic approach to convergence.
A model with charges and polarizability for CS2 in an ionic liquid
Indian Academy of Sciences (India)
RUTH M LYNDEN-BELL
the static electrostatic distribution in the CS2 molecule with 7 charged sites and anisotropic polarizability on the carbon site and isotropic .... the charges modified to reproduce the molecular quad- ... face at 1.5 times the van der Waals radii from the nuclei ..... shows the probability distribution of induced dipoles on the C site ...
Theory of Spin States of Quantum Dot Molecules
Ponomarev, I. V.; Reinecke, T. L.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Gammon, D.; Korenev, V. L.
2007-04-01
The photoluminescence spectrum of an asymmetric pair of coupled InAs quantum dots in an applied electric field shows a rich pattern of level anticrossings, crossings and fine structure that can be understood as a superposition of charge and spin configurations. We present a theoretical model that provides a description of the energy positions and intensities of the optical transitions in exciton, biexciton and charged exciton states of coupled quantum dots molecules.
Polarization and charge transfer in the hydration of chloride ions
International Nuclear Information System (INIS)
Zhao Zhen; Rogers, David M.; Beck, Thomas L.
2010-01-01
A theoretical study of the structural and electronic properties of the chloride ion and water molecules in the first hydration shell is presented. The calculations are performed on an ensemble of configurations obtained from molecular dynamics simulations of a single chloride ion in bulk water. The simulations utilize the polarizable AMOEBA force field for trajectory generation and MP2-level calculations are performed to examine the electronic structure properties of the ions and surrounding waters in the external field of more distant waters. The ChelpG method is employed to explore the effective charges and dipoles on the chloride ions and first-shell waters. The quantum theory of atoms in molecules (QTAIM) is further utilized to examine charge transfer from the anion to surrounding water molecules. The clusters extracted from the AMOEBA simulations exhibit high probabilities of anisotropic solvation for chloride ions in bulk water. From the QTAIM analysis, 0.2 elementary charges are transferred from the ion to the first-shell water molecules. The default AMOEBA model overestimates the average dipole moment magnitude of the ion compared to the quantum mechanical value. The average magnitude of the dipole moment of the water molecules in the first shell treated at the MP2-level, with the more distant waters handled with an AMOEBA effective charge model, is 2.67 D. This value is close to the AMOEBA result for first-shell waters (2.72 D) and is slightly reduced from the bulk AMOEBA value (2.78 D). The magnitude of the dipole moment of the water molecules in the first solvation shell is most strongly affected by the local water-water interactions and hydrogen bonds with the second solvation shell, rather than by interactions with the ion.
International Nuclear Information System (INIS)
Kuen, I.; Howorka, F.
1983-01-01
Absolute cross sections for the excitation of optically emitting states in collisions of He + , Ne + , Ar + , Kr + , B + , He ++ , Ne ++ and Ar ++ with oxygen molecules are measured, the energy range of the ion being1 - 1800 eV Lab for the singly charged and 1 - 3600 eV for the doubly charged ions. Seven important processes can be distinguished: charge exchange excitation of O 2 + band, O I, O II, X I and X II lines (X + , X ++ being the primary ion), direct excitation of X II and double charge exchange excitations. The energy dependences of the excitation cross sections are remarkably different for different processes but similar for one process with different ions. The sum total of all cross sections together for excitations which lead to light emission is on the order of a few square angstroms at 1000 eV c.m. energy. The results are of interest for surface investigations, plasma diagnostics and laser work. (Author)
Equilibrium configurations of tripolar charges
International Nuclear Information System (INIS)
Yershov, V.N.
2005-01-01
It is shown that an ensemble of particles with tripolar (color) charges will necessarily cohere in a hierarchy of structures, from simple clusters and strings to complex aggregates and cyclic molecule-like structures. The basic combinatoric rule remains essentially the same on different levels of the hierarchy, thus leading to a pattern of resemblance between different levels. The number of primitive charges in each structure is determined by the symmetry of the combined effective potential of this structure. The outlined scheme can serve as a framework for building a model of composite fundamental fermions. (author)
Charge distribution in an two-chain dual model
International Nuclear Information System (INIS)
Fialkowski, K.; Kotanski, A.
1983-01-01
Charge distributions in the multiple production processes are analysed using the dual chain model. A parametrisation of charge distributions for single dual chains based on the νp and anti vp data is proposed. The rapidity charge distributions are then calculated for pp and anti pp collisions and compared with the previous calculations based on the recursive cascade model of single chains. The results differ at the SPS collider energies and in the energy dependence of the net forward charge supplying the useful tests of the dual chain model. (orig.)
Modeling of charged anisotropic compact stars in general relativity
Energy Technology Data Exchange (ETDEWEB)
Dayanandan, Baiju; Maurya, S.K.; T, Smitha T. [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman)
2017-06-15
A charged compact star model has been determined for anisotropic fluid distribution. We have solved the Einstein-Maxwell field equations to construct the charged compact star model by using the radial pressure, the metric function e{sup λ} and the electric charge function. The generic charged anisotropic solution is verified by exploring different physical conditions like causality condition, mass-radius relation and stability of the solution (via the adiabatic index, TOV equations and the Herrera cracking concept). It is observed that the present charged anisotropic compact star model is compatible with the star PSR 1937+21. Moreover, we also presented the EOS ρ = f(p) for the present charged compact star model. (orig.)
Electrochemically-gated single-molecule electrical devices
International Nuclear Information System (INIS)
Guo, Shaoyin; Artés, Juan Manuel; Díez-Pérez, Ismael
2013-01-01
In the last decade, single-molecule electrical contacts have emerged as a new experimental platform that allows exploring charge transport phenomena in individual molecular blocks. This novel tool has evolved into an essential element within the Molecular Electronics field to understand charge transport processes in hybrid (bio)molecule/electrode interfaces at the nanoscale, and prospect the implementation of active molecular components into functional nanoscale optoelectronic devices. Within this area, three-terminal single-molecule devices have been sought, provided that they are highly desired to achieve full functionality in logic electronic circuits. Despite the latest experimental developments offer consistent methods to bridge a molecule between two electrodes (source and drain in a transistor notation), placing a third electrode (gate) close to the single-molecule electrical contact is still technically challenging. In this vein, electrochemically-gated single-molecule devices have emerged as an experimentally affordable alternative to overcome these technical limitations. In this review, the operating principle of an electrochemically-gated single-molecule device is presented together with the latest experimental methodologies to built them and characterize their charge transport characteristics. Then, an up-to-date comprehensive overview of the most prominent examples will be given, emphasizing on the relationship between the molecular structure and the final device electrical behaviour
Passing Current through Touching Molecules
DEFF Research Database (Denmark)
Schull, G.; Frederiksen, Thomas; Brandbyge, Mads
2009-01-01
The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...
Sterner, B; Harms, M; Wöll, S; Weigandt, M; Windbergs, M; Lehr, C M
2016-04-01
The treatment of joint related diseases often involves direct intra-articular injections. For rational development of novel delivery systems with extended residence time in the joint, detailed understanding of transport and retention phenomena within the joint is mandatory. This work presents a systematic study on the in vitro permeation, penetration and accumulation of model polymers with differing charges and molecular weights in bovine joint tissue. Permeation experiments with bovine synovial membrane were performed with PEG polymers (6-200 kDa) and methylene blue in customized diffusion chambers. For polyethylene glycol, 2-fold (PEG 6 kDa), 3-fold (PEG 10 kDa) and 13-fold (PEG 35 kDa) retention by the synovial membrane in reference to the small molecule methylene blue was demonstrated. No PEG 200 kDa was found in the acceptor in detectable amounts after 48 h. This showed the potential for a distinct extension of joint residence times by increasing molecular weights. In addition, experiments with bovine cartilage tissue were conducted. The ability for positively charged, high molecular weight chitosans and HEMA-Co-TMAP (HCT) polymers (up to 233 kDa) to distribute throughout the entire cartilage matrix was demonstrated. In contrast, a distribution into cartilage was not observed for neutral PEG polymers (6-200 kDa). Furthermore, the positive charge density of different compounds (chitosan, HEMA-Co-TMAP, methylene blue, MSC C1 (neutral NCE) and MSC D1 (positively charged NCE) was found to correlate with their accumulation in bovine cartilage tissue. In summary, the results offer pre-clinical in vitro data, indicating that the modification of molecular size and charge of a substance has the potential to decelerate its clearance through the synovial membrane and to promote accumulation inside the cartilage matrix. Copyright © 2016 Elsevier B.V. All rights reserved.
Lattice diffusion of a single molecule in solution
Ruggeri, Francesca; Krishnan, Madhavi
2017-12-01
The ability to trap a single molecule in an electrostatic potential well in solution has opened up new possibilities for the use of molecular electrical charge to study macromolecular conformation and dynamics at the level of the single entity. Here we study the diffusion of a single macromolecule in a two-dimensional lattice of electrostatic traps in solution. We report the ability to measure both the size and effective electrical charge of a macromolecule by observing single-molecule transport trajectories, typically a few seconds in length, using fluorescence microscopy. While, as shown previously, the time spent by the molecule in a trap is a strong function of its effective charge, we demonstrate here that the average travel time between traps in the landscape yields its hydrodynamic radius. Tailoring the pitch of the lattice thus yields two different experimentally measurable time scales that together uniquely determine both the size and charge of the molecule. Since no information is required on the location of the molecule between consecutive departure and arrival events at lattice sites, the technique is ideally suited to measurements on weakly emitting entities such as single molecules.
The interactions of high-energy, highly charged Xe ions with buckyballs
International Nuclear Information System (INIS)
Ali, R.; Berry, H.G.; Cheng, S.
1994-01-01
Ionization and fragmentation have been measured for C 60 molecules bombarded by highly charged (up to 35+) xenon ions with energies ranging up to 625 MeV. The observed mass distribution of positively charged fragments is explained in terms of a theoretical model indicating that the total interaction cross section contains roughly equal contributions from (a) excitation of the giant plasmon resonance, and (b) large-energy-transfer processes that lead to multiple fragmentation of the molecule. Preliminary results of measurements on VUV photons emitted in these interactions are also presented
Infrared intensities and charge mobility in hydrogen bonded complexes
Energy Technology Data Exchange (ETDEWEB)
Galimberti, Daria; Milani, Alberto; Castiglioni, Chiara [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta,” Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy)
2013-08-21
The analytical model for the study of charge mobility in the molecules presented by Galimberti et al.[J. Chem. Phys. 138, 164115 (2013)] is applied to hydrogen bonded planar dimers. Atomic charges and charge fluxes are obtained from density functional theory computed atomic polar tensors and related first derivatives, thus providing an interpretation of the IR intensity enhancement of the X–H stretching band observed upon aggregation. Our results show that both principal and non-principal charge fluxes have an important role for the rationalization of the spectral behavior; moreover, they demonstrate that the modulation of the charge distribution during vibrational motions of the –XH⋯Y– fragment is not localized exclusively on the atoms directly involved in hydrogen bonding. With these premises we made some correlations between IR intensities, interaction energies, and charge fluxes. The model was tested on small dimers and subsequently to the bigger one cytosine-guanine. Thus, the model can be applied to complex systems.
International Nuclear Information System (INIS)
Abbas, I.
2008-05-01
We have developed a relatively simple model to calculate total cross-sections of various ionizing processes involving ion-atom or ion-molecule collisions. This model is based on the Zarour and Saalmann model and has benefited from 2 other models: the classical over-barrier (COB) model and the classical trajectory Monte-Carlo (CTMC) model. The COB model is used to describe the initial conditions of the target's electrons and their process us of creation while the CTMC model is used to build the statistical aspects necessary to calculate the cross sections of the ionizing processes. 3 major improvements have been brought to the Zarour and Saalmann model. First, the particle-particle interactions have been described by a Coulombian potential which is more realistic. Secondly, the initial conditions in the target are better represented by taking into account in an aleatory manner the position and speed distributions of the electrons. Thirdly, the use of energy criteria instead of purely geometrical ones to describe the final situation of the electrons has led to a better determination of the possible ionizing events. We have validated our model by applying it first, in collisional systems involving multi-charged projectiles like H + , He 2+ , Li 3+ , C 6+ , O 8+ and Ne 10+ and simple targets like H, He and H 2 , for which a lot of experimental data is available. Then, we have studied collisions involving the water molecule for which experimental and experimental data exist. Satisfactorily results for H 2 O target has led us to study other biological targets like adenine or cytosine. We have shown that our results are valid for impact energies over 100 keV/uma and most satisfactorily results concern simple ionizing processes like simple capture and simple ionization. For more complex processes such as transfer-ionization, double capture or double ionization, our results are valid for helium and hydrogen targets. In the case of water, the cross-sections of double
Spectrally resolved single-molecule electrometry
Ruggeri, F.; Krishnan, M.
2018-03-01
Escape-time electrometry is a recently developed experimental technique that offers the ability to measure the effective electrical charge of a single biomolecule in solution with sub-elementary charge precision. The approach relies on measuring the average escape-time of a single charged macromolecule or molecular species transiently confined in an electrostatic fluidic trap. Comparing the experiments with the predictions of a mean-field model of molecular electrostatics, we have found that the measured effective charge even reports on molecular conformation, e.g., folded or disordered state, and non-uniform charge distribution in disordered proteins or polyelectrolytes. Here we demonstrate the ability to use the spectral dimension to distinguish minute differences in electrical charge between individual molecules or molecular species in a single simultaneous measurement, under identical experimental conditions. Using one spectral channel for referenced measurement, this kind of photophysical distinguishability essentially eliminates the need for accurate knowledge of key experimental parameters, otherwise obtained through intensive characterization of the experimental setup. As examples, we demonstrate the ability to detect small differences (˜5%) in the length of double-stranded DNA fragments as well as single amino acid exchange in an intrinsically disordered protein, prothymosin α.
Kuechler, Erich R; Giese, Timothy J; York, Darrin M
2016-04-28
To better represent the solvation effects observed along reaction pathways, and of ionic species in general, a charge-dependent variable-radii smooth conductor-like screening model (VR-SCOSMO) is developed. This model is implemented and parameterized with a third order density-functional tight binding quantum model, DFTB3/3OB-OPhyd, a quantum method which was developed for organic and biological compounds, utilizing a specific parameterization for phosphate hydrolysis reactions. Unlike most other applications with the DFTB3/3OB model, an auxiliary set of atomic multipoles is constructed from the underlying DFTB3 density matrix which is used to interact the solute with the solvent response surface. The resulting method is variational, produces smooth energies, and has analytic gradients. As a baseline, a conventional SCOSMO model with fixed radii is also parameterized. The SCOSMO and VR-SCOSMO models shown have comparable accuracy in reproducing neutral-molecule absolute solvation free energies; however, the VR-SCOSMO model is shown to reduce the mean unsigned errors (MUEs) of ionic compounds by half (about 2-3 kcal/mol). The VR-SCOSMO model presents similar accuracy as a charge-dependent Poisson-Boltzmann model introduced by Hou et al. [J. Chem. Theory Comput. 6, 2303 (2010)]. VR-SCOSMO is then used to examine the hydrolysis of trimethylphosphate and seven other phosphoryl transesterification reactions with different leaving groups. Two-dimensional energy landscapes are constructed for these reactions and calculated barriers are compared to those obtained from ab initio polarizable continuum calculations and experiment. Results of the VR-SCOSMO model are in good agreement in both cases, capturing the rate-limiting reaction barrier and the nature of the transition state.
Charge-Spot Model for Electrostatic Forces in Simulation of Fine Particulates
Walton, Otis R.; Johnson, Scott M.
2010-01-01
The charge-spot technique for modeling the static electric forces acting between charged fine particles entails treating electric charges on individual particles as small sets of discrete point charges, located near their surfaces. This is in contrast to existing models, which assume a single charge per particle. The charge-spot technique more accurately describes the forces, torques, and moments that act on triboelectrically charged particles, especially image-charge forces acting near conducting surfaces. The discrete element method (DEM) simulation uses a truncation range to limit the number of near-neighbor charge spots via a shifted and truncated potential Coulomb interaction. The model can be readily adapted to account for induced dipoles in uncharged particles (and thus dielectrophoretic forces) by allowing two charge spots of opposite signs to be created in response to an external electric field. To account for virtual overlap during contacts, the model can be set to automatically scale down the effective charge in proportion to the amount of virtual overlap of the charge spots. This can be accomplished by mimicking the behavior of two real overlapping spherical charge clouds, or with other approximate forms. The charge-spot method much more closely resembles real non-uniform surface charge distributions that result from tribocharging than simpler approaches, which just assign a single total charge to a particle. With the charge-spot model, a single particle may have a zero net charge, but still have both positive and negative charge spots, which could produce substantial forces on the particle when it is close to other charges, when it is in an external electric field, or when near a conducting surface. Since the charge-spot model can contain any number of charges per particle, can be used with only one or two charge spots per particle for simulating charging from solar wind bombardment, or with several charge spots for simulating triboelectric charging
Conduction mechanism in assemblies of metal nanoparticles linked by organic molecules
International Nuclear Information System (INIS)
Mueller, K.-H.; Herrmann, J.; Raguse, B.; Baxter, G.; Reda, T.
2002-01-01
Full text: We have investigated theoretically and experimentally electron transport through thin films of gold nanoparticles which are linked by alkanedithiol molecules of different chain lengths. We find that conduction between neighbouring nanoparticles takes place by electron tunnelling along weakly conducting organic linker molecules. Using a tight binding model for the alkanedithiol molecules to describe the tunnelling process we predict the conductivity to decrease exponentially with the length of the molecules. During tunnelling the electron has to overcome a charging energy due to the electron-hole interaction between tunnelling electrons and the corresponding holes left behind on the donor nanoparticle. Experimentally we find that large applied voltages cause nonlinear I-V characteristics and that the temperature dependence of the conductivity does not show Arrhenius behaviour but instead is of the form exp[-(E o /kT) 1/2 ]. Using percolation theory for a network of metal nanoparticles separated by barriers we show that strong disorder caused by variations in nanoparticle size and linker length as well as randomly trapped electric charges on the linker molecules can well explain our experimental data
Solid charged-core model of ball lightning
Muldrew, D. B.
2010-01-01
In this study, ball lightning (BL) is assumed to have a solid, positively-charged core. According to this underlying assumption, the core is surrounded by a thin electron layer with a charge nearly equal in magnitude to that of the core. A vacuum exists between the core and the electron layer containing an intense electromagnetic (EM) field which is reflected and guided by the electron layer. The microwave EM field applies a ponderomotive force (radiation pressure) to the electrons preventing them from falling into the core. The energetic electrons ionize the air next to the electron layer forming a neutral plasma layer. The electric-field distributions and their associated frequencies in the ball are determined by applying boundary conditions to a differential equation given by Stratton (1941). It is then shown that the electron and plasma layers are sufficiently thick and dense to completely trap and guide the EM field. This model of BL is exceptional in that it can explain all or nearly all of the peculiar characteristics of BL. The ES energy associated with the core charge can be extremely large which can explain the observations that occasionally BL contains enormous energy. The mass of the core prevents the BL from rising like a helium-filled balloon - a problem with most plasma and burning-gas models. The positively charged core keeps the negatively charged electron layer from diffusing away, i.e. it holds the ball together; other models do not have a mechanism to do this. The high electrical charges on the core and in the electron layer explains why some people have been electrocuted by BL. Experiments indicate that BL radiates microwaves upon exploding and this is consistent with the model. The fact that this novel model of BL can explain these and other observations is strong evidence that the model should be taken seriously.
Gravitational instantons as models for charged particle systems
Franchetti, Guido; Manton, Nicholas S.
2013-03-01
In this paper we propose ALF gravitational instantons of types A k and D k as models for charged particle systems. We calculate the charges of the two families. These are -( k + 1) for A k , which is proposed as a model for k + 1 electrons, and 2 - k for D k , which is proposed as a model for either a particle of charge +2 and k electrons or a proton and k - 1 electrons. Making use of preferred topological and metrical structures of the manifolds, namely metrically preferred representatives of middle dimension homology classes, we construct two different energy functionals which reproduce the Coulomb interaction energy for a system of charged particles.
International Nuclear Information System (INIS)
Panov, M.N.; Afrosimov, V.V.; Basalaev, A.A.; Guschina, N.A.; Nikulin, V.K.
2006-01-01
The interactions of protons and alpha-particles with hydrocarbons are investigated. A quantum-mechanical computation of the electronic structure of all hydrocarbons from methane to butane and its fragment ions was performed in the Hartree-Fock RHF/UHF approximation using a GAMESS program (General Atomic Molecular Electron Structure System). The correlation energy was taken into account within the framework of MP2 perturbation theory. The structural parameters of the hydrocarbon molecules and their charged and neutral fragments were calculated in two cases: in the geometry of the parent molecule or of the relaxation states. The difference of the full energy of the same fragments in and out of brackets gives us the vibration excitation energies of the fragments at the moment of creation. Additional Mulliken effective charges (in electron charge units) of atoms in the fragments have been calculated. The calculations show that removing one electron from the ethane molecule without electronic excitation produced a single charged molecular ion in vibration state with binding energy of hydrogen atoms, some decimal eV. As results we obtain C 2 H 6 + and C 2 H 5 + . Additional fragmentation of hydrocarbon needs electronic excitation of produced single charged ions. Cross sections for electron capture and excitation processes in collisions between the hydrogen-like He + , B 4+ and O 7+ ions have been evaluated. The purpose of the theory within this project during the period under review was to get for the first time new data on Single-Electron Capture (SEC) and Excitation Processes (EP) in collisions of He + (1s) ions with hydrogen-like impurity ions B 4+ (1s) and O 7+ (1s) in the energy range for He + ions from 0.2 MeV to 3.0 MeV. The calculations were carried out by using the method of close-coupling equations with basis sets of eleven and ten quasimolecular two-electron states for reactions (1, 2) and (3, 4), respectively (entrance channel, seven charge transfer channels
Huang, Jing; Mei, Ye; König, Gerhard; Simmonett, Andrew C; Pickard, Frank C; Wu, Qin; Wang, Lee-Ping; MacKerell, Alexander D; Brooks, Bernard R; Shao, Yihan
2017-02-14
In this work, we report two polarizable molecular mechanics (polMM) force field models for estimating the polarization energy in hybrid quantum mechanical molecular mechanical (QM/MM) calculations. These two models, named the potential of atomic charges (PAC) and potential of atomic dipoles (PAD), are formulated from the ab initio quantum mechanical (QM) response kernels for the prediction of the QM density response to an external molecular mechanical (MM) environment (as described by external point charges). The PAC model is similar to fluctuating charge (FQ) models because the energy depends on external electrostatic potential values at QM atomic sites; the PAD energy depends on external electrostatic field values at QM atomic sites, resembling induced dipole (ID) models. To demonstrate their uses, we apply the PAC and PAD models to 12 small molecules, which are solvated by TIP3P water. The PAC model reproduces the QM/MM polarization energy with a R 2 value of 0.71 for aniline (in 10,000 TIP3P water configurations) and 0.87 or higher for other 11 solute molecules, while the PAD model has a much better performance with R 2 values of 0.98 or higher. The PAC model reproduces reference QM/MM hydration free energies for 12 solute molecules with a RMSD of 0.59 kcal/mol. The PAD model is even more accurate, with a much smaller RMSD of 0.12 kcal/mol, with respect to the reference. This suggests that polarization effects, including both local charge distortion and intramolecular charge transfer, can be well captured by induced dipole type models with proper parametrization.
Simulations of charge transport in organic compounds
Energy Technology Data Exchange (ETDEWEB)
Vehoff, Thorsten
2010-05-05
features: first, the shifted cofacial alignment of its molecules, and second, the high center of mass vibrational frequency. In comparsion to SCD, only KMC based on Marcus rates is capable of describing neighbors with low coupling and of taking static disorder into account three-dimensionally. SCD, despite its one-dimensionality, is valuable for crystals with strong coupling and little disorder. It also allows correct treatment of dynamical effects, such as intermolecular vibrations of the molecules. Rate equations are incapable of this, because simulations are performed on static snapshots. We have thus shown strengths and weaknesses of two state of the art models used to study charge transport in organic compounds, partially developed a program to compute and visualize transfer integral distributions and other charge transport properties, and found structure-mobility relations for several promising organic semiconductors. (orig.)
Charge-coupled-device X-ray detector performance model
Bautz, M. W.; Berman, G. E.; Doty, J. P.; Ricker, G. R.
1987-01-01
A model that predicts the performance characteristics of CCD detectors being developed for use in X-ray imaging is presented. The model accounts for the interactions of both X-rays and charged particles with the CCD and simulates the transport and loss of charge in the detector. Predicted performance parameters include detective and net quantum efficiencies, split-event probability, and a parameter characterizing the effective thickness presented by the detector to cosmic-ray protons. The predicted performance of two CCDs of different epitaxial layer thicknesses is compared. The model predicts that in each device incomplete recovery of the charge liberated by a photon of energy between 0.1 and 10 keV is very likely to be accompanied by charge splitting between adjacent pixels. The implications of the model predictions for CCD data processing algorithms are briefly discussed.
Single-Molecule Electronics: Chemical and Analytical Perspectives.
Nichols, Richard J; Higgins, Simon J
2015-01-01
It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.
Theoretical aspects of electron transfer reactions of complex molecules
DEFF Research Database (Denmark)
Kuznetsov, A. M.; Ulstrup, Jens
2001-01-01
Features of electron transfer involving complex molecules are discussed. This notion presently refers to molecular reactants where charge transfer is accompanied by large molecular reorganization, and commonly used displaced harmonic oscillator models do not apply. It is shown that comprehensive...... theory of charge transfer in polar media offers convenient tools for the treatment of experimental data for such systems, with due account of large-amplitude strongly anharmonic intramolecular reorganization. Equations for the activation barrier and free energy relationships are provided, incorporating...
Anisotropic charged generalized polytropic models
Nasim, A.; Azam, M.
2018-06-01
In this paper, we found some new anisotropic charged models admitting generalized polytropic equation of state with spherically symmetry. An analytic solution of the Einstein-Maxwell field equations is obtained through the transformation introduced by Durgapal and Banerji (Phys. Rev. D 27:328, 1983). The physical viability of solutions corresponding to polytropic index η =1/2, 2/3, 1, 2 is analyzed graphically. For this, we plot physical quantities such as radial and tangential pressure, anisotropy, speed of sound which demonstrated that these models achieve all the considerable physical conditions required for a relativistic star. Further, it is mentioned here that previous results for anisotropic charged matter with linear, quadratic and polytropic equation of state can be retrieved.
International Nuclear Information System (INIS)
Kusakabe, Toshio; Kitamuro, Satoshi; Nakai, Yohta; Tawara, Hiroyuki; Sasao, Mamiko
2012-01-01
Charge-transfer cross sections of the ground state He + ions in collisions with He atoms and simple molecules (H 2 , D 2 , N 2 , CO and CO 2 ) have been measured in the energy range of 0.20 to 4.0 keV with the initial growth rate method. Since previously published experimental data are scattered in the low energy region, the present observations would provide reasonably reliable cross section data below 4 keV. The charge transfer accompanied by dissociation of product molecular ion can be dominant at low energies for molecular targets. In He + + D 2 collisions, any isotope effect was not observed over the present energy range, compared to H 2 molecule. (author)
Complexation behavior of oppositely charged polyelectrolytes: Effect of charge distribution
International Nuclear Information System (INIS)
Zhao, Mingtian; Li, Baohui; Zhou, Jihan; Su, Cuicui; Niu, Lin; Liang, Dehai
2015-01-01
Complexation behavior of oppositely charged polyelectrolytes in a solution is investigated using a combination of computer simulations and experiments, focusing on the influence of polyelectrolyte charge distributions along the chains on the structure of the polyelectrolyte complexes. The simulations are performed using Monte Carlo with the replica-exchange algorithm for three model systems where each system is composed of a mixture of two types of oppositely charged model polyelectrolyte chains (EGEG) 5 /(KGKG) 5 , (EEGG) 5 /(KKGG) 5 , and (EEGG) 5 /(KGKG) 5 , in a solution including explicit solvent molecules. Among the three model systems, only the charge distributions along the chains are not identical. Thermodynamic quantities are calculated as a function of temperature (or ionic strength), and the microscopic structures of complexes are examined. It is found that the three systems have different transition temperatures, and form complexes with different sizes, structures, and densities at a given temperature. Complex microscopic structures with an alternating arrangement of one monolayer of E/K monomers and one monolayer of G monomers, with one bilayer of E and K monomers and one bilayer of G monomers, and with a mixture of monolayer and bilayer of E/K monomers in a box shape and a trilayer of G monomers inside the box are obtained for the three mixture systems, respectively. The experiments are carried out for three systems where each is composed of a mixture of two types of oppositely charged peptide chains. Each peptide chain is composed of Lysine (K) and glycine (G) or glutamate (E) and G, in solution, and the chain length and amino acid sequences, and hence the charge distribution, are precisely controlled, and all of them are identical with those for the corresponding model chain. The complexation behavior and complex structures are characterized through laser light scattering and atomic force microscopy measurements. The order of the apparent weight
Graphical models for inferring single molecule dynamics
Directory of Open Access Journals (Sweden)
Gonzalez Ruben L
2010-10-01
Full Text Available Abstract Background The recent explosion of experimental techniques in single molecule biophysics has generated a variety of novel time series data requiring equally novel computational tools for analysis and inference. This article describes in general terms how graphical modeling may be used to learn from biophysical time series data using the variational Bayesian expectation maximization algorithm (VBEM. The discussion is illustrated by the example of single-molecule fluorescence resonance energy transfer (smFRET versus time data, where the smFRET time series is modeled as a hidden Markov model (HMM with Gaussian observables. A detailed description of smFRET is provided as well. Results The VBEM algorithm returns the model’s evidence and an approximating posterior parameter distribution given the data. The former provides a metric for model selection via maximum evidence (ME, and the latter a description of the model’s parameters learned from the data. ME/VBEM provide several advantages over the more commonly used approach of maximum likelihood (ML optimized by the expectation maximization (EM algorithm, the most important being a natural form of model selection and a well-posed (non-divergent optimization problem. Conclusions The results demonstrate the utility of graphical modeling for inference of dynamic processes in single molecule biophysics.
Directory of Open Access Journals (Sweden)
Haoming Liu
2018-04-01
Full Text Available With the advance of battery energy technology, electric vehicles (EV are catching more and more attention. One of the influencing factors of electric vehicles large-scale application is the availability of charging stations and convenience of charging. It is important to investigate how to make reserving charging strategies and ensure electric vehicles are charged with shorter time and lower charging expense whenever charging request is proposed. This paper proposes a reserving charging decision-making model for electric vehicles that move to certain destinations and need charging services in consideration of traffic conditions and available charging resources at the charging stations. Besides, the interactive mechanism is described to show how the reserving charging system works, as well as the rolling records-based credit mechanism where extra charges from EV is considered to hedge default behavior. With the objectives of minimizing driving time and minimizing charging expenses, an optimization model with two objective functions is formulated. Then the optimizations are solved by a K shortest paths algorithm based on a weighted directed graph, where the time and distance factors are respectively treated as weights of corresponding edges of transportation networks. Case studies show the effectiveness and validity of the proposed route plan and reserving charging decision-making model.
Multi-Excitonic Quantum Dot Molecules
Scheibner, M.; Stinaff, E. A.; Doty, M. F.; Ware, M. E.; Bracker, A. S.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.
2006-03-01
With the ability to create coupled pairs of quantum dots, the next step towards the realization of semiconductor based quantum information processing devices can be taken. However, so far little knowledge has been gained on these artificial molecules. Our photoluminescence experiments on single InAs/GaAs quantum dot molecules provide the systematics of coupled quantum dots by delineating the spectroscopic features of several key charge configurations in such quantum systems, including X, X^+,X^2+, XX, XX^+ (with X being the neutral exciton). We extract general rules which determine the formation of molecular states of coupled quantum dots. These include the fact that quantum dot molecules provide the possibility to realize various spin configurations and to switch the electron hole exchange interaction on and off by shifting charges inside the molecule. This knowledge will be valuable in developing implementations for quantum information processing.
Enhancing SERS by Means of Supramolecular Charge Transfer
Wong, Eric; Flood, Amar; Morales, Alfredo
2009-01-01
In a proposed method of sensing small quantities of molecules of interest, surface enhanced Raman scattering (SERS) spectroscopy would be further enhanced by means of intermolecular or supramolecular charge transfer. There is a very large potential market for sensors based on this method for rapid detection of chemical and biological hazards. In SERS, the Raman signals (vibrational spectra) of target molecules become enhanced by factors of the order of 108 when those molecules are in the vicinities of nanostructured substrate surfaces that have been engineered to have plasmon resonances that enhance local electric fields. SERS, as reported in several prior NASA Tech Briefs articles and elsewhere, has remained a research tool and has not yet been developed into a practical technique for sensing of target molecules: this is because the short range (5 to 20 nm) of the field enhancement necessitates engineering of receptor molecules to attract target molecules to the nanostructured substrate surfaces and to enable reliable identification of the target molecules in the presence of interferants. Intermolecular charge-transfer complexes have been used in fluorescence-, photoluminescence-, and electrochemistry-based techniques for sensing target molecules, but, until now, have not been considered for use in SERS-based sensing. The basic idea of the proposed method is to engineer receptor molecules that would be attached to nanostructured SERS substrates and that would interact with the target molecules to form receptor-target supramolecular charge-transfer complexes wherein the charge transfer could be photoexcited.
The R.E.D. tools: advances in RESP and ESP charge derivation and force field library building.
Dupradeau, François-Yves; Pigache, Adrien; Zaffran, Thomas; Savineau, Corentin; Lelong, Rodolphe; Grivel, Nicolas; Lelong, Dimitri; Rosanski, Wilfried; Cieplak, Piotr
2010-07-28
Deriving atomic charges and building a force field library for a new molecule are key steps when developing a force field required for conducting structural and energy-based analysis using molecular mechanics. Derivation of popular RESP charges for a set of residues is a complex and error prone procedure because it depends on numerous input parameters. To overcome these problems, the R.E.D. Tools (RESP and ESP charge Derive, ) have been developed to perform charge derivation in an automatic and straightforward way. The R.E.D. program handles chemical elements up to bromine in the periodic table. It interfaces different quantum mechanical programs employed for geometry optimization and computing molecular electrostatic potential(s), and performs charge fitting using the RESP program. By defining tight optimization criteria and by controlling the molecular orientation of each optimized geometry, charge values are reproduced at any computer platform with an accuracy of 0.0001 e. The charges can be fitted using multiple conformations, making them suitable for molecular dynamics simulations. R.E.D. allows also for defining charge constraints during multiple molecule charge fitting, which are used to derive charges for molecular fragments. Finally, R.E.D. incorporates charges into a force field library, readily usable in molecular dynamics computer packages. For complex cases, such as a set of homologous molecules belonging to a common family, an entire force field topology database is generated. Currently, the atomic charges and force field libraries have been developed for more than fifty model systems and stored in the RESP ESP charge DDataBase. Selected results related to non-polarizable charge models are presented and discussed.
Small molecule hydration energy and entropy from 3D-RISM
Johnson, J.; Case, D. A.; Yamazaki, T.; Gusarov, S.; Kovalenko, A.; Luchko, T.
2016-09-01
Implicit solvent models offer an attractive way to estimate the effects of a solvent environment on the properties of small or large solutes without the complications of explicit simulations. One common test of accuracy is to compute the free energy of transfer from gas to liquid for a variety of small molecules, since many of these values have been measured. Studies of the temperature dependence of these values (i.e. solvation enthalpies and entropies) can provide additional insights into the performance of implicit solvent models. Here, we show how to compute temperature derivatives of hydration free energies for the 3D-RISM integral equation approach. We have computed hydration free energies of 1123 small drug-like molecules (both neutral and charged). Temperature derivatives were also used to calculate hydration energies and entropies of 74 of these molecules (both neutral and charged) for which experimental data is available. While direct results have rather poor agreement with experiment, we have found that several previously proposed linear hydration free energy correction schemes give good agreement with experiment. These corrections also provide good agreement for hydration energies and entropies though simple extensions are required in some cases.
Small molecule hydration energy and entropy from 3D-RISM
International Nuclear Information System (INIS)
Johnson, J; Case, D A; Yamazaki, T; Gusarov, S; Kovalenko, A; Luchko, T
2016-01-01
Implicit solvent models offer an attractive way to estimate the effects of a solvent environment on the properties of small or large solutes without the complications of explicit simulations. One common test of accuracy is to compute the free energy of transfer from gas to liquid for a variety of small molecules, since many of these values have been measured. Studies of the temperature dependence of these values (i.e. solvation enthalpies and entropies) can provide additional insights into the performance of implicit solvent models. Here, we show how to compute temperature derivatives of hydration free energies for the 3D-RISM integral equation approach. We have computed hydration free energies of 1123 small drug-like molecules (both neutral and charged). Temperature derivatives were also used to calculate hydration energies and entropies of 74 of these molecules (both neutral and charged) for which experimental data is available. While direct results have rather poor agreement with experiment, we have found that several previously proposed linear hydration free energy correction schemes give good agreement with experiment. These corrections also provide good agreement for hydration energies and entropies though simple extensions are required in some cases. (paper)
Simple standard model extension by heavy charged scalar
Boos, E.; Volobuev, I.
2018-05-01
We consider a Standard Model (SM) extension by a heavy charged scalar gauged only under the UY(1 ) weak hypercharge gauge group. Such an extension, being gauge invariant with respect to the SM gauge group, is a simple special case of the well-known Zee model. Since the interactions of the charged scalar with the Standard Model fermions turn out to be significantly suppressed compared to the Standard Model interactions, the charged scalar provides an example of a long-lived charged particle being interesting to search for at the LHC. We present the pair and single production cross sections of the charged scalar at different colliders and the possible decay widths for various boson masses. It is shown that the current ATLAS and CMS searches at 8 and 13 TeV collision energy lead to the bounds on the scalar boson mass of about 300-320 GeV. The limits are expected to be much larger for higher collision energies and, assuming 15 a b-1 integrated luminosity, reach about 2.7 TeV at future 27 TeV LHC thus covering the most interesting mass region.
International Nuclear Information System (INIS)
Kazanskii, A.K.
1984-01-01
The detachment of the electron from the H - ion during a collision with the nitrogen molecule at 1--6 keV occurs as a result of charge transfer to an unstable intermediate state of the molecular ion N - 2 and the subsequent decay of the ion. The formation process is described in the impulse approximation, and the motion of nuclei in the ion is treated quasiclassically. Expressions are obtained for the spectrum of emitted electrons and for the energy-loss spectrum of heavy particles. These expressions relate the spectra to the cross sections for the vibrational excitation of N 2 by electron impact. A convenient expression for the amplitude for the formation of the intermediate state is obtained in the ''boomerang'' model, and it is shown that one of the parameters, considered to be adjustable in traditional theory, can be calculated
Nuclear fusion rate of the muonic T3 molecule
International Nuclear Information System (INIS)
Faghihi, F.; Eskandari, M. R.
2004-01-01
The ground state binding energy, size and effective nuclear charge of the muonic T 3 molecule are calculated using Born-Oppenheimer adiabatic approximation. The system possesses two minimum positions, one at typically muonic and the second at the atomic distances. A symmetric planar vibrational model between two minima is assumed and the approximated potential are calculated. Moreover, nuclear fusion rate calculations of the short-life molecule is carried out due to the overlap integral of the resonance nuclear compound nucleus and the molecular wave functions
A Simplified Quantum Mechanical Model of Diatomic Molecules
Nielsen, Lars Drud
1978-01-01
Introduces a simple one-dimensional model of a diatomic molecule that can explain all the essential features of a real two particle quantum mechanical system and gives quantitative results in fair agreement with those of a hydrogen molecule. (GA)
Space-Charge-Limited Emission Models for Particle Simulation
Verboncoeur, J. P.; Cartwright, K. L.; Murphy, T.
2004-11-01
Space-charge-limited (SCL) emission of electrons from various materials is a common method of generating the high current beams required to drive high power microwave (HPM) sources. In the SCL emission process, sufficient space charge is extracted from a surface, often of complicated geometry, to drive the electric field normal to the surface close to zero. The emitted current is highly dominated by space charge effects as well as ambient fields near the surface. In this work, we consider computational models for the macroscopic SCL emission process including application of Gauss's law and the Child-Langmuir law for space-charge-limited emission. Models are described for ideal conductors, lossy conductors, and dielectrics. Also considered is the discretization of these models, and the implications for the emission physics. Previous work on primary and dual-cell emission models [Watrous et al., Phys. Plasmas 8, 289-296 (2001)] is reexamined, and aspects of the performance, including fidelity and noise properties, are improved. Models for one-dimensional diodes are considered, as well as multidimensional emitting surfaces, which include corners and transverse fields.
Single Molecule Nanoelectrochemistry in Electrical Junctions.
Nichols, Richard J; Higgins, Simon J
2016-11-15
It is now possible to reliably measure single molecule conductance in a wide variety of environments including organic liquids, ultrahigh vacuum, water, ionic liquids, and electrolytes. The most commonly used methods deploy scanning probe microscopes, mechanically formed break junctions, or lithographically formed nanogap contacts. Molecules are generally captured between a pair of facing electrodes, and the junction current response is measured as a function of bias voltage. Gating electrodes can also be added so that the electrostatic potential at the molecular bridge can be independently controlled by this third noncontacting electrode. This can also be achieved in an electrolytic environment using a four-electrode bipotentiostatic configuration, which allows independent electrode potential control of the two contacting electrodes. This is commonly realized using an electrochemical STM and enables single molecule electrical characterization as a function of electrode potential and redox state of the molecular bridge. This has emerged as a powerful tool in modern interfacial electrochemistry and nanoelectrochemistry for studying charge transport across single molecules as a function of electrode potential and the electrolytic environments. Such measurements are possible in electrolytes ranging from aqueous buffers to nonaqueous ionic liquids. In this Account, we illustrate a number of examples of single molecule electrical measurements under electrode potential control use a scanning tunneling microscope (STM) and demonstrate how these can help in the understanding of charge transport in single molecule junctions. Examples showing charge transport following phase coherent tunneling to incoherent charge hopping across redox active molecular bridges are shown. In the case of bipyridinium (or viologen) molecular wires, it is shown how electrochemical reduction leads to an increase of the single molecule conductance, which is controlled by the liquid electrochemical
Problems in Modelling Charge Output Accelerometers
Directory of Open Access Journals (Sweden)
Tomczyk Krzysztof
2016-12-01
Full Text Available The paper presents major issues associated with the problem of modelling change output accelerometers. The presented solutions are based on the weighted least squares (WLS method using transformation of the complex frequency response of the sensors. The main assumptions of the WLS method and a mathematical model of charge output accelerometers are presented in first two sections of this paper. In the next sections applying the WLS method to estimation of the accelerometer model parameters is discussed and the associated uncertainties are determined. Finally, the results of modelling a PCB357B73 charge output accelerometer are analysed in the last section of this paper. All calculations were executed using the MathCad software program. The main stages of these calculations are presented in Appendices A−E.
Modeling and Analyzing Electric Vehicle Charging
DEFF Research Database (Denmark)
Andersen, Ove; Krogh, Benjamin Bjerre; Thomsen, Christian
2016-01-01
, such as wind turbines. To both enable a smart grid and the use of renewable energy, it is essential to know when and where an EV is plugged into the power grid and what battery capacity is available. In this paper, we present a generic spatio-temporal data-warehouse model for storing detailed information...... on all aspects of charging EVs, including integration with the electricity prices from a spot market. The proposed data warehouse is fully implemented and currently contains 2.5 years of charging data from 176 EVs. We describe the date warehouse model and the implementation including complex operations...
Droplet-model predictions of charge moments
International Nuclear Information System (INIS)
Myers, W.D.
1982-04-01
The Droplet Model expressions for calculating various moments of the nuclear charge distribution are given. There are contributions to the moments from the size and shape of the system, from the internal redistribution induced by the Coulomb repulsion, and from the diffuseness of the surface. A case is made for the use of diffuse charge distributions generated by convolution as an alternative to Fermi-functions
Yalcin, Eyyup; Kara, Duygu Akin; Karakaya, Caner; Yigit, Mesude Zeliha; Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Demic, Serafettin; Kus, Mahmut; Aboulouard, Abdelkhalk
2017-07-01
Organic semiconductor (OSC) materials as a charge carrier interface play an important role to improve the device performance of organic electroluminescent cells. In this study, 4,4″-bis(diphenyl amino)-1,1':3‧,1″-terphenyl-5'-carboxylic acid (TPA) and 4,4″-di-9H-carbazol-9-yl-1,1':3‧,1″-terphenyl-5'-carboxylic acid (CAR) has been designed and synthesized to modify indium tin oxide (ITO) layer as interface. Bare ITO and PEDOT:PSS coated on ITO was used as reference anode electrodes for comparison. Furthermore, PEDOT:PSS coated over CAR/ITO and TPA/ITO to observe stability of OSC molecules and to completely cover the ITO surface. Electrical, optical and surface characterizations were performed for each device. Almost all modified devices showed around 36% decrease at the turn on voltage with respect to bare ITO. The current density of bare ITO, ITO/CAR and ITO/TPA were measured as 288, 1525 and 1869 A/m2, respectively. By increasing current density, luminance of modified devices showed much better performance with respect to unmodified devices.
Storage of charge carriers on emitter molecules in organic light-emitting diodes
Weichsel, Caroline; Burtone, Lorenzo; Reineke, Sebastian; Hintschich, Susanne I.; Gather, Malte C.; Leo, Karl; Lüssem, Björn
2012-08-01
Organic light-emitting diodes (OLEDs) using the red phosphorescent emitter iridium(III)bis(2-methyldibenzo[f,h]quinoxaline) (acetylacetonate) [Ir(MDQ)2(acac)] are studied by time-resolved electroluminescence measurements. A transient overshoot after voltage turn-off is found, which is attributed to electron accumulation on Ir(MDQ)2(acac) molecules. The mechanism is verified via impedance spectroscopy and by application of positive and negative off-voltages. We calculate the density of accumulated electrons and find that it scales linearly with the doping concentration of the emitter. Using thin quenching layers, we locate the position of the emission zone during normal OLED operation and after voltage turn-off. In addition, the transient overshoot is also observed in three-color white-emitting OLEDs. By time- and spectrally resolved measurements using a streak camera, we directly attribute the overshoot to electron accumulation on Ir(MDQ)2(acac). We propose that similar processes are present in many state-of-the-art OLEDs and believe that the quantification of charge carrier storage will help to improve the efficiency of OLEDs.
International Nuclear Information System (INIS)
Muller, K.H.; Herrmann, J.; Raguse, B.; Baxter, G.; Reda, T.
2002-01-01
Full text: We have investigated theoretically and experimentally the temperature dependence of the conductance of films of Au nanoparticles linked by alkane dithiol molecules in the temperature range between 5 K and 300 K. Conduction in these films is due to tunneling of single electrons between neighbouring metal nanoparticles. During tunnelling an electron has to overcome the Coulomb charging energy. We find that the observed temperature dependence of the conductance is non-Arrhenius like and can be described in terms of a percolation theory which takes account of disorder in the system. Disorder in our nanoparticle films is caused by variations in the nanoparticle size, fluctuations in the separation gaps between adjacent nanoparticles and by offset charges. To explain in detail our experimental data, a wide distribution of separation gaps and charging energies is needed. We find that a wide Coulomb charging energy distribution can arise from random offset charges even if the nanoparticle size distribution is narrow
Energy Technology Data Exchange (ETDEWEB)
Tintaru, Aura [Aix-Marseille Université – CNRS, UMR 7273, Institut de Chimie Radicalaire, Marseille (France); Chendo, Christophe [Aix-Marseille Université – CNRS, FR 1739, Fédération des Sciences Chimiques de Marseille, Spectropole, Marseille (France); Wang, Qi [Aix-Marseille Université – CNRS, UMR 6114, Centre Interdisciplinaire de Nanosciences de Marseille, Marseille (France); Viel, Stéphane [Aix-Marseille Université – CNRS, UMR 7273, Institut de Chimie Radicalaire, Marseille (France); Quéléver, Gilles; Peng, Ling [Aix-Marseille Université – CNRS, UMR 6114, Centre Interdisciplinaire de Nanosciences de Marseille, Marseille (France); Posocco, Paola [University of Trieste, Molecular Simulation Engineering (MOSE) Laboratory, Department of Engineering and Architecture (DEA), Trieste (Italy); National Interuniversity Consortium for Material Science and Technology (INSTM), Research Unit MOSE-DEA, University of Trieste, Trieste (Italy); Pricl, Sabrina, E-mail: sabrina.pricl@di3.units.it [University of Trieste, Molecular Simulation Engineering (MOSE) Laboratory, Department of Engineering and Architecture (DEA), Trieste (Italy); National Interuniversity Consortium for Material Science and Technology (INSTM), Research Unit MOSE-DEA, University of Trieste, Trieste (Italy); Charles, Laurence, E-mail: laurence.charles@univ-amu.fr [Aix-Marseille Université – CNRS, UMR 7273, Institut de Chimie Radicalaire, Marseille (France)
2014-01-15
Graphical abstract: -- Highlights: •ESI-MS/MS, IMS and molecular modeling were combined to study PEO-PAMAM conformation. •Protonated and lithiated molecules were studied, with charge states from 2 to 4. •Protonation mostly occurred on PAMAM, with PEO units enclosing the protonated group. •Lithium adduction on PEO units lead to more expanded conformations. •Charge location strongly influenced PEO-PAMAM dissociation behavior. -- Abstract: Tandem mass spectrometry and ion mobility spectrometry experiments were performed on multiply charged molecules formed upon conjugation of a poly(amidoamine) (PAMAM) dendrimer with a poly(ethylene oxide) (PEO) linear polymer to evidence any conformational modification as a function of their charge state (2+ to 4+) and of the adducted cation (H{sup +}vs Li{sup +}). Experimental findings were rationalized by molecular dynamics simulations. The G0 PAMAM head-group could accommodate up to three protons, with protonated terminal amine group enclosed in a pseudo 18-crown-6 ring formed by the PEO segment. This particular conformation enabled a hydrogen bond network which allowed long-range proton transfer to occur during collisionally activated dissociation. In contrast, lithium adduction was found to mainly occur onto oxygen atoms of the polyether, each Li{sup +} cation being coordinated by a 12-crown-4 pseudo structure. As a result, for the studied polymeric segment (M{sub n} = 1500 g mol{sup −1}), PEO-PAMAM hybrid molecules exhibited a more expanded shape when adducted to lithium as compared to proton.
Sancho-García, J C
2012-05-07
A set of N-heteroquinones, deriving from oligoacenes, have been recently proposed as n-type organic semiconductors with high electron mobilities in thin-film transistors. Generally speaking, this class of compounds self-assembles in neighboring π-stacks linked by weak hydrogen bonds. We aim at theoretically characterizing here the sequential charge transport (hopping) process expected to take place across these arrays of molecules. To do so, we need to accurately address the preferred packing of these materials simultaneously to single-molecule properties related to charge-transfer events, carefully employing dispersion-corrected density functional theory methods to accurately extract the key molecular parameters governing this phenomenon at the nanoscale. This study confirms the great deal of interest around these compounds, since controlled functionalization of model molecules (i.e., pentacene) allows to efficiently tune the corresponding charge mobilities, and the capacity of modern quantum-chemical methods to predict it after rationalizing the underlying structure-property relationships.
Bhattacharya, Atanu; Bernstein, Elliot R
2011-10-06
The radical cationic reactivity of the peptide analogue molecule CH(3)CO-Gly-NH(2) is addressed both experimentally and theoretically. The radical cation intermediate of CH(3)CO-Gly-NH(2) is created by single-photon ionization of this molecule at 118.22 nm (~10.5 eV). The two most stable conformers (C(7) and C(5)) of this molecule exhibit different folds along the backbone: the C(7) conformer has a γ-turn structure, and the C(5) conformer has a β-strand structure. The experimental results show that the radical cation intermediate of CH(3)CO-Gly-NH(2) dissociates and generates a fragment-ion signal at 73 amu that is observed through TOFMS. Theoretical results show how the fragment-ion signal at 73 amu is generated by only one conformer of CH(3)CO-Gly-NH(2) (C(7)) and how local charge and specific hydrogen bonding in the molecule influence fragmentation of the radical cation intermediate of CH(3)CO-Gly-NH(2). The specific fold of the molecule controls fragmentation of this reactive radical cation intermediate. Whereas the radical cation of the C(7) conformer dissociates through a hydrogen-transfer mechanism followed by HNCO elimination, the radical cation of the C(5) conformer does not dissociate at all. CASSCF calculations show that positive charge in the radical cationic C(7) conformer is localized at the NH(2)CO moiety of the molecular ion. This site-specific localization of the positive charge enhances the acidity of the terminal NH(2) group, facilitating hydrogen transfer from the NH(2) to the COCH(3) end of the molecular ion. Positive charge in the C(5) conformer of the CH(3)CO-Gly-NH(2) radical cation is, however, localized at the COCH(3) end of the molecular ion, and this conformer does not have enough energy to surmount the energy barrier to dissociation on the ion potential energy surface. CASSCF results show that conformation-specific localization of charge in the CH(3)CO-Gly-NH(2) molecular ion occurs as a result of the different hydrogen
Sun, Hui; Wen, Jiayi; Zhao, Yanxiang; Li, Bo; McCammon, J. Andrew
2015-01-01
Dielectric boundary based implicit-solvent models provide efficient descriptions of coarse-grained effects, particularly the electrostatic effect, of aqueous solvent. Recent years have seen the initial success of a new such model, variational implicit-solvent model (VISM) [Dzubiella, Swanson, and McCammon Phys. Rev. Lett. 96, 087802 (2006) and J. Chem. Phys. 124, 084905 (2006)], in capturing multiple dry and wet hydration states, describing the subtle electrostatic effect in hydrophobic interactions, and providing qualitatively good estimates of solvation free energies. Here, we develop a phase-field VISM to the solvation of charged molecules in aqueous solvent to include more flexibility. In this approach, a stable equilibrium molecular system is described by a phase field that takes one constant value in the solute region and a different constant value in the solvent region, and smoothly changes its value on a thin transition layer representing a smeared solute-solvent interface or dielectric boundary. Such a phase field minimizes an effective solvation free-energy functional that consists of the solute-solvent interfacial energy, solute-solvent van der Waals interaction energy, and electrostatic free energy described by the Poisson–Boltzmann theory. We apply our model and methods to the solvation of single ions, two parallel plates, and protein complexes BphC and p53/MDM2 to demonstrate the capability and efficiency of our approach at different levels. With a diffuse dielectric boundary, our new approach can describe the dielectric asymmetry in the solute-solvent interfacial region. Our theory is developed based on rigorous mathematical studies and is also connected to the Lum–Chandler–Weeks theory (1999). We discuss these connections and possible extensions of our theory and methods. PMID:26723595
Sun, Hui; Wen, Jiayi; Zhao, Yanxiang; Li, Bo; McCammon, J Andrew
2015-12-28
Dielectric boundary based implicit-solvent models provide efficient descriptions of coarse-grained effects, particularly the electrostatic effect, of aqueous solvent. Recent years have seen the initial success of a new such model, variational implicit-solvent model (VISM) [Dzubiella, Swanson, and McCammon Phys. Rev. Lett. 96, 087802 (2006) and J. Chem. Phys. 124, 084905 (2006)], in capturing multiple dry and wet hydration states, describing the subtle electrostatic effect in hydrophobic interactions, and providing qualitatively good estimates of solvation free energies. Here, we develop a phase-field VISM to the solvation of charged molecules in aqueous solvent to include more flexibility. In this approach, a stable equilibrium molecular system is described by a phase field that takes one constant value in the solute region and a different constant value in the solvent region, and smoothly changes its value on a thin transition layer representing a smeared solute-solvent interface or dielectric boundary. Such a phase field minimizes an effective solvation free-energy functional that consists of the solute-solvent interfacial energy, solute-solvent van der Waals interaction energy, and electrostatic free energy described by the Poisson-Boltzmann theory. We apply our model and methods to the solvation of single ions, two parallel plates, and protein complexes BphC and p53/MDM2 to demonstrate the capability and efficiency of our approach at different levels. With a diffuse dielectric boundary, our new approach can describe the dielectric asymmetry in the solute-solvent interfacial region. Our theory is developed based on rigorous mathematical studies and is also connected to the Lum-Chandler-Weeks theory (1999). We discuss these connections and possible extensions of our theory and methods.
Stochastic models for surface diffusion of molecules
Energy Technology Data Exchange (ETDEWEB)
Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)
2014-07-28
We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.
International Nuclear Information System (INIS)
Wald, H.B.
1990-01-01
The 'PATH' codes are used to design magnetic optics subsystems for neutral particle beam systems. They include a 2-1/2D and three 3-D space charge models, two of which have recently been added. This paper describes the 3-D models and reports on preliminary benchmark studies in which these models are checked for stability as the cloud size is varied and for consistency with each other. Differences between the models are investigated and the computer time requirements for running these models are established
Modelling of an advanced charging system for electric vehicles
Hassan Jaafar, Abdul; Rahman, Ataur; Mohiuddin, A. K. M.; Rashid, Mahbubur
2017-03-01
Climate Change is recognized as one of the greatest environmental problem facing the World today and it has long been appreciated by governments that reducing the impact of the internal combustion (IC) engine powered motor vehicle has an important part to play in addressing this threat. In Malaysia, IC engine powered motor vehicle accounts almost 90% of the national greenhouse gas (GHG) emissions. The need to reduce the emission is paramount, as Malaysia has pledged to reduce 40% of CO2 intensity by 2020 from 2005 level by 25% of improvement in average fuel consumption. The introduction of electric vehicles (EVs) is one of the initiatives. However in terms of percentage, the electric vehicles have not been commonly used by people nowadays and one of the reasons is lack in charging infrastructure especially when cars are on the road. The aim of this study is to simulate and model an advanced charging system for the charging infrastructure of EVs/HEVs all over the nation with slow charging mode with charging current 25 A, medium charging mode with charging current 50 A and fast charging mode with charging current 100 A. The slow charging mode is proposed for residence, medium charging mode for office parking lots, and fast charging mode is called fast charging track for charging station on road. With three modes charger topology, consumers could choose a suitable mode for their car based on their need. The simulation and experiment of advanced charging system has been conducted on a scale down battery pack of nominal voltage of 3.75 V and capacity of 1020 mAh. Result shows that the battery could be charging less than 1 hour with fast charging mode. However, due to limitation of Tenaga Nasional Berhad (TNB) power grid, the maximum 50 A current is considered to be the optimized passive mode for the EV’s battery charging system. The developed advanced charger prototype performance has been compared with the simulation result and conventional charger performance, the
Wang, Bo; Truhlar, Donald G
2013-02-12
Tuned and balanced redistributed charge schemes have been developed for modeling the electrostatic fields of bonds that are cut by a quantum mechanical-molecular mechanical boundary in combined quantum mechanical and molecular mechanical (QM/MM) methods. First, the charge is balanced by adjusting the charge on the MM boundary atom to conserve the total charge of the entire QM/MM system. In the balanced smeared redistributed charge (BSRC) scheme, the adjusted MM boundary charge is smeared with a smearing width of 1.0 Å and is distributed in equal portions to the midpoints of the bonds between the MM boundary atom and the MM atoms bonded to it; in the balanced redistributed charge-2 (BRC2) scheme, the adjusted MM boundary charge is distributed as point charges in equal portions to the MM atoms that are bonded to the MM boundary atom. The QM subsystem is capped by a fluorine atom that is tuned to reproduce the sum of partial atomic charges of the uncapped portion of the QM subsystem. The new aspect of the present study is a new way to carry out the tuning process; in particular, the CM5 charge model, rather than the Mulliken population analysis applied in previous studies, is used for tuning the capping atom that terminates the dangling bond of the QM region. The mean unsigned error (MUE) of the QM/MM deprotonation energy for a 15-system test suite of deprotonation reactions is 2.3 kcal/mol for the tuned BSRC scheme (TBSRC) and 2.4 kcal/mol for the tuned BRC2 scheme (TBRC2). As was the case for the original tuning method based on Mulliken charges, the new tuning method performs much better than using conventional hydrogen link atoms, which have an MUE on this test set of about 7 kcal/mol. However, the new scheme eliminates the need to use small basis sets, which can be problematic, and it allows one to be more consistent by tuning the parameters with whatever basis set is appropriate for applications. (Alternatively, since the tuning parameters and partial charges
Point charges optimally placed to represent the multipole expansion of charge distributions.
Directory of Open Access Journals (Sweden)
Ramu Anandakrishnan
Full Text Available We propose an approach for approximating electrostatic charge distributions with a small number of point charges to optimally represent the original charge distribution. By construction, the proposed optimal point charge approximation (OPCA retains many of the useful properties of point multipole expansion, including the same far-field asymptotic behavior of the approximate potential. A general framework for numerically computing OPCA, for any given number of approximating charges, is described. We then derive a 2-charge practical point charge approximation, PPCA, which approximates the 2-charge OPCA via closed form analytical expressions, and test the PPCA on a set of charge distributions relevant to biomolecular modeling. We measure the accuracy of the new approximations as the RMS error in the electrostatic potential relative to that produced by the original charge distribution, at a distance 2x the extent of the charge distribution--the mid-field. The error for the 2-charge PPCA is found to be on average 23% smaller than that of optimally placed point dipole approximation, and comparable to that of the point quadrupole approximation. The standard deviation in RMS error for the 2-charge PPCA is 53% lower than that of the optimal point dipole approximation, and comparable to that of the point quadrupole approximation. We also calculate the 3-charge OPCA for representing the gas phase quantum mechanical charge distribution of a water molecule. The electrostatic potential calculated by the 3-charge OPCA for water, in the mid-field (2.8 Å from the oxygen atom, is on average 33.3% more accurate than the potential due to the point multipole expansion up to the octupole order. Compared to a 3 point charge approximation in which the charges are placed on the atom centers, the 3-charge OPCA is seven times more accurate, by RMS error. The maximum error at the oxygen-Na distance (2.23 Å is half that of the point multipole expansion up to the octupole
A Temperature Dependent Lumped-charge Model for Trench FS-IGBT
DEFF Research Database (Denmark)
Duan, Yaoqiang; Kang, Yong; Iannuzzo, Francesco
2018-01-01
Abstract: This paper proposes a temperature dependent lumped-charge model for FS-IGBT. Due to the evolution of the IGBT structure, the existing lumped-charge IGBT model established for NPT-IGBT is not suitable for the simulation of FS-IGBT. This paper extends the lumped-charge IGBT model including...... the field-stop (FS) structure and temperature characteristics. The temperature characteristics of the model are considered for both the bipolar part and unipolar part. In addition, a new PN junction model which can distinguish the collector structure is presented and validated by TCAD simulation. Finally...
Excitation of atoms and molecules in collisions with highly charged ions
International Nuclear Information System (INIS)
Watson, R.L.
1993-01-01
A study of the double ionization of He by high-energy N 7+ ions was extended up in energy to 40 MeV/amu. Coincidence time-of-flight studies of multicharged N 2 , O 2 , and CO molecular ions produced in collisions with 97-MeV Ar 14+ ions were completed. Analysis of the total kinetic energy distributions and comparison with the available data for CO 2+ and CO 3+ from synchrotron radiation experiments led to the conclusion that ionization by Ar-ion impact populates states having considerably higher excitation energies than those accessed by photoionization. The dissociation fractions for CO 1+ and CO 2+ molecular ions, and the branching ratios for the most prominent charge division channels of CO 2+ through CO 7+ were determined from time-of-flight singles and coincidence data. An experiment designed to investigate the orientation dependence of dissociative multielectron ionization of molecules by heavy ion impact was completed. Measurements of the cross sections for K-shell ionization of intermediate-Z elements by 30-MeV/amu H, N, Ne, and Ar ions were completed. The cross sections were determined for solid targets of Z = 13, 22, 26, 29, 32, 40, 42, 46, and 50 by recording the spectra of K x rays with a Si(Li) spectrometer
Methodology for assessing electric vehicle charging infrastructure business models
International Nuclear Information System (INIS)
Madina, Carlos; Zamora, Inmaculada; Zabala, Eduardo
2016-01-01
The analysis of economic implications of innovative business models in networked environments, as electro-mobility is, requires a global approach to ensure that all the involved actors obtain a benefit. Although electric vehicles (EVs) provide benefits for the society as a whole, there are a number of hurdles for their widespread adoption, mainly the high investment cost for the EV and for the infrastructure. Therefore, a sound business model must be built up for charging service operators, which allows them to recover their costs while, at the same time, offer EV users a charging price which makes electro-mobility comparable to internal combustion engine vehicles. For that purpose, three scenarios are defined, which present different EV charging alternatives, in terms of charging power and charging station ownership and accessibility. A case study is presented for each scenario and the required charging station usage to have a profitable business model is calculated. We demonstrate that private home charging is likely to be the preferred option for EV users who can charge at home, as it offers a lower total cost of ownership under certain conditions, even today. On the contrary, finding a profitable business case for fast charging requires more intensive infrastructure usage. - Highlights: • Ecosystem is a network of actors who collaborate to create a positive business case. • Electro-mobility (electricity-powered road vehicles and ICT) is a complex ecosystem. • Methodological analysis to ensure that all actors benefit from electro-mobility. • Economic analysis of charging infrastructure deployment linked to its usage. • Comparison of EV ownership cost vs. ICE for vehicle users.
Peng, Ran; Tang, Xiaowu Shirley; Li, Dongqing
2018-04-01
This paper presents a new method of sensing single molecules and cations by a carbon nanotube (CNT)-based differential resistive pulse sensing (RPS) technique on a nanofluidic chip. A mathematical model for multichannel RPS systems is developed to evaluate the CNT-based RPS signals. Individual cations, rhodamine B dye molecules, and ssDNAs are detected successfully with high resolution and high signal-to-noise ratio. Differentiating ssDNAs with 15 and 30 nucleotides are achieved. The experimental results also show that translocation of negatively charged ssDNAs through a CNT decreases the electrical resistance of the CNT channel, while translocation of positively charged cations and rhodamine B molecules increases the electrical resistance of the CNT. The CNT-based nanofluidic device developed in this work provides a new avenue for single-molecule/ion detection and offers a potential strategy for DNA sequencing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Femtosecond response of polyatomic molecules to ultra-intense hard X-rays.
Rudenko, A; Inhester, L; Hanasaki, K; Li, X; Robatjazi, S J; Erk, B; Boll, R; Toyota, K; Hao, Y; Vendrell, O; Bomme, C; Savelyev, E; Rudek, B; Foucar, L; Southworth, S H; Lehmann, C S; Kraessig, B; Marchenko, T; Simon, M; Ueda, K; Ferguson, K R; Bucher, M; Gorkhover, T; Carron, S; Alonso-Mori, R; Koglin, J E; Correa, J; Williams, G J; Boutet, S; Young, L; Bostedt, C; Son, S-K; Santra, R; Rolles, D
2017-06-01
X-ray free-electron lasers enable the investigation of the structure and dynamics of diverse systems, including atoms, molecules, nanocrystals and single bioparticles, under extreme conditions. Many imaging applications that target biological systems and complex materials use hard X-ray pulses with extremely high peak intensities (exceeding 10 20 watts per square centimetre). However, fundamental investigations have focused mainly on the individual response of atoms and small molecules using soft X-rays with much lower intensities. Studies with intense X-ray pulses have shown that irradiated atoms reach a very high degree of ionization, owing to multiphoton absorption, which in a heteronuclear molecular system occurs predominantly locally on a heavy atom (provided that the absorption cross-section of the heavy atom is considerably larger than those of its neighbours) and is followed by efficient redistribution of the induced charge. In serial femtosecond crystallography of biological objects-an application of X-ray free-electron lasers that greatly enhances our ability to determine protein structure-the ionization of heavy atoms increases the local radiation damage that is seen in the diffraction patterns of these objects and has been suggested as a way of phasing the diffraction data. On the basis of experiments using either soft or less-intense hard X-rays, it is thought that the induced charge and associated radiation damage of atoms in polyatomic molecules can be inferred from the charge that is induced in an isolated atom under otherwise comparable irradiation conditions. Here we show that the femtosecond response of small polyatomic molecules that contain one heavy atom to ultra-intense (with intensities approaching 10 20 watts per square centimetre), hard (with photon energies of 8.3 kiloelectronvolts) X-ray pulses is qualitatively different: our experimental and modelling results establish that, under these conditions, the ionization of a molecule is
Theoretical model for ultracold molecule formation via adaptive feedback control
Poschinger, Ulrich; Salzmann, Wenzel; Wester, Roland; Weidemueller, Matthias; Koch, Christiane P.; Kosloff, Ronnie
2006-01-01
We investigate pump-dump photoassociation of ultracold molecules with amplitude- and phase-modulated femtosecond laser pulses. For this purpose a perturbative model for the light-matter interaction is developed and combined with a genetic algorithm for adaptive feedback control of the laser pulse shapes. The model is applied to the formation of 85Rb2 molecules in a magneto-optical trap. We find for optimized pulse shapes an improvement for the formation of ground state molecules by more than ...
Mechanism and Dynamics of Charge Transfer in Donor-Bridge-Acceptor Systems
Gorczak-Vos, N.
2016-01-01
Photoinduced charge transfer in organic materials is a fundamental process in various biological and technological areas. Donor-bridge-acceptor (DBA) molecules are used as model systems in numerous theoretical and experimental work to systematically study and unravel the underlying mechanisms of
Electrostatic charge bounds for ball lightning models
International Nuclear Information System (INIS)
Stephan, Karl D
2008-01-01
Several current theories concerning the nature of ball lightning predict a substantial electrostatic charge in order to account for its observed motion and shape (Turner 1998 Phys. Rep. 293 1; Abrahamson and Dinniss 2000 Nature 403 519). Using charged soap bubbles as a physical model for ball lightning, we show that the magnitude of charge predicted by some of these theories is too high to allow for the types of motion commonly observed in natural ball lightning, which includes horizontal motion above the ground and movement near grounded conductors. Experiments show that at charge levels of only 10-15 nC, 3-cm-diameter soap bubbles tend to be attracted by induced charges to the nearest grounded conductor and rupture. We conclude with a scaling rule that can be used to extrapolate these results to larger objects and surroundings
Equivalent circuit modeling of space charge dominated magnetically insulated transmission lines
Energy Technology Data Exchange (ETDEWEB)
Hiraoka, Kazuki; Nakajima, Mitsuo; Horioka, Kazuhiko
1997-12-31
A new equivalent circuit model for space charge dominated MITLs (Magnetically Insulated Transmission Lines) was developed. MITLs under high power operation are dominated with space charge current flowing between anode and cathode. Conventional equivalent circuit model does not account for space charge effects on power flow. The model was modified to discuss the power transportation through the high power MITLs. With this model, it is possible to estimate the effects of space charge current on the power flow efficiency, without using complicated particle code simulations. (author). 3 figs., 3 refs.
Calculations on Electron Capture in Low Energy Ion-Molecule Collisions
Energy Technology Data Exchange (ETDEWEB)
Stancil, P.C. [Oak Ridge National Lab., TN (United States); Zygelman, B. [W.M. Keck Lab. for Computational Physics, Univ. of Nevada, Las Vegas, NV (United States); Kirby, K. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA (United States)
1997-12-31
Recent progress on the application of a quantal, molecular-orbital, close-coupling approach to the calculation of electron capture in collisions of multiply charged ions with molecules is discussed. Preliminary results for single electron capture by N{sup 2+} with H{sub 2} are presented. Electron capture by multiply charged ions colliding with H{sub 2} is an important process in laboratory and astrophysical plasmas. It provides a recombination mechanism for multiply charged ions in x-ray ionized astronomical environments which may have sparse electron and atomic hydrogen abundances. In the divertor region of a tokamak fusion device, charge exchange of impurity ions with H{sub 2} plays a role in the ionization balance and the production of radiative energy loss leading to cooling, X-ray and ultraviolet auroral emission from Jupiter is believed to be due to charge exchange of O and S ions with H{sub 2} in the Jovian atmosphere. Solar wind ions interacting with cometary molecules may have produced the x-rays observed from Comet Hyakutake. In order to model and understand the behavior of these environments, it is necessary to obtain total, electronic state-selective (ESS), and vibrational (or rotational) state-selective (VSS) capture cross sections for collision energies as low as 10 meV/amu to as high as 100 keV/amu in some instances. Fortunately, charge transfer with molecular targets has received considerable experimental attention. Numerous measurements have been made with flow tubes, ion traps, and ion beams. Flow tube and ion trap studies generally provide information on rate coefficients for temperatures between 800 K and 20,000 K. In this article, we report on the progress of our group in implementing a quantum-mechanical Molecular Orbital Close Coupling (MOCC) approach to the study of electron capture by multiply charged ions in collisions with molecules. We illustrate this with a preliminary investigation of Single Electron Capture (SEC) by N{sup 2+} with H
Semi-empirical modelization of charge funneling in a NP diode
International Nuclear Information System (INIS)
Musseau, O.
1991-01-01
Heavy ion interaction with a semiconductor generates a high density of electrons and holes pairs along the trajectory and in a space charge zone the collected charge is considerably increased. The chronology of this charge funneling is described in a semi-empirical model. From initial conditions characterizing the incident ion and the studied structure, it is possible to evaluate directly the transient current, the collected charge and the length of funneling with a good agreement. The model can be extrapolated to more complex structures
Charging and Screening in Nonpolar Solutions of Nonionizable Surfactants
Behrens, Sven
2010-03-01
Nonpolar liquids do not easily accommodate electric charges, but surfactant additives are often found to dramatically increase the solution conductivity and promote surface charging of suspended colloid particles. Such surfactant-mediated electrostatic effects have been associated with equilibrium charge fluctuations among reverse surfactant micelles and in some cases with the statistically rare ionization of individual surfactant molecules. Here we present experimental evidence that even surfactants without any ionizable group can mediate charging and charge screening in nonpolar oils, and that they can do so at surfactant concentrations well below the critical micelle concentration (cmc). Precision conductometry, light scattering, and Karl-Fischer titration of sorbitan oleate solutions in hexane, paired with electrophoretic mobility measurements on suspended polymer particles, reveal a distinctly electrostatic action of the surfactant. We interpret our observations in terms of a charge fluctuation model and argue that the observed charging processes are likely facilitated, but not limited, by the presence of ionizable impurities.
Modeling, hybridization, and optimal charging of electrical energy storage systems
Parvini, Yasha
The rising rate of global energy demand alongside the dwindling fossil fuel resources has motivated research for alternative and sustainable solutions. Within this area of research, electrical energy storage systems are pivotal in applications including electrified vehicles, renewable power generation, and electronic devices. The approach of this dissertation is to elucidate the bottlenecks of integrating supercapacitors and batteries in energy systems and propose solutions by the means of modeling, control, and experimental techniques. In the first step, the supercapacitor cell is modeled in order to gain fundamental understanding of its electrical and thermal dynamics. The dependence of electrical parameters on state of charge (SOC), current direction and magnitude (20-200 A), and temperatures ranging from -40°C to 60°C was embedded in this computationally efficient model. The coupled electro-thermal model was parameterized using specifically designed temporal experiments and then validated by the application of real world duty cycles. Driving range is one of the major challenges of electric vehicles compared to combustion vehicles. In order to shed light on the benefits of hybridizing a lead-acid driven electric vehicle via supercapacitors, a model was parameterized for the lead-acid battery and combined with the model already developed for the supercapacitor, to build the hybrid battery-supercapacitor model. A hardware in the loop (HIL) setup consisting of a custom built DC/DC converter, micro-controller (muC) to implement the power management strategy, 12V lead-acid battery, and a 16.2V supercapacitor module was built to perform the validation experiments. Charging electrical energy storage systems in an efficient and quick manner, motivated to solve an optimal control problem with the objective of maximizing the charging efficiency for supercapacitors, lead-acid, and lithium ion batteries. Pontryagins minimum principle was used to solve the problems
Exploring charge transport properties and functionality of molecule-nanoparticle ensembles
Devid, Edwin Johan
2015-01-01
For more than 65 years, scientists have been fascinated by the idea to miniaturize electrical circuits toward the smallest length scales. One particular way is inspired by nature itself, specifically to assemble electrical components and switches from atoms and molecules. The molecules typically
The effects of electric fields on charged molecules and particles in individual microenvironments
Jamieson, K. S.; ApSimon, H. M.; Jamieson, S. S.; Bell, J. N. B.; Yost, M. G.
Measurements of small air ion concentrations, electrostatic potential and AC electric field strengths were taken in an office setting to investigate the link between electric fields and charged molecule and particle concentrations in individual microenvironments. The results obtained indicate that the electromagnetic environments individuals can be exposed to whilst indoors can often bear little resemblance to those experienced outdoors in nature, and that many individuals may spend large periods of their time in "Faraday cage"-like conditions exposed to inappropriate levels and types of electric fields that can reduce localised concentrations of biologically essential and microbiocidal small air ions. Such conditions may escalate their risk of infection from airborne contaminants, including microbes, whilst increasing localised surface contamination. The degree of "electro-pollution" that individuals are exposed to was shown to be influenced by the type of microenvironment they occupy, with it being possible for very different types of microenvironment to exist within the same room. It is suggested that adopting suitable electromagnetic hygiene/productivity guidelines that seek to replicate the beneficial effects created by natural environments may greatly mitigate such problems.
DETAILED MODELLING OF CHARGING BEHAVIOUR OF SMART SOLAR TANKS
DEFF Research Database (Denmark)
Fan, Jianhua; Andersen, Elsa; Furbo, Simon
2010-01-01
The charging behaviour of smart solar tanks for solar combisystems for one-family houses is investigated with detailed Computational Fluid Dynamics (CFD) modelling and Particle Image Velocimetry (PIV) measurements. The smart solar tank can be charged with a variable auxiliary volume fitted...... or by an electric heating element in a side-arm mounted on the side of the tank. Detailed CFD models of the smart tanks are built with different mesh densities in the tank and in the side-arm. The thermal conditions of the tank during charging are calculated with the CFD models. The fluid flow and temperature...... by the mesh densities, the distribution of computational cells, the physical model and time steps used in the simulations. The findings of the investigations will be used as guidance for creation of CFD models for optimal design of smart solar tanks....
Interplanetary Radiation and Internal Charging Environment Models for Solar Sails
Minow, Joseph I.; Altstatt, Richard L.; NeegaardParker, Linda
2005-01-01
A Solar Sail Radiation Environment (SSRE) model has been developed for defining charged particle environments over an energy range from 0.01 keV to 1 MeV for hydrogen ions, helium ions, and electrons. The SSRE model provides the free field charged particle environment required for characterizing energy deposition per unit mass, charge deposition, and dose rate dependent conductivity processes required to evaluate radiation dose and internal (bulk) charging processes in the solar sail membrane in interplanetary space. Solar wind and energetic particle measurements from instruments aboard the Ulysses spacecraft in a solar, near-polar orbit provide the particle data over a range of heliospheric latitudes used to derive the environment that can be used for radiation and charging environments for both high inclination 0.5 AU Solar Polar Imager mission and the 1.0 AU L1 solar missions. This paper describes the techniques used to model comprehensive electron, proton, and helium spectra over the range of particle energies of significance to energy and charge deposition in thin (less than 25 micrometers) solar sail materials.
Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J
2015-09-16
Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.
Sequential nonadiabatic excitation of large molecules and ions driven by strong laser fields
International Nuclear Information System (INIS)
Markevitch, Alexei N.; Levis, Robert J.; Romanov, Dmitri A.; Smith, Stanley M.; Schlegel, H. Bernhard; Ivanov, Misha Yu.
2004-01-01
Electronic processes leading to dissociative ionization of polyatomic molecules in strong laser fields are investigated experimentally, theoretically, and numerically. Using time-of-flight ion mass spectroscopy, we study the dependence of fragmentation on laser intensity for a series of related molecules and report regular trends in this dependence on the size, symmetry, and electronic structure of a molecule. Based on these data, we develop a model of dissociative ionization of polyatomic molecules in intense laser fields. The model is built on three elements: (i) nonadiabatic population transfer from the ground electronic state to the excited-state manifold via a doorway (charge-transfer) transition; (ii) exponential enhancement of this transition by collective dynamic polarization of all electrons, and (iii) sequential energy deposition in both neutral molecules and resulting molecular ions. The sequential nonadiabatic excitation is accelerated by a counterintuitive increase of a large molecule's polarizability following its ionization. The generic theory of sequential nonadiabatic excitation forms a basis for quantitative description of various nonlinear processes in polyatomic molecules and ions in strong laser fields
A schematic model for energy and charge transfer in the chlorophyll complex
DEFF Research Database (Denmark)
Bohr, Henrik; Malik, F.B.
2011-01-01
A theory for simultaneous charge and energy transfer in the carotenoid-chlorophyll-a complex is presented here and discussed. The observed charge transfer process in these chloroplast complexes is reasonably explained in terms of this theory. In addition, the process leads to a mechanism to drive...... an electron in a lower to a higher-energy state, thus providing a mechanism for the ejection of the electron to a nearby molecule (chlorophyll) or into the environment. The observed lifetimes of the electronically excited states are in accord/agreement with the investigations of Sundström et al....... and are in the range of pico-seconds and less. The change in electronic charge distribution in internuclear space as the system undergoes an electronic transition to a higher-energy state could, under appropriate physical conditions, lead to oscillating dipoles capable of transmitting energy from the carotenoid-chlorophylls...
Net charge fluctuations and local charge compensation
International Nuclear Information System (INIS)
Fu Jinghua
2006-01-01
We propose net charge fluctuation as a measure of local charge correlation length. It is demonstrated that, in terms of a schematic multiperipheral model, net charge fluctuation satisfies the same Quigg-Thomas relation as satisfied by charge transfer fluctuation. Net charge fluctuations measured in finite rapidity windows depend on both the local charge correlation length and the size of the observation window. When the observation window is larger than the local charge correlation length, the net charge fluctuation only depends on the local charge correlation length, while forward-backward charge fluctuations always have strong dependence on the observation window size. Net charge fluctuations and forward-backward charge fluctuations measured in the present heavy ion experiments show characteristic features similar to those from multiperipheral models. But the data cannot all be understood within this simple model
Topological defects in mixtures of superconducting condensates with different charges
Garaud, Julien; Babaev, Egor
2014-06-01
We investigate the topological defects in phenomenological models describing mixtures of charged condensates with commensurate electric charges. Such situations are expected to appear for example in liquid metallic deuterium. This is modeled by a multicomponent Ginzburg-Landau theory where the condensates are coupled to the same gauge field by different coupling constants whose ratio is a rational number. We also briefly discuss the case where electric charges are incommensurate. Flux quantization and finiteness of the energy per unit length dictate that the different condensates have different winding and thus different number of (fractional) vortices. Competing attractive and repulsive interactions lead to molecule-like bound states between fractional vortices. Such bound states have finite energy and carry integer flux quanta. These can be characterized by the CP1 topological invariant that motivates their denomination as skyrmions.
Modelling charge storage in Euclid CCD structures
International Nuclear Information System (INIS)
Clarke, A S; Holland, A; Hall, D J; Burt, D
2012-01-01
The primary aim of ESA's proposed Euclid mission is to observe the distribution of galaxies and galaxy clusters, enabling the mapping of the dark architecture of the universe [1]. This requires a high performance detector, designed to endure a harsh radiation environment. The e2v CCD204 image sensor was redesigned for use on the Euclid mission [2]. The resulting e2v CCD273 has a narrower serial register electrode and transfer channel compared to its predecessor, causing a reduction in the size of charge packets stored, thus reducing the number of traps encountered by the signal electrons during charge transfer and improving the serial Charge Transfer Efficiency (CTE) under irradiation [3]. The proposed Euclid CCD has been modelled using the Silvaco TCAD software [4], to test preliminary calculations for the Full Well Capacity (FWC) and the channel potential of the device and provide indications of the volume occupied by varying signals. These results are essential for the realisation of the mission objectives and for radiation damage studies, with the aim of producing empirically derived formulae to approximate signal-volume characteristics in the devices. These formulae will be used in the radiation damage (charge trapping) models. The Silvaco simulations have been tested against real devices to compare the experimental measurements to those predicted in the models. Using these results, the implications of this study on the Euclid mission can be investigated in more detail.
Pazos, M Carolina; Castro, Miguel A; Orta, M Mar; Pavón, Esperanza; Valencia Rios, Jesús S; Alba, María D
2012-05-15
A family of organomicas was synthesized using synthetic swelling micas with high layer charge (Na(n)Si(8-n)Al(n)Mg(6)F(4)O(20)·XH(2)O, where n = 2, 3, and 4) exchanged with dodecylammonium and octadecylammonium cations. The molecular arrangement of the surfactant was elucidated on the basis on XRD patterns and DTA. The ordering conformation of the surfactant molecules into the interlayer space of micas was investigated by (13)C, (27)Al, and (29)Si MAS NMR. The arrangement of alkylammonium ions in these high-charge synthetic micas depends on the combined effects of the layer charge of the mica and the chain length of the cation. In the organomicas with dodecylammonium, a transition from a parallel layer to a bilayer-paraffin arrangement is observed when the layer charge of the mica increases. However, when octadecylammonium is the interlayer cation, the molecular arrangement of the surfactant was found to follow the bilayer-paraffin model for all values of layer charge. The amount of ordered conformation all-trans is directly proportional of layer charge.
A n-vector model for charge transport in molecular semiconductors.
Jackson, Nicholas E; Kohlstedt, Kevin L; Chen, Lin X; Ratner, Mark A
2016-11-28
We develop a lattice model utilizing coarse-grained molecular sites to study charge transport in molecular semiconducting materials. The model bridges atomistic descriptions and structureless lattice models by mapping molecular structure onto sets of spatial vectors isomorphic with spin vectors in a classical n-vector Heisenberg model. Specifically, this model incorporates molecular topology-dependent orientational and intermolecular coupling preferences, including the direct inclusion of spatially correlated transfer integrals and site energy disorder. This model contains the essential physics required to explicitly simulate the interplay of molecular topology and correlated structural disorder, and their effect on charge transport. As a demonstration of its utility, we apply this model to analyze the effects of long-range orientational correlations, molecular topology, and intermolecular interaction strength on charge motion in bulk molecular semiconductors.
Electrical Matching at Metal/Molecule Contacts for Efficient Heterogeneous Charge Transfer.
Sato, Shino; Iwase, Shigeru; Namba, Kotaro; Ono, Tomoya; Hara, Kenji; Fukuoka, Atsushi; Uosaki, Kohei; Ikeda, Katsuyoshi
2018-02-27
In a metal/molecule hybrid system, unavoidable electrical mismatch exists between metal continuum states and frontier molecular orbitals. This causes energy loss in the electron conduction across the metal/molecule interface. For efficient use of energy in a metal/molecule hybrid system, it is necessary to control interfacial electronic structures. Here we demonstrate that electrical matching between a gold substrate and π-conjugated molecular wires can be obtained by using monatomic foreign metal interlayers, which can change the degree of d-π* back-donation at metal/anchor contacts. This interfacial control leads to energy level alignment between the Fermi level of the metal electrode and conduction molecular orbitals, resulting in resonant electron conduction in the metal/molecule hybrid system. When this method is applied to molecule-modified electrocatalysts, the heterogeneous electrochemical reaction rate is considerably improved with significant suppression of energy loss at the internal electron conduction.
Sectional modeling of nanoparticle size and charge distributions in dusty plasmas
International Nuclear Information System (INIS)
Agarwal, Pulkit; Girshick, Steven L
2012-01-01
Sectional models of the dynamics of aerosol populations are well established in the aerosol literature but have received relatively less attention in numerical models of dusty plasmas, where most modeling studies have assumed the existence of monodisperse dust particles. In the case of plasmas in which nanoparticles nucleate and grow, significant polydispersity can exist in particle size distributions, and stochastic charging can cause particles of given size to have a broad distribution of charge states. Sectional models, while computationally expensive, are well suited to treating such distributions. This paper presents an overview of sectional modeling of nanodusty plasmas, and presents examples of simulation results that reveal important qualitative features of the spatiotemporal evolution of such plasmas, many of which could not be revealed by models that consider only monodisperse dust particles and average particle charge. These features include the emergence of bimodal particle populations consisting of very small neutral particles and larger negatively charged particles, the effects of size and charge distributions on coagulation, spreading and structure of the particle cloud, and the dynamics of dusty plasma afterglows. (paper)
Modeling charge polarization voltage for large lithium-ion batteries in electric vehicles
Directory of Open Access Journals (Sweden)
Yan Jiang
2013-06-01
Full Text Available Purpose: Polarization voltage of the lithium-ion battery is an important parameter that has direct influence on battery performance. The paper aims to analyze the impedance characteristics of the lithium-ion battery based on EIS data. Design/methodology/approach: The effects of currents, initial SOC of the battery on charge polarization voltage are investigated, which is approximately linear function of charge current. The change of charge polarization voltage is also analyzed with the gradient analytical method in the SOC domain. The charge polarization model with two RC networks is presented, and parts of model parameters like Ohmic resistance and charge transfer impedance are estimated by both EIS method and battery constant current testing method. Findings: This paper reveals that the Ohmic resistance accounts for much contribution to battery total polarization compared to charge transfer impedance. Practical implications: Experimental results demonstrate the efficacy of the model with the proposed identification method, which provides the foundation for battery charging optimization. Originality/value: The paper analyzed the impedance characteristics of the lithium-ion battery based on EIS data, presented a charge polarization model with two RC networks, and estimated parameters like Ohmic resistance and charge transfer impedance.
Surface charge sensing by altering the phase transition in VO2
Kumar, S.; Esfandyarpour, R.; Davis, R.; Nishi, Y.
2014-08-01
Detection of surface charges has various applications in medicine, electronics, biotechnology, etc. The source of surface charge induction may range from simple charge-polarized molecules like water to complicated proteins. It was recently discovered that surface charge accumulation can alter the temperature at which VO2 undergoes a Mott transition. Here, we deposited polar molecules onto the surface of two-terminal thin-film VO2 lateral devices and monitored the joule-heating-driven Mott transition, or conductance switching. We observed that the power required to induce the conductance switching reduced upon treatment with polar molecules and, using in-situ blackbody-emission direct measurement of local temperature, we show that this reduction in power was accompanied by reduction in the Mott transition temperature. Further evidence suggested that this effect has specificity to the nature of the species used to induce surface charges. Using x-ray absorption spectroscopy, we also show that there is no detectable change in oxidation state of vanadium or structural phase in the bulk of the 40 nm VO2 thin-film even as the phase transition temperature is reduced by up to 20 K by the polar molecules. The ability to alter the phase transition parameters by depositing polar molecules suggests a potential application in sensing surface charges of different origins and this set of results also highlights interesting aspects of the phase transition in VO2.
Simulating charge transport in flexible systems
Directory of Open Access Journals (Sweden)
Timothy Clark
2015-12-01
Full Text Available Systems in which movements occur on two significantly different time domains, such as organic electronic components with flexible molecules, require different simulation techniques for the two time scales. In the case of molecular electronics, charge transport is complicated by the several different mechanisms (and theoretical models that apply in different cases. We cannot yet combine time scales of molecular and electronic movement in simulations of real systems. This review describes our progress towards this goal.
Status of the charged Higgs boson in two Higgs doublet models
Arbey, A.; Mahmoudi, F.; Stål, O.; Stefaniak, T.
2018-03-01
The existence of charged Higgs boson(s) is inevitable in models with two (or more) Higgs doublets. Hence, their discovery would constitute unambiguous evidence for new physics beyond the Standard Model (SM). Taking into account all relevant results from direct charged and neutral Higgs boson searches at LEP and the LHC, as well as the most recent constraints from flavour physics, we present a detailed analysis of the current phenomenological status of the charged Higgs sector in a variety of well-motivated two Higgs doublet models (2HDMs). We find that charged Higgs bosons as light as 75 GeV can still be compatible with the combined data, although this implies severely suppressed charged Higgs couplings to all fermions. In more popular models, e.g. the 2HDM of Type II, we find that flavour physics observables impose a combined lower limit on the charged Higgs mass of M_{H^± } ≳ 600 GeV - independent of tan β - which increases to M_{H^± } ≳ 650 GeV for tan β < 1. We furthermore find that in certain scenarios, the signature of a charged Higgs boson decaying into a lighter neutral Higgs boson and a W boson provides a promising experimental avenue that would greatly complement the existing LHC search programme for charged Higgs boson(s).
Status of the charged Higgs boson in two Higgs doublet models
International Nuclear Information System (INIS)
Arbey, A.; Mahmoudi, F.; Stefaniak, T.; Staal, O.
2018-01-01
The existence of charged Higgs boson(s) is inevitable in models with two (or more) Higgs doublets. Hence, their discovery would constitute unambiguous evidence for new physics beyond the Standard Model (SM). Taking into account all relevant results from direct charged and neutral Higgs boson searches at LEP and the LHC, as well as the most recent constraints from flavour physics, we present a detailed analysis of the current phenomenological status of the charged Higgs sector in a variety of well-motivated two Higgs doublet models (2HDMs). We find that charged Higgs bosons as light as 75 GeV can still be compatible with the combined data, although this implies severely suppressed charged Higgs couplings to all fermions. In more popular models, e.g. the 2HDM of Type II, we find that flavour physics observables impose a combined lower limit on the charged Higgs mass of M H ± > or similar 600 GeV - independent of tan β - which increases to M H ± > or similar 650 GeV for tan β < 1. We furthermore find that in certain scenarios, the signature of a charged Higgs boson decaying into a lighter neutral Higgs boson and a W boson provides a promising experimental avenue that would greatly complement the existing LHC search programme for charged Higgs boson(s). (orig.)
Electronic coupling effects and charge transfer between organic molecules and metal surfaces
Energy Technology Data Exchange (ETDEWEB)
Forker, Roman
2010-07-01
We employ a variant of optical absorption spectroscopy, namely in situ differential reflectance spectroscopy (DRS), for an analysis of the structure-properties relations of thin epitaxial organic films. Clear correlations between the spectra and the differently intense coupling to the respective substrates are found. While rather broad and almost structureless spectra are obtained for a quaterrylene (QT) monolayer on Au(111), the spectral shape resembles that of isolated molecules when QT is grown on graphite. We even achieve an efficient electronic decoupling from the subjacent Au(111) by inserting an atomically thin organic spacer layer consisting of hexa-peri-hexabenzocoronene (HBC) with a noticeably dissimilar electronic behavior. These observations are further consolidated by a systematic variation of the metal substrate (Au, Ag, and Al), ranging from inert to rather reactive. For this purpose, 3,4,9,10-perylenetetracarboxylic dianhydride (PTCDA) is chosen to ensure comparability of the molecular film structures on the different metals, and also because its electronic alignment on various metal surfaces has previously been studied with great intensity. We present evidence for ionized PTCDA at several interfaces and propose the charge transfer to be related to the electronic level alignment governed by interface dipole formation on the respective metals. (orig.)
Charge and color breaking minima in supersymmetric models
International Nuclear Information System (INIS)
Brhlik, Michal
2001-01-01
Supersymmetric extensions of the Standard Model include complicated scalar sectors leading to the possible occurrence of non-standard minima along suitable directions in the field space. These minima usually break charge and/or color and their presence in the theory would require an explanation why the universe has settled in the standard electroweak symmetry breaking minimum. In this talk I illustrate the relevance of the charge and color breaking minima in the framework of the minimal supergravity model and a string motivated Horava-Witten scenario
Signature of charge migration in modulations of double ionization
Mauger, François; Abanador, Paul M.; Bruner, Adam; Sissay, Adonay; Gaarde, Mette B.; Lopata, Kenneth; Schafer, Kenneth J.
2018-04-01
We present a theoretical investigation of charge migration following strong-field ionization in a multielectron system. We study a model homonuclear molecule with two electrons, each restricted to one dimension (1 +1 D ), interacting with a strong, static electric field. We show that in this system charge migration results from the interplay between multiple ionization channels that overlap in space, creating a coherent electron-hole wave packet in the cation. We also find that, in our case, charge migration following the first ionization manifests as a modulation of the subsequent double-ionization signal. We derive a parametrized semiclassical model from the full multielectron system and we discuss the importance of the choice of cation electronic-structure basis for the efficacy of the semiclassical representation. We use the ab initio solution of the full 1 +1 D system as a reference for the qualitative and quantitative results of the parametrized semiclassical model. We discuss the extension of our model to long-wavelength time-dependent fields with full-dimension, many-electron targets.
A simplified quantum mechanical model of diatomic molecules
DEFF Research Database (Denmark)
Nielsen, Lars Drud
1978-01-01
A one-dimensional molecule model with Coulomb potentials replaced by delta functions is introduced. The mathematical simplicity of the model facilitates the quantum mechanical treatment and offers a straightforward demonstration of the essentials of two-particle problems. In spite of the crudeness...
International Nuclear Information System (INIS)
Havener, Charles C.
2001-01-01
At ORNL Multicharged Ion Research Facility (MIRF), charge exchange (CX) cross sections have been measured for multicharged ions (MCI) on neutral atoms and molecules. The ORNL ion-atom merged-beam apparatus was used to measure single electron capture by MCI from H at eV/amu energies. A gas cell was used to measure single and double electron capture by MCI from a variety of molecular targets at keV collision energies. The merged-beams experiment has been successful in providing benchmark total electron capture measurements for several collision systems with a variety of multicharged ions on H or D
Theoretical Study of the Charge-Transfer State Separation within Marcus Theory
DEFF Research Database (Denmark)
Volpi, Riccardo; Nassau, Racine; Nørby, Morten Steen
2016-01-01
We study, within Marcus theory, the possibility of the charge-transfer (CT) state splitting at organic interfaces and a subsequent transport of the free charge carriers to the electrodes. As a case study we analyze model anthracene-C60 interfaces. Kinetic Monte Carlo (KMC) simulations on the cold...... CT state were performed at a range of applied electric fields, and with the fields applied at a range of angles to the interface to simulate the action of the electric field in a bulk heterojunction (BHJ) interface. The results show that the inclusion of polarization in our model increases CT state...... dissociation and charge collection. The effect of the electric field on CT state splitting and free charge carrier conduction is analyzed in detail with and without polarization. Also, depending on the relative orientation of the anthracene and C60 molecules at the interface, CT state splitting shows different...
International Nuclear Information System (INIS)
Farrokhi, S.
1966-01-01
The variation of the double charge-changing collision cross-sections of H + , D + , Li + ions with organic molecules (CH 4 , C 2 H 6 , C 3 H 8 , C 4 H 10 ) in the energy range 10-50 keV has been studied. Several maximums for σ 1-1 = f(E) have been shown. Their existence should be explained by the different possibilities of dissociating the target-molecules. The position of the maximums, for the H + → H - and D + → D - reactions is in good agreement with that defined by the Massey adiabatic relation. (author) [fr
Stochastic Models of Molecule Formation on Dust
Charnley, Steven; Wirstroem, Eva
2011-01-01
We will present new theoretical models for the formation of molecules on dust. The growth of ice mantles and their layered structure is accounted for and compared directly to observations through simulation of the expected ice absorption spectra
Directory of Open Access Journals (Sweden)
István P. Sugár
2017-04-01
Full Text Available Here, we model a negatively charged lipid vesicle, composed of a mixture of bipolar tetraether and diester (or diether phospholipid molecules, by a spherical shell that has zero ion permeability. We take into consideration all the charge-charge interactions between intra-vesicular ions, extra-vesicular ions, and membrane lipid associated charges. Monte Carlo simulations result in homogeneous and double-exponential ion distribution, respectively, in the intra- and extra-vesicular space. The extra-vesicular ion concentration close to the membrane surface is proportional to the total amount of the membrane charges (Nm and is independent of the partitioning of the membrane charges between the outer (Nom and inner membrane (Nim surface. This result shows that one should not disregard the effect of the charges on the inner membrane surface when calculating the ion distributions around a charged vesicle. If the partitioning of the membrane charges is not restricted (i.e., lipid flip-flop is allowed, then at different Nm, the Nom/Nim ratio remains constant and the value of Nom/Nim, as a consequence of the interaction between every charges of the model, is close to, but significantly higher than, the ratio of the outer to the inner surface area of the membrane. These results indicate that the amount and the orientation of the negatively-charged tetraether lipids in the membrane are important determinants of membrane properties in tetraether/zwitterionic diester phospholipid liposomes. Finally we compared the results of our discrete charge model and continuous models based on the solutions of the Poisson-Boltzmann equation and pointed out qualitative similarities and sometimes major quantitative differences between these two types of models.
Theory and simulation of charge transport in disordered organic semiconductors
Bobbert, P.A.; Kondov, I.; Sutman, G.
2013-01-01
Charge transport in polymeric or small-molecule organic semiconductors used in organic light-emitting diodes (OLEDs) occurs by hopping of charges between sites at which the charges are localized. The energetic disorder in these semiconductors has a profound influence on the charge transport: charges
Modification of the properties of porous silicon on adsorption of iodine molecules
International Nuclear Information System (INIS)
Vorontsov, A. S.; Osminkina, L. A.; Tkachenko, A. E.; Konstantinova, E. A.; Elenskii, V. G.; Timoshenko, V. Yu.; Kashkarov, P. K.
2007-01-01
Infrared spectroscopy and electron spin resonance measurements are used to study the properties of porous silicon layers on adsorption of the I 2 iodine molecules. The layers are formed on the p-an n-Si single-crystal wafers. It is established that, in the atmosphere of I 2 molecules, the charge-carrier concentration in the layers produced on the p-type wafers can be noticeably increased: the concentration of holes can attain values on the order of ∼10 18 -10 19 cm -3 . In porous silicon layers formed on the n-type wafers, the adsorption-induced inversion of the type of charge carriers and the partial substitution of silicon-hydrogen bonds by silicon-iodine bonds are observed. A decrease in the concentration of surface paramagnetic defects, P b centers, is observed in the samples with adsorbed iodine. The experimental data are interpreted in the context of the model in which it is assumed that both deep and shallow acceptor states are formed at the surface of silicon nanocrystals upon the adsorption of I 2 molecules
DEFF Research Database (Denmark)
Kaasbjerg, Kristen; Flensberg, K.
2011-01-01
and molecular symmetries remain unclear. Using a theoretical framework developed for semiconductor-nanostructure-based single-electron transistors (SETs), we demonstrate that the image charge interaction breaks the molecular symmetries in a benzene-based single-molecule transistor operating in the Coulomb...... blockade regime. This results in the appearance of a so-called blocking state, which gives rise to negative-differential resistance (NDR). We show that the appearance of NDR and its magnitude in the symmetry-broken benzene SET depends in a complicated way on the interplay between the many-body matrix...
Giant Magnetoresistance in Carbon Nanotubes with Single-Molecule Magnets TbPc2.
Krainov, Igor V; Klier, Janina; Dmitriev, Alexander P; Klyatskaya, Svetlana; Ruben, Mario; Wernsdorfer, Wolfgang; Gornyi, Igor V
2017-07-25
We present experimental results and a theoretical model for the gate-controlled spin-valve effect in carbon nanotubes with side-attached single-molecule magnets TbPc 2 (Terbium(III) bis-phthalocyanine). These structures show a giant magnetoresistance up to 1000% in experiments on single-wall nanotubes that are tunnel-coupled to the leads. The proposed theoretical model combines the spin-dependent Fano effect with Coulomb blockade and predicts a spin-spin interaction between the TbPc 2 molecules, mediated by conducting electrons via the charging effect. This gate-tuned interaction is responsible for the stable magnetic ordering of the inner spins of the molecules in the absence of magnetic field. In the case of antiferromagnetic arrangement, electrons with either spin experience the scattering by the molecules, which results in blocking the linear transport. In strong magnetic fields, the Zeeman energy exceeds the effective antiferromagnetic coupling and one species of electrons is not scattered by molecules, which leads to a much lower total resistance at the resonant values of gate voltage, and hence to a supramolecular spin-valve effect.
Dynamic Colloidal Molecules Maneuvered by Light-Controlled Janus Micromotors.
Gao, Yirong; Mou, Fangzhi; Feng, Yizheng; Che, Shengping; Li, Wei; Xu, Leilei; Guan, Jianguo
2017-07-12
In this work, we propose and demonstrate a dynamic colloidal molecule that is capable of moving autonomously and performing swift, reversible, and in-place assembly dissociation in a high accuracy by manipulating a TiO 2 /Pt Janus micromotor with light irradiation. Due to the efficient motion of the TiO 2 /Pt Janus motor and the light-switchable electrostatic interactions between the micromotor and colloidal particles, the colloidal particles can be captured and assembled one by one on the fly, subsequently forming into swimming colloidal molecules by mimicking space-filling models of simple molecules with central atoms. The as-demonstrated dynamic colloidal molecules have a configuration accurately controlled and stabilized by regulating the time-dependent intensity of UV light, which controls the stop-and-go motion of the colloidal molecules. The dynamic colloidal molecules are dissociated when the light irradiation is turned off due to the disappearance of light-switchable electrostatic interaction between the motor and the colloidal particles. The strategy for the assembly of dynamic colloidal molecules is applicable to various charged colloidal particles. The simulated optical properties of a dynamic colloidal molecule imply that the results here may provide a novel approach for in-place building functional microdevices, such as microlens arrays, in a swift and reversible manner.
Energy Technology Data Exchange (ETDEWEB)
Spencer, J.; Gajdos, F.; Blumberger, J., E-mail: j.blumberger@ucl.ac.uk [Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)
2016-08-14
We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.
Spencer, J.; Gajdos, F.; Blumberger, J.
2016-08-01
We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.
An equivalent body surface charge model representing three-dimensional bioelectrical activity
He, B.; Chernyak, Y. B.; Cohen, R. J.
1995-01-01
A new surface-source model has been developed to account for the bioelectrical potential on the body surface. A single-layer surface-charge model on the body surface has been developed to equivalently represent bioelectrical sources inside the body. The boundary conditions on the body surface are discussed in relation to the surface-charge in a half-space conductive medium. The equivalent body surface-charge is shown to be proportional to the normal component of the electric field on the body surface just outside the body. The spatial resolution of the equivalent surface-charge distribution appears intermediate between those of the body surface potential distribution and the body surface Laplacian distribution. An analytic relationship between the equivalent surface-charge and the surface Laplacian of the potential was found for a half-space conductive medium. The effects of finite spatial sampling and noise on the reconstruction of the equivalent surface-charge were evaluated by computer simulations. It was found through computer simulations that the reconstruction of the equivalent body surface-charge from the body surface Laplacian distribution is very stable against noise and finite spatial sampling. The present results suggest that the equivalent body surface-charge model may provide an additional insight to our understanding of bioelectric phenomena.
DEFF Research Database (Denmark)
Quarsten, H; Paulsen, G; Johansen, B H
1998-01-01
Susceptibility and resistance to type 1 diabetes are associated with MHC class II alleles that carry non-Asp and Asp at residue 57 of their beta chain respectively. The effect of Asp or non-Aspbeta57 may relate to a differential ability of distinct class II molecules to bind specific immuno......-pathogenic peptides. Recent studies in man and mouse have revealed that some type 1 diabetes-predisposing non-Aspbeta57 class II molecules (i.e. DQ8, DR4Dw15 and I-Ag7) preferentially bind peptides with a negatively charged anchor residue at P9. It has been suggested that this is a common feature of type 1 diabetes......-predisposing class II molecules. The molecular explanation for such a phenomenon could be that class II beta chains with Aspbeta57 form a salt bridge between Aspbeta57 and a conserved Arg of the a chain, whereas in non-Aspbeta57 molecules the Arg is unopposed and free to interact with negatively charged P9 peptide...
Pion-nucleus double charge exchange and the nuclear shell model
International Nuclear Information System (INIS)
Auerbach, N.; Gibbs, W.R.; Ginocchio, J.N.; Kaufmann, W.B.
1988-01-01
The pion-nucleus double charge exchange reaction is studied with special emphasis on nuclear structure. The reaction mechanism and nuclear structure aspects of the process are separated using both the plane-wave and distorted-wave impulse approximations. Predictions are made employing both the seniority model and a full shell model (with a single active orbit). Transitions to the double analog state and to the ground state of the residual nucleus are computed. The seniority model yields particularly simple relations among double charge exchange cross sections for nuclei within the same shell. Limitations of the seniority model and of the plane-wave impulse approximation are discussed as well as extensions to the generalized seniority scheme. Applications of the foregoing ideas to single charge exchange are also presented
Warwick, C. N.; Venkateshvaran, D.; Sirringhaus, H.
2015-09-01
We present measurements of the Seebeck coefficient in two high mobility organic small molecules, 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) and 2,9-didecyl-dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene (C10-DNTT). The measurements are performed in a field effect transistor structure with high field effect mobilities of approximately 3 cm2/V s. This allows us to observe both the charge concentration and temperature dependence of the Seebeck coefficient. We find a strong logarithmic dependence upon charge concentration and a temperature dependence within the measurement uncertainty. Despite performing the measurements on highly polycrystalline evaporated films, we see an agreement in the Seebeck coefficient with modelled values from Shi et al. [Chem. Mater. 26, 2669 (2014)] at high charge concentrations. We attribute deviations from the model at lower charge concentrations to charge trapping.
International Nuclear Information System (INIS)
Damskin, B.B.; Baturina, O.A.; Vasil'ev, S.Yu.; Emets, V.V.; Kazarinov, V.E.
1999-01-01
Curves of differential capacitance in the interfaces Hg/H 2 O, Ga/H 2 O, (In-Ga)/H 2 O and (Tl-Ga)H 2 O in 0.05 M Na 2 SO 4 solutions with different additions of n-butanol have been obtained by the bridge method at a frequency of 420 Hz and temperature of 32 deg C. The method of regression analysis of the curves permitted ascertaining the adsorption parameters of n-butanol for the range of charges q, where there is no chemisorption of H 2 O dipoles. The data obtained suggested that the difference in the adsorption behaviour of organic molecules on the metals studied in the range of higher negative charges is largely determined by different electron electrochemical work functions, the definition being given by S. Trasatti [ru
Attosecond electron dynamics in molecules and liquids
WöRner, Hans Jakob
The ultrafast motion of electrons and holes following light-matter interaction is fundamental to a broad range of chemical and biophysical processes. In this lecture, I will discuss some of our recent experiments that measure the atomic-scale motion of charge with attosecond temporal resolution (1 as = 10-18s). The first experiment is carried out on isolated, spatially oriented molecules in the gas phase. Using high-harmonic spectroscopy, we resolve the migration of an electron hole across the molecule with a resolution of 100 as and simultaneously demonstrate extensive control over charge migration. In the second class of experiments, we use an attosecond pulse train synchronized with a near-infrared laser pulse to temporally resolve the process of photoemission from molecules in the gas phase and from a liquid-water microjet, resolving electron transport through liquid water on the attosecond time scale.
International Nuclear Information System (INIS)
Le Roy, S; Segur, P; Teyssedre, G; Laurent, C
2004-01-01
We present a conduction model aimed at describing bipolar transport and space charge phenomena in low density polyethylene under dc stress. In the first part we recall the basic requirements for the description of charge transport and charge storage in disordered media with emphasis on the case of polyethylene. A quick review of available conduction models is presented and our approach is compared with these models. Then, the bases of the model are described and related assumptions are discussed. Finally, results on external current, trapped and free space charge distributions, field distribution and recombination rate are presented and discussed, considering a constant dc voltage, a step-increase of the voltage, and a polarization-depolarization protocol for the applied voltage. It is shown that the model is able to describe the general features reported for external current, electroluminescence and charge distribution in polyethylene
Tunable optical absorption in silicene molecules
Mokkath, Junais Habeeb; Schwingenschlö gl, Udo
2016-01-01
Two-dimensional materials with a tunable band gap that covers a wide range of the solar spectrum hold great promise for sunlight harvesting. For this reason, we investigate the structural, electronic, and optical properties of silicene molecules using time dependent density functional theory. We address the influence of the molecular size, buckling, and charge state as well as that of a dielectric environment. Unlike planar graphene molecules, silicene molecules prefer to form low-buckled structures with strong visible to ultraviolet optical response. We also identify molecular plasmons.
Tunable optical absorption in silicene molecules
Mokkath, Junais Habeeb
2016-07-13
Two-dimensional materials with a tunable band gap that covers a wide range of the solar spectrum hold great promise for sunlight harvesting. For this reason, we investigate the structural, electronic, and optical properties of silicene molecules using time dependent density functional theory. We address the influence of the molecular size, buckling, and charge state as well as that of a dielectric environment. Unlike planar graphene molecules, silicene molecules prefer to form low-buckled structures with strong visible to ultraviolet optical response. We also identify molecular plasmons.
Leventis, Nicholas; Yang, Jinua; Fabrizio,Even F.; Rawashdeh, Abdel-Monem M.; Oh, Woon Su; Sotiriou-Leventis, Chariklia
2004-01-01
Dendrimers are self-repeating globular branched star molecules, whose fractal structure continues to fascinate, challenge, and inspire. Functional dendrimers may incorporate redox centers, and potential applications include antennae molecules for light harvesting, sensors, mediators, and artificial biomolecules. We report the synthesis and redox properties of four star systems incorporating the 4-benzoyl-N-alkylpyridinium cation; the redox potential varies along the branches but remains constant at fixed radii. Bulk electrolysis shows that at a semi-infinite time scale all redox centers are electrochemically accessible. However, voltammetric analysis (cyclic voltammetry and differential pulse voltammetry) shows that on1y two of the three redox-active centers in the perimeter are electrochemically accessible during potential sweeps as slow as 20 mV/s and as fast as 10 V/s. On the contrary, both redox centers along branches are accessible electrochemically within the same time frame. These results are explained in terms of slow through-space charge transfer and the globular 3-D folding of the molecules and are discussed in terms of their implications on the design of efficient redox functional dendrimers.
Structural properties of water around uncharged and charged carbon nanotubes
International Nuclear Information System (INIS)
Dezfoli, Amir Reza Ansari; Mehrabian, Mozaffar Ali; Rafsanjani, Hassan Hashemipour
2013-01-01
Studying the structural properties of water molecules around the carbon nanotubes is very important in a wide variety of carbon nanotubes applications. We studied the number of hydrogen bonds, oxygen and hydrogen density distributions, and water orientation around carbon nanotubes. The water density distribution for all carbon nanotubes was observed to have the same feature. In water-carbon nanotubes interface, a high-density region of water molecules exists around carbon nanotubes. The results reveal that the water orientation around carbon nanotubes is roughly dependent on carbon nanotubes surface charge. The water molecules in close distances to carbon nanotubes were found to make an HOH plane nearly perpendicular to the water-carbon nanotubes interface for carbon nanotubes with negative surface charge. For uncharged carbon nanotubes and carbon nanotubes with positive surface charge, the HOH plane was in tangential orientation with water-carbon nanotubes interface. There was also a significant reduction in hydrogen bond of water region around carbon nanotubes as compared with hydrogen bond in bulk water. This reduction was very obvious for carbon nanotubes with positive surface charge. In addition, the calculation of dynamic properties of water molecules in water-CNT interface revealed that there is a direct relation between the number of Hbonds and self-diffusion coefficient of water molecules
Formation of molecules in interstellar clouds from singly and multiply ionized atoms
International Nuclear Information System (INIS)
Langer, W.D.; and NASA, Institute for Space Studies, Goddard Space Flight Center, New York)
1978-01-01
Soft X-ray and cosmic rays produce multiply ionized atoms which may initiate molecule production in interstellar clouds. This molecule production can occur via ion-molecule reactions with H 2 , either directly from the multiply ionized atom (e.g.,C ++ + H 2 →CH + + H + ), or indirectly from the singly ionized atoms (e.g., N + + H 2 →NH + + H) that are formed from the recombination or charge transfer of the highly ionized atom (e.g., N ++ + e→N + + hv). We investigate the contribution of these reactions to the abundances of carbon-, nitrogen-, and oxygen-bearing molecules in isobaric models of diffuse clouds. In the presence of the average flux estimated for the diffuse soft X-ray background, multiply ionized atoms contribute only minimally (a few percent) to carbon-bearing molecules such as CH. In the neighborhood of diffuse structures or discrete sources, however, where the X-ray flux is enhanced, multiple ionization is considerably more important for molecule production
Numerical modelling of needle-grid electrodes for negative surface corona charging system
International Nuclear Information System (INIS)
Zhuang, Y; Chen, G; Rotaru, M
2011-01-01
Surface potential decay measurement is a simple and low cost tool to examine electrical properties of insulation materials. During the corona charging stage, a needle-grid electrodes system is often used to achieve uniform charge distribution on the surface of the sample. In this paper, a model using COMSOL Multiphysics has been developed to simulate the gas discharge. A well-known hydrodynamic drift-diffusion model was used. The model consists of a set of continuity equations accounting for the movement, generation and loss of charge carriers (electrons, positive and negative ions) coupled with Poisson's equation to take into account the effect of space and surface charges on the electric field. Four models with the grid electrode in different positions and several mesh sizes are compared with a model that only has the needle electrode. The results for impulse current and surface charge density on the sample clearly show the effect of the extra grid electrode with various positions.
Radioluminescence of aromatic molecule solutions in atactic and isotactic polystyrene
International Nuclear Information System (INIS)
Lisovskaya, I.A.; Alfimov, M.V.; Milinchuk, V.K.; Skvortsov, V.G.
1975-01-01
The generation of excited states of naphthalene-d 8 and carbazole molecules in polystyrene (PS) under X-ray illumination was investigated using luminescence method. A comparison of the concentration dependences of radioluminescence of the aromatic additives to solid PS and to toluene as well as the pattern of concentration versus photoluminescence of naphthalene-d 8 in PS demonstrates that unlike toluene there is no singlet-triplet conversion in PS owing to the formation of excimers. It is shown that the excited ststes of the aromatic additives in PS are populated under radiolysis via an energy transfer from singlet to triplet molecules of the matrix. Under the radiolysis the excited states of PS molecules may generate upon charge recombination. A comparison of radio luminescence spectra of the corresponding aromatic additives in two isomeric PS structures (atacting and isotactic) shows different processes with charge participation. The difference detected in the radioluminescence spectra of aromatic additives in the atactic and isotactic PS explained by the greater number of defects in atactic PS competing with the polymer molecule ion for charge capture
Study on Impact of Electric Vehicles Charging Models on Power Load
Cheng, Chen; Hui-mei, Yuan
2017-05-01
With the rapid increase in the number of electric vehicles, which will lead the power load on grid increased and have an adversely affect. This paper gives a detailed analysis of the following factors, such as scale of the electric cars, charging mode, initial charging time, initial state of charge, charging power and other factors. Monte Carlo simulation method is used to compare the two charging modes, which are conventional charging and fast charging, and MATLAB is used to model and simulate the electric vehicle charging load. The results show that compared with the conventional charging mode, fast charging mode can meet the requirements of fast charging, but also bring great load to the distribution network which will affect the reliability of power grid.
Electrostatic interactions between immunoglobulin (IgG) molecules and a charged sorbent
Bremer, M.G.E.G.; Duval, J.; Norde, Willem; Lyklema, J.
2004-01-01
The influence of electrostatic interactions on the adsorption of IgG is examined both theoretically and experimentally. The long-range interaction between IgG and the charged sorbent surface is treated in terms of the DLVO theory taking into account the possibility of charge- and potential
Henry, Jackson; Blair, Enrique P.
2018-02-01
Mixed-valence molecules provide an implementation for a high-speed, energy-efficient paradigm for classical computing known as quantum-dot cellular automata (QCA). The primitive device in QCA is a cell, a structure with multiple quantum dots and a few mobile charges. A single mixed-valence molecule can function as a cell, with redox centers providing quantum dots. The charge configuration of a molecule encodes binary information, and device switching occurs via intramolecular electron transfer between dots. Arrays of molecular cells adsorbed onto a substrate form QCA logic. Individual cells in the array are coupled locally via the electrostatic electric field. This device networking enables general-purpose computing. Here, a quantum model of a two-dot molecule is built in which the two-state electronic system is coupled to the dominant nuclear vibrational mode via a reorganization energy. This model is used to explore the effects of the electronic inter-dot tunneling (coupling) matrix element and the reorganization energy on device switching. A semi-classical reduction of the model also is made to investigate the competition between field-driven device switching and the electron-vibrational self-trapping. A strong electron-vibrational coupling (high reorganization energy) gives rise to self-trapping, which inhibits the molecule's ability to switch. Nonetheless, there remains an expansive area in the tunneling-reorganization phase space where molecules can support adequate tunneling. Thus, the relationship between the tunneling matrix element and the reorganization energy affords significant leeway in the design of molecules viable for QCA applications.
Charge transport parameters of HBC at different temperatures
Energy Technology Data Exchange (ETDEWEB)
Kirkpatrick, J. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom); Marcon, V.; Kremer, K.; Andrienko, D. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Nelson, J. [Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom)
2008-05-15
We study the dependence on temperature of the charge transport parameters for hexabenzocoronene (HBC). Following from Marcus theory, two charge transport parameters will be calculated: the transfer integral and the difference in site energies. These parameters are strongly dependent on the orientation and position of molecules. Position and orientation of molecules are determined using molecular dynamics. Transfer integrals are calculated from a simplified INDO method. A technique to compute energetic disorder, that is the spread in site energies for the charge carriers, is developed. In the herringbone phase transfer integrals are higher, but so is energetic disorder. We consider three derivatives of HBC with different side chains, which lead to different phase behaviour and distributions of charge transport parameters. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Charging stations location model based on spatiotemporal electromobility use patterns
Pagany, Raphaela; Marquardt, Anna; Zink, Roland
2016-04-01
One of the major challenges for mainstream adoption of electric vehicles is the provision of infrastructure for charging the batteries of the vehicles. The charging stations must not only be located dense enough to allow users to complete their journeys, but the electric energy must also be provided from renewable sources in order to truly offer a transportation with less CO2 emissions. The examination of potential locations for the charging of electric vehicles can facilitate the adaption of electromobility and the integration of electronic vehicles in everyday life. A geographic information system (GIS) based model for optimal location of charging stations in a small and regional scale is presented. This considers parameters such as the forecast of electric vehicle use penetration, the relevant weight of diverse point of interests and the distance between parking area and destination for different vehicle users. In addition to the spatial scale the temporal modelling of the energy demand at the different charging locations has to be considerate. Depending on different user profiles (commuters, short haul drivers etc.) the frequency of charging vary during the day, the week and the year. In consequence, the spatiotemporal variability is a challenge for a reliable energy supply inside a decentralized renewable energy system. The presented model delivers on the one side the most adequate identified locations for charging stations and on the other side the interaction between energy supply and demand for electromobility under the consideration of temporal aspects. Using ESRI ArcGIS Desktop, first results for the case study region of Lower Bavaria are generated. The aim of the concept is to keep the model transferable to other regions and also open to integrate further and more detailed user profiles, derived from social studies about i.e. the daily behavior and the perception of electromobility in a next step.
Model for thickness dependence of radiation charging in MOS structures
Viswanathan, C. R.; Maserjian, J.
1976-01-01
The model considers charge buildup in MOS structures due to hole trapping in the oxide and the creation of sheet charge at the silicon interface. The contribution of hole trapping causes the flatband voltage to increase with thickness in a manner in which square and cube dependences are limiting cases. Experimental measurements on samples covering a 200 - 1000 A range of oxide thickness are consistent with the model, using independently obtained values of hole-trapping parameters. An important finding of our experimental results is that a negative interface charge contribution due to surface states created during irradiation compensates most of the positive charge in the oxide at flatband. The tendency of the surface states to 'track' the positive charge buildup in the oxide, for all thicknesses, applies both in creation during irradiation and in annihilation during annealing. An explanation is proposed based on the common defect origin of hole traps and potential surface states.
Directory of Open Access Journals (Sweden)
R.Akiyama
2007-12-01
Full Text Available The potential of mean force (PMF between like-charged colloidal particles immersed in aqueous electrolyte solution is studied using the integral equation theory. Solvent molecules are modeled as neutral hard spheres, and ions and colloidal particles are taken to be charged hard spheres. The Coulomb potentials for ion-ion, ion-colloidal particle, and colloidal particle-colloidal particle pairs are divided by the dielectric constant of water. This simple model is employed to account for the effects of solvent granularity neglected in the so-called primitive model. The van der Waals attraction between colloidal particles, which is an essential constituent of conventional DLVO theory, is omitted in the present model. Nevertheless, when the electrolyte concentration is sufficiently high, attractive regions appear in the PMF. In particular, the interaction at small separations is significantly attractive and the contact of colloidal particles is stabilized. This interesting behavior arises from the effects of the translational motion of solvent molecules.
The influence of alkali promoters on coadsorbed molecules
International Nuclear Information System (INIS)
Umbach, E.
1986-01-01
A model has been suggested recently based on the results of an extensive study of the coadsorbate system CO + K on Ru(001). It is introduced and discussed in this article based on previous results and on results obtained very recently for a similar coadsorbate system, CO + K/Ni(111). This model is in competition with a variety of differing or similar ideas and interpretations which are mostly based on similar experimental results. Some of these other models postulate a lying-down, or strongly tilted, molecule in the presence of alkali atoms, at least at low coverages. The CO molecule is usually considered to be attached to the substrate and to be closely coadsorbed to the alkali neighbor(s) but sometimes even a vertical or horizontal adsorption on top of the alkali layer has been suggested. The interaction between alkali and CO has been described as indirect via the substrate or direct by forming a ''π''-bond between adjacent alkalis and CO molecules or even by forming an ionic K/sub x/-CO/sub y/ complex. Some authors prefer a model in which the main (or exclusive) interaction comes from a charge transfer from the donating alkali into the 2π orbital of the coadsorbed CO, thus, enhancing the C- metal and reducing the C-O bond strength
An algebraic model for three-cluster giant molecules
International Nuclear Information System (INIS)
Hess, P.O.; Bijker, R.; Misicu, S.
2001-01-01
After an introduction to the algebraic U(7) model for three bodies, we present a relation of a geometrical description of three-cluster molecule to the algebraic U(7) model. Stiffness parameters of oscillations between each of two clusters are calculated and translated to the model parameter values of the algebraic model. The model is applied to the trinuclear system l32 Sn+ α + ll6 Pd which occurs in the ternary cold fission of 252 Cf. (Author)
Directory of Open Access Journals (Sweden)
C. N. Warwick
2015-09-01
Full Text Available We present measurements of the Seebeck coefficient in two high mobility organic small molecules, 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT and 2,9-didecyl-dinaphtho[2,3-b:2′,3′-f]thieno[3,2-b]thiophene (C10-DNTT. The measurements are performed in a field effect transistor structure with high field effect mobilities of approximately 3 cm2/V s. This allows us to observe both the charge concentration and temperature dependence of the Seebeck coefficient. We find a strong logarithmic dependence upon charge concentration and a temperature dependence within the measurement uncertainty. Despite performing the measurements on highly polycrystalline evaporated films, we see an agreement in the Seebeck coefficient with modelled values from Shi et al. [Chem. Mater. 26, 2669 (2014] at high charge concentrations. We attribute deviations from the model at lower charge concentrations to charge trapping.
Modelling of energetic molecule-surface interactions
International Nuclear Information System (INIS)
Kerford, M.
2000-09-01
This thesis contains the results of molecular dynamics simulations of molecule-surface interactions, looking particularly at fullerene molecules and carbon surfaces. Energetic impacts of fullerene molecules on graphite create defect craters. The relationship between the parameters of the impacting molecule and the parameters of the crater axe examined and found to be a function of the energy and velocity of the impacting molecule. Less energetic fullerene molecules can be scattered from a graphite surface and the partitioning of energy after a scattering event is investigated. It is found that a large fraction of the kinetic energy retained after impact is translational energy, with a small fraction of rotational energy and a number of vibrational modes. At impact energies where the surface is not broken and at normal incidence, surface waves axe seen to occur. These waves axe used to develop a method of desorbing molecules from a graphite surface without damage to either the surface or the molecules being desorbed. A number of fullerene molecules are investigated and ways to increase the desorption yield are examined. It is found that this is a successful technique for desorbing large numbers of intact molecules from graphite. This technique could be used for desorbing intact molecules into a gas phase for mass spectrometric analysis. (author)
Model of electric field-induced charge disordering in praseodymium manganites
International Nuclear Information System (INIS)
Lapinskas, S.; Tornau, E.E.; Semiconductor Physics Inst., Vilnius
2001-01-01
We propose a model for an electric field-driven transition from the ordered NaCl-type phase to the disordered phase. Such a transition might be a prototype of charge disordering transition observed in Pr 1-c Ca c MnO 3 . We assume the lattice-gas model and hopping conductivity of charge carriers. The solution of this model, performed by the Monte Carlo method, demonstrates that considerably high electric field can disorder well-ordered phases. The comparison with the data for charge disordering in Pr 1-c Ca c MnO 3 shows that required fields are much too high. We analyze the obtained results trying to determine a possible scenario for conductivity in Pr 1-c Ca c MnO 3 . (orig.)
Quantum modeling of ultrafast photoinduced charge separation
Rozzi, Carlo Andrea; Troiani, Filippo; Tavernelli, Ivano
2018-01-01
Phenomena involving electron transfer are ubiquitous in nature, photosynthesis and enzymes or protein activity being prominent examples. Their deep understanding thus represents a mandatory scientific goal. Moreover, controlling the separation of photogenerated charges is a crucial prerequisite in many applicative contexts, including quantum electronics, photo-electrochemical water splitting, photocatalytic dye degradation, and energy conversion. In particular, photoinduced charge separation is the pivotal step driving the storage of sun light into electrical or chemical energy. If properly mastered, these processes may also allow us to achieve a better command of information storage at the nanoscale, as required for the development of molecular electronics, optical switching, or quantum technologies, amongst others. In this Topical Review we survey recent progress in the understanding of ultrafast charge separation from photoexcited states. We report the state-of-the-art of the observation and theoretical description of charge separation phenomena in the ultrafast regime mainly focusing on molecular- and nano-sized solar energy conversion systems. In particular, we examine different proposed mechanisms driving ultrafast charge dynamics, with particular regard to the role of quantum coherence and electron-nuclear coupling, and link experimental observations to theoretical approaches based either on model Hamiltonians or on first principles simulations.
Challenging chemical concepts through charge density of molecules and crystals
International Nuclear Information System (INIS)
Gatti, Carlo
2013-01-01
Narrating my scientific career, I show in this paper how, starting as a computational and theoretical chemist, I got naturally involved with x-ray crystallographers because of the common interest in charge density and in the study of chemical bonds based on such an observable. The tools I devised and the conceptual developments I made to facilitate a profitable encounter between x-ray charge density and computational chemistry researchers are illustrated, with a special focus on the proposal and applications of the Source Function concept. (comment)
International Nuclear Information System (INIS)
Larriba-Andaluz, Carlos; Hogan, Christopher J.
2014-01-01
Structural characterization of ions in the gas phase is facilitated by measurement of ion collision cross sections (CCS) using techniques such as ion mobility spectrometry. Further information is gained from CCS measurement when comparison is made between measurements and accurately predicted CCSs for model ion structures and the gas in which measurements are made. While diatomic gases, namely molecular nitrogen and air, are being used in CCS measurement with increasingly prevalency, the majority of studies in which measurements are compared to predictions use models in which gas molecules are spherical or non-rotating, which is not necessarily appropriate for diatomic gases. Here, we adapt a momentum transfer based CCS calculation approach to consider rotating, diatomic gas molecule collisions with polyatomic ions, and compare CCS predictions with a diatomic gas molecule to those made with a spherical gas molecular for model spherical ions, tetra-alkylammonium ions, and multiply charged polyethylene glycol ions. CCS calculations are performed using both specular-elastic and diffuse-inelastic collisions rules, which mimic negligible internal energy exchange and complete thermal accommodation, respectively, between gas molecule and ion. The influence of the long range ion-induced dipole potential on calculations is also examined with both gas molecule models. In large part we find that CCSs calculated with specular-elastic collision rules decrease, while they increase with diffuse-inelastic collision rules when using diatomic gas molecules. Results clearly show the structural model of both the ion and gas molecule, the potential energy field between ion and gas molecule, and finally the modeled degree of kinetic energy exchange between ion and gas molecule internal energy are coupled to one another in CCS calculations, and must be considered carefully to obtain results which agree with measurements
Theoretical model for ultracold molecule formation via adaptive feedback control
International Nuclear Information System (INIS)
Poschinger, Ulrich; Salzmann, Wenzel; Wester, Roland; Weidemueller, Matthias; Koch, Christiane P; Kosloff, Ronnie
2006-01-01
We theoretically investigate pump-dump photoassociation of ultracold molecules with amplitude- and phase-modulated femtosecond laser pulses. For this purpose, a perturbative model for light-matter interaction is developed and combined with a genetic algorithm for adaptive feedback control of the laser pulse shapes. The model is applied to the formation of 85 Rb 2 molecules in a magneto-optical trap. We find that optimized pulse shapes may maximize the formation of ground state molecules in a specific vibrational state at a pump-dump delay time for which unshaped pulses lead to a minimum of the formation rate. Compared to the maximum formation rate obtained for unshaped pulses at the optimum pump-dump delay, the optimized pulses lead to a significant improvement of about 40% for the target level population. Since our model yields the spectral amplitudes and phases of the optimized pulses, the results are directly applicable in pulse shaping experiments
Kipp, Dylan; Ganesan, Venkat
2013-06-01
We develop a kinetic Monte Carlo model for photocurrent generation in organic solar cells that demonstrates improved agreement with experimental illuminated and dark current-voltage curves. In our model, we introduce a charge injection rate prefactor to correct for the electrode grid-size and electrode charge density biases apparent in the coarse-grained approximation of the electrode as a grid of single occupancy, charge-injecting reservoirs. We use the charge injection rate prefactor to control the portion of dark current attributed to each of four kinds of charge injection. By shifting the dark current between electrode-polymer pairs, we align the injection timescales and expand the applicability of the method to accommodate ohmic energy barriers. We consider the device characteristics of the ITO/PEDOT/PSS:PPDI:PBTT:Al system and demonstrate the manner in which our model captures the device charge densities unique to systems with small injection energy barriers. To elucidate the defining characteristics of our model, we first demonstrate the manner in which charge accumulation and band bending affect the shape and placement of the various current-voltage regimes. We then discuss the influence of various model parameters upon the current-voltage characteristics.
Efficient charge generation by relaxed charge-transfer states at organic interfaces
Vandewal, Koen
2013-11-17
Interfaces between organic electron-donating (D) and electron-accepting (A) materials have the ability to generate charge carriers on illumination. Efficient organic solar cells require a high yield for this process, combined with a minimum of energy losses. Here, we investigate the role of the lowest energy emissive interfacial charge-transfer state (CT1) in the charge generation process. We measure the quantum yield and the electric field dependence of charge generation on excitation of the charge-transfer (CT) state manifold via weakly allowed, low-energy optical transitions. For a wide range of photovoltaic devices based on polymer:fullerene, small-molecule:C60 and polymer:polymer blends, our study reveals that the internal quantum efficiency (IQE) is essentially independent of whether or not D, A or CT states with an energy higher than that of CT1 are excited. The best materials systems show an IQE higher than 90% without the need for excess electronic or vibrational energy. © 2014 Macmillan Publishers Limited.
Efficient charge generation by relaxed charge-transfer states at organic interfaces
Vandewal, Koen; Albrecht, Steve N.; Hoke, Eric T.; Graham, Kenneth; Widmer, Johannes; Douglas, Jessica D.; Schubert, Marcel; Mateker, William R.; Bloking, Jason T.; Burkhard, George F.; Sellinger, Alan; Frechet, Jean; Amassian, Aram; Riede, Moritz Kilian; McGehee, Michael D.; Neher, Dieter; Salleo, Alberto
2013-01-01
Interfaces between organic electron-donating (D) and electron-accepting (A) materials have the ability to generate charge carriers on illumination. Efficient organic solar cells require a high yield for this process, combined with a minimum of energy losses. Here, we investigate the role of the lowest energy emissive interfacial charge-transfer state (CT1) in the charge generation process. We measure the quantum yield and the electric field dependence of charge generation on excitation of the charge-transfer (CT) state manifold via weakly allowed, low-energy optical transitions. For a wide range of photovoltaic devices based on polymer:fullerene, small-molecule:C60 and polymer:polymer blends, our study reveals that the internal quantum efficiency (IQE) is essentially independent of whether or not D, A or CT states with an energy higher than that of CT1 are excited. The best materials systems show an IQE higher than 90% without the need for excess electronic or vibrational energy. © 2014 Macmillan Publishers Limited.
Interactions between nitrogen molecules and barium atoms on Ru (0001) surface
International Nuclear Information System (INIS)
Zhao Xinxin; Mi Yiming; Xu Hongxia; Wang Lili; Ren Li; Tao Xiangming; Tan Mingqiu
2011-01-01
We had performed first principles calculations on interactions between nitrogen molecules and barium atoms on Ru (0001) surface using density function theory methods. It was shown that effects of barium atoms weakened the bond strength of nitrogen molecules. The bond length of nitrogen molecule increases from 0.113 nm on Ru (001)-N 2 to 0.120 nm on Ru (001)-N 2 /Ba surface. While stretch vibrational frequency of nitrogen molecule decreased from 2222 cm -1 and charge transfer toward nitrogen molecule increased from 0.3 e to 1.1 e. Charge was mainly translated from 6 s orbitals of barium atoms to 4 d orbitals of substrate, which enhanced the hybridization between 4 d and 2 π orbitals and increased the dipole moment of 5 σ and d π orbitals of nitrogen molecule. The molecular dipole moment of nitrogen molecule was increased by -0.136 e Anstrom. It was suggested that barium had some characters to be an electronic promoter on the process of activating nitrogen molecules on Ru (0001) surface. (authors)
Structural characterization of some substituted azolidine molecules
International Nuclear Information System (INIS)
Andreocci, M.V.; Bossa, M.; Furlani, C.; Mattogno, G.; Zanoni, R.; Consiglio Nazionale delle Ricerche, Rome; Devillanova, F.A.; Verani, G.
1981-01-01
The electronic structure of a series of organic molecules of general formula RN - (CH 2 ) 2 - X - C = Y, which are also of interest in inorganic chemistry because of their properties as ligands towards metals, have been investigated by X-ray photoelectron spectroscopy. The results suggest a general picture of atomic charge distribution within the investigated molecules, and allow an assessment of the effect of the different substituent groups X, Y, R (X = NR', O, S, CH 2 ; Y = O, S, Se; R, R' = H, alkyl) on the electronic structure of the ligands. Satisfactory correlation is found between experimental binding energies and computed CNDO/2 atomic charges, after correction for intramolecular Madelung potentials. (orig.)
Pazos, M Carolina; Cota, Agustín; Osuna, Francisco J; Pavón, Esperanza; Alba, María D
2015-04-21
A family of tetradecylammonium micas is synthesized using synthetic swelling micas with high layer charge (Na(n)Si(8-n)Al(n)Mg6F4O20·XH2O, where n = 2 and 3) exchanged with tetradecylammonium cations. The molecular arrangement of the surfactant is elucidated on the basis of XRD patterns and DTA. The ordering conformation of the surfactant molecules into the interlayer space of micas is investigated by IR/FT, (13)C, (27)Al, and (29)Si MAS NMR. The structural arrangement of the tetradecylammonium cation in the interlayer space of high-charge micas is more sensitive to the effect of the mica layer charge at high concentration. The surfactant arrangement is found to follow the bilayer-paraffin model for all values of layer charge and surfactant concentration. However, at initial concentration below the mica CEC, a lateral monolayer is also observed. The amount of ordered conformation all-trans is directly proportional to the layer charge and surfactant concentration.
Jia, Chun-Sheng; Liang, Guang-Chuan; Peng, Xiao-Long; Tang, Hong-Ming; Zhang, Lie-Hui
2014-06-01
By employing the dissociation energy and the equilibrium bond length for a diatomic molecule as explicit parameters, we generate an improved form of the Williams-Poulios potential energy model. It is found that the negative Williams-Poulios potential model is equivalent to the Manning-Rosen potential model for diatomic molecules. We observe that the Manning-Rosen potential is superior to the Morse potential in reproducing the interaction potential energy curves for the {{a}3 Σu+} state of the 6Li2 molecule and the {{X}1 sum+} state of the SiF+ molecule.
The EV Project Price/Fee Models for Publicly Accessible Charging
Energy Technology Data Exchange (ETDEWEB)
Francfort, James Edward [Idaho National Lab. (INL), Idaho Falls, ID (United States)
2015-12-01
As plug-in electric vehicles (PEVs) are introduced to the market place and gain more consumer acceptance, it is important for a robust and self-sustaining non-residential infrastructure of electric vehicle supply equipment (EVSE) to be established to meet the needs of PEV drivers. While federal and state financial incentives for electric vehicles were in place and remain so today, future incentives are uncertain. In order for PEVs to achieve mainstream adoption, an adequate and sustainable commercial or publicly available charging infrastructure was pursued by The EV Project to encourage increased PEV purchases by alleviating range anxiety, and by removing adoption barriers for consumers without a dedicated overnight parking location to provide a home-base charger. This included determining a business model for publicly accessible charge infrastructure. To establish this business model, The EV Project team created a fee for charge model along with various ancillary offerings related to charging that would generate revenue. And after placing chargers in the field the Project rolled out this fee structure.
Sutton, Christopher; Tummala, Naga Rajesh; Kemper, Travis; Aziz, Saadullah G.; Sears, John; Coropceanu, Veaceslav; Bredas, Jean-Luc
2017-01-01
Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.
Sutton, Christopher
2017-06-13
Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.
Hu, Yin; White, Marvin H.
1993-10-01
A new analytical model is developed to investigate the influence of the charge loss processes in the retention mode of the SONOS NVSM device. The model considers charge loss by the following processes: (1) electron back-tunneling from the nitride traps to the Si conduction band, (2) electron back-tunneling from the nitride traps to the Si/SiO 2 interface traps and (3) hole injection from the Si valence band to the nitride traps. An amphoteric trap charge distribution is used in this model. The new charge retention model predicts that process (1) determines the short term retention, while processes (2) and (3) determine the long term retention. Good agreement has been reached between the results of analytical calculations and the experimental retention data on both surface channel and buried channel SONOS devices.
Understanding charge transport in molecular electronics.
Kushmerick, J J; Pollack, S K; Yang, J C; Naciri, J; Holt, D B; Ratner, M A; Shashidhar, R
2003-12-01
For molecular electronics to become a viable technology the factors that control charge transport across a metal-molecule-metal junction need to be elucidated. We use an experimentally simple crossed-wire tunnel junction to interrogate how factors such as metal-molecule coupling, molecular structure, and the choice of metal electrode influence the current-voltage characteristics of a molecular junction.
Supramolecular Systems and Chemical Reactions in Single-Molecule Break Junctions.
Li, Xiaohui; Hu, Duan; Tan, Zhibing; Bai, Jie; Xiao, Zongyuan; Yang, Yang; Shi, Jia; Hong, Wenjing
2017-04-01
The major challenges of molecular electronics are the understanding and manipulation of the electron transport through the single-molecule junction. With the single-molecule break junction techniques, including scanning tunneling microscope break junction technique and mechanically controllable break junction technique, the charge transport through various single-molecule and supramolecular junctions has been studied during the dynamic fabrication and continuous characterization of molecular junctions. This review starts from the charge transport characterization of supramolecular junctions through a variety of noncovalent interactions, such as hydrogen bond, π-π interaction, and electrostatic force. We further review the recent progress in constructing highly conductive molecular junctions via chemical reactions, the response of molecular junctions to external stimuli, as well as the application of break junction techniques in controlling and monitoring chemical reactions in situ. We suggest that beyond the measurement of single molecular conductance, the single-molecule break junction techniques provide a promising access to study molecular assembly and chemical reactions at the single-molecule scale.
Technetium-aspirin molecule complexes
International Nuclear Information System (INIS)
El-Shahawy, A.S.; Mahfouz, R.M.; Aly, A.A.M.; El-Zohry, M.
1993-01-01
Technetium-aspirin and technetium-aspirin-like molecule complexes were prepared. The structure of N-acetylanthranilic acid (NAA) has been decided through CNDO calculations. The ionization potential and electron affinity of the NAA molecule as well as the charge densities were calculated. The electronic absorption spectra of Tc(V)-Asp and Tc(V)-ATS complexes have two characteristic absorption bands at 450 and 600 nm, but the Tc(V)-NAA spectrum has one characteristic band at 450 nm. As a comparative study, Mo-ATS complex was prepared and its electronic absorption spectrum is comparable with the Tc-ATS complex spectrum. (author)
Xu, Huifang; Dai, Yuehua
2017-02-01
A two-dimensional analytical model of double-gate (DG) tunneling field-effect transistors (TFETs) with interface trapped charges is proposed in this paper. The influence of the channel mobile charges on the potential profile is also taken into account in order to improve the accuracy of the models. On the basis of potential profile, the electric field is derived and the expression for the drain current is obtained by integrating the BTBT generation rate. The model can be used to study the impact of interface trapped charges on the surface potential, the shortest tunneling length, the drain current and the threshold voltage for varying interface trapped charge densities, length of damaged region as well as the structural parameters of the DG TFET and can also be utilized to design the charge trapped memory devices based on TFET. The biggest advantage of this model is that it is more accurate, and in its expression there are no fitting parameters with small calculating amount. Very good agreements for both the potential, drain current and threshold voltage are observed between the model calculations and the simulated results. Project supported by the National Natural Science Foundation of China (No. 61376106), the University Natural Science Research Key Project of Anhui Province (No. KJ2016A169), and the Introduced Talents Project of Anhui Science and Technology University.
Beichel, Witali; Trapp, Nils; Hauf, Christoph; Kohler, Oliver; Eickerling, Georg; Scherer, Wolfgang; Krossing, Ingo
2014-03-17
The charge scaling effect in ionic liquids was explored on the basis of experimental and theoretical chargedensity analyses of [C1MIM][C1SO4] employing the quantum theory of atoms in molecules (QTAIM) approach. Integrated QTAIM charges of the experimental (calculated) charge density of the cation and anion resulted in non-integer values of ±0.90 (±0.87) e. Efficient charge transfer along the bond paths of the hydrogen bonds between the imidazolium ring and the anion was considered as the origin of these reduced charges. In addition, a detailed QTAIM analysis of the bonding situation in the [C1SO4]- anion revealed the presence of negative πO→σ*S-O hyperconjugation.
Charge-changing transitions in an extended Lipkin-type model
International Nuclear Information System (INIS)
Mihut, I.; Stoica, S.; Suhonen, J.
1997-01-01
Charge-changing transition are considered in an extended Lipkin-Meshkov-Glick (LMG) model taking into account explicitly the proton and neutron degrees of freedom. The proton and neutron Hamiltonians are taken to be of the LMG form and in addition, a residual proton-neutron interaction is included. Model charge-changing operators and their action on eigenfunctions of the model Hamiltonian are defined. Transition amplitudes of these operators are calculated using exact eigenfunctions and then the RPA approximation. The best agreement between the two kinds of calculations was obtained when the correlated RPA ground state, instead of the uncorrelated HF ground state, is employed and when the proton-neutron residual interaction besides the proton-proton and neutron-neutron residual interactions is taken into account in the model Hamiltonian
Interplay between efficiency and device architecture for small molecule organic solar cells.
Williams, Graeme; Sutty, Sibi; Aziz, Hany
2014-06-21
Small molecule organic solar cells (OSCs) have experienced a resurgence of interest over their polymer solar cell counterparts, owing to their improved batch-to-batch (thus, cell-to-cell) reliability. In this systematic study on OSC device architecture, we investigate five different small molecule OSC structures, including the simple planar heterojunction (PHJ) and bulk heterojunction (BHJ), as well as several planar-mixed structures. The different OSC structures are studied over a wide range of donor:acceptor mixing concentrations to gain a comprehensive understanding of their charge transport behavior. Transient photocurrent decay measurements provide crucial information regarding the interplay between charge sweep-out and charge recombination, and ultimately hint toward space charge effects in planar-mixed structures. Results show that the BHJ/acceptor architecture, comprising a BHJ layer with high C60 acceptor content, generates OSCs with the highest performance by balancing charge generation with charge collection. The performance of other device architectures is largely limited by hole transport, with associated hole accumulation and space charge effects.
Charge carrier relaxation model in disordered organic semiconductors
International Nuclear Information System (INIS)
Lu, Nianduan; Li, Ling; Sun, Pengxiao; Liu, Ming
2013-01-01
The relaxation phenomena of charge carrier in disordered organic semiconductors have been demonstrated and investigated theoretically. An analytical model describing the charge carrier relaxation is proposed based on the pure hopping transport theory. The relation between the material disorder, electric field and temperature and the relaxation phenomena has been discussed in detail, respectively. The calculated results reveal that the increase of electric field and temperature can promote the relaxation effect in disordered organic semiconductors, while the increase of material disorder will weaken the relaxation. The proposed model can explain well the stretched-exponential law by adopting the appropriate parameters. The calculation shows a good agreement with the experimental data for organic semiconductors
Models of charge pair generation in organic solar cells.
Few, Sheridan; Frost, Jarvist M; Nelson, Jenny
2015-01-28
Efficient charge pair generation is observed in many organic photovoltaic (OPV) heterojunctions, despite nominal electron-hole binding energies which greatly exceed the average thermal energy. Empirically, the efficiency of this process appears to be related to the choice of donor and acceptor materials, the resulting sequence of excited state energy levels and the structure of the interface. In order to establish a suitable physical model for the process, a range of different theoretical studies have addressed the nature and energies of the interfacial states, the energetic profile close to the heterojunction and the dynamics of excited state transitions. In this paper, we review recent developments underpinning the theory of charge pair generation and phenomena, focussing on electronic structure calculations, electrostatic models and approaches to excited state dynamics. We discuss the remaining challenges in achieving a predictive approach to charge generation efficiency.
International Nuclear Information System (INIS)
Atterbury, C.; Kennedy, R.A.; Critchley, A.D.J.; Mayhew, C.A.
2002-01-01
Many sequential and parallel chemical reactions involving charged species occur in a plasma. Data needed to model plasma's chemical and physical environment includes cross-section, rate coefficients, and product ion distribution of electron-molecule and ion-molecule processes. Such reactions are studied by our group away from the complexity of the plasma environment, with experimental techniques that allow us to concentrate on a single process, where usually only one or two species are involved. A molecule commonly used in plasma etching applications is SF 6 1,2 . We have performed a series of positive ion-molecule and electron attachment studies on SF 6 and related molecules, including SeF 6 , TeF 6 (i.e. XF 6 molecules), SF 5 CF 3 and SF 5 Cl (i.e. SF 5 X molecules) 3- (. The studies of ion reactions with and electron attachment to SF 6 and physically similar molecules are of value when seeking to understand the ion and electron chemistry occurring in SF 6 containing plasma. The result of these studies are presented in this poster. Ion-molecule reactions. Rate coefficients and ion product branching ratios have been determined with the Selected Ion Flow Tube (SIFT) at room temperature (300 K) for reactions of SF 5 X with the following twenty-two cations; Ne + , F + , Ar + , N 2 + , N + , CO + , CO 2 + , O + , N 2 O + , O 2 + , SF 4 + , CF 2 + , SF + , SF 2 + , NO 2 + , SF 5 + , NO + , CF + , CF 3 + , SF 3 + , and H 3 O + (listed in order of decreasing recombination energy). SF 2 + , NO 2 + , NO + , SF 3 + , and H 3 O + are found to be unreacted with both SF 5 CF 3 and SF 5 Cl. The majority of the other reactions proceed with rate coefficients that are close to the capture value. Those found to occur at rates significantly less than the capture mechanism value re the reactions of O 2 + , SF + , SF 5 + , and CF 3 + with SF 5 CF 3 , and SF 4 + and SF 5 + with SF 5 Cl. Several distinction processes are observed among the large number of reactions studied, including
Supermolecular structure and charge carriers mobilities of perylene diimides
Energy Technology Data Exchange (ETDEWEB)
Marcon, Valentina; Pisula, Wojtek; Andrienko, Denis [Max-Planck-Institut fuer Polymerforschung, Mainz (Germany); Kirkpatrick, James [Max-Planck-Institut fuer Polymerforschung, Mainz (Germany); Department of Physics, Imperial College London, London (United Kingdom)
2008-07-01
Perylene diimides form columnar phases, where the molecules stack on top of each other and the columns arrange in a regular lattice. The self-organization into well-ordered columns results in the one-dimensional charge transport along the stack of the aromatic cores of the molecules. Most of the discotic molecules which organize in columns are p-type semiconductors, while the class of rylene diimide molecules, to which perylene belongs, forms n-type organic semiconductors. Using atomistic molecular dynamics (MD) simulations we study the columnar phases of perylene diimides and establish correlations between the molecular structure, packing, and dynamical properties of these materials. By using a scheme which combines electronic structure calculations, MD and kinetic Monte Carlo simulations, a correlation is then established between the molecular structure and charge mobility of perylenes columnar mesophases.
Charged-current inclusive neutrino cross sections in the SuperScaling model
Energy Technology Data Exchange (ETDEWEB)
Ivanov, M. V., E-mail: martin.inrne@gmail.com [Institute for Nuclear Research and Nuclear Energy, Bulgarian Academy of Sciences, Sofia 1784 (Bulgaria); Grupo de Física Nuclear, Departamento de Física Atómica, Molecular y Nuclear, Facultad de Ciencias Físicas, Universidad Complutense de Madrid, Madrid E-28040 (Spain); Megias, G. D.; Caballero, J. A. [Departamento de Física Atómica, Molecular y Nuclear, Universidad de Sevilla, 41080 Sevilla (Spain); González-Jiménez, R. [Department of Physics and Astronomy, Ghent University, Proeftuinstraat 86, B-9000 Gent (Belgium); Moreno, O.; Donnelly, T. W. [Center for Theoretical Physics, Laboratory for Nuclear Science and Department of Physics, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); Barbaro, M. B. [Dipartimento di Fisica, Università di Torino and INFN, Sezione di Torino, Via P. Giuria 1, 10125 Torino (Italy); Antonov, A. N. [Institute for Nuclear Research and Nuclear Energy, Bulgarian Academy of Sciences, Sofia 1784 (Bulgaria); Moya de Guerra, E.; Udías, J. M. [Grupo de Física Nuclear, Departamento de Física Atómica, Molecular y Nuclear, Facultad de Ciencias Físicas, Universidad Complutense de Madrid, Madrid E-28040 (Spain)
2016-03-25
SuperScaling model (SuSA) predictions to neutrino-induced charged-current π{sup +} production in the Δ-resonance region are explored under MiniBooNE experimental conditions. The SuSA charged-current π{sup +} results are in good agreement with data on neutrino flux-averaged double-differential cross sections. The SuSA model for quasielastic scattering and its extension to the pion production region are used for predictions of charged-current inclusive neutrino-nucleus cross sections. Results are also compared with the T2K experimental data for inclusive scattering.
Study of the charge transport characteristics of dendrimer molecular thin films
Energy Technology Data Exchange (ETDEWEB)
Li, J.C., E-mail: jcli@mail.neu.edu.cn; Han, N.; Wang, S.S.; Ba, D.C.
2011-05-31
In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.
Study of the charge transport characteristics of dendrimer molecular thin films
International Nuclear Information System (INIS)
Li, J.C.; Han, N.; Wang, S.S.; Ba, D.C.
2011-01-01
In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.
Dynamics in ion-molecule collisions at high velocities: One- and two-electron processes
International Nuclear Information System (INIS)
Wang, Yudong.
1992-01-01
This dissertation addresses the dynamic interactions in ion-molecule collisions. Theoretical methods are developed for single and multiple electron transitions in fast collisions with diatomic molecules by heavy-ion projectiles. Various theories and models are developed to treat the three basic inelastic processes (excitation, ionization and charge transfer) involving one and more electrons. The development, incorporating the understanding of ion-atom collision theories with some unique characteristics for molecular targets, provides new insights into phenomena that are absent from collisions with atomic targets. The influence from the multiple scattering centers on collision dynamics is assessed. For diatomic molecules, effects due to a fixed molecular orientation or alignment are calculated and compared with available experimental observations. Compared with excitation and ionization, electron capture, which probes deeper into the target, presents significant two-center interference and strong orientation dependence. Attention has been given in this dissertation to exploring mechanisms for two-and multiple electron transitions. Application of independent electron approximation to transfer excitation from molecular hydrogen is studied. Electron-electron interaction originated from projectile and target nuclear centers is studied in conjunction with the molecular nature of target. Limitations of the present theories and models as well as possible new areas for future theoretical and experimental applications are also discussed. This is the first attempt to describe multi-electron processes in molecular dynamics involving fast highly charged ions
Electrostatic Model Applied to ISS Charged Water Droplet Experiment
Stevenson, Daan; Schaub, Hanspeter; Pettit, Donald R.
2015-01-01
The electrostatic force can be used to create novel relative motion between charged bodies if it can be isolated from the stronger gravitational and dissipative forces. Recently, Coulomb orbital motion was demonstrated on the International Space Station by releasing charged water droplets in the vicinity of a charged knitting needle. In this investigation, the Multi-Sphere Method, an electrostatic model developed to study active spacecraft position control by Coulomb charging, is used to simulate the complex orbital motion of the droplets. When atmospheric drag is introduced, the simulated motion closely mimics that seen in the video footage of the experiment. The electrostatic force's inverse dependency on separation distance near the center of the needle lends itself to analytic predictions of the radial motion.
Mahale, Rajashree Y.; Dharmapurikar, Satej S.; Chini, Mrinmoy Kumar; Venugopalan, Vijay
2017-06-01
Diketopyrrolopyrrole based donor-acceptor-donor conjugated small molecules using ethylene dioxythiophene as a donor was synthesized. Electron deficient diketopyrrolopyrrole unit was substituted with thermocleavable (tert-butyl acetate) side chains. The thermal treatment of the molecules at 160 °C eliminated the tert-butyl ester group results in the formation of corresponding acid. Optical and theoretical studies revealed that the molecules adopted a change in molecular arrangement after thermolysis. The conjugated small molecules possessed p-channel charge transport characteristics in organic field effect transistors. The charge carrier mobility was increased after thermolysis of tert-butyl ester group to 5.07 × 10-5 cm2/V s.
Vibronic dephasing model for coherent-to-incoherent crossover in DNA
Karasch, Patrick; Ryndyk, Dmitry A.; Frauenheim, Thomas
2018-05-01
In this paper, we investigate the interplay between coherent and incoherent charge transport in cytosine-guanine (GC-) rich DNA molecules. Our objective is to introduce a physically grounded approach to dephasing in large molecules and to understand the length-dependent charge transport characteristics, and especially the crossover from the coherent tunneling to incoherent hopping regime at different temperatures. Therefore, we apply the vibronic dephasing model and compare the results to the Büttiker probe model which is commonly used to describe decoherence effects in charge transport. Using the full ladder model and simplified one-dimensional model of DNA, we consider molecular junctions with alternating and stacked GC sequences and compare our results to recent experimental measurements.
Charge loss experiments in surface channel CCD's explained by the McWhorter interface states model
Penning De Vries, R.G.M.; Wallinga, Hans
1985-01-01
On the basis of the McWhorter interface states model the CCD charge loss is derived as a function of bias charge, signal charge and channel width. As opposed to existing models, the charge loss is now attributed to interface states in the entire gate area, even for high bias charge levels.
Electrostrictive deformations in small carbon clusters, hydrocarbon molecules, and carbon nanotubes
International Nuclear Information System (INIS)
Cabria, I.; Lopez, M. J.; Alonso, J. A.; Amovilli, C.; March, N. H.
2006-01-01
The electrostrictive response of small carbon clusters, hydrocarbon molecules, and carbon nanotubes is investigated using the density functional theory. For ringlike carbon clusters, one can get insight on the deformations induced by an electric field from a simple two-dimensional model in which the positive charge of the carbon ions is smeared out in a circular homogeneous line of charge and the electronic density is calculated for a constant applied electric field within a two-dimensional Thomas-Fermi method. According to the Hellmann-Feynman theorem, this model predicts, for fields of about 1 V/A ring , only a small elongation of the ring clusters in the direction of the electric field. Full three-dimensional density functional calculations with an external electric field show similar small deformations in the ring carbon clusters compared to the simple model. The saturated benzene and phenanthrene hydrocarbon molecules do not experience any deformation, even under the action of relatively intense (1 V/A ring ) electric fields. In contrast, finite carbon nanotubes experience larger elongations (∼2.9%) induced by relatively weak (0.1 V/A ring ) applied electric fields. Both C-C bond length elongation and the deformation of the honeycomb structure contribute equally to the nanotube elongation. The effect of the electric field in hydrogen terminated nanotubes is reduced with respect to the nanotubes with dangling bonds in the edges
Ring current models for acetylene and ethylene molecules
International Nuclear Information System (INIS)
Pelloni, Stefano; Lazzeretti, Paolo
2009-01-01
Spatial models of the current density vector field, induced in the electronic cloud of the acetylene and ethylene molecules by a uniform, time-independent magnetic field, are discussed in terms of topological stagnation graphs and three-dimensional streamline plots. The models are validated by documenting their ability to explain magnetic susceptibility and nuclear magnetic shieldings of carbon and hydrogen via related shielding density maps
Poltorak, L.; Sudholter, E.J.R.; de Smet, L.C.P.M.
2017-01-01
The electrochemical behavior of three differently charged drug molecules (zwitter-ionic acetylcarnitine, bi-cationic succinylcholine and tri-cationic gallamine) was studied at the interface between two immiscible electrolyte solutions. Tetramethylammonium was used as a model mono cationic
Two-Dimensional Charge Transport in Disordered Organic Semiconductors
Brondijk, J. J.; Roelofs, W. S. C.; Mathijssen, S. G. J.; Shehu, A.; Cramer, T.; Biscarini, F.; Blom, P. W. M.; de Leeuw, D. M.
2012-01-01
We analyze the effect of carrier confinement on the charge-transport properties of organic field-effect transistors. Confinement is achieved experimentally by the use of semiconductors of which the active layer is only one molecule thick. The two-dimensional confinement of charge carriers provides
An improved limit on the charge of antihydrogen from stochastic acceleration
Ahmadi, M; Bertsche, W; Butler, E; Capra, A; Carruth, C; Cesar, C L; Charlton, M; Charman, A E; Eriksson, S; Evans, L T; Evetts, N; Fajans, J; Friesen, T; Fujiwara, M C; Gill, D R; Gutierrez, A; Hangst, J S; Hardy, W N; Hayden, M E; Isaac, C A; Ishida, A; Jones, S A; Jonsell, S; Kurchaninov, L; Madsen, N; Maxwell, D; McKenna, J T K; Menary, S; Michan, J M; Momose, T; Munich, J J; Nolan, P; Olchanski, K; Olin, A; Povilus, A; Pusa, P; Rasmussen, C Ø; Robicheaux, F; Sacramento, R L; Sameed, M; Sarid, E; Silveira, D M; So, C; Tharp, T D; Thompson, R I; van der Werf, D P; Wurtele, J S; Zhmoginov, A I
2016-01-01
Antimatter continues to intrigue physicists because of its apparent absence in the observable Universe. Current theory requires that matter and antimatter appeared in equal quantities after the Big Bang, but the Standard Model of particle physics offers no quantitative explanation for the apparent disappearance of half the Universe. It has recently become possible to study trapped atoms of antihydrogen to search for possible, as yet unobserved, differences in the physical behaviour of matter and antimatter. Here we consider the charge neutrality of the antihydrogen atom. By applying stochastic acceleration to trapped antihydrogen atoms, we determine an experimental bound on the antihydrogen charge, Qe, of |Q| < 0.71 parts per billion (one standard deviation), in which e is the elementary charge. This bound is a factor of 20 less than that determined from the best previous measurement of the antihydrogen charge. The electrical charge of atoms and molecules of normal matter is known to be no greater than...
Single-molecule dynamics in nanofabricated traps
Cohen, Adam
2009-03-01
The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.
Modeling the Electric Potential and Surface Charge Density near Charged Thunderclouds
Neel, Matthew Stephen
2018-01-01
Thundercloud charge separation, or the process by which the bottom portion of a cloud gathers charge and the top portion of the cloud gathers the opposite charge, is still not thoroughly understood. Whatever the mechanism, though, a charge separation definitely exists and can lead to electrostatic discharge via cloud-to-cloud lightning and…
Business Models for Solar Powered Charging Stations to Develop Infrastructure for Electric Vehicles
Directory of Open Access Journals (Sweden)
Jessica Robinson
2014-10-01
Full Text Available Electric power must become less dependent on fossil fuels and transportation must become more electric to decrease carbon emissions and mitigate climate change. Increasing availability and accessibility of charging stations is predicted to increase purchases of electric vehicles. In order to address the current inadequate charging infrastructure for electric vehicles, major entities must adopt business models for solar powered charging stations (SPCS. These SPCS should be located in parking lots to produce electricity for the grid and provide an integrated infrastructure for charging electric vehicles. Due to the lack of information related to SPCS business models, this manuscript designs several models for major entities including industry, the federal and state government, utilities, universities, and public parking. A literature review of the available relevant business models and case studies of constructed charging stations was completed to support the proposals. In addition, a survey of a university’s students, staff, and faculty was conducted to provide consumer research on people’s opinion of SPCS construction and preference of business model aspects. Results showed that 69% of respondents would be more willing to invest in an electric vehicle if there was sufficient charging station infrastructure at the university. Among many recommendations, the business models suggest installing level 1 charging for the majority of entities, and to match entities’ current pricing structures for station use. The manuscript discusses the impacts of fossil fuel use, and the benefits of electric car and SPCS use, accommodates for the present gap in available literature on SPCS business models, and provides current consumer data for SPCS and the models proposed.
Symmetrization of mathematical model of charge transport in semiconductors
Directory of Open Access Journals (Sweden)
Alexander M. Blokhin
2002-11-01
Full Text Available A mathematical model of charge transport in semiconductors is considered. The model is a quasilinear system of differential equations. A problem of finding an additional entropy conservation law and system symmetrization are solved.
Nuclear Fusion Rate Study of a Muonic Molecule via Nuclear Threshold Resonances
Faghihi, F.; Eskandari, M. R.
This work follows our previous calculations of the ground state binding energy, size, and the effective nuclear charge of the muonic T3 molecule, using the Born-Oppenheimer adiabatic approximation. In our past articles, we showed that the system possesses two minimum positions, the first one at the muonic distance and the second at the atomic distance. Also, the symmetric planner vibrational model assumed between the two minima and the approximated potential were calculated. Following from the previous studies, we now calculate the fusion rate of the T3 muonic molecule according to the overlap integral of the resonance nuclear compound nucleus and the molecular wave functions.
Charge transport in single photochromic molecular junctions
Kim, Youngsang; Pietsch, T.; Scheer, Elke; Hellmuth, T.; Pauly, F.; Sysoiev, D.; Huhn, T.; Exner, T.; Groth, U.; Steiner, U.; Erbe, A.
2012-02-01
Recently, photoswitchable molecules, i.e. diarylethene, gained significant interest due to their applicability in data storage media, as optical switches, and in novel logic circuits [1]. Diarylethene-derivative molecules are the most promising candidates to design electronic functional elements, because of their excellent thermal stability, high fatigue resistance, and negligible change upon switching [1]. Here, we present the preferential conductance of specifically designed sulfur-free diarylethene molecules [2] bridging the mechanically controlled break-junctions at low temperatures [3]. The molecular energy levels and electrode couplings are obtained by evaluating the current-voltage characteristics using the single-level model [4]. The charge transport mechanism of different types of diarylethene molecules is investigated, and the results are discussed within the framework of novel theoretical predictions. [4pt] [1] M. Del Valle etal., Nat Nanotechnol 2, 176 (2007) S. J. van der Molen etal., Nano. Lett. 9, 76 (2009).[0pt] [2] D. Sysoiev etal., Chem. Eur. J. 17, 6663 (2011).[0pt] [3] Y. Kim etal., Phys. Rev. Lett. 106, 196804 (2011).[0pt] [4] Y. Kim etal., Nano Lett. 11, 3734 (2011). L. Zotti etal., Small 6, 1529 (2010).
Atomic charges of sulfur in ionic liquids: experiments and calculations.
Fogarty, Richard M; Rowe, Rebecca; Matthews, Richard P; Clough, Matthew T; Ashworth, Claire R; Brandt, Agnieszka; Corbett, Paul J; Palgrave, Robert G; Smith, Emily F; Bourne, Richard A; Chamberlain, Thomas W; Thompson, Paul B J; Hunt, Patricia A; Lovelock, Kevin R J
2017-12-14
Experimental near edge X-ray absorption fine structure (NEXAFS) spectra, X-ray photoelectron (XP) spectra and Auger electron spectra are reported for sulfur in ionic liquids (ILs) with a range of chemical structures. These values provide experimental measures of the atomic charge in each IL and enable the evaluation of the suitability of NEXAFS spectroscopy and XPS for probing the relative atomic charge of sulfur. In addition, we use Auger electron spectroscopy to show that when XPS binding energies differ by less than 0.5 eV, conclusions on atomic charge should be treated with caution. Our experimental data provides a benchmark for calculations of the atomic charge of sulfur obtained using different methods. Atomic charges were computed for lone ions and ion pairs, both in the gas phase (GP) and in a solvation model (SMD), with a wide range of ion pair conformers considered. Three methods were used to compute the atomic charges: charges from the electrostatic potential using a grid based method (ChelpG), natural bond orbital (NBO) population analysis and Bader's atoms in molecules (AIM) approach. By comparing the experimental and calculated measures of the atomic charge of sulfur, we provide an order for the sulfur atoms, ranging from the most negative to the most positive atomic charge. Furthermore, we show that both ChelpG and NBO are reasonable methods for calculating the atomic charge of sulfur in ILs, based on the agreement with both the XPS and NEXAFS spectroscopy results. However, the atomic charges of sulfur derived from ChelpG are found to display significant, non-physical conformational dependence. Only small differences in individual atomic charge of sulfur were observed between lone ion (GP) and ion pair IL(SMD) model systems, indicating that ion-ion interactions do not strongly influence individual atomic charges.
Charge distributions and correlations in fragmentation models for soft hadron collisions
International Nuclear Information System (INIS)
Wolf, E.A. de
1984-01-01
Data on charge distributions and charge correlations in pp and meson-proton interactions at PS and SPS energies are successfully compared with the Lund fragmentation model for low-psub(T) hadron collisions. It is argued that local conservation of quantum numbers and resonance production, as implemented in fragmentation models, are sufficient ingredients to explain most of the available experimental results at these energies. No necessity is found for dual-sheet contributions considered in DTU-based parton models. (orig.)
Formation and fragmentation of quadruply charged molecular ions by intense femtosecond laser pulses.
Yatsuhashi, Tomoyuki; Nakashima, Nobuaki
2010-07-22
We investigated the formation and fragmentation of multiply charged molecular ions of several aromatic molecules by intense nonresonant femtosecond laser pulses of 1.4 mum with a 130 fs pulse duration (up to 2 x 10(14) W cm(-2)). Quadruply charged states were produced for 2,3-benzofluorene and triphenylene molecular ion in large abundance, whereas naphthalene and 1,1'-binaphthyl resulted only in up to triply charged molecular ions. The laser wavelength was nonresonant with regard to the electronic transitions of the neutral molecules, and the degree of fragmentation was strongly correlated with the absorption of the singly charged cation radical. Little fragmentation was observed for naphthalene (off-resonant with cation), whereas heavy fragmentation was observed in the case of 1,1'-binaphthyl (resonant with cation). The degree of H(2) (2H) and 2H(2) (4H) elimination from molecular ions increased as the charge states increased in all the molecules examined. A striking difference was found between triply and quadruply charged 2,3-benzofluorene: significant suppression of molecular ions with loss of odd number of hydrogen was observed in the quadruply charged ions. The Coulomb explosion of protons in the quadruply charged state and succeeding fragmentation resulted in the formation of triply charged molecular ions with an odd number of hydrogens. The hydrogen elimination mechanism in the highly charged state is discussed.
A charge-based model of Junction Barrier Schottky rectifiers
Latorre-Rey, Alvaro D.; Mudholkar, Mihir; Quddus, Mohammed T.; Salih, Ali
2018-06-01
A new charge-based model of the electric field distribution for Junction Barrier Schottky (JBS) diodes is presented, based on the description of the charge-sharing effect between the vertical Schottky junction and the lateral pn-junctions that constitute the active cell of the device. In our model, the inherently 2-D problem is transformed into a simple but accurate 1-D problem which has a closed analytical solution that captures the reshaping and reduction of the electric field profile responsible for the improved electrical performance of these devices, while preserving physically meaningful expressions that depend on relevant device parameters. The validation of the model is performed by comparing calculated electric field profiles with drift-diffusion simulations of a JBS device showing good agreement. Even though other fully 2-D models already available provide higher accuracy, they lack physical insight making the proposed model an useful tool for device design.
Charge state evolution in the solar wind. III. Model comparison with observations
Energy Technology Data Exchange (ETDEWEB)
Landi, E.; Oran, R.; Lepri, S. T.; Zurbuchen, T. H.; Fisk, L. A.; Van der Holst, B. [Department of Atmospheric, Oceanic and Space Sciences, University of Michigan, Ann Arbor, MI 48109 (United States)
2014-08-01
We test three theoretical models of the fast solar wind with a set of remote sensing observations and in-situ measurements taken during the minimum of solar cycle 23. First, the model electron density and temperature are compared to SOHO/SUMER spectroscopic measurements. Second, the model electron density, temperature, and wind speed are used to predict the charge state evolution of the wind plasma from the source regions to the freeze-in point. Frozen-in charge states are compared with Ulysses/SWICS measurements at 1 AU, while charge states close to the Sun are combined with the CHIANTI spectral code to calculate the intensities of selected spectral lines, to be compared with SOHO/SUMER observations in the north polar coronal hole. We find that none of the theoretical models are able to completely reproduce all observations; namely, all of them underestimate the charge state distribution of the solar wind everywhere, although the levels of disagreement vary from model to model. We discuss possible causes of the disagreement, namely, uncertainties in the calculation of the charge state evolution and of line intensities, in the atomic data, and in the assumptions on the wind plasma conditions. Last, we discuss the scenario where the wind is accelerated from a region located in the solar corona rather than in the chromosphere as assumed in the three theoretical models, and find that a wind originating from the corona is in much closer agreement with observations.
Charge state evolution in the solar wind. III. Model comparison with observations
International Nuclear Information System (INIS)
Landi, E.; Oran, R.; Lepri, S. T.; Zurbuchen, T. H.; Fisk, L. A.; Van der Holst, B.
2014-01-01
We test three theoretical models of the fast solar wind with a set of remote sensing observations and in-situ measurements taken during the minimum of solar cycle 23. First, the model electron density and temperature are compared to SOHO/SUMER spectroscopic measurements. Second, the model electron density, temperature, and wind speed are used to predict the charge state evolution of the wind plasma from the source regions to the freeze-in point. Frozen-in charge states are compared with Ulysses/SWICS measurements at 1 AU, while charge states close to the Sun are combined with the CHIANTI spectral code to calculate the intensities of selected spectral lines, to be compared with SOHO/SUMER observations in the north polar coronal hole. We find that none of the theoretical models are able to completely reproduce all observations; namely, all of them underestimate the charge state distribution of the solar wind everywhere, although the levels of disagreement vary from model to model. We discuss possible causes of the disagreement, namely, uncertainties in the calculation of the charge state evolution and of line intensities, in the atomic data, and in the assumptions on the wind plasma conditions. Last, we discuss the scenario where the wind is accelerated from a region located in the solar corona rather than in the chromosphere as assumed in the three theoretical models, and find that a wind originating from the corona is in much closer agreement with observations.
Rudberg, Elias
2012-02-01
Self-consistency-based Kohn-Sham density functional theory (KS-DFT) electronic structure calculations with Gaussian basis sets are reported for a set of 17 protein-like molecules with geometries obtained from the Protein Data Bank. It is found that in many cases such calculations do not converge due to vanishing HOMO-LUMO gaps. A sequence of polyproline I helix molecules is also studied and it is found that self-consistency calculations using pure functionals fail to converge for helices longer than six proline units. Since the computed gap is strongly correlated to the fraction of Hartree-Fock exchange, test calculations using both pure and hybrid density functionals are reported. The tested methods include the pure functionals BLYP, PBE and LDA, as well as Hartree-Fock and the hybrid functionals BHandHLYP, B3LYP and PBE0. The effect of including solvent molecules in the calculations is studied, and it is found that the inclusion of explicit solvent molecules around the protein fragment in many cases gives a larger gap, but that convergence problems due to vanishing gaps still occur in calculations with pure functionals. In order to achieve converged results, some modeling of the charge distribution of solvent water molecules outside the electronic structure calculation is needed. Representing solvent water molecules by a simple point charge distribution is found to give non-vanishing HOMO-LUMO gaps for the tested protein-like systems also for pure functionals.
International Nuclear Information System (INIS)
Rudberg, Elias
2012-01-01
Self-consistency-based Kohn-Sham density functional theory (KS-DFT) electronic structure calculations with Gaussian basis sets are reported for a set of 17 protein-like molecules with geometries obtained from the Protein Data Bank. It is found that in many cases such calculations do not converge due to vanishing HOMO-LUMO gaps. A sequence of polyproline I helix molecules is also studied and it is found that self-consistency calculations using pure functionals fail to converge for helices longer than six proline units. Since the computed gap is strongly correlated to the fraction of Hartree-Fock exchange, test calculations using both pure and hybrid density functionals are reported. The tested methods include the pure functionals BLYP, PBE and LDA, as well as Hartree-Fock and the hybrid functionals BHandHLYP, B3LYP and PBE0. The effect of including solvent molecules in the calculations is studied, and it is found that the inclusion of explicit solvent molecules around the protein fragment in many cases gives a larger gap, but that convergence problems due to vanishing gaps still occur in calculations with pure functionals. In order to achieve converged results, some modeling of the charge distribution of solvent water molecules outside the electronic structure calculation is needed. Representing solvent water molecules by a simple point charge distribution is found to give non-vanishing HOMO-LUMO gaps for the tested protein-like systems also for pure functionals. (fast track communication)
McClarty, P. A.; O'Brien, A.; Pollmann, F.
2014-05-01
We consider a classical model of charges ±q on a pyrochlore lattice in the presence of long-range Coulomb interactions. This model first appeared in the early literature on charge order in magnetite [P. W. Anderson, Phys. Rev. 102, 1008 (1956), 10.1103/PhysRev.102.1008]. In the limit where the interactions become short ranged, the model has a ground state with an extensive entropy and dipolar charge-charge correlations. When long-range interactions are introduced, the exact degeneracy is broken. We study the thermodynamics of the model and show the presence of a correlated charge liquid within a temperature window in which the physics is well described as a liquid of screened charged defects. The structure factor in this phase, which has smeared pinch points at the reciprocal lattice points, may be used to detect charge ice experimentally. In addition, the model exhibits fractionally charged excitations ±q/2 which are shown to interact via a 1/r potential. At lower temperatures, the model exhibits a transition to a long-range ordered phase. We are able to treat the Coulombic charge ice model and the dipolar spin ice model on an equal footing by mapping both to a constrained charge model on the diamond lattice. We find that states of the two ice models are related by a staggering field which is reflected in the energetics of these two models. From this perspective, we can understand the origin of the spin ice and charge ice ground states as coming from a dipolar model on a diamond lattice. We study the properties of charge ice in an external electric field, finding that the correlated liquid is robust to the presence of a field in contrast to the case of spin ice in a magnetic field. Finally, we comment on the transport properties of Coulombic charge ice in the correlated liquid phase.
Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere
Desai, R. T.; Coates, A. J.; Wellbrock, A.; Vuitton, V.; Crary, F. J.; González-Caniulef, D.; Shebanits, O.; Jones, G. H.; Lewis, G. R.; Waite, J. H.; Cordiner, M.; Taylor, S. A.; Kataria, D. O.; Wahlund, J.-E.; Edberg, N. J. T.; Sittler, E. C.
2017-08-01
Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q-1. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950-1300 km. We report on detections consistently centered between 25.8 and 26.0 u q-1 and between 49.0-50.1 u q-1 which are identified as belonging to the carbon chain anions, CN-/C3N- and/or C2H-/C4H-, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73-74 u q-1 could be attributed to the further carbon chain anions C5N-/C6H- but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.
Pouran, Behdad; Arbabi, Vahid; Zadpoor, Amir A; Weinans, Harrie
2016-12-01
The metabolic function of cartilage primarily depends on transport of solutes through diffusion mechanism. In the current study, we use contrast enhanced micro-computed tomography to determine equilibrium concentration of solutes through different cartilage zones and solute flux in the cartilage, using osteochondral plugs from equine femoral condyles. Diffusion experiments were performed with two solutes of different charge and approximately equal molecular weight, namely iodixanol (neutral) and ioxaglate (charge=-1) in order to isolate the effects of solute's charge on diffusion. Furthermore, solute concentrations as well as bath osmolality were changed to isolate the effects of steric hindrance on diffusion. Bath concentration and bath osmolality only had minor effects on the diffusion of the neutral solute through cartilage at the surface, middle and deep zones, indicating that the diffusion of the neutral solute was mainly Fickian. The negatively charged solute diffused considerably slower through cartilage than the neutral solute, indicating a large non-Fickian contribution in the diffusion of charged molecules. The numerical models determined maximum solute flux in the superficial zone up to a factor of 2.5 lower for the negatively charged solutes (charge=-1) as compared to the neutral solutes confirming the importance of charge-matrix interaction in diffusion of molecules across cartilage. Copyright © 2016 IPEM. Published by Elsevier Ltd. All rights reserved.
AARHUS: Exotic charge states in ASTRID
International Nuclear Information System (INIS)
Moller, Soren Pape
1995-01-01
Ions are atoms from which one or more orbital electrons have been detached. This removal can be done, for example, by impact of other electrons. Today beams of bare ions - nuclei without any electrons - are available, for example at the GSI heavy ion Laboratory, Darmstadt, even for the heaviest elements. Molecules too can be ionized by removal of one electron and these molecules can be accelerated to form high energy beams. Molecules are, however, generally not expected to be stable when more than one electron is missing, since there is too little negative charge to bind the positive nuclei. It was therefore a surprise when a stable doubly-charged molecular ion was found at experiments at the ASTRID storage ring, Aarhus, Denmark. The aim of the experiment was to measure lifetimes of expected metastable states of doubly-charged carbon monoxide, CO ++ . The CO ++ ions were produced in an ion source and the accelerated beam injected into the storage ring. The circulating intensity was then monitored by detecting neutral species produced in restgas collisions at the end of a straight section. For CO ++ , a fraction of the beam survived for tens of seconds, with a lifetime around 4 seconds. This lifetime was dominated by restgas collisions. The base pressure was around 2 x 10 -11 mbar. In order to avoid contamination from molecules with the same mass/charge ratio, e.g. singly-charged nitrogen-14, the carbon monoxide used was based on the naturally rare isotope carbon-13 rather than the abundant carbon-12. Many atoms can also bind an additional electron and form negative ions. Several negative ions are metastable, and lifetime measurements performed at ASTRID and elsewhere produce accurate results important for comparisons with theory. Double-charged negative ions could in principle exist, and indications of metastable states of H - and O - were seen some years ago as resonances in the electron bombardment of negative hydrogen ions. This process was recently studied at
AARHUS: Exotic charge states in ASTRID
Energy Technology Data Exchange (ETDEWEB)
Moller, Soren Pape
1995-04-15
Ions are atoms from which one or more orbital electrons have been detached. This removal can be done, for example, by impact of other electrons. Today beams of bare ions - nuclei without any electrons - are available, for example at the GSI heavy ion Laboratory, Darmstadt, even for the heaviest elements. Molecules too can be ionized by removal of one electron and these molecules can be accelerated to form high energy beams. Molecules are, however, generally not expected to be stable when more than one electron is missing, since there is too little negative charge to bind the positive nuclei. It was therefore a surprise when a stable doubly-charged molecular ion was found at experiments at the ASTRID storage ring, Aarhus, Denmark. The aim of the experiment was to measure lifetimes of expected metastable states of doubly-charged carbon monoxide, CO{sup ++}. The CO{sup ++} ions were produced in an ion source and the accelerated beam injected into the storage ring. The circulating intensity was then monitored by detecting neutral species produced in restgas collisions at the end of a straight section. For CO{sup ++}, a fraction of the beam survived for tens of seconds, with a lifetime around 4 seconds. This lifetime was dominated by restgas collisions. The base pressure was around 2 x 10{sup -11} mbar. In order to avoid contamination from molecules with the same mass/charge ratio, e.g. singly-charged nitrogen-14, the carbon monoxide used was based on the naturally rare isotope carbon-13 rather than the abundant carbon-12. Many atoms can also bind an additional electron and form negative ions. Several negative ions are metastable, and lifetime measurements performed at ASTRID and elsewhere produce accurate results important for comparisons with theory. Double-charged negative ions could in principle exist, and indications of metastable states of H{sup -} and O{sup -} were seen some years ago as resonances in the electron bombardment of negative hydrogen ions. This
Supercooled liquid dynamics for the charged hard-sphere model
International Nuclear Information System (INIS)
Lai, S.K.; Chang, S.Y.
1994-08-01
We study the dynamics of supercooled liquid and the liquid-glass transition by applying the mode coupling theory to the charged hard-sphere model. By exploiting the two independent parameters inherent in the charged hard-sphere system we examine structurally the subtle and competitive role played by the short-range hard-core correlation and the long-range Coulomb tail. It is found in this work that the long-range Coulombic charge factor effect is generally a less effective contribution to structure when the plasma parameter is less than 500 and becomes dominant when it is greater thereof. To extend our understanding of the supercooled liquid and the liquid-glass transition, an attempt is made to calculate and to give physical relevance to the mode-coupling parameters which are frequently used as mere fitting parameters in analysis of experiments on supercooled liquid systems. This latter information enables us to discuss the possible application of the model to a realistic system. (author). 22 refs, 4 figs
Fermi level alignment in molecular nanojunctions and its relation to charge transfer
DEFF Research Database (Denmark)
Stadler, Robert; Jacobsen, Karsten Wedel
2006-01-01
The alignment of the Fermi level of a metal electrode within the gap of the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) of a molecule is a key quantity in molecular electronics, which can vary the electron transparency of a single-molecule junction...... by orders of magnitude. We present a quantitative analysis of the relation between this level alignment (which can be estimated from charging free molecules) and charge transfer for bipyridine and biphenyl dithiolate (BPDT) molecules attached to gold leads based on density functional theory calculations...... end of the gap in the transmission function for bipyridine and at its lower end for BPDT....
Interchain interactions in charged diacetylenic oligomers carrying bulk substituents revisited
International Nuclear Information System (INIS)
Ottonelli, M.; Izzo, G.M.M.; Comoretto, D.; Musso, G.F.; Dellepiane, G.
2006-01-01
We are studying how the electronic properties of an aggregate, built with conjugated oligomers carrying bulk substituents, are affected by intermolecular interactions. In this paper we apply the CEO (Collective Electronic Oscillator) method, on the basis of the semiempirical INDO/S Hamiltonian, to compute the electronic density matrix modifications following the photon absorption in a doubly charged cluster of two units of a fully carbazolyl-substituted oligodiacetylene tetramer, taken as a model system. The picture that had emerged from our previous calculations based on the less sophisticated CIS (Configuration Interaction including Singles) approach is seen to be confirmed. Despite the large separation between the backbones, a through-space charge transfer occurs between the two oligomers due to the fact that the excess charge, contrary to what is generally believed, is not localized on the conjugated backbone, but is spread out over the carbazolyl moieties of the charged molecule. Consideration of this kind of interaction improves the theoretical results obtained for the isolated charged oligomer chain, and aids in better explaining some features of the experimental photoinduced spectra of the corresponding polymer
Single molecule transistor based nanopore for the detection of nicotine
Energy Technology Data Exchange (ETDEWEB)
Ray, S. J., E-mail: ray.sjr@gmail.com [Institute of Materials Science, Technical University of Darmstadt, Alarich-Weiss-Str. 2, 64287 Darmstadt (Germany)
2014-12-28
A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realised from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.
Single molecule transistor based nanopore for the detection of nicotine
Ray, S. J.
2014-12-01
A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realised from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.
Inner-shell excitation and ionic fragmentation of molecules
International Nuclear Information System (INIS)
Hitchcock, A.P.; Tyliszczak, T.; Cavell, R.G.
1997-01-01
Inner-shell excitation and associated decay spectroscopies are site specific probes of electronic and geometrical structure and photoionization dynamics. X-ray absorption probes the geometric and electronic structure, while time-of-flight mass spectrometry with multi-coincidence detection provides information on the photofragmentation dynamics of the initially produced inner-shell state. Auger decay of inner-shell excited and ionised states is an efficient source of multiply charged ions. The charge separation and fragmentation of these species, studied by photoelectron-photoion-photoion coincidence (also called charge separation mass spectrometry) gives insights into bonding and electronic structure. In molecules, the dependence of the fragmentation process on the X-ray energy can reveal cases of site and/or state selective fragmentation. At the ALS the authors have examined the soft X-ray spectroscopy and ionic fragmentation of a number of molecules, including carboranes, silylenes, phosphorus halides, SF 6 and CO 2 . Their work is illustrated using results from the carborane and PF 3 studies
Inner-shell excitation and ionic fragmentation of molecules
Energy Technology Data Exchange (ETDEWEB)
Hitchcock, A.P.; Tyliszczak, T. [McMaster Univ., Hamilton, Ontario (Canada); Cavell, R.G. [Univ. of Alberta, Edmonton (Canada)] [and others
1997-04-01
Inner-shell excitation and associated decay spectroscopies are site specific probes of electronic and geometrical structure and photoionization dynamics. X-ray absorption probes the geometric and electronic structure, while time-of-flight mass spectrometry with multi-coincidence detection provides information on the photofragmentation dynamics of the initially produced inner-shell state. Auger decay of inner-shell excited and ionised states is an efficient source of multiply charged ions. The charge separation and fragmentation of these species, studied by photoelectron-photoion-photoion coincidence (also called charge separation mass spectrometry) gives insights into bonding and electronic structure. In molecules, the dependence of the fragmentation process on the X-ray energy can reveal cases of site and/or state selective fragmentation. At the ALS the authors have examined the soft X-ray spectroscopy and ionic fragmentation of a number of molecules, including carboranes, silylenes, phosphorus halides, SF{sub 6} and CO{sub 2}. Their work is illustrated using results from the carborane and PF{sub 3} studies.
Energy Technology Data Exchange (ETDEWEB)
Sheppard, Colin; Waraich, Rashid; Campbell, Andrew; Pozdnukov, Alexei; Gopal, Anand R.
2017-05-01
This report summarizes the BEAM modeling framework (Behavior, Energy, Mobility, and Autonomy) and its application to simulating plug-in electric vehicle (PEV) mobility, energy consumption, and spatiotemporal charging demand. BEAM is an agent-based model of PEV mobility and charging behavior designed as an extension to MATSim (the Multi-Agent Transportation Simulation model). We apply BEAM to the San Francisco Bay Area and conduct a preliminary calibration and validation of its prediction of charging load based on observed charging infrastructure utilization for the region in 2016. We then explore the impact of a variety of common modeling assumptions in the literature regarding charging infrastructure availability and driver behavior. We find that accurately reproducing observed charging patterns requires an explicit representation of spatially disaggregated charging infrastructure as well as a more nuanced model of the decision to charge that balances tradeoffs people make with regards to time, cost, convenience, and range anxiety.
Adsorption of different amphiphilic molecules onto polystyrene latices.
Jódar-Reyes, A B; Ortega-Vinuesa, J L; Martín-Rodríguez, A
2005-02-15
In order to know the influence of the surface characteristics and the chain properties on the adsorption of amphiphilic molecules onto polystyrene latex, a set of experiments to study the adsorption of ionic surfactants, nonionic surfactants and an amphiphilic synthetic peptide on different latex dispersions was performed. The adsorbed amount versus the equilibrium surfactant concentration was determined. The main adsorption mechanism was the hydrophobic attraction between the nonpolar tail of the molecule and the hydrophobic regions of the latex surface. This attraction overcame the electrostatic repulsion between chains and latex surface with identical charge sign. However, the electrostatic interactions chain-surface and chain-chain also played a role. General patterns for the adsorption of ionic chains on charged latex surfaces could be established. Regarding the shape, the isotherms presented different plateaus corresponding to electrostatic effects and conformational changes. The surfactant size also affects the adsorption results: the higher the hydrophilic moiety in the surfactant molecule the lower the adsorbed amount.
Takanashi, Tsukasa; Nakamura, Kosuke; Kukk, Edwin; Motomura, Koji; Fukuzawa, Hironobu; Nagaya, Kiyonobu; Wada, Shin-Ichi; Kumagai, Yoshiaki; Iablonskyi, Denys; Ito, Yuta; Sakakibara, Yuta; You, Daehyun; Nishiyama, Toshiyuki; Asa, Kazuki; Sato, Yuhiro; Umemoto, Takayuki; Kariyazono, Kango; Ochiai, Kohei; Kanno, Manabu; Yamazaki, Kaoru; Kooser, Kuno; Nicolas, Christophe; Miron, Catalin; Asavei, Theodor; Neagu, Liviu; Schöffler, Markus; Kastirke, Gregor; Liu, Xiao-Jing; Rudenko, Artem; Owada, Shigeki; Katayama, Tetsuo; Togashi, Tadashi; Tono, Kensuke; Yabashi, Makina; Kono, Hirohiko; Ueda, Kiyoshi
2017-08-02
Coulomb explosion of diiodomethane CH 2 I 2 molecules irradiated by ultrashort and intense X-ray pulses from SACLA, the Japanese X-ray free electron laser facility, was investigated by multi-ion coincidence measurements and self-consistent charge density-functional-based tight-binding (SCC-DFTB) simulations. The diiodomethane molecule, containing two heavy-atom X-ray absorbing sites, exhibits a rather different charge generation and nuclear motion dynamics compared to iodomethane CH 3 I with only a single heavy atom, as studied earlier. We focus on charge creation and distribution in CH 2 I 2 in comparison to CH 3 I. The release of kinetic energy into atomic ion fragments is also studied by comparing SCC-DFTB simulations with the experiment. Compared to earlier simulations, several key enhancements are made, such as the introduction of a bond axis recoil model, where vibrational energy generated during charge creation processes induces only bond stretching or shrinking. We also propose an analytical Coulomb energy partition model to extract the essential mechanism of Coulomb explosion of molecules from the computed and the experimentally measured kinetic energies of fragment atomic ions by partitioning each pair Coulomb interaction energy into two ions of the pair under the constraint of momentum conservation. Effective internuclear distances assigned to individual fragment ions at the critical moment of the Coulomb explosion are then estimated from the average kinetic energies of the ions. We demonstrate, with good agreement between the experiment and the SCC-DFTB simulation, how the more heavily charged iodine fragments and their interplay define the characteristic features of the Coulomb explosion of CH 2 I 2 . The present study also confirms earlier findings concerning the magnitude of bond elongation in the ultrashort X-ray pulse duration, showing that structural damage to all but C-H bonds does not develop to a noticeable degree in the pulse length of ∼10
Growing interstellar molecules with ion-molecule reactions
International Nuclear Information System (INIS)
Bohme, D.K.
1989-01-01
Laboratory measurements of gas-phase ion-molecule reactions continue to provide important insights into the chemistry of molecular growth in interstellar environments. It is also true that the measurements are becoming more demanding as larger molecules capture our interest. While some of these measurements are motivated by current developments in chemical models of interstellar environments or by new molecular observations by astronomers, others explore novel chemistry which can lead to predictions of new interstellar molecules. Here the author views the results of some recent measurements, taken in the Ion Chemistry Laboratory at York University with the SIFT technique, which address some of the current needs of modellers and observers and which also provide some new fundamental insight into molecular growth, particularly when it occurs in the presence of large molecules such as PAH molecules which are now thought to have a major influence on the chemistry of interstellar environments in which they are present
Oil Contact Angles in a Water-Decane-Silicon Dioxide System: Effects of Surface Charge.
Xu, Shijing; Wang, Jingyao; Wu, Jiazhong; Liu, Qingjie; Sun, Chengzhen; Bai, Bofeng
2018-04-19
Oil wettability in the water-oil-rock systems is very sensitive to the evolution of surface charges on the rock surfaces induced by the adsorption of ions and other chemical agents in water flooding. Through a set of large-scale molecular dynamics simulations, we reveal the effects of surface charge on the oil contact angles in an ideal water-decane-silicon dioxide system. The results show that the contact angles of oil nano-droplets have a great dependence on the surface charges. As the surface charge density exceeds a critical value of 0.992 e/nm 2 , the contact angle reaches up to 78.8° and the water-wet state is very apparent. The variation of contact angles can be confirmed from the number density distributions of oil molecules. With increasing the surface charge density, the adsorption of oil molecules weakens and the contact areas between nano-droplets and silicon dioxide surface are reduced. In addition, the number density distributions, RDF distributions, and molecular orientations indicate that the oil molecules are adsorbed on the silicon dioxide surface layer-by-layer with an orientation parallel to the surface. However, the layered structure of oil molecules near the silicon dioxide surface becomes more and more obscure at higher surface charge densities.
Effect of vibrational excitation on the dynamics of ion-molecule reactions
International Nuclear Information System (INIS)
Anderson, S.L.
1981-11-01
A new experimental technique for the study of vibrational effects on ion-molecule reaction cross sections is described. Vibrational and collision energy dependent cross sections are presented for proton and H atom transfer, charge transfer and collision induced dissociation reactions in various isotopic H 2 + + H 2 systems. Charge and proton transfer cross sections are presented for the reactions of H 2 + and D 2 + with Ar, N 2 , CO, and O 2 . All the reactions are shown to be highly influenced by avoided crossings between the ground and first excited potential energy surfaces. Because of the nature of the crossings, vibrational motion of the systems can cause both adiabatic and non-adiabatic behavior of the system. This makes the vibrational dependences of the various cross sections a very sensitive probe of the dynamics of the collisions particularly, their behavior in the region of the crossings. Evidence is seen for charge transfer between reagents as they approach each other, transition to and in some cases reactions on excited potential energy surfaces, competition between different channels, and strong coupling of proton and charge transfer channels which occurs only for two of the systems studied (H 2 + + Ar, N 2 ). Oscillatory structure is observed in the collision energy dependence of the endoergic H 2 + (v = 0) + Ar charge transfer reaction for the first time, and a simple model which is commonly used for atom-atom charge transfer is used to fit the peaks. Finally a simple model is used to assess the importance of energy resonance and Franck-Condon effects on molecular charge transfer
Charged black holes in a generalized scalar–tensor gravity model
Directory of Open Access Journals (Sweden)
Yves Brihaye
2017-09-01
Full Text Available We study 4-dimensional charged and static black holes in a generalized scalar–tensor gravity model, in which a shift symmetry for the scalar field exists. For vanishing scalar field the solution corresponds to the Reissner–Nordström (RN solution, while solutions of the full scalar-gravity model have to be constructed numerically. We demonstrate that these black holes support Galilean scalar hair up to a maximal value of the scalar–tensor coupling that depends on the value of the charge and can be up to roughly twice as large as that for uncharged solutions. The Hawking temperature TH of the hairy black holes at maximal scalar–tensor coupling decreases continuously with the increase of the charge and reaches TH=0 for the highest possible charge that these solutions can carry. However, in this limit, the scalar–tensor coupling needs to vanish. The limiting solution hence corresponds to the extremal RN solution, which does not support regular Galilean scalar hair due to its AdS2×S2 near-horizon geometry.
Charging and coagulation of radioactive and nonradioactive particles in the atmosphere
International Nuclear Information System (INIS)
Kim, Yong-ha; Yiacoumi, Sotira
2016-01-01
Charging and coagulation influence one another and impact the particle charge and size distributions in the atmosphere. However, few investigations to date have focused on the coagulation kinetics of atmospheric particles accumulating charge. This study presents three approaches to include mutual effects of charging and coagulation on the microphysical evolution of atmospheric particles such as radioactive particles. The first approach employs ion balance, charge balance, and a bivariate population balance model (PBM) to comprehensively calculate both charge accumulation and coagulation rates of particles. The second approach involves a much simpler description of charging, and uses a monovariate PBM and subsequent effects of charge on particle coagulation. The third approach is further simplified assuming that particles instantaneously reach their steady-state charge distributions. It is found that compared to the other two approaches, the first approach can accurately predict time-dependent changes in the size and charge distributions of particles over a wide size range covering from the free molecule to continuum regimes. The other two approaches can reliably predict both charge accumulation and coagulation rates for particles larger than about 0.04 micrometers and atmospherically relevant conditions. These approaches are applied to investigate coagulation kinetics of particles accumulating charge in a radioactive neutralizer, the urban atmosphere, and an atmospheric system containing radioactive particles. Limitations of the approaches are discussed.
Martelli, Fausto; Vuilleumier, Rodolphe; Simonin, Jean-Pierre; Spezia, Riccardo
2012-10-01
In this work, we show how increasing the charge of small cations affects the structural, thermodynamical, and dynamical properties of these ions in liquid water. We have studied the case of lanthanoid and actinoid ions, for which we have recently developed accurate polarizable force fields, and the ionic radius is in the 0.995-1.250 Å range, and explored the valency range from 0 to 4+. We found that the ion charge strongly structures the neighboring water molecules and that, in this range of charges, the hydration enthalpies exhibit a quadratic dependence with respect to the charge, in line with the Born model. The diffusion process follows two main regimes: a hydrodynamical regime for neutral or low charges, and a dielectric friction regime for high charges in which the contraction of the ionic radius along the series of elements causes a decrease of the diffusion coefficient. This latter behavior can be qualitatively described by theoretical models, such as the Zwanzig and the solvated ion models. However, these models need be modified in order to obtain agreement with the observed behavior in the full charge range. We have thus modified the solvated ion model by introducing a dependence of the bare ion radius as a function of the ionic charge. Besides agreement between theory and simulation this modification allows one to obtain an empirical unified model. Thus, by analyzing the contributions to the drag coefficient from the viscous and the dielectric terms, we are able to explain the transition from a regime in which the effect of viscosity dominates to one in which dielectric friction governs the motion of ions with radii of ca. 1 Å.
Single-Molecule Photocurrent at a Metal-Molecule-Semiconductor Junction.
Vezzoli, Andrea; Brooke, Richard J; Higgins, Simon J; Schwarzacher, Walther; Nichols, Richard J
2017-11-08
We demonstrate here a new concept for a metal-molecule-semiconductor nanodevice employing Au and GaAs contacts that acts as a photodiode. Current-voltage traces for such junctions are recorded using a STM, and the "blinking" or "I(t)" method is used to record electrical behavior at the single-molecule level in the dark and under illumination, with both low and highly doped GaAs samples and with two different types of molecular bridge: nonconjugated pentanedithiol and the more conjugated 1,4-phenylene(dimethanethiol). Junctions with highly doped GaAs show poor rectification in the dark and a low photocurrent, while junctions with low doped GaAs show particularly high rectification ratios in the dark (>10 3 for a 1.5 V bias potential) and a high photocurrent in reverse bias. In low doped GaAs, the greater thickness of the depletion layer not only reduces the reverse bias leakage current, but also increases the volume that contributes to the photocurrent, an effect amplified by the point contact geometry of the junction. Furthermore, since photogenerated holes tunnel to the metal electrode assisted by the HOMO of the molecular bridge, the choice of the latter has a strong influence on both the steady state and transient metal-molecule-semiconductor photodiode response. The control of junction current via photogenerated charge carriers adds new functionality to single-molecule nanodevices.
Charge transport through molecular switches
International Nuclear Information System (INIS)
Jan van der Molen, Sense; Liljeroth, Peter
2010-01-01
We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)
Charge transport through molecular switches
Energy Technology Data Exchange (ETDEWEB)
Jan van der Molen, Sense [Kamerlingh Onnes Laboratorium, Leiden University, Niels Bohrweg 2, 2333 CA Leiden (Netherlands); Liljeroth, Peter, E-mail: molen@physics.leidenuniv.n [Condensed Matter and Interfaces, Debye Institute for Nanomaterials Science, University of Utrecht, PO Box 80000, 3508 TA Utrecht (Netherlands)
2010-04-07
We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)
Morphological Analysis on Business Model of Electric Vehicles Charging Infrastructure in China
DEFF Research Database (Denmark)
Li, Suxiu; Liu, Yingqi; Wang, Jingyu
2016-01-01
of EVs charging infrastructure business model for China, and takes the city Shenzhen as a case study. The research shows that we can achieve EVs Charging infrastructure business model innovation by combining design possibility on the right side of morphological box as much as possible.......The issues of energy crisis and environment pollution have paved opportunities to electric vehicles (EVs), many countries take it as an effective way to reducing the depletion of fossil fuels and CO2 emissions. As the energy supply of electric vehicles, the development of charging infrastructure...
Effects of charging and electric field on graphene functionalized with titanium
International Nuclear Information System (INIS)
Gürel, H Hakan; Ciraci, S
2013-01-01
Titanium atoms are adsorbed to graphene with a significant binding energy and render diverse functionalities to it. Carrying out first-principles calculations, we investigated the effects of charging and static electric field on the physical and chemical properties of graphene covered by Ti adatoms. When uniformly Ti covered graphene is charged positively, its antiferromagnetic ground state changes to ferromagnetic metal and attains a permanent magnetic moment. Static electric field applied perpendicularly causes charge transfer between Ti and graphene, and can induce metal–insulator transition. While each Ti adatom adsorbed to graphene atom can hold four hydrogen molecules with a weak binding, these molecules can be released by charging or applying electric field perpendicularly. Hence, it is demonstrated that charging and applied static electric field induce quasi-continuous and side specific modifications in the charge distribution and potential energy of adatoms absorbed to single-layer nanostructures, resulting in fundamentally crucial effects on their physical and chemical properties. (paper)
Probabilistic modeling of nodal electric vehicle load due to fast charging stations
DEFF Research Database (Denmark)
Tang, Difei; Wang, Peng; Wu, Qiuwei
2016-01-01
In order to reduce greenhouse gas emission and fossil fuel dependence, Electric Vehicle (EV) has drawn increasing attention due to its zero emission and high efficiency. However, new problems such as range anxiety, long charging duration and high charging power may threaten the safe and efficient...... station into consideration. Fuzzy logic inference system is applied to simulate the charging decision of EV drivers at fast charging station. Due to increasing EV loads in power system, the potential traffic congestion in fast charging stations is modeled and evaluated by queuing theory with spatial...
An improved limit on the charge of antihydrogen from stochastic acceleration.
Ahmadi, M; Baquero-Ruiz, M; Bertsche, W; Butler, E; Capra, A; Carruth, C; Cesar, C L; Charlton, M; Charman, A E; Eriksson, S; Evans, L T; Evetts, N; Fajans, J; Friesen, T; Fujiwara, M C; Gill, D R; Gutierrez, A; Hangst, J S; Hardy, W N; Hayden, M E; Isaac, C A; Ishida, A; Jones, S A; Jonsell, S; Kurchaninov, L; Madsen, N; Maxwell, D; McKenna, J T K; Menary, S; Michan, J M; Momose, T; Munich, J J; Nolan, P; Olchanski, K; Olin, A; Povilus, A; Pusa, P; Rasmussen, C Ø; Robicheaux, F; Sacramento, R L; Sameed, M; Sarid, E; Silveira, D M; So, C; Tharp, T D; Thompson, R I; van der Werf, D P; Wurtele, J S; Zhmoginov, A I
2016-01-21
Antimatter continues to intrigue physicists because of its apparent absence in the observable Universe. Current theory requires that matter and antimatter appeared in equal quantities after the Big Bang, but the Standard Model of particle physics offers no quantitative explanation for the apparent disappearance of half the Universe. It has recently become possible to study trapped atoms of antihydrogen to search for possible, as yet unobserved, differences in the physical behaviour of matter and antimatter. Here we consider the charge neutrality of the antihydrogen atom. By applying stochastic acceleration to trapped antihydrogen atoms, we determine an experimental bound on the antihydrogen charge, Qe, of |Q| < 0.71 parts per billion (one standard deviation), in which e is the elementary charge. This bound is a factor of 20 less than that determined from the best previous measurement of the antihydrogen charge. The electrical charge of atoms and molecules of normal matter is known to be no greater than about 10(-21)e for a diverse range of species including H2, He and SF6. Charge-parity-time symmetry and quantum anomaly cancellation demand that the charge of antihydrogen be similarly small. Thus, our measurement constitutes an improved limit and a test of fundamental aspects of the Standard Model. If we assume charge superposition and use the best measured value of the antiproton charge, then we can place a new limit on the positron charge anomaly (the relative difference between the positron and elementary charge) of about one part per billion (one standard deviation), a 25-fold reduction compared to the current best measurement.
Electron-vibron coupling effects on electron transport via a single-molecule magnet
McCaskey, Alexander; Yamamoto, Yoh; Warnock, Michael; Burzurí, Enrique; van der Zant, Herre S. J.; Park, Kyungwha
2015-03-01
We investigate how the electron-vibron coupling influences electron transport via an anisotropic magnetic molecule, such as a single-molecule magnet (SMM) Fe4, by using a model Hamiltonian with parameter values obtained from density-functional theory (DFT). The magnetic anisotropy parameters, vibrational energies, and electron-vibron coupling strengths of the Fe4 are computed using DFT. A giant spin model is applied to the Fe4 with only two charge states, specifically a neutral state with a total spin S =5 and a singly charged state with S =9 /2 , which is consistent with our DFT result and experiments on Fe4 single-molecule transistors. In sequential electron tunneling, we find that the magnetic anisotropy gives rise to new features in the conductance peaks arising from vibrational excitations. In particular, the peak height shows a strong, unusual dependence on the direction as well as magnitude of applied B field. The magnetic anisotropy also introduces vibrational satellite peaks whose position and height are modified with the direction and magnitude of applied B field. Furthermore, when multiple vibrational modes with considerable electron-vibron coupling have energies close to one another, a low-bias current is suppressed, independently of gate voltage and applied B field, although that is not the case for a single mode with a similar electron-vibron coupling. In the former case, the conductance peaks reveal a stronger B -field dependence than in the latter case. The new features appear because the magnetic anisotropy barrier is of the same order of magnitude as the energies of vibrational modes with significant electron-vibron coupling. Our findings clearly show the interesting interplay between magnetic anisotropy and electron-vibron coupling in electron transport via the Fe4. Similar behavior can be observed in transport via other anisotropic magnetic molecules.
Dynamical image-charge effect in molecular tunnel junctions
DEFF Research Database (Denmark)
Jin, Chengjun; Thygesen, Kristian Sommer
2014-01-01
the finite IC formation time affects charge transport through a molecule suspended between two electrodes. For a single-level model, an analytical treatment shows that the conductance is suppressed by a factor Z(2), where Z is the quasiparticle renormalization factor, compared to the static IC approximation...... that the dynamical corrections can reduce the conductance by more than a factor of two when compared to static GW or density functional theory where the molecular energy levels have been shifted to match the exact quasiparticle levels....
Microscopic origins of charge transport in triphenylene systems
Thompson, Ian R.; Coe, Mary K.; Walker, Alison B.; Ricci, Matteo; Roscioni, Otello M.; Zannoni, Claudio
2018-06-01
We study the effects of molecular ordering on charge transport at the mesoscale level in a layer of ≈9000 hexa-octyl-thio-triphenylene discotic mesogens with dimensions of ≈20 ×20 ×60 nm3 . Ordered (columnar) and disordered isotropic morphologies are obtained from a combination of atomistic and coarse-grained molecular-dynamics simulations. Electronic structure codes are used to find charge hopping rates at the microscopic level. Energetic disorder is included through the Thole model. Kinetic Monte Carlo simulations then predict charge mobilities. We reproduce the large increase in mobility in going from an isotropic to a columnar morphology. To understand how these mobilities depend on the morphology and hopping rates, we employ graph theory to analyze charge trajectories by representing the film as a charge-transport network. This approach allows us to identify spatial correlations of molecule pairs with high transfer rates. These pairs must be linked to ensure good transport characteristics or may otherwise act as traps. Our analysis is straightforward to implement and will be a useful tool in linking materials to device performance, for example, to investigate the influence of local inhomogeneities in the current density. Our mobility-field curves show an increasing mobility with field, as would be expected for an organic semiconductor.
Extended charge banking model of dual path shocks for implantable cardioverter defibrillators.
Dosdall, Derek J; Sweeney, James D
2008-08-01
Single path defibrillation shock methods have been improved through the use of the Charge Banking Model of defibrillation, which predicts the response of the heart to shocks as a simple resistor-capacitor (RC) circuit. While dual path defibrillation configurations have significantly reduced defibrillation thresholds, improvements to dual path defibrillation techniques have been limited to experimental observations without a practical model to aid in improving dual path defibrillation techniques. The Charge Banking Model has been extended into a new Extended Charge Banking Model of defibrillation that represents small sections of the heart as separate RC circuits, uses a weighting factor based on published defibrillation shock field gradient measures, and implements a critical mass criteria to predict the relative efficacy of single and dual path defibrillation shocks. The new model reproduced the results from several published experimental protocols that demonstrated the relative efficacy of dual path defibrillation shocks. The model predicts that time between phases or pulses of dual path defibrillation shock configurations should be minimized to maximize shock efficacy. Through this approach the Extended Charge Banking Model predictions may be used to improve dual path and multi-pulse defibrillation techniques, which have been shown experimentally to lower defibrillation thresholds substantially. The new model may be a useful tool to help in further improving dual path and multiple pulse defibrillation techniques by predicting optimal pulse durations and shock timing parameters.
Triton - Stratospheric molecules and organic sediments
Thompson, W. Reid; Singh, Sushil K.; Khare, B. N.; Sagan, Carl
1989-01-01
Continuous-flow plasma discharge techniques show production rates of hydrocarbons and nitriles in N2 + CH4 atmospheres appropriate to the stratosphere of Titan, and indicate that a simple eddy diffusion model together with the observed electron flux quantitatively matches the Voyager IRIS observations for all the hydrocarbons, except for the simplest ones. Charged particle chemistry is very important in Triton's stratosphere. In the more CH4-rich case of Titan, many hydrocarbons and nitriles are produced in high yield. If N2 is present, the CH4 fraction is low, but hydrocarbons and nitriles are produced in fair yield, abundances of HCN and C2H2 in Triton's stratosphere exceed 10 to the 19th molecules/sq cm per sec, and NCCN, C3H4, and other species are predicted to be present. These molecules may be detected by IRIS if the stratosphere is as warm as expected. Both organic haze and condensed gases will provide a substantial UV and visible opacity in Triton's atmosphere.
Exploring the Binding of Barbital to a Synthetic Macrocyclic Receptor; a Charge Density Study
DEFF Research Database (Denmark)
Du, Jonathan J.; Hanrahan, Jane Rouse; Solomon, V. Raja
2018-01-01
Experimental charge density distribution studies, complemented by quantum mechanical theoretical calculations, of a host-guest system comprised of a macrocycle (1) and barbital (2) in a 1:1 ratio (3) have been carried out via high resolution single crystal X-ray diffraction. The data was modelled...... molecule. Visual comparison of the conformations of the macrocyclic ring shows the rotation by 180° of an amide bond attributed to competitive hydrogen bonding. It was found the intraannular and extraannular molecules inside were orientated to maximise the number of hydrogen bonds present...
Beta functions and central charge of supersymmetric sigma models with torsion
International Nuclear Information System (INIS)
Guadagnini, E.; Mintchev, M.
1987-01-01
We present a method for the computation of the renormalization group β-functions and the central charge in two-dimensional supersymmetric sigma models in a gravitational background. The two-loops results are exhibited. We use the Pauli-Villars regularization which preserves supersymmetry and permits an unambiguous treatment of the model with torsion. The central charge we derive for a general manifold is in agreement with the expression found on group manifolds. (orig.)
International Nuclear Information System (INIS)
Konopka, Ladislav; Kosek, Juraj
2015-01-01
Polyethylene particles of various sizes are present in industrial gas-dispersion reactors and downstream processing units. The contact of the particles with a device wall as well as the mutual particle collisions cause electrons on the particle surface to redistribute in the system. The undesirable triboelectric charging results in several operational problems and safety risks in industrial systems, for example in the fluidized-bed polymerization reactor. We studied the charging of polyethylene particles caused by the particle-particle interactions in gas. Our model employs the Discrete Element Method (DEM) describing the particle dynamics and incorporates the ‘Trapped Electron Approach’ as the physical basis for the considered charging mechanism. The model predicts the particle charge distribution for systems with various particle size distributions and various level of segregation. Simulation results are in a qualitative agreement with experimental observations of similar particulate systems specifically in two aspects: 1) Big particles tend to gain positive charge and small particles the negative one. 2) The wider the particle size distribution is, the more pronounced is the charging process. Our results suggest that not only the size distribution, but also the effect of the spatial segregation of the polyethylene particles significantly influence the resulting charge distribution ‘generated’ in the system. The level of particle segregation as well as the particle size distribution of polyethylene particles can be in practice adjusted by the choice of supported catalysts, by the conditions in the fluidized-bed polymerization reactor and by the fluid dynamics. We also attempt to predict how the reactor temperature affects the triboelectric charging of particles. (paper)
The Physics of Small Molecule Acceptors for Efficient and Stable Bulk Heterojunction Solar Cells
Gasparini, Nicola
2018-01-29
Organic bulk heterojunction solar cells based on small molecule acceptors have recently seen a rapid rise in the power conversion efficiency with values exceeding 13%. This impressive achievement has been obtained by simultaneous reduction of voltage and charge recombination losses within this class of materials as compared to fullerene-based solar cells. In this contribution, the authors review the current understanding of the relevant photophysical processes in highly efficient nonfullerene acceptor (NFA) small molecules. Charge generation, recombination, and charge transport is discussed in comparison to fullerene-based composites. Finally, the authors review the superior light and thermal stability of nonfullerene small molecule acceptor based solar cells, and highlight the importance of NFA-based composites that enable devices without early performance loss, thus resembling so-called burn-in free devices.
The Physics of Small Molecule Acceptors for Efficient and Stable Bulk Heterojunction Solar Cells
Gasparini, Nicola; Wadsworth, Andrew; Moser, Maximilian; Baran, Derya; McCulloch, Iain; Brabec, Christoph J.
2018-01-01
Organic bulk heterojunction solar cells based on small molecule acceptors have recently seen a rapid rise in the power conversion efficiency with values exceeding 13%. This impressive achievement has been obtained by simultaneous reduction of voltage and charge recombination losses within this class of materials as compared to fullerene-based solar cells. In this contribution, the authors review the current understanding of the relevant photophysical processes in highly efficient nonfullerene acceptor (NFA) small molecules. Charge generation, recombination, and charge transport is discussed in comparison to fullerene-based composites. Finally, the authors review the superior light and thermal stability of nonfullerene small molecule acceptor based solar cells, and highlight the importance of NFA-based composites that enable devices without early performance loss, thus resembling so-called burn-in free devices.
Impact of charge carrier injection on single-chain photophysics of conjugated polymers
Energy Technology Data Exchange (ETDEWEB)
Hofmann, Felix J.; Vogelsang, Jan, E-mail: jan.vogelsang@physik.uni-regensburg.de; Lupton, John M. [Institut für Experimentelle und Angewandte Physik, Universität Regensburg, Universitätsstrasse 31, 93053 Regensburg (Germany)
2016-06-27
Charges in conjugated polymer materials have a strong impact on the photophysics and their interaction with the primary excited state species has to be taken into account in understanding device properties. Here, we employ single-molecule spectroscopy to unravel the influence of charges on several photoluminescence (PL) observables. The charges are injected either stochastically by a photochemical process or deterministically in a hole-injection sandwich device configuration. We find that upon charge injection, besides a blue-shift of the PL emission and a shortening of the PL lifetime due to quenching and blocking of the lowest-energy chromophores, the non-classical photon arrival time distribution of the multichromophoric chain is modified towards a more classical distribution. Surprisingly, the fidelity of photon antibunching deteriorates upon charging, whereas one would actually expect the opposite: the number of chromophores to be reduced. A qualitative model is presented to explain the observed PL changes. The results are of interest to developing a microscopic understanding of the intrinsic charge-exciton quenching interaction in devices.
Probing the Importance of Charge Flux in Force Field Modeling.
Sedghamiz, Elaheh; Nagy, Balazs; Jensen, Frank
2017-08-08
We analyze the conformational dependence of atomic charges and molecular dipole moments for a selection of ∼900 conformations of peptide models of the 20 neutral amino acids. Based on a set of reference density functional theory calculations, we partition the changes into effects due to changes in bond distances, bond angles, and torsional angles and into geometry and charge flux contributions. This allows an assessment of the limitations of fixed charge force fields and indications for how to design improved force fields. The torsional degrees of freedom are the main contribution to conformational changes of atomic charges and molecular dipole moments, but indirect effects due to change in bond distances and angles account for ∼25% of the variation. Charge flux effects dominate for changes in bond distances and are also the main component of the variation in bond angles, while they are ∼25% compared to the geometry variations for torsional degrees of freedom. The geometry and charge flux contributions to some extent produce compensating effects.
Bâldea, Ioan
2017-10-26
Inspired by earlier attempts in organic electronics aiming at controlling charge injection from metals into organic materials by manipulating the Schottky energy barrier using self-assembled monolayers (SAMs), recent experimental and theoretical work in molecular electronics showed that metal-organic interfaces can be controlled via changes in the metal work function that are induced by SAMs. In this paper we indicate a different route to achieve interface-driven control over the charge transfer/transport at the molecular scale. It is based on the fact that, in floppy molecule based SAMs, the molecular conformation can be tuned by varying the coverage of the adsorbate. We demonstrate this effect with the aid of benchmark molecules that are often used to fabricate nanojunctions and consist of two rings that can easily rotate relative to each other. We show that, by varying the coverage of the SAM, the twisting angle φ of the considered molecular species can be modified by a factor of two. Given the fact that the low bias conductance G scales as cos 2 φ, this results in a change in G of over one order of magnitude for the considered molecular species. Tuning the twisting angle by controlling the SAM coverage may be significant, e.g., for current efforts to fabricate molecular switches. Conversely, the lack of control over the local SAM coverage may be problematic for the reproducibility and interpretation of the STM (scanning tunneling microscope) measurements on repeatedly forming single molecule break junctions.
Discrete Velocity Models for Polyatomic Molecules Without Nonphysical Collision Invariants
Bernhoff, Niclas
2018-05-01
An important aspect of constructing discrete velocity models (DVMs) for the Boltzmann equation is to obtain the right number of collision invariants. Unlike for the Boltzmann equation, for DVMs there can appear extra collision invariants, so called spurious collision invariants, in plus to the physical ones. A DVM with only physical collision invariants, and hence, without spurious ones, is called normal. The construction of such normal DVMs has been studied a lot in the literature for single species, but also for binary mixtures and recently extensively for multicomponent mixtures. In this paper, we address ways of constructing normal DVMs for polyatomic molecules (here represented by that each molecule has an internal energy, to account for non-translational energies, which can change during collisions), under the assumption that the set of allowed internal energies are finite. We present general algorithms for constructing such models, but we also give concrete examples of such constructions. This approach can also be combined with similar constructions of multicomponent mixtures to obtain multicomponent mixtures with polyatomic molecules, which is also briefly outlined. Then also, chemical reactions can be added.
Conformational transformations induced by the charge-curvature interaction: Mean-field approach
DEFF Research Database (Denmark)
Gaididei, Yu B.; Christiansen, Peter Leth; Zakrzewski, W.J.
2006-01-01
A simple phenomenological model for describing the conformational dynamics of biological macromolecules via the nonlinearity-induced instabilities is proposed. It is shown that the interaction between charges and bending degrees of freedom of closed molecular aggregates may act as drivers giving ...... impetus to conformational dynamics of biopolymers. It is demonstrated that initially circular aggregates may undergo transformation to polygonal shapes and possible application to aggregates of bacteriochlorophyl a molecules is considered....
A stochastic model for magnetic dynamics in single-molecule magnets
Energy Technology Data Exchange (ETDEWEB)
López-Ruiz, R., E-mail: rlruiz@ifi.unicamp.br [Instituto de Física Gleb Wataghin - Universidade Estadual de Campinas, 13083-859 Campinas (SP) (Brazil); Almeida, P.T. [Instituto de Física Gleb Wataghin - Universidade Estadual de Campinas, 13083-859 Campinas (SP) (Brazil); Vaz, M.G.F. [Instituto de Química, Universidade Federal Fluminense, 24020-150 Niterói (RJ) (Brazil); Novak, M.A. [Instituto de Física - Universidade Federal do Rio de Janeiro, 21941-972 Rio de Janeiro (RJ) (Brazil); Béron, F.; Pirota, K.R. [Instituto de Física Gleb Wataghin - Universidade Estadual de Campinas, 13083-859 Campinas (SP) (Brazil)
2016-04-01
Hysteresis and magnetic relaxation curves were performed on double well potential systems with quantum tunneling possibility via stochastic simulations. Simulation results are compared with experimental ones using the Mn{sub 12} single-molecule magnet, allowing us to introduce time dependence in the model. Despite being a simple simulation model, it adequately reproduces the phenomenology of a thermally activated quantum tunneling and can be extended to other systems with different parameters. Assuming competition between the reversal modes, thermal (over) and tunneling (across) the anisotropy barrier, a separation of classical and quantum contributions to relaxation time can be obtained. - Highlights: • Single-molecule magnets are modeled using a simple stochastic approach. • Simulation reproduces thermally-activated tunnelling magnetization reversal features. • The time is introduced in hysteresis and relaxation simulations. • We can separate the quantum and classical contributions to decay time.
Modeling and simulation of a proton beam space-charge neutralization
International Nuclear Information System (INIS)
Fleury, Xavier
2000-01-01
The aim of this work is to understand and to model the build-up of a plasma in the low-energy beam transport line of a proton accelerator. This plasma is generated by the beam, which ionizes the residual gas remaining in this low-energy section. By neutralizing the space-charge of the beam, the plasma modifies its transport, thus, to control the beam, it is necessary to study this phenomenon. In this work, we consider a continuous beam and we take interest in the stationary states of the plasma. We first restrict the description of the plasma to a plane perpendicular to the beam, by assuming that the beam and the plasma are longitudinally invariant. The build-up of the plasma is first described with a kinetic model where binary collisions are neglected, based on the Vlasov-Poisson system with source terms which take into account ionization. We prove mathematically that this system has no stationary solution, by using appropriate subsets of the phase-space that we call trapping-sets. Yet, measurements show that the plasma evolves towards a steady state. To account for this evolution, we modify the source terms of the model. The resulting model is solved by a particle-in-cell method, and the results are compared to the measurements. Then, we show that binary collisions between plasma electrons and beam ions or gas molecules help to maintain the equilibrium of the plasma. In the last part of the thesis, we use hydrodynamic models to investigate more easily the coupling between transversal and longitudinal effects. The preliminary study of a one-dimensional model enables to find the behaviour of the transverse potential of the plasma. Finally, a two-dimensional model of the transport of the beam when it is neutralized by the plasma is solved numerically, which shows that the longitudinal electric field should play an important role in the set-up of the equilibrium of the plasma. (author) [fr
International Nuclear Information System (INIS)
Wang Xumei; Xu Shuping; Xu Weiqing; Liang Chongyang; Li Hongrui; Sun Fei
2011-01-01
Multicolored fluorescent dye loaded PMMA nanospheres were synthesized by the electrostatic adsorption of dye molecules on the charged PMMA nanospheres, whose charges were adjusted by choosing different initiators. The charged PMMA nanospheres have a wider capacity and advantage for combining the charged dyes. The fluorescent dye-PMMA composite nanospheres possess the advantages of higher brightness, longer lifetime and stronger resistance to photobleaching relative to dye molecules. Dye leakage remained lower than 5% over one week. These fluorescent nanospheres have been used in biological labels in cell imaging. They can easily stain blood cancer cells without further surface modification.
A radial distribution function-based open boundary force model for multi-centered molecules
Neumann, Philipp
2014-06-01
We derive an expression for radial distribution function (RDF)-based open boundary forcing for molecules with multiple interaction sites. Due to the high-dimensionality of the molecule configuration space and missing rotational invariance, a computationally cheap, 1D approximation of the arising integral expressions as in the single-centered case is not possible anymore. We propose a simple, yet accurate model invoking standard molecule- and site-based RDFs to approximate the respective integral equation. The new open boundary force model is validated for ethane in different scenarios and shows very good agreement with data from periodic simulations. © World Scientific Publishing Company.
Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere
Energy Technology Data Exchange (ETDEWEB)
Desai, R. T.; Coates, A. J.; Wellbrock, A.; González-Caniulef, D.; Jones, G. H.; Lewis, G. R.; Taylor, S. A.; Kataria, D. O. [Mullard Space Science Laboratory, University College London, Holmbury St. Mary, Surrey RH5 6NT (United Kingdom); Vuitton, V. [Université Grenoble Alpes, CNRS, IPAG, F-38000 Grenoble (France); Crary, F. J. [Laboratory for Atmospheric and Space Physics, University of Colorado, Innovation Drive, Boulder, CO 80303 (United States); Shebanits, O.; Wahlund, J.-E. [Department of Physics and Astronomy, Uppsala University, Box 516, SE-751 20 Uppsala (Sweden); Waite, J. H. [Space Science and Engineering Division, Southwest Research Institute (SWRI), 6220 Culebra Road, San Antonio, TX 78238 (United States); Cordiner, M.; Sittler, E. C. [NASA Goddard Space Flight Center, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Edberg, N. J. T., E-mail: r.t.desai@ucl.ac.uk [Swedish Institute of Space Physics, Box 537, SE-751 21 Uppsala (Sweden)
2017-08-01
Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q{sup −1}. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950–1300 km. We report on detections consistently centered between 25.8 and 26.0 u q{sup −1} and between 49.0–50.1 u q{sup −1} which are identified as belonging to the carbon chain anions, CN{sup −}/C{sub 3}N{sup −} and/or C{sub 2}H{sup −}/C{sub 4}H{sup −}, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73–74 u q{sup −1} could be attributed to the further carbon chain anions C{sub 5}N{sup −}/C{sub 6}H{sup −} but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below <1100 km, the low-mass anions (<150 u q{sup −1}) were found to deplete at a rate proportional to the growth of the larger molecules, a correlation that indicates the anions are tightly coupled to the growth process. This study adds Titan to an increasing list of astrophysical environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.
Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere
International Nuclear Information System (INIS)
Desai, R. T.; Coates, A. J.; Wellbrock, A.; González-Caniulef, D.; Jones, G. H.; Lewis, G. R.; Taylor, S. A.; Kataria, D. O.; Vuitton, V.; Crary, F. J.; Shebanits, O.; Wahlund, J.-E.; Waite, J. H.; Cordiner, M.; Sittler, E. C.; Edberg, N. J. T.
2017-01-01
Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q"−"1. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950–1300 km. We report on detections consistently centered between 25.8 and 26.0 u q"−"1 and between 49.0–50.1 u q"−"1 which are identified as belonging to the carbon chain anions, CN"−/C_3N"− and/or C_2H"−/C_4H"−, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73–74 u q"−"1 could be attributed to the further carbon chain anions C_5N"−/C_6H"− but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below <1100 km, the low-mass anions (<150 u q"−"1) were found to deplete at a rate proportional to the growth of the larger molecules, a correlation that indicates the anions are tightly coupled to the growth process. This study adds Titan to an increasing list of astrophysical environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.
Optimal Day-ahead Charging Scheduling of Electric Vehicles through an Aggregative Game Model
DEFF Research Database (Denmark)
Liu, Zhaoxi; Wu, Qiuwei; Huang, Shaojun
2017-01-01
The electric vehicle (EV) market has been growing rapidly around the world. With large scale deployment of EVs in power systems, both the grid and EV owners will benefit if the flexible demand of EV charging is properly managed through the electricity market. When EV charging demand is considerable...... in a grid, it will impact spot prices in the electricity market and consequently influence the charging scheduling itself. The interaction between the spot prices and the EV demand needs to be considered in the EV charging scheduling, otherwise it will lead to a higher charging cost. A day-ahead EV charging...... scheduling based on an aggregative game model is proposed in this paper. The impacts of the EV demand on the electricity prices are formulated with the game model in the scheduling considering possible actions of other EVs. The existence and uniqueness of the pure strategy Nash equilibrium are proved...
Entropic lattice Boltzmann model for charged leaky dielectric multiphase fluids in electrified jets.
Lauricella, Marco; Melchionna, Simone; Montessori, Andrea; Pisignano, Dario; Pontrelli, Giuseppe; Succi, Sauro
2018-03-01
We present a lattice Boltzmann model for charged leaky dielectric multiphase fluids in the context of electrified jet simulations, which are of interest for a number of production technologies including electrospinning. The role of nonlinear rheology on the dynamics of electrified jets is considered by exploiting the Carreau model for pseudoplastic fluids. We report exploratory simulations of charged droplets at rest and under a constant electric field, and we provide results for charged jet formation under electrospinning conditions.
Murrell, Daniel S; Cortes-Ciriano, Isidro; van Westen, Gerard J P; Stott, Ian P; Bender, Andreas; Malliavin, Thérèse E; Glen, Robert C
2015-01-01
In silico predictive models have proved to be valuable for the optimisation of compound potency, selectivity and safety profiles in the drug discovery process. camb is an R package that provides an environment for the rapid generation of quantitative Structure-Property and Structure-Activity models for small molecules (including QSAR, QSPR, QSAM, PCM) and is aimed at both advanced and beginner R users. camb's capabilities include the standardisation of chemical structure representation, computation of 905 one-dimensional and 14 fingerprint type descriptors for small molecules, 8 types of amino acid descriptors, 13 whole protein sequence descriptors, filtering methods for feature selection, generation of predictive models (using an interface to the R package caret), as well as techniques to create model ensembles using techniques from the R package caretEnsemble). Results can be visualised through high-quality, customisable plots (R package ggplot2). Overall, camb constitutes an open-source framework to perform the following steps: (1) compound standardisation, (2) molecular and protein descriptor calculation, (3) descriptor pre-processing and model training, visualisation and validation, and (4) bioactivity/property prediction for new molecules. camb aims to speed model generation, in order to provide reproducibility and tests of robustness. QSPR and proteochemometric case studies are included which demonstrate camb's application.Graphical abstractFrom compounds and data to models: a complete model building workflow in one package.
Contributions of charge-density research to medicinal chemistry
Directory of Open Access Journals (Sweden)
Birger Dittrich
2014-11-01
Full Text Available This article reviews efforts in accurate experimental charge-density studies with relevance to medicinal chemistry. Initially, classical charge-density studies that measure electron density distribution via least-squares refinement of aspherical-atom population parameters are summarized. Next, interaction density is discussed as an idealized situation resembling drug–receptor interactions. Scattering-factor databases play an increasing role in charge-density research, and they can be applied both to small-molecule and macromolecular structures in refinement and analysis; software development facilitates their use. Therefore combining both of these complementary branches of X-ray crystallography is recommended, and examples are given where such a combination already proved useful. On the side of the experiment, new pixel detectors are allowing rapid measurements, thereby enabling both high-throughput small-molecule studies and macromolecular structure determination to higher resolutions. Currently, the most ambitious studies compute intermolecular interaction energies of drug–receptor complexes, and it is recommended that future studies benefit from recent method developments. Selected new developments in theoretical charge-density studies are discussed with emphasis on its symbiotic relation to crystallography.
International Nuclear Information System (INIS)
DeNardis, Nadica Ivošević; Ilić, Jadranka Pečar; Ružić, Ivica; Pletikapić, Galja
2015-01-01
Highlights: • Kinetics of adhesion and spreading of the algal cell at a charged interface is explored. • Amperometric signals are analyzed using extended methodology and the reaction kinetics model. • The model reconstructs and quantifies individual states of the three-step adhesion process. • Adhesion kinetics of the algal cell is slower than that of its plasma membrane vesicle. • Slow spreading of organic film at the interface could be due to the attenuated effect of the potential. - Abstract: We study the kinetics of adhesion and spreading of an algal cell and its plasma membrane vesicle at the charged interface. A simple system of an isolated plasma membrane vesicle without internal content has been developed and characterized by atomic force microscopy (AFM). We extend the methodology based on the reaction kinetics model and empirical fitting for the analysis of amperometric signals, and demonstrate its validity and pertinence in a wide range of surface charge densities. Adhesion kinetics of the algal cell is slower than that of its plasma membrane vesicle. Isolated plasma membrane contributes about one quarter to the cell contact area. The model reconstructs and quantifies individual states of the three-step adhesion process of the algal cell and makes it possible to associate them with various features of amperometric signal. At the time of current amplitude, the ruptured state predominates and the cell spread contact area is larger than its initial area as well as the contact area of the plasma membrane vesicle. These results suggest that a major structural disruption of the cell membrane, collapse of cytoskeleton and leakage of intracellular material could appear close to the time of current amplitude. Further, slow kinetics of the organic film spreading at the interface to its maximal extent is considered as the rate determining step, which could be a consequence of the attenuated effect of potential at the modified interface, stronger
Biradical and triradical organic magnetic molecules as spin filters and rectifiers
International Nuclear Information System (INIS)
Zhu, L.; Yao, K.L.; Liu, Z.L.
2012-01-01
Graphical abstract: (a) Negative differential resistance (NDR) characteristic and antiparallel spin-current (ASC) rectification; (b) spin-current (SC) rectification and charge-current (CC) rectification properties Display Omitted Highlights: ► Organic magnetic molecules at gold electrodes as spin/charge rectifier. ► Spin diode/rectification stems from length and asymmetry of molecular framework. ► Negative differential resistance, spin-filtering and switching evidenced. - Abstract: We have theoretically investigated the spin-polarized transport properties of molecular junctions consisting of biradical and triradical organic magnetic molecules sandwiched between two symmetric gold electrodes, respectively. It shows that these junctions function as a spin rectifier or a combination of spin and charge rectifiers with high spin rectification ratios exceeding 100, wherein the spin diode/rectification effect stems from the conjugated length and asymmetry of the molecular framework, which is the pre-requisite for electronic asymmetry of the adsorbed species. The negative differential resistance, spin-filtering and switching properties are also unveiled. In particular, it is revealed that the strong couplings between the electrodes and molecules are responsible for the negative differential resistance.
Probing physics beyond the standard model in diatomic molecules
International Nuclear Information System (INIS)
Denis, M.
2017-01-01
Nowadays, the incompleteness of the Standard Model of particles (SM) is largely acknowledged. One of its most obvious shortcomings is the lack of explanation for the huge surplus of matter over antimatter in the universe, the so-called baryon asymmetry of the universe. New CP (charge conjugation and spatial parity) violations absent in the SM are assumed to be responsible for this asymmetry. Such a violation could be observed, in ordinary matter through a set of interactions violating both parity and time-reversal symmetries (P, T -odd) among which the preponderant ones are the electron Electric Dipole Moment (eEDM), the electron-nucleon scalar-pseudoscalar (enSPS) and the nuclear magnetic quadrupole moment (nMQM) interactions. Hence, an experimental evidence of a non-zero P, T -odd interaction constant would be a probe of this New Physics beyond the Standard Model. The calculation of the corresponding molecular parameters is performed by making use of an elaborate four-component relativistic configuration interaction approach in polar diatomic molecules containing an actinide, that are particularly adequate systems for eEDM experiments, such as ThO that allowed for assigning the most constraining upper bound on the eEDM and ThF"+ that will be used in a forthcoming experiment. Those results will be of crucial importance in the interpretation of the measurements since the fundamental constants can only be evaluated if one combines both experimental energy shift measurements and theoretical molecular parameters. This manuscript proceeds as follows, after an introduction to the general background of the search of CP-violations and its consequences for the understanding of the Universe (Chapter 1), a presentation of the underlying theory of the evidence of such violation in ordinary matter, namely the P, T -odd sources of the Electric Dipole Moment of a many-electron system, as well as the relevant molecular parameters is given in Chapter 2. A similar introduction to
Energy Technology Data Exchange (ETDEWEB)
Li, Guochang; Chen, George, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China); School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ (United Kingdom); Li, Shengtao, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China)
2016-08-08
Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loading concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.
Electron distributions of the first-row homonuclear diatomic molecules, A2
International Nuclear Information System (INIS)
Ramirez, B.I.; Bielefeld Univ.
1982-08-01
Electron momentum density contour maps of the first-row homonuclear diatomic molecules, A 2 , are obtained from near Hartree-Fock wave functions. Both the total momentum density and momentum density difference (molecule - isolated atoms) maps present trends that may be related to the binding in the molecules. These results are compared with the corresponding charge density maps in position space (Bader, Henneker and Cade 1967). (author)
Schottky’s conjecture, field emitters, and the point charge model
Directory of Open Access Journals (Sweden)
Kevin L. Jensen
2016-06-01
Full Text Available A Point Charge Model of conical field emitters, in which the emitter is defined by an equipotential surface of judiciously placed charges over a planar conductor, is used to confirm Schottky’s conjecture that field enhancement factors are multiplicative for a small protrusion placed on top of a larger base structure. Importantly, it is shown that Schottky’s conjecture for conical / ellipsoidal field emitters remains unexpectedly valid even when the dimensions of the protrusion begin to approach the dimensions of the base structure. The model is analytic and therefore the methodology is extensible to other configurations.
Lee, Victor; James, Nicole M.; Waitukaitis, Scott R.; Jaeger, Heinrich M.
2018-03-01
Electrostatic charging of insulating fine particles can be responsible for numerous phenomena ranging from lightning in volcanic plumes to dust explosions. However, even basic aspects of how fine particles become charged are still unclear. Studying particle charging is challenging because it usually involves the complexities associated with many-particle collisions. To address these issues, we introduce a method based on acoustic levitation, which makes it possible to initiate sequences of repeated collisions of a single submillimeter particle with a flat plate, and to precisely measure the particle charge in situ after each collision. We show that collisional charge transfer between insulators is dependent on the hydrophobicity of the contacting surfaces. We use glass, which we modify by attaching nonpolar molecules to the particle, the plate, or both. We find that hydrophilic surfaces develop significant positive charges after contacting hydrophobic surfaces. Moreover, we demonstrate that charging between a hydrophilic and a hydrophobic surface is suppressed in an acidic environment and enhanced in a basic one. Application of an electric field during each collision is found to modify the charge transfer, again depending on surface hydrophobicity. We discuss these results within the context of contact charging due to ion transfer, and we show that they lend strong support to O H- ions as the charge carriers.
Song, Jinsuk; Kim, Mahn Won
2010-03-11
Understanding the differential adsorption of ions at the interface of an electrolyte solution is very important because it is closely related, not only to the fundamental aspects of biological systems, but also to many industrial applications. We have measured the excess interfacial negative charge density at air-electrolyte solution interfaces by using resonant second harmonic generation of oppositely charged probe molecules. The excess charge density increased with the square root of the bulk electrolyte concentration. A new adsorption model that includes the electrostatic interaction between adsorbed molecules is proposed to explain the measured adsorption isotherm, and it is in good agreement with the experimental results.
Single charging events on colloidal particles in a nonpolar liquid with surfactant
Schreuer, Caspar; Vandewiele, Stijn; Brans, Toon; Strubbe, Filip; Neyts, Kristiaan; Beunis, Filip
2018-01-01
Electrical charging of colloidal particles in nonpolar liquids due to surfactant additives is investigated intensively, motivated by its importance in a variety of applications. Most methods rely on average electrophoretic mobility measurements of many particles, which provide only indirect information on the charging mechanism. In the present work, we present a method that allows us to obtain direct information on the charging mechanism, by measuring the charge fluctuations on individual particles with a precision higher than the elementary charge using optical trapping electrophoresis. We demonstrate the capabilities of the method by studying the influence of added surfactant OLOA 11000 on the charging of single colloidal PMMA particles in dodecane. The particle charge and the frequency of charging events are investigated both below and above the critical micelle concentration (CMC) and with or without applying a DC offset voltage. It is found that at least two separate charging mechanisms are present below the critical micelle concentration. One mechanism is a process where the particle is stripped from negatively charged ionic molecules. An increase in the charging frequency with increased surfactant concentration suggests a second mechanism that involves single surfactant molecules. Above the CMC, neutral inverse micelles can also be involved in the charging process.
Aligned deposition and electrical measurements on single DNA molecules
International Nuclear Information System (INIS)
Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid
2015-01-01
A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)
Limits to differences in active and passive charges
Laemmerzahl, C.; Macias, A.; Mueller, H.
2007-01-01
We explore consequences of a hypothetical difference between active charges, which generate electric fields, and passive charges, which respond to them. A confrontation to experiments using atoms, molecules, or macroscopic matter yields limits on their fractional difference at levels down to 10^-21, which at the same time corresponds to an experimental confirmation of Newtons third law.
Charging of mobile services by mobile payment reference model
Pousttchi, Key; Wiedemann, Dietmar Georg
2005-01-01
The purpose of the paper is to analyze mobile payments in the mobile commerce scenario. Therefore, we first classify the mobile payment in the mobile commerce scenario by explaining general offer models, charging concepts, and intermediaries. Second, we describe the mobile payment reference model, especially, the mobile payment reference organization model and different mobile payment standard types. Finally, we conclude our findings.
Attah, Isaac K; Platt, Sean P; Meot-Ner Mautner, Michael; El-Shall, M Samy; Peverati, Roberto; Head-Gordon, Martin
2015-04-02
The binding energy of the naphthalene(+•)(benzene) heterodimer cation has been determined to be 7.9 ± 1 kcal/mol for C10H8(+•)(C6H6) and 8.1 ± 1 kcal/mol for C10H8(+•)(C6D6) by equilibrium thermochemical measurements using the mass-selected drift cell technique. A second benzene molecule binds to the C10H8(+•)(C6D6) dimer with essentially the same energy (8.4 ± 1 kcal/mol), suggesting that the two benzene molecules are stacked on opposite sides of the naphthalene cation in the (C6D6)C10H8(+•)(C6D6) heterotrimer. The lowest-energy isomers of the C10H8(+•)(C6D6) and (C6D6)C10H8(+•)(C6D6) dimer and trimer calculated using the M11/cc-pVTZ method have parallel stacked structures with enthalpies of binding (-ΔH°) of 8.4 and 9.0 kcal/mol, respectively, in excellent agreement with the experimental values. The stacked face-to-face class of isomers is calculated to have substantial charge-transfer stabilization of about 45% of the total interaction energy despite the large difference between the ionization energies of benzene and naphthalene. Similarly, significant delocalization of the positive charge is found among all three fragments of the (C6D6)C10H8(+•)(C6D6) heterotrimer, thus leaving only 46% of the total charge on the central naphthalene moiety. This unexpectedly high charge-transfer component results in activating two benzene molecules in the naphthalene(+•)(benzene)2 heterotrimer cation to associate with a third benzene molecule at 219 K to form a benzene trimer cation and a neutral naphthalene molecule. The global minimum of the C10H8(+•)(C6H6)2 heterotrimer is found to be the one where the naphthalene cation is sandwiched between two benzene molecules. It is remarkable, and rather unusual, that the binding energy of the second benzene molecule is essentially the same as that of the first. This is attributed to the enhanced charge-transfer interaction in the stacked trimer radical cation.
Solvation thermodynamics and heat capacity of polar and charged solutes in water
Sedlmeier, Felix; Netz, Roland R.
2013-03-01
The solvation thermodynamics and in particular the solvation heat capacity of polar and charged solutes in water is studied using atomistic molecular dynamics simulations. As ionic solutes we consider a F- and a Na+ ion, as an example for a polar molecule with vanishing net charge we take a SPC/E water molecule. The partial charges of all three solutes are varied in a wide range by a scaling factor. Using a recently introduced method for the accurate determination of the solvation free energy of polar solutes, we determine the free energy, entropy, enthalpy, and heat capacity of the three different solutes as a function of temperature and partial solute charge. We find that the sum of the solvation heat capacities of the Na+ and F- ions is negative, in agreement with experimental observations, but our results uncover a pronounced difference in the heat capacity between positively and negatively charged groups. While the solvation heat capacity ΔCp stays positive and even increases slightly upon charging the Na+ ion, it decreases upon charging the F- ion and becomes negative beyond an ion charge of q = -0.3e. On the other hand, the heat capacity of the overall charge-neutral polar solute derived from a SPC/E water molecule is positive for all charge scaling factors considered by us. This means that the heat capacity of a wide class of polar solutes with vanishing net charge is positive. The common ascription of negative heat capacities to polar chemical groups might arise from the neglect of non-additive interaction effects between polar and apolar groups. The reason behind this non-additivity is suggested to be related to the second solvation shell that significantly affects the solvation thermodynamics and due to its large spatial extent induces quite long-ranged interactions between solvated molecular parts and groups.
Optimal Charging Schedule Planning and Economic Analysis for Electric Bus Charging Stations
Directory of Open Access Journals (Sweden)
Rong-Ceng Leou
2017-04-01
Full Text Available The battery capacity of electric buses (EB used for public transportation is greater than that of electric cars, and the charging power is also several times greater than that used in electric cars; this can result in high energy consumption and negatively impact power distribution networks. This paper proposes a framework to determine the optimal contracted power capacity and charging schedule of an EB charging station in such a way that energy costs can be reduced. A mathematical model of controlled charging, which includes the capacity and energy charges of the station, was developed to minimize costs. The constraints of the model include the charging characteristics of an EB and the operational guidelines of the bus company. A practical EB charging station was used to verify the proposed model. The financial viability of this EB charging station is also studied in this paper. The economic analysis model for this charging station considers investment and operational costs, and the operational revenue. Sensitivity analyses with respect to some key parameters are also performed in this paper. Based on actual operational routes and EB charging schemes, test results indicate that the EB charging station investment is feasible, and the planning model proposed can be used to determine optimal station power capacity and minimize energy costs.
Photoionization of water molecules by high energy photons
Directory of Open Access Journals (Sweden)
Lara Martini
2017-07-01
Full Text Available We theoretically study the photoionization of water molecules by high energy photon impact. We develop a model in which the final state wavefunction is given by a Coulomb continuum wavefunction with effective charges and the water molecule bound states are represented using the Moccia's monocentric wavefunctions. We obtain analytical expressions for the transition matrix element that enable the computation of cross sections by numerical quadratures. We compare our predictions for photon energies between 20 and 300 eV with more elaborated theoretical results and experiments. We obtain a very good agreement with experiments, in particular, at enough high energies where there is a lack of elaborated results due to their high computational cost. Received: 15 March 2017, Accepted: 25 June 2017; Edited by: S. Kais; DOI: http://dx.doi.org/10.4279/PIP.090006 Cite as: L Martini, D I R Boll, O A Fojón, Papers in Physics 9, 090006 (2017
Interactions of electrons with biologically important molecules
International Nuclear Information System (INIS)
Pisklova, K.; Papp, P.; Stano, M.
2012-01-01
For the study of interactions of low-energy electrons with the molecules in the gas phase, the authors used electron-molecule cross-beam apparatus. The experiment is carried out in high vacuum, where molecules of the tested compound are inducted through a capillary. For purposes of this experiment the sample was electrically heated to 180 Deg C., giving a bundle of GlyGly molecules into the gas phase. The resulting signals can be evaluated in two different modes: mass spectrum - at continuous electron energy (e.g. 100 eV) they obtained the signal of intensity of the ions according to their mass to charge ratio; ionization and resonance spectra - for selected ion mass when the authors received the signal of intensity of the ions, depending on the energy of interacting electron.
Hydration of a Large Anionic Charge Distribution - Naphthalene-Water Cluster Anions
Weber, J. Mathias; Adams, Christopher L.
2010-06-01
We report the infrared spectra of anionic clusters of naphthalene with up to three water molecules. Comparison of the experimental infrared spectra with theoretically predicted spectra from quantum chemistry calculations allow conclusions regarding the structures of the clusters under study. The first water molecule forms two hydrogen bonds with the π electron system of the naphthalene moiety. Subsequent water ligands interact with both the naphthalene and the other water ligands to form hydrogen bonded networks, similar to other hydrated anion clusters. Naphthalene-water anion clusters illustrate how water interacts with negative charge delocalized over a large π electron system. The clusters are interesting model systems that are discussed in the context of wetting of graphene surfaces and polyaromatic hydrocarbons.
A theoretical-electron-density databank using a model of real and virtual spherical atoms.
Nassour, Ayoub; Domagala, Slawomir; Guillot, Benoit; Leduc, Theo; Lecomte, Claude; Jelsch, Christian
2017-08-01
A database describing the electron density of common chemical groups using combinations of real and virtual spherical atoms is proposed, as an alternative to the multipolar atom modelling of the molecular charge density. Theoretical structure factors were computed from periodic density functional theory calculations on 38 crystal structures of small molecules and the charge density was subsequently refined using a density model based on real spherical atoms and additional dummy charges on the covalent bonds and on electron lone-pair sites. The electron-density parameters of real and dummy atoms present in a similar chemical environment were averaged on all the molecules studied to build a database of transferable spherical atoms. Compared with the now-popular databases of transferable multipolar parameters, the spherical charge modelling needs fewer parameters to describe the molecular electron density and can be more easily incorporated in molecular modelling software for the computation of electrostatic properties. The construction method of the database is described. In order to analyse to what extent this modelling method can be used to derive meaningful molecular properties, it has been applied to the urea molecule and to biotin/streptavidin, a protein/ligand complex.
Internal Structure of Charged Particles in a GRT Gravitational Model
Khlestkov, Yu. A.; Sukhanova, L. A.
2018-05-01
With the help of an exact solution of the Einstein and Maxwell equations, the internal structure of a multiply connected space of wormhole type with two unclosed static throats leading out of it into two parallel vacuum spaces or into one space is investigated in GRT for a free electric field and dust-like matter. The given geometry is considered as a particle-antiparticle pair with fundamental constants arising in the form of first integrals in the solution of the Cauchy problem - electric charges ±e of opposite sign in the throats and rest mass m0 - the total gravitational mass of the inner world of the particle in the throat. With the help of the energy conservation law, the unremovable rotation of the internal structure is included and the projection of the angular momentum of which onto the rotation axis is identified with the z-projection of the spin of the charged particle. The radius of 2-Gaussian curvature of the throat R* is identified with the charge radius of the particle, and the z-projection of the magnetic moment and the g-factor are found. The feasibility of the given gravitational model is confirmed by the found condition of independence of the spin quantum number of the electron and the proton s = 1/2 of the charge radius R* and the relativistic rest mass m* of the rotating throat, which is reliably confirmed experimentally, and also by the coincidence with high accuracy of the proton radius calculated in the model R*p = 0.8412·10-13 cm with the value of the proton charge radius obtained experimentally by measuring the Lamb shift on muonic hydrogen. The electron in the given model also turns out to be a structured particle with radius R*e = 3.8617·10-11 cm.
Discrete Element Modeling (DEM) of Triboelectrically Charged Particles: Revised Experiments
Hogue, Michael D.; Calle, Carlos I.; Curry, D. R.; Weitzman, P. S.
2008-01-01
In a previous work, the addition of basic screened Coulombic electrostatic forces to an existing commercial discrete element modeling (DEM) software was reported. Triboelectric experiments were performed to charge glass spheres rolling on inclined planes of various materials. Charge generation constants and the Q/m ratios for the test materials were calculated from the experimental data and compared to the simulation output of the DEM software. In this paper, we will discuss new values of the charge generation constants calculated from improved experimental procedures and data. Also, planned work to include dielectrophoretic, Van der Waals forces, and advanced mechanical forces into the software will be discussed.
Integrated DEM-CFD modeling of the contact charging of pneumatically conveyed powders
Korevaar, M.W.; Padding, J.T.; Hoef, van der M.A.; Kuipers, J.A.M.
2014-01-01
A model is proposed that incorporates contact charging (also known as triboelectric charging) of pneumatically conveyed powders in a DEM–CFD framework, which accounts for the electrostatic interactions, both between particles and between the particles and conducting walls. The simulation results
Integrated DEM–CFD modeling of the contact charging of pneumatically conveyed powders
Korevaar, M.W.; Padding, J.T.; van der Hoef, Martin Anton; Kuipers, J.A.M.
2014-01-01
A model is proposed that incorporates contact charging (also known as triboelectric charging) of pneumatically conveyed powders in a DEM–CFD framework, which accounts for the electrostatic interactions, both between particles and between the particles and conducting walls. The simulation results
On well-posedness of variational models of charged drops.
Muratov, Cyrill B; Novaga, Matteo
2016-03-01
Electrified liquids are well known to be prone to a variety of interfacial instabilities that result in the onset of apparent interfacial singularities and liquid fragmentation. In the case of electrically conducting liquids, one of the basic models describing the equilibrium interfacial configurations and the onset of instability assumes the liquid to be equipotential and interprets those configurations as local minimizers of the energy consisting of the sum of the surface energy and the electrostatic energy. Here we show that, surprisingly, this classical geometric variational model is mathematically ill-posed irrespective of the degree to which the liquid is electrified. Specifically, we demonstrate that an isolated spherical droplet is never a local minimizer, no matter how small is the total charge on the droplet, as the energy can always be lowered by a smooth, arbitrarily small distortion of the droplet's surface. This is in sharp contrast to the experimental observations that a critical amount of charge is needed in order to destabilize a spherical droplet. We discuss several possible regularization mechanisms for the considered free boundary problem and argue that well-posedness can be restored by the inclusion of the entropic effects resulting in finite screening of free charges.
Zheng, Zilong
2017-05-08
We investigate the impact of electronic polarization, charge delocalization, and energetic disorder on the charge-transfer (CT) states formed at a planar C60/pentacene interface. The ability to examine large complexes containing up to seven pentacene molecules and three C60 molecules allows us to take explicitly into account the electronic polarization effects. These complexes are extracted from a bilayer architecture modeled by molecular dynamics simulations and evaluated by means of electronic-structure calculations based on long-range-separated functionals (ωB97XD and BNL) with optimized range-separation parameters. The energies of the lowest charge-transfer states derived for the large complexes are in very good agreement with the experimentally reported values. The average singlet-triplet energy splittings of the lowest CT states are calculated not to exceed 10 meV. The rates of geminate recombination as well as of dissociation of the triplet excitons are also evaluated. In line with experiment, our results indicate that the pentacene triplet excitons generated through singlet fission can dissociate into separated charges on a picosecond time scale, despite the fact that their energy in C60/pentacene heterojunctions is slightly lower than the energies of the lowest CT triplet states.
Electrolyte effects in a model of proton discharge on charged electrodes
Wiebe, Johannes; Kravchenko, Kateryna; Spohr, Eckhard
2015-01-01
We report results on the influence of NaCl electrolyte dissolved in water on proton discharge reactions from aqueous solution to charged platinum electrodes. We have extended a recently developed combined proton transfer/proton discharge model on the basis of empirical valence bond theory to include NaCl solutions with several different concentrations of cations and anions, both stoichiometric (1:1) compositions and non-stoichiometric ones with an excess of cations. The latter solutions partially screen the electrostatic potential from the surface charge of the negatively charged electrode. 500-1000 trajectories of a discharging proton were integrated by molecular dynamics simulations until discharge occurred, or for at most 1.5 ns. The results show a strong dependence on ionic strength, but only a weak dependence on the screening behavior, when comparing stoichiometric and non-stoichiometric solutions. Overall, the Na+ cations exert a more dominant effect on the discharge reaction, which we argue is likely due to the very rigid arrangements of the cations on the negatively polarized electrode surface. Thus, our model predicts, for the given and very high negative surface charge densities, the fastest discharge reaction for pure water, but obviously cannot take into account the fact that such high charge densities are even more out of reach experimentally than for higher electrolyte concentrations.
Abbasi, Amirali; Sardroodi, Jaber Jahanbin
2018-06-01
Based on the density functional theory (DFT) calculations, we explored the sensing capabilities and electronic structures of TiO2/Stanene heterostructures as novel and highly efficient materials for detection of toxic NO2 and O3 molecules in the environment. Studied gas molecules were positioned at different sites and orientations towards the nanocomposite, and the adsorption process was examined based on the most stable structures. We found that both of these molecules are chemically adsorbed on the TiO2/Stanene heterostructures. The calculations of the adsorption energy indicate that the fivefold coordinated titanium sites of the TiO2/Stanene are the most stable sites for the adsorption of NO2 and O3 molecules. The side oxygen atoms of the gas molecules were found to be chemically bonded to these titanium atoms. The adsorption of gas molecules is an exothermic process, and the adsorption on the pristine nanocomposite is more favorable in energy than that on the nitrogen-doped nanocomposite. The effects of van der Waals interactions were taken into account, which indicate the adsorption energies were increased for the most sable configurations. The gas sensing response and charge transfers were analyzed in detail. The pristine nanocomposites have better sensing response than the doped ones. The spin density distribution plots indicate that the magnetization was mainly located over the adsorbed gas molecules. Mulliken charge analysis reveals that both NO2 and O3 molecules behave as charge acceptors, as evidenced by the accumulation of electronic charges on the adsorbed molecules predicted by charge density difference calculations. Our DFT results provide a theoretical basis for an innovative gas sensor system designed from a sensitive TiO2/Stanene heterostructures for efficient detection of harmful air pollutants such as NO2 and O3.
Surface Charge Transfer Doping of Monolayer Phosphorene via Molecular Adsorption.
He, Yuanyuan; Xia, Feifei; Shao, Zhibin; Zhao, Jianwei; Jie, Jiansheng
2015-12-03
Monolayer phosphorene has attracted much attention owing to its extraordinary electronic, optical, and structural properties. Rationally tuning the electrical transport characteristics of monolayer phosphorene is essential to its applications in electronic and optoelectronic devices. Herein, we study the electronic transport behaviors of monolayer phosphorene with surface charge transfer doping of electrophilic molecules, including 2,3,5,6-tetrafluoro-7,7,8,8-tetracyanoquinodimethane (F4TCNQ), NO2, and MoO3, using density functional theory combined with the nonequilibrium Green's function formalism. F4TCNQ shows optimal performance in enhancing the p-type conductance of monolayer phosphorene. Static electronic properties indicate that the enhancement is originated from the charge transfer between adsorbed molecule and phosphorene layer. Dynamic transport behaviors demonstrate that additional channels for hole transport in host monolayer phosphorene were generated upon the adsorption of molecule. Our work unveils the great potential of surface charge transfer doping in tuning the electronic properties of monolayer phosphorene and is of significance to its application in high-performance devices.
Latychevskaia, Tatiana; Wicki, Flavio; Longchamp, Jean-Nicolas; Escher, Conrad; Fink, Hans-Werner
2016-09-14
Visualizing individual charges confined to molecules and observing their dynamics with high spatial resolution is a challenge for advancing various fields in science, ranging from mesoscopic physics to electron transfer events in biological molecules. We show here that the high sensitivity of low-energy electrons to local electric fields can be employed to directly visualize individual charged adsorbates and to study their behavior in a quantitative way. This makes electron holography a unique probing tool for directly visualizing charge distributions with a sensitivity of a fraction of an elementary charge. Moreover, spatial resolution in the nanometer range and fast data acquisition inherent to lens-less low-energy electron holography allows for direct visual inspection of charge transfer processes.
Analytical estimation of effective charges at saturation in Poisson-Boltzmann cell models
International Nuclear Information System (INIS)
Trizac, Emmanuel; Aubouy, Miguel; Bocquet, Lyderic
2003-01-01
We propose a simple approximation scheme for computing the effective charges of highly charged colloids (spherical or cylindrical with infinite length). Within non-linear Poisson-Boltzmann theory, we start from an expression for the effective charge in the infinite-dilution limit which is asymptotically valid for large salt concentrations; this result is then extended to finite colloidal concentration, approximating the salt partitioning effect which relates the salt content in the suspension to that of a dialysing reservoir. This leads to an analytical expression for the effective charge as a function of colloid volume fraction and salt concentration. These results compare favourably with the effective charges at saturation (i.e. in the limit of large bare charge) computed numerically following the standard prescription proposed by Alexander et al within the cell model
Charge states of ions, and mechanisms of charge ordering transitions
Pickett, Warren E.; Quan, Yundi; Pardo, Victor
2014-07-01
To gain insight into the mechanism of charge ordering transitions, which conventionally are pictured as a disproportionation of an ion M as 2Mn+→M(n+1)+ + M(n-1)+, we (1) review and reconsider the charge state (or oxidation number) picture itself, (2) introduce new results for the putative charge ordering compound AgNiO2 and the dual charge state insulator AgO, and (3) analyze the cationic occupations of the actual (not formal) charge, and work to reconcile the conundrums that arise. We establish that several of the clearest cases of charge ordering transitions involve no disproportion (no charge transfer between the cations, and hence no charge ordering), and that the experimental data used to support charge ordering can be accounted for within density functional-based calculations that contain no charge transfer between cations. We propose that the charge state picture retains meaning and importance, at least in many cases, if one focuses on Wannier functions rather than atomic orbitals. The challenge of modeling charge ordering transitions with model Hamiltonians isdiscussed.
Mobility of charge carriers in porous silicon layers
International Nuclear Information System (INIS)
Forsh, P. A.; Martyshov, M. N.; Latysheva, A. P.; Vorontsov, A. S.; Timoshenko, V. Yu.; Kashkarov, P. K.
2008-01-01
The (conduction) mobility of majority charge carriers in porous silicon layers of the n and p types is estimated by joint measurements of electrical conductivity and free charge carrier concentration, which is determined from IR absorption spectra. Adsorption of donor and acceptor molecules leading to a change in local electric fields in the structure is used to identify the processes controlling the mobility in porous silicon. It is found that adsorption of acceptor and donor molecules at porous silicon of the p and n types, respectively, leads to a strong increase in electrical conductivity, which is associated with an increase in the concentration of free carrier as well as in their mobility. The increase in the mobility of charge carriers as a result of adsorption indicates the key role of potential barriers at the boundaries of silicon nanocrystals and may be due to a decrease in the barrier height as a result of adsorption
Charged and neutral minimal supersymmetric standard model Higgs ...
Indian Academy of Sciences (India)
physics pp. 759–763. Charged and neutral minimal supersymmetric standard model Higgs boson decays and measurement of tan β at the compact linear collider. E CONIAVITIS and A FERRARI∗. Department of Nuclear and Particle Physics, Uppsala University, 75121 Uppsala, Sweden. ∗E-mail: ferrari@tsl.uu.se. Abstract.
Molecular spintronics using single-molecule magnets
Bogani, Lapo; Wernsdorfer, Wolfgang
2008-03-01
A revolution in electronics is in view, with the contemporary evolution of the two novel disciplines of spintronics and molecular electronics. A fundamental link between these two fields can be established using molecular magnetic materials and, in particular, single-molecule magnets. Here, we review the first progress in the resulting field, molecular spintronics, which will enable the manipulation of spin and charges in electronic devices containing one or more molecules. We discuss the advantages over more conventional materials, and the potential applications in information storage and processing. We also outline current challenges in the field, and propose convenient schemes to overcome them.
Numerical analysis of ion wind flow using space charge for optimal design
Ko, Han Seo; Shin, Dong Ho; Baek, Soo Hong
2014-11-01
Ion wind flow has been widly studied for its advantages of a micro fluidic device. However, it is very difficult to predict the performance of the ion wind flow for various conditions because of its complicated electrohydrodynamic phenomena. Thus, a reliable numerical modeling is required to design an otimal ion wind generator and calculate velocity of the ion wind for the proper performance. In this study, the numerical modeling of the ion wind has been modified and newly defined to calculate the veloctiy of the ion wind flow by combining three basic models such as electrostatics, electrodynamics and fluid dynamics. The model has included presence of initial space charges to calculate transfer energy between space charges and air gas molecules using a developed space charge correlation. The simulation has been performed for a geometry of a pin to parallel plate electrode. Finally, the results of the simulation have been compared with the experimental data for the ion wind velocity to confirm the accuracy of the modified numerical modeling and to obtain the optimal design of the ion wind generator. This work was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Korean government (MEST) (No. 2013R1A2A2A01068653).
Observation of excited state charge transfer with fs/ps-CARS
International Nuclear Information System (INIS)
Blom, Alex Jason
2009-01-01
Excited state charge transfer processes are studied using the fs/ps-CARS probe technique. This probe allows for multiplexed detection of Raman active vibrational modes. Systems studied include Michler's Ketone, Coumarin 120, 4-dimethylamino-4(prime)-nitrostilbene, and several others. The vibrational spectrum of the para di-substituted benzophenone Michler's Ketone in the first excited singlet state is studied for the first time. It is found that there are several vibrational modes indicative of structural changes of the excited molecule. A combined experimental and theoretical approach is used to study the simplest 7-amino-4-methylcoumarin, Coumarin 120. Vibrations observed in FTIR and spontaneous Raman spectra are assigned using density functional calculations and a continuum solvation model is used to predict how observed modes are affected upon inclusion of a solvent. The low frequency modes of the excited state charge transfer species 4-dimethylamino-4(prime)-nitrostilbene are studied in acetonitrile. Results are compared to previous work on this molecule in the fingerprint region. Finally, several partially completed projects and their implications are discussed. These include the two photon absorption of Coumarin 120, nanoconfinement in cyclodextrin cavities and sensitization of titania nanoparticles
Observation of excited state charge transfer with fs/ps-CARS
Energy Technology Data Exchange (ETDEWEB)
Blom, Alex Jason [Iowa State Univ., Ames, IA (United States)
2009-01-01
Excited state charge transfer processes are studied using the fs/ps-CARS probe technique. This probe allows for multiplexed detection of Raman active vibrational modes. Systems studied include Michler's Ketone, Coumarin 120, 4-dimethylamino-4'-nitrostilbene, and several others. The vibrational spectrum of the para di-substituted benzophenone Michler's Ketone in the first excited singlet state is studied for the first time. It is found that there are several vibrational modes indicative of structural changes of the excited molecule. A combined experimental and theoretical approach is used to study the simplest 7-amino-4-methylcoumarin, Coumarin 120. Vibrations observed in FTIR and spontaneous Raman spectra are assigned using density functional calculations and a continuum solvation model is used to predict how observed modes are affected upon inclusion of a solvent. The low frequency modes of the excited state charge transfer species 4-dimethylamino-4{prime}-nitrostilbene are studied in acetonitrile. Results are compared to previous work on this molecule in the fingerprint region. Finally, several partially completed projects and their implications are discussed. These include the two photon absorption of Coumarin 120, nanoconfinement in cyclodextrin cavities and sensitization of titania nanoparticles.
Heiles, Sven; Cooper, Richard J.; DiTucci, Matthew J.
2017-01-01
Sequential water molecule binding enthalpies, ΔH n,n–1, are important for a detailed understanding of competitive interactions between ions, water and solute molecules, and how these interactions affect physical properties of ion-containing nanodrops that are important in aerosol chemistry. Water molecule binding enthalpies have been measured for small clusters of many different ions, but these values for ion-containing nanodrops containing more than 20 water molecules are scarce. Here, ΔH n,n–1 values are deduced from high-precision ultraviolet photodissociation (UVPD) measurements as a function of ion identity, charge state and cluster size between 20–500 water molecules and for ions with +1, +2 and +3 charges. The ΔH n,n–1 values are obtained from the number of water molecules lost upon photoexcitation at a known wavelength, and modeling of the release of energy into the translational, rotational and vibrational motions of the products. The ΔH n,n–1 values range from 36.82 to 50.21 kJ mol–1. For clusters containing more than ∼250 water molecules, the binding enthalpies are between the bulk heat of vaporization (44.8 kJ mol–1) and the sublimation enthalpy of bulk ice (51.0 kJ mol–1). These values depend on ion charge state for clusters with fewer than 150 water molecules, but there is a negligible dependence at larger size. There is a minimum in the ΔH n,n–1 values that depends on the cluster size and ion charge state, which can be attributed to the competing effects of ion solvation and surface energy. The experimental ΔH n,n–1 values can be fit to the Thomson liquid drop model (TLDM) using bulk ice parameters. By optimizing the surface tension and temperature change of the logarithmic partial pressure for the TLDM, the experimental sequential water molecule binding enthalpies can be fit with an accuracy of ±3.3 kJ mol–1 over the entire range of cluster sizes. PMID:28451364
Modeling space charge in beams for heavy-ion fusion
International Nuclear Information System (INIS)
Sharp, W.M.
1995-01-01
A new analytic model is presented which accurately estimates the radially averaged axial component of the space-charge field of an axisymmetric heavy-ion beam in a cylindrical beam pipe. The model recovers details of the field near the beam ends that are overlooked by simpler models, and the results compare well to exact solutions of Poisson's equation. Field values are shown for several simple beam profiles and are compared with values obtained from simpler models
Harris, Christopher; Stace, Anthony J
2018-03-15
A series of experiments have been undertaken on the fragmentation of multiply charged ammonia clusters, (NH 3 ) n z+ , where z ≤ 8 and n ≤ 850, to establish Rayleigh instability limits, whereby clusters at certain critical sizes become unstable due to Coulomb repulsion between the resident charges. Experimental results on size-selected clusters are found to be in excellent agreement with theoretical predictions of Rayleigh instability limits at all values of the charge. Electrostatic theory has been used to help identify fragmentation patterns on the assumption that the clusters separate into two dielectric spheres, and the predicted Coulomb repulsion energies used to establish pathways and the sizes of cluster fragments. The results show that fragmentation is very asymmetric in terms of both the numbers of molecules involved and the amount of charge each fragment accommodates. For clusters carrying a charge ≤+4, the results show that fragmentation proceeds via the loss of small, singly charged clusters. When clusters carry a charge of +5 or more, the experimental observations suggest a marked switch in behavior. Although the laboratory measurements equate to fragmentation via the loss of a large dication cluster, electrostatic theory supports an interpretation that involves the sequential loss of two smaller, singly charged clusters possibly accompanied by the extensive evaporation of neutral molecules. It is suggested that this change in fragmentation pattern is driven by the channelling of Coulomb repulsion energy into intermolecular modes within these larger clusters. Overall, the results appear to support the ion evaporation model that is frequently used to interpret electrospray experiments.
Capozza, R.; Vanossi, A.; Benassi, A.; Tosatti, E.
2015-02-01
Electrical charging of parallel plates confining a model ionic liquid down to nanoscale distances yields a variety of charge-induced changes in the structural features of the confined film. That includes even-odd switching of the structural layering and charging-induced solidification and melting, with important changes of local ordering between and within layers, and of squeezout behavior. By means of molecular dynamics simulations, we explore this variety of phenomena in the simplest charged Lennard-Jones coarse-grained model including or excluding the effect a neutral tail giving an anisotropic shape to one of the model ions. Using these models and open conditions permitting the flow of ions in and out of the interplate gap, we simulate the liquid squeezout to obtain the distance dependent structure and forces between the plates during their adiabatic approach under load. Simulations at fixed applied force illustrate an effective electrical pumping of the ionic liquid, from a thick nearly solid film that withstands the interplate pressure for high plate charge to complete squeezout following melting near zero charge. Effective enthalpy curves obtained by integration of interplate forces versus distance show the local minima that correspond to layering and predict the switching between one minimum and another under squeezing and charging.
DEFF Research Database (Denmark)
Bjørnholm, Thomas
2010-01-01
Bianthrone is a sterically hindered compound that exists in the form of two nonplanar isomers. Our experimental study of single-molecule junctions with bianthrone reveals persistent switching of electric conductance at low temperatures, which can be reasonably associated with molecular isomerizat...
Biradical and triradical organic magnetic molecules as spin filters and rectifiers
Energy Technology Data Exchange (ETDEWEB)
Zhu, L. [School of Physics, School of Optoelectronics Science and Engineering, Wuhan Pulsed Magnetic Field Center, Huazhong University of Science and Technology, Wuhan 430074 (China); Yao, K.L., E-mail: klyao@hust.edu.cn [School of Physics, School of Optoelectronics Science and Engineering, Wuhan Pulsed Magnetic Field Center, Huazhong University of Science and Technology, Wuhan 430074 (China); International Center of Materials Physics, Chinese Academy of Science, Shengyang 110015 (China); Liu, Z.L. [School of Physics, School of Optoelectronics Science and Engineering, Wuhan Pulsed Magnetic Field Center, Huazhong University of Science and Technology, Wuhan 430074 (China)
2012-03-13
Graphical abstract: (a) Negative differential resistance (NDR) characteristic and antiparallel spin-current (ASC) rectification; (b) spin-current (SC) rectification and charge-current (CC) rectification properties Display Omitted Highlights: Black-Right-Pointing-Pointer Organic magnetic molecules at gold electrodes as spin/charge rectifier. Black-Right-Pointing-Pointer Spin diode/rectification stems from length and asymmetry of molecular framework. Black-Right-Pointing-Pointer Negative differential resistance, spin-filtering and switching evidenced. - Abstract: We have theoretically investigated the spin-polarized transport properties of molecular junctions consisting of biradical and triradical organic magnetic molecules sandwiched between two symmetric gold electrodes, respectively. It shows that these junctions function as a spin rectifier or a combination of spin and charge rectifiers with high spin rectification ratios exceeding 100, wherein the spin diode/rectification effect stems from the conjugated length and asymmetry of the molecular framework, which is the pre-requisite for electronic asymmetry of the adsorbed species. The negative differential resistance, spin-filtering and switching properties are also unveiled. In particular, it is revealed that the strong couplings between the electrodes and molecules are responsible for the negative differential resistance.
Adsorption of CO molecules on doped graphene: A first-principles study
Directory of Open Access Journals (Sweden)
Weidong Wang
2016-02-01
Full Text Available As a typical kinds of toxic gases, CO plays an important role in environmental monitoring, control of chemical processes, space missions, agricultural and medical applications. Graphene is considered a potential candidate of gases sensor, so the adsorption of CO molecules on various graphene, including pristine graphene, Nitrogen-doped graphene (N-doped graphene and Aluminum-doped graphene (Al-doped graphene, are studied by using first-principles calculations. The optimal configurations, adsorption energies, charge transfer, and electronic properties including band structures, density of states and differential charge density are obtained. The adsorption energies of CO molecules on pristine graphene and N-doped graphene are −0.01 eV, and −0.03 eV, respectively. In comparison, the adsorption energy of CO on Al-doped graphene is much larger, −2.69 eV. Our results also show that there occurs a large amount of charge transfer between CO molecules and graphene sheet after the adsorption, which suggests Al-doped graphene is more sensitive to the adsorption of CO than pristine graphene and N-doped graphene. Therefore, the sensitivity of gases on graphene can be drastically improved by introducing the suitable dopants.
Effect of Surface Hydration on Antifouling Properties of Mixed Charged Polymers.
Leng, Chuan; Huang, Hao; Zhang, Kexin; Hung, Hsiang-Chieh; Xu, Yao; Li, Yaoxin; Jiang, Shaoyi; Chen, Zhan
2018-05-07
Interfacial water structure on a polymer surface in water (or surface hydration) is related to the antifouling activity of the polymer. Zwitterionic polymer materials exhibit excellent antifouling activity due to their strong surface hydration. It was proposed to replace zwitterionic polymers using mixed charged polymers because it is much easier to prepare mixed charged polymer samples with much lower costs. In this study, using sum frequency generation (SFG) vibrational spectroscopy, we investigated interfacial water structures on mixed charged polymer surfaces in water, and how such structures change while exposing to salt solutions and protein solutions. The 1:1 mixed charged polymer exhibits excellent antifouling property while other mixed charged polymers with different ratios of the positive/negative charges do not. It was found that on the 1:1 mixed charged polymer surface, SFG water signal is dominated by the contribution of the strongly hydrogen bonded water molecules, indicating strong hydration of the polymer surface. The responses of the 1:1 mixed charged polymer surface to salt solutions are similar to those of zwitterionic polymers. Interestingly, exposure to high concentrations of salt solutions leads to stronger hydration of the 1:1 mixed charged polymer surface after replacing the salt solution with water. Protein molecules do not substantially perturb the interfacial water structure on the 1:1 mixed charged polymer surface and do not adsorb to the surface, showing that this mixed charged polymer is an excellent antifouling material.
International Nuclear Information System (INIS)
Ho, Minhhuy; Schmider, H.; Edgecombe, K.E.
1994-01-01
Topological properties of the charge density p(→) of a series of diatomic molecules, as well as ethane, ethene, and acetylene are calculated at the Hartree-Fock level employing various basis sets, and by the AM1 method. The effect of the core orbitals on the bonding regions in these molecules is examined. The results help to evaluate the utility of AM1 wavefunctions for analyzing the topological properties of the charge density
Solitary Model of the Charge Particle Transport in Collisionless Plasma
International Nuclear Information System (INIS)
Simonchik, L.V.; Trukhachev, F.M.
2006-01-01
The one-dimensional MHD solitary model of charged particle transport in plasma is developed. It is shown that self-consistent electric field of ion-acoustic solitons can displace charged particles in space, which can be a reason of local electric current generation. The displacement amount is order of a few Debye lengths. It is shown that the current associated with soliton cascade has pulsating nature with DC component. Methods of built theory verification in dusty plasma are proposed
In-transit charging lane model
Verkerk, A.; Nijmeijer, H.; Khajepour, A.
2012-01-01
The current electric vehicles still have a problem with a short range and long charging time compared to the internal combustion vehicles. A possible solution for this problem is to charge the batteries while driving on the highway. For this, a special traffic lane is needed with an in-transit
International Nuclear Information System (INIS)
Turner, R.E.
1984-01-01
A search was made for fractional charges of the form Z plus two-thirds e, where Z is an integer. It was assumed that the charges exist in natural form bound with other fractional charges in neutral molecules. It was further assumed that these neutral molecules are present in air. Two concentration schemes were employed. One sample was derived from the waste gases from a xenon distillation plant. This assumes that high mass, low vapor pressure components of air are concentrated along with the xenon. The second sample involved ionizing air, allowing a brief recombination period, and then collecting residual ions on the surface of titanium discs. Both samples were analyzed at the University of Rochester in a system using a tandem Van de Graff to accelerate particles through an essentially electrostatic beam handling system. The detector system employed both a Time of Flight and an energy-sensitive gas ionization detector. In the most sensitive mode of analysis, a gas absorber was inserted in the beam path to block the intense background. The presence of an absorber limited the search to highly penetrating particles. Effectively, this limited the search to particles with low Z and masses greater than roughly fifty GeV. The final sensitivities attained were on the order of 1 x 10 -20 for the ionized air sample and 1 x 10 -21 for the gas sample. A discussion of the caveats that could reduce the actual level of sensitivity is included
Directory of Open Access Journals (Sweden)
Joris de Hoog
2018-03-01
Full Text Available Fast charging is an exciting topic in the field of electric and hybrid electric vehicles (EVs/HEVs. In order to achieve faster charging times, fast-charging applications involve high-current profiles which can lead to high cell temperature increase, and in some cases thermal runaways. There has been some research on the impact caused by fast-charging profiles. This research is mostly focused on the electrical, thermal and aging aspects of the cell individually, but these factors are never treated together. In this paper, the thermal progression of the lithium-ion battery under specific fast-charging profiles is investigated and modeled. The cell is a Lithium Nickel Manganese Cobalt Oxide/graphite-based cell (NMC rated at 20 Ah, and thermal images during fast-charging have been taken at four degradation states: 100%, 90%, 85%, and 80% State-of-Health (SoH. A semi-empirical resistance aging model is developed using gathered data from extensive cycling and calendar aging tests, which is coupled to an electrothermal model. This novel combined model achieves good agreement with the measurements, with simulation results always within 2 °C of the measured values. This study presents a modeling methodology that is usable to predict the potential temperature distribution for lithium-ion batteries (LiBs during fast-charging profiles at different aging states, which would be of benefit for Battery Management Systems (BMS in future thermal strategies.
Improving Charge Injection in Organic Electronic Devices Using Self-Assembled Monolayers
Campbell, I. H.; Kress, J. D.; Martin, R. L.; Smith, D. L.; Barashkov, N. N.; Ferraris, J. P.
1997-03-01
Organic electronic devices consist of one or more insulating organic layers contacted by metallic conductors. The Schottky energy barrier between the metal and the organic material is determined by the work function of the metal contact as described in the ideal Schottky model. The magnitude of the metal/organic Schottky energy barrier controls charge injection from the metal into the organic layer. Previously, polar alkane-thiol based self-assembled monolayers (SAMs) were used to change the Schottky energy barrier between the metal and an organic film by more than 1 eV. In these SAMs, the large energy gap of the alkane molecules blocks charge injection into the organic layer despite the decrease of the Schottky energy barrier. Here, we demonstrate improved charge injection into the organic material by using conjugated self-assembled monolayers. The conjugated SAMs have modest energy gaps which allow improved charge injection into the organic layer. We present measurements of current-voltage characteristics and metal/organic Schottky energy barriers for device structures both with and without conjugated SAMs.
Electrical manipulation of oligonucleotides grafted to charged surfaces.
Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc
2006-09-21
The electrical manipulation of short DNA molecules on surfaces offers novel functionalities with fascinating possibilities in the field of bio-interfaces. Here we present systematic investigations of the electrical interactions which govern the structure of oligonucleotides on charged gold surfaces. Successively, we address influences of the applied field strength, the role of DC electrode potentials, in particular for polycrystalline surfaces, as well as screening effects of the surrounding electrolyte solution. Data obtained for single and double stranded DNA exhibit differences which can be attributed to the dissimilar flexibility of the different molecular conformations. A comparison of the experimental results with a basic model shows how the alignment of the molecules adjusts according to a balance between electrically induced ordering and stochastic thermal motions. The presented conclusions are expected to be of general relevance for the behaviour of polyelectrolytes exposed to localized electric fields at interfaces.
Wang, Dai; Gao, Junyu; Li, Pan; Wang, Bin; Zhang, Cong; Saxena, Samveg
2017-08-01
Modeling PEV travel and charging behavior is the key to estimate the charging demand and further explore the potential of providing grid services. This paper presents a stochastic simulation methodology to generate itineraries and charging load profiles for a population of PEVs based on real-world vehicle driving data. In order to describe the sequence of daily travel activities, we use the trip chain model which contains the detailed information of each trip, namely start time, end time, trip distance, start location and end location. A trip chain generation method is developed based on the Naive Bayes model to generate a large number of trips which are temporally and spatially coupled. We apply the proposed methodology to investigate the multi-location charging loads in three different scenarios. Simulation results show that home charging can meet the energy demand of the majority of PEVs in an average condition. In addition, we calculate the lower bound of charging load peak on the premise of lowest charging cost. The results are instructive for the design and construction of charging facilities to avoid excessive infrastructure.
Bardhan, Jaydeep P; Knepley, Matthew G
2014-10-07
We show that charge-sign-dependent asymmetric hydration can be modeled accurately using linear Poisson theory after replacing the standard electric-displacement boundary condition with a simple nonlinear boundary condition. Using a single multiplicative scaling factor to determine atomic radii from molecular dynamics Lennard-Jones parameters, the new model accurately reproduces MD free-energy calculations of hydration asymmetries for: (i) monatomic ions, (ii) titratable amino acids in both their protonated and unprotonated states, and (iii) the Mobley "bracelet" and "rod" test problems [D. L. Mobley, A. E. Barber II, C. J. Fennell, and K. A. Dill, "Charge asymmetries in hydration of polar solutes," J. Phys. Chem. B 112, 2405-2414 (2008)]. Remarkably, the model also justifies the use of linear response expressions for charging free energies. Our boundary-element method implementation demonstrates the ease with which other continuum-electrostatic solvers can be extended to include asymmetry.
International Nuclear Information System (INIS)
Bardhan, Jaydeep P.; Knepley, Matthew G.
2014-01-01
We show that charge-sign-dependent asymmetric hydration can be modeled accurately using linear Poisson theory after replacing the standard electric-displacement boundary condition with a simple nonlinear boundary condition. Using a single multiplicative scaling factor to determine atomic radii from molecular dynamics Lennard-Jones parameters, the new model accurately reproduces MD free-energy calculations of hydration asymmetries for: (i) monatomic ions, (ii) titratable amino acids in both their protonated and unprotonated states, and (iii) the Mobley “bracelet” and “rod” test problems [D. L. Mobley, A. E. Barber II, C. J. Fennell, and K. A. Dill, “Charge asymmetries in hydration of polar solutes,” J. Phys. Chem. B 112, 2405–2414 (2008)]. Remarkably, the model also justifies the use of linear response expressions for charging free energies. Our boundary-element method implementation demonstrates the ease with which other continuum-electrostatic solvers can be extended to include asymmetry
Energy Technology Data Exchange (ETDEWEB)
Bardhan, Jaydeep P. [Department of Mechanical and Industrial Engineering, Northeastern University, Boston, Massachusetts 02115 (United States); Knepley, Matthew G. [Computation Institute, The University of Chicago, Chicago, Illinois 60637 (United States)
2014-10-07
We show that charge-sign-dependent asymmetric hydration can be modeled accurately using linear Poisson theory after replacing the standard electric-displacement boundary condition with a simple nonlinear boundary condition. Using a single multiplicative scaling factor to determine atomic radii from molecular dynamics Lennard-Jones parameters, the new model accurately reproduces MD free-energy calculations of hydration asymmetries for: (i) monatomic ions, (ii) titratable amino acids in both their protonated and unprotonated states, and (iii) the Mobley “bracelet” and “rod” test problems [D. L. Mobley, A. E. Barber II, C. J. Fennell, and K. A. Dill, “Charge asymmetries in hydration of polar solutes,” J. Phys. Chem. B 112, 2405–2414 (2008)]. Remarkably, the model also justifies the use of linear response expressions for charging free energies. Our boundary-element method implementation demonstrates the ease with which other continuum-electrostatic solvers can be extended to include asymmetry.
Calvo, Florent; Bacchus-Montabonel, Marie-Christine
2018-01-01
Recent photochemistry experiments provided evidence for the formation of hydantoin by irradiation of interstellar ice analogues. The significance of these results and the importance of hydantoin in prebiotic chemistry and polypeptide synthesis motivate the present theoretical investigation, in which we analyzed the effects of stepwise hydration on the electronic and thermodynamical properties of the structure of microhydrated hydantoin using a variety of computational approaches. We generally find microhydration to proceed around the hydantoin heterocycle until 5 water molecules are reached, at which stage hydration becomes segregated with a water cluster forming aside the heterocycle. The reactivity of microhydrated hydantoin caused by an impinging proton was evaluated through charge transfer collision cross sections for microhydrated compounds but also for hydantoin on icy grains modeled using a cluster approach mimicking the true hexagonal ice surface. The effects of hydration on charge transfer efficiency are mostly significant when few water molecules are present, and they progressively weaken and stabilize in larger clusters. On the ice substrate, charge transfer essentially contributes to a global increase in the cross sections.
Single Molecule Conductance of Oligothiophene Derivatives
Dell, Emma J.
to sample similar conformers. This work demonstrates that the conductance of bithiophene displays a strong dependence on the conformational fluctuations accessible within a given junction configuration, and that the symmetry of such small molecules can significantly influence their conductance behavior. Next, the single-molecule conductance of a family of oligothiophenes comprising one to six thiophene units was measured. An anomalous behavior was found: the peak of the conductance histogram distribution did not follow a clear exponential decay with increasing number of thiophene units in the chain. The electronic properties of the materials were characterized by optical spectroscopy and electrochemistry to gain an understanding of the factors affecting the conductance of these molecules. Different conformers in the junction were postulated to be a contributing factor to the anomalous trend in the observed conductance as a function of molecule length. Then, the electronic properties of the thiophene-1,1-dioxide unit were investigated. These motifs have become synthetically accessible in the last decade, due to Rozen's unprecedentedly potent oxidizing reagent - HOF˙CH 3CN - which has been shown to be powerful yet selective enough to oxidize thiophenes in various environments. The resulting thiophene-1,1-dioxides show great promise for electronic devices. The oxidation chemistry of thiophenes was expanded and tuning of the frontier energy levels was demonstrated through combining electron poor and electron rich units. Finally, charge carriers in single-molecule junctions were shown to be tunable within a family of molecules containing these thiophene-1,1-dioxide (TDO) building blocks. Oligomers of TDO were designed in order to increase electron affinity, maintain delocalized frontier orbitals, while significantly decreasing the transport gap. Through thermopower measurements, the dominant charge carriers were shown to change from holes to electrons as the number of
Volpi, Riccardo; Nassau, Racine; Nørby, Morten Steen; Linares, Mathieu
2016-09-21
We study, within Marcus theory, the possibility of the charge-transfer (CT) state splitting at organic interfaces and a subsequent transport of the free charge carriers to the electrodes. As a case study we analyze model anthracene-C60 interfaces. Kinetic Monte Carlo (KMC) simulations on the cold CT state were performed at a range of applied electric fields, and with the fields applied at a range of angles to the interface to simulate the action of the electric field in a bulk heterojunction (BHJ) interface. The results show that the inclusion of polarization in our model increases CT state dissociation and charge collection. The effect of the electric field on CT state splitting and free charge carrier conduction is analyzed in detail with and without polarization. Also, depending on the relative orientation of the anthracene and C60 molecules at the interface, CT state splitting shows different behavior with respect to both applied field strength and applied field angle. The importance of the hot CT in helping the charge carrier dissociation is also analyzed in our scheme.
Volpi, Riccardo; Camilo, Ana Claudia Santos; Filho, Demetrio A da Silva; Navarrete, Juan T López; Gómez-Lor, Berta; Delgado, M Carmen Ruiz; Linares, Mathieu
2017-09-13
We have performed a multiscale approach to study the influence of peripheral substitution in the semiconducting properties of discotic liquid-crystalline triindoles. Charge carrier mobility as high as 1.4 cm 2 V -1 s -1 was experimentally reported for triindoles substituted with alkynyl chains on the periphery (Gómez-Lor et al. Angew. Chem., Int. Ed., 2011, 50, 7399-7402). In this work, our goal is to get a deeper understanding of both the molecular electronic structure and microscopic factors affecting the charge transport properties in triindoles as a function of the spacer group connecting the central cores with the external alkyl chains (i.e., alkyne or phenyl spacers groups). To this end, we first perform Quantum Mechanical (QM) calculations to assess how the peripheral substitution affects the electronic structure and the internal reorganization energy. Secondly, boxes of stacked molecules were built and relaxed through molecular dynamics to obtain realistic structures. Conformational analysis and calculations of transfer integrals for closed neighbours were performed. Our results show that the insertion of ethynyl spacers between the central aromatic core and the flexible peripheral chains results in lower reorganization energies and enhanced intermolecular order within the stacks with a preferred cofacial 60° staggered conformation, which would result in high charge-carrier mobilities in good agreement with the experimental data. This work allows a deeper understanding of charge carrier mobility in columnar phases, linking the structural order at the molecular level to the property of interest, i.e. the charge carrier mobility. We hope that this understanding will improve the design of systems at the supramolecular level aiming at obtaining a more defined conducting channel, higher mobility and smaller fluctuations within the column.
Bagheri, Shahriar; Wu, Nan; Filizadeh, Shaahin
2018-06-01
This paper presents an iterative numerical method that accurately models an energy harvesting system charging a capacitor with piezoelectric patches. The constitutive relations of piezoelectric materials connected with an external charging circuit with a diode bridge and capacitors lead to the electromechanical coupling effect and the difficulty of deriving accurate transient mechanical response, as well as the charging progress. The proposed model is built upon the Euler-Bernoulli beam theory and takes into account the electromechanical coupling effects as well as the dynamic process of charging an external storage capacitor. The model is validated through experimental tests on a cantilever beam coated with piezoelectric patches. Several parametric studies are performed and the functionality of the model is verified. The efficiency of power harvesting system can be predicted and tuned considering variations in different design parameters. Such a model can be utilized to design robust and optimal energy harvesting system.
Islam, Nazmul; Ghosh, Dulal C
2012-01-01
Electrophilicity is an intrinsic property of atoms and molecules. It probably originates logistically with the involvement in the physical process of electrostatics of soaked charge in electronic shells and the screened nuclear charge of atoms. Motivated by the existing view of conceptual density functional theory that similar to electronegativity and hardness equalization, there should be a physical process of equalization of electrophilicity during the chemical process of formation of hetero nuclear molecules, we have developed a new theoretical scheme and formula for evaluating the electrophilicity of hetero nuclear molecules. A comparative study with available bench marking reveals that the hypothesis of electrophilicity and equalization, and the present method of evaluating equalized electrophilicity, are scientifically promising.
Directory of Open Access Journals (Sweden)
Dulal C. Ghosh
2012-02-01
Full Text Available Electrophilicity is an intrinsic property of atoms and molecules. It probably originates logistically with the involvement in the physical process of electrostatics of soaked charge in electronic shells and the screened nuclear charge of atoms. Motivated by the existing view of conceptual density functional theory that similar to electronegativity and hardness equalization, there should be a physical process of equalization of electrophilicity during the chemical process of formation of hetero nuclear molecules, we have developed a new theoretical scheme and formula for evaluating the electrophilicity of hetero nuclear molecules. A comparative study with available bench marking reveals that the hypothesis of electrophilicity and equalization, and the present method of evaluating equalized electrophilicity, are scientifically promising.
Directory of Open Access Journals (Sweden)
Yongjun Ahn
Full Text Available The charging infrastructure location problem is becoming more significant due to the extensive adoption of electric vehicles. Efficient charging station planning can solve deeply rooted problems, such as driving-range anxiety and the stagnation of new electric vehicle consumers. In the initial stage of introducing electric vehicles, the allocation of charging stations is difficult to determine due to the uncertainty of candidate sites and unidentified charging demands, which are determined by diverse variables. This paper introduces the Estimating the Required Density of EV Charging (ERDEC stations model, which is an analytical approach to estimating the optimal density of charging stations for certain urban areas, which are subsequently aggregated to city level planning. The optimal charging station's density is derived to minimize the total cost. A numerical study is conducted to obtain the correlations among the various parameters in the proposed model, such as regional parameters, technological parameters and coefficient factors. To investigate the effect of technological advances, the corresponding changes in the optimal density and total cost are also examined by various combinations of technological parameters. Daejeon city in South Korea is selected for the case study to examine the applicability of the model to real-world problems. With real taxi trajectory data, the optimal density map of charging stations is generated. These results can provide the optimal number of chargers for driving without driving-range anxiety. In the initial planning phase of installing charging infrastructure, the proposed model can be applied to a relatively extensive area to encourage the usage of electric vehicles, especially areas that lack information, such as exact candidate sites for charging stations and other data related with electric vehicles. The methods and results of this paper can serve as a planning guideline to facilitate the extensive
Ahn, Yongjun; Yeo, Hwasoo
2015-01-01
The charging infrastructure location problem is becoming more significant due to the extensive adoption of electric vehicles. Efficient charging station planning can solve deeply rooted problems, such as driving-range anxiety and the stagnation of new electric vehicle consumers. In the initial stage of introducing electric vehicles, the allocation of charging stations is difficult to determine due to the uncertainty of candidate sites and unidentified charging demands, which are determined by diverse variables. This paper introduces the Estimating the Required Density of EV Charging (ERDEC) stations model, which is an analytical approach to estimating the optimal density of charging stations for certain urban areas, which are subsequently aggregated to city level planning. The optimal charging station's density is derived to minimize the total cost. A numerical study is conducted to obtain the correlations among the various parameters in the proposed model, such as regional parameters, technological parameters and coefficient factors. To investigate the effect of technological advances, the corresponding changes in the optimal density and total cost are also examined by various combinations of technological parameters. Daejeon city in South Korea is selected for the case study to examine the applicability of the model to real-world problems. With real taxi trajectory data, the optimal density map of charging stations is generated. These results can provide the optimal number of chargers for driving without driving-range anxiety. In the initial planning phase of installing charging infrastructure, the proposed model can be applied to a relatively extensive area to encourage the usage of electric vehicles, especially areas that lack information, such as exact candidate sites for charging stations and other data related with electric vehicles. The methods and results of this paper can serve as a planning guideline to facilitate the extensive adoption of electric
International Nuclear Information System (INIS)
Wang Lei; Xu Guang; Shi Zhikun; Jiang Wei; Jin Wenrui
2007-01-01
We developed a sensitive single-molecule imaging method for quantification of protein by total internal reflection fluorescence microscopy with adsorption equilibrium. In this method, the adsorption equilibrium of protein was achieved between solution and glass substrate. Then, fluorescence images of protein molecules in a evanescent wave field were taken by a highly sensitive electron multiplying charge coupled device. Finally, the number of fluorescent spots corresponding to the protein molecules in the images was counted. Alexa Fluor 488-labeled goat anti-rat IgG(H + L) was chosen as the model protein. The spot number showed an excellent linear relationship with protein concentration. The concentration linear range was 5.4 x 10 -11 to 8.1 x 10 -10 mol L -1
Modeling of radiation-induced charge trapping in MOS devices under ionizing irradiation
Energy Technology Data Exchange (ETDEWEB)
Petukhov, M. A., E-mail: m.a.petukhov@gmail.com; Ryazanov, A. I. [National Research Center Kurchatov Institute (Russian Federation)
2016-12-15
The numerical model of the radiation-induced charge trapping process in the oxide layer of a MOS device under ionizing irradiation is developed; the model includes carrier transport, hole capture by traps in different states, recombination of free electrons and trapped holes, kinetics of hydrogen ions which can be accumulated in the material during transistor manufacture, and accumulation and charging of interface states. Modeling of n-channel MOSFET behavior under 1 MeV photon irradiation is performed. The obtained dose dependences of the threshold voltage shift and its contributions from trapped holes and interface states are in good agreement with experimental data.
Tunnel magnetoresistance of magnetic molecules with spin-vibron coupling
Directory of Open Access Journals (Sweden)
Ahmed Kenawy
2017-05-01
Full Text Available The effect of molecular vibrations on the tunnel magnetoresistance (TMR of a magnetic tunnel junction with a single spin-anisotropic molecule interconnecting its electrodes is investigated theoretically. We demonstrate that if these vibrations couple at the same time to the charge of tunneling electrons and to the spin of the molecule, the spin anisotropy of such a molecule becomes enhanced. This has, in turn, a profound impact on the TMR of such a device showing that molecular vibrations lead to a significant change of spin-polarized transport, differing for the parallel and antiparallel magnetic configuration of the junction.
A Massless-Point-Charge Model for the Electron
Directory of Open Access Journals (Sweden)
Daywitt W. C.
2010-04-01
Full Text Available “It is rather remarkable that the modern concept of electrodynamics is not quite 100 years old and yet still does not rest firmly upon uniformly accepted theoretical foun- dations. Maxwell’s theory of the electromagnetic field is firmly ensconced in modern physics, to be sure, but the details of how charged particles are to be coupled to this field remain somewhat uncertain, despite the enormous advances in quantum electrody- namics over the past 45 years. Our theories remain mathematically ill-posed and mired in conceptual ambiguities which quantum mechanics has only moved to another arena rather than resolve. Fundamentally, we still do not understand just what is a charged particle” [1, p.367]. As a partial answer to the preceeding quote, this paper presents a new model for the electron that combines the seminal work of Puthoff [2] with the theory of the Planck vacuum (PV [3], the basic idea for the model following from [2] with the PV theory adding some important details.
A Massless-Point-Charge Model for the Electron
Directory of Open Access Journals (Sweden)
Daywitt W. C.
2010-04-01
Full Text Available "It is rather remarkable that the modern concept of electrodynamics is not quite 100 years old and yet still does not rest firmly upon uniformly accepted theoretical foundations. Maxwell's theory of the electromagnetic field is firmly ensconced in modern physics, to be sure, but the details of how charged particles are to be coupled to this field remain somewhat uncertain, despite the enormous advances in quantum electrodynamics over the past 45 years. Our theories remain mathematically ill-posed and mired in conceptual ambiguities which quantum mechanics has only moved to another arena rather than resolve. Fundamentally, we still do not understand just what is a charged particle" (Grandy W.T. Jr. Relativistic quantum mechanics of leptons and fields. Kluwer Academic Publishers, Dordrecht-London, 1991, p.367. As a partial answer to the preceeding quote, this paper presents a new model for the electron that combines the seminal work of Puthoff with the theory of the Planck vacuum (PV, the basic idea for the model following from Puthoff with the PV theory adding some important details.
Computational Modeling of Biological Systems From Molecules to Pathways
2012-01-01
Computational modeling is emerging as a powerful new approach for studying and manipulating biological systems. Many diverse methods have been developed to model, visualize, and rationally alter these systems at various length scales, from atomic resolution to the level of cellular pathways. Processes taking place at larger time and length scales, such as molecular evolution, have also greatly benefited from new breeds of computational approaches. Computational Modeling of Biological Systems: From Molecules to Pathways provides an overview of established computational methods for the modeling of biologically and medically relevant systems. It is suitable for researchers and professionals working in the fields of biophysics, computational biology, systems biology, and molecular medicine.
A Monte Carlo modeling on charging effect for structures with arbitrary geometries
Li, C.; Mao, S. F.; Zou, Y. B.; Li, Yong Gang; Zhang, P.; Li, H. M.; Ding, Z. J.
2018-04-01
Insulating materials usually suffer charging effects when irradiated by charged particles. In this paper, we present a Monte Carlo study on the charging effect caused by electron beam irradiation for sample structures with any complex geometry. When transporting in an insulating solid, electrons encounter elastic and inelastic scattering events; the Mott cross section and a Lorentz-type dielectric function are respectively employed to describe such scatterings. In addition, the band gap and the electron–long optical phonon interaction are taken into account. The electronic excitation in inelastic scattering causes generation of electron–hole pairs; these negative and positive charges establish an inner electric field, which in turn induces the drift of charges to be trapped by impurities, defects, vacancies etc in the solid, where the distributions of trapping sites are assumed to have uniform density. Under charging conditions, the inner electric field distorts electron trajectories, and the surface electric potential dynamically alters secondary electron emission. We present, in this work, an iterative modeling method for a self-consistent calculation of electric potential; the method has advantages in treating any structure with arbitrary complex geometry, in comparison with the image charge method—which is limited to a quite simple boundary geometry. Our modeling is based on: the combination of the finite triangle mesh method for an arbitrary geometry construction; a self-consistent method for the spatial potential calculation; and a full dynamic description for the motion of deposited charges. Example calculations have been done to simulate secondary electron yield of SiO2 for a semi-infinite solid, the charging for a heterostructure of SiO2 film grown on an Au substrate, and SEM imaging of a SiO2 line structure with rough surfaces and SiO2 nanoparticles with irregular shapes. The simulations have explored interesting interlaced charge layer distribution
Physical stage of photosynthesis charge separation
Yakovlev, A. G.; Shuvalov, V. A.
2016-06-01
An analytical review is given concerning the biophysical aspects of light-driven primary charge separation in photosynthesis reaction centers (RCs) which are special pigment-protein complexes residing in a cell membrane. The primary (physical) stage of charge separation occurs in the pico- and femtosecond ranges and consists of transferring an electron along the active A-branch of pigments. The review presents vast factual material on both the general issues of primary photosynthesis and some more specific topics, including (1) the role of the inactive B-branch of pigments, (2) the effect of the protein environment on the charge separation, and (3) the participation of monomeric bacteriochlorophyll BA in primary electron acceptance. It is shown that the electron transfer and stabilization are strongly influenced by crystallographic water and tyrosine M210 molecules from the nearest environment of BA. A linkage between collective nuclear motions and electron transfer upon charge separation is demonstrated. The nature of the high quantum efficiency of primary charge separation reactions is discussed.
Koole, Max; Thijssen, Jos M.; Valkenier, Hennie; Hummelen, Jan C.; van der Zant, Herre S. J.
It is understood that molecular conjugation plays an important role in charge transport through single-molecule junctions. Here, we investigate electron transport through an anthraquinone based single-molecule three-terminal device. With the use of an electric-field induced by a gate electrode, the
Single-molecule conductance of redox molecules in electrochemical scanning tunneling microscopy
DEFF Research Database (Denmark)
Haiss, W.; Albrecht, Tim; van Zalinge, H.
2007-01-01
of a maximum in the I-tunneling versus electrode potential relationship can be fitted by a "soft" gating concept. This arises from large configurational fluctuations of the molecular bridge linked to the gold contacts by flexible chains. This view is incorporated in a formalism that is well-suited for data...... analysis and reproduces in all important respects the 6V6 data for physically sound values of the appropriate parameters. This study demonstrates that fluctuations of isolated configurationally "soft" molecules can dominate charge transport patterns and that theoretical frameworks for compact monolayers...
Plasmonic tunnel junctions for single-molecule redox chemistry.
de Nijs, Bart; Benz, Felix; Barrow, Steven J; Sigle, Daniel O; Chikkaraddy, Rohit; Palma, Aniello; Carnegie, Cloudy; Kamp, Marlous; Sundararaman, Ravishankar; Narang, Prineha; Scherman, Oren A; Baumberg, Jeremy J
2017-10-20
Nanoparticles attached just above a flat metallic surface can trap optical fields in the nanoscale gap. This enables local spectroscopy of a few molecules within each coupled plasmonic hotspot, with near thousand-fold enhancement of the incident fields. As a result of non-radiative relaxation pathways, the plasmons in such sub-nanometre cavities generate hot charge carriers, which can catalyse chemical reactions or induce redox processes in molecules located within the plasmonic hotspots. Here, surface-enhanced Raman spectroscopy allows us to track these hot-electron-induced chemical reduction processes in a series of different aromatic molecules. We demonstrate that by increasing the tunnelling barrier height and the dephasing strength, a transition from coherent to hopping electron transport occurs, enabling observation of redox processes in real time at the single-molecule level.
A new theoretical model for scattering of electrons by molecules. 1
International Nuclear Information System (INIS)
Peixoto, E.M.A.; Mu-tao, L.; Nogueira, J.C.
1975-01-01
A new theoretical model for electron-molecule scattering is suggested. The e-H 2 scattering is studied and the superiority of the new model over the commonly used Independent Atom Model (IAM) is demonstrated. Comparing theoretical and experimental data for 40keV electrons scattered by H 2 utilizing the new model, its validity is proved, while Partial Wave and First Born calculations, employing the Independent Atom Model, strongly deviated from the experiment [pt
Double photoionisation spectra of molecules
Eland, John
2017-01-01
This book contains spectra of the doubly charged positive ions (dications) of some 75 molecules, including the major constituents of terrestrial and planetary atmospheres and prototypes of major chemical groups. It is intended to be a new resource for research in all areas of molecular spectroscopy involving high energy environments, both terrestrial and extra-terrestrial. All the spectra have been produced by photoionisation using laboratory lamps or synchrotron radiation and have been measured using the magnetic bottle time-of-flight technique by coincidence detection of correlated electron pairs. Full references to published work on the same species are given, though for several molecules these are the first published spectra. Double ionisation energies are listed and discussed in relation to the molecular electronic structure of the molecules. A full introduction to the field of molecular double ionisation is included and the mechanisms by which double photoionisation can occur are examined in detail. A p...
Computational models of an inductive power transfer system for electric vehicle battery charge
Anele, A. O.; Hamam, Y.; Chassagne, L.; Linares, J.; Alayli, Y.; Djouani, K.
2015-09-01
One of the issues to be solved for electric vehicles (EVs) to become a success is the technical solution of its charging system. In this paper, computational models of an inductive power transfer (IPT) system for EV battery charge are presented. Based on the fundamental principles behind IPT systems, 3 kW single phase and 22 kW three phase IPT systems for Renault ZOE are designed in MATLAB/Simulink. The results obtained based on the technical specifications of the lithium-ion battery and charger type of Renault ZOE show that the models are able to provide the total voltage required by the battery. Also, considering the charging time for each IPT model, they are capable of delivering the electricity needed to power the ZOE. In conclusion, this study shows that the designed computational IPT models may be employed as a support structure needed to effectively power any viable EV.
Computational models of an inductive power transfer system for electric vehicle battery charge
International Nuclear Information System (INIS)
Anele, A O; Hamam, Y; Djouani, K; Chassagne, L; Alayli, Y; Linares, J
2015-01-01
One of the issues to be solved for electric vehicles (EVs) to become a success is the technical solution of its charging system. In this paper, computational models of an inductive power transfer (IPT) system for EV battery charge are presented. Based on the fundamental principles behind IPT systems, 3 kW single phase and 22 kW three phase IPT systems for Renault ZOE are designed in MATLAB/Simulink. The results obtained based on the technical specifications of the lithium-ion battery and charger type of Renault ZOE show that the models are able to provide the total voltage required by the battery. Also, considering the charging time for each IPT model, they are capable of delivering the electricity needed to power the ZOE. In conclusion, this study shows that the designed computational IPT models may be employed as a support structure needed to effectively power any viable EV. (paper)
Directory of Open Access Journals (Sweden)
Mahammad A. Hannan
2017-09-01
Full Text Available This study aims to develop an accurate model of a charge equalization controller (CEC that manages individual cell monitoring and equalizing by charging and discharging series-connected lithium-ion (Li-ion battery cells. In this concept, an intelligent control algorithm is developed to activate bidirectional cell switches and control direct current (DC–DC converter switches along with pulse width modulation (PWM generation. Individual models of an electric vehicle (EV-sustainable Li-ion battery, optimal power rating, a bidirectional flyback DC–DC converter, and charging and discharging controllers are integrated to develop a small-scale CEC model that can be implemented for 10 series-connected Li-ion battery cells. Results show that the charge equalization controller operates at 91% efficiency and performs well in equalizing both overdischarged and overcharged cells on time. Moreover, the outputs of the CEC model show that the desired balancing level occurs at 2% of state of charge difference and that all cells are operated within a normal range. The configuration, execution, control, power loss, cost, size, and efficiency of the developed CEC model are compared with those of existing controllers. The proposed model is proven suitable for high-tech storage systems toward the advancement of sustainable EV technologies and renewable source of applications.
Bardhan, Jaydeep P.; Knepley, Matthew G.
2014-01-01
We show that charge-sign-dependent asymmetric hydration can be modeled accurately using linear Poisson theory after replacing the standard electric-displacement boundary condition with a simple nonlinear boundary condition. Using a single multiplicative scaling factor to determine atomic radii from molecular dynamics Lennard-Jones parameters, the new model accurately reproduces MD free-energy calculations of hydration asymmetries for: (i) monatomic ions, (ii) titratable amino acids in both their protonated and unprotonated states, and (iii) the Mobley “bracelet” and “rod” test problems [D. L. Mobley, A. E. Barber II, C. J. Fennell, and K. A. Dill, “Charge asymmetries in hydration of polar solutes,” J. Phys. Chem. B 112, 2405–2414 (2008)]. Remarkably, the model also justifies the use of linear response expressions for charging free energies. Our boundary-element method implementation demonstrates the ease with which other continuum-electrostatic solvers can be extended to include asymmetry. PMID:25296776
Experimental validation of calculated atomic charges in ionic liquids
Fogarty, Richard M.; Matthews, Richard P.; Ashworth, Claire R.; Brandt-Talbot, Agnieszka; Palgrave, Robert G.; Bourne, Richard A.; Vander Hoogerstraete, Tom; Hunt, Patricia A.; Lovelock, Kevin R. J.
2018-05-01
A combination of X-ray photoelectron spectroscopy and near edge X-ray absorption fine structure spectroscopy has been used to provide an experimental measure of nitrogen atomic charges in nine ionic liquids (ILs). These experimental results are used to validate charges calculated with three computational methods: charges from electrostatic potentials using a grid-based method (ChelpG), natural bond orbital population analysis, and the atoms in molecules approach. By combining these results with those from a previous study on sulfur, we find that ChelpG charges provide the best description of the charge distribution in ILs. However, we find that ChelpG charges can lead to significant conformational dependence and therefore advise that small differences in ChelpG charges (<0.3 e) should be interpreted with care. We use these validated charges to provide physical insight into nitrogen atomic charges for the ILs probed.
Effects of Charge-Transfer Excitons on the Photophysics of Organic Semiconductors
Hestand, Nicholas J.
The field of organic electronics has received considerable attention over the past several years due to the promise of novel electronic materials that are cheap, flexible and light weight. While some devices based on organic materials have already emerged on the market (e.g. organic light emitting diodes), a deeper understanding of the excited states within the condensed phase is necessary both to improve current commercial products and to develop new materials for applications that are currently in the commercial pipeline (e.g. organic photovoltaics, wearable displays, and field effect transistors). To this end, a model for pi-conjugated molecular aggregates and crystals is developed and analyzed. The model considers two types of electronic excitations, namely Frenkel and charge-transfer excitons, both of which play a prominent role in determining the nature of the excited states within tightly-packed organic systems. The former consist of an electron-hole pair bound to the same molecule while in the later the electron and hole are located on different molecules. The model also considers the important nuclear reorganization that occurs when the system switches between electronic states. This is achieved using a Holstein-style Hamiltonian that includes linear vibronic coupling of the electronic states to the nuclear motion associated with the high frequency vinyl-stretching and ring-breathing modes. Analysis of the model reveals spectroscopic signatures of charge-transfer mediated J- and H-aggregation in systems where the photophysical properties are determined primarily by charge-transfer interactions. Importantly, such signatures are found to be sensitive to the relative phase of the intermolecular electron and hole transfer integrals, and the relative energy of the Frenkel and charge-transfer states. When the charge-transfer integrals are in phase and the energy of the charge-transfer state is higher than the Frenkel state, the system exhibits J
Directory of Open Access Journals (Sweden)
Diogo de Jesus Medeiros
2013-01-01
Full Text Available The suitable computation of accurate atomic charges for the GROMACS topology *.itp files of small molecules, generated in the PRODRG server, has been a tricky task nowadays because it does not calculate atomic charges using an ab initio method. Usually additional steps of structure optimization and charges calculation, followed by a tedious manual replacement of atomic charges in the *.itp file, are needed. In order to assist this task, we report here the ITP Adjuster 1.0, a utility program developed to perform the replacement of the PRODRG charges in the *.itp files of small molecules by ab initio charges.
International Nuclear Information System (INIS)
Aubouy, Miguel; Trizac, Emmanuel; Bocquet, Lyderic
2003-01-01
We propose an analytical approximation for the dependence of the effective charge on the bare charge for spherical and cylindrical macro-ions as a function of the size of the colloid and salt content, for the situation of a unique colloid immersed in a sea of electrolyte (where the definition of an effective charge is non-ambiguous). Our approach is based on the Poisson-Boltzmann (PB) mean-field theory. Mathematically speaking, our estimate is asymptotically exact in the limit κa >> 1, where a is the radius of the colloid and κ is the inverse screening length. In practice, a careful comparison with effective charge parameters, obtained by numerically solving the full nonlinear PB theory, proves that our estimate is good down to κa ∼ 1. This is precisely the limit appropriate to treat colloidal suspensions. A particular emphasis is put on the range of parameters suitable to describe both single and double strand DNA molecules under physiological conditions
Unraveling the physics of nanofluidic phenomena at the single-molecule level
Energy Technology Data Exchange (ETDEWEB)
Fornasiero, Francesco [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2015-10-13
Despite groundbreaking potential in a broad application space, several nanofluidic phenomena remain poorly understood. Toward advancing the understanding of fluid behavior under nanoscale confinement, we developed a novel, ideal platform for fundamental molecular transport studies, in which the fluidic channel is a single carbon nanotube (CNT). CNTs offer the advantage of simple chemistry and structure, which can be synthetically tuned with nanometer precision and accurately modeled. With combined experimental and computational approaches, we demonstrated that CNT pores with 1-5 nm diameters conduct giant ionic currents that follow an unusual sublinear electrolyte concentration dependence. The large magnitude of the ionic conductance appears to originate from a strong electro-osmotic flow in smooth CNT pores. First-principle simulations suggest that electro-osmotic flow arises from localized negative polarization charges on carbon atoms near a potassium (K+) ion and from the strong cation-graphitic wall interactions, which drive K+ ions much closer to the wall than chlorides (Cl-). Single-molecule translocation studies reveal that charged molecules may be distinguished from neutral species on the basis of the sign of the transient current change during their passage through the nanopore. Together with shedding light on a few controversial questions in the CNT nanofluidics area, these results may benefit LLNL’s Security Mission by providing the foundation for the development of advanced single-molecule detection system for bio/chem/explosive analytes. In addition, these experimental and computational platforms can be applied to advance fundamental knowledge in other fields, from energy storage and membrane separation to superfluid physics.
An advanced Lithium-ion battery optimal charging strategy based on a coupled thermoelectric model
International Nuclear Information System (INIS)
Liu, Kailong; Li, Kang; Yang, Zhile; Zhang, Cheng; Deng, Jing
2017-01-01
Lithium-ion batteries are widely adopted as the power supplies for electric vehicles. A key but challenging issue is to achieve optimal battery charging, while taking into account of various constraints for safe, efficient and reliable operation. In this paper, a triple-objective function is first formulated for battery charging based on a coupled thermoelectric model. An advanced optimal charging strategy is then proposed to develop the optimal constant-current-constant-voltage (CCCV) charge current profile, which gives the best trade-off among three conflicting but important objectives for battery management. To be specific, a coupled thermoelectric battery model is first presented. Then, a specific triple-objective function consisting of three objectives, namely charging time, energy loss, and temperature rise (both the interior and surface), is proposed. Heuristic methods such as Teaching-learning-based-optimization (TLBO) and particle swarm optimization (PSO) are applied to optimize the triple-objective function, and their optimization performances are compared. The impacts of the weights for different terms in the objective function are then assessed. Experimental results show that the proposed optimal charging strategy is capable of offering desirable effective optimal charging current profiles and a proper trade-off among the conflicting objectives. Further, the proposed optimal charging strategy can be easily extended to other battery types.
Liu, Weiwen
The continual downsizing of the basic functional units used in the electronics industry has motivated the study of the quantum computation and related topics. To overcome the limitations of classical physics and engineering, some unique quantum mechanical features, especially entanglement and superpositions have begun to be considered as important properties for future bits. Including these quantum mechanical features is attractive because the ability to utilize quantum mechanics can dramatically enhance computational power. Among the various ways of constructing the basic building blocks for quantum computation, we are particularly interested in using spins inside epitaxially grown InAs/GaAs quantum dot molecules as quantum bits (qubits). The ability to design and engineer nanostructures with tailored quantum properties is critical to engineering quantum computers and other novel electro-optical devices and is one of the key challenges for scaling up new ideas for device application. In this thesis, we will focus on how the structure and composition of quantum dot molecules can be used to control spin properties and charge interactions. Tunable spin and charge properties can enable new, more scalable, methods of initializing and manipulating quantum information. In this thesis, we demonstrate one method to enable electric-field tunability of Zeeman splitting for a single electron spin inside a quantum dot molecules by using heterostructure engineering techniques to modify the barrier that separates quantum dots. We describe how these structural changes to the quantum dot molecules also change charge interactions and propose ways to use this effect to enable accurate measurement of coulomb interactions and possibly charge occupancy inside these complicated quantum dot molecules.
Biological Nanopores: Confined Spaces for Electrochemical Single-Molecule Analysis.
Cao, Chan; Long, Yi-Tao
2018-02-20
Nanopore sensing is developing into a powerful single-molecule approach to investigate the features of biomolecules that are not accessible by studying ensemble systems. When a target molecule is transported through a nanopore, the ions occupying the pore are excluded, resulting in an electrical signal from the intermittent ionic blockade event. By statistical analysis of the amplitudes, duration, frequencies, and shapes of the blockade events, many properties of the target molecule can be obtained in real time at the single-molecule level, including its size, conformation, structure, charge, geometry, and interactions with other molecules. With the development of the use of α-hemolysin to characterize individual polynucleotides, nanopore technology has attracted a wide range of research interest in the fields of biology, physics, chemistry, and nanoscience. As a powerful single-molecule analytical method, nanopore technology has been applied for the detection of various biomolecules, including oligonucleotides, peptides, oligosaccharides, organic molecules, and disease-related proteins. In this Account, we highlight recent developments of biological nanopores in DNA-based sensing and in studying the conformational structures of DNA and RNA. Furthermore, we introduce the application of biological nanopores to investigate the conformations of peptides affected by charge, length, and dipole moment and to study disease-related proteins' structures and aggregation transitions influenced by an inhibitor, a promoter, or an applied voltage. To improve the sensing ability of biological nanopores and further extend their application to a wider range of molecular sensing, we focus on exploring novel biological nanopores, such as aerolysin and Stable Protein 1. Aerolysin exhibits an especially high sensitivity for the detection of single oligonucleotides both in current separation and duration. Finally, to facilitate the use of nanopore measurements and statistical analysis
Electric Vehicle Fast-Charging Station Unified Modeling and Stability Analysis in the dq Frame
Directory of Open Access Journals (Sweden)
Xiang Wang
2018-05-01
Full Text Available The electric vehicle fast-charging station is an important guarantee for the popularity of electric vehicle. As the fast-charging piles are voltage source converters, stability issues will occur in the grid-connected fast-charging station. Since the dynamic input admittance of the fast-charging pile and the dynamic output impedance play an important role in the interaction system stability, the station and grid interaction system is regarded as load-side and source-side sub-systems to build the dynamic impedance model. The dynamic input admittance in matrix form is derived from the fast-charging pile current control loop considering the influence of the LC filter. Similarly, the dynamic output impedance can be obtained similarly by considering the regional power grid capacity, transformer capacity, and feed line length. On this basis, a modified forbidden region-based stability criterion is used for the fast-charging station stability analysis. The frequency-domain case studies and time-domain simulations are presented next to show the influence of factors from both the power grid side and fast-charging pile side. The simulation results validated the effectiveness of the dq frame impedance model and the stability analysis method.
Bond index: relation to second-order density matrix and charge fluctuations
International Nuclear Information System (INIS)
Giambiagi, M.S. de; Giambiagi, M.; Jorge, F.E.
1985-01-01
It is shown that, in the same way as the atomic charge is an invariant built from the first-order density matrix, the closed-shell generalized bond index is an invariant associated with the second-order reduced density matrix. The active charge of an atom (sum of bond indices) is shown to be the sum of all density correlation functions between it and the other atoms in the molecule; similarly, the self-charge is the fluctuation of its total charge. (Author) [pt
New directions in low energy electron molecule collision calculations
International Nuclear Information System (INIS)
Burke, P.G.; Noble, C.J.
1982-01-01
New theoretical and computational methods for studying low energy electron molecule collisions are discussed. Having considered the fixed-nuclei approximation and the form of the expansion of the total collision wavefunction, the various approximations which have been made are examined, including the static plus model exchange approximation, the static exchange approximation and the close coupling approximation, particular attention being paid to methods of including the molecular charge polarisation. Various ways which have been developed to solve the resultant equations are discussed and it is found that there is increasing emphasis being given to methods which combine the advantages of discrete multi-centre analytic bases with single centre numerical bases. (U.K.)
A MODEL FOR THE ELECTRICALLY CHARGED CURRENT SHEET OF A PULSAR
Energy Technology Data Exchange (ETDEWEB)
DeVore, C. R.; Antiochos, S. K.; Black, C. E. [Heliophysics Science Division, NASA Goddard Space Flight Center, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Harding, A. K.; Kalapotharakos, C.; Kazanas, D.; Timokhin, A. N., E-mail: c.richard.devore@nasa.gov [Astrophysics Science Division, NASA Goddard Space Flight Center, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States)
2015-03-10
Global-scale solutions for the magnetosphere of a pulsar consist of a region of low-lying, closed magnetic field near the star, bounded by opposite-polarity regions of open magnetic field along which the pulsar wind flows into space. Separating these open-field regions is a magnetic discontinuity—an electric current sheet—consisting of generally nonneutral plasma. We have developed a self-consistent model for the internal equilibrium structure of the sheet by generalizing the charge-neutral Vlasov/Maxwell equilibria of Harris and Hoh to allow for net electric charge. The resulting equations for the electromagnetic field are solved analytically and numerically. Our results show that the internal thermal pressure needed to establish equilibrium force balance, and the associated effective current-sheet thickness and magnetization, can differ by orders of magnitude from the Harris/Hoh charge-neutral limit. The new model provides a starting point for kinetic or fluid investigations of instabilities that can cause magnetic reconnection and flaring in pulsar magnetospheres.
Modelling of the charge carrier mobility in disordered linear polymer materials
Czech Academy of Sciences Publication Activity Database
Toman, Petr; Menšík, Miroslav; Bartkowiak, W.; Pfleger, Jiří
2017-01-01
Roč. 19, č. 11 (2017), s. 7760-7771 ISSN 1463-9076 R&D Projects: GA ČR(CZ) GA15-05095S Grant - others:AV ČR(CZ) M200501204 Program:M Institutional support: RVO:61389013 Keywords : charge carrier mobility * conjugated polymer * charge transport modelling Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 4.123, year: 2016
Riccardi, E; Wang, J-C; Liapis, A I
2010-08-28
The transport of a charged adsorbate biomolecule in a porous polymeric adsorbent medium and its adsorption onto the covalently immobilized ligands have been modeled and investigated using molecular dynamics modeling and simulations as the third part of a novel fundamental methodology developed for studying ion-exchange chromatography based bioseparations. To overcome computational challenges, a novel simulation approach is devised where appropriate atomistic and coarse grain models are employed simultaneously and the transport of the adsorbate is characterized through a number of locations representative of the progress of the transport process. The adsorbate biomolecule for the system studied in this work changes shape, orientation, and lateral position in order to proceed toward the site where adsorption occurs and exhibits decreased mass transport coefficients as it approaches closer to the immobilized ligand. Furthermore, because the ligands are surrounded by counterions carrying the same type of charge as the adsorbate biomolecule, it takes the biomolecule repeated attempts to approach toward a ligand in order to displace the counterions in the proximity of the ligand and to finally become adsorbed. The formed adsorbate-ligand complex interacts with the counterions and polymeric molecules and is found to evolve slowly and continuously from one-site (monovalent) interaction to multisite (multivalent) interactions. Such a transition of the nature of adsorption reduces the overall adsorption capacity of the ligands in the adsorbent medium and results in a type of surface exclusion effect. Also, the adsorption of the biomolecule also presents certain volume exclusion effects by not only directly reducing the pore volume and the availability of the ligands in the adjacent regions, but also causing the polymeric molecules to change to more compact structures that could further shield certain ligands from being accessible to subsequent adsorbate molecules. These
Electrical charging effects on the sliding friction of a model nano-confined ionic liquid
Energy Technology Data Exchange (ETDEWEB)
Capozza, R.; Vanossi, A. [International School for Advanced Studies (SISSA), Via Bonomea 265, 34136 Trieste (Italy); CNR-IOM Democritos National Simulation Center, Via Bonomea 265, 34136 Trieste (Italy); Benassi, A. [CNR-IOM Democritos National Simulation Center, Via Bonomea 265, 34136 Trieste (Italy); Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Tosatti, E. [International School for Advanced Studies (SISSA), Via Bonomea 265, 34136 Trieste (Italy); CNR-IOM Democritos National Simulation Center, Via Bonomea 265, 34136 Trieste (Italy); International Centre for Theoretical Physics (ICTP), Strada Costiera 11, 34014 Trieste (Italy)
2015-10-14
Recent measurements suggest the possibility to exploit ionic liquids (ILs) as smart lubricants for nano-contacts, tuning their tribological and rheological properties by charging the sliding interfaces. Following our earlier theoretical study of charging effects on nanoscale confinement and squeezout of a model IL, we present here molecular dynamics simulations of the frictional and lubrication properties of that model under charging conditions. First, we describe the case when two equally charged plates slide while being held together to a confinement distance of a few molecular layers. The shear sliding stress is found to rise strongly and discontinuously as the number of IL layers decreases stepwise. However, the shear stress shows, within each given number of layers, only a weak dependence upon the precise value of the normal load, a result in agreement with data extracted from recent experiments. We subsequently describe the case of opposite charging of the sliding plates and follow the shear stress when the charging is slowly and adiabatically reversed in the course of time, under fixed load. Despite the fixed load, the number and structure of the confined IL layers change with changing charge, and that in turn drives strong friction variations. The latter involves first of all charging-induced freezing of the IL film, followed by a discharging-induced melting, both made possible by the nanoscale confinement. Another mechanism for charging-induced frictional changes is a shift of the plane of maximum shear from mid-film to the plate-film interface, and vice versa. While these occurrences and results invariably depend upon the parameters of the model IL and upon its specific interaction with the plates, the present study helps identifying a variety of possible behavior, obtained under very simple assumptions, while connecting it to an underlying equilibrium thermodynamics picture.
The most negative ion in the Thomas-Fermi-von Weizsaecker theory of atoms and molecules
International Nuclear Information System (INIS)
Benguria, R.; Lieb, E.H.; Princeton Univ., NJ
1985-01-01
Let Nsub(c) denote the maximum number of electrons that can be bound to an atom of nuclear charge z, in the Thomas-Fermi-von Weizaecker theory. It is proved that Nsub(c) cannot exceed z by more than one, and thus this theory is in agreement with experimental facts about real atoms. A similar result is proved for molecules, i.e. Nsub(c) cannot exceed the total nuclear charge by more than the number of atoms in the molecule. (author)
Modeling of diatomic molecule using the Morse potential and the Verlet algorithm
Energy Technology Data Exchange (ETDEWEB)
Fidiani, Elok [Department of Physics, Parahyangan Catholic University, Bandung-Jawa Barat (Indonesia)
2016-03-11
Performing molecular modeling usually uses special software for Molecular Dynamics (MD) such as: GROMACS, NAMD, JMOL etc. Molecular dynamics is a computational method to calculate the time dependent behavior of a molecular system. In this work, MATLAB was used as numerical method for a simple modeling of some diatomic molecules: HCl, H{sub 2} and O{sub 2}. MATLAB is a matrix based numerical software, in order to do numerical analysis, all the functions and equations describing properties of atoms and molecules must be developed manually in MATLAB. In this work, a Morse potential was generated to describe the bond interaction between the two atoms. In order to analyze the simultaneous motion of molecules, the Verlet Algorithm derived from Newton’s Equations of Motion (classical mechanics) was operated. Both the Morse potential and the Verlet algorithm were integrated using MATLAB to derive physical properties and the trajectory of the molecules. The data computed by MATLAB is always in the form of a matrix. To visualize it, Visualized Molecular Dynamics (VMD) was performed. Such method is useful for development and testing some types of interaction on a molecular scale. Besides, this can be very helpful for describing some basic principles of molecular interaction for educational purposes.
Modeling of diatomic molecule using the Morse potential and the Verlet algorithm
International Nuclear Information System (INIS)
Fidiani, Elok
2016-01-01
Performing molecular modeling usually uses special software for Molecular Dynamics (MD) such as: GROMACS, NAMD, JMOL etc. Molecular dynamics is a computational method to calculate the time dependent behavior of a molecular system. In this work, MATLAB was used as numerical method for a simple modeling of some diatomic molecules: HCl, H_2 and O_2. MATLAB is a matrix based numerical software, in order to do numerical analysis, all the functions and equations describing properties of atoms and molecules must be developed manually in MATLAB. In this work, a Morse potential was generated to describe the bond interaction between the two atoms. In order to analyze the simultaneous motion of molecules, the Verlet Algorithm derived from Newton’s Equations of Motion (classical mechanics) was operated. Both the Morse potential and the Verlet algorithm were integrated using MATLAB to derive physical properties and the trajectory of the molecules. The data computed by MATLAB is always in the form of a matrix. To visualize it, Visualized Molecular Dynamics (VMD) was performed. Such method is useful for development and testing some types of interaction on a molecular scale. Besides, this can be very helpful for describing some basic principles of molecular interaction for educational purposes.
Kiiskinen, A P
2004-01-01
This thesis describes direct searches for pair production of charged Higgs bosons performed in the data collected by the DELPHI detector at the LEP collider at CERN. In addition, the possibilities to discover and study heavy charged Higgs bosons at possible future high-energy linear colliders are presented. The existence of charged Higgs bosons is predicted by many extensions of the Standard Model. A possible discovery of these particles would be a solid proof for physics beyond the Standard Model. Discovery of charged Higgs bosons, and measurement of their properties, would also provide useful information about the structure of the more general theory. New analysis methods were developed for the searches performed at LEP. A large, previously unexplored, mass range for cover but no evidence for the existence of the charged Higgs bosons was found. This allowed setting new lower mass limits for the charged Higgs boson within the framework of general two Higgs doublet models. Results have been interpreted and pr...
Measurement of Neutrino Induced, Charged Current, Charged Pion Production
Energy Technology Data Exchange (ETDEWEB)
Wilking, Michael Joseph [Univ. of Colorado, Boulder, CO (United States)
2009-05-01
Neutrinos are among the least understood particles in the standard model of particle physics. At neutrino energies in the 1 GeV range, neutrino properties are typically determined by observing the outgoing charged lepton produced in a charged current quasi-elastic interactions. The largest charged current background to these measurements comes from charged current pion production interactions, for which there is very little available data.
Detecting high-density ultracold molecules using atom–molecule collision
International Nuclear Information System (INIS)
Chen, Jun-Ren; Kao, Cheng-Yang; Chen, Hung-Bin; Liu, Yi-Wei
2013-01-01
Utilizing single-photon photoassociation, we have achieved ultracold rubidium molecules with a high number density that provides a new efficient approach toward molecular quantum degeneracy. A new detection mechanism for ultracold molecules utilizing inelastic atom–molecule collision is demonstrated. The resonant coupling effect on the formation of the X 1 Σ + g ground state 85 Rb 2 allows for a sufficient number of more deeply bound ultracold molecules, which induced an additional trap loss and heating of the co-existing atoms owing to the inelastic atom–molecule collision. Therefore, after the photoassociation process, the ultracold molecules can be investigated using the absorption image of the ultracold rubidium atoms mixed with the molecules in a crossed optical dipole trap. The existence of the ultracold molecules was then verified, and the amount of accumulated molecules was measured. This method detects the final produced ultracold molecules, and hence is distinct from the conventional trap loss experiment, which is used to study the association resonance. It is composed of measurements of the time evolution of an atomic cloud and a decay model, by which the number density of the ultracold 85 Rb 2 molecules in the optical trap was estimated to be >5.2 × 10 11 cm −3 . (paper)
Nemchinova, N. V.; Tyutrin, A. A.; Salov, V. M.
2018-03-01
The silicon production process in the electric arc reduction furnaces (EAF) is studied using pelletized charge as an additive to the standard on the basis of the generated mathematical model. The results obtained due to the model will contribute to the analysis of the charge components behavior during melting with the achievement of optimum final parameters of the silicon production process. The authors proposed using technogenic waste as a raw material for the silicon production in a pelletized form using liquid glass and aluminum production dust from the electrostatic precipitators as a binder. The method of mathematical modeling with the help of the ‘Selector’ software package was used as a basis for the theoretical study. A model was simulated with the imitation of four furnace temperature zones and a crystalline silicon phase (25 °C). The main advantage of the created model is the ability to analyze the behavior of all burden materials (including pelletized charge) in the carbothermic process. The behavior analysis is based on the thermodynamic probability data of the burden materials interactions in the carbothermic process. The model accounts for 17 elements entering the furnace with raw materials, electrodes and air. The silicon melt, obtained by the modeling, contained 91.73 % wt. of the target product. The simulation results showed that in the use of the proposed combined charge, the recovery of silicon reached 69.248 %, which is in good agreement with practical data. The results of the crystalline silicon chemical composition modeling are compared with the real silicon samples of chemical analysis data, which showed the results of convergence. The efficiency of the mathematical modeling methods in the studying of the carbothermal silicon obtaining process with complex interphase transformations and the formation of numerous intermediate compounds using a pelletized charge as an additive to the traditional one is shown.
Sadavarte, Rahul; Madadkar, Pedram; Filipe, Carlos Dm; Ghosh, Raja
2018-01-15
Monoclonal antibodies undergo various forms of chemical transformation which have been shown to cause loss in efficacy and alteration in pharmacokinetic properties of these molecules. Such modified antibody molecules are known as variants. They also display physical properties such as charge that are different from intact antibody molecules. However, the difference in charge is very subtle and separation based on it is quite challenging. Charge variants are usually separated using ion-exchange column chromatography or isoelectric focusing. In this paper, we report a rapid and scalable method for fractionating monoclonal antibody charge variants, based on the use of cation exchange laterally-fed membrane chromatography (LFMC). Starting with a sample of monoclonal antibody hIgG1-CD4, three well-resolved fractions were obtained using either pH or salt gradient. These fractions were identified as acidic, neutral and basic variants. Each of these fractions contained intact heavy and light chains and so antibody fragmentation had no role in variant generation. The separation was comparable to that using column chromatography but was an order of magnitude faster. Copyright © 2017 Elsevier B.V. All rights reserved.
Working fluid charge oriented off-design modeling of a small scale Organic Rankine Cycle system
International Nuclear Information System (INIS)
Liu, Liuchen; Zhu, Tong; Ma, Jiacheng
2017-01-01
Highlights: • Organic Rankine Cycle model considering working fluid charge has been established. • Overall solution algorithm of system off-design performance is proposed. • Variation trend of different zones in both heat exchangers can be observed. • Optimal working fluid charge volume for different output work has been estimated. - Abstract: Organic Rankine Cycle system is one of the most widely used technique for low-grade waste heat recovery. Developing of dynamic Organic Rankine Cycle models played an increasingly important part in system performance prediction. The present paper developed a working fluid charge oriented model for an small scale Organic Rankine Cycle to calculate the theoretical value of working fluid charge level for the system under rated condition. The two heat exchangers are divided into three different zones and related heat transfer correlations are employed to estimate the length variation of each zones. Steady state models have been applied to describe the performance of pump and expander. Afterwards, an overall solution algorithm based on the established model has been proposed in order to exact simulate the system’s off-design performance. Additionally, the impact of different working fluid charge volumes has also been discussed. Simulation results clearly shows the variation trend of different zones in both heat exchangers, as well as the variation trend of system operating parameters under various expander output work. Furthermore, the highest thermal efficiency can be reached 6.37% under rated conditions with a working fluid charge volume of 34.6 kg.
Modeling charge transfer at organic donor-acceptor semiconductor interfaces
Cakir, Deniz; Bokdam, Menno; de Jong, Machiel Pieter; Fahlman, M.; Brocks, G.
2012-01-01
We develop an integer charge transfer model for the potential steps observed at interfaces between donor and acceptor molecular semiconductors. The potential step can be expressed as the difference between the Fermi energy pinning levels of electrons on the acceptor material and holes on the donor
Charging and geometric effects on conduction through Anthracene molecular junctions
Kaur, Rupan Preet; Sawhney, Ravinder Singh; Engles, Derick
We studied the geometric effects on the charge transfer through the anthracenedithiol (ADT) molecular junction using density functional theory combined with the non-equilibrium Green’s function approach. Two major geometric aspects, bond length and bond angle, were moderated to optimize the electrical conduction. From the results established in this paper, we found that the electrical conduction can be tuned from 0.2 G0 to 0.9 G0 by varying the Au-S bond length, whereas the moderation of bonding angle assayed a minor change from 0.37 G0 to 0.47 G0. We attributed this escalating zero bias conductance to the increasing charge on the terminal sulfur atom of the ADT molecule, which increased the energy of the HOMO orbital towards Fermi level and exhibited a semi-metallic behaviour. Therefore, geometry plays a critical role in deciding the charge transport through the metal/molecule interface.
Analytic Models for Sunlight Charging of a Rapidly Spinning Satellite
National Research Council Canada - National Science Library
Tautz, Maurice
2003-01-01
... photoelectrons can be blocked by local potential barriers. In this report, we discuss two analytic models for sunlight charging of a rapidly spinning spherical satellite, both of which are based on blocked photoelectron currents...
Radical Chemistry and Charge Manipulation with an Atomic Force Microscope
Gross, Leo
The fuctionalization of tips by atomic manipulation dramatically increased the resolution of atomic force microscopy (AFM). The combination of high-resolution AFM with atomic manipulation now offers the unprecedented possibility to custom-design individual molecules by making and breaking bonds with the tip of the microscope and directly characterizing the products on the atomic scale. We recently applied this technique to generate and study reaction intermediates and to investigate chemical reactions trigged by atomic manipulation. We formed diradicals by dissociating halogen atoms and then reversibly triggered ring-opening and -closing reactions via atomic manipulation, allowing us to switch and control the molecule's reactivity, magnetic and optical properties. Additional information about charge states and charge distributions can be obtained by Kelvin probe force spectroscopy. On multilayer insulating films we investigated single-electron attachment, detachment and transfer between individual molecules. EU ERC AMSEL (682144), EU project PAMS (610446).
Minow, Joseph I.
2011-01-01
Internal charging is a risk to spacecraft in energetic electron environments. DICTAT, NU MIT computational codes are the most widely used engineering tools for evaluating internal charging of insulator materials exposed to these environments. Engineering tools are designed for rapid evaluation of ESD threats, but there is a need for more physics based models for investigating the science of materials interactions with energetic electron environments. Current tools are limited by the physics included in the models and ease of user implementation .... additional development work is needed to improve models.
Experimental study on pion capture by hydrogen bound in molecules
International Nuclear Information System (INIS)
Horvath, D.; Aniol, K.A.; Entezami, F.; Measday, D.F.; Noble, A.J.; Stanislaus, S.; Virtue, C.J.
1988-08-01
An experiment was performed at TRIUMF to study the formation of pionic hydrogen atoms and molecules in solids, particularly in groups of organic molecules of slightly different structure in order to help further clarify the problem. The nuclear capture of pions by hydrogen was measured using the charge exchange of stopped pions. The coincident photons emitted by the decaying π 0 mesons were detected by TRIUMF's two large NaI spectrometers. New experimental results were obtained for the capture probability of stopped π - mesons in the nuclei of hydrogen atoms, chemically bound in molecules of some simple hydrides, acid anhydrides, and sugar isomers. A linear relation was found between pion capture in hydrogen and melting point in sugar isomers. The pion capture probability in acid anhydrides is fairly well described by a simple atomic capture model in which the capture probability on the hydrogen dramatically increases as the hydrogen atom is separated from the strongly electronegative C 2 O 3 group. Both effects are consistent with a correlation between pion capture and electron density on hydrogen atoms. (Author) (38 refs., 4 tabs., 7 figs.)
International Nuclear Information System (INIS)
Balenzategui, J. L.
1999-01-01
A new way for the modelling of the charge and discharge processes in electrochemical batteries based on the use of integral equations is presented. The proposed method models the charge curves by the so called fractional or cumulative integrals of a certain objective function f(t) that must be sought. The charge figures can be easily fitted by breaking down this objective function as the addition of two different Lorentz type functions: the first one is associated to the own charge process and the second one to the overcharge process. The method allows calculating the starting voltage for overcharge as the intersection between both functions. The curve fitting of this model to different experimental charge curves, by using the Marquart algorithm, has shown very accurate results. In the case of discharge curves, two possible methods for modelling purposes are suggested, well by using the same kind of integral equations, well by the simple subtraction of an objective function f(t) from a constant value V O D. Many other aspects for the study and analysis of this method in order to improve its results in further developments are also discussed. (Author) 10 refs
Molecular electronics--resonant transport through single molecules.
Lörtscher, Emanuel; Riel, Heike
2010-01-01
The mechanically controllable break-junction technique (MCBJ) enables us to investigate charge transport through an individually contacted and addressed molecule in ultra-high vacuum (UHV) environment at variable temperature ranging from room temperature down to 4 K. Using a statistical measurement and analysis approach, we acquire current-voltage (I-V) characteristics during the repeated formation, manipulation, and breaking of a molecular junction. At low temperatures, voltages accessing the first molecular orbitals in resonance can be applied, providing spectroscopic information about the junction's energy landscape, in particular about the molecular level alignment in respect to the Fermi energy of the electrodes. Thereby, we can investigate the non-linear transport properties of various types of functional molecules and explore their potential use as functional building blocks for future nano-electronics. An example will be given by the reversible and controllable switching between two distinct conductive states of a single molecule. As a proof-of-principle for functional molecular devices, a single-molecule memory element will be demonstrated.
Neuroprotective Properties of Mildronate, a Small Molecule, in a Rat Model of Parkinson’s Disease
Directory of Open Access Journals (Sweden)
Harry V. Vinters
2010-11-01
Full Text Available Previously, we have found that mildronate [3-(2,2,2-trimethylhydrazinium propionate dihydrate], a small molecule with charged nitrogen and oxygen atoms, protects mitochondrial metabolism that is altered by inhibitors of complex I and has neuroprotective effects in an azidothymidine-neurotoxicity mouse model. In the present study, we investigated the effects of mildronate in a rat model of Parkinson’s disease (PD that was generated via a unilateral intrastriatal injection of the neurotoxin 6-hydroxydopamine (6‑OHDA. We assessed the expression of cell biomarkers that are involved in signaling cascades and provide neural and glial integration: the neuronal marker TH (tyrosine hydroxylase; ubiquitin (a regulatory peptide involved in the ubiquitin-proteasome degradation system; Notch-3 (a marker of progenitor cells; IBA-1 (a marker of microglial cells; glial fibrillary acidic protein, GFAP (a marker of astrocytes; and inducible nitric oxide synthase, iNOS (a marker of inflammation. The data show that in the 6-OHDA-lesioned striatum, mildronate completely prevented the loss of TH, stimulated Notch-3 expression and decreased the expression of ubiquitin, GFAP and iNOS. These results provide evidence for the ability of mildronate to control the expression of an array of cellular proteins and, thus, impart multi-faceted homeostatic mechanisms in neurons and glial cells in a rat model of PD. We suggest that the use of mildronate provides a protective effect during the early stages of PD that can delay or halt the progression of this neurodegenerative disease.
Arbabi, Vahid; Pouran, Behdad; Zadpoor, Amir A; Weinans, Harrie
2017-04-23
Osteoarthritis (OA) is a debilitating disease that is associated with degeneration of articular cartilage and subchondral bone. Degeneration of articular cartilage impairs its load-bearing function substantially as it experiences tremendous chemical degradation, i.e. proteoglycan loss and collagen fibril disruption. One promising way to investigate chemical damage mechanisms during OA is to expose the cartilage specimens to an external solute and monitor the diffusion of the molecules. The degree of cartilage damage (i.e. concentration and configuration of essential macromolecules) is associated with collisional energy loss of external solutes while moving across articular cartilage creates different diffusion characteristics compared to healthy cartilage. In this study, we introduce a protocol, which consists of several steps and is based on previously developed experimental micro-Computed Tomography (micro-CT) and finite element modeling. The transport of charged and uncharged iodinated molecules is first recorded using micro-CT, which is followed by applying biphasic-solute and multiphasic finite element models to obtain diffusion coefficients and fixed charge densities across cartilage zones.
The Minimum Binding Energy and Size of Doubly Muonic D3 Molecule
Eskandari, M. R.; Faghihi, F.; Mahdavi, M.
The minimum energy and size of doubly muonic D3 molecule, which two of the electrons are replaced by the much heavier muons, are calculated by the well-known variational method. The calculations show that the system possesses two minimum positions, one at typically muonic distance and the second at the atomic distance. It is shown that at the muonic distance, the effective charge, zeff is 2.9. We assumed a symmetric planar vibrational model between two minima and an oscillation potential energy is approximated in this region.
International Nuclear Information System (INIS)
Oliveira, I. S. S. de; Miwa, R. H.
2015-01-01
We use ab initio simulations to investigate the adsorption and the self-assembly processes of tetracyanoquinodimethane (TCNQ), tetrafluoro-tetracyanoquinodimethane (F4-TCNQ), and tetrasodium 1,3,6,8-pyrenetetrasulfonic acid (TPA) on the graphene surface. We find that there are no chemical bonds at the molecule–graphene interface, even at the presence of grain boundaries on the graphene surface. The molecules bond to graphene through van der Waals interactions. In addition to the molecule–graphene interaction, we performed a detailed study of the role played by the (lateral) molecule–molecule interaction in the formation of the, experimentally verified, self-assembled layers of TCNQ and TPA on graphene. Regarding the electronic properties, we calculate the electronic charge transfer from the graphene sheet to the TCNQ and F4-TCNQ molecules, leading to a p-doping of graphene. Meanwhile, such charge transfer is reduced by an order of magnitude for TPA molecules on graphene. In this case, it is not expected a significant doping process upon the formation of self-assembled layer of TPA molecules on the graphene sheet
Electric dipole moments of nanosolvated acid molecules in water clusters.
Guggemos, Nicholas; Slavíček, Petr; Kresin, Vitaly V
2015-01-30
The electric dipole moments of (H2O)nDCl (n=3-9) clusters have been measured by the beam-deflection method. Reflecting the (dynamical) charge distribution within the system, the dipole moment contributes information about the microscopic structure of nanoscale solvation. The addition of a DCl molecule to a water cluster results in a strongly enhanced susceptibility. There is evidence for a noticeable rise in the dipole moment occurring at n≈5-6. This size is consistent with predictions for the onset of ionic dissociation. Additionally, a molecular-dynamics model suggests that even with a nominally bound impurity an enhanced dipole moment can arise due to the thermal and zero-point motion of the proton and the water molecules. The experimental measurements and the calculations draw attention to the importance of fluctuations in defining the polarity of water-based nanoclusters and generally to the essential role played by motional effects in determining the response of fluxional nanoscale systems under realistic conditions.
Alsam, Amani Abdu
2017-03-14
Controlling the ultrafast dynamical process of photoinduced charge transfer at donor acceptor interfaces remains a major challenge for physical chemistry and solar cell communities. The process is complicated by the involvement of other complex dynamical processes, including hydrogen bond formation, energy transfer, and solvation dynamics occurring on similar time scales. In this study, we explore the remarkable impact of hydrogen-bond formation on the interfacial charge transfer between a negatively charged electron donating anionic porphyrin and a positively charged electron accepting pi-conjugated polymer, as a model system in solvents with different polarities and capabilities for hydiogen bonding using femtosecond transient absorption spectroscopy. Unlike the conventional understanding of the key role of hydrogen bonding in promoting the charge-transfer process, our steadystate and time-resolved results reveal that the intervening hydrogen-bonding environment and, consequently, the probable longer spacing between the donor and acceptor molecules significantly hinders the charge-transfer process between them. These results show that site-specific hydrogen bonding and geometric considerations between donor and acceptor can be exploited to control both the charge-transfer dynamics and its efficiency not only at donor acceptor interfaces but also in complex biological systems.
Fragmentation and mean kinetic energy release of the nitrogen molecule
International Nuclear Information System (INIS)
Santos, A.C.F.; Melo, W.S.; Sant'Anna, M.M.; Sigaud, G.M.; Montenegro, E.C.
2007-01-01
Ionization and fragmentation of the N 2 molecule in coincidence with the final projectile charge state have been measured for the impact of 0.188-0.875 MeV/amu He + projectiles. The average kinetic energy release (KER) of the target ionic fragments is derived from the peak widths of their time-of-flight distributions. It is shown that the KER's for singly-charged products follow scaling laws irrespectively to the collision channel
Superconducting, magnetic, and charge correlations in the doped two-chain Hubbard model
International Nuclear Information System (INIS)
Asai, Y.
1995-01-01
We have studied the superconducting, magnetic, and charge correlation functions and the spin excitation spectrum in the doped two-chain Hubbard model by projector Monte Carlo and Lanczos diagonalization methods. The exponent of the interchain singlet superconducting correlation function, γ, is found to be close to 2.0 as long as two distinct noninteracting bands cross the Fermi level. Magnetic and charge correlation functions decay more rapidly than or as fast as the interchain singlet superconducting correlation function along the chains. The superconducting correlation in the doped two-chain Hubbard model is the most long-range correlation studied here. Implications of the results for the possible universality class of the doped two-chain Hubbard model are discussed
Oppositely charged colloids out of equilibrium
Vissers, T.
2010-11-01
Colloids are particles with a size in the range of a few nanometers up to several micrometers. Similar to atomic and molecular systems, they can form gases, liquids, solids, gels and glasses. Colloids can be used as model systems because, unlike molecules, they are sufficiently large to be studied directly with light microscopy and move sufficiently slow to study their dynamics. In this thesis, we study binary systems of polymethylmethacrylate (PMMA) colloidal particles suspended in low-polar solvent mixtures. Since the ions can still partially dissociate, a surface charge builds up which causes electrostatic interactions between the colloids. By carefully tuning the conditions inside the suspension, we make two kinds of particles oppositely charged. To study our samples, we use Confocal Laser Scanning Microscopy (CLSM). The positively and negatively charged particles can be distinguished by a different fluorescent dye. Colloids constantly experience a random motion resulting from random kicks of surrounding solvent molecules. When the attractions between the oppositely charged particles are weak, the particles can attach and detach many times and explore a lot of possible configurations and the system can reach thermodynamic equilibrium. For example, colloidal ‘ionic’ crystals consisting of thousands to millions of particles can form under the right conditions. When the attractions are strong, the system can become kinetically trapped inside a gel-like state. We observe that when the interactions change again, crystals can even emerge again from this gel-like phase. By using local order parameters, we quantitatively study the crystallization of colloidal particles and identify growth defects inside the crystals. We also study the effect of gravity on the growth of ionic crystals by using a rotating stage. We find that sedimentation can completely inhibit crystal growth and plays an important role in crystallization from the gel-like state. The surface
Energy Technology Data Exchange (ETDEWEB)
Pavanello, Michele [Department of Chemistry, Rutgers University, Newark, New Jersey 07102-1811 (United States); Van Voorhis, Troy [Department of Chemistry, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139-4307 (United States); Visscher, Lucas [Amsterdam Center for Multiscale Modeling, VU University, De Boelelaan 1083, 1081 HV Amsterdam (Netherlands); Neugebauer, Johannes [Theoretische Organische Chemie, Organisch-Chemisches Institut der Westfaelischen Wilhelms-Universitaet Muenster, Corrensstrasse 40, 48149 Muenster (Germany)
2013-02-07
Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlap matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Angstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.
Poudel, Lokendra; Wen, Amy M; French, Roger H; Parsegian, V Adrian; Podgornik, Rudolf; Steinmetz, Nicole F; Ching, Wai-Yim
2015-05-18
The electronic structure and partial charge of doxorubicin (DOX) in three different molecular environments-isolated, solvated, and intercalated in a DNA complex-are studied by first-principles density functional methods. It is shown that the addition of solvating water molecules to DOX, together with the proximity to and interaction with DNA, has a significant impact on the electronic structure as well as on the partial charge distribution. Significant improvement in estimating the DOX-DNA interaction energy is achieved. The results are further elucidated by resolving the total density of states and surface charge density into different functional groups. It is concluded that the presence of the solvent and the details of the interaction geometry matter greatly in determining the stability of DOX complexation. Ab initio calculations on realistic models are an important step toward a more accurate description of the long-range interactions in biomolecular systems. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Model of charge-state distributions for electron cyclotron resonance ion source plasmas
Directory of Open Access Journals (Sweden)
D. H. Edgell
1999-12-01
Full Text Available A computer model for the ion charge-state distribution (CSD in an electron cyclotron resonance ion source (ECRIS plasma is presented that incorporates non-Maxwellian distribution functions, multiple atomic species, and ion confinement due to the ambipolar potential well that arises from confinement of the electron cyclotron resonance (ECR heated electrons. Atomic processes incorporated into the model include multiple ionization and multiple charge exchange with rate coefficients calculated for non-Maxwellian electron distributions. The electron distribution function is calculated using a Fokker-Planck code with an ECR heating term. This eliminates the electron temperature as an arbitrary user input. The model produces results that are a good match to CSD data from the ANL-ECRII ECRIS. Extending the model to 1D axial will also allow the model to determine the plasma and electrostatic potential profiles, further eliminating arbitrary user input to the model.
Curvature contributions to the static electrical properties of push-pull molecules
International Nuclear Information System (INIS)
Squitieri, Emilio
2005-01-01
Calculations of the curvature contribution to the diagonals components of the static dipole moment (μ), polarizability (α), first (β) and second (γ) hyperpolarizability of push-pull molecules are presented. This contribution was obtained from the analytical evaluation of electrical properties method using the harmonic zero-point energy. The valence-bond charge-transfer model was employed to obtain the field-dependent force constant and their derivates with respect to electric field. Our results show a relationship between the curvature and electronic contributions. We have also found that the curvature contribution is important in a numerical estimation of β and γ
Molecular distortion and charge transfer effects in ZnPc/Cu(111)
Amin, B.; Nazir, S.; Schwingenschlö gl, Udo
2013-01-01
The adsorption geometry and electronic properties of a zinc-phthalocyanine molecule on a Cu(111) substrate are studied by density functional theory. In agreement with experiment, we find remarkable distortions of the molecule, mainly as the central Zn atom tends towards the substrate to minimize the Zn-Cu distance. As a consequence, the Zn-N chemical bonding and energy levels of the molecule are significantly modified. However, charge transfer induces metallic states on the molecule and therefore is more important for the ZnPc/Cu(111) system than the structural distortions.
Molecular distortion and charge transfer effects in ZnPc/Cu(111)
Amin, B.
2013-04-23
The adsorption geometry and electronic properties of a zinc-phthalocyanine molecule on a Cu(111) substrate are studied by density functional theory. In agreement with experiment, we find remarkable distortions of the molecule, mainly as the central Zn atom tends towards the substrate to minimize the Zn-Cu distance. As a consequence, the Zn-N chemical bonding and energy levels of the molecule are significantly modified. However, charge transfer induces metallic states on the molecule and therefore is more important for the ZnPc/Cu(111) system than the structural distortions.
Charge transport models for reliability engineering of semiconductor devices
International Nuclear Information System (INIS)
Bina, M.
2014-01-01
The simulation of semiconductor devices is important for the assessment of device lifetimes before production. In this context, this work investigates the influence of the charge carrier transport model on the accuracy of bias temperature instability and hot-carrier degradation models in MOS devices. For this purpose, a four-state defect model based on a non-radiative multi phonon (NMP) theory is implemented to study the bias temperature instability. However, the doping concentrations typically used in nano-scale devices correspond to only a small number of dopants in the channel, leading to fluctuations of the electrostatic potential. Thus, the granularity of the doping cannot be ignored in these devices. To study the bias temperature instability in the presence of fluctuations of the electrostatic potential, the advanced drift diffusion device simulator Minimos-NT is employed. In a first effort to understand the bias temperature instability in p-channel MOSFETs at elevated temperatures, data from direct-current-current-voltage measurements is successfully reproduced using a four-state defect model. Differences between the four-state defect model and the commonly employed trapping model from Shockley, Read and Hall (SRH) have been investigated showing that the SRH model is incapable of reproducing the measurement data. This is in good agreement with the literature, where it has been extensively shown that a model based on SRH theory cannot reproduce the characteristic time constants found in BTI recovery traces. Upon inspection of recorded recovery traces after bias temperature stress in n-channel MOSFETs it is found that the gate current is strongly correlated with the drain current (recovery trace). Using a random discrete dopant model and non-equilibrium greens functions it is shown that direct tunnelling cannot explain the magnitude of the gate current reduction. Instead it is found that trap-assisted tunnelling, modelled using NMP theory, is the cause of this
Modeling Framework and Results to Inform Charging Infrastructure Investments
Energy Technology Data Exchange (ETDEWEB)
Melaina, Marc W [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Wood, Eric W [National Renewable Energy Laboratory (NREL), Golden, CO (United States)
2017-09-01
The plug-in electric vehicle (PEV) market is experiencing rapid growth with dozens of battery electric (BEV) and plug-in hybrid electric (PHEV) models already available and billions of dollars being invested by automotive manufacturers in the PEV space. Electric range is increasing thanks to larger and more advanced batteries and significant infrastructure investments are being made to enable higher power fast charging. Costs are falling and PEVs are becoming more competitive with conventional vehicles. Moreover, new technologies such as connectivity and automation hold the promise of enhancing the value proposition of PEVs. This presentation outlines a suite of projects funded by the U.S. Department of Energy's Vehicle Technology Office to conduct assessments of the economic value and charging infrastructure requirements of the evolving PEV market. Individual assessments include national evaluations of PEV economic value (assuming 73M PEVs on the road in 2035), national analysis of charging infrastructure requirements (with community and corridor level resolution), and case studies of PEV ownership in Columbus, OH and Massachusetts.
International Nuclear Information System (INIS)
Bauer, Thilo; Jäger, Christof M.; Jordan, Meredith J. T.; Clark, Timothy
2015-01-01
We have developed a multi-agent quantum Monte Carlo model to describe the spatial dynamics of multiple majority charge carriers during conduction of electric current in the channel of organic field-effect transistors. The charge carriers are treated by a neglect of diatomic differential overlap Hamiltonian using a lattice of hydrogen-like basis functions. The local ionization energy and local electron affinity defined previously map the bulk structure of the transistor channel to external potentials for the simulations of electron- and hole-conduction, respectively. The model is designed without a specific charge-transport mechanism like hopping- or band-transport in mind and does not arbitrarily localize charge. An electrode model allows dynamic injection and depletion of charge carriers according to source-drain voltage. The field-effect is modeled by using the source-gate voltage in a Metropolis-like acceptance criterion. Although the current cannot be calculated because the simulations have no time axis, using the number of Monte Carlo moves as pseudo-time gives results that resemble experimental I/V curves
Energy Technology Data Exchange (ETDEWEB)
Bauer, Thilo; Jäger, Christof M. [Department of Chemistry and Pharmacy, Computer-Chemistry-Center and Interdisciplinary Center for Molecular Materials, Friedrich-Alexander-Universität Erlangen-Nürnberg, Nägelsbachstrasse 25, 91052 Erlangen (Germany); Jordan, Meredith J. T. [School of Chemistry, University of Sydney, Sydney, NSW 2006 (Australia); Clark, Timothy, E-mail: tim.clark@fau.de [Department of Chemistry and Pharmacy, Computer-Chemistry-Center and Interdisciplinary Center for Molecular Materials, Friedrich-Alexander-Universität Erlangen-Nürnberg, Nägelsbachstrasse 25, 91052 Erlangen (Germany); Centre for Molecular Design, University of Portsmouth, Portsmouth PO1 2DY (United Kingdom)
2015-07-28
We have developed a multi-agent quantum Monte Carlo model to describe the spatial dynamics of multiple majority charge carriers during conduction of electric current in the channel of organic field-effect transistors. The charge carriers are treated by a neglect of diatomic differential overlap Hamiltonian using a lattice of hydrogen-like basis functions. The local ionization energy and local electron affinity defined previously map the bulk structure of the transistor channel to external potentials for the simulations of electron- and hole-conduction, respectively. The model is designed without a specific charge-transport mechanism like hopping- or band-transport in mind and does not arbitrarily localize charge. An electrode model allows dynamic injection and depletion of charge carriers according to source-drain voltage. The field-effect is modeled by using the source-gate voltage in a Metropolis-like acceptance criterion. Although the current cannot be calculated because the simulations have no time axis, using the number of Monte Carlo moves as pseudo-time gives results that resemble experimental I/V curves.
Charge deposition model for investigating SE-microdose effect in trench power MOSFETs
Xin, Wan; Weisong, Zhou; Daoguang, Liu; Hanliang, Bo; Jun, Xu
2015-05-01
It was demonstrated that heavy ions can induce large current—voltage (I-V) characteristics shift in commercial trench power MOSFETs, named single event microdose effect (SE-microdose effect). A model is presented to describe this effect. This model calculates the charge deposition by a single heavy ion hitting oxide and the subsequent charge transport under an electric field. Holes deposited at the SiO2/Si interface by a Xe ion are calculated by using this model. The calculated results were then used in Sentaurus TCAD software to simulate a trench power MOSFET's I-V curve shift after a Xe ion has hit it. The simulation results are consistent with the related experiment's data. In the end, several factors which affect the SE-microdose effect in trench power MOSFETs are investigated by using this model.
Modelling the Effects of Parking Charge and Supply Policy Using System Dynamics Method
Directory of Open Access Journals (Sweden)
Zhenyu Mei
2017-01-01
Full Text Available Reasonable parking charge and supply policy are essential for the regular operation of the traffic in city center. This paper develops an evaluation model for parking policies using system dynamics. A quantitative study is conducted to examine the effects of parking charge and supply policy on traffic speed. The model, which is composed of three interrelated subsystems, first summarizes the travel cost of each travel mode and then calibrates the travel choice model through the travel mode subsystem. Finally, the subsystem that evaluates the state of traffic forecasts future car speed based on bureau of public roads (BPR function and generates new travel cost until the entire model reaches a steady state. The accuracy of the model is verified in Hangzhou Wulin business district. The related error of predicted speed is only 2.2%. The results indicate that the regular pattern of traffic speed and parking charge can be illustrated using the proposed model based on system dynamics, and the model infers that reducing the parking supply in core area will increase its congestion level and, under certain parking supply conditions, there exists an interval of possible pricing at which the service reaches a level that is fairly stable.
Lessons on electronic decoherence in molecules from exact modeling
Hu, Wenxiang; Gu, Bing; Franco, Ignacio
2018-04-01
Electronic decoherence processes in molecules and materials are usually thought and modeled via schemes for the system-bath evolution in which the bath is treated either implicitly or approximately. Here we present computations of the electronic decoherence dynamics of a model many-body molecular system described by the Su-Schrieffer-Heeger Hamiltonian with Hubbard electron-electron interactions using an exact method in which both electronic and nuclear degrees of freedom are taken into account explicitly and fully quantum mechanically. To represent the electron-nuclear Hamiltonian in matrix form and propagate the dynamics, the computations employ the Jordan-Wigner transformation for the fermionic creation/annihilation operators and the discrete variable representation for the nuclear operators. The simulations offer a standard for electronic decoherence that can be used to test approximations. They also provide a useful platform to answer fundamental questions about electronic decoherence that cannot be addressed through approximate or implicit schemes. Specifically, through simulations, we isolate basic mechanisms for electronic coherence loss and demonstrate that electronic decoherence is possible even for one-dimensional nuclear bath. Furthermore, we show that (i) decreasing the mass of the bath generally leads to faster electronic decoherence; (ii) electron-electron interactions strongly affect the electronic decoherence when the electron-nuclear dynamics is not pure-dephasing; (iii) classical bath models with initial conditions sampled from the Wigner distribution accurately capture the short-time electronic decoherence dynamics; (iv) model separable initial superpositions often used to understand decoherence after photoexcitation are only relevant in experiments that employ delta-like laser pulses to initiate the dynamics. These insights can be employed to interpret and properly model coherence phenomena in molecules.
Quantum interference effects at room temperature in OPV-based single-molecule junctions
DEFF Research Database (Denmark)
Arroyo, Carlos R.; Frisenda, Riccardo; Moth-Poulsen, Kasper
2013-01-01
Interference effects on charge transport through an individual molecule can lead to a notable modulation and suppression on its conductance. In this letter, we report the observation of quantum interference effects occurring at room temperature in single-molecule junctions based on oligo(3......)-phenylenevinylene (OPV3) derivatives, in which the central benzene ring is coupled to either para- or meta-positions. Using the break-junction technique, we find that the conductance for a single meta-OPV3 molecule wired between gold electrodes is one order of magnitude smaller than that of a para-OPV3 molecule...
Doping Phosphorene with Holes and Electrons through Molecular Charge Transfer.
Vishnoi, Pratap; Rajesh, S; Manjunatha, S; Bandyopadhyay, Arkamita; Barua, Manaswee; Pati, Swapan K; Rao, C N R
2017-11-03
An important aspect of phosphorene, the novel two-dimensional semiconductor, is whether holes and electrons can both be doped in this material. Some reports found that only electrons can be preferentially doped into phosphorene. There are some theoretical calculations showing charge-transfer interaction with both tetrathiafulvalene (TTF) and tetracyanoethylene (TCNE). We have carried out an investigation of chemical doping of phosphorene by a variety of electron donor and acceptor molecules, employing both experiment and theory, Raman scattering being a crucial aspect of the study. We find that both electron acceptors and donors interact with phosphorene by charge-transfer, with the acceptors having more marked effects. All the three Raman bands of phosphorene soften and exhibit band broadening on interaction with both donor and acceptor molecules. First-principles calculations establish the occurrence of charge-transfer between phosphorene with donors as well as acceptors. The absence of electron-hole asymmetry is noteworthy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Feng, Linlin; Dong, Huanli; Li, Qingyuan
2017-01-01
It is a common phenomenon for organic semiconductors to crystallize in two or more polymorphs, leading to various molecular packings and different charge transport properties. Therefore, it is a crucial issue of tuning molecular crystal polymorphs (i.e., adjusting the same molecule with different......)-based cruciform molecule, named as IF-TTF. The charge carrier mobility of the α-phase IF-TTF crystals was more than one order of magnitude higher than that of β-phase crystals, suggesting the importance of reasonably tuning molecular packing in solid state for the improvement of charge transport in organic...... semiconductors...