WorldWideScience

Sample records for charged model molecules

  1. First Principles Modeling and Interpretation of Ionization-Triggered Charge Migration in Molecules

    Science.gov (United States)

    Bruner, Adam; Hernandez, Sam; Mauger, Francois; Abanador, Paul; Gaarde, Mette; Schafer, Ken; Lopata, Ken

    Modeling attosecond coherent charge migration in molecules is important for understanding initial steps of photochemistry and light harvesting processes. Ionization triggered hole migration can be difficult to characterize and interpret as the dynamics can be convoluted with excited states. Here, we introduce a real-time time-dependent density functional theory (RT-TDDFT) approach for modeling such dynamics from first principles. To isolate the specific hole dynamics from excited states, Fourier transform analysis and orbital occupations are used to provide a spatial hole representation in the frequency domain. These techniques are applied to hole transfer across a thiophene dimer as well as core-hole triggered valence motion in nitrosobenzene. This work was supported by U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under Award No. DE-SC0012462.

  2. Effective charge model in the theory of infrared intensities and its application for study of charge di.stribution in the molecules of organometallic compounds

    International Nuclear Information System (INIS)

    Aleksanyan, V.T.; Samvelyan, S.Kh.

    1984-01-01

    General principles of plotting the parametric theory of IR spectrum intensities of polyatomic molecules are outlined. The development of the effective charges model in this theory is considered and the mathematical formalism of the first approximation of the method of effective atom charges is described in detail. The results of calculations of charges distribution in the Mo(CO) 6 , W(CO) 6 , Cp 2 V, Cp 2 Ru and others (Cp-cyclopentadiene), performed in the frame work of the outlined scheme are presented. It is shown that in the investigated carbonyles the effective charge on oxygen and metal atoms is negative, on carbon atom - positive. In dicyclopentavienyl complexes the effective charge on the metal atom is positive and is not over 0.6e; charge values on hydrogen and carbon atoms do not exceed, 0.10-0.15e. The notions of ''electrovalence'' of coordination bond and charge distribution in the case of metallocenes are not correlated

  3. Synthesis, growth, structural modeling and physio-chemical properties of a charge transfer molecule: Guanidinium tosylate

    Science.gov (United States)

    Era, Paavai; Jauhar, RO. MU.; Vinitha, G.; Murugakoothan, P.

    2018-05-01

    An organic nonlinear optical material, guanidinium tosylate was synthesized adopting slow evaporation method and the crystals were harvested from aqueous methanolic medium with dimensions 13 × 9 × 3 mm3. Constitution of crystalline material was confirmed by single crystal X-ray diffraction study. The title compound crystallizes in the monoclinic crystal system with space group P21/c. The UV-vis-NIR spectral study of the grown crystal exhibits high transparency of 80% in the entire visible region with lower cut-off wavelength at 282 nm. Optimized molecular geometry of the grown crystal was obtained using density functional theory (DFT) and the frontier energy gaps calculated from the DFT aids to understand the charge transfer taking place in the molecule. The dielectric properties were studied as a function of temperature and frequency to find the charge distribution within the crystal. The titular compound is thermally stable up to 230 °C assessed by thermogravimetric and differential thermal analysis. Anisotropy in the mechanical behavior was observed while measuring for individual planes. The laser induced surface damage threshold of the grown crystal was measured to be 0.344 GW/cm2 for 1064 nm Nd:YAG laser radiation. Z-scan technique confirms the third-order nonlinear optical property with the ascertained nonlinear refractive index (n2), nonlinear absorption coefficient (β) and third order nonlinear susceptibility (χ(3)). Optical limiting study divulges that the transmitted output power step-up linearly with the increase of the input power at lower power realms and saturates from the threshold 24.95 mW/cm2 and amplitude 0.23 mW/cm2.

  4. Computational modeling of chemical reactions and interstitial growth and remodeling involving charged solutes and solid-bound molecules.

    Science.gov (United States)

    Ateshian, Gerard A; Nims, Robert J; Maas, Steve; Weiss, Jeffrey A

    2014-10-01

    Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio ( www.febio.org ). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the

  5. Optical Spectroscopy Of Charged Quantum Dot Molecules

    Science.gov (United States)

    Scheibner, M.; Bracker, A. S.; Stinaff, E. A.; Doty, M. F.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.

    2007-04-01

    Coupling between two closely spaced quantum dots is observed by means of photoluminescence spectroscopy. Hole coupling is realized by rational crystal growth and heterostructure design. We identify molecular resonances of different excitonic charge states, including the important case of a doubly charged quantum dot molecule.

  6. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    OpenAIRE

    Buyukdagli, Sahin

    2016-01-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

  7. The Holographic Electron Density Theorem, de-quantization, re-quantization, and nuclear charge space extrapolations of the Universal Molecule Model

    Science.gov (United States)

    Mezey, Paul G.

    2017-11-01

    Two strongly related theorems on non-degenerate ground state electron densities serve as the basis of "Molecular Informatics". The Hohenberg-Kohn theorem is a statement on global molecular information, ensuring that the complete electron density contains the complete molecular information. However, the Holographic Electron Density Theorem states more: the local information present in each and every positive volume density fragment is already complete: the information in the fragment is equivalent to the complete molecular information. In other words, the complete molecular information provided by the Hohenberg-Kohn Theorem is already provided, in full, by any positive volume, otherwise arbitrarily small electron density fragment. In this contribution some of the consequences of the Holographic Electron Density Theorem are discussed within the framework of the "Nuclear Charge Space" and the Universal Molecule Model. In the Nuclear Charge Space" the nuclear charges are regarded as continuous variables, and in the more general Universal Molecule Model some other quantized parameteres are also allowed to become "de-quantized and then re-quantized, leading to interrelations among real molecules through abstract molecules. Here the specific role of the Holographic Electron Density Theorem is discussed within the above context.

  8. Discrete and continuum modeling of solvent effects in a twisted intramolecular charge transfer system: The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule.

    Science.gov (United States)

    Modesto-Costa, Lucas; Borges, Itamar

    2018-08-05

    The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule is a prototypical system displaying twisted intramolecular (TICT) charge transfer effects. The ground and the first four electronic excited states (S 1 -S 4 ) in gas phase and upon solvation were studied. Charge transfer values as function of the torsion angle between the donor group (dimethylamine) and the acceptor moiety (benzonitrile) were explicitly computed. Potential energy curves were also obtained. The algebraic diagrammatic construction method at the second-order [ADC(2)] ab initio wave function was employed. Three solvents of increased polarities (benzene, DMSO and water) were investigated using discrete (average solvent electrostatic configuration - ASEC) and continuum (conductor-like screening model - COSMO) models. The results for the S 3 and S 4 excited states and the S 1 -S 4 charge transfer curves were not previously available in the literature. Electronic gas phase and solvent vertical spectra are in good agreement with previous theoretical and experimental results. In the twisted (90°) geometry the optical oscillator strengths have negligible values even for the S 2 bright state. Potential energy curves show two distinct pairs of curves intersecting at decreasing angles or not crossing in the more polar solvents. Charge transfer and electric dipole values allowed the rationalization of these results. The former effects are mostly independent of the solvent model and polarity. Although COSMO and ASEC solvent models mostly lead to similar results, there is an important difference: some crossings of the excitation energy curves appear only in the ASEC solvation model, which has important implications to the photochemistry of DMABN. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Theory of Charged Quantum Dot Molecules

    Science.gov (United States)

    Ponomarev, I. V.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Ware, M. E.; Gammon, D.; Reinecke, T. L.; Korenev, V. L.

    2006-03-01

    Recent optical spectroscopy of excitonic molecules in coupled quantum dots (CQDs) tuned by electric field reveal a richer diversity in spectral line patterns than in their single quantum dot counterparts. We developed a theoretical model that allows us to classify energies and intensities of various PL transitions. In this approach the electric field induced resonance tunneling of the electron and hole states occurs at different biases due to the inherent asymmetry of CQDs. The truncated many-body basis configurations for each molecule are constructed from antisymmetrized products of single-particle states, where the electron occupies only one ground state level in single QD and the hole can occupy two lowest levels of CQD system. The Coulomb interaction between particles is treated with perturbation theory. As a result the observed PL spectral lines can be described with a small number of parameters. The theoretical predictions account well for recent experiments.

  10. Thermally induced charge current through long molecules

    Science.gov (United States)

    Zimbovskaya, Natalya A.; Nitzan, Abraham

    2018-01-01

    In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

  11. Charge transport through image charged stabilized states in a single molecule single electron transistor device

    International Nuclear Information System (INIS)

    Hedegard, Per; Bjornholm, Thomas

    2005-01-01

    The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond

  12. Phase-Transfer Energetics of Small-Molecule Alcohols Across the Water-Hexane Interface: Molecular Dynamics Simulation Using Charge Equilibration Models

    Science.gov (United States)

    Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep

    2010-01-01

    We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than

  13. Spectroscopy of Charged Quantum Dot Molecules

    Science.gov (United States)

    Stinaff, E. A.; Scheibner, M.; Bracker, A. S.; Ponomarev, I. V.; Ware, M. E.; Doty, M. F.; Reinecke, T. L.; Gammon, D.; Korenev, V. L.

    2006-03-01

    Spins of single charges in quantum dots are attractive for many quantum information and spintronic proposals. Scalable quantum information applications require the ability to entangle and operate on multiple spins in coupled quantum dots (CQDs). To further the understanding of these systems, we present detailed spectroscopic studies of InAs CQDs with control of the discrete electron or hole charging of the system. The optical spectrum reveals a pattern of energy anticrossings and crossings in the photoluminescence as a function of applied electric field. These features can be understood as a superposition of charge and spin configurations of the two dots and represent clear signatures of quantum mechanical coupling. The molecular resonance leading to these anticrossings is achieved at different electric fields for the optically excited (trion) states and the ground (hole) states allowing for the possibility of using the excited states for optically induced coupling of the qubits.

  14. Interactions Between Charged Macroions Mediated by Molecules with Rod-like Charged Structures

    Directory of Open Access Journals (Sweden)

    Bohinc, K.

    2014-03-01

    Full Text Available A short review of recent theoretical advances in studies of the interaction between highly charged systems embedded in a solution of rod-like molecules is presented. The system is theoretically described by the functional density theory, where the correlations within the rod-like molecules are accounted for. We show that for sufficiently long molecules and large surface charge densities, an attractive force between like-charged surfaces arises due to the spatially distributed charges within the molecules. The added salt has an influence on the condition for the attractive force between like-charged surfaces. The theoretical results are compared with Monte Carlo simulations. Many phenomena motivate the study of the interaction between like-charged surfaces (DNA condensation, virus aggregation, yeast flocculation, cohesion of cement paste.

  15. About the correlation between atomic charge fluctuations in a molecule

    International Nuclear Information System (INIS)

    Pitanga, P.; Giambiagi, M.S. de; Giambiagi, M.

    1987-01-01

    In this note, the features of the correlation between the electronic charge fluctuations of a pair of atoms within a molecule are analised. Through Schwarz's inequality for random operators in the Hilbert space, the softness of an atom in a molecule is related to its valence and to the softness of the other atoms. It is concluded that in the general case this correlation (from which in turn stems the chemical bond) in non-linear. (author) [pt

  16. Anisotropy in highly charged ion induced molecule fragmentation

    International Nuclear Information System (INIS)

    Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.

    2006-01-01

    Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)

  17. Surface-confined electroactive molecules for multistate charge storage information.

    Science.gov (United States)

    Mas-Torrent, M; Rovira, C; Veciana, J

    2013-01-18

    Bi-stable molecular systems with potential for applications in binary memory devices are raising great interest for device miniaturization. Particular appealing are those systems that operate with electrical inputs since they are compatible with existing electronic technologies. The processing of higher memory densities in these devices could be accomplished by increasing the number of memory states in each cell, although this strategy has not been much explored yet. Here we highlight the recent advances devoted to the fabrication of charge-storage molecular surface-confined devices exhibiting multiple states. Mainly, this goal has been realized immobilizing a variety (or a combination) of electroactive molecules on a surface, although alternative approaches employing non-electroactive systems have also been described. Undoubtedly, the use of molecules with chemically tunable properties and nanoscale dimensions are raising great hopes for the devices of the future in which molecules can bring new perspectives such as multistability.

  18. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S

    2007-01-01

    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  19. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    Science.gov (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  20. Systems Based Study of the Therapeutic Potential of Small Charged Molecules for the Inhibition of IL-1 Mediated Cartilage Degradation

    Science.gov (United States)

    Kar, Saptarshi; Smith, David W.; Gardiner, Bruce S.; Grodzinsky, Alan J.

    2016-01-01

    Inflammatory cytokines are key drivers of cartilage degradation in post-traumatic osteoarthritis. Cartilage degradation mediated by these inflammatory cytokines has been extensively investigated using in vitro experimental systems. Based on one such study, we have developed a computational model to quantitatively assess the impact of charged small molecules intended to inhibit IL-1 mediated cartilage degradation. We primarily focus on the simplest possible computational model of small molecular interaction with the IL-1 system—direct binding of the small molecule to the active site on the IL-1 molecule itself. We first use the model to explore the uptake and release kinetics of the small molecule inhibitor by cartilage tissue. Our results show that negatively charged small molecules are excluded from the negatively charged cartilage tissue and have uptake kinetics in the order of hours. In contrast, the positively charged small molecules are drawn into the cartilage with uptake and release timescales ranging from hours to days. Using our calibrated computational model, we subsequently explore the effect of small molecule charge and binding constant on the rate of cartilage degradation. The results from this analysis indicate that the small molecules are most effective in inhibiting cartilage degradation if they are either positively charged and/or bind strongly to IL-1α, or both. Furthermore, our results showed that the cartilage structural homeostasis can be restored by the small molecule if administered within six days following initial tissue exposure to IL-1α. We finally extended the scope of the computational model by simulating the competitive inhibition of cartilage degradation by the small molecule. Results from this model show that small molecules are more efficient in inhibiting cartilage degradation by binding directly to IL-1α rather than binding to IL-1α receptors. The results from this study can be used as a template for the design and

  1. Temperature dependence of positronium reactivities with charge transfer molecules in bilayer membranes

    International Nuclear Information System (INIS)

    Jean, Y.C.; Yu, C.; Wang, Y.Y.; Yeh, Y.Y.

    1984-01-01

    Rate constants for positronium atoms reacting chemically with charge-transfer molecules such as p-benzoquinone, nitrobenzene, and coenzyme Q-10 in a model bilayer membrane, dipalmitoylphosphatidylcholine (DPPC), have been measured at temperatures between 23 and 65 0 C. A strong variation of the positronium chemical reactivities, k/sub Ps/ was observed in these systems: k/sub Ps/ increases with increasing temperature until the pretransition temperature of the membrane reaches a maximum value near the main transition temperature and decreases at temperatures higher than the main transition temperature. This variation is interpreted in terms of fluidity and permeability changes associated with the phase transitions of membranes and in terms of charge-transfer-complex formation between the solubilized molecules and the polar head of the membrane. These results demonstrate that positronium and its annihilation characteristics can be employed to investigate charge transport phenomena and microstructural changes of real biological membranes

  2. Electron stereodynamics in coulomb explosion of molecules by slow highly charged ions

    International Nuclear Information System (INIS)

    Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko

    2008-01-01

    The three-center Coulombic over-the-barrier model is developed for Coulomb explosion of a homonuclear diatomic molecule in collisions with a slow (∼10 eV/amu) highly charged ion. A conventional two-step picture of multiple electron transfer followed by Coulomb explosion is far from appropriate because the molecule sets out to dissociate before the incident ion approaches the closest distance. We treat the formation of a quasi-molecule and its decay into the three moving atomic ions. Charge-asymmetric population between fragment ions observed in a triple-coincidence measurement is suggested to reflect the bond elongation during a collision. Collisions of Kr 8+ + N 2 are analyzed. (author)

  3. Structural Arrangement of Water Molecules around Highly Charged Nanoparticles: Molecular Dynamics Simulation

    International Nuclear Information System (INIS)

    Kim, Eunae; Yeom, Min Sun

    2014-01-01

    Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge

  4. Temperature Dependence of Charge Localization in High-Mobility, Solution-Crystallized Small Molecule Semiconductors Studied by Charge Modulation Spectroscopy

    DEFF Research Database (Denmark)

    Meneau, Aurélie Y. B.; Olivier, Yoann; Backlund, Tomas

    2016-01-01

    In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld-effect tran......In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld......-effect transistor and CMS measurements as a function of temperature that in certain molecular semiconductors, such as solution-processible pentacene, charge carriers become trapped at low temperatures in environments in which the charges become highly localized on individual molecules, while in some other molecules...

  5. Charge-resonance excitations in symmetric molecules - Comparison of linear response DFT with CC3 for the excited states of a model dimer

    DEFF Research Database (Denmark)

    Kuhlman, Thomas Scheby; Mikkelsen, Kurt V.; Møller, Klaus Braagaard

    2009-01-01

    to a reference CC3 calculation revealing a better description of the excited states by CAM-B3LYP than that of B3LYP. The Λ parameter introduced by Peach et al. [M.J.G. Peach, P. Benfield, T. Helgaker, D.J. Tozer, J. Chem. Phys. 128 (2008) 044118] does not always reveal the problematic charge-resonance states...

  6. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  7. The effect of the charge density on the dipole moment of diatomic molecules

    International Nuclear Information System (INIS)

    Rosato, A.; Germano, J.S.E.

    1986-01-01

    The results of the calculation, using the Variational Cellular Method (VCM), of the electric dipole moment of several diatomic molecules are improved. In previous calculations, the electronic charge density was treated like a spherically symmetric function in the inscribed sphere within each cell and as being the same constant value for all intercellular regions. Since the results obtained with such an approximation have not been satisfactory, an improved approximation for the charge density in the intercellular regions is needed. It is considered that the charge density is still constant outside the inscribed sphere but with different values in each intercellular region. A new expression for the dipole moment is obtained, and applied to the diatomic molecules HF, CO, BF and CS. In addition, the corresponding dipole moment curves, potential energy curves and spectroscopic constants are calculated taking into consideration our approximation and the traditional approximation for the charge density. The results of the two models are compared with each other and with experimental results for all the molecules considered. (Author) [pt

  8. Low energy cross section data for ion-molecule reactions in hydrogen systems and for charge transfer of multiply charged ions with atoms and molecules

    International Nuclear Information System (INIS)

    Okuno, Kazuhiko

    2007-04-01

    Systematic cross section measurements for ion-molecule reactions in hydrogen systems and for charge transfer of multiply charged ions in low energy collisions with atoms and molecules have been performed continuously by the identical apparatus installed with an octo-pole ion beam guide (OPIG) since 1980 till 2004. Recently, all of accumulated cross section data for a hundred collision systems has been entered into CMOL and CHART of the NIFS atomic and molecular numerical database together with some related cross section data. In this present paper, complicated ion-molecule reactions in hydrogen systems are revealed and the brief outlines of specific properties in low energy charge transfer collisions of multiply charged ions with atoms and molecules are introduced. (author)

  9. Charge transfer in dissociating iodomethane and fluoromethane molecules ionized by intense femtosecond X-ray pulses

    Directory of Open Access Journals (Sweden)

    Rebecca Boll

    2016-07-01

    Full Text Available Ultrafast electron transfer in dissociating iodomethane and fluoromethane molecules was studied at the Linac Coherent Light Source free-electron laser using an ultraviolet-pump, X-ray-probe scheme. The results for both molecules are discussed with respect to the nature of their UV excitation and different chemical properties. Signatures of long-distance intramolecular charge transfer are observed for both species, and a quantitative analysis of its distance dependence in iodomethane is carried out for charge states up to I21+. The reconstructed critical distances for electron transfer are in good agreement with a classical over-the-barrier model and with an earlier experiment employing a near-infrared pump pulse.

  10. Interstellar Chemistry Gets More Complex With New Charged-Molecule Discovery

    Science.gov (United States)

    2007-07-01

    Astronomers using data from the National Science Foundation's Robert C. Byrd Green Bank Telescope (GBT) have found the largest negatively-charged molecule yet seen in space. The discovery of the third negatively-charged molecule, called an anion, in less than a year and the size of the latest anion will force a drastic revision of theoretical models of interstellar chemistry, the astronomers say. Molecule formation Formation Process of Large, Negatively-Charged Molecule in Interstellar Space CREDIT: Bill Saxton, NRAO/AUI/NSF Click on image for page of graphics and detailed information "This discovery continues to add to the diversity and complexity that is already seen in the chemistry of interstellar space," said Anthony J. Remijan of the National Radio Astronomy Observatory (NRAO). "It also adds to the number of paths available for making the complex organic molecules and other large molecular species that may be precursors to life in the giant clouds from which stars and planets are formed," he added. Two teams of scientists found negatively-charged octatetraynyl, a chain of eight carbon atoms and one hydrogen atom, in the envelope of gas around an old, evolved star and in a cold, dark cloud of molecular gas. In both cases, the molecule had an extra electron, giving it a negative charge. About 130 neutral and about a dozen positively-charged molecules have been discovered in space, but the first negatively-charged molecule was not discovered until late last year. The largest previously-discovered negative ion found in space has six carbon atoms and one hydrogen atom. "Until recently, many theoretical models of how chemical reactions evolve in interstellar space have largely neglected the presence of anions. This can no longer be the case, and this means that there are many more ways to build large organic molecules in cosmic environments than have been explored," said Jan M. Hollis of NASA's Goddard Space Flight Center (GSFC). Ultraviolet light from stars can

  11. Topology of charge density of flucytosine and related molecules and characteristics of their bond charge distributions.

    Science.gov (United States)

    Murgich, Juan; Franco, Héctor J; San-Blas, Gioconda

    2006-08-24

    The molecular charge distribution of flucytosine (4-amino-5-fluoro-2-pyrimidone), uracil, 5-fluorouracil, and thymine was studied by means of density functional theory calculations (DFT). The resulting distributions were analyzed by means of the atoms in molecules (AIM) theory. Bonds were characterized through vectors formed with the charge density value, its Laplacian, and the bond ellipticity calculated at the bond critical point (BCP). Within each set of C=O, C-H, and N-H bonds, these vectors showed little dispersion. C-C bonds formed three different subsets, one with a significant degree of double bonding, a second corresponding to single bonds with a finite ellipticity produced by hyperconjugation, and a third one formed by a pure single bond. In N-C bonds, a decrease in bond length (an increase in double bond character) was not reflected as an increase in their ellipticity, as in all C-C bonds studied. It was also found that substitution influenced the N-C, C-O, and C-C bond ellipticity much more than density and its Laplacian at the BCP. The Laplacian of charge density pointed to the existence of both bonding and nonbonding maxima in the valence shell charge concentration of N, O, and F, while only bonding ones were found for the C atoms. The nonbonding maxima related to the sites for electrophilic attack and H bonding in O and N, while sites of nucleophilic attack were suggested by the holes in the valence shell of the C atoms of the carbonyl groups.

  12. Electronic transport in single-helical protein molecules: Effects of multiple charge conduction pathways and helical symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.

    2016-07-15

    We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.

  13. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  14. One- and two-electron processes in collisions between hydrogen molecules and slow highly charged ions

    International Nuclear Information System (INIS)

    Wells, E.; Carnes, K.D.; Tawara, H.; Ali, R.; Sidky, Emil Y.; Illescas, Clara; Ben-Itzhak, I.

    2005-01-01

    A coincidence time-of-flight technique coupled with projectile charge state analysis was used to study electron capture in collisions between slow highly charged ions and hydrogen molecules. We found single electron capture with no target excitation to be the dominant process for both C 6+ projectiles at a velocity of 0.8 atomic units and Ar 11+ projectiles at v 0.63 a.u. Double electron capture and transfer excitation, however, were found to be comparable and occur about 30% of the time relative to single capture. Most projectiles (96%) auto-ionize quickly following double capture into doubly excited states. The data are compared to classical and quantum mechanical model calculations

  15. Single Molecule Spectroelectrochemistry of Interfacial Charge Transfer Dynamics In Hybrid Organic Solar Cell

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Shanlin [Univ. of Alabama, Tuscaloosa, AL (United States)

    2014-11-16

    Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest that the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an

  16. Challenging chemical concepts through charge density of molecules and crystals

    International Nuclear Information System (INIS)

    Gatti, Carlo

    2013-01-01

    Narrating my scientific career, I show in this paper how, starting as a computational and theoretical chemist, I got naturally involved with x-ray crystallographers because of the common interest in charge density and in the study of chemical bonds based on such an observable. The tools I devised and the conceptual developments I made to facilitate a profitable encounter between x-ray charge density and computational chemistry researchers are illustrated, with a special focus on the proposal and applications of the Source Function concept. (comment)

  17. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  18. Space charge models and PATH

    International Nuclear Information System (INIS)

    Wald, H.B.

    1990-01-01

    The 'PATH' codes are used to design magnetic optics subsystems for neutral particle beam systems. They include a 2-1/2D and three 3-D space charge models, two of which have recently been added. This paper describes the 3-D models and reports on preliminary benchmark studies in which these models are checked for stability as the cloud size is varied and for consistency with each other. Differences between the models are investigated and the computer time requirements for running these models are established

  19. Equilibrium distributions of free charged particles and molecules in systems with non-plane boundaries

    International Nuclear Information System (INIS)

    Usenko, A.S.

    1995-01-01

    The equilibrium space-inhomogeneous distributions of free and pair bound charged particles are calculated in the dipole approximation for the plasma-molecular cylinder and sphere. It is shown that the space and orientational distributions of charged particles and molecules in these systems are similar to those in the cases of plasma-molecular system restricted by one or two parallel planes. The influence of the parameters of outer medium and a plasma-molecular system on the space and orientational distributions of charged particles and molecules is studied in detail

  20. Influence of charge on encapsulation and release behavior of small molecules in self-assembled layer-by-layer microcapsules.

    Science.gov (United States)

    Mandapalli, Praveen K; Labala, Suman; Vanamala, Deekshith; Koranglekar, Manali P; Sakimalla, Lakshmi A; Venuganti, Venkata Vamsi K

    2014-12-01

    The objective of this study is to investigate the influence of charge of model small molecules on their encapsulation and release behavior in layer-by-layer microcapsules (LbL-MC). Poly(styrene sulfonate) and poly(ethylene imine) were sequentially adsorbed on calcium carbonate sacrificial templates to prepare LbL-MC. Model molecules with varying charge, anionic - ascorbic acid, cationic - imatinib mesylate (IM) and neutral - 5-fluorouracil were encapsulated in LbL-MC. Free and encapsulated LbL-MC were characterized using zetasizer, FTIR spectroscope and differential scanning calorimeter. The influence of IM-loaded LbL-MC on cell viability was studied in B16F10 murine melanoma cells. Furthermore, biodistribution of IM-loaded LbL-MC with and without PEGylation was studied in BALB/c mice. Results showed spherical LbL-MC of 3.0 ± 0.4 μm diameter. Encapsulation efficiency of LbL-MC increased linearly (R(2 )= 0.89-0.99) with the increase in solute concentration. Increase in pH from 2 to 6 increased the encapsulation of charged molecules in LbL-MC. Charged molecules showed greater encapsulation efficiency in LbL-MC compared with neutral molecule. In vitro release kinetics showed Fickian and non-Fickian diffusion of small molecules, depending on the nature of molecular interactions with LbL-MC. At 50 μM concentration, free IM showed significantly (p < 0.05) more cytotoxicity compared with IM-loaded LbL-MC. Biodistribution studies showed that PEGylation of LbL-MC decreased the liver and spleen uptake of IM-encapsulated LbL-MC. In conclusion, LbL-MC can be developed as a potential carrier for small molecules depending on their physical and chemical properties.

  1. Anisotropic charged generalized polytropic models

    Science.gov (United States)

    Nasim, A.; Azam, M.

    2018-06-01

    In this paper, we found some new anisotropic charged models admitting generalized polytropic equation of state with spherically symmetry. An analytic solution of the Einstein-Maxwell field equations is obtained through the transformation introduced by Durgapal and Banerji (Phys. Rev. D 27:328, 1983). The physical viability of solutions corresponding to polytropic index η =1/2, 2/3, 1, 2 is analyzed graphically. For this, we plot physical quantities such as radial and tangential pressure, anisotropy, speed of sound which demonstrated that these models achieve all the considerable physical conditions required for a relativistic star. Further, it is mentioned here that previous results for anisotropic charged matter with linear, quadratic and polytropic equation of state can be retrieved.

  2. Charge migration induced by attosecond pulses in bio-relevant molecules

    International Nuclear Information System (INIS)

    Calegari, Francesca; Castrovilli, Mattea C; Nisoli, Mauro; Trabattoni, Andrea; Palacios, Alicia; Ayuso, David; Martín, Fernando; Greenwood, Jason B; Decleva, Piero

    2016-01-01

    After sudden ionization of a large molecule, the positive charge can migrate throughout the system on a sub-femtosecond time scale, purely guided by electronic coherences. The possibility to actively explore the role of the electron dynamics in the photo-chemistry of bio-relevant molecules is of fundamental interest for understanding, and perhaps ultimately controlling, the processes leading to damage, mutation and, more generally, to the alteration of the biological functions of the macromolecule. Attosecond laser sources can provide the extreme time resolution required to follow this ultrafast charge flow. In this review we will present recent advances in attosecond molecular science: after a brief description of the results obtained for small molecules, recent experimental and theoretical findings on charge migration in bio-relevant molecules will be discussed. (topical review)

  3. Modulation and Control of Charge Transport Through Single-Molecule Junctions.

    Science.gov (United States)

    Wang, Kun; Xu, Bingqian

    2017-02-01

    The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge

  4. Variational multiscale models for charge transport.

    Science.gov (United States)

    Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin

    2012-01-01

    This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle

  5. Variational multiscale models for charge transport

    Science.gov (United States)

    Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin

    2012-01-01

    This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle

  6. Crystal growth of new charge-transfer salts based on π-conjugated donor molecules

    Energy Technology Data Exchange (ETDEWEB)

    Morherr, Antonia, E-mail: morherr@stud.uni-frankfurt.de [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Witt, Sebastian [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Chernenkaya, Alisa [Graduate School Materials Science in Mainz, 55128 Mainz (Germany); Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bäcker, Jan-Peter [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Schönhense, Gerd [Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bolte, Michael [Institut für anorganische Chemie, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Krellner, Cornelius [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany)

    2016-09-01

    New charge transfer crystals of π-conjugated, aromatic molecules (phenanthrene and picene) as donors were obtained by physical vapor transport. The melting behavior, optimization of crystal growth and the crystal structure are reported for charge transfer salts with (fluorinated) tetracyanoquinodimethane (TCNQ-F{sub x}, x=0, 2, 4), which was used as acceptor material. The crystal structures were determined by single-crystal X-ray diffraction. Growth conditions for different vapor pressures in closed ampules were applied and the effect of these starting conditions for crystal size and quality is reported. The process of charge transfer was investigated by geometrical analysis of the crystal structure and by infrared spectroscopy on single crystals. With these three different acceptor strengths and the two sets of donor materials, it is possible to investigate the distribution of the charge transfer systematically. This helps to understand the charge transfer process in this class of materials with π-conjugated donor molecules.

  7. Extracting Models in Single Molecule Experiments

    Science.gov (United States)

    Presse, Steve

    2013-03-01

    Single molecule experiments can now monitor the journey of a protein from its assembly near a ribosome to its proteolytic demise. Ideally all single molecule data should be self-explanatory. However data originating from single molecule experiments is particularly challenging to interpret on account of fluctuations and noise at such small scales. Realistically, basic understanding comes from models carefully extracted from the noisy data. Statistical mechanics, and maximum entropy in particular, provide a powerful framework for accomplishing this task in a principled fashion. Here I will discuss our work in extracting conformational memory from single molecule force spectroscopy experiments on large biomolecules. One clear advantage of this method is that we let the data tend towards the correct model, we do not fit the data. I will show that the dynamical model of the single molecule dynamics which emerges from this analysis is often more textured and complex than could otherwise come from fitting the data to a pre-conceived model.

  8. Model improvements to simulate charging in SEM

    Science.gov (United States)

    Arat, K. T.; Klimpel, T.; Hagen, C. W.

    2018-03-01

    Charging of insulators is a complex phenomenon to simulate since the accuracy of the simulations is very sensitive to the interaction of electrons with matter and electric fields. In this study, we report model improvements for a previously developed Monte-Carlo simulator to more accurately simulate samples that charge. The improvements include both modelling of low energy electron scattering and charging of insulators. The new first-principle scattering models provide a more realistic charge distribution cloud in the material, and a better match between non-charging simulations and experimental results. Improvements on charging models mainly focus on redistribution of the charge carriers in the material with an induced conductivity (EBIC) and a breakdown model, leading to a smoother distribution of the charges. Combined with a more accurate tracing of low energy electrons in the electric field, we managed to reproduce the dynamically changing charging contrast due to an induced positive surface potential.

  9. Charge-Dipole Acceleration of Polar Gas Molecules towards Charged Nanoparticles: Involvement in Powerful Charge-Induced Catalysis of Heterophase Chemical Reactions and Ball Lightning Phenomenon

    Directory of Open Access Journals (Sweden)

    Oleg Meshcheryakov

    2010-01-01

    Full Text Available In humid air, the substantial charge-dipole attraction and electrostatic acceleration of surrounding water vapour molecules towards charged combustible nanoparticles cause intense electrostatic hydration and preferential oxidation of these nanoparticles by electrostatically accelerated polar water vapour molecules rather than nonaccelerated nonpolar oxygen gas molecules. Intense electrostatic hydration of charged combustible nanoparticles converts the nanoparticle's oxide-based shells into the hydroxide-based electrolyte shells, transforming these nanoparticles into reductant/air core-shell nanobatteries, periodically short-circuited by intraparticle field and thermionic emission. Partially synchronized electron emission breakdowns within trillions of nanoparticles-nanobatteries turn a cloud of charged nanoparticles-nanobatteries into a powerful radiofrequency aerosol generator. Electrostatic oxidative hydration and charge-catalyzed oxidation of charged combustible nanoparticles also contribute to a self-oscillating thermocycling process of evolution and periodic autoignition of inflammable gases near to the nanoparticle's surface. The described effects might be of interest for the improvement of certain nanotechnological heterophase processes and to better understand ball lightning phenomenon.

  10. Charge Pricing Optimization Model for Private Charging Piles in Beijing

    Directory of Open Access Journals (Sweden)

    Xingping Zhang

    2017-11-01

    Full Text Available This paper develops a charge pricing model for private charging piles (PCPs by considering the environmental and economic effects of private electric vehicle (PEV charging energy sources and the impact of PCP charging load on the total load. This model simulates users’ responses to different combinations of peak-valley prices based on the charging power of PCPs and user charging transfer rate. According to the regional power structure, it calculates the real-time coal consumption, carbon dioxide emissions reduction, and power generation costs of PEVs on the power generation side. The empirical results demonstrate that the proposed peak-valley time-of-use charging price can not only minimize the peak-valley difference of the total load but also improve the environmental effects of PEVs and the economic income of the power system. The sensitivity analysis shows that the load-shifting effect of PCPs will be more obvious when magnifying the number of PEVs by using the proposed charging price. The case study indicates that the proposed peak, average, and valley price in Beijing should be 1.8, 1, and 0.4 yuan/kWh, which can promote the large-scale adoption of PEVs.

  11. Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules.

    Science.gov (United States)

    Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin; Huang, Yingzhou

    2017-08-02

    The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-M x (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-M x complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS.

  12. Cross sections and rate coefficients for charge exchange reactions of protons with hydrocarbon molecules

    International Nuclear Information System (INIS)

    Janev, R.K.; Kato, T.; Wang, J.G.

    2001-05-01

    The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C x H y charge exchange reactions from thermal energies up to several hundreds keV for all C x H y molecules with x=1, 2, 3 and 1 ≤ y ≤ 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)

  13. Cross sections and rate coefficients for charge exchange reactions of protons with hydrocarbon molecules

    Energy Technology Data Exchange (ETDEWEB)

    Janev, R.K.; Kato, T. [National Inst. for Fusion Science, Toki, Gifu (Japan); Wang, J.G. [Department of Physics and Astronomy, University of Georgia, Athens (United States)

    2001-05-01

    The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C{sub x}H{sub y} charge exchange reactions from thermal energies up to several hundreds keV for all C{sub x}H{sub y} molecules with x=1, 2, 3 and 1 {<=} y {<=} 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)

  14. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  15. Stochastic Models of Molecule Formation on Dust

    Science.gov (United States)

    Charnley, Steven; Wirstroem, Eva

    2011-01-01

    We will present new theoretical models for the formation of molecules on dust. The growth of ice mantles and their layered structure is accounted for and compared directly to observations through simulation of the expected ice absorption spectra

  16. Study on molecular modelling of the selectivity of catalysts for heavy petroleum fractions hydrocracking; Etude sur molecule modele des parametres regissant la selectivite des catalyseurs d'hydrocraquage des charges lourdes

    Energy Technology Data Exchange (ETDEWEB)

    Leite, L.

    2000-10-19

    Hydrocracking is a catalytic petroleum refining process that is commonly applied to upgrade the heavier fractions obtained from the distillation of crude oils. Nowadays the European demand for good quality middle distillates (kerosene and gas-oil) is high and one important goal for the refining is to transform selectively feedstocks into middle distillates. To understand how this transformation occurs, studies on model compounds have been investigated. Numerous studies have been devoted to paraffin hydrocracking. However theses molecules do not fully represent heavy petroleum fraction. Taking into account that the trend in the future will be to treat heavier feedstocks containing a large quantity of PNA (Polynuclear Aromatic hydrocarbons), the understanding of their transformation under hydrocracking conditions is a key point. In this study, we studied hydrocracking of phenanthrene over platinum on acid solids catalysts. Our main aim was to compare hydrocracking catalysts in term of catalytic activity and selectivity toward primary products thanks to our model reaction and to correlate these catalytic performances with acid solid properties and especially to rationalize the effects due to the acidity and the porosity of the acid solids. Catalytic experiments emphasised an effect of the porous structure on the selectivities. The acidity of the catalysts seemed to impose the catalytic activity but did not permit to explain the selectivities. This 'effect of the structure' has been clarified with the simulation of intermediate products adsorption and diffusion in the studied structures thanks to a molecular modelling study. Indeed, the selectivities obtained during phenanthrene hydrocracking have been linked up with the intermediate products adsorption energies in the structures. The results of this study permit to propose that the key-step for selectivities determination is the physical desorption of the primary products. (author)

  17. Large tunable image-charge effects in single-molecule junctions.

    NARCIS (Netherlands)

    Perrin, M.L.; Verzijl, C.J.; Martin, C.A.; Shaikh, A.J.; Eelkema, R.; Esch, J.H. van; Ruitenbeek, J.M. van; Thijssen, J.M.; Zant, H.S. van der; Dulic, D.

    2013-01-01

    Metal/organic interfaces critically determine the characteristics of molecular electronic devices, because they influence the arrangement of the orbital levels that participate in charge transport. Studies on self-assembled monolayers show molecule-dependent energy-level shifts as well as

  18. Charge transfer through single molecule contacts: How reliable are rate descriptions?

    Directory of Open Access Journals (Sweden)

    Denis Kast

    2011-08-01

    Full Text Available Background: The trend for the fabrication of electrical circuits with nanoscale dimensions has led to impressive progress in the field of molecular electronics in the last decade. However, a theoretical description of molecular contacts as the building blocks of future devices is challenging, as it has to combine the properties of Fermi liquids in the leads with charge and phonon degrees of freedom on the molecule. Outside of ab initio schemes for specific set-ups, generic models reveal the characteristics of transport processes. Particularly appealing are descriptions based on transfer rates successfully used in other contexts such as mesoscopic physics and intramolecular electron transfer. However, a detailed analysis of this scheme in comparison with numerically exact solutions is still elusive.Results: We show that a formulation in terms of transfer rates provides a quantitatively accurate description even in domains of parameter space where strictly it is expected to fail, e.g., at lower temperatures. Typically, intramolecular phonons are distributed according to a voltage driven steady state that can only roughly be captured by a thermal distribution with an effective elevated temperature (heating. An extension of a master equation for the charge–phonon complex, to effectively include the impact of off-diagonal elements of the reduced density matrix, provides very accurate solutions even for stronger electron–phonon coupling.Conclusion: Rate descriptions and master equations offer a versatile model to describe and understand charge transfer processes through molecular junctions. Such methods are computationally orders of magnitude less expensive than elaborate numerical simulations that, however, provide exact solutions as benchmarks. Adjustable parameters obtained, e.g., from ab initio calculations allow for the treatment of various realizations. Even though not as rigorously formulated as, e.g., nonequilibrium Green’s function

  19. Stochastic models for surface diffusion of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Shea, Patrick, E-mail: patrick.shea@dal.ca; Kreuzer, Hans Jürgen [Department of Physics and Atmospheric Science, Dalhousie University, Halifax, Nova Scotia B3H 3J5 (Canada)

    2014-07-28

    We derive a stochastic model for the surface diffusion of molecules, starting from the classical equations of motion for an N-atom molecule on a surface. The equation of motion becomes a generalized Langevin equation for the center of mass of the molecule, with a non-Markovian friction kernel. In the Markov approximation, a standard Langevin equation is recovered, and the effect of the molecular vibrations on the diffusion is seen to lead to an increase in the friction for center of mass motion. This effective friction has a simple form that depends on the curvature of the lowest energy diffusion path in the 3N-dimensional coordinate space. We also find that so long as the intramolecular forces are sufficiently strong, memory effects are usually not significant and the Markov approximation can be employed, resulting in a simple one-dimensional model that can account for the effect of the dynamics of the molecular vibrations on the diffusive motion.

  20. Influence of capture to excited states of multiply charged ion beams colliding with small molecules

    International Nuclear Information System (INIS)

    Montenegro, P; Monti, J M; Fojón, O A; Hanssen, J; Rivarola, R D

    2015-01-01

    Electron capture by multiply charged ions impacting on small molecules is theoretically investigated. Particular attention is paid to the case of biological targets. The interest is focused on the importance of the transition to excited final states which can play a dominant role on the total capture cross sections. Projectiles at intermediate and high collision energies are considered. Comparison with existing experimental data is shown. (paper)

  1. Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule

    Directory of Open Access Journals (Sweden)

    Satoshi Ohmura

    2016-01-01

    Full Text Available Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC-triethylene glycol (TEG–C60 molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D+ and A- in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.

  2. Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule

    Energy Technology Data Exchange (ETDEWEB)

    Ohmura, Satoshi, E-mail: s.ohmura.m4@cc.it-hiroshima.ac.jp [Research Center for Condensed Matter Physics, Department of Civil Engineering and Urban Design, Hiroshima Institute of Technology, Hiroshima 731-5193 (Japan); Tsuruta, Kenji [Department of Electrical and Electronic Engineering, Okayama University, Okayama 700-8530 (Japan); Shimojo, Fuyuki [Department of Physics, Kumamoto University, Kumamoto 860-8555 Japan (Japan); Nakano, Aiichiro [Collaboratory for Advanced Computing and Simulations, Department of Computer Science, Department of Physics & Astronomy, Department of Chemical Engineering & Materials Science, Department of Biological Sciences, University of Southern California, CA90089-024 (United States)

    2016-01-15

    Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC)-triethylene glycol (TEG)–C{sub 60} molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D{sup +} and A{sup -}) in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.

  3. Charge dependence of one and two electron processes in collisions between hydrogen molecules and fast projectiles

    International Nuclear Information System (INIS)

    Wells, E.; Ben-Itzhak, I.; Carnes, K.D.; Krishnamurthi, V.

    1996-01-01

    The ratio of double- to single-ionization (DI/SI) as well as the ratio of ionization-excitation to single-ionization (IE/SI) in hydrogen molecules was studied by examining the effect of the projectile charge on these processes. The DI/SI and IE/SI ratios were measured using the coincidence time of flight technique at a fixed velocity (1 MeV/amu) over a range of projectile charge states (q = 1-9,14,20). Preliminary results indicate that for a highly charged F 9+ projectile the DI/SI and IE/SI ratios are 6.8% and 24.7%, respectively, a large increase from the ratios of 0.13% and 1.95%, respectively, for H + projectiles. For low charge states, the DI/SI is negligible relative to the IE/SI ratio, while for more highly charged projectiles the DI/SI ratio becomes comparable to the IE/SI ratio. This indicates that double-ionization increases much more rapidly with projectile charge than ionization-excitation

  4. X-ray Pump–Probe Investigation of Charge and Dissociation Dynamics in Methyl Iodine Molecule

    Directory of Open Access Journals (Sweden)

    Li Fang

    2017-05-01

    Full Text Available Molecular dynamics is of fundamental interest in natural science research. The capability of investigating molecular dynamics is one of the various motivations for ultrafast optics. We present our investigation of photoionization and nuclear dynamics in methyl iodine (CH3I molecule with an X-ray pump X-ray probe scheme. The pump–probe experiment was realized with a two-mirror X-ray split and delay apparatus. Time-of-flight mass spectra at various pump–probe delay times were recorded to obtain the time profile for the creation of high charge states via sequential ionization and for molecular dissociation. We observed high charge states of atomic iodine up to 29+, and visualized the evolution of creating these high atomic ion charge states, including their population suppression and enhancement as the arrival time of the second X-ray pulse was varied. We also show the evolution of the kinetics of the high charge states upon the timing of their creation during the ionization-dissociation coupled dynamics. We demonstrate the implementation of X-ray pump–probe methodology for investigating X-ray induced molecular dynamics with femtosecond temporal resolution. The results indicate the footprints of ionization that lead to high charge states, probing the long-range potential curves of the high charge states.

  5. Anisotropic charge transport in large single crystals of π-conjugated organic molecules.

    Science.gov (United States)

    Hourani, Wael; Rahimi, Khosrow; Botiz, Ioan; Koch, Felix Peter Vinzenz; Reiter, Günter; Lienerth, Peter; Heiser, Thomas; Bubendorff, Jean-Luc; Simon, Laurent

    2014-05-07

    The electronic properties of organic semiconductors depend strongly on the nature of the molecules, their conjugation and conformation, their mutual distance and the orientation between adjacent molecules. Variations of intramolecular distances and conformation disturb the conjugation and perturb the delocalization of charges. As a result, the mobility considerably decreases compared to that of a covalently well-organized crystal. Here, we present electrical characterization of large single crystals made of the regioregular octamer of 3-hexyl-thiophene (3HT)8 using a conductive-atomic force microscope (C-AFM) in air. We find a large anisotropy in the conduction with charge mobility values depending on the crystallographic orientation of the single crystal. The smaller conduction is in the direction of π-π stacking (along the long axis of the single crystal) with a mobility value in the order of 10(-3) cm(2) V(-1) s(-1), and the larger one is along the molecular axis (in the direction normal to the single crystal surface) with a mobility value in the order of 0.5 cm(2) V(-1) s(-1). The measured current-voltage (I-V) curves showed that along the molecular axis, the current followed an exponential dependence corresponding to an injection mode. In the π-π stacking direction, the current exhibits a space charge limited current (SCLC) behavior, which allows us to estimate the charge carrier mobility.

  6. Visualizing electron dynamics in organic materials: Charge transport through molecules and angular resolved photoemission

    Science.gov (United States)

    Kümmel, Stephan

    Being able to visualize the dynamics of electrons in organic materials is a fascinating perspective. Simulations based on time-dependent density functional theory allow to realize this hope, as they visualize the flow of charge through molecular structures in real-space and real-time. We here present results on two fundamental processes: Photoemission from organic semiconductor molecules and charge transport through molecular structures. In the first part we demonstrate that angular resolved photoemission intensities - from both theory and experiment - can often be interpreted as a visualization of molecular orbitals. However, counter-intuitive quantum-mechanical electron dynamics such as emission perpendicular to the direction of the electrical field can substantially alter the picture, adding surprising features to the molecular orbital interpretation. In a second study we calculate the flow of charge through conjugated molecules. The calculations show in real time how breaks in the conjugation can lead to a local buildup of charge and the formation of local electrical dipoles. These can interact with neighboring molecular chains. As a consequence, collections of ''molecular electrical wires'' can show distinctly different characteristics than ''classical electrical wires''. German Science Foundation GRK 1640.

  7. Signatures of dynamics in charge transport through organic molecules; Dynamisches Verhalten beim Ladungstransport durch organische Molekuele

    Energy Technology Data Exchange (ETDEWEB)

    Secker, Daniel

    2008-06-03

    The aim of the thesis at hand was to investigate dynamical behaviour in charge transport through organic molecules experimentally with the help of the mechanically controlled break junction (MCBJ) technique. the thesis concentrates on the complex interaction between the molecular contact configuration and the electronic structure. it is shown that by variation of the electrode distance and so by a manipulation of the molecule and contact configuration the electronic structure as well as the coupling between the molecule and the electrodes is affected. The latter statement is an additional hint how closely I-V-characteristics depend on the molecular contact configuration. Depending on the applied voltage and so the electric field there are two different configurations preferred by the molecular contact. A potential barrier between these two states is the origin of the hysteresis. A central part of the thesis is dealing with measurements of the current noise. Finally it can be concluded that the detailed discussion reveals the strong effect of dynamical interactions between the atomic configuration of the molecular contact and the electronic structure on the charge transport in single molecule junctions. (orig.)

  8. Graphical models for inferring single molecule dynamics

    Directory of Open Access Journals (Sweden)

    Gonzalez Ruben L

    2010-10-01

    Full Text Available Abstract Background The recent explosion of experimental techniques in single molecule biophysics has generated a variety of novel time series data requiring equally novel computational tools for analysis and inference. This article describes in general terms how graphical modeling may be used to learn from biophysical time series data using the variational Bayesian expectation maximization algorithm (VBEM. The discussion is illustrated by the example of single-molecule fluorescence resonance energy transfer (smFRET versus time data, where the smFRET time series is modeled as a hidden Markov model (HMM with Gaussian observables. A detailed description of smFRET is provided as well. Results The VBEM algorithm returns the model’s evidence and an approximating posterior parameter distribution given the data. The former provides a metric for model selection via maximum evidence (ME, and the latter a description of the model’s parameters learned from the data. ME/VBEM provide several advantages over the more commonly used approach of maximum likelihood (ML optimized by the expectation maximization (EM algorithm, the most important being a natural form of model selection and a well-posed (non-divergent optimization problem. Conclusions The results demonstrate the utility of graphical modeling for inference of dynamic processes in single molecule biophysics.

  9. Reorganization energy upon charging a single molecule on an insulator measured by atomic force microscopy

    Science.gov (United States)

    Fatayer, Shadi; Schuler, Bruno; Steurer, Wolfram; Scivetti, Ivan; Repp, Jascha; Gross, Leo; Persson, Mats; Meyer, Gerhard

    2018-05-01

    Intermolecular single-electron transfer on electrically insulating films is a key process in molecular electronics1-4 and an important example of a redox reaction5,6. Electron-transfer rates in molecular systems depend on a few fundamental parameters, such as interadsorbate distance, temperature and, in particular, the Marcus reorganization energy7. This crucial parameter is the energy gain that results from the distortion of the equilibrium nuclear geometry in the molecule and its environment on charging8,9. The substrate, especially ionic films10, can have an important influence on the reorganization energy11,12. Reorganization energies are measured in electrochemistry13 as well as with optical14,15 and photoemission spectroscopies16,17, but not at the single-molecule limit and nor on insulating surfaces. Atomic force microscopy (AFM), with single-charge sensitivity18-22, atomic-scale spatial resolution20 and operable on insulating films, overcomes these challenges. Here, we investigate redox reactions of single naphthalocyanine (NPc) molecules on multilayered NaCl films. Employing the atomic force microscope as an ultralow current meter allows us to measure the differential conductance related to transitions between two charge states in both directions. Thereby, the reorganization energy of NPc on NaCl is determined as (0.8 ± 0.2) eV, and density functional theory (DFT) calculations provide the atomistic picture of the nuclear relaxations on charging. Our approach presents a route to perform tunnelling spectroscopy of single adsorbates on insulating substrates and provides insight into single-electron intermolecular transport.

  10. Electron-molecule chemistry and charging processes on organic ices and Titan's icy aerosol surrogates

    Science.gov (United States)

    Pirim, C.; Gann, R. D.; McLain, J. L.; Orlando, T. M.

    2015-09-01

    Electron-induced polymerization processes and charging events that can occur within Titan's atmosphere or on its surface were simulated using electron irradiation and dissociative electron attachment (DEA) studies of nitrogen-containing organic condensates. The DEA studies probe the desorption of H- from hydrogen cyanide (HCN), acetonitrile (CH3CN), and aminoacetonitrile (NH2CH2CN) ices, as well as from synthesized tholin materials condensed or deposited onto a graphite substrate maintained at low temperature (90-130 K). The peak cross sections for H- desorption during low-energy (3-15 eV) electron irradiation were measured and range from 3 × 10-21 to 2 × 10-18 cm2. Chemical and structural transformations of HCN ice upon 2 keV electron irradiation were investigated using X-ray photoelectron and Fourier-transform infrared spectroscopy techniques. The electron-beam processed materials displayed optical properties very similar to tholins produced by conventional discharge methods. Electron and negative ion trapping lead to 1011 charges cm-2 on a flat surface which, assuming a radius of 0.05 μm for Titan aerosols, is ∼628 charges/radius (in μm). The facile charge trapping indicates that electron interactions with nitriles and complex tholin-like molecules could affect the conductivity of Titan's atmosphere due to the formation of large negative ion complexes. These negatively charged complexes can also precipitate onto Titan's surface and possibly contribute to surface reactions and the formation of dunes.

  11. Modeling Charge Collection in Detector Arrays

    Science.gov (United States)

    Hardage, Donna (Technical Monitor); Pickel, J. C.

    2003-01-01

    A detector array charge collection model has been developed for use as an engineering tool to aid in the design of optical sensor missions for operation in the space radiation environment. This model is an enhancement of the prototype array charge collection model that was developed for the Next Generation Space Telescope (NGST) program. The primary enhancements were accounting for drift-assisted diffusion by Monte Carlo modeling techniques and implementing the modeling approaches in a windows-based code. The modeling is concerned with integrated charge collection within discrete pixels in the focal plane array (FPA), with high fidelity spatial resolution. It is applicable to all detector geometries including monolithc charge coupled devices (CCDs), Active Pixel Sensors (APS) and hybrid FPA geometries based on a detector array bump-bonded to a readout integrated circuit (ROIC).

  12. Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy

    International Nuclear Information System (INIS)

    Lee, Min Hyung; Song, Hyunwook

    2013-01-01

    We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects

  13. Charge transfer through amino groups-small molecules interface improving the performance of electroluminescent devices

    Science.gov (United States)

    Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Kus, Mahmut; Okur, Salih; Demic, Şerafettin; Demirak, Kadir; Kurt, Mustafa; Icli, Sıddık

    2016-05-01

    A carboxylic group functioned charge transporting was synthesized and self-assembled on an indium tin oxide (ITO) anode. A typical electroluminescent device [modified ITO/TPD (50 nm)/Alq3 (60 nm)/LiF (2 nm)/(120 nm)] was fabricated to investigate the effect of the amino groups-small molecules interface on the characteristics of the device. The increase in the surface work function of ITO is expected to facilitate the hole injection from the ITO anode to the Hole Transport Layer (HTL) in electroluminescence. The modified electroluminescent device could endure a higher current and showed a much higher luminance than the nonmodified one. For the produced electroluminescent devices, the I-V characteristics, optical characterization and quantum yields were performed. The external quantum efficiency of the modified electroluminescent device is improved as the result of the presence of the amino groups-small molecules interface.

  14. Excitation of atoms and molecules in collisions with highly charged ions

    International Nuclear Information System (INIS)

    Watson, R.L.

    1991-01-01

    Much of the work this year has been directed toward studies of charge exchange and ionization in single collisions of heavy ions with gaseous atoms and molecules. A study of the double ionization of He by high energy N 7+ ions, which began last year, was extended up in energy to 40 MeV/amu. These measurements verified the deviations from the predictions of theory observed in our previous work and indicated that the energy required to reach the limiting value of the ratio of double-to-single ionization cross sections may be as high as 70 MeV/amu

  15. Elimination of Spurious Fractional Charges in Dissociating Molecules by Correcting the Shape of Approximate Kohn-Sham Potentials.

    Science.gov (United States)

    Komsa, Darya N; Staroverov, Viktor N

    2016-11-08

    Standard density-functional approximations often incorrectly predict that heteronuclear diatomic molecules dissociate into fractionally charged atoms. We demonstrate that these spurious charges can be eliminated by adapting the shape-correction method for Kohn-Sham potentials that was originally introduced to improve Rydberg excitation energies [ Phys. Rev. Lett. 2012 , 108 , 253005 ]. Specifically, we show that if a suitably determined fraction of electron charge is added to or removed from a frontier Kohn-Sham orbital level, the approximate Kohn-Sham potential of a stretched molecule self-corrects by developing a semblance of step structure; if this potential is used to obtain the electron density of the neutral molecule, charge delocalization is blocked and spurious fractional charges disappear beyond a certain internuclear distance.

  16. Electrostatic charge bounds for ball lightning models

    International Nuclear Information System (INIS)

    Stephan, Karl D

    2008-01-01

    Several current theories concerning the nature of ball lightning predict a substantial electrostatic charge in order to account for its observed motion and shape (Turner 1998 Phys. Rep. 293 1; Abrahamson and Dinniss 2000 Nature 403 519). Using charged soap bubbles as a physical model for ball lightning, we show that the magnitude of charge predicted by some of these theories is too high to allow for the types of motion commonly observed in natural ball lightning, which includes horizontal motion above the ground and movement near grounded conductors. Experiments show that at charge levels of only 10-15 nC, 3-cm-diameter soap bubbles tend to be attracted by induced charges to the nearest grounded conductor and rupture. We conclude with a scaling rule that can be used to extrapolate these results to larger objects and surroundings

  17. Charge trapping at organic/self-assembly molecule interfaces studied by electrical switching behaviour in a crosspoint structure

    International Nuclear Information System (INIS)

    Li Yun; Pan Lijia; Pu Lin; Shi Yi; Liu Chuan; Tsukagoshi, Kazuhito

    2012-01-01

    Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels. (paper)

  18. Charge trapping at organic/self-assembly molecule interfaces studied by electrical switching behaviour in a crosspoint structure

    Science.gov (United States)

    Li, Yun; Liu, Chuan; Pan, Lijia; Pu, Lin; Tsukagoshi, Kazuhito; Shi, Yi

    2012-01-01

    Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels.

  19. Cross-sections for inelastic collisions of fast charged particles with atoms and molecules

    International Nuclear Information System (INIS)

    Inokuti, M.

    1987-01-01

    Despite the long history of research, the current experimental data of the cross-sections, required for solving problems of radiological physics and dosimetry, are far from being complete or even satisfactory for tentative applications. Calculations are, in general, difficult and only in exceptional situations lead to reliable results. Thus, one practical approach to the cross-section determination is to test experimental data with general criteria. This is possible because cross-sections for various processes are related among themselves and with many other properties of atoms and molecules. For example, the Bethe theory indicates a close connection between photoabsorption and energy absorption by glancing collisions and puts many other useful constraints on the cross-section data. Development and use of these data constraints, first advanced by Platzman, can now be demonstrated in many examples. More recent studies concern the determination of the analytic expression most suitable for fitting the data on the oscillator strength distribution or the energy distribution of secondary electrons from ionizing collisions of charged particles. There are three areas to which major efforts should be directed: (1) Methods of absolute cross-section measurements, both for electron and ionic collisions, must be thoroughly reviewed so that sources of systematic errors may be identified and corrected. (2) Efforts should be devoted to the understanding of the data systematics, viz. the trends of cross-sections for a series of molecules. This is especially important because the variety of molecules relevant to radiological physics and radiation biology is so enormous that even the data presentation for each molecule will be impractical. (3) Electron and ionic collisions with molecules in condensed phases will be an important topic of study for years to come. Initial reports on efforts in this direction are encouraging. 49 refs

  20. Adsorption of a cationic dye molecule on polystyrene microspheres in colloids: effect of surface charge and composition probed by second harmonic generation.

    Science.gov (United States)

    Eckenrode, Heather M; Jen, Shih-Hui; Han, Jun; Yeh, An-Gong; Dai, Hai-Lung

    2005-03-17

    Nonlinear optical probe, second harmonic generation (SHG), of the adsorption of the dye molecule malachite green (MG), in cationic form at pH polystyrene microspheres in aqueous solution is used to study the effect of surface charge and composition on molecular adsorption. Three types of polystyrene microspheres with different surface composition are investigated: (1) a sulfate terminated, anionic surface, (2) a neutral surface without any functional group termination, and (3) an amine terminated, cationic surface. The cationic dye was found to adsorb at all three surfaces, regardless of surface charge. The adsorption free energies, DeltaG's, measured for the three surfaces are -12.67, -12.39, and -10.46 kcal/mol, respectively, with the trend as expected from the charge interactions. The adsorption density on the anionic surface, where attractive charge-charge interaction dominates, is determined by the surface negative charge density. The adsorption densities on the neutral and cationic surfaces are on the other hand higher, perhaps as a result of a balance between minimizing repulsive charge interaction and maximizing attractive molecule-substrate and intermolecular interactions. The relative strength of the SH intensity per molecule, in combination of a model calculation, reveals that the C(2) axis of the MG molecule is nearly perpendicular to the surface on the anionic surface and tilts away from the surface norm when the surface is neutral and further away when cationic. Changing the pH of the solution may alter the surface charge and subsequently affect the adsorption configuration and SH intensity.

  1. Droplet-model predictions of charge moments

    International Nuclear Information System (INIS)

    Myers, W.D.

    1982-04-01

    The Droplet Model expressions for calculating various moments of the nuclear charge distribution are given. There are contributions to the moments from the size and shape of the system, from the internal redistribution induced by the Coulomb repulsion, and from the diffuseness of the surface. A case is made for the use of diffuse charge distributions generated by convolution as an alternative to Fermi-functions

  2. A simple model for electrical charge in globular macromolecules and linear polyelectrolytes in solution

    Science.gov (United States)

    Krishnan, M.

    2017-05-01

    We present a model for calculating the net and effective electrical charge of globular macromolecules and linear polyelectrolytes such as proteins and DNA, given the concentration of monovalent salt and pH in solution. The calculation is based on a numerical solution of the non-linear Poisson-Boltzmann equation using a finite element discretized continuum approach. The model simultaneously addresses the phenomena of charge regulation and renormalization, both of which underpin the electrostatics of biomolecules in solution. We show that while charge regulation addresses the true electrical charge of a molecule arising from the acid-base equilibria of its ionizable groups, charge renormalization finds relevance in the context of a molecule's interaction with another charged entity. Writing this electrostatic interaction free energy in terms of a local electrical potential, we obtain an "interaction charge" for the molecule which we demonstrate agrees closely with the "effective charge" discussed in charge renormalization and counterion-condensation theories. The predictions of this model agree well with direct high-precision measurements of effective electrical charge of polyelectrolytes such as nucleic acids and disordered proteins in solution, without tunable parameters. Including the effective interior dielectric constant for compactly folded molecules as a tunable parameter, the model captures measurements of effective charge as well as published trends of pKa shifts in globular proteins. Our results suggest a straightforward general framework to model electrostatics in biomolecules in solution. In offering a platform that directly links theory and experiment, these calculations could foster a systematic understanding of the interrelationship between molecular 3D structure and conformation, electrical charge and electrostatic interactions in solution. The model could find particular relevance in situations where molecular crystal structures are not available or

  3. Invariance of molecular charge transport upon changes of extended molecule size and several related issues

    Directory of Open Access Journals (Sweden)

    Ioan Bâldea

    2016-03-01

    Full Text Available As a sanity test for the theoretical method employed, studies on (steady-state charge transport through molecular devices usually confine themselves to check whether the method in question satisfies the charge conservation. Another important test of the theory’s correctness is to check that the computed current does not depend on the choice of the central region (also referred to as the “extended molecule”. This work addresses this issue and demonstrates that the relevant transport and transport-related properties are indeed invariant upon changing the size of the extended molecule, when the embedded molecule can be described within a general single-particle picture (namely, a second-quantized Hamiltonian bilinear in the creation and annihilation operators. It is also demonstrates that the invariance of nonequilibrium properties is exhibited by the exact results but not by those computed approximately within ubiquitous wide- and flat-band limits (WBL and FBL, respectively. To exemplify the limitations of the latter, the phenomenon of negative differential resistance (NDR is considered. It is shown that the exactly computed current may exhibit a substantial NDR, while the NDR effect is absent or drastically suppressed within the WBL and FBL approximations. The analysis done in conjunction with the WBLs and FBLs reveals why general studies on nonequilibrium properties require a more elaborate theoretical than studies on linear response properties (e.g., ohmic conductance and thermopower at zero temperature. Furthermore, examples are presented that demonstrate that treating parts of electrodes adjacent to the embedded molecule and the remaining semi-infinite electrodes at different levels of theory (which is exactly what most NEGF-DFT approaches do is a procedure that yields spurious structures in nonlinear ranges of current–voltage curves.

  4. The effect of polymer size and charge of molecules on permeation through synovial membrane and accumulation in hyaline articular cartilage.

    Science.gov (United States)

    Sterner, B; Harms, M; Wöll, S; Weigandt, M; Windbergs, M; Lehr, C M

    2016-04-01

    The treatment of joint related diseases often involves direct intra-articular injections. For rational development of novel delivery systems with extended residence time in the joint, detailed understanding of transport and retention phenomena within the joint is mandatory. This work presents a systematic study on the in vitro permeation, penetration and accumulation of model polymers with differing charges and molecular weights in bovine joint tissue. Permeation experiments with bovine synovial membrane were performed with PEG polymers (6-200 kDa) and methylene blue in customized diffusion chambers. For polyethylene glycol, 2-fold (PEG 6 kDa), 3-fold (PEG 10 kDa) and 13-fold (PEG 35 kDa) retention by the synovial membrane in reference to the small molecule methylene blue was demonstrated. No PEG 200 kDa was found in the acceptor in detectable amounts after 48 h. This showed the potential for a distinct extension of joint residence times by increasing molecular weights. In addition, experiments with bovine cartilage tissue were conducted. The ability for positively charged, high molecular weight chitosans and HEMA-Co-TMAP (HCT) polymers (up to 233 kDa) to distribute throughout the entire cartilage matrix was demonstrated. In contrast, a distribution into cartilage was not observed for neutral PEG polymers (6-200 kDa). Furthermore, the positive charge density of different compounds (chitosan, HEMA-Co-TMAP, methylene blue, MSC C1 (neutral NCE) and MSC D1 (positively charged NCE) was found to correlate with their accumulation in bovine cartilage tissue. In summary, the results offer pre-clinical in vitro data, indicating that the modification of molecular size and charge of a substance has the potential to decelerate its clearance through the synovial membrane and to promote accumulation inside the cartilage matrix. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Modeling and Analyzing Electric Vehicle Charging

    DEFF Research Database (Denmark)

    Andersen, Ove; Krogh, Benjamin Bjerre; Thomsen, Christian

    2016-01-01

    , such as wind turbines. To both enable a smart grid and the use of renewable energy, it is essential to know when and where an EV is plugged into the power grid and what battery capacity is available. In this paper, we present a generic spatio-temporal data-warehouse model for storing detailed information...... on all aspects of charging EVs, including integration with the electricity prices from a spot market. The proposed data warehouse is fully implemented and currently contains 2.5 years of charging data from 176 EVs. We describe the date warehouse model and the implementation including complex operations...

  6. Modelling of energetic molecule-surface interactions

    International Nuclear Information System (INIS)

    Kerford, M.

    2000-09-01

    This thesis contains the results of molecular dynamics simulations of molecule-surface interactions, looking particularly at fullerene molecules and carbon surfaces. Energetic impacts of fullerene molecules on graphite create defect craters. The relationship between the parameters of the impacting molecule and the parameters of the crater axe examined and found to be a function of the energy and velocity of the impacting molecule. Less energetic fullerene molecules can be scattered from a graphite surface and the partitioning of energy after a scattering event is investigated. It is found that a large fraction of the kinetic energy retained after impact is translational energy, with a small fraction of rotational energy and a number of vibrational modes. At impact energies where the surface is not broken and at normal incidence, surface waves axe seen to occur. These waves axe used to develop a method of desorbing molecules from a graphite surface without damage to either the surface or the molecules being desorbed. A number of fullerene molecules are investigated and ways to increase the desorption yield are examined. It is found that this is a successful technique for desorbing large numbers of intact molecules from graphite. This technique could be used for desorbing intact molecules into a gas phase for mass spectrometric analysis. (author)

  7. A Simplified Quantum Mechanical Model of Diatomic Molecules

    Science.gov (United States)

    Nielsen, Lars Drud

    1978-01-01

    Introduces a simple one-dimensional model of a diatomic molecule that can explain all the essential features of a real two particle quantum mechanical system and gives quantitative results in fair agreement with those of a hydrogen molecule. (GA)

  8. Formation and decay of the intermediate quasistationary ion N-2 during charge exchange between fast H- ions and nitrogen molecules

    International Nuclear Information System (INIS)

    Kazanskii, A.K.

    1984-01-01

    The detachment of the electron from the H - ion during a collision with the nitrogen molecule at 1--6 keV occurs as a result of charge transfer to an unstable intermediate state of the molecular ion N - 2 and the subsequent decay of the ion. The formation process is described in the impulse approximation, and the motion of nuclei in the ion is treated quasiclassically. Expressions are obtained for the spectrum of emitted electrons and for the energy-loss spectrum of heavy particles. These expressions relate the spectra to the cross sections for the vibrational excitation of N 2 by electron impact. A convenient expression for the amplitude for the formation of the intermediate state is obtained in the ''boomerang'' model, and it is shown that one of the parameters, considered to be adjustable in traditional theory, can be calculated

  9. Problems in Modelling Charge Output Accelerometers

    Directory of Open Access Journals (Sweden)

    Tomczyk Krzysztof

    2016-12-01

    Full Text Available The paper presents major issues associated with the problem of modelling change output accelerometers. The presented solutions are based on the weighted least squares (WLS method using transformation of the complex frequency response of the sensors. The main assumptions of the WLS method and a mathematical model of charge output accelerometers are presented in first two sections of this paper. In the next sections applying the WLS method to estimation of the accelerometer model parameters is discussed and the associated uncertainties are determined. Finally, the results of modelling a PCB357B73 charge output accelerometer are analysed in the last section of this paper. All calculations were executed using the MathCad software program. The main stages of these calculations are presented in Appendices A−E.

  10. Quantum modeling of ultrafast photoinduced charge separation

    Science.gov (United States)

    Rozzi, Carlo Andrea; Troiani, Filippo; Tavernelli, Ivano

    2018-01-01

    Phenomena involving electron transfer are ubiquitous in nature, photosynthesis and enzymes or protein activity being prominent examples. Their deep understanding thus represents a mandatory scientific goal. Moreover, controlling the separation of photogenerated charges is a crucial prerequisite in many applicative contexts, including quantum electronics, photo-electrochemical water splitting, photocatalytic dye degradation, and energy conversion. In particular, photoinduced charge separation is the pivotal step driving the storage of sun light into electrical or chemical energy. If properly mastered, these processes may also allow us to achieve a better command of information storage at the nanoscale, as required for the development of molecular electronics, optical switching, or quantum technologies, amongst others. In this Topical Review we survey recent progress in the understanding of ultrafast charge separation from photoexcited states. We report the state-of-the-art of the observation and theoretical description of charge separation phenomena in the ultrafast regime mainly focusing on molecular- and nano-sized solar energy conversion systems. In particular, we examine different proposed mechanisms driving ultrafast charge dynamics, with particular regard to the role of quantum coherence and electron-nuclear coupling, and link experimental observations to theoretical approaches based either on model Hamiltonians or on first principles simulations.

  11. Manipulating the dipole layer of polar organic molecules on metal surfaces via different charge-transfer channels

    Science.gov (United States)

    Lin, Meng-Kai; Nakayama, Yasuo; Zhuang, Ying-Jie; Wang, Chin-Yung; Pi, Tun-Wen; Ishii, Hisao; Tang, S.-J.

    The key properties of organic films such as energy level alignment (ELA), work functions, and injection barriers are closely linked to this dipole layer. Using angle resolved photoemission spectroscopy (ARPES), we systemically investigate the coverage-dependent work functions and spectra line shapes of occupied molecular orbital states of a polar molecule, chloroaluminium phthalocyanine (ClAlPc), grown on Ag(111) to show that the orientations of the first ClAlPc layer can be manipulated via the molecule deposition rate and post annealing, causing ELA at organic-metal interface to differ for about 0.3 eV between Cl-up and Cl-down configuration. Moreover, by comparing the experimental results with the calculations based on both gas-phase model and realistic model of ClAlPc on Ag(111) , we evidence that the different orientations of ClAlPc dipole layers lead to different charge-transfer channels between ClAlPc and Ag, a key factor that controls the ELA at organic-metal interface.

  12. Modelling charge storage in Euclid CCD structures

    International Nuclear Information System (INIS)

    Clarke, A S; Holland, A; Hall, D J; Burt, D

    2012-01-01

    The primary aim of ESA's proposed Euclid mission is to observe the distribution of galaxies and galaxy clusters, enabling the mapping of the dark architecture of the universe [1]. This requires a high performance detector, designed to endure a harsh radiation environment. The e2v CCD204 image sensor was redesigned for use on the Euclid mission [2]. The resulting e2v CCD273 has a narrower serial register electrode and transfer channel compared to its predecessor, causing a reduction in the size of charge packets stored, thus reducing the number of traps encountered by the signal electrons during charge transfer and improving the serial Charge Transfer Efficiency (CTE) under irradiation [3]. The proposed Euclid CCD has been modelled using the Silvaco TCAD software [4], to test preliminary calculations for the Full Well Capacity (FWC) and the channel potential of the device and provide indications of the volume occupied by varying signals. These results are essential for the realisation of the mission objectives and for radiation damage studies, with the aim of producing empirically derived formulae to approximate signal-volume characteristics in the devices. These formulae will be used in the radiation damage (charge trapping) models. The Silvaco simulations have been tested against real devices to compare the experimental measurements to those predicted in the models. Using these results, the implications of this study on the Euclid mission can be investigated in more detail.

  13. Effect of charged and excited states on the decomposition of 1,1-diamino-2,2-dinitroethylene molecules

    International Nuclear Information System (INIS)

    Kimmel, Anna V.; Sushko, Peter V.; Shluger, Alexander L.; Kuklja, Maija M.

    2007-01-01

    The authors have calculated the electronic structure of individual 1,1-diamino-2,2-dinitroethylene molecules (FOX-7) in the gas phase by means of density functional theory with the hybrid B3LYP functional and 6-31+G(d,p) basis set and considered their dissociation pathways. Positively and negatively charged states as well as the lowest excited states of the molecule were simulated. They found that charging and excitation can not only reduce the activation barriers for decomposition reactions but also change the dominating chemistry from endo- to exothermic type. In particular, they found that there are two competing primary initiation mechanisms of FOX-7 decomposition: C-NO 2 bond fission and C-NO 2 to CONO isomerization. Electronic excitation or charging of FOX-7 disfavors CONO formation and, thus, terminates this channel of decomposition. However, if CONO is formed from the neutral FOX-7 molecule, charge trapping and/or excitation results in spontaneous splitting of an NO group accompanied by the energy release. Intramolecular hydrogen transfer is found to be a rare event in FOX-7 unless free electrons are available in the vicinity of the molecule, in which case HONO formation is a feasible exothermic reaction with a relatively low energy barrier. The effect of charged and excited states on other possible reactions is also studied. Implications of the obtained results to FOX-7 decomposition in condensed state are discussed

  14. Bianthrone in a Single-Molecule Junction: Conductance Switching with a Bistable Molecule Facilitated by Image Charge Effects

    DEFF Research Database (Denmark)

    Bjørnholm, Thomas

    2010-01-01

    Bianthrone is a sterically hindered compound that exists in the form of two nonplanar isomers. Our experimental study of single-molecule junctions with bianthrone reveals persistent switching of electric conductance at low temperatures, which can be reasonably associated with molecular isomerizat...

  15. Electronic coupling effects and charge transfer between organic molecules and metal surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Forker, Roman

    2010-07-01

    We employ a variant of optical absorption spectroscopy, namely in situ differential reflectance spectroscopy (DRS), for an analysis of the structure-properties relations of thin epitaxial organic films. Clear correlations between the spectra and the differently intense coupling to the respective substrates are found. While rather broad and almost structureless spectra are obtained for a quaterrylene (QT) monolayer on Au(111), the spectral shape resembles that of isolated molecules when QT is grown on graphite. We even achieve an efficient electronic decoupling from the subjacent Au(111) by inserting an atomically thin organic spacer layer consisting of hexa-peri-hexabenzocoronene (HBC) with a noticeably dissimilar electronic behavior. These observations are further consolidated by a systematic variation of the metal substrate (Au, Ag, and Al), ranging from inert to rather reactive. For this purpose, 3,4,9,10-perylenetetracarboxylic dianhydride (PTCDA) is chosen to ensure comparability of the molecular film structures on the different metals, and also because its electronic alignment on various metal surfaces has previously been studied with great intensity. We present evidence for ionized PTCDA at several interfaces and propose the charge transfer to be related to the electronic level alignment governed by interface dipole formation on the respective metals. (orig.)

  16. Excitation of atoms and molecules in collisions with highly charged ions

    International Nuclear Information System (INIS)

    Watson, R.L.

    1993-01-01

    A study of the double ionization of He by high-energy N 7+ ions was extended up in energy to 40 MeV/amu. Coincidence time-of-flight studies of multicharged N 2 , O 2 , and CO molecular ions produced in collisions with 97-MeV Ar 14+ ions were completed. Analysis of the total kinetic energy distributions and comparison with the available data for CO 2+ and CO 3+ from synchrotron radiation experiments led to the conclusion that ionization by Ar-ion impact populates states having considerably higher excitation energies than those accessed by photoionization. The dissociation fractions for CO 1+ and CO 2+ molecular ions, and the branching ratios for the most prominent charge division channels of CO 2+ through CO 7+ were determined from time-of-flight singles and coincidence data. An experiment designed to investigate the orientation dependence of dissociative multielectron ionization of molecules by heavy ion impact was completed. Measurements of the cross sections for K-shell ionization of intermediate-Z elements by 30-MeV/amu H, N, Ne, and Ar ions were completed. The cross sections were determined for solid targets of Z = 13, 22, 26, 29, 32, 40, 42, 46, and 50 by recording the spectra of K x rays with a Si(Li) spectrometer

  17. Functionalized organic semiconductor molecules to enhance charge carrier injection in electroluminescent cell

    Science.gov (United States)

    Yalcin, Eyyup; Kara, Duygu Akin; Karakaya, Caner; Yigit, Mesude Zeliha; Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Demic, Serafettin; Kus, Mahmut; Aboulouard, Abdelkhalk

    2017-07-01

    Organic semiconductor (OSC) materials as a charge carrier interface play an important role to improve the device performance of organic electroluminescent cells. In this study, 4,4″-bis(diphenyl amino)-1,1':3‧,1″-terphenyl-5'-carboxylic acid (TPA) and 4,4″-di-9H-carbazol-9-yl-1,1':3‧,1″-terphenyl-5'-carboxylic acid (CAR) has been designed and synthesized to modify indium tin oxide (ITO) layer as interface. Bare ITO and PEDOT:PSS coated on ITO was used as reference anode electrodes for comparison. Furthermore, PEDOT:PSS coated over CAR/ITO and TPA/ITO to observe stability of OSC molecules and to completely cover the ITO surface. Electrical, optical and surface characterizations were performed for each device. Almost all modified devices showed around 36% decrease at the turn on voltage with respect to bare ITO. The current density of bare ITO, ITO/CAR and ITO/TPA were measured as 288, 1525 and 1869 A/m2, respectively. By increasing current density, luminance of modified devices showed much better performance with respect to unmodified devices.

  18. The effects of electric fields on charged molecules and particles in individual microenvironments

    Science.gov (United States)

    Jamieson, K. S.; ApSimon, H. M.; Jamieson, S. S.; Bell, J. N. B.; Yost, M. G.

    Measurements of small air ion concentrations, electrostatic potential and AC electric field strengths were taken in an office setting to investigate the link between electric fields and charged molecule and particle concentrations in individual microenvironments. The results obtained indicate that the electromagnetic environments individuals can be exposed to whilst indoors can often bear little resemblance to those experienced outdoors in nature, and that many individuals may spend large periods of their time in "Faraday cage"-like conditions exposed to inappropriate levels and types of electric fields that can reduce localised concentrations of biologically essential and microbiocidal small air ions. Such conditions may escalate their risk of infection from airborne contaminants, including microbes, whilst increasing localised surface contamination. The degree of "electro-pollution" that individuals are exposed to was shown to be influenced by the type of microenvironment they occupy, with it being possible for very different types of microenvironment to exist within the same room. It is suggested that adopting suitable electromagnetic hygiene/productivity guidelines that seek to replicate the beneficial effects created by natural environments may greatly mitigate such problems.

  19. Storage of charge carriers on emitter molecules in organic light-emitting diodes

    Science.gov (United States)

    Weichsel, Caroline; Burtone, Lorenzo; Reineke, Sebastian; Hintschich, Susanne I.; Gather, Malte C.; Leo, Karl; Lüssem, Björn

    2012-08-01

    Organic light-emitting diodes (OLEDs) using the red phosphorescent emitter iridium(III)bis(2-methyldibenzo[f,h]quinoxaline) (acetylacetonate) [Ir(MDQ)2(acac)] are studied by time-resolved electroluminescence measurements. A transient overshoot after voltage turn-off is found, which is attributed to electron accumulation on Ir(MDQ)2(acac) molecules. The mechanism is verified via impedance spectroscopy and by application of positive and negative off-voltages. We calculate the density of accumulated electrons and find that it scales linearly with the doping concentration of the emitter. Using thin quenching layers, we locate the position of the emission zone during normal OLED operation and after voltage turn-off. In addition, the transient overshoot is also observed in three-color white-emitting OLEDs. By time- and spectrally resolved measurements using a streak camera, we directly attribute the overshoot to electron accumulation on Ir(MDQ)2(acac). We propose that similar processes are present in many state-of-the-art OLEDs and believe that the quantification of charge carrier storage will help to improve the efficiency of OLEDs.

  20. Theoretical model for ultracold molecule formation via adaptive feedback control

    OpenAIRE

    Poschinger, Ulrich; Salzmann, Wenzel; Wester, Roland; Weidemueller, Matthias; Koch, Christiane P.; Kosloff, Ronnie

    2006-01-01

    We investigate pump-dump photoassociation of ultracold molecules with amplitude- and phase-modulated femtosecond laser pulses. For this purpose a perturbative model for the light-matter interaction is developed and combined with a genetic algorithm for adaptive feedback control of the laser pulse shapes. The model is applied to the formation of 85Rb2 molecules in a magneto-optical trap. We find for optimized pulse shapes an improvement for the formation of ground state molecules by more than ...

  1. Ionisation of atoms, molecules and biomolecules by impact of multiply charged ions of high energy: classical and quantal comparison

    International Nuclear Information System (INIS)

    Abbas, I.

    2008-05-01

    We have developed a relatively simple model to calculate total cross-sections of various ionizing processes involving ion-atom or ion-molecule collisions. This model is based on the Zarour and Saalmann model and has benefited from 2 other models: the classical over-barrier (COB) model and the classical trajectory Monte-Carlo (CTMC) model. The COB model is used to describe the initial conditions of the target's electrons and their process us of creation while the CTMC model is used to build the statistical aspects necessary to calculate the cross sections of the ionizing processes. 3 major improvements have been brought to the Zarour and Saalmann model. First, the particle-particle interactions have been described by a Coulombian potential which is more realistic. Secondly, the initial conditions in the target are better represented by taking into account in an aleatory manner the position and speed distributions of the electrons. Thirdly, the use of energy criteria instead of purely geometrical ones to describe the final situation of the electrons has led to a better determination of the possible ionizing events. We have validated our model by applying it first, in collisional systems involving multi-charged projectiles like H + , He 2+ , Li 3+ , C 6+ , O 8+ and Ne 10+ and simple targets like H, He and H 2 , for which a lot of experimental data is available. Then, we have studied collisions involving the water molecule for which experimental and experimental data exist. Satisfactorily results for H 2 O target has led us to study other biological targets like adenine or cytosine. We have shown that our results are valid for impact energies over 100 keV/uma and most satisfactorily results concern simple ionizing processes like simple capture and simple ionization. For more complex processes such as transfer-ionization, double capture or double ionization, our results are valid for helium and hydrogen targets. In the case of water, the cross-sections of double

  2. Collisions of singly and doubly charged ions with oxygen molecules in the energy range 1 - 1800 (3600) eV

    International Nuclear Information System (INIS)

    Kuen, I.; Howorka, F.

    1983-01-01

    Absolute cross sections for the excitation of optically emitting states in collisions of He + , Ne + , Ar + , Kr + , B + , He ++ , Ne ++ and Ar ++ with oxygen molecules are measured, the energy range of the ion being1 - 1800 eV Lab for the singly charged and 1 - 3600 eV for the doubly charged ions. Seven important processes can be distinguished: charge exchange excitation of O 2 + band, O I, O II, X I and X II lines (X + , X ++ being the primary ion), direct excitation of X II and double charge exchange excitations. The energy dependences of the excitation cross sections are remarkably different for different processes but similar for one process with different ions. The sum total of all cross sections together for excitations which lead to light emission is on the order of a few square angstroms at 1000 eV c.m. energy. The results are of interest for surface investigations, plasma diagnostics and laser work. (Author)

  3. Nanoscale charge localization induced by random orientations of organic molecules in hybrid perovskite CH3NH3PbI3

    Science.gov (United States)

    Ma, Jie; Wang, Lin-Wang

    2015-03-01

    Perovskite-based solar cells have achieved high solar-energy conversion efficiencies and attracted wide attentions nowadays. Despite the rapid progress in solar-cell devices, many fundamental issues of the hybrid perovskites have not been fully understood. Experimentally, it is well known that in CH3NH3PbI3, the organic molecules CH3NH3 are randomly orientated at the room temperature, but the impact of the random molecular orientation has not been investigated. Using linear-scaling ab-initiomethods, we have calculated the electronic structures of the tetragonal phase of CH3NH3PbI3 with randomly orientated organic molecules in large supercells up to ~20,000 atoms. Due to the dipole moment of the organic molecule, the random orientation creates a novel system with long-range potential fluctuations unlike alloys or other conventional disordered systems. We find that the charge densities of the conduction-band minimum and the valence-band maximum are localized separately in nanoscales due to the potential fluctuations. The charge localization causes electron-hole separation and reduces carrier recombination rates, which may contribute to the long carrier lifetime observed in experiments. We have also proposed a model to explain the charge localization.

  4. Interference effects in double ionization of spatially aligned hydrogen molecules by fast highly charged ions

    International Nuclear Information System (INIS)

    Landers, A.L.; Alnaser, A.S.; Tanis, J.A.; Wells, E.; Osipov, T.; Carnes, K.D.; Ben-Itzhak, I.; Cocke, C.L.; McGuire, J.H.

    2004-01-01

    Cross sections differential in target orientation angle were measured for 19 MeV F 8+ +D 2 collisions. Multihit position-sensitive detectors were used to isolate the double-ionization channel and determine a posteriori the full momentum vectors of both ejected D + fragments. A strong dependence of the double ionization cross section on the angle between the incident ion direction and the target molecular axis is observed with a ≅3.5:1 enhancement for molecules aligned perpendicular to the projectile axis. This clear asymmetry is attributed to interference effects, analogous to Young's two-slit experiment, arising from coherent contributions to the ionization from both atomic centers. The data are compared to a simple scattering model based on two center interference

  5. Simple molecular model for the binding of antibiotic molecules to bacterial ion channels

    Science.gov (United States)

    Mafé, Salvador; Ramírez, Patricio; Alcaraz, Antonio

    2003-10-01

    A molecular model aimed at explaining recent experimental data by Nestorovich et al. [Proc. Natl. Acad. Sci. USA 99, 9789 (2002)] on the interaction of ampicillin molecules with the constriction zone in a channel of the general bacterial porin, OmpF (outer membrane protein F), is presented. The model extends T. L. Hill's theory for intermolecular interactions in a pair of binding sites [J. Am. Chem. Soc. 78, 3330 (1956)] by incorporating two binding ions and two pairs of interacting sites. The results provide new physical insights on the role of the complementary pattern of the charge distributions in the ampicillin molecule and the narrowest part of the channel pore. Charge matching of interacting sites facilitates drug binding. The dependence of the number of ampicillin binding events per second with the solution pH and salt concentration is explained qualitatively using a reduced number of fundamental concepts.

  6. Use of ionic model for analysis of intramolecular movement in alkali metal metaborate molecules

    International Nuclear Information System (INIS)

    Ezhov, Yu.S.; Vinogradov, V.S.

    1978-01-01

    To clear out the peculiarities of intramolecular movement in MBO 2 (where M=Li, Na, K, Rb, Cs) molecules the energy dependence of cation electrostatic interaction with BO 2 anion on the charge value of oxygen, values of the MOB valence angle and internuclear distance r(M-O) is calculated. The calculation results on the base of ionic model show that the minimum of potential energy function corresponds to angular configuration of the MBO 2 molecules. Parameters of potential function of deformation oscillation connected with the change of MOB angle, are evaluated

  7. A self-consistent phase-field approach to implicit solvation of charged molecules with Poisson–Boltzmann electrostatics

    Science.gov (United States)

    Sun, Hui; Wen, Jiayi; Zhao, Yanxiang; Li, Bo; McCammon, J. Andrew

    2015-01-01

    Dielectric boundary based implicit-solvent models provide efficient descriptions of coarse-grained effects, particularly the electrostatic effect, of aqueous solvent. Recent years have seen the initial success of a new such model, variational implicit-solvent model (VISM) [Dzubiella, Swanson, and McCammon Phys. Rev. Lett. 96, 087802 (2006) and J. Chem. Phys. 124, 084905 (2006)], in capturing multiple dry and wet hydration states, describing the subtle electrostatic effect in hydrophobic interactions, and providing qualitatively good estimates of solvation free energies. Here, we develop a phase-field VISM to the solvation of charged molecules in aqueous solvent to include more flexibility. In this approach, a stable equilibrium molecular system is described by a phase field that takes one constant value in the solute region and a different constant value in the solvent region, and smoothly changes its value on a thin transition layer representing a smeared solute-solvent interface or dielectric boundary. Such a phase field minimizes an effective solvation free-energy functional that consists of the solute-solvent interfacial energy, solute-solvent van der Waals interaction energy, and electrostatic free energy described by the Poisson–Boltzmann theory. We apply our model and methods to the solvation of single ions, two parallel plates, and protein complexes BphC and p53/MDM2 to demonstrate the capability and efficiency of our approach at different levels. With a diffuse dielectric boundary, our new approach can describe the dielectric asymmetry in the solute-solvent interfacial region. Our theory is developed based on rigorous mathematical studies and is also connected to the Lum–Chandler–Weeks theory (1999). We discuss these connections and possible extensions of our theory and methods. PMID:26723595

  8. A self-consistent phase-field approach to implicit solvation of charged molecules with Poisson-Boltzmann electrostatics.

    Science.gov (United States)

    Sun, Hui; Wen, Jiayi; Zhao, Yanxiang; Li, Bo; McCammon, J Andrew

    2015-12-28

    Dielectric boundary based implicit-solvent models provide efficient descriptions of coarse-grained effects, particularly the electrostatic effect, of aqueous solvent. Recent years have seen the initial success of a new such model, variational implicit-solvent model (VISM) [Dzubiella, Swanson, and McCammon Phys. Rev. Lett. 96, 087802 (2006) and J. Chem. Phys. 124, 084905 (2006)], in capturing multiple dry and wet hydration states, describing the subtle electrostatic effect in hydrophobic interactions, and providing qualitatively good estimates of solvation free energies. Here, we develop a phase-field VISM to the solvation of charged molecules in aqueous solvent to include more flexibility. In this approach, a stable equilibrium molecular system is described by a phase field that takes one constant value in the solute region and a different constant value in the solvent region, and smoothly changes its value on a thin transition layer representing a smeared solute-solvent interface or dielectric boundary. Such a phase field minimizes an effective solvation free-energy functional that consists of the solute-solvent interfacial energy, solute-solvent van der Waals interaction energy, and electrostatic free energy described by the Poisson-Boltzmann theory. We apply our model and methods to the solvation of single ions, two parallel plates, and protein complexes BphC and p53/MDM2 to demonstrate the capability and efficiency of our approach at different levels. With a diffuse dielectric boundary, our new approach can describe the dielectric asymmetry in the solute-solvent interfacial region. Our theory is developed based on rigorous mathematical studies and is also connected to the Lum-Chandler-Weeks theory (1999). We discuss these connections and possible extensions of our theory and methods.

  9. DFT calculations of the charged states of N@C60 and Fe4 single molecule magnets investigated in tunneling spectroscopy

    Science.gov (United States)

    Nossa, Javier; Islam, Fhokrul; Canali, Carlo; Pederson, Mark

    2012-02-01

    For device applications of single molecule magnets (SMMs) in high-density information storage and quantum-state control it is essential that the magnetic properties of the molecules remain stable under the influence of metallic contacts or surface environment. Recent tunneling experiments [1, 2] on N@C60 and Fe4 SMM have shown that these molecules preserve their magnetic characteristics when they are used as the central island of single-electron transistors. Although quantum spin models have been used extensively to study theoretically tunneling spectroscopy of SMMs, it has been shown recently that the orbital degrees of freedom, which is absent in spin models, can significantly affect the tunneling conductance [3]. In this work we present first-principles calculations of the neutral and charged states of N@C60 and Fe4 SMMs, and discuss a strategy to include their properties into a theory of quantum transport. We also present results of the magnetic anisotropy for the different charge states of Fe4 and discuss their relevance for experiments [2] in the sequential tunneling and cotunnelling regimes. [4pt] [1]. N. Roch et al., Phys. Rev. B 83, 081407 (2011). [0pt] [2]. A.S. Zyazin et al., Nano Lett. 10, 3307 (2010). [0pt] [3]. L. Michalak et al., Phys. Rev. Lett. 104, 017202 (2010).

  10. Electrostatic interactions between immunoglobulin (IgG) molecules and a charged sorbent

    NARCIS (Netherlands)

    Bremer, M.G.E.G.; Duval, J.; Norde, Willem; Lyklema, J.

    2004-01-01

    The influence of electrostatic interactions on the adsorption of IgG is examined both theoretically and experimentally. The long-range interaction between IgG and the charged sorbent surface is treated in terms of the DLVO theory taking into account the possibility of charge- and potential

  11. Exploring charge transport properties and functionality of molecule-nanoparticle ensembles

    NARCIS (Netherlands)

    Devid, Edwin Johan

    2015-01-01

    For more than 65 years, scientists have been fascinated by the idea to miniaturize electrical circuits toward the smallest length scales. One particular way is inspired by nature itself, specifically to assemble electrical components and switches from atoms and molecules. The molecules typically

  12. Electrical Matching at Metal/Molecule Contacts for Efficient Heterogeneous Charge Transfer.

    Science.gov (United States)

    Sato, Shino; Iwase, Shigeru; Namba, Kotaro; Ono, Tomoya; Hara, Kenji; Fukuoka, Atsushi; Uosaki, Kohei; Ikeda, Katsuyoshi

    2018-02-27

    In a metal/molecule hybrid system, unavoidable electrical mismatch exists between metal continuum states and frontier molecular orbitals. This causes energy loss in the electron conduction across the metal/molecule interface. For efficient use of energy in a metal/molecule hybrid system, it is necessary to control interfacial electronic structures. Here we demonstrate that electrical matching between a gold substrate and π-conjugated molecular wires can be obtained by using monatomic foreign metal interlayers, which can change the degree of d-π* back-donation at metal/anchor contacts. This interfacial control leads to energy level alignment between the Fermi level of the metal electrode and conduction molecular orbitals, resulting in resonant electron conduction in the metal/molecule hybrid system. When this method is applied to molecule-modified electrocatalysts, the heterogeneous electrochemical reaction rate is considerably improved with significant suppression of energy loss at the internal electron conduction.

  13. Probing physics beyond the standard model in diatomic molecules

    International Nuclear Information System (INIS)

    Denis, M.

    2017-01-01

    Nowadays, the incompleteness of the Standard Model of particles (SM) is largely acknowledged. One of its most obvious shortcomings is the lack of explanation for the huge surplus of matter over antimatter in the universe, the so-called baryon asymmetry of the universe. New CP (charge conjugation and spatial parity) violations absent in the SM are assumed to be responsible for this asymmetry. Such a violation could be observed, in ordinary matter through a set of interactions violating both parity and time-reversal symmetries (P, T -odd) among which the preponderant ones are the electron Electric Dipole Moment (eEDM), the electron-nucleon scalar-pseudoscalar (enSPS) and the nuclear magnetic quadrupole moment (nMQM) interactions. Hence, an experimental evidence of a non-zero P, T -odd interaction constant would be a probe of this New Physics beyond the Standard Model. The calculation of the corresponding molecular parameters is performed by making use of an elaborate four-component relativistic configuration interaction approach in polar diatomic molecules containing an actinide, that are particularly adequate systems for eEDM experiments, such as ThO that allowed for assigning the most constraining upper bound on the eEDM and ThF"+ that will be used in a forthcoming experiment. Those results will be of crucial importance in the interpretation of the measurements since the fundamental constants can only be evaluated if one combines both experimental energy shift measurements and theoretical molecular parameters. This manuscript proceeds as follows, after an introduction to the general background of the search of CP-violations and its consequences for the understanding of the Universe (Chapter 1), a presentation of the underlying theory of the evidence of such violation in ordinary matter, namely the P, T -odd sources of the Electric Dipole Moment of a many-electron system, as well as the relevant molecular parameters is given in Chapter 2. A similar introduction to

  14. Mixed Domains Enhance Charge Generation and Extraction in Bulk-Heterojunction Solar Cells with Small-Molecule Donors

    KAUST Repository

    Alqahtani, Obaid

    2018-03-25

    The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.

  15. Mixed Domains Enhance Charge Generation and Extraction in Bulk-Heterojunction Solar Cells with Small-Molecule Donors

    KAUST Repository

    Alqahtani, Obaid; Babics, Maxime; Gorenflot, Julien; Savikhin, Victoria; Ferron, Thomas; Balawi, Ahmed H.; Paulke, Andreas; Kan, Zhipeng; Pope, Michael; Clulow, Andrew J.; Wolf, Jannic Sebastian; Burn, Paul L.; Gentle, Ian R.; Neher, Dieter; Toney, Michael F.; Laquai, Fré dé ric; Beaujuge, Pierre; Collins, Brian A.

    2018-01-01

    The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.

  16. In-transit charging lane model

    NARCIS (Netherlands)

    Verkerk, A.; Nijmeijer, H.; Khajepour, A.

    2012-01-01

    The current electric vehicles still have a problem with a short range and long charging time compared to the internal combustion vehicles. A possible solution for this problem is to charge the batteries while driving on the highway. For this, a special traffic lane is needed with an in-transit

  17. Diffusion of flexible, charged, nanoscopic molecules in solution: Size and pH dependence for PAMAM dendrimer

    Science.gov (United States)

    Maiti, Prabal K.; Bagchi, Biman

    2009-12-01

    In order to understand self-diffusion (D) of a charged, flexible, and porous nanoscopic molecule in water, we carry out very long, fully atomistic molecular dynamics simulation of PAMAM dendrimer up to eight generations in explicit salt water under varying pH. We find that while the radius of gyration (Rg) varies as N1/3, the self-diffusion constant (D ) scales, surprisingly, as N-α, with α =0.39 at high pH and 0.5 at neutral pH, indicating a dramatic breakdown of Stokes-Einstein relation for diffusion of charged nanoscopic molecules. The variation in D as a function of radius of gyration demonstrates the importance of treating water and ions explicitly in the diffusion process of a flexible nanoscopic molecule. In agreement with recent experiments, the self-diffusion constant increases with pH, revealing the importance of dielectric friction in the diffusion process. The shape of a dendrimer is found to fluctuate on a nanosecond time scale. We argue that this flexibility (and also the porosity) of the dendrimer may play an important role in determining the mean square displacement of the dendrimer and the breakdown of the Stokes-Einstein relation between diffusion constant and the radius.

  18. An algebraic model for three-cluster giant molecules

    International Nuclear Information System (INIS)

    Hess, P.O.; Bijker, R.; Misicu, S.

    2001-01-01

    After an introduction to the algebraic U(7) model for three bodies, we present a relation of a geometrical description of three-cluster molecule to the algebraic U(7) model. Stiffness parameters of oscillations between each of two clusters are calculated and translated to the model parameter values of the algebraic model. The model is applied to the trinuclear system l32 Sn+ α + ll6 Pd which occurs in the ternary cold fission of 252 Cf. (Author)

  19. Modeling of charged anisotropic compact stars in general relativity

    Energy Technology Data Exchange (ETDEWEB)

    Dayanandan, Baiju; Maurya, S.K.; T, Smitha T. [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman)

    2017-06-15

    A charged compact star model has been determined for anisotropic fluid distribution. We have solved the Einstein-Maxwell field equations to construct the charged compact star model by using the radial pressure, the metric function e{sup λ} and the electric charge function. The generic charged anisotropic solution is verified by exploring different physical conditions like causality condition, mass-radius relation and stability of the solution (via the adiabatic index, TOV equations and the Herrera cracking concept). It is observed that the present charged anisotropic compact star model is compatible with the star PSR 1937+21. Moreover, we also presented the EOS ρ = f(p) for the present charged compact star model. (orig.)

  20. Recent measurements of low energy charge exchange cross sections for collisions of multicharged ions on neutral atoms and molecules

    International Nuclear Information System (INIS)

    Havener, Charles C.

    2001-01-01

    At ORNL Multicharged Ion Research Facility (MIRF), charge exchange (CX) cross sections have been measured for multicharged ions (MCI) on neutral atoms and molecules. The ORNL ion-atom merged-beam apparatus was used to measure single electron capture by MCI from H at eV/amu energies. A gas cell was used to measure single and double electron capture by MCI from a variety of molecular targets at keV collision energies. The merged-beams experiment has been successful in providing benchmark total electron capture measurements for several collision systems with a variety of multicharged ions on H or D

  1. Exploring Charge Transport in Guest Molecule Infiltrated Cu3(BTC)2 Metal Organic Framework

    Energy Technology Data Exchange (ETDEWEB)

    Leonard, Francois Leonard [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Stavila, Vitalie [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Allendorf, Mark D. [Sandia National Lab. (SNL-CA), Livermore, CA (United States)

    2014-09-01

    The goal of this Exploratory Express project was to expand the understanding of the physical properties of our recently discovered class of materials consisting of metal-organic frameworks with electroactive ‘guest’ molecules that together form an electrically conducting charge-transfer complex (molecule@MOF). Thin films of Cu3(BTC)2 were grown on fused silica using solution step-by-step growth and were infiltrated with the molecule tetracyanoquinodimethane (TCNQ). The infiltrated MOF films were extensively characterized using optical microscopy, scanning electron microscopy, Raman spectroscopy, electrical conductivity, and thermoelectric properties. Thermopower measurements on TCNQ@Cu3(BTC)2 revealed a positive Seebeck coefficient of ~400 μV/k, indicating that holes are the primary carriers in this material. The high value of the Seebeck coefficient and the expected low thermal conductivity suggest that molecule@MOF materials may be attractive for thermoelectric power conversion applications requiring low cost, solution-processable, and non-toxic active materials.

  2. Communication: Modeling of concentration dependent water diffusivity in ionic solutions: Role of intermolecular charge transfer

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Yi; Berkowitz, Max L., E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu; Kanai, Yosuke, E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu [Department of Chemistry, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599 (United States)

    2015-12-28

    The translational diffusivity of water in solutions of alkali halide salts depends on the identity of ions, exhibiting dramatically different behavior even in solutions of similar salts of NaCl and KCl. The water diffusion coefficient decreases as the salt concentration increases in NaCl. Yet, in KCl solution, it slightly increases and remains above bulk value as salt concentration increases. Previous classical molecular dynamics simulations have failed to describe this important behavior even when polarizable models were used. Here, we show that inclusion of dynamical charge transfer among water molecules produces results in a quantitative agreement with experiments. Our results indicate that the concentration-dependent diffusivity reflects the importance of many-body effects among the water molecules in aqueous ionic solutions. Comparison with quantum mechanical calculations shows that a heterogeneous and extended distribution of charges on water molecules around the ions due to ion-water and also water-water charge transfer plays a very important role in controlling water diffusivity. Explicit inclusion of the charge transfer allows us to model accurately the difference in the concentration-dependent water diffusivity between Na{sup +} and K{sup +} ions in simulations, and it is likely to impact modeling of a wide range of systems for medical and technological applications.

  3. Charge distribution in an two-chain dual model

    International Nuclear Information System (INIS)

    Fialkowski, K.; Kotanski, A.

    1983-01-01

    Charge distributions in the multiple production processes are analysed using the dual chain model. A parametrisation of charge distributions for single dual chains based on the νp and anti vp data is proposed. The rapidity charge distributions are then calculated for pp and anti pp collisions and compared with the previous calculations based on the recursive cascade model of single chains. The results differ at the SPS collider energies and in the energy dependence of the net forward charge supplying the useful tests of the dual chain model. (orig.)

  4. Gravitational instantons as models for charged particle systems

    Science.gov (United States)

    Franchetti, Guido; Manton, Nicholas S.

    2013-03-01

    In this paper we propose ALF gravitational instantons of types A k and D k as models for charged particle systems. We calculate the charges of the two families. These are -( k + 1) for A k , which is proposed as a model for k + 1 electrons, and 2 - k for D k , which is proposed as a model for either a particle of charge +2 and k electrons or a proton and k - 1 electrons. Making use of preferred topological and metrical structures of the manifolds, namely metrically preferred representatives of middle dimension homology classes, we construct two different energy functionals which reproduce the Coulomb interaction energy for a system of charged particles.

  5. A simplified quantum mechanical model of diatomic molecules

    DEFF Research Database (Denmark)

    Nielsen, Lars Drud

    1978-01-01

    A one-dimensional molecule model with Coulomb potentials replaced by delta functions is introduced. The mathematical simplicity of the model facilitates the quantum mechanical treatment and offers a straightforward demonstration of the essentials of two-particle problems. In spite of the crudeness...

  6. Ultrafast Charge Generation Pathways in Photovoltaic Blends Based on Novel Star-Shaped Conjugated Molecules

    NARCIS (Netherlands)

    Kozlov, Oleg V.; Luponosov, Yuriy N.; Ponomarenko, Sergei A.; Kausch-Busies, Nina; Paraschuk, Dmitry Yu; Olivier, Yoann; Beljonne, David; Cornil, Jerome; Pshenichnikov, Maxim S.

    2015-01-01

    The quest for new materials is one of the main factors propelling recent advances in organic photovoltaics. Star-shaped small molecules (SSMs) have been proven promising candidates as perspective donor material due to the increase in numbers of excitation pathways caused by the degeneracy of the

  7. Theoretical model for ultracold molecule formation via adaptive feedback control

    International Nuclear Information System (INIS)

    Poschinger, Ulrich; Salzmann, Wenzel; Wester, Roland; Weidemueller, Matthias; Koch, Christiane P; Kosloff, Ronnie

    2006-01-01

    We theoretically investigate pump-dump photoassociation of ultracold molecules with amplitude- and phase-modulated femtosecond laser pulses. For this purpose, a perturbative model for light-matter interaction is developed and combined with a genetic algorithm for adaptive feedback control of the laser pulse shapes. The model is applied to the formation of 85 Rb 2 molecules in a magneto-optical trap. We find that optimized pulse shapes may maximize the formation of ground state molecules in a specific vibrational state at a pump-dump delay time for which unshaped pulses lead to a minimum of the formation rate. Compared to the maximum formation rate obtained for unshaped pulses at the optimum pump-dump delay, the optimized pulses lead to a significant improvement of about 40% for the target level population. Since our model yields the spectral amplitudes and phases of the optimized pulses, the results are directly applicable in pulse shaping experiments

  8. Modelling of an advanced charging system for electric vehicles

    Science.gov (United States)

    Hassan Jaafar, Abdul; Rahman, Ataur; Mohiuddin, A. K. M.; Rashid, Mahbubur

    2017-03-01

    Climate Change is recognized as one of the greatest environmental problem facing the World today and it has long been appreciated by governments that reducing the impact of the internal combustion (IC) engine powered motor vehicle has an important part to play in addressing this threat. In Malaysia, IC engine powered motor vehicle accounts almost 90% of the national greenhouse gas (GHG) emissions. The need to reduce the emission is paramount, as Malaysia has pledged to reduce 40% of CO2 intensity by 2020 from 2005 level by 25% of improvement in average fuel consumption. The introduction of electric vehicles (EVs) is one of the initiatives. However in terms of percentage, the electric vehicles have not been commonly used by people nowadays and one of the reasons is lack in charging infrastructure especially when cars are on the road. The aim of this study is to simulate and model an advanced charging system for the charging infrastructure of EVs/HEVs all over the nation with slow charging mode with charging current 25 A, medium charging mode with charging current 50 A and fast charging mode with charging current 100 A. The slow charging mode is proposed for residence, medium charging mode for office parking lots, and fast charging mode is called fast charging track for charging station on road. With three modes charger topology, consumers could choose a suitable mode for their car based on their need. The simulation and experiment of advanced charging system has been conducted on a scale down battery pack of nominal voltage of 3.75 V and capacity of 1020 mAh. Result shows that the battery could be charging less than 1 hour with fast charging mode. However, due to limitation of Tenaga Nasional Berhad (TNB) power grid, the maximum 50 A current is considered to be the optimized passive mode for the EV’s battery charging system. The developed advanced charger prototype performance has been compared with the simulation result and conventional charger performance, the

  9. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    International Nuclear Information System (INIS)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y.; Taub, H.; Miskowiec, A.

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10 8 –10 9 V m −1 , which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10 8 V m −1 ) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10 8 V m −1 ) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1,2-dimyristoyl-sn-glycero-3

  10. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    Energy Technology Data Exchange (ETDEWEB)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y., E-mail: flemming@kemi.dtu.dk [Department of Chemistry, Technical University of Denmark, IK 207 DTU, DK-2800 Lyngby (Denmark); Taub, H.; Miskowiec, A. [Department of Physics and Astronomy and the University of Missouri Research Reactor,University of Missouri, Columbia, Missouri 65211 (United States)

    2016-04-14

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10{sup 8}–10{sup 9} V m{sup −1}, which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10{sup 8} V m{sup −1}) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10{sup 8} V m{sup −1}) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1

  11. Study on charge transfer reaction of several organic molecules with accelerated rare gas ions

    International Nuclear Information System (INIS)

    Takahasi, Makoto; Okuda, Sachiko; Arai, Eiichi; Ichinose, Akira; Takakubo, Masaaki.

    1984-01-01

    Observing the charge transfer mass spectra of ethylbenzene, cyclobutane and methanol in Ar and Xe ion impacts, we investigated the dependence of the secondary ion peak intensities (normalized to primary ion current and target pressure) on the translational energy of primary ions (0-3500 eV).In the case of ethylbenzene, several maxima of the secondary i on peak intensities were observed in Ar and Xe ion impacts. The correlation between the maxima and the primary ion energy was examined in terms of near adiabatic theory of Massey. Supplementary studies on the energy distribution of primary ion, charge transfer cross section between methanol and Xe ion, and final product analysis in rare gas ion irradiation on cyclobutane were described. (author)

  12. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    DEFF Research Database (Denmark)

    Rønnest, A. K.; Peters, Günther H.J.; Hansen, Flemming Yssing

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid...... compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have...... the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic...

  13. Charge exchange of excited mesic atoms of hydrogen isotopes in triple collisions with molecules

    International Nuclear Information System (INIS)

    Men'shikov, L.I.; Ponomarev, L.I.

    1985-01-01

    At high densities of deuterium-tritium mixture the probability for the occurrence of the isotope-exchange reaction (dμ)/sub n/+t → d+(tμ)/sub n/ from the excited states of n mesic atoms of deuterium is high in the triple collisions of mesic atoms with the molecules of hydrogen isotopes. This reaction should be taken into account in describing the kinetics of muon catalysis

  14. Symmetrization of mathematical model of charge transport in semiconductors

    Directory of Open Access Journals (Sweden)

    Alexander M. Blokhin

    2002-11-01

    Full Text Available A mathematical model of charge transport in semiconductors is considered. The model is a quasilinear system of differential equations. A problem of finding an additional entropy conservation law and system symmetrization are solved.

  15. The Impact of Molecular p-Doping on Charge Transport in High-Mobility Small-Molecule/Polymer Blend Organic Transistors

    KAUST Repository

    Paterson, Alexandra F.

    2017-12-27

    Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.

  16. The Impact of Molecular p-Doping on Charge Transport in High-Mobility Small-Molecule/Polymer Blend Organic Transistors

    KAUST Repository

    Paterson, Alexandra F.; Lin, Yen-Hung; Mottram, Alexander D.; Fei, Zhuping; Niazi, Muhammad Rizwan; Kirmani, Ahmad R.; Amassian, Aram; Solomeshch, Olga; Tessler, Nir; Heeney, Martin; Anthopoulos, Thomas D.

    2017-01-01

    Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.

  17. Affine-response model of molecular solvation of ions: Accurate predictions of asymmetric charging free energies.

    Science.gov (United States)

    Bardhan, Jaydeep P; Jungwirth, Pavel; Makowski, Lee

    2012-09-28

    Two mechanisms have been proposed to drive asymmetric solvent response to a solute charge: a static potential contribution similar to the liquid-vapor potential, and a steric contribution associated with a water molecule's structure and charge distribution. In this work, we use free-energy perturbation molecular-dynamics calculations in explicit water to show that these mechanisms act in complementary regimes; the large static potential (∼44 kJ/mol/e) dominates asymmetric response for deeply buried charges, and the steric contribution dominates for charges near the solute-solvent interface. Therefore, both mechanisms must be included in order to fully account for asymmetric solvation in general. Our calculations suggest that the steric contribution leads to a remarkable deviation from the popular "linear response" model in which the reaction potential changes linearly as a function of charge. In fact, the potential varies in a piecewise-linear fashion, i.e., with different proportionality constants depending on the sign of the charge. This discrepancy is significant even when the charge is completely buried, and holds for solutes larger than single atoms. Together, these mechanisms suggest that implicit-solvent models can be improved using a combination of affine response (an offset due to the static potential) and piecewise-linear response (due to the steric contribution).

  18. Affine-response model of molecular solvation of ions: Accurate predictions of asymmetric charging free energies

    Science.gov (United States)

    Bardhan, Jaydeep P.; Jungwirth, Pavel; Makowski, Lee

    2012-01-01

    Two mechanisms have been proposed to drive asymmetric solvent response to a solute charge: a static potential contribution similar to the liquid-vapor potential, and a steric contribution associated with a water molecule's structure and charge distribution. In this work, we use free-energy perturbation molecular-dynamics calculations in explicit water to show that these mechanisms act in complementary regimes; the large static potential (∼44 kJ/mol/e) dominates asymmetric response for deeply buried charges, and the steric contribution dominates for charges near the solute-solvent interface. Therefore, both mechanisms must be included in order to fully account for asymmetric solvation in general. Our calculations suggest that the steric contribution leads to a remarkable deviation from the popular “linear response” model in which the reaction potential changes linearly as a function of charge. In fact, the potential varies in a piecewise-linear fashion, i.e., with different proportionality constants depending on the sign of the charge. This discrepancy is significant even when the charge is completely buried, and holds for solutes larger than single atoms. Together, these mechanisms suggest that implicit-solvent models can be improved using a combination of affine response (an offset due to the static potential) and piecewise-linear response (due to the steric contribution). PMID:23020318

  19. Charge Transport in Conjugated Materials: From Theoretical Models to Experimental Systems

    International Nuclear Information System (INIS)

    Olivier, Yoann; Cornil, Jerome; Muccioli, Luca; Zannoni, Claudio

    2008-01-01

    Charge carrier mobility is the key quantity to characterize the charge transport properties in devices. Based on earlier work of Baessler and co-workers, we set up a Monte-Carlo approach that allows us to calculate mobility using transfer rates derived from Marcus theory. The parameters entering into the rate expression are evaluated by means of different quantum-chemical techniques. Our approach is applied here to a model one-dimensional system made of pentacene molecules as well as to real systems such as crystalline structures and columnar liquid crystal phases.

  20. Electron emission following collisions between multi-charged ions and D2 molecules

    International Nuclear Information System (INIS)

    Laurent, G.

    2004-05-01

    Dissociative ionisation mechanisms induced in collisions involving a highly charged ion (S 15+ , 13.6 MeV/u) and a molecular deuterium target, have been studied through momentum vector correlations of both the D + fragments and the electrons produced. An experimental apparatus has been developed in order to detect in coincidence all the charged particles produced during the collision. The measurement of their momentum vectors, which allows one to determine both their kinetic energy and direction of emission with respect to the projectile one, combines Time of Flight, Position Sensitive Detection, and multi-coincidence techniques. The correlation of the fragment and electron kinetic energies enables not only to determine branching ratios between the dissociative ionisation pathways, but also to separate unambiguously kinetic energy distributions of fragments associated to each process. Finally, the angular distributions of ejected electrons, as a function of the orientation of the molecular axis with respect to the projectile direction, are deduced from the spatial correlation. Measurements are compared to theoretical angular distributions obtained using the CDW-EIS (Continuum Distorted Wave-Eikonal Initial State) method. (author)

  1. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    Science.gov (United States)

    Spencer, J.; Gajdos, F.; Blumberger, J.

    2016-08-01

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  2. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    Energy Technology Data Exchange (ETDEWEB)

    Spencer, J.; Gajdos, F.; Blumberger, J., E-mail: j.blumberger@ucl.ac.uk [Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)

    2016-08-14

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  3. Ring current models for acetylene and ethylene molecules

    International Nuclear Information System (INIS)

    Pelloni, Stefano; Lazzeretti, Paolo

    2009-01-01

    Spatial models of the current density vector field, induced in the electronic cloud of the acetylene and ethylene molecules by a uniform, time-independent magnetic field, are discussed in terms of topological stagnation graphs and three-dimensional streamline plots. The models are validated by documenting their ability to explain magnetic susceptibility and nuclear magnetic shieldings of carbon and hydrogen via related shielding density maps

  4. Cross-sections of charge and electronic states change of particles at ion-ion and ion-molecule collisions

    International Nuclear Information System (INIS)

    Panov, M.N.; Afrosimov, V.V.; Basalaev, A.A.; Guschina, N.A.; Nikulin, V.K.

    2006-01-01

    The interactions of protons and alpha-particles with hydrocarbons are investigated. A quantum-mechanical computation of the electronic structure of all hydrocarbons from methane to butane and its fragment ions was performed in the Hartree-Fock RHF/UHF approximation using a GAMESS program (General Atomic Molecular Electron Structure System). The correlation energy was taken into account within the framework of MP2 perturbation theory. The structural parameters of the hydrocarbon molecules and their charged and neutral fragments were calculated in two cases: in the geometry of the parent molecule or of the relaxation states. The difference of the full energy of the same fragments in and out of brackets gives us the vibration excitation energies of the fragments at the moment of creation. Additional Mulliken effective charges (in electron charge units) of atoms in the fragments have been calculated. The calculations show that removing one electron from the ethane molecule without electronic excitation produced a single charged molecular ion in vibration state with binding energy of hydrogen atoms, some decimal eV. As results we obtain C 2 H 6 + and C 2 H 5 + . Additional fragmentation of hydrocarbon needs electronic excitation of produced single charged ions. Cross sections for electron capture and excitation processes in collisions between the hydrogen-like He + , B 4+ and O 7+ ions have been evaluated. The purpose of the theory within this project during the period under review was to get for the first time new data on Single-Electron Capture (SEC) and Excitation Processes (EP) in collisions of He + (1s) ions with hydrogen-like impurity ions B 4+ (1s) and O 7+ (1s) in the energy range for He + ions from 0.2 MeV to 3.0 MeV. The calculations were carried out by using the method of close-coupling equations with basis sets of eleven and ten quasimolecular two-electron states for reactions (1, 2) and (3, 4), respectively (entrance channel, seven charge transfer channels

  5. The charged particle accelerators subsystems modeling

    International Nuclear Information System (INIS)

    Averyanov, G P; Kobylyatskiy, A V

    2017-01-01

    Presented web-based resource for information support the engineering, science and education in Electrophysics, containing web-based tools for simulation subsystems charged particle accelerators. Formulated the development motivation of Web-Environment for Virtual Electrophysical Laboratories. Analyzes the trends of designs the dynamic web-environments for supporting of scientific research and E-learning, within the framework of Open Education concept. (paper)

  6. Computational Modeling of Biological Systems From Molecules to Pathways

    CERN Document Server

    2012-01-01

    Computational modeling is emerging as a powerful new approach for studying and manipulating biological systems. Many diverse methods have been developed to model, visualize, and rationally alter these systems at various length scales, from atomic resolution to the level of cellular pathways. Processes taking place at larger time and length scales, such as molecular evolution, have also greatly benefited from new breeds of computational approaches. Computational Modeling of Biological Systems: From Molecules to Pathways provides an overview of established computational methods for the modeling of biologically and medically relevant systems. It is suitable for researchers and professionals working in the fields of biophysics, computational biology, systems biology, and molecular medicine.

  7. Model for thickness dependence of radiation charging in MOS structures

    Science.gov (United States)

    Viswanathan, C. R.; Maserjian, J.

    1976-01-01

    The model considers charge buildup in MOS structures due to hole trapping in the oxide and the creation of sheet charge at the silicon interface. The contribution of hole trapping causes the flatband voltage to increase with thickness in a manner in which square and cube dependences are limiting cases. Experimental measurements on samples covering a 200 - 1000 A range of oxide thickness are consistent with the model, using independently obtained values of hole-trapping parameters. An important finding of our experimental results is that a negative interface charge contribution due to surface states created during irradiation compensates most of the positive charge in the oxide at flatband. The tendency of the surface states to 'track' the positive charge buildup in the oxide, for all thicknesses, applies both in creation during irradiation and in annihilation during annealing. An explanation is proposed based on the common defect origin of hole traps and potential surface states.

  8. Tuned and Balanced Redistributed Charge Scheme for Combined Quantum Mechanical and Molecular Mechanical (QM/MM) Methods and Fragment Methods: Tuning Based on the CM5 Charge Model.

    Science.gov (United States)

    Wang, Bo; Truhlar, Donald G

    2013-02-12

    Tuned and balanced redistributed charge schemes have been developed for modeling the electrostatic fields of bonds that are cut by a quantum mechanical-molecular mechanical boundary in combined quantum mechanical and molecular mechanical (QM/MM) methods. First, the charge is balanced by adjusting the charge on the MM boundary atom to conserve the total charge of the entire QM/MM system. In the balanced smeared redistributed charge (BSRC) scheme, the adjusted MM boundary charge is smeared with a smearing width of 1.0 Å and is distributed in equal portions to the midpoints of the bonds between the MM boundary atom and the MM atoms bonded to it; in the balanced redistributed charge-2 (BRC2) scheme, the adjusted MM boundary charge is distributed as point charges in equal portions to the MM atoms that are bonded to the MM boundary atom. The QM subsystem is capped by a fluorine atom that is tuned to reproduce the sum of partial atomic charges of the uncapped portion of the QM subsystem. The new aspect of the present study is a new way to carry out the tuning process; in particular, the CM5 charge model, rather than the Mulliken population analysis applied in previous studies, is used for tuning the capping atom that terminates the dangling bond of the QM region. The mean unsigned error (MUE) of the QM/MM deprotonation energy for a 15-system test suite of deprotonation reactions is 2.3 kcal/mol for the tuned BSRC scheme (TBSRC) and 2.4 kcal/mol for the tuned BRC2 scheme (TBRC2). As was the case for the original tuning method based on Mulliken charges, the new tuning method performs much better than using conventional hydrogen link atoms, which have an MUE on this test set of about 7 kcal/mol. However, the new scheme eliminates the need to use small basis sets, which can be problematic, and it allows one to be more consistent by tuning the parameters with whatever basis set is appropriate for applications. (Alternatively, since the tuning parameters and partial charges

  9. Analytic Models for Sunlight Charging of a Rapidly Spinning Satellite

    National Research Council Canada - National Science Library

    Tautz, Maurice

    2003-01-01

    ... photoelectrons can be blocked by local potential barriers. In this report, we discuss two analytic models for sunlight charging of a rapidly spinning spherical satellite, both of which are based on blocked photoelectron currents...

  10. Charge-coupled-device X-ray detector performance model

    Science.gov (United States)

    Bautz, M. W.; Berman, G. E.; Doty, J. P.; Ricker, G. R.

    1987-01-01

    A model that predicts the performance characteristics of CCD detectors being developed for use in X-ray imaging is presented. The model accounts for the interactions of both X-rays and charged particles with the CCD and simulates the transport and loss of charge in the detector. Predicted performance parameters include detective and net quantum efficiencies, split-event probability, and a parameter characterizing the effective thickness presented by the detector to cosmic-ray protons. The predicted performance of two CCDs of different epitaxial layer thicknesses is compared. The model predicts that in each device incomplete recovery of the charge liberated by a photon of energy between 0.1 and 10 keV is very likely to be accompanied by charge splitting between adjacent pixels. The implications of the model predictions for CCD data processing algorithms are briefly discussed.

  11. Multiphasic modeling of charged solute transport across articular cartilage: Application of multi-zone finite-bath model.

    Science.gov (United States)

    Arbabi, Vahid; Pouran, Behdad; Weinans, Harrie; Zadpoor, Amir A

    2016-06-14

    Charged and uncharged solutes penetrate through cartilage to maintain the metabolic function of chondrocytes and to possibly restore or further breakdown the cartilage tissue in different stages of osteoarthritis. In this study the transport of charged solutes across the various zones of cartilage was quantified, taken into account the physicochemical interactions between the solute and the cartilage constituents. A multiphasic finite-bath finite element (FE) model was developed to simulate equine cartilage diffusion experiments that used a negatively charged contrast agent (ioxaglate) in combination with serial micro-computed tomography (micro-CT) to measure the diffusion. By comparing the FE model with the experimental data both the diffusion coefficient of ioxaglate and the fixed charge density (FCD) were obtained. In the multiphasic model, cartilage was divided into multiple (three) zones to help understand how diffusion coefficient and FCD vary across cartilage thickness. The direct effects of charged solute-FCD interaction on diffusion were investigated by comparing the diffusion coefficients derived from the multiphasic and biphasic-solute models. We found a relationship between the FCD obtained by the multiphasic model and ioxaglate partitioning obtained from micro-CT experiments. Using our multi-zone multiphasic model, diffusion coefficient of the superficial zone was up to ten-fold higher than that of the middle zone, while the FCD of the middle zone was up to almost two-fold higher than that of the superficial zone. In conclusion, the developed finite-bath multiphasic model provides us with a non-destructive method by which we could obtain both diffusion coefficient and FCD of different cartilage zones. The outcomes of the current work will also help understand how charge of the bath affects the diffusion of a charged molecule and also predict the diffusion behavior of a charged solute across articular cartilage. Copyright © 2016 Elsevier Ltd. All

  12. Models of charge transport and transfer in molecular switch tunnel junctions of bistable catenanes and rotaxanes

    International Nuclear Information System (INIS)

    Flood, Amar H.; Wong, Eric W.; Stoddart, J. Fraser

    2006-01-01

    The processes by which charge transfer can occur play a foundational role in molecular electronics. Here we consider simplified models of the transfer processes that could be present in bistable molecular switch tunnel junction (MSTJ) devices during one complete cycle of the device from its low- to high- and back to low-conductance state. The bistable molecular switches, which are composed of a monolayer of either switchable catenanes or rotaxanes, exist in either a ground-state co-conformation or a metastable one in which the conduction properties of the two co-conformations, when measured at small biases (+0.1 V), are significantly different irrespective of whether transport is dominated by tunneling or hopping. The voltage-driven generation (±2 V) of molecule-based redox states, which are sufficiently long-lived to allow the relative mechanical movements necessary to switch between the two co-conformations, rely upon unequal charge transfer rates on to and/or off of the molecules. Surface-enhanced Raman spectroscopy has been used to image the ground state of the bistable rotaxane in MSTJ-like devices. Consideration of these models provide new ways of looking at molecular electronic devices that rely, not only on nanoscale charge-transport, but also upon the bustling world of molecular motion in mechanically interlocked bistable molecules

  13. Methodology for assessing electric vehicle charging infrastructure business models

    International Nuclear Information System (INIS)

    Madina, Carlos; Zamora, Inmaculada; Zabala, Eduardo

    2016-01-01

    The analysis of economic implications of innovative business models in networked environments, as electro-mobility is, requires a global approach to ensure that all the involved actors obtain a benefit. Although electric vehicles (EVs) provide benefits for the society as a whole, there are a number of hurdles for their widespread adoption, mainly the high investment cost for the EV and for the infrastructure. Therefore, a sound business model must be built up for charging service operators, which allows them to recover their costs while, at the same time, offer EV users a charging price which makes electro-mobility comparable to internal combustion engine vehicles. For that purpose, three scenarios are defined, which present different EV charging alternatives, in terms of charging power and charging station ownership and accessibility. A case study is presented for each scenario and the required charging station usage to have a profitable business model is calculated. We demonstrate that private home charging is likely to be the preferred option for EV users who can charge at home, as it offers a lower total cost of ownership under certain conditions, even today. On the contrary, finding a profitable business case for fast charging requires more intensive infrastructure usage. - Highlights: • Ecosystem is a network of actors who collaborate to create a positive business case. • Electro-mobility (electricity-powered road vehicles and ICT) is a complex ecosystem. • Methodological analysis to ensure that all actors benefit from electro-mobility. • Economic analysis of charging infrastructure deployment linked to its usage. • Comparison of EV ownership cost vs. ICE for vehicle users.

  14. Image-charge-induced localization of molecular orbitals at metal-molecule interfaces

    DEFF Research Database (Denmark)

    Strange, M.; Thygesen, K. S.

    2012-01-01

    Quasiparticle (QP) wave functions, also known as Dyson orbitals, extend the concept of single-particle states to interacting electron systems. Here we employ many-body perturbation theory in the GW approximation to calculate the QP wave functions for a semiempirical model describing a pi-conjugat......Quasiparticle (QP) wave functions, also known as Dyson orbitals, extend the concept of single-particle states to interacting electron systems. Here we employ many-body perturbation theory in the GW approximation to calculate the QP wave functions for a semiempirical model describing a pi...

  15. Reserving Charging Decision-Making Model and Route Plan for Electric Vehicles Considering Information of Traffic and Charging Station

    Directory of Open Access Journals (Sweden)

    Haoming Liu

    2018-04-01

    Full Text Available With the advance of battery energy technology, electric vehicles (EV are catching more and more attention. One of the influencing factors of electric vehicles large-scale application is the availability of charging stations and convenience of charging. It is important to investigate how to make reserving charging strategies and ensure electric vehicles are charged with shorter time and lower charging expense whenever charging request is proposed. This paper proposes a reserving charging decision-making model for electric vehicles that move to certain destinations and need charging services in consideration of traffic conditions and available charging resources at the charging stations. Besides, the interactive mechanism is described to show how the reserving charging system works, as well as the rolling records-based credit mechanism where extra charges from EV is considered to hedge default behavior. With the objectives of minimizing driving time and minimizing charging expenses, an optimization model with two objective functions is formulated. Then the optimizations are solved by a K shortest paths algorithm based on a weighted directed graph, where the time and distance factors are respectively treated as weights of corresponding edges of transportation networks. Case studies show the effectiveness and validity of the proposed route plan and reserving charging decision-making model.

  16. Experimental and theoretical data on ion-molecule-reactions relevant for plasma modelling

    International Nuclear Information System (INIS)

    Hansel, A.; Praxmarer, C.; Lindinger, W.

    1995-01-01

    Despite the fact that the rate coefficients of hundreds of ion-molecule-reactions have been published in the literature, much more data are required for the purpose of plasma modelling. Many ion molecule reactions have rate coefficients, k, as large as the collisional limiting value, k c , i.e. the rate coefficients k c at which ion-neutral collision complexes are formed are close to the actual rate coefficients observed. In the case of the interaction of an ion with a non polar molecule, k c , is determined by the Langevin limiting value k L being typically 10 -9 cm 3 s -1 . However, when ions react with polar molecules k c is predicted by the average dipole orientation (ADO) theory. These classical theories yield accurate rate coefficients at thermal and elevated temperatures for practically all proton transfer as well as for many charge transfer and hydrogen abstraction reactions. The agreement between experimental and calculated values is usually better than ±20% and in the case of proton transfer reactions the agreement seems to be even better as recent investigations have shown. Even the interaction of the permanent ion dipole with non polar and polar neutrals can be taken into account to predict reaction rate coefficients as has been shown very recently in reactions of the highly polar ion ArH 3 + with various neutrals

  17. Discrete Velocity Models for Polyatomic Molecules Without Nonphysical Collision Invariants

    Science.gov (United States)

    Bernhoff, Niclas

    2018-05-01

    An important aspect of constructing discrete velocity models (DVMs) for the Boltzmann equation is to obtain the right number of collision invariants. Unlike for the Boltzmann equation, for DVMs there can appear extra collision invariants, so called spurious collision invariants, in plus to the physical ones. A DVM with only physical collision invariants, and hence, without spurious ones, is called normal. The construction of such normal DVMs has been studied a lot in the literature for single species, but also for binary mixtures and recently extensively for multicomponent mixtures. In this paper, we address ways of constructing normal DVMs for polyatomic molecules (here represented by that each molecule has an internal energy, to account for non-translational energies, which can change during collisions), under the assumption that the set of allowed internal energies are finite. We present general algorithms for constructing such models, but we also give concrete examples of such constructions. This approach can also be combined with similar constructions of multicomponent mixtures to obtain multicomponent mixtures with polyatomic molecules, which is also briefly outlined. Then also, chemical reactions can be added.

  18. Gap junction modulation by extracellular signaling molecules: the thymus model

    Directory of Open Access Journals (Sweden)

    Alves L.A.

    2000-01-01

    Full Text Available Gap junctions are intercellular channels which connect adjacent cells and allow direct exchange of molecules of low molecular weight between them. Such a communication has been described as fundamental in many systems due to its importance in coordination, proliferation and differentiation. Recently, it has been shown that gap junctional intercellular communication (GJIC can be modulated by several extracellular soluble factors such as classical hormones, neurotransmitters, interleukins, growth factors and some paracrine substances. Herein, we discuss some aspects of the general modulation of GJIC by extracellular messenger molecules and more particularly the regulation of such communication in the thymus gland. Additionally, we discuss recent data concerning the study of different neuropeptides and hormones in the modulation of GJIC in thymic epithelial cells. We also suggest that the thymus may be viewed as a model to study the modulation of gap junction communication by different extracellular messengers involved in non-classical circuits, since this organ is under bidirectional neuroimmunoendocrine control.

  19. Charging of mobile services by mobile payment reference model

    OpenAIRE

    Pousttchi, Key; Wiedemann, Dietmar Georg

    2005-01-01

    The purpose of the paper is to analyze mobile payments in the mobile commerce scenario. Therefore, we first classify the mobile payment in the mobile commerce scenario by explaining general offer models, charging concepts, and intermediaries. Second, we describe the mobile payment reference model, especially, the mobile payment reference organization model and different mobile payment standard types. Finally, we conclude our findings.

  20. Model for screened, charge-regulated electrostatics of an eye lens protein: Bovine gammaB-crystallin

    Science.gov (United States)

    Wahle, Christopher W.; Martini, K. Michael; Hollenbeck, Dawn M.; Langner, Andreas; Ross, David S.; Hamilton, John F.; Thurston, George M.

    2017-09-01

    We model screened, site-specific charge regulation of the eye lens protein bovine gammaB-crystallin (γ B ) and study the probability distributions of its proton occupancy patterns. Using a simplified dielectric model, we solve the linearized Poisson-Boltzmann equation to calculate a 54 ×54 work-of-charging matrix, each entry being the modeled voltage at a given titratable site, due to an elementary charge at another site. The matrix quantifies interactions within patches of sites, including γ B charge pairs. We model intrinsic p K values that would occur hypothetically in the absence of other charges, with use of experimental data on the dependence of p K values on aqueous solution conditions, the dielectric model, and literature values. We use Monte Carlo simulations to calculate a model grand-canonical partition function that incorporates both the work-of-charging and the intrinsic p K values for isolated γ B molecules and we calculate the probabilities of leading proton occupancy configurations, for 4 Debye screening lengths from 6 to 20 Å. We select the interior dielectric value to model γ B titration data. At p H 7.1 and Debye length 6.0 Å, on a given γ B molecule the predicted top occupancy pattern is present nearly 20% of the time, and 90% of the time one or another of the first 100 patterns will be present. Many of these occupancy patterns differ in net charge sign as well as in surface voltage profile. We illustrate how charge pattern probabilities deviate from the multinomial distribution that would result from use of effective p K values alone and estimate the extents to which γ B charge pattern distributions broaden at lower p H and narrow as ionic strength is lowered. These results suggest that for accurate modeling of orientation-dependent γ B -γ B interactions, consideration of numerous pairs of proton occupancy patterns will be needed.

  1. Discrete Element Modeling (DEM) of Triboelectrically Charged Particles: Revised Experiments

    Science.gov (United States)

    Hogue, Michael D.; Calle, Carlos I.; Curry, D. R.; Weitzman, P. S.

    2008-01-01

    In a previous work, the addition of basic screened Coulombic electrostatic forces to an existing commercial discrete element modeling (DEM) software was reported. Triboelectric experiments were performed to charge glass spheres rolling on inclined planes of various materials. Charge generation constants and the Q/m ratios for the test materials were calculated from the experimental data and compared to the simulation output of the DEM software. In this paper, we will discuss new values of the charge generation constants calculated from improved experimental procedures and data. Also, planned work to include dielectrophoretic, Van der Waals forces, and advanced mechanical forces into the software will be discussed.

  2. Single-molecule conductance of a chemically modified, π-extended tetrathiafulvalene and its charge-transfer complex with F4TCNQ

    Directory of Open Access Journals (Sweden)

    Raúl García

    2015-06-01

    Full Text Available We describe the synthesis and single-molecule electrical transport properties of a molecular wire containing a π-extended tetrathiafulvalene (exTTF group and its charge-transfer complex with F4TCNQ. We form single-molecule junctions using the in situ break junction technique using a homebuilt scanning tunneling microscope with a range of conductance between 10 G0 down to 10−7 G0. Within this range we do not observe a clear conductance signature of the neutral parent molecule, suggesting either that its conductance is too low or that it does not form a stable junction. Conversely, we do find a clear conductance signature in the experiments carried out on the charge-transfer complex. Due to the fact we expected this species to have a higher conductance than the neutral molecule, we believe this supports the idea that the conductance of the neutral molecule is very low, below our measurement sensitivity. This idea is further supported by theoretical calculations. To the best of our knowledge, these are the first reported single-molecule conductance measurements on a molecular charge-transfer species.

  3. DETAILED MODELLING OF CHARGING BEHAVIOUR OF SMART SOLAR TANKS

    DEFF Research Database (Denmark)

    Fan, Jianhua; Andersen, Elsa; Furbo, Simon

    2010-01-01

    The charging behaviour of smart solar tanks for solar combisystems for one-family houses is investigated with detailed Computational Fluid Dynamics (CFD) modelling and Particle Image Velocimetry (PIV) measurements. The smart solar tank can be charged with a variable auxiliary volume fitted...... or by an electric heating element in a side-arm mounted on the side of the tank. Detailed CFD models of the smart tanks are built with different mesh densities in the tank and in the side-arm. The thermal conditions of the tank during charging are calculated with the CFD models. The fluid flow and temperature...... by the mesh densities, the distribution of computational cells, the physical model and time steps used in the simulations. The findings of the investigations will be used as guidance for creation of CFD models for optimal design of smart solar tanks....

  4. Solitary Model of the Charge Particle Transport in Collisionless Plasma

    International Nuclear Information System (INIS)

    Simonchik, L.V.; Trukhachev, F.M.

    2006-01-01

    The one-dimensional MHD solitary model of charged particle transport in plasma is developed. It is shown that self-consistent electric field of ion-acoustic solitons can displace charged particles in space, which can be a reason of local electric current generation. The displacement amount is order of a few Debye lengths. It is shown that the current associated with soliton cascade has pulsating nature with DC component. Methods of built theory verification in dusty plasma are proposed

  5. Interplanetary Radiation and Internal Charging Environment Models for Solar Sails

    Science.gov (United States)

    Minow, Joseph I.; Altstatt, Richard L.; NeegaardParker, Linda

    2005-01-01

    A Solar Sail Radiation Environment (SSRE) model has been developed for defining charged particle environments over an energy range from 0.01 keV to 1 MeV for hydrogen ions, helium ions, and electrons. The SSRE model provides the free field charged particle environment required for characterizing energy deposition per unit mass, charge deposition, and dose rate dependent conductivity processes required to evaluate radiation dose and internal (bulk) charging processes in the solar sail membrane in interplanetary space. Solar wind and energetic particle measurements from instruments aboard the Ulysses spacecraft in a solar, near-polar orbit provide the particle data over a range of heliospheric latitudes used to derive the environment that can be used for radiation and charging environments for both high inclination 0.5 AU Solar Polar Imager mission and the 1.0 AU L1 solar missions. This paper describes the techniques used to model comprehensive electron, proton, and helium spectra over the range of particle energies of significance to energy and charge deposition in thin (less than 25 micrometers) solar sail materials.

  6. General Method to Determine the Flux of Charged Molecules through Nanopores Applied to β-Lactamase Inhibitors and OmpF.

    Science.gov (United States)

    Ghai, Ishan; Pira, Alessandro; Scorciapino, Mariano Andrea; Bodrenko, Igor; Benier, Lorraine; Ceccarelli, Matteo; Winterhalter, Mathias; Wagner, Richard

    2017-03-16

    A major challenge in the discovery of the new antibiotics against Gram-negative bacteria is to achieve sufficiently fast permeation in order to avoid high doses causing toxic side effects. So far, suitable assays for quantifying the uptake of charged antibiotics into bacteria are lacking. We apply an electrophysiological zero-current assay using concentration gradients of β-lactamase inhibitors combined with single-channel conductance to quantify their flux rates through OmpF. Molecular dynamic simulations provide in addition details on the interactions between the nanopore wall and the charged solutes. In particular, the interaction barrier for three β-lactamase inhibitors is surprisingly as low as 3-5 kcal/mol and only slightly above the diffusion barrier of ions such as chloride. Within our macroscopic constant field model, we determine that at a zero-membrane potential a concentration gradient of 10 μM of avibactam, sulbactam, or tazobactam can create flux rates of roughly 620 molecules/s per OmpF trimer.

  7. Electrostatic Model Applied to ISS Charged Water Droplet Experiment

    Science.gov (United States)

    Stevenson, Daan; Schaub, Hanspeter; Pettit, Donald R.

    2015-01-01

    The electrostatic force can be used to create novel relative motion between charged bodies if it can be isolated from the stronger gravitational and dissipative forces. Recently, Coulomb orbital motion was demonstrated on the International Space Station by releasing charged water droplets in the vicinity of a charged knitting needle. In this investigation, the Multi-Sphere Method, an electrostatic model developed to study active spacecraft position control by Coulomb charging, is used to simulate the complex orbital motion of the droplets. When atmospheric drag is introduced, the simulated motion closely mimics that seen in the video footage of the experiment. The electrostatic force's inverse dependency on separation distance near the center of the needle lends itself to analytic predictions of the radial motion.

  8. Charging stations location model based on spatiotemporal electromobility use patterns

    Science.gov (United States)

    Pagany, Raphaela; Marquardt, Anna; Zink, Roland

    2016-04-01

    One of the major challenges for mainstream adoption of electric vehicles is the provision of infrastructure for charging the batteries of the vehicles. The charging stations must not only be located dense enough to allow users to complete their journeys, but the electric energy must also be provided from renewable sources in order to truly offer a transportation with less CO2 emissions. The examination of potential locations for the charging of electric vehicles can facilitate the adaption of electromobility and the integration of electronic vehicles in everyday life. A geographic information system (GIS) based model for optimal location of charging stations in a small and regional scale is presented. This considers parameters such as the forecast of electric vehicle use penetration, the relevant weight of diverse point of interests and the distance between parking area and destination for different vehicle users. In addition to the spatial scale the temporal modelling of the energy demand at the different charging locations has to be considerate. Depending on different user profiles (commuters, short haul drivers etc.) the frequency of charging vary during the day, the week and the year. In consequence, the spatiotemporal variability is a challenge for a reliable energy supply inside a decentralized renewable energy system. The presented model delivers on the one side the most adequate identified locations for charging stations and on the other side the interaction between energy supply and demand for electromobility under the consideration of temporal aspects. Using ESRI ArcGIS Desktop, first results for the case study region of Lower Bavaria are generated. The aim of the concept is to keep the model transferable to other regions and also open to integrate further and more detailed user profiles, derived from social studies about i.e. the daily behavior and the perception of electromobility in a next step.

  9. Simple standard model extension by heavy charged scalar

    Science.gov (United States)

    Boos, E.; Volobuev, I.

    2018-05-01

    We consider a Standard Model (SM) extension by a heavy charged scalar gauged only under the UY(1 ) weak hypercharge gauge group. Such an extension, being gauge invariant with respect to the SM gauge group, is a simple special case of the well-known Zee model. Since the interactions of the charged scalar with the Standard Model fermions turn out to be significantly suppressed compared to the Standard Model interactions, the charged scalar provides an example of a long-lived charged particle being interesting to search for at the LHC. We present the pair and single production cross sections of the charged scalar at different colliders and the possible decay widths for various boson masses. It is shown that the current ATLAS and CMS searches at 8 and 13 TeV collision energy lead to the bounds on the scalar boson mass of about 300-320 GeV. The limits are expected to be much larger for higher collision energies and, assuming 15 a b-1 integrated luminosity, reach about 2.7 TeV at future 27 TeV LHC thus covering the most interesting mass region.

  10. Modeling space charge in beams for heavy-ion fusion

    International Nuclear Information System (INIS)

    Sharp, W.M.

    1995-01-01

    A new analytic model is presented which accurately estimates the radially averaged axial component of the space-charge field of an axisymmetric heavy-ion beam in a cylindrical beam pipe. The model recovers details of the field near the beam ends that are overlooked by simpler models, and the results compare well to exact solutions of Poisson's equation. Field values are shown for several simple beam profiles and are compared with values obtained from simpler models

  11. Adsorption and transport of charged vs. neutral hydrophobic molecules at the membrane of murine erythroleukemia (MEL) cells.

    Science.gov (United States)

    Zeng, Jia; Eckenrode, Heather M; Dai, Hai-Lung; Wilhelm, Michael J

    2015-03-01

    The adsorption and transport of hydrophobic molecules at the membrane surface of pre- and post-DMSO induced differentiated murine erythroleukemia (MEL) cells were examined by time- and wavelength-resolved second harmonic light scattering. Two medium (MEL cell, neutral BCP does not. It is suggested that an electrostatic interaction between the opposite charges of the cation and the MEL cell surface is the primary driving force for adsorption. Comparisons of adsorption density and free energy, measured at different pH and cell morphology, indicate that the interaction is predominantly through sialic acid carboxyl groups. MG cation adsorption densities have been determined as (0.6±0.3)×10(6) μm(-2) on the surface of undifferentiated MEL cells, and (1.8±0.5)×10(7) μm(-2) on differentiated MEL cells, while the deduced adsorption free energies are effectively identical (ca. -10.9±0.1 and -10.8±0.1 kcal mol(-1), respectively). The measured MG densities indicate that the total number of surface carboxyl groups is largely conserved following differentiation, and therefore the density of carboxylic groups is much larger on the differentiated cell surface than the undifferentiated one. Finally, in contrast to synthetic liposomes and bacterial membranes, surface adsorbed MG cations are unable to traverse the MEL cell membrane. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Solid charged-core model of ball lightning

    Science.gov (United States)

    Muldrew, D. B.

    2010-01-01

    In this study, ball lightning (BL) is assumed to have a solid, positively-charged core. According to this underlying assumption, the core is surrounded by a thin electron layer with a charge nearly equal in magnitude to that of the core. A vacuum exists between the core and the electron layer containing an intense electromagnetic (EM) field which is reflected and guided by the electron layer. The microwave EM field applies a ponderomotive force (radiation pressure) to the electrons preventing them from falling into the core. The energetic electrons ionize the air next to the electron layer forming a neutral plasma layer. The electric-field distributions and their associated frequencies in the ball are determined by applying boundary conditions to a differential equation given by Stratton (1941). It is then shown that the electron and plasma layers are sufficiently thick and dense to completely trap and guide the EM field. This model of BL is exceptional in that it can explain all or nearly all of the peculiar characteristics of BL. The ES energy associated with the core charge can be extremely large which can explain the observations that occasionally BL contains enormous energy. The mass of the core prevents the BL from rising like a helium-filled balloon - a problem with most plasma and burning-gas models. The positively charged core keeps the negatively charged electron layer from diffusing away, i.e. it holds the ball together; other models do not have a mechanism to do this. The high electrical charges on the core and in the electron layer explains why some people have been electrocuted by BL. Experiments indicate that BL radiates microwaves upon exploding and this is consistent with the model. The fact that this novel model of BL can explain these and other observations is strong evidence that the model should be taken seriously.

  13. New models for intermolecular repulsion and their application to Van Der Waals complexes and crystals of organic molecules

    International Nuclear Information System (INIS)

    Tsui, H.H.Y.

    2001-01-01

    Model intermolecular potentials are required for simulations of molecules in the gas, liquid, or solid phase. The widely used isotropic atom-atom model potentials are empirically fitted and based on the assumptions of transferability, combining rules and that atoms in molecules are spherical. This thesis develops a non-empirical method of modelling repulsion by applying the overlap model, which we show as a general non-empirical method of deriving repulsion potentials for a specific molecule. In this thesis, the repulsion parameters for an exponential atom-atom model potential are obtained from the ab initio charge density of a small organic molecule by making the assumption that the repulsion is proportional to the overlap of a pair of molecules. The proportionality constant is fixed by a limited number of intermolecular perturbation theory (IMPT) calculations. To complete the model potential, the electrostatic interaction is represented by a distributed multipole analysis, and the Slater-Kirkwood formula is used for the dispersion. These non-empirical potentials can reproduce experimental crystal structure when applied to crystal structure prediction of an oxyboryl derivative. A detailed study on further improving the overlap model was carried out for phenol-water, by including other minor intermolecular contributions of charge-transfer and penetration. High quality ab initio calculations on the complex were performed for use in comparison. To compare with experimental data, diffusion Monte Carlo simulations were performed with the potential, so that the effects of anharmonic zero-point motion on structure and energy of the system are included. When the system is too large for an IMPT calculation, the proportionality constant can be determined empirically by fitting the cell volume as shown in our study of crystal structures of chlorothalonil. This is used with an anisotropic repulsion model that has been derived for Cl and N atoms in chlorothalonil. This model

  14. Charge loss experiments in surface channel CCD's explained by the McWhorter interface states model

    NARCIS (Netherlands)

    Penning De Vries, R.G.M.; Wallinga, Hans

    1985-01-01

    On the basis of the McWhorter interface states model the CCD charge loss is derived as a function of bias charge, signal charge and channel width. As opposed to existing models, the charge loss is now attributed to interface states in the entire gate area, even for high bias charge levels.

  15. Effect of polysaccharide capsule of the microalgae Staurastrum iversenii var. americanum on diffusion of charged and uncharged molecules, using EPR technique

    International Nuclear Information System (INIS)

    Freire-Nordi, Cristina S.; Nascimento, Otaciro R.; Vieira, Armando A.H.; Nakaie, Clovis R.

    2006-01-01

    The existence of a mucilaginous envelope, sheath or capsule is usual in many desmids, but few data concerning its function are available. Previous studies of the transport function and permeation of molecules through the algae capsules were done using the algae Spondylosium panduriforme and Nephrocytium lunatum, the Electron Paramagnetic Resonance (EPR) technique, and different spin labels. The results suggested that the capsule functions as a selective diffusion medium. In the present work charged and uncharged molecules (spin labels group A) and Staurastrum iversenii var. americanum (Desmids),whose alga presents a great mucilaginous capsule, were used. Charged nitroxide molecules similar to amino acids (spin labels group B) were also used allowing a better understanding of the electrostatic effect in the permeation process across the capsule. The role of the cell capsule in the solute diffusion was evaluated by determining the capsulated and decapsulated cell permeation times. The permeation times for all spin labels tested in the cells lacking capsules were always shorter than those containing this physical barrier. The decay times of spin labels group A observed for S. iversenii were compared to other studied algae. The results regarding the diffusion of charged spin labels group B suggested that the interaction of cell capsule occurs more strongly with negatively charged molecules than with positively charged ones. The results obtained in this work with spin labels group A confirm that the capsule is an essential structure for the cell, and that due to the polar interactions with the spin labels, it plays an important role in the selection of small molecules. Several parameters, mainly those of electrostatic nature, seem to control the permeation across the algal capsules of spin labels group B, showing that structures which are similar to amino acids could diffuse across the interior of the algal cell. (author)

  16. Charge and color breaking minima in supersymmetric models

    International Nuclear Information System (INIS)

    Brhlik, Michal

    2001-01-01

    Supersymmetric extensions of the Standard Model include complicated scalar sectors leading to the possible occurrence of non-standard minima along suitable directions in the field space. These minima usually break charge and/or color and their presence in the theory would require an explanation why the universe has settled in the standard electroweak symmetry breaking minimum. In this talk I illustrate the relevance of the charge and color breaking minima in the framework of the minimal supergravity model and a string motivated Horava-Witten scenario

  17. Charge carrier relaxation model in disordered organic semiconductors

    International Nuclear Information System (INIS)

    Lu, Nianduan; Li, Ling; Sun, Pengxiao; Liu, Ming

    2013-01-01

    The relaxation phenomena of charge carrier in disordered organic semiconductors have been demonstrated and investigated theoretically. An analytical model describing the charge carrier relaxation is proposed based on the pure hopping transport theory. The relation between the material disorder, electric field and temperature and the relaxation phenomena has been discussed in detail, respectively. The calculated results reveal that the increase of electric field and temperature can promote the relaxation effect in disordered organic semiconductors, while the increase of material disorder will weaken the relaxation. The proposed model can explain well the stretched-exponential law by adopting the appropriate parameters. The calculation shows a good agreement with the experimental data for organic semiconductors

  18. Modeling, hybridization, and optimal charging of electrical energy storage systems

    Science.gov (United States)

    Parvini, Yasha

    The rising rate of global energy demand alongside the dwindling fossil fuel resources has motivated research for alternative and sustainable solutions. Within this area of research, electrical energy storage systems are pivotal in applications including electrified vehicles, renewable power generation, and electronic devices. The approach of this dissertation is to elucidate the bottlenecks of integrating supercapacitors and batteries in energy systems and propose solutions by the means of modeling, control, and experimental techniques. In the first step, the supercapacitor cell is modeled in order to gain fundamental understanding of its electrical and thermal dynamics. The dependence of electrical parameters on state of charge (SOC), current direction and magnitude (20-200 A), and temperatures ranging from -40°C to 60°C was embedded in this computationally efficient model. The coupled electro-thermal model was parameterized using specifically designed temporal experiments and then validated by the application of real world duty cycles. Driving range is one of the major challenges of electric vehicles compared to combustion vehicles. In order to shed light on the benefits of hybridizing a lead-acid driven electric vehicle via supercapacitors, a model was parameterized for the lead-acid battery and combined with the model already developed for the supercapacitor, to build the hybrid battery-supercapacitor model. A hardware in the loop (HIL) setup consisting of a custom built DC/DC converter, micro-controller (muC) to implement the power management strategy, 12V lead-acid battery, and a 16.2V supercapacitor module was built to perform the validation experiments. Charging electrical energy storage systems in an efficient and quick manner, motivated to solve an optimal control problem with the objective of maximizing the charging efficiency for supercapacitors, lead-acid, and lithium ion batteries. Pontryagins minimum principle was used to solve the problems

  19. Lessons on electronic decoherence in molecules from exact modeling

    Science.gov (United States)

    Hu, Wenxiang; Gu, Bing; Franco, Ignacio

    2018-04-01

    Electronic decoherence processes in molecules and materials are usually thought and modeled via schemes for the system-bath evolution in which the bath is treated either implicitly or approximately. Here we present computations of the electronic decoherence dynamics of a model many-body molecular system described by the Su-Schrieffer-Heeger Hamiltonian with Hubbard electron-electron interactions using an exact method in which both electronic and nuclear degrees of freedom are taken into account explicitly and fully quantum mechanically. To represent the electron-nuclear Hamiltonian in matrix form and propagate the dynamics, the computations employ the Jordan-Wigner transformation for the fermionic creation/annihilation operators and the discrete variable representation for the nuclear operators. The simulations offer a standard for electronic decoherence that can be used to test approximations. They also provide a useful platform to answer fundamental questions about electronic decoherence that cannot be addressed through approximate or implicit schemes. Specifically, through simulations, we isolate basic mechanisms for electronic coherence loss and demonstrate that electronic decoherence is possible even for one-dimensional nuclear bath. Furthermore, we show that (i) decreasing the mass of the bath generally leads to faster electronic decoherence; (ii) electron-electron interactions strongly affect the electronic decoherence when the electron-nuclear dynamics is not pure-dephasing; (iii) classical bath models with initial conditions sampled from the Wigner distribution accurately capture the short-time electronic decoherence dynamics; (iv) model separable initial superpositions often used to understand decoherence after photoexcitation are only relevant in experiments that employ delta-like laser pulses to initiate the dynamics. These insights can be employed to interpret and properly model coherence phenomena in molecules.

  20. Probing the Importance of Charge Flux in Force Field Modeling.

    Science.gov (United States)

    Sedghamiz, Elaheh; Nagy, Balazs; Jensen, Frank

    2017-08-08

    We analyze the conformational dependence of atomic charges and molecular dipole moments for a selection of ∼900 conformations of peptide models of the 20 neutral amino acids. Based on a set of reference density functional theory calculations, we partition the changes into effects due to changes in bond distances, bond angles, and torsional angles and into geometry and charge flux contributions. This allows an assessment of the limitations of fixed charge force fields and indications for how to design improved force fields. The torsional degrees of freedom are the main contribution to conformational changes of atomic charges and molecular dipole moments, but indirect effects due to change in bond distances and angles account for ∼25% of the variation. Charge flux effects dominate for changes in bond distances and are also the main component of the variation in bond angles, while they are ∼25% compared to the geometry variations for torsional degrees of freedom. The geometry and charge flux contributions to some extent produce compensating effects.

  1. ADAS tools for collisional–radiative modelling of molecules

    Energy Technology Data Exchange (ETDEWEB)

    Guzmán, F., E-mail: francisco.guzman@cea.fr [Department of Physics, University of Strathclyde, Glasgow G4 0NG (United Kingdom); CEA, IRFM, Saint-Paul-lez-Durance 13108 (France); O’Mullane, M.; Summers, H.P. [Department of Physics, University of Strathclyde, Glasgow G4 0NG (United Kingdom)

    2013-07-15

    New theoretical and computational tools for molecular collisional–radiative models are presented. An application to the hydrogen molecule system has been made. At the same time, a structured database has been created where fundamental cross sections and rates for individual processes as well as derived data (effective coefficients) are stored. Relative populations for the vibrational states of the ground electronic state of H{sub 2} are presented and this vibronic resolution model is compared electronic resolution where vibronic transitions are summed over vibrational sub-states. Some new reaction rates are calculated by means of the impact parameter approximation. Computational tools have been developed to automate process and simplify the data assembly. Effective (collisional–radiative) rate coefficients versus temperature and density are presented.

  2. ADAS tools for collisional-radiative modelling of molecules

    Science.gov (United States)

    Guzmán, F.; O'Mullane, M.; Summers, H. P.

    2013-07-01

    New theoretical and computational tools for molecular collisional-radiative models are presented. An application to the hydrogen molecule system has been made. At the same time, a structured database has been created where fundamental cross sections and rates for individual processes as well as derived data (effective coefficients) are stored. Relative populations for the vibrational states of the ground electronic state of H2 are presented and this vibronic resolution model is compared electronic resolution where vibronic transitions are summed over vibrational sub-states. Some new reaction rates are calculated by means of the impact parameter approximation. Computational tools have been developed to automate process and simplify the data assembly. Effective (collisional-radiative) rate coefficients versus temperature and density are presented.

  3. Models of charge pair generation in organic solar cells.

    Science.gov (United States)

    Few, Sheridan; Frost, Jarvist M; Nelson, Jenny

    2015-01-28

    Efficient charge pair generation is observed in many organic photovoltaic (OPV) heterojunctions, despite nominal electron-hole binding energies which greatly exceed the average thermal energy. Empirically, the efficiency of this process appears to be related to the choice of donor and acceptor materials, the resulting sequence of excited state energy levels and the structure of the interface. In order to establish a suitable physical model for the process, a range of different theoretical studies have addressed the nature and energies of the interfacial states, the energetic profile close to the heterojunction and the dynamics of excited state transitions. In this paper, we review recent developments underpinning the theory of charge pair generation and phenomena, focussing on electronic structure calculations, electrostatic models and approaches to excited state dynamics. We discuss the remaining challenges in achieving a predictive approach to charge generation efficiency.

  4. Space-Charge-Limited Emission Models for Particle Simulation

    Science.gov (United States)

    Verboncoeur, J. P.; Cartwright, K. L.; Murphy, T.

    2004-11-01

    Space-charge-limited (SCL) emission of electrons from various materials is a common method of generating the high current beams required to drive high power microwave (HPM) sources. In the SCL emission process, sufficient space charge is extracted from a surface, often of complicated geometry, to drive the electric field normal to the surface close to zero. The emitted current is highly dominated by space charge effects as well as ambient fields near the surface. In this work, we consider computational models for the macroscopic SCL emission process including application of Gauss's law and the Child-Langmuir law for space-charge-limited emission. Models are described for ideal conductors, lossy conductors, and dielectrics. Also considered is the discretization of these models, and the implications for the emission physics. Previous work on primary and dual-cell emission models [Watrous et al., Phys. Plasmas 8, 289-296 (2001)] is reexamined, and aspects of the performance, including fidelity and noise properties, are improved. Models for one-dimensional diodes are considered, as well as multidimensional emitting surfaces, which include corners and transverse fields.

  5. Characterizing cavities in model inclusion molecules: a comparative study.

    Science.gov (United States)

    Torrens, F; Sánchez-Marín, J; Nebot-Gil, I

    1998-04-01

    We have selected fullerene-60 and -70 cavities as model systems in order to test several methods for characterizing inclusion molecules. The methods are based on different technical foundations such as a square and triangular tessellation of the molecule taken as a unitary sphere, spherical tessellation of the molecular surface, numerical integration of the atomic volumes and surfaces, triangular tessellation of the molecular surface, and a cubic lattice approach to a molecular space. Accurate measures of the molecular volume and surface area have been performed with the pseudo-random Monte Carlo (MCVS) and uniform Monte Carlo (UMCVS) methods. These calculations serve as a reference for the rest of the methods. The SURMO2 and MS methods have not recognized the cavities and may not be convenient for intercalation compounds. The programs that have detected the cavities never exceed 5% deviation relative to the reference values for molecular volume and surface area. The GEPOL algorithm, alone or combined with TOPO, shows results in good agreement with those of the UMCVS reference. The uniform random number generator provides the fastest convergence for UMCVS and a correct estimate of the standard deviations. The effect of the internal cavity on the accessible surfaces has been calculated.

  6. Models for calculation of dissociation energies of homonuclear diatomic molecules

    International Nuclear Information System (INIS)

    Brewer, L.; Winn, J.S.

    1979-08-01

    The variation of known dissociation energies of the transition metal diatomics across the Periodic Table is rather irregular like the bulk sublimation enthalpy, suggesting that the valence-bond model for bulk metallic systems might be applicable to the gaseous diatomic molecules and the various intermediate clusters. Available dissociation energies were converted to valence-state bonding energies considering various degrees of promotion to optimize the bonding. The degree of promotion of electrons to increase the number of bonding electrons is smaller than for the bulk, but the trends in bonding energy parallel the behavior found for the bulk metals. Thus using the established trends in bonding energies for the bulk elements, it was possible to calculate all unknown dissociation energies to provide a complete table of dissociation energies for all M 2 molecules from H 2 to Lr 2 . For solids such as Mg, Al, Si and most of the transition metals, large promotion energies are offset by strong bonding between the valence state atoms. The main question is whether bonding in the diatomics is adequate to sustain extensive promotion. The most extreme example for which a considerable difference would be expected between the bulk and the diatomics would be that of the Group IIA and IIB metals. The first section of this paper which deals with the alkaline earths Mg and Ca demonstrates a significant influence of the excited valence state even for these elements. The next section then expands the treatment to transition metals

  7. A charge-based model of Junction Barrier Schottky rectifiers

    Science.gov (United States)

    Latorre-Rey, Alvaro D.; Mudholkar, Mihir; Quddus, Mohammed T.; Salih, Ali

    2018-06-01

    A new charge-based model of the electric field distribution for Junction Barrier Schottky (JBS) diodes is presented, based on the description of the charge-sharing effect between the vertical Schottky junction and the lateral pn-junctions that constitute the active cell of the device. In our model, the inherently 2-D problem is transformed into a simple but accurate 1-D problem which has a closed analytical solution that captures the reshaping and reduction of the electric field profile responsible for the improved electrical performance of these devices, while preserving physically meaningful expressions that depend on relevant device parameters. The validation of the model is performed by comparing calculated electric field profiles with drift-diffusion simulations of a JBS device showing good agreement. Even though other fully 2-D models already available provide higher accuracy, they lack physical insight making the proposed model an useful tool for device design.

  8. Charged and neutral minimal supersymmetric standard model Higgs ...

    Indian Academy of Sciences (India)

    physics pp. 759–763. Charged and neutral minimal supersymmetric standard model Higgs boson decays and measurement of tan β at the compact linear collider. E CONIAVITIS and A FERRARI∗. Department of Nuclear and Particle Physics, Uppsala University, 75121 Uppsala, Sweden. ∗E-mail: ferrari@tsl.uu.se. Abstract.

  9. Modeling charge transfer at organic donor-acceptor semiconductor interfaces

    NARCIS (Netherlands)

    Cakir, Deniz; Bokdam, Menno; de Jong, Machiel Pieter; Fahlman, M.; Brocks, G.

    2012-01-01

    We develop an integer charge transfer model for the potential steps observed at interfaces between donor and acceptor molecular semiconductors. The potential step can be expressed as the difference between the Fermi energy pinning levels of electrons on the acceptor material and holes on the donor

  10. Computer simulation study of water using a fluctuating charge model

    Indian Academy of Sciences (India)

    Unknown

    Typically, the simulated diffusion constants are larger, and relaxation times smaller than .... where λi is the Lagrange multiplier for the charge neutrality constraint. As the .... For a geometrically rigid model such as SPC, the integral turns out to ...

  11. The charge-asymmetric nonlocally determined local-electric (CANDLE) solvation model

    Energy Technology Data Exchange (ETDEWEB)

    Sundararaman, Ravishankar; Goddard, William A. [Joint Center for Artificial Photosynthesis, Pasadena, California 91125 (United States)

    2015-02-14

    Many important applications of electronic structure methods involve molecules or solid surfaces in a solvent medium. Since explicit treatment of the solvent in such methods is usually not practical, calculations often employ continuum solvation models to approximate the effect of the solvent. Previous solvation models either involve a parametrization based on atomic radii, which limits the class of applicable solutes, or based on solute electron density, which is more general but less accurate, especially for charged systems. We develop an accurate and general solvation model that includes a cavity that is a nonlocal functional of both solute electron density and potential, local dielectric response on this nonlocally determined cavity, and nonlocal approximations to the cavity-formation and dispersion energies. The dependence of the cavity on the solute potential enables an explicit treatment of the solvent charge asymmetry. With four parameters per solvent, this “CANDLE” model simultaneously reproduces solvation energies of large datasets of neutral molecules, cations, and anions with a mean absolute error of 1.8 kcal/mol in water and 3.0 kcal/mol in acetonitrile.

  12. Investigations of solution-processed charge generation unit with low concentration of small molecule doped in p-type/HAT-CN{sub 6} for tandem OLED

    Energy Technology Data Exchange (ETDEWEB)

    Talik, N.A., E-mail: azrina_talik@hotmail.com [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yeoh, K.H. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Centre for Photonics and Advanced Materials Research (CPR), Lee Kong Chian Faculty of Engineering and Science, University Tunku Abdul Rahman, 43000 Kajang, Selangor (Malaysia); Ng, C.Y.B. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Tan, C.Y. [Centre of Advanced Manufacturing & Material Processing (AMMP), Department of Mechanical Engineering, Faculty of Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yap, B.K., E-mail: kbyap@uniten.edu.my [Centre of Microelectronic and Nano Engineering (CeMNE), College of Engineering, Universiti Tenaga Nasional, 43000 Kajang, Selangor (Malaysia)

    2016-01-15

    We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN{sub 6} has been used for tandem OLED. • The improvement attributes to the lower V{sub bi} and larger ΔV{sub L} in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.

  13. Investigations of solution-processed charge generation unit with low concentration of small molecule doped in p-type/HAT-CN6 for tandem OLED

    International Nuclear Information System (INIS)

    Talik, N.A.; Yeoh, K.H.; Ng, C.Y.B.; Tan, C.Y.; Yap, B.K.

    2016-01-01

    We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN 6 has been used for tandem OLED. • The improvement attributes to the lower V bi and larger ΔV L in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.

  14. Methodology for assessing electric vehicle charging infrastructure business models

    OpenAIRE

    Madina, Carlos; Zamora, Inmaculada; Zabala, Eduardo

    2016-01-01

    The analysis of economic implications of innovative business models in networked environments, as electro-mobility is, requires a global approach to ensure that all the involved actors obtain a benefit. Although electric vehicles (EVs) provide benefits for the society as a whole, there are a number of hurdles for their widespread adoption, mainly the high investment cost for the EV and for the infrastructure. Therefore, a sound business model must be built up for charging service operators, w...

  15. Modeling the Electric Potential and Surface Charge Density near Charged Thunderclouds

    Science.gov (United States)

    Neel, Matthew Stephen

    2018-01-01

    Thundercloud charge separation, or the process by which the bottom portion of a cloud gathers charge and the top portion of the cloud gathers the opposite charge, is still not thoroughly understood. Whatever the mechanism, though, a charge separation definitely exists and can lead to electrostatic discharge via cloud-to-cloud lightning and…

  16. Investigation of multi-state charge-storage properties of redox-active organic molecules in silicon-molecular hybrid devices for DRAM and Flash applications

    Science.gov (United States)

    Gowda, Srivardhan Shivappa

    Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was

  17. Continuum model for chiral induced spin selectivity in helical molecules

    Energy Technology Data Exchange (ETDEWEB)

    Medina, Ernesto [Centro de Física, Instituto Venezolano de Investigaciones Científicas, 21827, Caracas 1020 A (Venezuela, Bolivarian Republic of); Groupe de Physique Statistique, Institut Jean Lamour, Université de Lorraine, 54506 Vandoeuvre-les-Nancy Cedex (France); Department of Chemistry and Biochemistry, Arizona State University, Tempe, Arizona 85287 (United States); González-Arraga, Luis A. [IMDEA Nanoscience, Cantoblanco, 28049 Madrid (Spain); Finkelstein-Shapiro, Daniel; Mujica, Vladimiro [Department of Chemistry and Biochemistry, Arizona State University, Tempe, Arizona 85287 (United States); Berche, Bertrand [Centro de Física, Instituto Venezolano de Investigaciones Científicas, 21827, Caracas 1020 A (Venezuela, Bolivarian Republic of); Groupe de Physique Statistique, Institut Jean Lamour, Université de Lorraine, 54506 Vandoeuvre-les-Nancy Cedex (France)

    2015-05-21

    A minimal model is exactly solved for electron spin transport on a helix. Electron transport is assumed to be supported by well oriented p{sub z} type orbitals on base molecules forming a staircase of definite chirality. In a tight binding interpretation, the spin-orbit coupling (SOC) opens up an effective π{sub z} − π{sub z} coupling via interbase p{sub x,y} − p{sub z} hopping, introducing spin coupled transport. The resulting continuum model spectrum shows two Kramers doublet transport channels with a gap proportional to the SOC. Each doubly degenerate channel satisfies time reversal symmetry; nevertheless, a bias chooses a transport direction and thus selects for spin orientation. The model predicts (i) which spin orientation is selected depending on chirality and bias, (ii) changes in spin preference as a function of input Fermi level and (iii) back-scattering suppression protected by the SO gap. We compute the spin current with a definite helicity and find it to be proportional to the torsion of the chiral structure and the non-adiabatic Aharonov-Anandan phase. To describe room temperature transport, we assume that the total transmission is the result of a product of coherent steps.

  18. Internal Structure of Charged Particles in a GRT Gravitational Model

    Science.gov (United States)

    Khlestkov, Yu. A.; Sukhanova, L. A.

    2018-05-01

    With the help of an exact solution of the Einstein and Maxwell equations, the internal structure of a multiply connected space of wormhole type with two unclosed static throats leading out of it into two parallel vacuum spaces or into one space is investigated in GRT for a free electric field and dust-like matter. The given geometry is considered as a particle-antiparticle pair with fundamental constants arising in the form of first integrals in the solution of the Cauchy problem - electric charges ±e of opposite sign in the throats and rest mass m0 - the total gravitational mass of the inner world of the particle in the throat. With the help of the energy conservation law, the unremovable rotation of the internal structure is included and the projection of the angular momentum of which onto the rotation axis is identified with the z-projection of the spin of the charged particle. The radius of 2-Gaussian curvature of the throat R* is identified with the charge radius of the particle, and the z-projection of the magnetic moment and the g-factor are found. The feasibility of the given gravitational model is confirmed by the found condition of independence of the spin quantum number of the electron and the proton s = 1/2 of the charge radius R* and the relativistic rest mass m* of the rotating throat, which is reliably confirmed experimentally, and also by the coincidence with high accuracy of the proton radius calculated in the model R*p = 0.8412·10-13 cm with the value of the proton charge radius obtained experimentally by measuring the Lamb shift on muonic hydrogen. The electron in the given model also turns out to be a structured particle with radius R*e = 3.8617·10-11 cm.

  19. A preon model with hidden electric and magnetic type charges

    International Nuclear Information System (INIS)

    Pati, J.C.; Strathdee, J.

    1980-11-01

    The U(1) x U(1) binding forces in an earlier preonic composite model of quarks and leptons are interpreted as arising from hidden electric and magnetic type charges. The preons may possess intrinsic spin zero; the half-integer spins of the composites being contributed by the force field. The quark-lepton gauge symmetry is interpreted as an effective low-energy symmetry arising at the composite level. Some remarks are made regarding the possible composite nature of the graviton. (author)

  20. Evidence for excited state intramolecular charge transfer reaction in donor-acceptor molecule 5-(4-dimethylamino-phenyl)-penta-2,4-dienoic acid methyl ester: Experimental and quantum chemical approach

    International Nuclear Information System (INIS)

    Kumar Paul, Bijan; Samanta, Anuva; Kar, Samiran; Guchhait, Nikhil

    2010-01-01

    Intramolecular charge transfer (ICT) reaction has been investigated in 5-(4-dimethylamino-phenyl)-penta-2,4-dienoic acid methyl ester (DPDAME) using spectroscopic techniques. The molecule DPDAME shows local emission in non-polar solvent and dual emission in polar solvents. Solvatochromic effects on the Stokes shifted emission band clearly demonstrate the charge transfer character of the excited state. Quantum chemical calculations have been performed at Hartree-Fock (HF) and density functional theoretical (DFT) levels to correlate the experimental findings. Potential energy curves (PECs) for the ICT reaction have been evaluated along the donor twist angle at DFT and time dependent density functional theory (TDDFT) levels for the ground and excited states, respectively, using B3LYP hybrid functional and 6-31G** basis set. The solvent effects on the spectral properties have been explored theoretically at the same level with time dependent density functional theory-polarized continuum model (TDDFT-PCM) and the theoretical results are found to well substantiate the solvent polarity dependent Stokes shifted emission of DPDAME. Huge enhancement of dipole moment (Δμ=16.42 D) of the molecule following photoexcitation dictates the highly polar character of the excited state. Although elucidation of PECs does not exactly predict the operation of ICT according to twisted intramolecular charge transfer (TICT) model in DPDAME, lowering of vertical transition energy as a function of the donor twist coordinate scripts the occurrence of red shifted emission as observed experimentally.

  1. Charge-Spot Model for Electrostatic Forces in Simulation of Fine Particulates

    Science.gov (United States)

    Walton, Otis R.; Johnson, Scott M.

    2010-01-01

    The charge-spot technique for modeling the static electric forces acting between charged fine particles entails treating electric charges on individual particles as small sets of discrete point charges, located near their surfaces. This is in contrast to existing models, which assume a single charge per particle. The charge-spot technique more accurately describes the forces, torques, and moments that act on triboelectrically charged particles, especially image-charge forces acting near conducting surfaces. The discrete element method (DEM) simulation uses a truncation range to limit the number of near-neighbor charge spots via a shifted and truncated potential Coulomb interaction. The model can be readily adapted to account for induced dipoles in uncharged particles (and thus dielectrophoretic forces) by allowing two charge spots of opposite signs to be created in response to an external electric field. To account for virtual overlap during contacts, the model can be set to automatically scale down the effective charge in proportion to the amount of virtual overlap of the charge spots. This can be accomplished by mimicking the behavior of two real overlapping spherical charge clouds, or with other approximate forms. The charge-spot method much more closely resembles real non-uniform surface charge distributions that result from tribocharging than simpler approaches, which just assign a single total charge to a particle. With the charge-spot model, a single particle may have a zero net charge, but still have both positive and negative charge spots, which could produce substantial forces on the particle when it is close to other charges, when it is in an external electric field, or when near a conducting surface. Since the charge-spot model can contain any number of charges per particle, can be used with only one or two charge spots per particle for simulating charging from solar wind bombardment, or with several charge spots for simulating triboelectric charging

  2. A model with charges and polarizability for CS2 in an ionic liquid

    Indian Academy of Sciences (India)

    RUTH M LYNDEN-BELL

    the static electrostatic distribution in the CS2 molecule with 7 charged sites and anisotropic polarizability on the carbon site and isotropic .... the charges modified to reproduce the molecular quad- ... face at 1.5 times the van der Waals radii from the nuclei ..... shows the probability distribution of induced dipoles on the C site ...

  3. Percolation model for electron conduction in films of metal nanoparticles linked by organic molecules

    International Nuclear Information System (INIS)

    Muller, K.H.; Herrmann, J.; Raguse, B.; Baxter, G.; Reda, T.

    2002-01-01

    Full text: We have investigated theoretically and experimentally the temperature dependence of the conductance of films of Au nanoparticles linked by alkane dithiol molecules in the temperature range between 5 K and 300 K. Conduction in these films is due to tunneling of single electrons between neighbouring metal nanoparticles. During tunnelling an electron has to overcome the Coulomb charging energy. We find that the observed temperature dependence of the conductance is non-Arrhenius like and can be described in terms of a percolation theory which takes account of disorder in the system. Disorder in our nanoparticle films is caused by variations in the nanoparticle size, fluctuations in the separation gaps between adjacent nanoparticles and by offset charges. To explain in detail our experimental data, a wide distribution of separation gaps and charging energies is needed. We find that a wide Coulomb charging energy distribution can arise from random offset charges even if the nanoparticle size distribution is narrow

  4. Supercooled liquid dynamics for the charged hard-sphere model

    International Nuclear Information System (INIS)

    Lai, S.K.; Chang, S.Y.

    1994-08-01

    We study the dynamics of supercooled liquid and the liquid-glass transition by applying the mode coupling theory to the charged hard-sphere model. By exploiting the two independent parameters inherent in the charged hard-sphere system we examine structurally the subtle and competitive role played by the short-range hard-core correlation and the long-range Coulomb tail. It is found in this work that the long-range Coulombic charge factor effect is generally a less effective contribution to structure when the plasma parameter is less than 500 and becomes dominant when it is greater thereof. To extend our understanding of the supercooled liquid and the liquid-glass transition, an attempt is made to calculate and to give physical relevance to the mode-coupling parameters which are frequently used as mere fitting parameters in analysis of experiments on supercooled liquid systems. This latter information enables us to discuss the possible application of the model to a realistic system. (author). 22 refs, 4 figs

  5. On well-posedness of variational models of charged drops.

    Science.gov (United States)

    Muratov, Cyrill B; Novaga, Matteo

    2016-03-01

    Electrified liquids are well known to be prone to a variety of interfacial instabilities that result in the onset of apparent interfacial singularities and liquid fragmentation. In the case of electrically conducting liquids, one of the basic models describing the equilibrium interfacial configurations and the onset of instability assumes the liquid to be equipotential and interprets those configurations as local minimizers of the energy consisting of the sum of the surface energy and the electrostatic energy. Here we show that, surprisingly, this classical geometric variational model is mathematically ill-posed irrespective of the degree to which the liquid is electrified. Specifically, we demonstrate that an isolated spherical droplet is never a local minimizer, no matter how small is the total charge on the droplet, as the energy can always be lowered by a smooth, arbitrarily small distortion of the droplet's surface. This is in sharp contrast to the experimental observations that a critical amount of charge is needed in order to destabilize a spherical droplet. We discuss several possible regularization mechanisms for the considered free boundary problem and argue that well-posedness can be restored by the inclusion of the entropic effects resulting in finite screening of free charges.

  6. A Unified Channel Charges Expression for Analytic MOSFET Modeling

    Directory of Open Access Journals (Sweden)

    Hugues Murray

    2012-01-01

    Full Text Available Based on a 1D Poissons equation resolution, we present an analytic model of inversion charges allowing calculation of the drain current and transconductance in the Metal Oxide Semiconductor Field Effect Transistor. The drain current and transconductance are described by analytical functions including mobility corrections and short channel effects (CLM, DIBL. The comparison with the Pao-Sah integral shows excellent accuracy of the model in all inversion modes from strong to weak inversion in submicronics MOSFET. All calculations are encoded with a simple C program and give instantaneous results that provide an efficient tool for microelectronics users.

  7. Modeling Framework and Results to Inform Charging Infrastructure Investments

    Energy Technology Data Exchange (ETDEWEB)

    Melaina, Marc W [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Wood, Eric W [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-09-01

    The plug-in electric vehicle (PEV) market is experiencing rapid growth with dozens of battery electric (BEV) and plug-in hybrid electric (PHEV) models already available and billions of dollars being invested by automotive manufacturers in the PEV space. Electric range is increasing thanks to larger and more advanced batteries and significant infrastructure investments are being made to enable higher power fast charging. Costs are falling and PEVs are becoming more competitive with conventional vehicles. Moreover, new technologies such as connectivity and automation hold the promise of enhancing the value proposition of PEVs. This presentation outlines a suite of projects funded by the U.S. Department of Energy's Vehicle Technology Office to conduct assessments of the economic value and charging infrastructure requirements of the evolving PEV market. Individual assessments include national evaluations of PEV economic value (assuming 73M PEVs on the road in 2035), national analysis of charging infrastructure requirements (with community and corridor level resolution), and case studies of PEV ownership in Columbus, OH and Massachusetts.

  8. Neuroprotective Properties of Mildronate, a Small Molecule, in a Rat Model of Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Harry V. Vinters

    2010-11-01

    Full Text Available Previously, we have found that mildronate [3-(2,2,2-trimethylhydrazinium propionate dihydrate], a small molecule with charged nitrogen and oxygen atoms, protects mitochondrial metabolism that is altered by inhibitors of complex I and has neuroprotective effects in an azidothymidine-neurotoxicity mouse model. In the present study, we investigated the effects of mildronate in a rat model of Parkinson’s disease (PD that was generated via a unilateral intrastriatal injection of the neurotoxin 6-hydroxydopamine (6‑OHDA. We assessed the expression of cell biomarkers that are involved in signaling cascades and provide neural and glial integration: the neuronal marker TH (tyrosine hydroxylase; ubiquitin (a regulatory peptide involved in the ubiquitin-proteasome degradation system; Notch-3 (a marker of progenitor cells; IBA-1 (a marker of microglial cells; glial fibrillary acidic protein, GFAP (a marker of astrocytes; and inducible nitric oxide synthase, iNOS (a marker of inflammation. The data show that in the 6-OHDA-lesioned striatum, mildronate completely prevented the loss of TH, stimulated Notch-3 expression and decreased the expression of ubiquitin, GFAP and iNOS. These results provide evidence for the ability of mildronate to control the expression of an array of cellular proteins and, thus, impart multi-faceted homeostatic mechanisms in neurons and glial cells in a rat model of PD. We suggest that the use of mildronate provides a protective effect during the early stages of PD that can delay or halt the progression of this neurodegenerative disease.

  9. Relationship of the Williams-Poulios and Manning-Rosen Potential Energy Models for Diatomic Molecules

    Science.gov (United States)

    Jia, Chun-Sheng; Liang, Guang-Chuan; Peng, Xiao-Long; Tang, Hong-Ming; Zhang, Lie-Hui

    2014-06-01

    By employing the dissociation energy and the equilibrium bond length for a diatomic molecule as explicit parameters, we generate an improved form of the Williams-Poulios potential energy model. It is found that the negative Williams-Poulios potential model is equivalent to the Manning-Rosen potential model for diatomic molecules. We observe that the Manning-Rosen potential is superior to the Morse potential in reproducing the interaction potential energy curves for the {{a}3 Σu+} state of the 6Li2 molecule and the {{X}1 sum+} state of the SiF+ molecule.

  10. Study on Impact of Electric Vehicles Charging Models on Power Load

    Science.gov (United States)

    Cheng, Chen; Hui-mei, Yuan

    2017-05-01

    With the rapid increase in the number of electric vehicles, which will lead the power load on grid increased and have an adversely affect. This paper gives a detailed analysis of the following factors, such as scale of the electric cars, charging mode, initial charging time, initial state of charge, charging power and other factors. Monte Carlo simulation method is used to compare the two charging modes, which are conventional charging and fast charging, and MATLAB is used to model and simulate the electric vehicle charging load. The results show that compared with the conventional charging mode, fast charging mode can meet the requirements of fast charging, but also bring great load to the distribution network which will affect the reliability of power grid.

  11. Chemically Aware Model Builder (camb): an R package for property and bioactivity modelling of small molecules.

    Science.gov (United States)

    Murrell, Daniel S; Cortes-Ciriano, Isidro; van Westen, Gerard J P; Stott, Ian P; Bender, Andreas; Malliavin, Thérèse E; Glen, Robert C

    2015-01-01

    In silico predictive models have proved to be valuable for the optimisation of compound potency, selectivity and safety profiles in the drug discovery process. camb is an R package that provides an environment for the rapid generation of quantitative Structure-Property and Structure-Activity models for small molecules (including QSAR, QSPR, QSAM, PCM) and is aimed at both advanced and beginner R users. camb's capabilities include the standardisation of chemical structure representation, computation of 905 one-dimensional and 14 fingerprint type descriptors for small molecules, 8 types of amino acid descriptors, 13 whole protein sequence descriptors, filtering methods for feature selection, generation of predictive models (using an interface to the R package caret), as well as techniques to create model ensembles using techniques from the R package caretEnsemble). Results can be visualised through high-quality, customisable plots (R package ggplot2). Overall, camb constitutes an open-source framework to perform the following steps: (1) compound standardisation, (2) molecular and protein descriptor calculation, (3) descriptor pre-processing and model training, visualisation and validation, and (4) bioactivity/property prediction for new molecules. camb aims to speed model generation, in order to provide reproducibility and tests of robustness. QSPR and proteochemometric case studies are included which demonstrate camb's application.Graphical abstractFrom compounds and data to models: a complete model building workflow in one package.

  12. Pore Polarity and Charge Determine Differential Block of Kir1.1 and Kir7.1 Potassium Channels by Small-Molecule Inhibitor VU590.

    Science.gov (United States)

    Kharade, Sujay V; Sheehan, Jonathan H; Figueroa, Eric E; Meiler, Jens; Denton, Jerod S

    2017-09-01

    VU590 was the first publicly disclosed, submicromolar-affinity (IC 50 = 0.2 μ M), small-molecule inhibitor of the inward rectifier potassium (Kir) channel and diuretic target, Kir1.1. VU590 also inhibits Kir7.1 (IC 50 ∼ 8 μ M), and has been used to reveal new roles for Kir7.1 in regulation of myometrial contractility and melanocortin signaling. Here, we employed molecular modeling, mutagenesis, and patch clamp electrophysiology to elucidate the molecular mechanisms underlying VU590 inhibition of Kir1.1 and Kir7.1. Block of both channels is voltage- and K + -dependent, suggesting the VU590 binding site is located within the pore. Mutagenesis analysis in Kir1.1 revealed that asparagine 171 (N171) is the only pore-lining residue required for high-affinity block, and that substituting negatively charged residues (N171D, N171E) at this position dramatically weakens block. In contrast, substituting a negatively charged residue at the equivalent position in Kir7.1 enhances block by VU590, suggesting the VU590 binding mode is different. Interestingly, mutations of threonine 153 (T153) in Kir7.1 that reduce constrained polarity at this site (T153C, T153V, T153S) make wild-type and binding-site mutants (E149Q, A150S) more sensitive to block by VU590. The Kir7.1-T153C mutation enhances block by the structurally unrelated inhibitor VU714 but not by a higher-affinity analog ML418, suggesting that the polar side chain of T153 creates a barrier to low-affinity ligands that interact with E149 and A150. Reverse mutations in Kir1.1 suggest that this mechanism is conserved in other Kir channels. This study reveals a previously unappreciated role of membrane pore polarity in determination of Kir channel inhibitor pharmacology. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

  13. Model Hamiltonian Calculations of the Nonlinear Polarizabilities of Conjugated Molecules.

    Science.gov (United States)

    Risser, Steven Michael

    This dissertation advances the theoretical knowledge of the nonlinear polarizabilities of conjugated molecules. The unifying feature of these molecules is an extended delocalized pi electron structure. The pi electrons dominate the electronic properties of the molecules, allowing prediction of molecular properties based on the treatment of just the pi electrons. Two separate pi electron Hamiltonians are used in the research. The principal Hamiltonian used is the non-interacting single-particle Huckel Hamiltonian, which replaces the Coulomb interaction among the pi electrons with a mean field interaction. The simplification allows for exact solution of the Hamiltonian for large molecules. The second Hamiltonian used for this research is the interacting multi-particle Pariser-Parr-Pople (PPP) Hamiltonian, which retains explicit Coulomb interactions. This limits exact solutions to molecules containing at most eight electrons. The molecular properties being investigated are the linear polarizability, and the second and third order hyperpolarizabilities. The hyperpolarizabilities determine the nonlinear optical response of materials. These molecular parameters are determined by two independent approaches. The results from the Huckel Hamiltonian are obtained through first, second and third order perturbation theory. The results from the PPP Hamiltonian are obtained by including the applied field directly in the Hamiltonian and determining the ground state energy at a series of field strengths. By fitting the energy to a polynomial in field strength, the polarizability and hyperpolarizabilities are determined. The Huckel Hamiltonian is used to calculate the third order hyperpolarizability of polyenes. These calculations were the first to show the average hyperpolarizability of the polyenes to be positive, and also to show the saturation of the hyperpolarizability. Comparison of these Huckel results to those from the PPP Hamiltonian shows the lack of explicit Coulomb

  14. Adsorption behavior of n-butanol molecules on negatively charged surfaces of electrodes of mercury, gallium, and alloys In-Ga and Tl-Ga

    International Nuclear Information System (INIS)

    Damskin, B.B.; Baturina, O.A.; Vasil'ev, S.Yu.; Emets, V.V.; Kazarinov, V.E.

    1999-01-01

    Curves of differential capacitance in the interfaces Hg/H 2 O, Ga/H 2 O, (In-Ga)/H 2 O and (Tl-Ga)H 2 O in 0.05 M Na 2 SO 4 solutions with different additions of n-butanol have been obtained by the bridge method at a frequency of 420 Hz and temperature of 32 deg C. The method of regression analysis of the curves permitted ascertaining the adsorption parameters of n-butanol for the range of charges q, where there is no chemisorption of H 2 O dipoles. The data obtained suggested that the difference in the adsorption behaviour of organic molecules on the metals studied in the range of higher negative charges is largely determined by different electron electrochemical work functions, the definition being given by S. Trasatti [ru

  15. Thermal Models of the Niger Delta: Implications for Charge Modelling

    International Nuclear Information System (INIS)

    Ejedawe, J.

    2002-01-01

    There are generally three main sources of temperature data-BHT data from log headers, production temperature data, and continuo's temperature logs. Analysis of continuous temperature profiles of over 100 wells in the Niger Delta two main thermal models (single leg and dogleg) are defined with occasional occurrence of a modified dogleg model.The dogleg model is characterised by a shallow interval of low geothermal gradient ( 3.0.C/100m). This is characteristically developed onshore area is simple, requiring only consideration of heat transients, modelling in the onshore require modelling programmes with built in modules to handle convective heat flow dissipation in the shallow layer. Current work around methods would involve tweaking of thermal conductivity values to mimic the underlying heat flow process effects, or heat flow mapping above and below the depth of gradient change. These methods allow for more realistic thermal modelling, hydrocarbon type prediction, and also more accurate prediction of temperature prior to drilling and for reservoir rock properties. The regional distribution of the models also impact on regional hydrocarbon distribution pattern in the Niger Delta

  16. Image charge effects in single-molecule junctions: Breaking of symmetries and negative-differential resistance in a benzene single-electron transistor

    DEFF Research Database (Denmark)

    Kaasbjerg, Kristen; Flensberg, K.

    2011-01-01

    and molecular symmetries remain unclear. Using a theoretical framework developed for semiconductor-nanostructure-based single-electron transistors (SETs), we demonstrate that the image charge interaction breaks the molecular symmetries in a benzene-based single-molecule transistor operating in the Coulomb...... blockade regime. This results in the appearance of a so-called blocking state, which gives rise to negative-differential resistance (NDR). We show that the appearance of NDR and its magnitude in the symmetry-broken benzene SET depends in a complicated way on the interplay between the many-body matrix...

  17. A Massless-Point-Charge Model for the Electron

    Directory of Open Access Journals (Sweden)

    Daywitt W. C.

    2010-04-01

    Full Text Available “It is rather remarkable that the modern concept of electrodynamics is not quite 100 years old and yet still does not rest firmly upon uniformly accepted theoretical foun- dations. Maxwell’s theory of the electromagnetic field is firmly ensconced in modern physics, to be sure, but the details of how charged particles are to be coupled to this field remain somewhat uncertain, despite the enormous advances in quantum electrody- namics over the past 45 years. Our theories remain mathematically ill-posed and mired in conceptual ambiguities which quantum mechanics has only moved to another arena rather than resolve. Fundamentally, we still do not understand just what is a charged particle” [1, p.367]. As a partial answer to the preceeding quote, this paper presents a new model for the electron that combines the seminal work of Puthoff [2] with the theory of the Planck vacuum (PV [3], the basic idea for the model following from [2] with the PV theory adding some important details.

  18. A Massless-Point-Charge Model for the Electron

    Directory of Open Access Journals (Sweden)

    Daywitt W. C.

    2010-04-01

    Full Text Available "It is rather remarkable that the modern concept of electrodynamics is not quite 100 years old and yet still does not rest firmly upon uniformly accepted theoretical foundations. Maxwell's theory of the electromagnetic field is firmly ensconced in modern physics, to be sure, but the details of how charged particles are to be coupled to this field remain somewhat uncertain, despite the enormous advances in quantum electrodynamics over the past 45 years. Our theories remain mathematically ill-posed and mired in conceptual ambiguities which quantum mechanics has only moved to another arena rather than resolve. Fundamentally, we still do not understand just what is a charged particle" (Grandy W.T. Jr. Relativistic quantum mechanics of leptons and fields. Kluwer Academic Publishers, Dordrecht-London, 1991, p.367. As a partial answer to the preceeding quote, this paper presents a new model for the electron that combines the seminal work of Puthoff with the theory of the Planck vacuum (PV, the basic idea for the model following from Puthoff with the PV theory adding some important details.

  19. Charge transport models for reliability engineering of semiconductor devices

    International Nuclear Information System (INIS)

    Bina, M.

    2014-01-01

    The simulation of semiconductor devices is important for the assessment of device lifetimes before production. In this context, this work investigates the influence of the charge carrier transport model on the accuracy of bias temperature instability and hot-carrier degradation models in MOS devices. For this purpose, a four-state defect model based on a non-radiative multi phonon (NMP) theory is implemented to study the bias temperature instability. However, the doping concentrations typically used in nano-scale devices correspond to only a small number of dopants in the channel, leading to fluctuations of the electrostatic potential. Thus, the granularity of the doping cannot be ignored in these devices. To study the bias temperature instability in the presence of fluctuations of the electrostatic potential, the advanced drift diffusion device simulator Minimos-NT is employed. In a first effort to understand the bias temperature instability in p-channel MOSFETs at elevated temperatures, data from direct-current-current-voltage measurements is successfully reproduced using a four-state defect model. Differences between the four-state defect model and the commonly employed trapping model from Shockley, Read and Hall (SRH) have been investigated showing that the SRH model is incapable of reproducing the measurement data. This is in good agreement with the literature, where it has been extensively shown that a model based on SRH theory cannot reproduce the characteristic time constants found in BTI recovery traces. Upon inspection of recorded recovery traces after bias temperature stress in n-channel MOSFETs it is found that the gate current is strongly correlated with the drain current (recovery trace). Using a random discrete dopant model and non-equilibrium greens functions it is shown that direct tunnelling cannot explain the magnitude of the gate current reduction. Instead it is found that trap-assisted tunnelling, modelled using NMP theory, is the cause of this

  20. Surface functionalization of bioactive glasses with natural molecules of biological significance, Part I: Gallic acid as model molecule

    Science.gov (United States)

    Zhang, Xin; Ferraris, Sara; Prenesti, Enrico; Verné, Enrica

    2013-12-01

    Gallic acid (3,4,5-trihydroxybenzoic acid, GA) and its derivatives are a group of biomolecules (polyphenols) obtained from plants. They have effects which are potentially beneficial to heath, for example they are antioxidant, anticarcinogenic and antibacterial, as recently investigated in many fields such as medicine, food and plant sciences. The main drawbacks of these molecules are both low stability and bioavailability. In this research work the opportunity to graft GA to bioactive glasses is investigated, in order to deliver the undamaged biological molecule into the body, using the biomaterial surfaces as a localized carrier. GA was considered for functionalization since it is a good model molecule for polyphenols and presents several interesting biological activities, like antibacterial, antioxidant and anticarcinogenic properties. Two different silica based bioactive glasses (SCNA and CEL2), with different reactivity, were employed as substrates. UV photometry combined with the Folin&Ciocalteu reagent was adopted to test the concentration of GA in uptake solution after functionalization. This test verified how much GA consumption occurred with surface modification and it was also used on solid samples to test the presence of GA on functionalized glasses. XPS and SEM-EDS techniques were employed to characterize the modification of material surface properties and functional group composition before and after functionalization.

  1. Generalized one-loop neutrino mass model with charged particles

    Science.gov (United States)

    Cheung, Kingman; Okada, Hiroshi

    2018-04-01

    We propose a radiative neutrino-mass model by introducing 3 generations of fermion pairs E-(N +1 )/2E+(N +1 )/2 and a couple of multicharged bosonic doublet fields ΦN /2,ΦN /2 +1, where N =1 , 3, 5, 7, 9. We show that the models can satisfy the neutrino masses and oscillation data, and are consistent with lepton-flavor violations, the muon anomalous magnetic moment, the oblique parameters, and the beta function of the U (1 )Y hypercharge gauge coupling. We also discuss the collider signals for various N , namely, multicharged leptons in the final state from the Drell-Yan production of E-(N +1 )/2E+(N +1 )/2. In general, the larger the N the more charged leptons will appear in the final state.

  2. Accurate Online Full Charge Capacity Modeling of Smartphone Batteries

    OpenAIRE

    Hoque, Mohammad A.; Siekkinen, Matti; Koo, Jonghoe; Tarkoma, Sasu

    2016-01-01

    Full charge capacity (FCC) refers to the amount of energy a battery can hold. It is the fundamental property of smartphone batteries that diminishes as the battery ages and is charged/discharged. We investigate the behavior of smartphone batteries while charging and demonstrate that the battery voltage and charging rate information can together characterize the FCC of a battery. We propose a new method for accurately estimating FCC without exposing low-level system details or introducing new ...

  3. Discrete element method modeling of the triboelectric charging of polyethylene particles: Can particle size distribution and segregation reduce the charging?

    International Nuclear Information System (INIS)

    Konopka, Ladislav; Kosek, Juraj

    2015-01-01

    Polyethylene particles of various sizes are present in industrial gas-dispersion reactors and downstream processing units. The contact of the particles with a device wall as well as the mutual particle collisions cause electrons on the particle surface to redistribute in the system. The undesirable triboelectric charging results in several operational problems and safety risks in industrial systems, for example in the fluidized-bed polymerization reactor. We studied the charging of polyethylene particles caused by the particle-particle interactions in gas. Our model employs the Discrete Element Method (DEM) describing the particle dynamics and incorporates the ‘Trapped Electron Approach’ as the physical basis for the considered charging mechanism. The model predicts the particle charge distribution for systems with various particle size distributions and various level of segregation. Simulation results are in a qualitative agreement with experimental observations of similar particulate systems specifically in two aspects: 1) Big particles tend to gain positive charge and small particles the negative one. 2) The wider the particle size distribution is, the more pronounced is the charging process. Our results suggest that not only the size distribution, but also the effect of the spatial segregation of the polyethylene particles significantly influence the resulting charge distribution ‘generated’ in the system. The level of particle segregation as well as the particle size distribution of polyethylene particles can be in practice adjusted by the choice of supported catalysts, by the conditions in the fluidized-bed polymerization reactor and by the fluid dynamics. We also attempt to predict how the reactor temperature affects the triboelectric charging of particles. (paper)

  4. Conical Intersections, charge localization, and photoisomerization pathway selection in a minimal model of a degenerate monomethine dye

    International Nuclear Information System (INIS)

    Olsen, Seth; McKenzie, Ross H.

    2009-01-01

    We propose a minimal model Hamiltonian for the electronic structure of a monomethine dye, in order to describe the photoisomerization of such dyes. The model describes interactions between three diabatic electronic states, each of which can be associated with a valence bond structure. Monomethine dyes are characterized by a charge-transfer resonance; the indeterminacy of the single-double bonding structure dictated by the resonance is reflected in a duality of photoisomerization pathways corresponding to the different methine bonds. The possible multiplicity of decay channels complicates mechanistic models of the effect of the environment on fluorescent quantum yields, as well as coherent control strategies. We examine the extent and topology of intersection seams between the electronic states of the dye and how they relate to charge localization and selection between different decay pathways. We find that intersections between the S 1 and S 0 surfaces only occur for large twist angles. In contrast, S 2 /S 1 intersections can occur near the Franck-Condon region. When the molecule has left-right symmetry, all intersections are associated with con- or disrotations and never with single bond twists. For asymmetric molecules (i.e., where the bridge couples more strongly to one end) the S 2 and S 1 surfaces bias torsion about different bonds. Charge localization and torsion pathway biasing are correlated. We relate our observations with several recent experimental and theoretical results, which have been obtained for dyes with similar structure.

  5. Electric vehicle charge planning using Economic Model Predictive Control

    DEFF Research Database (Denmark)

    Halvgaard, Rasmus; Poulsen, Niels K.; Madsen, Henrik

    2012-01-01

    Economic Model Predictive Control (MPC) is very well suited for controlling smart energy systems since electricity price and demand forecasts are easily integrated in the controller. Electric vehicles (EVs) are expected to play a large role in the future Smart Grid. They are expected to provide...... grid services, both for peak reduction and for ancillary services, by absorbing short term variations in the electricity production. In this paper the Economic MPC minimizes the cost of electricity consumption for a single EV. Simulations show savings of 50–60% of the electricity costs compared...... to uncontrolled charging from load shifting based on driving pattern predictions. The future energy system in Denmark will most likely be based on renewable energy sources e.g. wind and solar power. These green energy sources introduce stochastic fluctuations in the electricity production. Therefore, energy...

  6. VR-SCOSMO: A smooth conductor-like screening model with charge-dependent radii for modeling chemical reactions.

    Science.gov (United States)

    Kuechler, Erich R; Giese, Timothy J; York, Darrin M

    2016-04-28

    To better represent the solvation effects observed along reaction pathways, and of ionic species in general, a charge-dependent variable-radii smooth conductor-like screening model (VR-SCOSMO) is developed. This model is implemented and parameterized with a third order density-functional tight binding quantum model, DFTB3/3OB-OPhyd, a quantum method which was developed for organic and biological compounds, utilizing a specific parameterization for phosphate hydrolysis reactions. Unlike most other applications with the DFTB3/3OB model, an auxiliary set of atomic multipoles is constructed from the underlying DFTB3 density matrix which is used to interact the solute with the solvent response surface. The resulting method is variational, produces smooth energies, and has analytic gradients. As a baseline, a conventional SCOSMO model with fixed radii is also parameterized. The SCOSMO and VR-SCOSMO models shown have comparable accuracy in reproducing neutral-molecule absolute solvation free energies; however, the VR-SCOSMO model is shown to reduce the mean unsigned errors (MUEs) of ionic compounds by half (about 2-3 kcal/mol). The VR-SCOSMO model presents similar accuracy as a charge-dependent Poisson-Boltzmann model introduced by Hou et al. [J. Chem. Theory Comput. 6, 2303 (2010)]. VR-SCOSMO is then used to examine the hydrolysis of trimethylphosphate and seven other phosphoryl transesterification reactions with different leaving groups. Two-dimensional energy landscapes are constructed for these reactions and calculated barriers are compared to those obtained from ab initio polarizable continuum calculations and experiment. Results of the VR-SCOSMO model are in good agreement in both cases, capturing the rate-limiting reaction barrier and the nature of the transition state.

  7. Detecting and identifying small molecules in a nanopore flux capacitor

    International Nuclear Information System (INIS)

    Bearden, Samuel; Zhang, Guigen; McClure, Ethan

    2016-01-01

    A new method of molecular detection in a metallic-semiconductor nanopore was developed and evaluated with experimental and computational methods. Measurements were made of the charging potential of the electrical double layer (EDL) capacitance as charge-carrying small molecules translocated the nanopore. Signals in the charging potential were found to be correlated to the physical properties of analyte molecules. From the measured signals, we were able to distinguish molecules with different valence charge or similar valence charge but different size. The relative magnitude of the signals from different analytes was consistent over a wide range of experimental conditions, suggesting that the detected signals are likely due to single molecules. Computational modeling of the nanopore system indicated that the double layer potential signal may be described in terms of disruption of the EDL structure due to the size and charge of the analyte molecule, in agreement with Huckel and Debye’s analysis of the electrical atmosphere of electrolyte solutions. (paper)

  8. Redox-Active Star Molecules Incorporating the 4-Benzoylpyridinium Cation - Implications for the Charge Transfer Along Branches vs. Across the Perimeter in Dendrimer

    Science.gov (United States)

    Leventis, Nicholas; Yang, Jinua; Fabrizio,Even F.; Rawashdeh, Abdel-Monem M.; Oh, Woon Su; Sotiriou-Leventis, Chariklia

    2004-01-01

    Dendrimers are self-repeating globular branched star molecules, whose fractal structure continues to fascinate, challenge, and inspire. Functional dendrimers may incorporate redox centers, and potential applications include antennae molecules for light harvesting, sensors, mediators, and artificial biomolecules. We report the synthesis and redox properties of four star systems incorporating the 4-benzoyl-N-alkylpyridinium cation; the redox potential varies along the branches but remains constant at fixed radii. Bulk electrolysis shows that at a semi-infinite time scale all redox centers are electrochemically accessible. However, voltammetric analysis (cyclic voltammetry and differential pulse voltammetry) shows that on1y two of the three redox-active centers in the perimeter are electrochemically accessible during potential sweeps as slow as 20 mV/s and as fast as 10 V/s. On the contrary, both redox centers along branches are accessible electrochemically within the same time frame. These results are explained in terms of slow through-space charge transfer and the globular 3-D folding of the molecules and are discussed in terms of their implications on the design of efficient redox functional dendrimers.

  9. Evidences from electron momentum spectroscopy for ultra-fast charge transfers and structural reorganizations in a floppy molecule: Ethanol

    International Nuclear Information System (INIS)

    Deleuze, Michael S; Hajgato, Balazs; Morini, Filippo

    2009-01-01

    Calculations of electron momentum distributions employing advanced Dyson orbital theories and statistical thermodynamics beyond the RRHO approximation fail to quantitatively reproduce the outermost momentum profile inferred from experiments on ethanol employing high resolution Electron Momentum Spectroscopy [1]. Study of the influence of nuclear dynamics in the initial ground state and final ionized state indicates that this discrepancy between theory and experiment reflects a charge transfer occurring during an ultra-fast dissociation of the ethanol radical cation into a methyl radical and H 2 C=O-H + .

  10. Model for competitive binary and ternary ion-molecule reactions

    International Nuclear Information System (INIS)

    Herbst, E.

    1985-01-01

    A mechanism by which competitive binary and ternary ion-molecule reactions can occur is proposed. Calculations are undertaken for the specific system CH3(+) + NH3 + He which has been studied in the laboratory by Smith and Adams (1978), and the potential surface of which has been studied theoretically by Nobes and Radom (1983). It is shown that a potential-energy barrier in the exit channel prevents the rapid dissociation of collision complexes with large amounts of angular momentum and thereby allows collisional stabilization of the complexes. The calculated ternary-reaction rate coefficient is in good agreement with the experimental value, but a plot of the effective two-body rate coefficient of the ternary channel vs helium density does not quite show the observed saturation. 21 references

  11. Modeling track access charge to enhance railway industry performance

    Science.gov (United States)

    Berawi, Mohammed Ali; Miraj, Perdana; Berawi, Abdur Rohim Boy; Susantono, Bambang; Leviakangas, Pekka; Radiansyah, Hendra

    2017-11-01

    Indonesia attempts to improve nation's competitiveness by increasing the quality and the availability of railway network. However, the infrastructure improperly managed by the operator in terms of the technical issue. One of the reasons for this problem is an unbalanced value of infrastructure charge. In 2000's track access charge and infrastructure maintenance and operation for Indonesia railways are equal and despite current formula of the infrastructure charge, issues of transparency and accountability still in question. This research aims to produce an alternative scheme of track access charge by considering marginal cost plus markup (MC+) approach. The research combines qualitative and quantitative method through an in-depth interview and financial analysis. The result will generate alternative formula of infrastructure charge in Indonesia's railway industry. The simulation also conducted to estimate track access charge for the operator and to forecast government support in terms of subsidy. The result is expected to enhance railway industry performance and competitiveness.

  12. Discrete Charge Effects on an Infinitely Long Cylindrical Rod Model

    OpenAIRE

    Agung, Ahmad A. J; Jesudason, Christopher G.

    2011-01-01

    Two methods for determining the potential (\\psi) around a discretely charged rod have been devised. The methods utilize the potential around the continuously charged rod (\\bar{\\psi}) as the reference where \\bar{\\psi} isdetermined by the Poisson-Boltzmann equation. The potential data are used to determine the theoretical radial distribution function (RDF) which is compared with MD simulation data. It is shown that the magnitude of the charge and size parameters very strongly affects the shape ...

  13. Applications of the quasi-elastic light scattering to the study of dynamic properties of charged macro-molecules

    International Nuclear Information System (INIS)

    Gouesin-Menez, Renee

    1979-01-01

    The object of this research thesis is to study the modifications of dynamic properties of a macromolecule under the influence of variations of its medium, by using a frequency analysis of the spectrum of light scattered by a solution of particles. Thus, an important part of this thesis addresses the study and development of the scattering method and of its analysis by 'photon pulses', and the development and adjustment of an electrophoretic device to study light scattering by molecules submitted to an electric field. Then, hydrodynamic characteristics of some macromolecules have been measured with or without electric field. The studied molecular systems have been: calibrated spheres of latex polystyrene, a globular protein (bovine serum albumin), a polysaccharide (under the form of a rigid short stick), a flexible linear polyelectrolyte (polymethacrylate), and two DNA samples

  14. A radial distribution function-based open boundary force model for multi-centered molecules

    KAUST Repository

    Neumann, Philipp

    2014-06-01

    We derive an expression for radial distribution function (RDF)-based open boundary forcing for molecules with multiple interaction sites. Due to the high-dimensionality of the molecule configuration space and missing rotational invariance, a computationally cheap, 1D approximation of the arising integral expressions as in the single-centered case is not possible anymore. We propose a simple, yet accurate model invoking standard molecule- and site-based RDFs to approximate the respective integral equation. The new open boundary force model is validated for ethane in different scenarios and shows very good agreement with data from periodic simulations. © World Scientific Publishing Company.

  15. Modeling of charge transport in ion bipolar junction transistors.

    Science.gov (United States)

    Volkov, Anton V; Tybrandt, Klas; Berggren, Magnus; Zozoulenko, Igor V

    2014-06-17

    Spatiotemporal control of the complex chemical microenvironment is of great importance to many fields within life science. One way to facilitate such control is to construct delivery circuits, comprising arrays of dispensing outlets, for ions and charged biomolecules based on ionic transistors. This allows for addressability of ionic signals, which opens up for spatiotemporally controlled delivery in a highly complex manner. One class of ionic transistors, the ion bipolar junction transistors (IBJTs), is especially attractive for these applications because these transistors are functional at physiological conditions and have been employed to modulate the delivery of neurotransmitters to regulate signaling in neuronal cells. Further, the first integrated complementary ionic circuits were recently developed on the basis of these ionic transistors. However, a detailed understanding of the device physics of these transistors is still lacking and hampers further development of components and circuits. Here, we report on the modeling of IBJTs using Poisson's and Nernst-Planck equations and the finite element method. A two-dimensional model of the device is employed that successfully reproduces the main characteristics of the measurement data. On the basis of the detailed concentration and potential profiles provided by the model, the different modes of operation of the transistor are analyzed as well as the transitions between the different modes. The model correctly predicts the measured threshold voltage, which is explained in terms of membrane potentials. All in all, the results provide the basis for a detailed understanding of IBJT operation. This new knowledge is employed to discuss potential improvements of ion bipolar junction transistors in terms of miniaturization and device parameters.

  16. Spacecraft Charging Modeling -- Nascap-2k 2014 Annual Report

    Science.gov (United States)

    2014-09-19

    appears to work similarly in Internet Explorer, FireFox , and Opera, but fails in Safari and Chrome. Note that the SEE Spacecraft Charging Handbook is... Characteristics of Spacecraft Charging in Low Earth Orbit, J Geophys Res. 11 7, doi: 10.1029/20 11JA016875, 2012. 2 M. Cho, K. Saito, T. Hamanaga, Data

  17. Modeling Prosecutors' Charging Decisions in Domestic Violence Cases

    Science.gov (United States)

    Worrall, John L.; Ross, Jay W.; McCord, Eric S.

    2006-01-01

    Relatively little research explaining prosecutors' charging decisions in criminal cases is available. Even less has focused on charging decisions in domestic violence cases. Past studies have also relied on restrictive definitions of domestic violence, notably cases with male offenders and female victims, and they have not considered prosecutors'…

  18. Screening model for nanowire surface-charge sensors in liquid

    DEFF Research Database (Denmark)

    Sørensen, Martin Hedegård; Mortensen, Asger; Brandbyge, Mads

    2007-01-01

    The conductance change of nanowire field-effect transistors is considered a highly sensitive probe for surface charge. However, Debye screening of relevant physiological liquid environments challenge device performance due to competing screening from the ionic liquid and nanowire charge carriers....

  19. Modeling charge transport properties of cyano-substituted PPV

    International Nuclear Information System (INIS)

    Correia, Helena M.G.; Ramos, Marta M.D.

    2003-01-01

    In recent years, poly (p-phenylenevinylene) (PPV) and its derivatives have attracted much interest due to their applications in light-emitting diodes (LEDs). One of the issues that determine device performance is the transport of charge carriers along the polymer strands. For that reason, we investigate the influence of cyano substitution on geometry and electronic behaviour of PPV chains using self-consistent quantum molecular dynamics simulations. Our results suggest that substitution by cyano groups induce distortion in the PPV chains and a charge rearrangement among the polymer atoms. Specifically addressed is the issue concerning estimates of charge (electron and hole) mobility by computer experiments. Significant differences have been found both in the strength of the electric field needed to move positive and negative charge carriers along the polymer chain as well as in charge mobility

  20. Resonance Raman spectra of organic molecules absorbed on inorganic semiconducting surfaces: Contribution from both localized intramolecular excitation and intermolecular charge transfer excitation

    International Nuclear Information System (INIS)

    Ye, ChuanXiang; Zhao, Yi; Liang, WanZhen

    2015-01-01

    The time-dependent correlation function approach for the calculations of absorption and resonance Raman spectra (RRS) of organic molecules absorbed on semiconductor surfaces [Y. Zhao and W. Z. Liang, J. Chem. Phys. 135, 044108 (2011)] is extended to include the contribution of the intermolecular charge transfer (CT) excitation from the absorbers to the semiconducting nanoparticles. The results demonstrate that the bidirectionally interfacial CT significantly modifies the spectral line shapes. Although the intermolecular CT excitation makes the absorption spectra red shift slightly, it essentially changes the relative intensities of mode-specific RRS and causes the oscillation behavior of surface enhanced Raman spectra with respect to interfacial electronic couplings. Furthermore, the constructive and destructive interferences of RRS from the localized molecular excitation and CT excitation are observed with respect to the electronic coupling and the bottom position of conductor band. The interferences are determined by both excitation pathways and bidirectionally interfacial CT

  1. Non-adiabatic Excited State Molecule Dynamics Modeling of Photochemistry and Photophysics of Materials

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, Tammie Renee [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Tretiak, Sergei [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-01-06

    Understanding and controlling excited state dynamics lies at the heart of all our efforts to design photoactive materials with desired functionality. This tailor-design approach has become the standard for many technological applications (e.g., solar energy harvesting) including the design of organic conjugated electronic materials with applications in photovoltaic and light-emitting devices. Over the years, our team has developed efficient LANL-based codes to model the relevant photophysical processes following photoexcitation (spatial energy transfer, excitation localization/delocalization, and/or charge separation). The developed approach allows the non-radiative relaxation to be followed on up to ~10 ps timescales for large realistic molecules (hundreds of atoms in size) in the realistic solvent dielectric environment. The Collective Electronic Oscillator (CEO) code is used to compute electronic excited states, and the Non-adiabatic Excited State Molecular Dynamics (NA-ESMD) code is used to follow the non-adiabatic dynamics on multiple coupled Born-Oppenheimer potential energy surfaces. Our preliminary NA-ESMD simulations have revealed key photoinduced mechanisms controlling competing interactions and relaxation pathways in complex materials, including organic conjugated polymer materials, and have provided a detailed understanding of photochemical products and intermediates and the internal conversion process during the initiation of energetic materials. This project will be using LANL-based CEO and NA-ESMD codes to model nonradiative relaxation in organic and energetic materials. The NA-ESMD and CEO codes belong to a class of electronic structure/quantum chemistry codes that require large memory, “long-queue-few-core” distribution of resources in order to make useful progress. The NA-ESMD simulations are trivially parallelizable requiring ~300 processors for up to one week runtime to reach a meaningful restart point.

  2. Equivalent circuit modeling of space charge dominated magnetically insulated transmission lines

    Energy Technology Data Exchange (ETDEWEB)

    Hiraoka, Kazuki; Nakajima, Mitsuo; Horioka, Kazuhiko

    1997-12-31

    A new equivalent circuit model for space charge dominated MITLs (Magnetically Insulated Transmission Lines) was developed. MITLs under high power operation are dominated with space charge current flowing between anode and cathode. Conventional equivalent circuit model does not account for space charge effects on power flow. The model was modified to discuss the power transportation through the high power MITLs. With this model, it is possible to estimate the effects of space charge current on the power flow efficiency, without using complicated particle code simulations. (author). 3 figs., 3 refs.

  3. Modeling molecule-plasmon interactions using quantized radiation fields within time-dependent electronic structure theory

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, Daniel R.; DePrince, A. Eugene, E-mail: deprince@chem.fsu.edu [Department of Chemistry and Biochemistry, Florida State University, Tallahassee, Florida 32306-4390 (United States)

    2015-12-07

    We present a combined cavity quantum electrodynamics/ab initio electronic structure approach for simulating plasmon-molecule interactions in the time domain. The simple Jaynes-Cummings-type model Hamiltonian typically utilized in such simulations is replaced with one in which the molecular component of the coupled system is treated in a fully ab initio way, resulting in a computationally efficient description of general plasmon-molecule interactions. Mutual polarization effects are easily incorporated within a standard ground-state Hartree-Fock computation, and time-dependent simulations carry the same formal computational scaling as real-time time-dependent Hartree-Fock theory. As a proof of principle, we apply this generalized method to the emergence of a Fano-like resonance in coupled molecule-plasmon systems; this feature is quite sensitive to the nanoparticle-molecule separation and the orientation of the molecule relative to the polarization of the external electric field.

  4. Impact of electron delocalization on the nature of the charge-transfer states in model pentacene/C60 Interfaces: A density functional theory study

    KAUST Repository

    Yang, Bing

    2014-12-04

    Electronic delocalization effects have been proposed to play a key role in photocurrent generation in organic photovoltaic devices. Here, we study the role of charge delocalization on the nature of the charge-transfer (CT) states in the case of model complexes consisting of several pentacene molecules and one fullerene (C60) molecule, which are representative of donor/acceptor heterojunctions. The energies of the CT states are examined by means of time-dependent density functional theory (TD-DFT) using the long-range-corrected functional, ωB97X, with an optimized range-separation parameter, ω. We provide a general description of how the nature of the CT states is impacted by molecular packing (i.e., interfacial donor/acceptor orientations), system size, and intermolecular interactions, features of importance in the understanding of the charge-separation mechanism.

  5. The infra-red spectrum of the molecular dication (doubly positively charged molecule) D35Cl2+

    International Nuclear Information System (INIS)

    Abusen, R.A.

    1999-07-01

    The ion-beam/laser-beam spectrometer used in this work was designed, built and commissioned for the experimental investigation of doubly charged molecular species [Shiell 1995]. Using this spectrometer the photodissociation spectrum of the X 3 Σ - state of the molecular dication D 35 Cl 2+ was measured in the infrared. It has not yet been possible to assign and fit the observed transitions in the usual way, but comparisons of our spectra with ab-initio generated spectra show good agreement and form the basis for our preliminary assignments. Our preliminary analysis shows a good agreement between the measured spectra and an ab-initio theoretical spectra of the ν = 2-1 band, including the rotational constants and tunneling lifetimes, calculated from the potential energy of Bennett and McNab [1995]. The theoretical spectrum was brought into agreement with the measured spectra by moving its band origin by -21.1 cm -1 . The theoretical rotational constants that give good agreement with the spectrum are (in cm -1 ) B'' = 3.898, D'' = 3.561, H'' = 1.04 x 10 -9 , B' = 3.648, D' = 3.163 x 10 -4 , H' = -9.269 x 10 -8 . The shifted origin of the ν = 2-1 band is 994.3 cm -1 . A Fortran computer program was written to simulate 3Σ-3Σ vibration-rotation spectra. The theoretical spectrum obtained with this computer program has been compared with our measured spectrum. Our experimentally measured line widths and wavenumbers have been compared with the ab-initio theoretical spectrum and a good agreement obtained. This is good evidence that we are observing the ν=2-1 band of D 35 CI 2+ in the ground electronic state (X 3 Σ - state). Good agreement between measured and predicted hyperfine patterns was found using a Fermi contact constant (for the chlorine nucleus) of 190 MHz. (author)

  6. Conformation-related exciton localization and charge-pair formation in polythiophenes: ensemble and single-molecule study.

    Science.gov (United States)

    Sugimoto, Toshikazu; Habuchi, Satoshi; Ogino, Kenji; Vacha, Martin

    2009-09-10

    We study conformation-dependent photophysical properties of polythiophene (PT) by molecular dynamics simulations and by ensemble and single-molecule optical experiments. We use a graft copolymer consisting of a polythiophene backbone and long polystyrene branches and compare its properties with those obtained on the same polythiophene derivative without the side chains. Coarse-grain molecular dynamics simulations show that in a poor solvent, the PT without the side chains (PT-R) forms a globulelike conformation in which distances between any two conjugated segments on the chain are within the Forster radius for efficient energy transfer. In the PT with the polystyrene branches (PT-PS), the polymer main PT chain retains an extended coillike conformation, even in a poor solvent, and the calculated distances between conjugated segments favor energy transfer only between a few neighboring chromophores. The theoretical predictions are confirmed by measurements of fluorescence anisotropy and fluorescence blinking of the polymers' single chains. High anisotropy ratios and two-state blinking in PT-R are due to localization of the exciton on a single conjugated segment. These signatures of exciton localization are absent in single chains of PT-PS. Electric-field-induced quenching measured as a function of concentration of PT dispersed in an inert matrix showed that in well-isolated chains of PT-PS, the exciton dissociation is an intrachain process and that aggregation of the PT-R chains causes an increase in quenching due to the onset of interchain interactions. Measurements of the field-induced quenching on single chains indicate that in PT-R, the exciton dissociation is a slower process that takes place only after the exciton is localized on one conjugated segment.

  7. Probabilistic modeling of nodal electric vehicle load due to fast charging stations

    DEFF Research Database (Denmark)

    Tang, Difei; Wang, Peng; Wu, Qiuwei

    2016-01-01

    In order to reduce greenhouse gas emission and fossil fuel dependence, Electric Vehicle (EV) has drawn increasing attention due to its zero emission and high efficiency. However, new problems such as range anxiety, long charging duration and high charging power may threaten the safe and efficient...... station into consideration. Fuzzy logic inference system is applied to simulate the charging decision of EV drivers at fast charging station. Due to increasing EV loads in power system, the potential traffic congestion in fast charging stations is modeled and evaluated by queuing theory with spatial...

  8. Entropic lattice Boltzmann model for charged leaky dielectric multiphase fluids in electrified jets.

    Science.gov (United States)

    Lauricella, Marco; Melchionna, Simone; Montessori, Andrea; Pisignano, Dario; Pontrelli, Giuseppe; Succi, Sauro

    2018-03-01

    We present a lattice Boltzmann model for charged leaky dielectric multiphase fluids in the context of electrified jet simulations, which are of interest for a number of production technologies including electrospinning. The role of nonlinear rheology on the dynamics of electrified jets is considered by exploiting the Carreau model for pseudoplastic fluids. We report exploratory simulations of charged droplets at rest and under a constant electric field, and we provide results for charged jet formation under electrospinning conditions.

  9. (CryoTransmission Electron Microscopy of Phospholipid Model Membranes Interacting with Amphiphilic and Polyphilic Molecules

    Directory of Open Access Journals (Sweden)

    Annette Meister

    2017-10-01

    Full Text Available Lipid membranes can incorporate amphiphilic or polyphilic molecules leading to specific functionalities and to adaptable properties of the lipid bilayer host. The insertion of guest molecules into membranes frequently induces changes in the shape of the lipid matrix that can be visualized by transmission electron microscopy (TEM techniques. Here, we review the use of stained and vitrified specimens in (cryoTEM to characterize the morphology of amphiphilic and polyphilic molecules upon insertion into phospholipid model membranes. Special emphasis is placed on the impact of novel synthetic amphiphilic and polyphilic bolalipids and polymers on membrane integrity and shape stability.

  10. Unified Model of Dynamic Forced Barrier Crossing in Single Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Friddle, R W

    2007-06-21

    Thermally activated barrier crossing in the presence of an increasing load can reveal kinetic rate constants and energy barrier parameters when repeated over a range of loading rates. Here we derive a model of the mean escape force for all relevant loading rates--the complete force spectrum. Two well-known approximations emerge as limiting cases; one of which confirms predictions that single-barrier spectra should converge to a phenomenological description in the slow loading limit.

  11. Charge transport model in nanodielectric composites based on quantum tunneling mechanism and dual-level traps

    Energy Technology Data Exchange (ETDEWEB)

    Li, Guochang; Chen, George, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China); School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ (United Kingdom); Li, Shengtao, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China)

    2016-08-08

    Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loading concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.

  12. A new theoretical model for scattering of electrons by molecules. 1

    International Nuclear Information System (INIS)

    Peixoto, E.M.A.; Mu-tao, L.; Nogueira, J.C.

    1975-01-01

    A new theoretical model for electron-molecule scattering is suggested. The e-H 2 scattering is studied and the superiority of the new model over the commonly used Independent Atom Model (IAM) is demonstrated. Comparing theoretical and experimental data for 40keV electrons scattered by H 2 utilizing the new model, its validity is proved, while Partial Wave and First Born calculations, employing the Independent Atom Model, strongly deviated from the experiment [pt

  13. Bond charges and electronic charge transfer in ternary semiconductors

    International Nuclear Information System (INIS)

    Pietsch, U.

    1986-01-01

    By means of a simple molecule-theoretic model of 'linear superposition of two-electron molecules' the bond charges between nearest neighbours and the effective charges of ions are calculated for ternary zinc-blende structure alloys as well as chalcopyrite semiconductors. Taking into account both, the charge transfer among the ions caused by the differences of electronegativities of atoms used and between the bonds created by the internal stress of the lattice a nearly unvaried averaged bond charge amount of the alloy is found, but rather dramatically changed local bond charge parameters in comparison with the respective values of binary compounds used. This fact should influence the noncentral force interaction in such semiconductors. (author)

  14. Numerical modelling of needle-grid electrodes for negative surface corona charging system

    International Nuclear Information System (INIS)

    Zhuang, Y; Chen, G; Rotaru, M

    2011-01-01

    Surface potential decay measurement is a simple and low cost tool to examine electrical properties of insulation materials. During the corona charging stage, a needle-grid electrodes system is often used to achieve uniform charge distribution on the surface of the sample. In this paper, a model using COMSOL Multiphysics has been developed to simulate the gas discharge. A well-known hydrodynamic drift-diffusion model was used. The model consists of a set of continuity equations accounting for the movement, generation and loss of charge carriers (electrons, positive and negative ions) coupled with Poisson's equation to take into account the effect of space and surface charges on the electric field. Four models with the grid electrode in different positions and several mesh sizes are compared with a model that only has the needle electrode. The results for impulse current and surface charge density on the sample clearly show the effect of the extra grid electrode with various positions.

  15. Semi-empirical modelization of charge funneling in a NP diode

    International Nuclear Information System (INIS)

    Musseau, O.

    1991-01-01

    Heavy ion interaction with a semiconductor generates a high density of electrons and holes pairs along the trajectory and in a space charge zone the collected charge is considerably increased. The chronology of this charge funneling is described in a semi-empirical model. From initial conditions characterizing the incident ion and the studied structure, it is possible to evaluate directly the transient current, the collected charge and the length of funneling with a good agreement. The model can be extrapolated to more complex structures

  16. A Temperature Dependent Lumped-charge Model for Trench FS-IGBT

    DEFF Research Database (Denmark)

    Duan, Yaoqiang; Kang, Yong; Iannuzzo, Francesco

    2018-01-01

    Abstract: This paper proposes a temperature dependent lumped-charge model for FS-IGBT. Due to the evolution of the IGBT structure, the existing lumped-charge IGBT model established for NPT-IGBT is not suitable for the simulation of FS-IGBT. This paper extends the lumped-charge IGBT model including...... the field-stop (FS) structure and temperature characteristics. The temperature characteristics of the model are considered for both the bipolar part and unipolar part. In addition, a new PN junction model which can distinguish the collector structure is presented and validated by TCAD simulation. Finally...

  17. Modeling charge polarization voltage for large lithium-ion batteries in electric vehicles

    Directory of Open Access Journals (Sweden)

    Yan Jiang

    2013-06-01

    Full Text Available Purpose: Polarization voltage of the lithium-ion battery is an important parameter that has direct influence on battery performance. The paper aims to analyze the impedance characteristics of the lithium-ion battery based on EIS data. Design/methodology/approach: The effects of currents, initial SOC of the battery on charge polarization voltage are investigated, which is approximately linear function of charge current. The change of charge polarization voltage is also analyzed with the gradient analytical method in the SOC domain. The charge polarization model with two RC networks is presented, and parts of model parameters like Ohmic resistance and charge transfer impedance are estimated by both EIS method and battery constant current testing method. Findings: This paper reveals that the Ohmic resistance accounts for much contribution to battery total polarization compared to charge transfer impedance. Practical implications: Experimental results demonstrate the efficacy of the model with the proposed identification method, which provides the foundation for battery charging optimization. Originality/value: The paper analyzed the impedance characteristics of the lithium-ion battery based on EIS data, presented a charge polarization model with two RC networks, and estimated parameters like Ohmic resistance and charge transfer impedance.

  18. 3D Printed Molecules and Extended Solid Models for Teaching Symmetry and Point Groups

    Science.gov (United States)

    Scalfani, Vincent F.; Vaid, Thomas P.

    2014-01-01

    Tangible models help students and researchers visualize chemical structures in three dimensions (3D). 3D printing offers a unique and straightforward approach to fabricate plastic 3D models of molecules and extended solids. In this article, we prepared a series of digital 3D design files of molecular structures that will be useful for teaching…

  19. Optimal Day-ahead Charging Scheduling of Electric Vehicles through an Aggregative Game Model

    DEFF Research Database (Denmark)

    Liu, Zhaoxi; Wu, Qiuwei; Huang, Shaojun

    2017-01-01

    The electric vehicle (EV) market has been growing rapidly around the world. With large scale deployment of EVs in power systems, both the grid and EV owners will benefit if the flexible demand of EV charging is properly managed through the electricity market. When EV charging demand is considerable...... in a grid, it will impact spot prices in the electricity market and consequently influence the charging scheduling itself. The interaction between the spot prices and the EV demand needs to be considered in the EV charging scheduling, otherwise it will lead to a higher charging cost. A day-ahead EV charging...... scheduling based on an aggregative game model is proposed in this paper. The impacts of the EV demand on the electricity prices are formulated with the game model in the scheduling considering possible actions of other EVs. The existence and uniqueness of the pure strategy Nash equilibrium are proved...

  20. Implementação computacional do modelo carga-fluxo de carga-fluxo de dipolo para cálculo e interpretação das intensidades do espectro infravermelho Computational implementation of the model charge-charge flux-dipole flux for calculation and analysis of infrared intensities

    Directory of Open Access Journals (Sweden)

    Thiago C. F. Gomes

    2008-01-01

    Full Text Available The first computational implementation that automates the procedures involved in the calculation of infrared intensities using the charge-charge flux-dipole flux model is presented. The atomic charges and dipoles from the Quantum Theory of Atoms in Molecules (QTAIM model was programmed for Morphy98, Gaussian98 and Gaussian03 programs outputs, but for the ChelpG parameters only the Gaussian programs are supported. Results of illustrative but new calculations for the water, ammonia and methane molecules at the MP2/6-311++G(3d,3p theoretical level, using the ChelpG and QTAIM/Morphy charges and dipoles are presented. These results showed excellent agreement with analytical results obtained directly at the MP2/6-311++G(3d,3p level of theory.

  1. Rapid Charged Geosynchronous Debris Perturbation Modeling of Electrodynamic Disturbances

    Science.gov (United States)

    Hughes, Joseph; Schaub, Hanspeter

    2018-04-01

    Charged space objects experience small perturbative torques and forces from their interaction with Earth's magnetic field. These small perturbations can change the orbits of lightweight, uncontrolled debris objects dramatically even over short periods. This paper investigates the effects of the isolated Lorentz force, the effects of including or neglecting this and other electromagnetic perturbations in a full propagation, and then analyzes for which objects electromagnetic effects have the most impact. It is found that electromagnetic forces have a negligible impact on their own. However, if the center of charge is not collocated with the center of mass, electromagnetic torques are produced which do impact the attitude, and thus the position by affecting the direction and magnitude of the solar radiation pressure force. The objects for which electrostatic torques have the most influence are charged above the kilovolt level, have a difference between their center of mass and center of charge, have highly attitude-dependent cross-sectional area, and are not spinning stably about an axis of maximum inertia. Fully coupled numerical simulation illustrate the impact of electromagnetic disturbances through the solar radiation pressure coupling.

  2. Modeling charged defects inside density functional theory band gaps

    International Nuclear Information System (INIS)

    Schultz, Peter A.; Edwards, Arthur H.

    2014-01-01

    Density functional theory (DFT) has emerged as an important tool to probe microscopic behavior in materials. The fundamental band gap defines the energy scale for charge transition energy levels of point defects in ionic and covalent materials. The eigenvalue gap between occupied and unoccupied states in conventional DFT, the Kohn–Sham gap, is often half or less of the experimental band gap, seemingly precluding quantitative studies of charged defects. Applying explicit and rigorous control of charge boundary conditions in supercells, we find that calculations of defect energy levels derived from total energy differences give accurate predictions of charge transition energy levels in Si and GaAs, unhampered by a band gap problem. The GaAs system provides a good theoretical laboratory for investigating band gap effects in defect level calculations: depending on the functional and pseudopotential, the Kohn–Sham gap can be as large as 1.1 eV or as small as 0.1 eV. We find that the effective defect band gap, the computed range in defect levels, is mostly insensitive to the Kohn–Sham gap, demonstrating it is often possible to use conventional DFT for quantitative studies of defect chemistry governing interesting materials behavior in semiconductors and oxides despite a band gap problem

  3. Enhancement of charge transport properties of small molecule semiconductors by controlling fluorine substitution and effects on photovoltaic properties of organic solar cells and perovskite solar cells.

    Science.gov (United States)

    Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung

    2016-11-01

    We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .

  4. Status of the charged Higgs boson in two Higgs doublet models

    Science.gov (United States)

    Arbey, A.; Mahmoudi, F.; Stål, O.; Stefaniak, T.

    2018-03-01

    The existence of charged Higgs boson(s) is inevitable in models with two (or more) Higgs doublets. Hence, their discovery would constitute unambiguous evidence for new physics beyond the Standard Model (SM). Taking into account all relevant results from direct charged and neutral Higgs boson searches at LEP and the LHC, as well as the most recent constraints from flavour physics, we present a detailed analysis of the current phenomenological status of the charged Higgs sector in a variety of well-motivated two Higgs doublet models (2HDMs). We find that charged Higgs bosons as light as 75 GeV can still be compatible with the combined data, although this implies severely suppressed charged Higgs couplings to all fermions. In more popular models, e.g. the 2HDM of Type II, we find that flavour physics observables impose a combined lower limit on the charged Higgs mass of M_{H^± } ≳ 600 GeV - independent of tan β - which increases to M_{H^± } ≳ 650 GeV for tan β < 1. We furthermore find that in certain scenarios, the signature of a charged Higgs boson decaying into a lighter neutral Higgs boson and a W boson provides a promising experimental avenue that would greatly complement the existing LHC search programme for charged Higgs boson(s).

  5. Integrated DEM-CFD modeling of the contact charging of pneumatically conveyed powders

    NARCIS (Netherlands)

    Korevaar, M.W.; Padding, J.T.; Hoef, van der M.A.; Kuipers, J.A.M.

    2014-01-01

    A model is proposed that incorporates contact charging (also known as triboelectric charging) of pneumatically conveyed powders in a DEM–CFD framework, which accounts for the electrostatic interactions, both between particles and between the particles and conducting walls. The simulation results

  6. Integrated DEM–CFD modeling of the contact charging of pneumatically conveyed powders

    NARCIS (Netherlands)

    Korevaar, M.W.; Padding, J.T.; van der Hoef, Martin Anton; Kuipers, J.A.M.

    2014-01-01

    A model is proposed that incorporates contact charging (also known as triboelectric charging) of pneumatically conveyed powders in a DEM–CFD framework, which accounts for the electrostatic interactions, both between particles and between the particles and conducting walls. The simulation results

  7. A surface diffuse scattering model for the mobility of electrons in surface charge coupled devices

    International Nuclear Information System (INIS)

    Ionescu, M.

    1977-01-01

    An analytical model for the mobility of electrons in surface charge coupled devices is studied on the basis of the results previously obtained, considering a surface diffuse scattering; the importance of the results obtained for a better understanding of the influence of the fringing field in surface charge coupled devices is discussed. (author)

  8. Status of the charged Higgs boson in two Higgs doublet models

    International Nuclear Information System (INIS)

    Arbey, A.; Mahmoudi, F.; Stefaniak, T.; Staal, O.

    2018-01-01

    The existence of charged Higgs boson(s) is inevitable in models with two (or more) Higgs doublets. Hence, their discovery would constitute unambiguous evidence for new physics beyond the Standard Model (SM). Taking into account all relevant results from direct charged and neutral Higgs boson searches at LEP and the LHC, as well as the most recent constraints from flavour physics, we present a detailed analysis of the current phenomenological status of the charged Higgs sector in a variety of well-motivated two Higgs doublet models (2HDMs). We find that charged Higgs bosons as light as 75 GeV can still be compatible with the combined data, although this implies severely suppressed charged Higgs couplings to all fermions. In more popular models, e.g. the 2HDM of Type II, we find that flavour physics observables impose a combined lower limit on the charged Higgs mass of M H ± > or similar 600 GeV - independent of tan β - which increases to M H ± > or similar 650 GeV for tan β < 1. We furthermore find that in certain scenarios, the signature of a charged Higgs boson decaying into a lighter neutral Higgs boson and a W boson provides a promising experimental avenue that would greatly complement the existing LHC search programme for charged Higgs boson(s). (orig.)

  9. Dynamics of Charged Particulate Systems Modeling, Theory and Computation

    CERN Document Server

    Zohdi, Tarek I

    2012-01-01

    The objective of this monograph is to provide a concise introduction to the dynamics of systems comprised of charged small-scale particles. Flowing, small-scale, particles ("particulates'') are ubiquitous in industrial processes and in the natural sciences. Applications include electrostatic copiers, inkjet printers, powder coating machines, etc., and a variety of manufacturing processes. Due to their small-scale size, external electromagnetic fields can be utilized to manipulate and control charged particulates in industrial processes in order to achieve results that are not possible by purely mechanical means alone. A unique feature of small-scale particulate flows is that they exhibit a strong sensitivity to interparticle near-field forces, leading to nonstandard particulate dynamics, agglomeration and cluster formation, which can strongly affect manufactured product quality. This monograph also provides an introduction to the mathematically-related topic of the dynamics of swarms of interacting objects, ...

  10. Anisotropic charged physical models with generalized polytropic equation of state

    Energy Technology Data Exchange (ETDEWEB)

    Nasim, A.; Azam, M. [University of Education, Division of Science and Technology, Lahore (Pakistan)

    2018-01-15

    In this paper, we found the exact solutions of Einstein-Maxwell equations with generalized polytropic equation of state (GPEoS). For this, we consider spherically symmetric object with charged anisotropic matter distribution. We rewrite the field equations into simple form through transformation introduced by Durgapal (Phys Rev D 27:328, 1983) and solve these equations analytically. For the physically acceptability of these solutions, we plot physical quantities like energy density, anisotropy, speed of sound, tangential and radial pressure. We found that all solutions fulfill the required physical conditions. It is concluded that all our results are reduced to the case of anisotropic charged matter distribution with linear, quadratic as well as polytropic equation of state. (orig.)

  11. Analytical estimation of effective charges at saturation in Poisson-Boltzmann cell models

    International Nuclear Information System (INIS)

    Trizac, Emmanuel; Aubouy, Miguel; Bocquet, Lyderic

    2003-01-01

    We propose a simple approximation scheme for computing the effective charges of highly charged colloids (spherical or cylindrical with infinite length). Within non-linear Poisson-Boltzmann theory, we start from an expression for the effective charge in the infinite-dilution limit which is asymptotically valid for large salt concentrations; this result is then extended to finite colloidal concentration, approximating the salt partitioning effect which relates the salt content in the suspension to that of a dialysing reservoir. This leads to an analytical expression for the effective charge as a function of colloid volume fraction and salt concentration. These results compare favourably with the effective charges at saturation (i.e. in the limit of large bare charge) computed numerically following the standard prescription proposed by Alexander et al within the cell model

  12. Theoretical study of stability and charge-transport properties of coronene molecule and some of its halogenated derivatives: A path to ambipolar organic-based materials?

    Energy Technology Data Exchange (ETDEWEB)

    Sancho-García, J. C., E-mail: jc.sancho@ua.es; Pérez-Jiménez, A. J., E-mail: aj.perez@ua.es [Departamento de Química Física, Universidad de Alicante, E-03080 Alicante (Spain)

    2014-10-07

    We have carefully investigated the structural and electronic properties of coronene and some of its fluorinated and chlorinated derivatives, including full periphery substitution, as well as the preferred orientation of the non-covalent dimer structures subsequently formed. We have paid particular attention to a set of methodological details, to first obtain single-molecule magnitudes as accurately as possible, including next the use of modern dispersion-corrected methods to tackle the corresponding non-covalently bound dimers. Generally speaking, this class of compounds is expected to self-assembly in neighboring π-stacks with dimer stabilization energies ranging from –20 to –30 kcal mol{sup −1} at close distances around 3.0–3.3 Å. Then, in a further step, we have also calculated hole and electron transfer rates of some suitable candidates for ambipolar materials, and corresponding charge mobility values, which are known to critically depend on the supramolecular organization of the samples. For coronene and per-fluorinated coronene, we have found high values for their hopping rates, although slightly smaller for the latter due to an increase (decrease) of the reorganization energies (electronic couplings)

  13. Charge orders in organic charge-transfer salts

    International Nuclear Information System (INIS)

    Kaneko, Ryui; Valentí, Roser; Tocchio, Luca F; Becca, Federico

    2017-01-01

    Motivated by recent experimental suggestions of charge-order-driven ferroelectricity in organic charge-transfer salts, such as κ -(BEDT-TTF) 2 Cu[N(CN) 2 ]Cl, we investigate magnetic and charge-ordered phases that emerge in an extended two-orbital Hubbard model on the anisotropic triangular lattice at 3/4 filling. This model takes into account the presence of two organic BEDT-TTF molecules, which form a dimer on each site of the lattice, and includes short-range intramolecular and intermolecular interactions and hoppings. By using variational wave functions and quantum Monte Carlo techniques, we find two polar states with charge disproportionation inside the dimer, hinting to ferroelectricity. These charge-ordered insulating phases are stabilized in the strongly correlated limit and their actual charge pattern is determined by the relative strength of intradimer to interdimer couplings. Our results suggest that ferroelectricity is not driven by magnetism, since these polar phases can be stabilized also without antiferromagnetic order and provide a possible microscopic explanation of the experimental observations. In addition, a conventional dimer-Mott state (with uniform density and antiferromagnetic order) and a nonpolar charge-ordered state (with charge-rich and charge-poor dimers forming a checkerboard pattern) can be stabilized in the strong-coupling regime. Finally, when electron–electron interactions are weak, metallic states appear, with either uniform charge distribution or a peculiar 12-site periodicity that generates honeycomb-like charge order. (paper)

  14. Surface Complexation Modeling in Variable Charge Soils: Charge Characterization by Potentiometric Titration

    Directory of Open Access Journals (Sweden)

    Giuliano Marchi

    2015-10-01

    Full Text Available ABSTRACT Intrinsic equilibrium constants of 17 representative Brazilian Oxisols were estimated from potentiometric titration measuring the adsorption of H+ and OH− on amphoteric surfaces in suspensions of varying ionic strength. Equilibrium constants were fitted to two surface complexation models: diffuse layer and constant capacitance. The former was fitted by calculating total site concentration from curve fitting estimates and pH-extrapolation of the intrinsic equilibrium constants to the PZNPC (hand calculation, considering one and two reactive sites, and by the FITEQL software. The latter was fitted only by FITEQL, with one reactive site. Soil chemical and physical properties were correlated to the intrinsic equilibrium constants. Both surface complexation models satisfactorily fit our experimental data, but for results at low ionic strength, optimization did not converge in FITEQL. Data were incorporated in Visual MINTEQ and they provide a modeling system that can predict protonation-dissociation reactions in the soil surface under changing environmental conditions.

  15. Charge distributions and correlations in fragmentation models for soft hadron collisions

    International Nuclear Information System (INIS)

    Wolf, E.A. de

    1984-01-01

    Data on charge distributions and charge correlations in pp and meson-proton interactions at PS and SPS energies are successfully compared with the Lund fragmentation model for low-psub(T) hadron collisions. It is argued that local conservation of quantum numbers and resonance production, as implemented in fragmentation models, are sufficient ingredients to explain most of the available experimental results at these energies. No necessity is found for dual-sheet contributions considered in DTU-based parton models. (orig.)

  16. Description of bipolar charge transport in polyethylene using a fluid model with a constant mobility: model prediction

    International Nuclear Information System (INIS)

    Le Roy, S; Segur, P; Teyssedre, G; Laurent, C

    2004-01-01

    We present a conduction model aimed at describing bipolar transport and space charge phenomena in low density polyethylene under dc stress. In the first part we recall the basic requirements for the description of charge transport and charge storage in disordered media with emphasis on the case of polyethylene. A quick review of available conduction models is presented and our approach is compared with these models. Then, the bases of the model are described and related assumptions are discussed. Finally, results on external current, trapped and free space charge distributions, field distribution and recombination rate are presented and discussed, considering a constant dc voltage, a step-increase of the voltage, and a polarization-depolarization protocol for the applied voltage. It is shown that the model is able to describe the general features reported for external current, electroluminescence and charge distribution in polyethylene

  17. A schematic model for energy and charge transfer in the chlorophyll complex

    DEFF Research Database (Denmark)

    Bohr, Henrik; Malik, F.B.

    2011-01-01

    A theory for simultaneous charge and energy transfer in the carotenoid-chlorophyll-a complex is presented here and discussed. The observed charge transfer process in these chloroplast complexes is reasonably explained in terms of this theory. In addition, the process leads to a mechanism to drive...... an electron in a lower to a higher-energy state, thus providing a mechanism for the ejection of the electron to a nearby molecule (chlorophyll) or into the environment. The observed lifetimes of the electronically excited states are in accord/agreement with the investigations of Sundström et al....... and are in the range of pico-seconds and less. The change in electronic charge distribution in internuclear space as the system undergoes an electronic transition to a higher-energy state could, under appropriate physical conditions, lead to oscillating dipoles capable of transmitting energy from the carotenoid-chlorophylls...

  18. Modeling of capacitor charging dynamics in an energy harvesting system considering accurate electromechanical coupling effects

    Science.gov (United States)

    Bagheri, Shahriar; Wu, Nan; Filizadeh, Shaahin

    2018-06-01

    This paper presents an iterative numerical method that accurately models an energy harvesting system charging a capacitor with piezoelectric patches. The constitutive relations of piezoelectric materials connected with an external charging circuit with a diode bridge and capacitors lead to the electromechanical coupling effect and the difficulty of deriving accurate transient mechanical response, as well as the charging progress. The proposed model is built upon the Euler-Bernoulli beam theory and takes into account the electromechanical coupling effects as well as the dynamic process of charging an external storage capacitor. The model is validated through experimental tests on a cantilever beam coated with piezoelectric patches. Several parametric studies are performed and the functionality of the model is verified. The efficiency of power harvesting system can be predicted and tuned considering variations in different design parameters. Such a model can be utilized to design robust and optimal energy harvesting system.

  19. An equivalent body surface charge model representing three-dimensional bioelectrical activity

    Science.gov (United States)

    He, B.; Chernyak, Y. B.; Cohen, R. J.

    1995-01-01

    A new surface-source model has been developed to account for the bioelectrical potential on the body surface. A single-layer surface-charge model on the body surface has been developed to equivalently represent bioelectrical sources inside the body. The boundary conditions on the body surface are discussed in relation to the surface-charge in a half-space conductive medium. The equivalent body surface-charge is shown to be proportional to the normal component of the electric field on the body surface just outside the body. The spatial resolution of the equivalent surface-charge distribution appears intermediate between those of the body surface potential distribution and the body surface Laplacian distribution. An analytic relationship between the equivalent surface-charge and the surface Laplacian of the potential was found for a half-space conductive medium. The effects of finite spatial sampling and noise on the reconstruction of the equivalent surface-charge were evaluated by computer simulations. It was found through computer simulations that the reconstruction of the equivalent body surface-charge from the body surface Laplacian distribution is very stable against noise and finite spatial sampling. The present results suggest that the equivalent body surface-charge model may provide an additional insight to our understanding of bioelectric phenomena.

  20. Combining an Electrothermal and Impedance Aging Model to Investigate Thermal Degradation Caused by Fast Charging

    Directory of Open Access Journals (Sweden)

    Joris de Hoog

    2018-03-01

    Full Text Available Fast charging is an exciting topic in the field of electric and hybrid electric vehicles (EVs/HEVs. In order to achieve faster charging times, fast-charging applications involve high-current profiles which can lead to high cell temperature increase, and in some cases thermal runaways. There has been some research on the impact caused by fast-charging profiles. This research is mostly focused on the electrical, thermal and aging aspects of the cell individually, but these factors are never treated together. In this paper, the thermal progression of the lithium-ion battery under specific fast-charging profiles is investigated and modeled. The cell is a Lithium Nickel Manganese Cobalt Oxide/graphite-based cell (NMC rated at 20 Ah, and thermal images during fast-charging have been taken at four degradation states: 100%, 90%, 85%, and 80% State-of-Health (SoH. A semi-empirical resistance aging model is developed using gathered data from extensive cycling and calendar aging tests, which is coupled to an electrothermal model. This novel combined model achieves good agreement with the measurements, with simulation results always within 2 °C of the measured values. This study presents a modeling methodology that is usable to predict the potential temperature distribution for lithium-ion batteries (LiBs during fast-charging profiles at different aging states, which would be of benefit for Battery Management Systems (BMS in future thermal strategies.

  1. Wave packet formulation of the boomerang model for resonant electron--molecule scattering

    International Nuclear Information System (INIS)

    McCurdy, C.W.; Turner, J.L.

    1983-01-01

    A time-dependent formulation of the boomerang model for resonant electron--molecule scattering is presented in terms of a wave packet propagating on the complex potential surface of the metastable anion. The results of calculations using efficient semiclassical techniques for propagating the wave packet are found to be in excellent agreement with full quantum-mechanical calculations of vibrational excitation cross sections in e - --N 2 scattering. The application of the wave packet formulation as a computational and conceptual approach to the problem of resonant collisions with polyatomic molecules is discussed in the light of recent wave packet calculations on polyatomic photodissociation and Raman spectra

  2. Investigation of gas molecules adsorption on carbon nano tubes electric properties in tight binding model

    International Nuclear Information System (INIS)

    Moradian, R.; Mohammadi, Y.

    2007-01-01

    Based on tight binding model we investigated effects of bi-atomic molecules gas(in the general form denoted by X 2 )on single-walled carbon nano tubes electronic properties. We found for some specified values of hopping integrals and random on-site energies, adsorbed molecules bound states located inside of the (10,0) single-walled carbon nano tubes energy gap, where it is similar to the reported experimental results for O 2 adsorption while for other values there is no bound states inside of energy gap. This is similar to the N 2 adsorption on semiconductor single-walled carbon nano tubes.

  3. An Analytical Planning Model to Estimate the Optimal Density of Charging Stations for Electric Vehicles.

    Directory of Open Access Journals (Sweden)

    Yongjun Ahn

    Full Text Available The charging infrastructure location problem is becoming more significant due to the extensive adoption of electric vehicles. Efficient charging station planning can solve deeply rooted problems, such as driving-range anxiety and the stagnation of new electric vehicle consumers. In the initial stage of introducing electric vehicles, the allocation of charging stations is difficult to determine due to the uncertainty of candidate sites and unidentified charging demands, which are determined by diverse variables. This paper introduces the Estimating the Required Density of EV Charging (ERDEC stations model, which is an analytical approach to estimating the optimal density of charging stations for certain urban areas, which are subsequently aggregated to city level planning. The optimal charging station's density is derived to minimize the total cost. A numerical study is conducted to obtain the correlations among the various parameters in the proposed model, such as regional parameters, technological parameters and coefficient factors. To investigate the effect of technological advances, the corresponding changes in the optimal density and total cost are also examined by various combinations of technological parameters. Daejeon city in South Korea is selected for the case study to examine the applicability of the model to real-world problems. With real taxi trajectory data, the optimal density map of charging stations is generated. These results can provide the optimal number of chargers for driving without driving-range anxiety. In the initial planning phase of installing charging infrastructure, the proposed model can be applied to a relatively extensive area to encourage the usage of electric vehicles, especially areas that lack information, such as exact candidate sites for charging stations and other data related with electric vehicles. The methods and results of this paper can serve as a planning guideline to facilitate the extensive

  4. An Analytical Planning Model to Estimate the Optimal Density of Charging Stations for Electric Vehicles.

    Science.gov (United States)

    Ahn, Yongjun; Yeo, Hwasoo

    2015-01-01

    The charging infrastructure location problem is becoming more significant due to the extensive adoption of electric vehicles. Efficient charging station planning can solve deeply rooted problems, such as driving-range anxiety and the stagnation of new electric vehicle consumers. In the initial stage of introducing electric vehicles, the allocation of charging stations is difficult to determine due to the uncertainty of candidate sites and unidentified charging demands, which are determined by diverse variables. This paper introduces the Estimating the Required Density of EV Charging (ERDEC) stations model, which is an analytical approach to estimating the optimal density of charging stations for certain urban areas, which are subsequently aggregated to city level planning. The optimal charging station's density is derived to minimize the total cost. A numerical study is conducted to obtain the correlations among the various parameters in the proposed model, such as regional parameters, technological parameters and coefficient factors. To investigate the effect of technological advances, the corresponding changes in the optimal density and total cost are also examined by various combinations of technological parameters. Daejeon city in South Korea is selected for the case study to examine the applicability of the model to real-world problems. With real taxi trajectory data, the optimal density map of charging stations is generated. These results can provide the optimal number of chargers for driving without driving-range anxiety. In the initial planning phase of installing charging infrastructure, the proposed model can be applied to a relatively extensive area to encourage the usage of electric vehicles, especially areas that lack information, such as exact candidate sites for charging stations and other data related with electric vehicles. The methods and results of this paper can serve as a planning guideline to facilitate the extensive adoption of electric

  5. Conformational sensitivity of conjugated poly(ethylene oxide)-poly(amidoamine) molecules to cations adducted upon electrospray ionization – A mass spectrometry, ion mobility and molecular modeling study

    Energy Technology Data Exchange (ETDEWEB)

    Tintaru, Aura [Aix-Marseille Université – CNRS, UMR 7273, Institut de Chimie Radicalaire, Marseille (France); Chendo, Christophe [Aix-Marseille Université – CNRS, FR 1739, Fédération des Sciences Chimiques de Marseille, Spectropole, Marseille (France); Wang, Qi [Aix-Marseille Université – CNRS, UMR 6114, Centre Interdisciplinaire de Nanosciences de Marseille, Marseille (France); Viel, Stéphane [Aix-Marseille Université – CNRS, UMR 7273, Institut de Chimie Radicalaire, Marseille (France); Quéléver, Gilles; Peng, Ling [Aix-Marseille Université – CNRS, UMR 6114, Centre Interdisciplinaire de Nanosciences de Marseille, Marseille (France); Posocco, Paola [University of Trieste, Molecular Simulation Engineering (MOSE) Laboratory, Department of Engineering and Architecture (DEA), Trieste (Italy); National Interuniversity Consortium for Material Science and Technology (INSTM), Research Unit MOSE-DEA, University of Trieste, Trieste (Italy); Pricl, Sabrina, E-mail: sabrina.pricl@di3.units.it [University of Trieste, Molecular Simulation Engineering (MOSE) Laboratory, Department of Engineering and Architecture (DEA), Trieste (Italy); National Interuniversity Consortium for Material Science and Technology (INSTM), Research Unit MOSE-DEA, University of Trieste, Trieste (Italy); Charles, Laurence, E-mail: laurence.charles@univ-amu.fr [Aix-Marseille Université – CNRS, UMR 7273, Institut de Chimie Radicalaire, Marseille (France)

    2014-01-15

    Graphical abstract: -- Highlights: •ESI-MS/MS, IMS and molecular modeling were combined to study PEO-PAMAM conformation. •Protonated and lithiated molecules were studied, with charge states from 2 to 4. •Protonation mostly occurred on PAMAM, with PEO units enclosing the protonated group. •Lithium adduction on PEO units lead to more expanded conformations. •Charge location strongly influenced PEO-PAMAM dissociation behavior. -- Abstract: Tandem mass spectrometry and ion mobility spectrometry experiments were performed on multiply charged molecules formed upon conjugation of a poly(amidoamine) (PAMAM) dendrimer with a poly(ethylene oxide) (PEO) linear polymer to evidence any conformational modification as a function of their charge state (2+ to 4+) and of the adducted cation (H{sup +}vs Li{sup +}). Experimental findings were rationalized by molecular dynamics simulations. The G0 PAMAM head-group could accommodate up to three protons, with protonated terminal amine group enclosed in a pseudo 18-crown-6 ring formed by the PEO segment. This particular conformation enabled a hydrogen bond network which allowed long-range proton transfer to occur during collisionally activated dissociation. In contrast, lithium adduction was found to mainly occur onto oxygen atoms of the polyether, each Li{sup +} cation being coordinated by a 12-crown-4 pseudo structure. As a result, for the studied polymeric segment (M{sub n} = 1500 g mol{sup −1}), PEO-PAMAM hybrid molecules exhibited a more expanded shape when adducted to lithium as compared to proton.

  6. Charge retention in scaled SONOS nonvolatile semiconductor memory devices—Modeling and characterization

    Science.gov (United States)

    Hu, Yin; White, Marvin H.

    1993-10-01

    A new analytical model is developed to investigate the influence of the charge loss processes in the retention mode of the SONOS NVSM device. The model considers charge loss by the following processes: (1) electron back-tunneling from the nitride traps to the Si conduction band, (2) electron back-tunneling from the nitride traps to the Si/SiO 2 interface traps and (3) hole injection from the Si valence band to the nitride traps. An amphoteric trap charge distribution is used in this model. The new charge retention model predicts that process (1) determines the short term retention, while processes (2) and (3) determine the long term retention. Good agreement has been reached between the results of analytical calculations and the experimental retention data on both surface channel and buried channel SONOS devices.

  7. Modeling space-charge-limited currents in organic semiconductors: Extracting trap density and mobility

    KAUST Repository

    Dacuñ a, Javier; Salleo, Alberto

    2011-01-01

    We have developed and have applied a mobility edge model that takes drift and diffusion currents to characterize the space-charge-limited current in organic semiconductors into account. The numerical solution of the drift-diffusion equation allows

  8. Squeezout phenomena and boundary layer formation of a model ionic liquid under confinement and charging

    Science.gov (United States)

    Capozza, R.; Vanossi, A.; Benassi, A.; Tosatti, E.

    2015-02-01

    Electrical charging of parallel plates confining a model ionic liquid down to nanoscale distances yields a variety of charge-induced changes in the structural features of the confined film. That includes even-odd switching of the structural layering and charging-induced solidification and melting, with important changes of local ordering between and within layers, and of squeezout behavior. By means of molecular dynamics simulations, we explore this variety of phenomena in the simplest charged Lennard-Jones coarse-grained model including or excluding the effect a neutral tail giving an anisotropic shape to one of the model ions. Using these models and open conditions permitting the flow of ions in and out of the interplate gap, we simulate the liquid squeezout to obtain the distance dependent structure and forces between the plates during their adiabatic approach under load. Simulations at fixed applied force illustrate an effective electrical pumping of the ionic liquid, from a thick nearly solid film that withstands the interplate pressure for high plate charge to complete squeezout following melting near zero charge. Effective enthalpy curves obtained by integration of interplate forces versus distance show the local minima that correspond to layering and predict the switching between one minimum and another under squeezing and charging.

  9. An advanced Lithium-ion battery optimal charging strategy based on a coupled thermoelectric model

    International Nuclear Information System (INIS)

    Liu, Kailong; Li, Kang; Yang, Zhile; Zhang, Cheng; Deng, Jing

    2017-01-01

    Lithium-ion batteries are widely adopted as the power supplies for electric vehicles. A key but challenging issue is to achieve optimal battery charging, while taking into account of various constraints for safe, efficient and reliable operation. In this paper, a triple-objective function is first formulated for battery charging based on a coupled thermoelectric model. An advanced optimal charging strategy is then proposed to develop the optimal constant-current-constant-voltage (CCCV) charge current profile, which gives the best trade-off among three conflicting but important objectives for battery management. To be specific, a coupled thermoelectric battery model is first presented. Then, a specific triple-objective function consisting of three objectives, namely charging time, energy loss, and temperature rise (both the interior and surface), is proposed. Heuristic methods such as Teaching-learning-based-optimization (TLBO) and particle swarm optimization (PSO) are applied to optimize the triple-objective function, and their optimization performances are compared. The impacts of the weights for different terms in the objective function are then assessed. Experimental results show that the proposed optimal charging strategy is capable of offering desirable effective optimal charging current profiles and a proper trade-off among the conflicting objectives. Further, the proposed optimal charging strategy can be easily extended to other battery types.

  10. Charged-current inclusive neutrino cross sections in the SuperScaling model

    Energy Technology Data Exchange (ETDEWEB)

    Ivanov, M. V., E-mail: martin.inrne@gmail.com [Institute for Nuclear Research and Nuclear Energy, Bulgarian Academy of Sciences, Sofia 1784 (Bulgaria); Grupo de Física Nuclear, Departamento de Física Atómica, Molecular y Nuclear, Facultad de Ciencias Físicas, Universidad Complutense de Madrid, Madrid E-28040 (Spain); Megias, G. D.; Caballero, J. A. [Departamento de Física Atómica, Molecular y Nuclear, Universidad de Sevilla, 41080 Sevilla (Spain); González-Jiménez, R. [Department of Physics and Astronomy, Ghent University, Proeftuinstraat 86, B-9000 Gent (Belgium); Moreno, O.; Donnelly, T. W. [Center for Theoretical Physics, Laboratory for Nuclear Science and Department of Physics, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); Barbaro, M. B. [Dipartimento di Fisica, Università di Torino and INFN, Sezione di Torino, Via P. Giuria 1, 10125 Torino (Italy); Antonov, A. N. [Institute for Nuclear Research and Nuclear Energy, Bulgarian Academy of Sciences, Sofia 1784 (Bulgaria); Moya de Guerra, E.; Udías, J. M. [Grupo de Física Nuclear, Departamento de Física Atómica, Molecular y Nuclear, Facultad de Ciencias Físicas, Universidad Complutense de Madrid, Madrid E-28040 (Spain)

    2016-03-25

    SuperScaling model (SuSA) predictions to neutrino-induced charged-current π{sup +} production in the Δ-resonance region are explored under MiniBooNE experimental conditions. The SuSA charged-current π{sup +} results are in good agreement with data on neutrino flux-averaged double-differential cross sections. The SuSA model for quasielastic scattering and its extension to the pion production region are used for predictions of charged-current inclusive neutrino-nucleus cross sections. Results are also compared with the T2K experimental data for inclusive scattering.

  11. Morphological Analysis on Business Model of Electric Vehicles Charging Infrastructure in China

    DEFF Research Database (Denmark)

    Li, Suxiu; Liu, Yingqi; Wang, Jingyu

    2016-01-01

    of EVs charging infrastructure business model for China, and takes the city Shenzhen as a case study. The research shows that we can achieve EVs Charging infrastructure business model innovation by combining design possibility on the right side of morphological box as much as possible.......The issues of energy crisis and environment pollution have paved opportunities to electric vehicles (EVs), many countries take it as an effective way to reducing the depletion of fossil fuels and CO2 emissions. As the energy supply of electric vehicles, the development of charging infrastructure...

  12. Beta functions and central charge of supersymmetric sigma models with torsion

    International Nuclear Information System (INIS)

    Guadagnini, E.; Mintchev, M.

    1987-01-01

    We present a method for the computation of the renormalization group β-functions and the central charge in two-dimensional supersymmetric sigma models in a gravitational background. The two-loops results are exhibited. We use the Pauli-Villars regularization which preserves supersymmetry and permits an unambiguous treatment of the model with torsion. The central charge we derive for a general manifold is in agreement with the expression found on group manifolds. (orig.)

  13. Charge asymmetry in e+e- → γ + hadrons: New tests of the quark-parton model and fractional charge

    International Nuclear Information System (INIS)

    Brodsky, S.J.; Carlson, C.E.; Suaya, R.

    1976-01-01

    We consider the process e + e - → γ + h + X, where h is a hadron and γ is a hard photon, and show how it can be used to test the quark-parton model. Detailed formulas are given for the cross sections, which in the quark-parton model are products of cross sections for e + e - → γμanti μ and quark breakup functions. We focus on the asymmetry between h and h-bar production, and display sum rules and ratio tests which measure the quark charge, the quark Compton amplitude, and the large-x behavior of the quark breakup function. The asymmetry is calculated for the muon case, and is about 100% for the forward direction

  14. A n-vector model for charge transport in molecular semiconductors.

    Science.gov (United States)

    Jackson, Nicholas E; Kohlstedt, Kevin L; Chen, Lin X; Ratner, Mark A

    2016-11-28

    We develop a lattice model utilizing coarse-grained molecular sites to study charge transport in molecular semiconducting materials. The model bridges atomistic descriptions and structureless lattice models by mapping molecular structure onto sets of spatial vectors isomorphic with spin vectors in a classical n-vector Heisenberg model. Specifically, this model incorporates molecular topology-dependent orientational and intermolecular coupling preferences, including the direct inclusion of spatially correlated transfer integrals and site energy disorder. This model contains the essential physics required to explicitly simulate the interplay of molecular topology and correlated structural disorder, and their effect on charge transport. As a demonstration of its utility, we apply this model to analyze the effects of long-range orientational correlations, molecular topology, and intermolecular interaction strength on charge motion in bulk molecular semiconductors.

  15. Complexation of metal ions with humic acid: charge neutralization model

    International Nuclear Information System (INIS)

    Kim, J.I.; Czerwinski, K.R.

    1995-01-01

    A number of different approaches are being used for describing the complexation equilibrium of actinide ions with humic or fulvic acid. The approach chosen and verified experimentally by Tu Muenchen will be discussed with notable examples from experiment. This approach is based on the conception that a given actinide ion is neutralized upon complexation with functional groups of humic or fulvic acid, e.g. carboxylic and phenolic groups, which are known as heterogeneously cross-linked polyelectrolytes. The photon energy transfer experiment with laser light excitation has shown that the actinide ion binding with the functional groups is certainly a chelation process accompanied by metal ion charge neutralization. This fact is in accordance with the experimental evidence of the postulated thermodynamic equilibrium reaction. The experimental results are found to be independent of origin of humic or fulvic acid and applicable for a broad range of pH. (authors). 23 refs., 7 figs., 1 tab

  16. Model for diffusion of a narrow beam of charged particles

    International Nuclear Information System (INIS)

    Eisenhauer, C.

    1980-01-01

    A simple analytic expression is presented to describe the three-dimensioned spatial distribution of flux or energy deposition by a narrow beam of charged particles. In this expression distances are expressed in terms of a scaling parameter that is proportional to the mean square scattering angle in a single collision. Finite ranges are expressed in terms of the continuous-slowing-down range. Track-length distributions for one-velocity particles and energy deposition for electrons are discussed. Comparisons with rigorous Monte Carlo calculations show that departures from the analytic expression can be expressed as a slowly varying function of order unity. This function can be used as a basis for interpolation over a wide range of source energies and materials

  17. A stochastic model for magnetic dynamics in single-molecule magnets

    Energy Technology Data Exchange (ETDEWEB)

    López-Ruiz, R., E-mail: rlruiz@ifi.unicamp.br [Instituto de Física Gleb Wataghin - Universidade Estadual de Campinas, 13083-859 Campinas (SP) (Brazil); Almeida, P.T. [Instituto de Física Gleb Wataghin - Universidade Estadual de Campinas, 13083-859 Campinas (SP) (Brazil); Vaz, M.G.F. [Instituto de Química, Universidade Federal Fluminense, 24020-150 Niterói (RJ) (Brazil); Novak, M.A. [Instituto de Física - Universidade Federal do Rio de Janeiro, 21941-972 Rio de Janeiro (RJ) (Brazil); Béron, F.; Pirota, K.R. [Instituto de Física Gleb Wataghin - Universidade Estadual de Campinas, 13083-859 Campinas (SP) (Brazil)

    2016-04-01

    Hysteresis and magnetic relaxation curves were performed on double well potential systems with quantum tunneling possibility via stochastic simulations. Simulation results are compared with experimental ones using the Mn{sub 12} single-molecule magnet, allowing us to introduce time dependence in the model. Despite being a simple simulation model, it adequately reproduces the phenomenology of a thermally activated quantum tunneling and can be extended to other systems with different parameters. Assuming competition between the reversal modes, thermal (over) and tunneling (across) the anisotropy barrier, a separation of classical and quantum contributions to relaxation time can be obtained. - Highlights: • Single-molecule magnets are modeled using a simple stochastic approach. • Simulation reproduces thermally-activated tunnelling magnetization reversal features. • The time is introduced in hysteresis and relaxation simulations. • We can separate the quantum and classical contributions to decay time.

  18. Modeling the Release Kinetics of Poorly Water-Soluble Drug Molecules from Liposomal Nanocarriers

    Directory of Open Access Journals (Sweden)

    Stephan Loew

    2011-01-01

    Full Text Available Liposomes are frequently used as pharmaceutical nanocarriers to deliver poorly water-soluble drugs such as temoporfin, cyclosporine A, amphotericin B, and paclitaxel to their target site. Optimal drug delivery depends on understanding the release kinetics of the drug molecules from the host liposomes during the journey to the target site and at the target site. Transfer of drugs in model systems consisting of donor liposomes and acceptor liposomes is known from experimental work to typically exhibit a first-order kinetics with a simple exponential behavior. In some cases, a fast component in the initial transfer is present, in other cases the transfer is sigmoidal. We present and analyze a theoretical model for the transfer that accounts for two physical mechanisms, collisions between liposomes and diffusion of the drug molecules through the aqueous phase. Starting with the detailed distribution of drug molecules among the individual liposomes, we specify the conditions that lead to an apparent first-order kinetic behavior. We also discuss possible implications on the transfer kinetics of (1 high drug loading of donor liposomes, (2 attractive interactions between drug molecules within the liposomes, and (3 slow transfer of drugs between the inner and outer leaflets of the liposomes.

  19. Modeling of diatomic molecule using the Morse potential and the Verlet algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Fidiani, Elok [Department of Physics, Parahyangan Catholic University, Bandung-Jawa Barat (Indonesia)

    2016-03-11

    Performing molecular modeling usually uses special software for Molecular Dynamics (MD) such as: GROMACS, NAMD, JMOL etc. Molecular dynamics is a computational method to calculate the time dependent behavior of a molecular system. In this work, MATLAB was used as numerical method for a simple modeling of some diatomic molecules: HCl, H{sub 2} and O{sub 2}. MATLAB is a matrix based numerical software, in order to do numerical analysis, all the functions and equations describing properties of atoms and molecules must be developed manually in MATLAB. In this work, a Morse potential was generated to describe the bond interaction between the two atoms. In order to analyze the simultaneous motion of molecules, the Verlet Algorithm derived from Newton’s Equations of Motion (classical mechanics) was operated. Both the Morse potential and the Verlet algorithm were integrated using MATLAB to derive physical properties and the trajectory of the molecules. The data computed by MATLAB is always in the form of a matrix. To visualize it, Visualized Molecular Dynamics (VMD) was performed. Such method is useful for development and testing some types of interaction on a molecular scale. Besides, this can be very helpful for describing some basic principles of molecular interaction for educational purposes.

  20. Modeling of diatomic molecule using the Morse potential and the Verlet algorithm

    International Nuclear Information System (INIS)

    Fidiani, Elok

    2016-01-01

    Performing molecular modeling usually uses special software for Molecular Dynamics (MD) such as: GROMACS, NAMD, JMOL etc. Molecular dynamics is a computational method to calculate the time dependent behavior of a molecular system. In this work, MATLAB was used as numerical method for a simple modeling of some diatomic molecules: HCl, H_2 and O_2. MATLAB is a matrix based numerical software, in order to do numerical analysis, all the functions and equations describing properties of atoms and molecules must be developed manually in MATLAB. In this work, a Morse potential was generated to describe the bond interaction between the two atoms. In order to analyze the simultaneous motion of molecules, the Verlet Algorithm derived from Newton’s Equations of Motion (classical mechanics) was operated. Both the Morse potential and the Verlet algorithm were integrated using MATLAB to derive physical properties and the trajectory of the molecules. The data computed by MATLAB is always in the form of a matrix. To visualize it, Visualized Molecular Dynamics (VMD) was performed. Such method is useful for development and testing some types of interaction on a molecular scale. Besides, this can be very helpful for describing some basic principles of molecular interaction for educational purposes.

  1. A Classical Potential to Model the Adsorption of Biological Molecules on Oxidized Titanium Surfaces.

    Science.gov (United States)

    Schneider, Julian; Ciacchi, Lucio Colombi

    2011-02-08

    The behavior of titanium implants in physiological environments is governed by the thin oxide layer that forms spontaneously on the metal surface and mediates the interactions with adsorbate molecules. In order to study the adsorption of biomolecules on titanium in a realistic fashion, we first build up a model of an oxidized Ti surface in contact with liquid water by means of extensive first-principles molecular dynamics simulations. Taking the obtained structure as reference, we then develop a classical potential to model the Ti/TiOx/water interface. This is based on the mapping with Coulomb and Lennard-Jones potentials of the adsorption energy landscape of single water and ammonia molecules on the rutile TiO2(110) surface. The interactions with arbitrary organic molecules are obtained via standard combination rules to established biomolecular force fields. The transferability of our potential to the case of organic molecules adsorbing on the oxidized Ti surface is checked by comparing the classical potential energy surfaces of representative systems to quantum mechanical results at the level of density functional theory. Moreover, we calculate the heat of immersion of the TiO2 rutile surface and the detachment force of a single tyrosine residue from steered molecular dynamics simulations, finding good agreement with experimental reference data in both cases. As a first application, we study the adsorption behavior of the Arg-Gly-Asp (RGD) peptide on the oxidized titanium surface, focusing particularly on the calculation of the free energy of desorption.

  2. Modeling and simulation of a proton beam space-charge neutralization

    International Nuclear Information System (INIS)

    Fleury, Xavier

    2000-01-01

    The aim of this work is to understand and to model the build-up of a plasma in the low-energy beam transport line of a proton accelerator. This plasma is generated by the beam, which ionizes the residual gas remaining in this low-energy section. By neutralizing the space-charge of the beam, the plasma modifies its transport, thus, to control the beam, it is necessary to study this phenomenon. In this work, we consider a continuous beam and we take interest in the stationary states of the plasma. We first restrict the description of the plasma to a plane perpendicular to the beam, by assuming that the beam and the plasma are longitudinally invariant. The build-up of the plasma is first described with a kinetic model where binary collisions are neglected, based on the Vlasov-Poisson system with source terms which take into account ionization. We prove mathematically that this system has no stationary solution, by using appropriate subsets of the phase-space that we call trapping-sets. Yet, measurements show that the plasma evolves towards a steady state. To account for this evolution, we modify the source terms of the model. The resulting model is solved by a particle-in-cell method, and the results are compared to the measurements. Then, we show that binary collisions between plasma electrons and beam ions or gas molecules help to maintain the equilibrium of the plasma. In the last part of the thesis, we use hydrodynamic models to investigate more easily the coupling between transversal and longitudinal effects. The preliminary study of a one-dimensional model enables to find the behaviour of the transverse potential of the plasma. Finally, a two-dimensional model of the transport of the beam when it is neutralized by the plasma is solved numerically, which shows that the longitudinal electric field should play an important role in the set-up of the equilibrium of the plasma. (author) [fr

  3. Benchmarking density functional tight binding models for barrier heights and reaction energetics of organic molecules.

    Science.gov (United States)

    Gruden, Maja; Andjeklović, Ljubica; Jissy, Akkarapattiakal Kuriappan; Stepanović, Stepan; Zlatar, Matija; Cui, Qiang; Elstner, Marcus

    2017-09-30

    Density Functional Tight Binding (DFTB) models are two to three orders of magnitude faster than ab initio and Density Functional Theory (DFT) methods and therefore are particularly attractive in applications to large molecules and condensed phase systems. To establish the applicability of DFTB models to general chemical reactions, we conduct benchmark calculations for barrier heights and reaction energetics of organic molecules using existing databases and several new ones compiled in this study. Structures for the transition states and stable species have been fully optimized at the DFTB level, making it possible to characterize the reliability of DFTB models in a more thorough fashion compared to conducting single point energy calculations as done in previous benchmark studies. The encouraging results for the diverse sets of reactions studied here suggest that DFTB models, especially the most recent third-order version (DFTB3/3OB augmented with dispersion correction), in most cases provide satisfactory description of organic chemical reactions with accuracy almost comparable to popular DFT methods with large basis sets, although larger errors are also seen for certain cases. Therefore, DFTB models can be effective for mechanistic analysis (e.g., transition state search) of large (bio)molecules, especially when coupled with single point energy calculations at higher levels of theory. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  4. A Monte Carlo modeling on charging effect for structures with arbitrary geometries

    Science.gov (United States)

    Li, C.; Mao, S. F.; Zou, Y. B.; Li, Yong Gang; Zhang, P.; Li, H. M.; Ding, Z. J.

    2018-04-01

    Insulating materials usually suffer charging effects when irradiated by charged particles. In this paper, we present a Monte Carlo study on the charging effect caused by electron beam irradiation for sample structures with any complex geometry. When transporting in an insulating solid, electrons encounter elastic and inelastic scattering events; the Mott cross section and a Lorentz-type dielectric function are respectively employed to describe such scatterings. In addition, the band gap and the electron–long optical phonon interaction are taken into account. The electronic excitation in inelastic scattering causes generation of electron–hole pairs; these negative and positive charges establish an inner electric field, which in turn induces the drift of charges to be trapped by impurities, defects, vacancies etc in the solid, where the distributions of trapping sites are assumed to have uniform density. Under charging conditions, the inner electric field distorts electron trajectories, and the surface electric potential dynamically alters secondary electron emission. We present, in this work, an iterative modeling method for a self-consistent calculation of electric potential; the method has advantages in treating any structure with arbitrary complex geometry, in comparison with the image charge method—which is limited to a quite simple boundary geometry. Our modeling is based on: the combination of the finite triangle mesh method for an arbitrary geometry construction; a self-consistent method for the spatial potential calculation; and a full dynamic description for the motion of deposited charges. Example calculations have been done to simulate secondary electron yield of SiO2 for a semi-infinite solid, the charging for a heterostructure of SiO2 film grown on an Au substrate, and SEM imaging of a SiO2 line structure with rough surfaces and SiO2 nanoparticles with irregular shapes. The simulations have explored interesting interlaced charge layer distribution

  5. A Mathematical Model of Membrane Gas Separation with Energy Transfer by Molecules of Gas Flowing in a Channel to Molecules Penetrating this Channel from the Adjacent Channel

    Directory of Open Access Journals (Sweden)

    Szwast Maciej

    2015-06-01

    Full Text Available The paper presents the mathematical modelling of selected isothermal separation processes of gaseous mixtures, taking place in plants using membranes, in particular nonporous polymer membranes. The modelling concerns membrane modules consisting of two channels - the feeding and the permeate channels. Different shapes of the channels cross-section were taken into account. Consideration was given to co-current and counter-current flows, for feeding and permeate streams, respectively, flowing together with the inert gas receiving permeate. In the proposed mathematical model it was considered that pressure of gas changes along the length of flow channels was the result of both - the drop of pressure connected with flow resistance, and energy transfer by molecules of gas flowing in a given channel to molecules which penetrate this channel from the adjacent channel. The literature on membrane technology takes into account only the drop of pressure connected with flow resistance. Consideration given to energy transfer by molecules of gas flowing in a given channel to molecules which penetrate this channel from the adjacent channel constitute the essential novelty in the current study. The paper also presents results of calculations obtained by means of a computer program which used equations of the derived model. Physicochemical data concerning separation of the CO2/CH4 mixture with He as the sweep gas and data concerning properties of the membrane made of PDMS were assumed for calculations.

  6. Working fluid charge oriented off-design modeling of a small scale Organic Rankine Cycle system

    International Nuclear Information System (INIS)

    Liu, Liuchen; Zhu, Tong; Ma, Jiacheng

    2017-01-01

    Highlights: • Organic Rankine Cycle model considering working fluid charge has been established. • Overall solution algorithm of system off-design performance is proposed. • Variation trend of different zones in both heat exchangers can be observed. • Optimal working fluid charge volume for different output work has been estimated. - Abstract: Organic Rankine Cycle system is one of the most widely used technique for low-grade waste heat recovery. Developing of dynamic Organic Rankine Cycle models played an increasingly important part in system performance prediction. The present paper developed a working fluid charge oriented model for an small scale Organic Rankine Cycle to calculate the theoretical value of working fluid charge level for the system under rated condition. The two heat exchangers are divided into three different zones and related heat transfer correlations are employed to estimate the length variation of each zones. Steady state models have been applied to describe the performance of pump and expander. Afterwards, an overall solution algorithm based on the established model has been proposed in order to exact simulate the system’s off-design performance. Additionally, the impact of different working fluid charge volumes has also been discussed. Simulation results clearly shows the variation trend of different zones in both heat exchangers, as well as the variation trend of system operating parameters under various expander output work. Furthermore, the highest thermal efficiency can be reached 6.37% under rated conditions with a working fluid charge volume of 34.6 kg.

  7. Charged particle emission: the Child-Langmuir model

    International Nuclear Information System (INIS)

    Degond, P.; Raviart, P.A.

    1993-01-01

    The recent mathematical results concerning boundary emission modelling are reviewed with a synthetical view. The plane diode case is first studied; the Child-Langmuir model is then characterized as the limit to an absolutely non standard singular perturbation problem and is associated with approximate models (constrained and penalized models) which may be easily generalized in more realistic cases; an iterative solution method for the penalized problem is studied. The derived Child-Langmuir model is extended to the cylindrical diode case and to an arbitrary geometry case: constrained and penalized models related to the stationary Vlasov-Poisson equations are studied and extended to the Vlasov-Maxwell evolution equation general case

  8. Modeling plug-in electric vehicle charging demand with BEAM: the framework for behavior energy autonomy mobility

    Energy Technology Data Exchange (ETDEWEB)

    Sheppard, Colin; Waraich, Rashid; Campbell, Andrew; Pozdnukov, Alexei; Gopal, Anand R.

    2017-05-01

    This report summarizes the BEAM modeling framework (Behavior, Energy, Mobility, and Autonomy) and its application to simulating plug-in electric vehicle (PEV) mobility, energy consumption, and spatiotemporal charging demand. BEAM is an agent-based model of PEV mobility and charging behavior designed as an extension to MATSim (the Multi-Agent Transportation Simulation model). We apply BEAM to the San Francisco Bay Area and conduct a preliminary calibration and validation of its prediction of charging load based on observed charging infrastructure utilization for the region in 2016. We then explore the impact of a variety of common modeling assumptions in the literature regarding charging infrastructure availability and driver behavior. We find that accurately reproducing observed charging patterns requires an explicit representation of spatially disaggregated charging infrastructure as well as a more nuanced model of the decision to charge that balances tradeoffs people make with regards to time, cost, convenience, and range anxiety.

  9. Electron capture in ion-molecule collisions at intermediate energy

    International Nuclear Information System (INIS)

    Kumura, M.

    1986-01-01

    Recent progress of theoretical charge transfer study in ion-molecule collisions at the intermediate energy is reviewed. Concept of close and distant collisions obtained from extensive ion-atom collision studies is identified so that it can be utilized to model two distinct collision processes. For a close collision, explicit representation of the whole collision complex is necessary to describe collision dynamics correctly, while a model potential approach for molecule is appropriate for a distant collision. It is shown that these two distinct models are indeed capable of reproducing experimental charge transfer cross sections. Some remarks for further theoretical study of ion-molecule collisions are also given. 21 refs., 8 figs

  10. Study of the double charge-changing collision cross-sections of H+, D+, Li+ ions with organic molecules in the energy range 10-50 keV

    International Nuclear Information System (INIS)

    Farrokhi, S.

    1966-01-01

    The variation of the double charge-changing collision cross-sections of H + , D + , Li + ions with organic molecules (CH 4 , C 2 H 6 , C 3 H 8 , C 4 H 10 ) in the energy range 10-50 keV has been studied. Several maximums for σ 1-1 = f(E) have been shown. Their existence should be explained by the different possibilities of dissociating the target-molecules. The position of the maximums, for the H + → H - and D + → D - reactions is in good agreement with that defined by the Massey adiabatic relation. (author) [fr

  11. Electrical charging effects on the sliding friction of a model nano-confined ionic liquid

    Energy Technology Data Exchange (ETDEWEB)

    Capozza, R.; Vanossi, A. [International School for Advanced Studies (SISSA), Via Bonomea 265, 34136 Trieste (Italy); CNR-IOM Democritos National Simulation Center, Via Bonomea 265, 34136 Trieste (Italy); Benassi, A. [CNR-IOM Democritos National Simulation Center, Via Bonomea 265, 34136 Trieste (Italy); Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Tosatti, E. [International School for Advanced Studies (SISSA), Via Bonomea 265, 34136 Trieste (Italy); CNR-IOM Democritos National Simulation Center, Via Bonomea 265, 34136 Trieste (Italy); International Centre for Theoretical Physics (ICTP), Strada Costiera 11, 34014 Trieste (Italy)

    2015-10-14

    Recent measurements suggest the possibility to exploit ionic liquids (ILs) as smart lubricants for nano-contacts, tuning their tribological and rheological properties by charging the sliding interfaces. Following our earlier theoretical study of charging effects on nanoscale confinement and squeezout of a model IL, we present here molecular dynamics simulations of the frictional and lubrication properties of that model under charging conditions. First, we describe the case when two equally charged plates slide while being held together to a confinement distance of a few molecular layers. The shear sliding stress is found to rise strongly and discontinuously as the number of IL layers decreases stepwise. However, the shear stress shows, within each given number of layers, only a weak dependence upon the precise value of the normal load, a result in agreement with data extracted from recent experiments. We subsequently describe the case of opposite charging of the sliding plates and follow the shear stress when the charging is slowly and adiabatically reversed in the course of time, under fixed load. Despite the fixed load, the number and structure of the confined IL layers change with changing charge, and that in turn drives strong friction variations. The latter involves first of all charging-induced freezing of the IL film, followed by a discharging-induced melting, both made possible by the nanoscale confinement. Another mechanism for charging-induced frictional changes is a shift of the plane of maximum shear from mid-film to the plate-film interface, and vice versa. While these occurrences and results invariably depend upon the parameters of the model IL and upon its specific interaction with the plates, the present study helps identifying a variety of possible behavior, obtained under very simple assumptions, while connecting it to an underlying equilibrium thermodynamics picture.

  12. Currents, charges, and canonical structure of pseudodual chiral models

    International Nuclear Information System (INIS)

    Curtright, T.; Zachos, C.

    1994-01-01

    We discuss the pseudodual chiral model to illustrate a class of two-dimensional theories which have an infinite number of conservation laws but allow particle production, at variance with naive expectations. We describe the symmetries of the pseudodual model, both local and nonlocal, as transmutations of the symmetries of the usual chiral model. We refine the conventional algorithm to more efficiently produce the nonlocal symmetries of the model, and we discuss the complete local current algebra for the pseudodual theory. We also exhibit the canonical transformation which connects the usual chiral model to its fully equivalent dual, further distinguishing the pseudodual theory

  13. Business Models for Solar Powered Charging Stations to Develop Infrastructure for Electric Vehicles

    Directory of Open Access Journals (Sweden)

    Jessica Robinson

    2014-10-01

    Full Text Available Electric power must become less dependent on fossil fuels and transportation must become more electric to decrease carbon emissions and mitigate climate change. Increasing availability and accessibility of charging stations is predicted to increase purchases of electric vehicles. In order to address the current inadequate charging infrastructure for electric vehicles, major entities must adopt business models for solar powered charging stations (SPCS. These SPCS should be located in parking lots to produce electricity for the grid and provide an integrated infrastructure for charging electric vehicles. Due to the lack of information related to SPCS business models, this manuscript designs several models for major entities including industry, the federal and state government, utilities, universities, and public parking. A literature review of the available relevant business models and case studies of constructed charging stations was completed to support the proposals. In addition, a survey of a university’s students, staff, and faculty was conducted to provide consumer research on people’s opinion of SPCS construction and preference of business model aspects. Results showed that 69% of respondents would be more willing to invest in an electric vehicle if there was sufficient charging station infrastructure at the university. Among many recommendations, the business models suggest installing level 1 charging for the majority of entities, and to match entities’ current pricing structures for station use. The manuscript discusses the impacts of fossil fuel use, and the benefits of electric car and SPCS use, accommodates for the present gap in available literature on SPCS business models, and provides current consumer data for SPCS and the models proposed.

  14. Electric Vehicle Fast-Charging Station Unified Modeling and Stability Analysis in the dq Frame

    Directory of Open Access Journals (Sweden)

    Xiang Wang

    2018-05-01

    Full Text Available The electric vehicle fast-charging station is an important guarantee for the popularity of electric vehicle. As the fast-charging piles are voltage source converters, stability issues will occur in the grid-connected fast-charging station. Since the dynamic input admittance of the fast-charging pile and the dynamic output impedance play an important role in the interaction system stability, the station and grid interaction system is regarded as load-side and source-side sub-systems to build the dynamic impedance model. The dynamic input admittance in matrix form is derived from the fast-charging pile current control loop considering the influence of the LC filter. Similarly, the dynamic output impedance can be obtained similarly by considering the regional power grid capacity, transformer capacity, and feed line length. On this basis, a modified forbidden region-based stability criterion is used for the fast-charging station stability analysis. The frequency-domain case studies and time-domain simulations are presented next to show the influence of factors from both the power grid side and fast-charging pile side. The simulation results validated the effectiveness of the dq frame impedance model and the stability analysis method.

  15. A kinetic Monte Carlo model with improved charge injection model for the photocurrent characteristics of organic solar cells

    Science.gov (United States)

    Kipp, Dylan; Ganesan, Venkat

    2013-06-01

    We develop a kinetic Monte Carlo model for photocurrent generation in organic solar cells that demonstrates improved agreement with experimental illuminated and dark current-voltage curves. In our model, we introduce a charge injection rate prefactor to correct for the electrode grid-size and electrode charge density biases apparent in the coarse-grained approximation of the electrode as a grid of single occupancy, charge-injecting reservoirs. We use the charge injection rate prefactor to control the portion of dark current attributed to each of four kinds of charge injection. By shifting the dark current between electrode-polymer pairs, we align the injection timescales and expand the applicability of the method to accommodate ohmic energy barriers. We consider the device characteristics of the ITO/PEDOT/PSS:PPDI:PBTT:Al system and demonstrate the manner in which our model captures the device charge densities unique to systems with small injection energy barriers. To elucidate the defining characteristics of our model, we first demonstrate the manner in which charge accumulation and band bending affect the shape and placement of the various current-voltage regimes. We then discuss the influence of various model parameters upon the current-voltage characteristics.

  16. Charge state evolution in the solar wind. III. Model comparison with observations

    Energy Technology Data Exchange (ETDEWEB)

    Landi, E.; Oran, R.; Lepri, S. T.; Zurbuchen, T. H.; Fisk, L. A.; Van der Holst, B. [Department of Atmospheric, Oceanic and Space Sciences, University of Michigan, Ann Arbor, MI 48109 (United States)

    2014-08-01

    We test three theoretical models of the fast solar wind with a set of remote sensing observations and in-situ measurements taken during the minimum of solar cycle 23. First, the model electron density and temperature are compared to SOHO/SUMER spectroscopic measurements. Second, the model electron density, temperature, and wind speed are used to predict the charge state evolution of the wind plasma from the source regions to the freeze-in point. Frozen-in charge states are compared with Ulysses/SWICS measurements at 1 AU, while charge states close to the Sun are combined with the CHIANTI spectral code to calculate the intensities of selected spectral lines, to be compared with SOHO/SUMER observations in the north polar coronal hole. We find that none of the theoretical models are able to completely reproduce all observations; namely, all of them underestimate the charge state distribution of the solar wind everywhere, although the levels of disagreement vary from model to model. We discuss possible causes of the disagreement, namely, uncertainties in the calculation of the charge state evolution and of line intensities, in the atomic data, and in the assumptions on the wind plasma conditions. Last, we discuss the scenario where the wind is accelerated from a region located in the solar corona rather than in the chromosphere as assumed in the three theoretical models, and find that a wind originating from the corona is in much closer agreement with observations.

  17. Charge state evolution in the solar wind. III. Model comparison with observations

    International Nuclear Information System (INIS)

    Landi, E.; Oran, R.; Lepri, S. T.; Zurbuchen, T. H.; Fisk, L. A.; Van der Holst, B.

    2014-01-01

    We test three theoretical models of the fast solar wind with a set of remote sensing observations and in-situ measurements taken during the minimum of solar cycle 23. First, the model electron density and temperature are compared to SOHO/SUMER spectroscopic measurements. Second, the model electron density, temperature, and wind speed are used to predict the charge state evolution of the wind plasma from the source regions to the freeze-in point. Frozen-in charge states are compared with Ulysses/SWICS measurements at 1 AU, while charge states close to the Sun are combined with the CHIANTI spectral code to calculate the intensities of selected spectral lines, to be compared with SOHO/SUMER observations in the north polar coronal hole. We find that none of the theoretical models are able to completely reproduce all observations; namely, all of them underestimate the charge state distribution of the solar wind everywhere, although the levels of disagreement vary from model to model. We discuss possible causes of the disagreement, namely, uncertainties in the calculation of the charge state evolution and of line intensities, in the atomic data, and in the assumptions on the wind plasma conditions. Last, we discuss the scenario where the wind is accelerated from a region located in the solar corona rather than in the chromosphere as assumed in the three theoretical models, and find that a wind originating from the corona is in much closer agreement with observations.

  18. Charge-transfer cross sections of ground state He+ ions in collisions with He atoms and simple molecules in the energy range below 4.0 keV

    International Nuclear Information System (INIS)

    Kusakabe, Toshio; Kitamuro, Satoshi; Nakai, Yohta; Tawara, Hiroyuki; Sasao, Mamiko

    2012-01-01

    Charge-transfer cross sections of the ground state He + ions in collisions with He atoms and simple molecules (H 2 , D 2 , N 2 , CO and CO 2 ) have been measured in the energy range of 0.20 to 4.0 keV with the initial growth rate method. Since previously published experimental data are scattered in the low energy region, the present observations would provide reasonably reliable cross section data below 4 keV. The charge transfer accompanied by dissociation of product molecular ion can be dominant at low energies for molecular targets. In He + + D 2 collisions, any isotope effect was not observed over the present energy range, compared to H 2 molecule. (author)

  19. Adler-type sum rule, charge symmetry and neutral current in general multi-triplet model

    International Nuclear Information System (INIS)

    Katuya, Mituaki; Baba, Yoshimitsu; Fujii, Kanji

    1975-01-01

    We derive Adler-type sum rule extended to general multi-triplet model. Paying attention to roles of the colour degree of freedom, we discuss the charge symmetry property of the weak charged current and the structure functions for ν(ν - )+N→l(l - )+X, and also the structure of the neutral current. A comment is given on implications in our theory of Koike and Konuma's result on the neutral hadronic current. (auth.)

  20. Modelling of the charge carrier mobility in disordered linear polymer materials

    Czech Academy of Sciences Publication Activity Database

    Toman, Petr; Menšík, Miroslav; Bartkowiak, W.; Pfleger, Jiří

    2017-01-01

    Roč. 19, č. 11 (2017), s. 7760-7771 ISSN 1463-9076 R&D Projects: GA ČR(CZ) GA15-05095S Grant - others:AV ČR(CZ) M200501204 Program:M Institutional support: RVO:61389013 Keywords : charge carrier mobility * conjugated polymer * charge transport modelling Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 4.123, year: 2016

  1. Faradaic Impedance Spectroscopy for Detection of Small Molecules Binding using the Avidin-Biotin Model

    International Nuclear Information System (INIS)

    Yoetz-Kopelman, Tal; Ram, Yaron; Freeman, Amihay; Shacham-Diamand, Yosi

    2015-01-01

    The changes in the Faradaic impedance of gold/biomolecules system due to specific binding of small molecule to a significantly larger binding protein molecule were investigated. The biotin (244.31 Da) - avidin (66000 Da) couple was used as a model for small ligand - binding protein biorecognition. The study was carried out under open circuit potential in the presence of [Fe(CN) 6 ] −3/−4 redox couple. An equivalent electrical circuit was proposed and used for the interpretation of the recorded impedance spectra. Adsorption of thiolated avidin increased the electron transfer resistance, R ct , by a factor of about 7.5 while subsequent addition of biotin within the concentration range of 4.1-40.9 nM reduced the value of R ct by amount proportional to the biotin concentration. The addition of biotin did not affect, however, the equivalent double layer capacitance or other equivalent circuit parameters. A simple model based on effective surface coverage by the avidin molecules and the effect of the added biotin on electron transfer through the coated surface is proposed. A model for the minimum detection limit based on the random distribution of the binding protein and its dimensions is proposed

  2. Fermion local charged boson model and cuprate superconductors

    International Nuclear Information System (INIS)

    Sinha, K.P.; Kakani, S.L.

    2002-01-01

    One of the most exciting developments in Science in past few years is the discovery of high temperature superconductivity (HTSC) in cuprates. It has been observed that the superconducting state in these cuprates is rather normal compared to the anomalous normal state. This discovery has led to deluge of experimental and theoretical researches all along the world. These cuprates are close to metal-insulator transition and the stability of the insulating and metallic phase depends on the degree of doping. Measurements of physical properties of these systems have revealed many anomalous results both in the superconducting and normal states, e.g. d-wave superconducting gap, the presence of pseudo gap in the normal state, static or dynamic striped structure of CuO 2 planes etc. These have posed serious theoretical challenges towards formulating the mechanisms of pairing and explanation of anomalous behaviour. Several theoretical proposals have been advanced and only a few are likely to survive in the teeth of some reliable experimental data. A combined mechanism mediated by phonons and lochons (local charged bosons, local pairs or bipolarons) for the pairing of fermions (holes or electrons) belonging to a wide band provides a microscopic explanation of anomalous normal state properties of HTSC cuprates and vindicates features of the phenomenological marginal Fermi liquid formulation. In the present review article detailed features of combined lochon and phonon mediated pairing mechanism are presented and a contact with the normal and superconducting state properties of HTSC in YBa 2 Cu 3 O x does indicate pair hopping between planes via such resonant centres lying in between the CuO 2 planes. (author)

  3. Sectional modeling of nanoparticle size and charge distributions in dusty plasmas

    International Nuclear Information System (INIS)

    Agarwal, Pulkit; Girshick, Steven L

    2012-01-01

    Sectional models of the dynamics of aerosol populations are well established in the aerosol literature but have received relatively less attention in numerical models of dusty plasmas, where most modeling studies have assumed the existence of monodisperse dust particles. In the case of plasmas in which nanoparticles nucleate and grow, significant polydispersity can exist in particle size distributions, and stochastic charging can cause particles of given size to have a broad distribution of charge states. Sectional models, while computationally expensive, are well suited to treating such distributions. This paper presents an overview of sectional modeling of nanodusty plasmas, and presents examples of simulation results that reveal important qualitative features of the spatiotemporal evolution of such plasmas, many of which could not be revealed by models that consider only monodisperse dust particles and average particle charge. These features include the emergence of bimodal particle populations consisting of very small neutral particles and larger negatively charged particles, the effects of size and charge distributions on coagulation, spreading and structure of the particle cloud, and the dynamics of dusty plasma afterglows. (paper)

  4. Charged ρ Meson Condensate in Neutron Stars within RMF Models

    Directory of Open Access Journals (Sweden)

    Konstantin A. Maslov

    2017-12-01

    Full Text Available Knowledge of the equation of state (EoS of cold and dense baryonic matter is essential for the description of properties of neutron stars (NSs. With an increase of the density, new baryon species can appear in NS matter, as well as various meson condensates. In previous works, we developed relativistic mean-field (RMF models with hyperons and Δ -isobars, which passed the majority of known experimental constraints, including the existence of a 2 M ⊙ neutron star. In this contribution, we present results of the inclusion of ρ − -meson condensation into these models. We have shown that, in one class of the models (so-called KVOR-based models, in which the additional stiffening procedure is introduced in the isoscalar sector, the condensation gives only a small contribution to the EoS. In another class of the models (MKVOR-based models with additional stiffening in isovector sector, the condensation can lead to a first-order phase transition and a substantial decrease of the NS mass. Nevertheless, in all resulting models, the condensation does not spoil the description of the experimental constraints.

  5. Reduced order dynamic model for polysaccharides molecule attached to an atomic force microscope

    International Nuclear Information System (INIS)

    Tang Deman; Li Aiqin; Attar, Peter; Dowell, Earl H.

    2004-01-01

    A dynamic analysis and numerical simulation has been conducted of a polysaccharides molecular structure (a ten (10) single-α-D-glucose molecule chain) connected to a moving atomic force microscope (AFM). Sinusoidal base excitation of the AFM cantilevered beam is considered. First a linearized perturbation model is constructed for the complex polysaccharides molecular structure. Then reduced order (dynamic) models based upon a proper orthogonal decomposition (POD) technique are constructed using global modes for both the linearized perturbation model and for the full nonlinear model. The agreement between the original and reduced order models (ROM/POD) is very good even when only a few global modes are included in the ROM for either the linear case or for the nonlinear case. The computational advantage of the reduced order model is clear from the results presented

  6. Computational models of an inductive power transfer system for electric vehicle battery charge

    Science.gov (United States)

    Anele, A. O.; Hamam, Y.; Chassagne, L.; Linares, J.; Alayli, Y.; Djouani, K.

    2015-09-01

    One of the issues to be solved for electric vehicles (EVs) to become a success is the technical solution of its charging system. In this paper, computational models of an inductive power transfer (IPT) system for EV battery charge are presented. Based on the fundamental principles behind IPT systems, 3 kW single phase and 22 kW three phase IPT systems for Renault ZOE are designed in MATLAB/Simulink. The results obtained based on the technical specifications of the lithium-ion battery and charger type of Renault ZOE show that the models are able to provide the total voltage required by the battery. Also, considering the charging time for each IPT model, they are capable of delivering the electricity needed to power the ZOE. In conclusion, this study shows that the designed computational IPT models may be employed as a support structure needed to effectively power any viable EV.

  7. Computational models of an inductive power transfer system for electric vehicle battery charge

    International Nuclear Information System (INIS)

    Anele, A O; Hamam, Y; Djouani, K; Chassagne, L; Alayli, Y; Linares, J

    2015-01-01

    One of the issues to be solved for electric vehicles (EVs) to become a success is the technical solution of its charging system. In this paper, computational models of an inductive power transfer (IPT) system for EV battery charge are presented. Based on the fundamental principles behind IPT systems, 3 kW single phase and 22 kW three phase IPT systems for Renault ZOE are designed in MATLAB/Simulink. The results obtained based on the technical specifications of the lithium-ion battery and charger type of Renault ZOE show that the models are able to provide the total voltage required by the battery. Also, considering the charging time for each IPT model, they are capable of delivering the electricity needed to power the ZOE. In conclusion, this study shows that the designed computational IPT models may be employed as a support structure needed to effectively power any viable EV. (paper)

  8. Pion-nucleus double charge exchange and the nuclear shell model

    International Nuclear Information System (INIS)

    Auerbach, N.; Gibbs, W.R.; Ginocchio, J.N.; Kaufmann, W.B.

    1988-01-01

    The pion-nucleus double charge exchange reaction is studied with special emphasis on nuclear structure. The reaction mechanism and nuclear structure aspects of the process are separated using both the plane-wave and distorted-wave impulse approximations. Predictions are made employing both the seniority model and a full shell model (with a single active orbit). Transitions to the double analog state and to the ground state of the residual nucleus are computed. The seniority model yields particularly simple relations among double charge exchange cross sections for nuclei within the same shell. Limitations of the seniority model and of the plane-wave impulse approximation are discussed as well as extensions to the generalized seniority scheme. Applications of the foregoing ideas to single charge exchange are also presented

  9. Modeling Electrostatic Fields Generated by Internal Charging of Materials in Space Radiation Environments

    Science.gov (United States)

    Minow, Joseph I.

    2011-01-01

    Internal charging is a risk to spacecraft in energetic electron environments. DICTAT, NU MIT computational codes are the most widely used engineering tools for evaluating internal charging of insulator materials exposed to these environments. Engineering tools are designed for rapid evaluation of ESD threats, but there is a need for more physics based models for investigating the science of materials interactions with energetic electron environments. Current tools are limited by the physics included in the models and ease of user implementation .... additional development work is needed to improve models.

  10. Modeling of radiation-induced charge trapping in MOS devices under ionizing irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Petukhov, M. A., E-mail: m.a.petukhov@gmail.com; Ryazanov, A. I. [National Research Center Kurchatov Institute (Russian Federation)

    2016-12-15

    The numerical model of the radiation-induced charge trapping process in the oxide layer of a MOS device under ionizing irradiation is developed; the model includes carrier transport, hole capture by traps in different states, recombination of free electrons and trapped holes, kinetics of hydrogen ions which can be accumulated in the material during transistor manufacture, and accumulation and charging of interface states. Modeling of n-channel MOSFET behavior under 1 MeV photon irradiation is performed. The obtained dose dependences of the threshold voltage shift and its contributions from trapped holes and interface states are in good agreement with experimental data.

  11. The P9 pocket of HLA-DQ2 (non-Aspbeta57) has no particular preference for negatively charged anchor residues found in other type 1 diabetes-predisposing non-Aspbeta57 MHC class II molecules

    DEFF Research Database (Denmark)

    Quarsten, H; Paulsen, G; Johansen, B H

    1998-01-01

    Susceptibility and resistance to type 1 diabetes are associated with MHC class II alleles that carry non-Asp and Asp at residue 57 of their beta chain respectively. The effect of Asp or non-Aspbeta57 may relate to a differential ability of distinct class II molecules to bind specific immuno......-pathogenic peptides. Recent studies in man and mouse have revealed that some type 1 diabetes-predisposing non-Aspbeta57 class II molecules (i.e. DQ8, DR4Dw15 and I-Ag7) preferentially bind peptides with a negatively charged anchor residue at P9. It has been suggested that this is a common feature of type 1 diabetes......-predisposing class II molecules. The molecular explanation for such a phenomenon could be that class II beta chains with Aspbeta57 form a salt bridge between Aspbeta57 and a conserved Arg of the a chain, whereas in non-Aspbeta57 molecules the Arg is unopposed and free to interact with negatively charged P9 peptide...

  12. Extended charge banking model of dual path shocks for implantable cardioverter defibrillators.

    Science.gov (United States)

    Dosdall, Derek J; Sweeney, James D

    2008-08-01

    Single path defibrillation shock methods have been improved through the use of the Charge Banking Model of defibrillation, which predicts the response of the heart to shocks as a simple resistor-capacitor (RC) circuit. While dual path defibrillation configurations have significantly reduced defibrillation thresholds, improvements to dual path defibrillation techniques have been limited to experimental observations without a practical model to aid in improving dual path defibrillation techniques. The Charge Banking Model has been extended into a new Extended Charge Banking Model of defibrillation that represents small sections of the heart as separate RC circuits, uses a weighting factor based on published defibrillation shock field gradient measures, and implements a critical mass criteria to predict the relative efficacy of single and dual path defibrillation shocks. The new model reproduced the results from several published experimental protocols that demonstrated the relative efficacy of dual path defibrillation shocks. The model predicts that time between phases or pulses of dual path defibrillation shock configurations should be minimized to maximize shock efficacy. Through this approach the Extended Charge Banking Model predictions may be used to improve dual path and multi-pulse defibrillation techniques, which have been shown experimentally to lower defibrillation thresholds substantially. The new model may be a useful tool to help in further improving dual path and multiple pulse defibrillation techniques by predicting optimal pulse durations and shock timing parameters.

  13. Fuzzy chance constrained linear programming model for scrap charge optimization in steel production

    DEFF Research Database (Denmark)

    Rong, Aiying; Lahdelma, Risto

    2008-01-01

    the uncertainty based on fuzzy set theory and constrain the failure risk based on a possibility measure. Consequently, the scrap charge optimization problem is modeled as a fuzzy chance constrained linear programming problem. Since the constraints of the model mainly address the specification of the product...

  14. Diverging strains near threshold: Breakdown of the elastic description of a charge density wave model

    International Nuclear Information System (INIS)

    Mungan, M.; Coppersmith, S.; Vinokur, V.M.

    1999-01-01

    We analyze the strains near threshold in 1-d charge density wave models at zero temperature and strong pinning. We show that in these models local strains diverge near the depinning threshold and characterize the scaling behavior of the phenomenon. This helps quantify when the underlying elastic description breaks down and plastic effects have to be included

  15. Development of a charge transport model for white OLEDs

    NARCIS (Netherlands)

    Vries, de R.J.

    2012-01-01

    Organic light-emitting diodes (OLEDs) are promising candidates for future lighting applications since they can be made ultra-thin, color-tunable and exible. Improving their e??ciency is an important challenge in the ??eld of organic electronics. The availability of a device model can make the

  16. Cometary models - excitation of molecules at radio wavelengths and thermodynamics of the coma

    International Nuclear Information System (INIS)

    Crovisier, J.

    1987-01-01

    Models for molecular excitation under physical conditions of cometary atmospheres are obviously a requisite for interpreting radio spectroscopic observations of comets. A review of such models is presented. The prevailing excitation mechanism for the rotational lines of parent molecules is pumping of the fundamental vibrational bands by the solar infrared radiation field, followed by spontaneous decay; the molecular rotational population is then at fluorescence equilibrium. Another competing mechanism in the inner coma is thermal excitation by collisions. Its evaluation needs the knowledge of the coma kinetic temperature law, which up to now can only be achieved by modeling the coma thermodynamics. A review of cometary thermodynamical models is also given here, and the relations between such models and cometary molecular observations are discussed. 50 references

  17. From single molecule fluctuations to muscle contraction: a Brownian model of A.F. Huxley's hypotheses.

    Directory of Open Access Journals (Sweden)

    Lorenzo Marcucci

    Full Text Available Muscular force generation in response to external stimuli is the result of thermally fluctuating, cyclical interactions between myosin and actin, which together form the actomyosin complex. Normally, these fluctuations are modelled using transition rate functions that are based on muscle fiber behaviour, in a phenomenological fashion. However, such a basis reduces the predictive power of these models. As an alternative, we propose a model which uses direct single molecule observations of actomyosin fluctuations reported in the literature. We precisely estimate the actomyosin potential bias and use diffusion theory to obtain a brownian ratchet model that reproduces the complete cross-bridge cycle. The model is validated by simulating several macroscopic experimental conditions, while its interpretation is compatible with two different force-generating scenarios.

  18. Approximation to the Modelling of Charge and Discharge Processes in Electrochemical Batteries by Integral Equations

    International Nuclear Information System (INIS)

    Balenzategui, J. L.

    1999-01-01

    A new way for the modelling of the charge and discharge processes in electrochemical batteries based on the use of integral equations is presented. The proposed method models the charge curves by the so called fractional or cumulative integrals of a certain objective function f(t) that must be sought. The charge figures can be easily fitted by breaking down this objective function as the addition of two different Lorentz type functions: the first one is associated to the own charge process and the second one to the overcharge process. The method allows calculating the starting voltage for overcharge as the intersection between both functions. The curve fitting of this model to different experimental charge curves, by using the Marquart algorithm, has shown very accurate results. In the case of discharge curves, two possible methods for modelling purposes are suggested, well by using the same kind of integral equations, well by the simple subtraction of an objective function f(t) from a constant value V O D. Many other aspects for the study and analysis of this method in order to improve its results in further developments are also discussed. (Author) 10 refs

  19. Phospholipid monolayer coated microfabricated electrodes to model the interaction of molecules with biomembranes

    Energy Technology Data Exchange (ETDEWEB)

    Coldrick, Zachary [Centre for Self-Organising Molecular Systems (SOMS), School of Chemistry, University of Leeds, Leeds, LS2 9JT (United Kingdom)], E-mail: eenzc@leeds.ac.uk; Steenson, Paul [School of Electronic Engineering, University of Leeds, Leeds, LS2 9JT (United Kingdom); Millner, Paul [Institute of Membrane and Systems Biology, University of Leeds, Leeds, LS2 9JT (United Kingdom); Davies, Matthew [Health and Safety Laboratories, Buxton, SK17 9JN (United Kingdom); Nelson, Andrew [Centre for Self-Organising Molecular Systems (SOMS), School of Chemistry, University of Leeds, Leeds, LS2 9JT (United Kingdom)

    2009-09-01

    The hanging mercury (Hg) drop electrode (HMDE) has a classical application as a tool to study adsorption and desorption processes of surface organic films due to its: (a) atomically smooth surface and, (b) hydrophobicity at its potential of zero charge. In this study we report on a replacement of the HMDE for studying supported organic layers in the form of platinum (Pt) working electrodes fabricated using lithography techniques on which a thin film of Hg is electrodeposited. These wafer-based Pt/Hg electrodes are characterised and compared to the HMDE using rapid cyclic voltammetry (RCV) and show similar capacitance-potential profiles while being far more mechanically stable and consuming considerably less Hg over their lifetime of several months. The electrodes have been used to support self-assembled phospholipid monolayers which are dynamic surface coatings with unique dielectric properties. The issue of surface contamination has been solved by regenerating the electrode surface prior to phospholipid coating by application of extreme cathodic potentials more negative than -2.6 V (vs. Ag/AgCl). The phospholipid coated electrodes presented in this paper mimic one half of a phospholipid bilayer and exhibit interactions with the biomembrane active drug molecules chlorpromazine, and quinidine. The magnitudes of these interactions have been assessed by recording changes in the capacitance-potential profiles in real time using RCV at 40 V s{sup -1} over potential ranges >1 V. A method for electrode coating with phospholipids with the electrodes fitted in a flow cell device has been developed. This has enabled sequential rapid cleaning/coating/interaction cycles for the purposes of drug screening and/or on-line monitoring for molecules of interest.

  20. Phospholipid monolayer coated microfabricated electrodes to model the interaction of molecules with biomembranes

    International Nuclear Information System (INIS)

    Coldrick, Zachary; Steenson, Paul; Millner, Paul; Davies, Matthew; Nelson, Andrew

    2009-01-01

    The hanging mercury (Hg) drop electrode (HMDE) has a classical application as a tool to study adsorption and desorption processes of surface organic films due to its: (a) atomically smooth surface and, (b) hydrophobicity at its potential of zero charge. In this study we report on a replacement of the HMDE for studying supported organic layers in the form of platinum (Pt) working electrodes fabricated using lithography techniques on which a thin film of Hg is electrodeposited. These wafer-based Pt/Hg electrodes are characterised and compared to the HMDE using rapid cyclic voltammetry (RCV) and show similar capacitance-potential profiles while being far more mechanically stable and consuming considerably less Hg over their lifetime of several months. The electrodes have been used to support self-assembled phospholipid monolayers which are dynamic surface coatings with unique dielectric properties. The issue of surface contamination has been solved by regenerating the electrode surface prior to phospholipid coating by application of extreme cathodic potentials more negative than -2.6 V (vs. Ag/AgCl). The phospholipid coated electrodes presented in this paper mimic one half of a phospholipid bilayer and exhibit interactions with the biomembrane active drug molecules chlorpromazine, and quinidine. The magnitudes of these interactions have been assessed by recording changes in the capacitance-potential profiles in real time using RCV at 40 V s -1 over potential ranges >1 V. A method for electrode coating with phospholipids with the electrodes fitted in a flow cell device has been developed. This has enabled sequential rapid cleaning/coating/interaction cycles for the purposes of drug screening and/or on-line monitoring for molecules of interest.

  1. Assessing the reliability of predictive activity coefficient models for molecules consisting of several functional groups

    Directory of Open Access Journals (Sweden)

    R. P. Gerber

    2013-03-01

    Full Text Available Currently, the most successful predictive models for activity coefficients are those based on functional groups such as UNIFAC. In contrast, these models require a large amount of experimental data for the determination of their parameter matrix. A more recent alternative is the models based on COSMO, for which only a small set of universal parameters must be calibrated. In this work, a recalibrated COSMO-SAC model was compared with the UNIFAC (Do model employing experimental infinite dilution activity coefficient data for 2236 non-hydrogen-bonding binary mixtures at different temperatures. As expected, UNIFAC (Do presented better overall performance, with a mean absolute error of 0.12 ln-units against 0.22 for our COSMO-SAC implementation. However, in cases involving molecules with several functional groups or when functional groups appear in an unusual way, the deviation for UNIFAC was 0.44 as opposed to 0.20 for COSMO-SAC. These results show that COSMO-SAC provides more reliable predictions for multi-functional or more complex molecules, reaffirming its future prospects.

  2. Communication: modeling charge-sign asymmetric solvation free energies with nonlinear boundary conditions.

    Science.gov (United States)

    Bardhan, Jaydeep P; Knepley, Matthew G

    2014-10-07

    We show that charge-sign-dependent asymmetric hydration can be modeled accurately using linear Poisson theory after replacing the standard electric-displacement boundary condition with a simple nonlinear boundary condition. Using a single multiplicative scaling factor to determine atomic radii from molecular dynamics Lennard-Jones parameters, the new model accurately reproduces MD free-energy calculations of hydration asymmetries for: (i) monatomic ions, (ii) titratable amino acids in both their protonated and unprotonated states, and (iii) the Mobley "bracelet" and "rod" test problems [D. L. Mobley, A. E. Barber II, C. J. Fennell, and K. A. Dill, "Charge asymmetries in hydration of polar solutes," J. Phys. Chem. B 112, 2405-2414 (2008)]. Remarkably, the model also justifies the use of linear response expressions for charging free energies. Our boundary-element method implementation demonstrates the ease with which other continuum-electrostatic solvers can be extended to include asymmetry.

  3. Communication: Modeling charge-sign asymmetric solvation free energies with nonlinear boundary conditions

    International Nuclear Information System (INIS)

    Bardhan, Jaydeep P.; Knepley, Matthew G.

    2014-01-01

    We show that charge-sign-dependent asymmetric hydration can be modeled accurately using linear Poisson theory after replacing the standard electric-displacement boundary condition with a simple nonlinear boundary condition. Using a single multiplicative scaling factor to determine atomic radii from molecular dynamics Lennard-Jones parameters, the new model accurately reproduces MD free-energy calculations of hydration asymmetries for: (i) monatomic ions, (ii) titratable amino acids in both their protonated and unprotonated states, and (iii) the Mobley “bracelet” and “rod” test problems [D. L. Mobley, A. E. Barber II, C. J. Fennell, and K. A. Dill, “Charge asymmetries in hydration of polar solutes,” J. Phys. Chem. B 112, 2405–2414 (2008)]. Remarkably, the model also justifies the use of linear response expressions for charging free energies. Our boundary-element method implementation demonstrates the ease with which other continuum-electrostatic solvers can be extended to include asymmetry

  4. Communication: Modeling charge-sign asymmetric solvation free energies with nonlinear boundary conditions

    Science.gov (United States)

    Bardhan, Jaydeep P.; Knepley, Matthew G.

    2014-01-01

    We show that charge-sign-dependent asymmetric hydration can be modeled accurately using linear Poisson theory after replacing the standard electric-displacement boundary condition with a simple nonlinear boundary condition. Using a single multiplicative scaling factor to determine atomic radii from molecular dynamics Lennard-Jones parameters, the new model accurately reproduces MD free-energy calculations of hydration asymmetries for: (i) monatomic ions, (ii) titratable amino acids in both their protonated and unprotonated states, and (iii) the Mobley “bracelet” and “rod” test problems [D. L. Mobley, A. E. Barber II, C. J. Fennell, and K. A. Dill, “Charge asymmetries in hydration of polar solutes,” J. Phys. Chem. B 112, 2405–2414 (2008)]. Remarkably, the model also justifies the use of linear response expressions for charging free energies. Our boundary-element method implementation demonstrates the ease with which other continuum-electrostatic solvers can be extended to include asymmetry. PMID:25296776

  5. Communication: Modeling charge-sign asymmetric solvation free energies with nonlinear boundary conditions

    Energy Technology Data Exchange (ETDEWEB)

    Bardhan, Jaydeep P. [Department of Mechanical and Industrial Engineering, Northeastern University, Boston, Massachusetts 02115 (United States); Knepley, Matthew G. [Computation Institute, The University of Chicago, Chicago, Illinois 60637 (United States)

    2014-10-07

    We show that charge-sign-dependent asymmetric hydration can be modeled accurately using linear Poisson theory after replacing the standard electric-displacement boundary condition with a simple nonlinear boundary condition. Using a single multiplicative scaling factor to determine atomic radii from molecular dynamics Lennard-Jones parameters, the new model accurately reproduces MD free-energy calculations of hydration asymmetries for: (i) monatomic ions, (ii) titratable amino acids in both their protonated and unprotonated states, and (iii) the Mobley “bracelet” and “rod” test problems [D. L. Mobley, A. E. Barber II, C. J. Fennell, and K. A. Dill, “Charge asymmetries in hydration of polar solutes,” J. Phys. Chem. B 112, 2405–2414 (2008)]. Remarkably, the model also justifies the use of linear response expressions for charging free energies. Our boundary-element method implementation demonstrates the ease with which other continuum-electrostatic solvers can be extended to include asymmetry.

  6. Model of electric field-induced charge disordering in praseodymium manganites

    International Nuclear Information System (INIS)

    Lapinskas, S.; Tornau, E.E.; Semiconductor Physics Inst., Vilnius

    2001-01-01

    We propose a model for an electric field-driven transition from the ordered NaCl-type phase to the disordered phase. Such a transition might be a prototype of charge disordering transition observed in Pr 1-c Ca c MnO 3 . We assume the lattice-gas model and hopping conductivity of charge carriers. The solution of this model, performed by the Monte Carlo method, demonstrates that considerably high electric field can disorder well-ordered phases. The comparison with the data for charge disordering in Pr 1-c Ca c MnO 3 shows that required fields are much too high. We analyze the obtained results trying to determine a possible scenario for conductivity in Pr 1-c Ca c MnO 3 . (orig.)

  7. Influence of turn (or fold) and local charge in fragmentation of the peptide analogue molecule CH3CO-Gly-NH2 following single-photon VUV (118.22 nm) ionization.

    Science.gov (United States)

    Bhattacharya, Atanu; Bernstein, Elliot R

    2011-10-06

    The radical cationic reactivity of the peptide analogue molecule CH(3)CO-Gly-NH(2) is addressed both experimentally and theoretically. The radical cation intermediate of CH(3)CO-Gly-NH(2) is created by single-photon ionization of this molecule at 118.22 nm (~10.5 eV). The two most stable conformers (C(7) and C(5)) of this molecule exhibit different folds along the backbone: the C(7) conformer has a γ-turn structure, and the C(5) conformer has a β-strand structure. The experimental results show that the radical cation intermediate of CH(3)CO-Gly-NH(2) dissociates and generates a fragment-ion signal at 73 amu that is observed through TOFMS. Theoretical results show how the fragment-ion signal at 73 amu is generated by only one conformer of CH(3)CO-Gly-NH(2) (C(7)) and how local charge and specific hydrogen bonding in the molecule influence fragmentation of the radical cation intermediate of CH(3)CO-Gly-NH(2). The specific fold of the molecule controls fragmentation of this reactive radical cation intermediate. Whereas the radical cation of the C(7) conformer dissociates through a hydrogen-transfer mechanism followed by HNCO elimination, the radical cation of the C(5) conformer does not dissociate at all. CASSCF calculations show that positive charge in the radical cationic C(7) conformer is localized at the NH(2)CO moiety of the molecular ion. This site-specific localization of the positive charge enhances the acidity of the terminal NH(2) group, facilitating hydrogen transfer from the NH(2) to the COCH(3) end of the molecular ion. Positive charge in the C(5) conformer of the CH(3)CO-Gly-NH(2) radical cation is, however, localized at the COCH(3) end of the molecular ion, and this conformer does not have enough energy to surmount the energy barrier to dissociation on the ion potential energy surface. CASSCF results show that conformation-specific localization of charge in the CH(3)CO-Gly-NH(2) molecular ion occurs as a result of the different hydrogen

  8. The surface chemistry of divalent metal carbonate minerals; a critical assessment of surface charge and potential data using the charge distribution multi-site ion complexation model

    NARCIS (Netherlands)

    Wolthers, M.; Charlet, L.; Van Cappellen, P.

    2008-01-01

    The Charge Distribution MUltiSite Ion Complexation or CD–MUSIC modeling approach is used to describe the chemical structure of carbonate mineralaqueous solution interfaces. The new model extends existing surface complexation models of carbonate minerals, by including atomic scale information on

  9. Modelling charge transport of discotic liquid-crystalline triindoles: the role of peripheral substitution.

    Science.gov (United States)

    Volpi, Riccardo; Camilo, Ana Claudia Santos; Filho, Demetrio A da Silva; Navarrete, Juan T López; Gómez-Lor, Berta; Delgado, M Carmen Ruiz; Linares, Mathieu

    2017-09-13

    We have performed a multiscale approach to study the influence of peripheral substitution in the semiconducting properties of discotic liquid-crystalline triindoles. Charge carrier mobility as high as 1.4 cm 2 V -1 s -1 was experimentally reported for triindoles substituted with alkynyl chains on the periphery (Gómez-Lor et al. Angew. Chem., Int. Ed., 2011, 50, 7399-7402). In this work, our goal is to get a deeper understanding of both the molecular electronic structure and microscopic factors affecting the charge transport properties in triindoles as a function of the spacer group connecting the central cores with the external alkyl chains (i.e., alkyne or phenyl spacers groups). To this end, we first perform Quantum Mechanical (QM) calculations to assess how the peripheral substitution affects the electronic structure and the internal reorganization energy. Secondly, boxes of stacked molecules were built and relaxed through molecular dynamics to obtain realistic structures. Conformational analysis and calculations of transfer integrals for closed neighbours were performed. Our results show that the insertion of ethynyl spacers between the central aromatic core and the flexible peripheral chains results in lower reorganization energies and enhanced intermolecular order within the stacks with a preferred cofacial 60° staggered conformation, which would result in high charge-carrier mobilities in good agreement with the experimental data. This work allows a deeper understanding of charge carrier mobility in columnar phases, linking the structural order at the molecular level to the property of interest, i.e. the charge carrier mobility. We hope that this understanding will improve the design of systems at the supramolecular level aiming at obtaining a more defined conducting channel, higher mobility and smaller fluctuations within the column.

  10. Blind intercomparison of nuclear models for predicting charged particle emission

    International Nuclear Information System (INIS)

    Shibata, K.; Cierjacks, S.

    1994-01-01

    Neutron activation data are important for dosimetry, radiation-damage and production of long-lived activities. For fusion energy applications, it is required to develop 'low-activation materials' from the viewpoints of safety, maintenance and waste disposal. Existing evaluated activation cross-section libraries are to a large extent based on nuclear-model calculations. The former Nuclear Energy Agency Nuclear Data Committee, NEANDC, (presently replaced by the NEA Nuclear Science Committee) organized the working group on activation cross sections. The first meeting of the group was held in 1989, and it was then agreed that a blind intercomparison of nuclear-model calculations should be undertaken in order to test the predictive power of the theoretical calculations. As a first stage the working group selected the reactions 60g Co(n,p) 60 Fe and 60m Co(n,p) 60 Fe, for which no experimental data were available, in the energy range from 1 to 20 MeV. The preliminary results compiled at the NEA Data Bank were sent to each participant and a meeting was held during the International Conference on Nuclear Data for Science and Technology in Julich 1991 to discuss the results. Following the outcome of the discussion in Julich, it was decided to extend this intercomparison. In the second-stage calculation, the same optical-model parameters were employed for neutrons, protons and α-particles, i.e., V = 50 MeV, W = 10 MeV, r = 1.25 fm and a = 0.6 fm with the Woods-Saxon volume-type form factors. No spin-orbit interaction was considered. Concerning the level density, the Fermi gas model with a = A/8 MeV -1 was assumed without pairing corrections. Moreover, gamma-ray competition was neglected to simplify the calculation. This report describes the final results of the blind comparison. Section 2 deals with a survey of the received contributions. The final results are graphically presented in section 3. 67 figs., 1 tab., 12 refs

  11. Multiscale Molecular Dynamics Model for Heterogeneous Charged Systems

    Science.gov (United States)

    Stanton, L. G.; Glosli, J. N.; Murillo, M. S.

    2018-04-01

    Modeling matter across large length scales and timescales using molecular dynamics simulations poses significant challenges. These challenges are typically addressed through the use of precomputed pair potentials that depend on thermodynamic properties like temperature and density; however, many scenarios of interest involve spatiotemporal variations in these properties, and such variations can violate assumptions made in constructing these potentials, thus precluding their use. In particular, when a system is strongly heterogeneous, most of the usual simplifying assumptions (e.g., spherical potentials) do not apply. Here, we present a multiscale approach to orbital-free density functional theory molecular dynamics (OFDFT-MD) simulations that bridges atomic, interionic, and continuum length scales to allow for variations in hydrodynamic quantities in a consistent way. Our multiscale approach enables simulations on the order of micron length scales and 10's of picosecond timescales, which exceeds current OFDFT-MD simulations by many orders of magnitude. This new capability is then used to study the heterogeneous, nonequilibrium dynamics of a heated interface characteristic of an inertial-confinement-fusion capsule containing a plastic ablator near a fuel layer composed of deuterium-tritium ice. At these scales, fundamental assumptions of continuum models are explored; features such as the separation of the momentum fields among the species and strong hydrogen jetting from the plastic into the fuel region are observed, which had previously not been seen in hydrodynamic simulations.

  12. Schottky’s conjecture, field emitters, and the point charge model

    Directory of Open Access Journals (Sweden)

    Kevin L. Jensen

    2016-06-01

    Full Text Available A Point Charge Model of conical field emitters, in which the emitter is defined by an equipotential surface of judiciously placed charges over a planar conductor, is used to confirm Schottky’s conjecture that field enhancement factors are multiplicative for a small protrusion placed on top of a larger base structure. Importantly, it is shown that Schottky’s conjecture for conical / ellipsoidal field emitters remains unexpectedly valid even when the dimensions of the protrusion begin to approach the dimensions of the base structure. The model is analytic and therefore the methodology is extensible to other configurations.

  13. Cell adhesion and spreading at a charged interface: Insight into the mechanism using surface techniques and mathematical modelling

    International Nuclear Information System (INIS)

    DeNardis, Nadica Ivošević; Ilić, Jadranka Pečar; Ružić, Ivica; Pletikapić, Galja

    2015-01-01

    Highlights: • Kinetics of adhesion and spreading of the algal cell at a charged interface is explored. • Amperometric signals are analyzed using extended methodology and the reaction kinetics model. • The model reconstructs and quantifies individual states of the three-step adhesion process. • Adhesion kinetics of the algal cell is slower than that of its plasma membrane vesicle. • Slow spreading of organic film at the interface could be due to the attenuated effect of the potential. - Abstract: We study the kinetics of adhesion and spreading of an algal cell and its plasma membrane vesicle at the charged interface. A simple system of an isolated plasma membrane vesicle without internal content has been developed and characterized by atomic force microscopy (AFM). We extend the methodology based on the reaction kinetics model and empirical fitting for the analysis of amperometric signals, and demonstrate its validity and pertinence in a wide range of surface charge densities. Adhesion kinetics of the algal cell is slower than that of its plasma membrane vesicle. Isolated plasma membrane contributes about one quarter to the cell contact area. The model reconstructs and quantifies individual states of the three-step adhesion process of the algal cell and makes it possible to associate them with various features of amperometric signal. At the time of current amplitude, the ruptured state predominates and the cell spread contact area is larger than its initial area as well as the contact area of the plasma membrane vesicle. These results suggest that a major structural disruption of the cell membrane, collapse of cytoskeleton and leakage of intracellular material could appear close to the time of current amplitude. Further, slow kinetics of the organic film spreading at the interface to its maximal extent is considered as the rate determining step, which could be a consequence of the attenuated effect of potential at the modified interface, stronger

  14. Three-dimensional model of a selective theophylline-binding RNA molecule

    Energy Technology Data Exchange (ETDEWEB)

    Tung, Chang-Shung; Oprea, T.I.; Hummer, G.; Garcia, A.E.

    1995-07-01

    We propose a three-dimensional (3D) model for an RNA molecule that selectively binds theophylline but not caffeine. This RNA, which was found using SELEX [Jenison, R.D., et al., Science (1994) 263:1425] is 10,000 times more specific for theophylline (Kd=320 nM) than for caffeine (Kd=3.5 mM), although the two ligands are identical except for a methyl group substituted at N7 (present only in caffeine). The binding affinity for ten xanthine-based ligands was used to derive a Comparative Molecular Field Analysis (CoMFA) model (R{sup 2} = 0.93 for 3 components, with cross-validated R{sup 2} of 0.73), using the SYBYL and GOLPE programs. A pharmacophoric map was generated to locate steric and electrostatic interactions between theophylline and the RNA binding site. This information was used to identify putative functional groups of the binding pocket and to generate distance constraints. Based on a model for the secondary structure (Jenison et al., idem), the 3D structure of this RNA was then generated using the following method: each helical region of the RNA molecule was treated as a rigid body; single-stranded loops with specific end-to-end distances were generated. The structures of RNA-xanthine complexes were studied using a modified Monte Carlo algorithm. The detailed structure of an RNA-ligand complex model, as well as possible explanations for the theophylline selectivity will be discussed.

  15. Modeling of a Photovoltaic-Powered Electric Vehicle Charging Station with Vehicle-to-Grid Implementation

    Directory of Open Access Journals (Sweden)

    Azhar Ul-Haq

    2016-12-01

    Full Text Available This paper is aimed at modelling of a distinct smart charging station for electric vehicles (EVs that is suitable for DC quick EV charging while ensuring minimum stress on the power grid. Operation of the charging station is managed in such a way that it is either supplied by photovoltaic (PV power or the power grid, and the vehicle-to-grid (V2G is also implemented for improving the stability of the grid during peak load hours. The PV interfaced DC/DC converter and grid interfaced DC/AC bidirectional converter share a DC bus. A smooth transition of one operating mode to another demonstrates the effectiveness of the employed control strategy. Modelling and control of the different components are explained and are implemented in Simulink. Simulations illustrate the feasible behaviour of the charging station under all operating modes in terms of the four-way interaction among PV, EVs and the grid along with V2G operation. Additionally, a business model is discussed with comprehensive analysis of cost estimation for the deployment of charging facilities in a residential area. It has been recognized that EVs bring new opportunities in terms of providing regulation services and consumption flexibility by varying the recharging power at a certain time instant. The paper also discusses the potential financial incentives required to inspire EV owners for active participation in the demand response mechanism.

  16. Mathematical model of silicon smelting process basing on pelletized charge from technogenic raw materials

    Science.gov (United States)

    Nemchinova, N. V.; Tyutrin, A. A.; Salov, V. M.

    2018-03-01

    The silicon production process in the electric arc reduction furnaces (EAF) is studied using pelletized charge as an additive to the standard on the basis of the generated mathematical model. The results obtained due to the model will contribute to the analysis of the charge components behavior during melting with the achievement of optimum final parameters of the silicon production process. The authors proposed using technogenic waste as a raw material for the silicon production in a pelletized form using liquid glass and aluminum production dust from the electrostatic precipitators as a binder. The method of mathematical modeling with the help of the ‘Selector’ software package was used as a basis for the theoretical study. A model was simulated with the imitation of four furnace temperature zones and a crystalline silicon phase (25 °C). The main advantage of the created model is the ability to analyze the behavior of all burden materials (including pelletized charge) in the carbothermic process. The behavior analysis is based on the thermodynamic probability data of the burden materials interactions in the carbothermic process. The model accounts for 17 elements entering the furnace with raw materials, electrodes and air. The silicon melt, obtained by the modeling, contained 91.73 % wt. of the target product. The simulation results showed that in the use of the proposed combined charge, the recovery of silicon reached 69.248 %, which is in good agreement with practical data. The results of the crystalline silicon chemical composition modeling are compared with the real silicon samples of chemical analysis data, which showed the results of convergence. The efficiency of the mathematical modeling methods in the studying of the carbothermal silicon obtaining process with complex interphase transformations and the formation of numerous intermediate compounds using a pelletized charge as an additive to the traditional one is shown.

  17. A Macro Model of Squeeze-Film Air Damping in the Free-Molecule Regime

    KAUST Repository

    Hong, Gang; Ye, Wenjing

    2009-01-01

    An accurate macro model for free‐molecule squeeze‐film air damping on micro plate resonators is present. This model relates air damping directly with device dimensions and operation parameters and therefore provides an efficient tool for the design of high‐performance micro resonators. The construction of the macro model is based on Molecular Dynamics (MD) simulations and analytical traveling‐time distribution. Its accuracy is validated via the comparison between the calculated quality factors of several micro resonators and the available experimental measurements and full MD simulation results. It has been found that the relative errors of the quality factors of two resonators, as compared with experimental data, are 3.9% and 5.7% respectively. The agreements between the macro model results and MD simulation results, on the other hand, are excellent in all cases considered.

  18. A Macro Model of Squeeze-Film Air Damping in the Free-Molecule Regime

    KAUST Repository

    Hong, Gang

    2009-11-30

    An accurate macro model for free‐molecule squeeze‐film air damping on micro plate resonators is present. This model relates air damping directly with device dimensions and operation parameters and therefore provides an efficient tool for the design of high‐performance micro resonators. The construction of the macro model is based on Molecular Dynamics (MD) simulations and analytical traveling‐time distribution. Its accuracy is validated via the comparison between the calculated quality factors of several micro resonators and the available experimental measurements and full MD simulation results. It has been found that the relative errors of the quality factors of two resonators, as compared with experimental data, are 3.9% and 5.7% respectively. The agreements between the macro model results and MD simulation results, on the other hand, are excellent in all cases considered.

  19. Poisson-Boltzmann theory of charged colloids: limits of the cell model for salty suspensions

    International Nuclear Information System (INIS)

    Denton, A R

    2010-01-01

    Thermodynamic properties of charge-stabilized colloidal suspensions and polyelectrolyte solutions are commonly modelled by implementing the mean-field Poisson-Boltzmann (PB) theory within a cell model. This approach models a bulk system by a single macroion, together with counterions and salt ions, confined to a symmetrically shaped, electroneutral cell. While easing numerical solution of the nonlinear PB equation, the cell model neglects microion-induced interactions and correlations between macroions, precluding modelling of macroion ordering phenomena. An alternative approach, which avoids the artificial constraints of cell geometry, exploits the mapping of a macroion-microion mixture onto a one-component model of pseudo-macroions governed by effective interparticle interactions. In practice, effective-interaction models are usually based on linear-screening approximations, which can accurately describe strong nonlinear screening only by incorporating an effective (renormalized) macroion charge. Combining charge renormalization and linearized PB theories, in both the cell model and an effective-interaction (cell-free) model, we compute osmotic pressures of highly charged colloids and monovalent microions, in Donnan equilibrium with a salt reservoir, over a range of concentrations. By comparing predictions with primitive model simulation data for salt-free suspensions, and with predictions from nonlinear PB theory for salty suspensions, we chart the limits of both the cell model and linear-screening approximations in modelling bulk thermodynamic properties. Up to moderately strong electrostatic couplings, the cell model proves accurate for predicting osmotic pressures of deionized (counterion-dominated) suspensions. With increasing salt concentration, however, the relative contribution of macroion interactions to the osmotic pressure grows, leading predictions from the cell and effective-interaction models to deviate. No evidence is found for a liquid

  20. Determining Trajectory of Triboelectrically Charged Particles, Using Discrete Element Modeling

    Science.gov (United States)

    2008-01-01

    The Kennedy Space Center (KSC) Electrostatics and Surface Physics Laboratory is participating in an Innovative Partnership Program (IPP) project with an industry partner to modify a commercial off-the-shelf simulation software product to treat the electrodynamics of particulate systems. Discrete element modeling (DEM) is a numerical technique that can track the dynamics of particle systems. This technique, which was introduced in 1979 for analysis of rock mechanics, was recently refined to include the contact force interaction of particles with arbitrary surfaces and moving machinery. In our work, we endeavor to incorporate electrostatic forces into the DEM calculations to enhance the fidelity of the software and its applicability to (1) particle processes, such as electrophotography, that are greatly affected by electrostatic forces, (2) grain and dust transport, and (3) the study of lunar and Martian regoliths.

  1. Modeling of flux, binding and substitution of urea molecules in the urea transporter dvUT.

    Science.gov (United States)

    Zhang, Hai-Tian; Wang, Zhe; Yu, Tao; Sang, Jian-Ping; Zou, Xian-Wu; Zou, Xiaoqin

    2017-09-01

    Urea transporters (UTs) are transmembrane proteins that transport urea molecules across cell membranes and play a crucial role in urea excretion and water balance. Modeling the functional characteristics of UTs helps us understand how their structures accomplish the functions at the atomic level, and facilitates future therapeutic design targeting the UTs. This study was based on the crystal structure of Desulfovibrio vulgaris urea transporter (dvUT). To model the binding behavior of urea molecules in dvUT, we constructed a cooperative binding model. To model the substitution of urea by the urea analogue N,N'-dimethylurea (DMU) in dvUT, we calculated the occupation probability of DMU along the urea pore and the ratio of the occupation probabilities of DMU at the external (S ext ) and internal (S int ) binding sites, and we established the mutual substitution rule for binding and substitution of urea and DMU. Based on these calculations and modelings, together with the use of the Monte Carlo (MC) method, we further modeled the urea flux in dvUT, equilibrium urea binding to dvUT, and the substitution of urea by DMU in the dvUT. Our modeling results are in good agreement with the existing experimental functional data. Furthermore, the modelings have discovered the microscopic process and mechanisms of those functional characteristics. The methods and the results would help our future understanding of the underlying mechanisms of the diseases associated with impaired UT functions and rational drug design for the treatment of these diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Absence of ballistic charge transport in the half-filled 1D Hubbard model

    Science.gov (United States)

    Carmelo, J. M. P.; Nemati, S.; Prosen, T.

    2018-05-01

    Whether in the thermodynamic limit of lattice length L → ∞, hole concentration mηz = - 2 Sηz/L = 1 -ne → 0, nonzero temperature T > 0, and U / t > 0 the charge stiffness of the 1D Hubbard model with first neighbor transfer integral t and on-site repulsion U is finite or vanishes and thus whether there is or there is no ballistic charge transport, respectively, remains an unsolved and controversial issue, as different approaches yield contradictory results. (Here Sηz = - (L -Ne) / 2 is the η-spin projection and ne =Ne / L the electronic density.) In this paper we provide an upper bound on the charge stiffness and show that (similarly as at zero temperature), for T > 0 and U / t > 0 it vanishes for mηz → 0 within the canonical ensemble in the thermodynamic limit L → ∞. Moreover, we show that at high temperature T → ∞ the charge stiffness vanishes as well within the grand-canonical ensemble for L → ∞ and chemical potential μ →μu where (μ -μu) ≥ 0 and 2μu is the Mott-Hubbard gap. The lack of charge ballistic transport indicates that charge transport at finite temperatures is dominated by a diffusive contribution. Our scheme uses a suitable exact representation of the electrons in terms of rotated electrons for which the numbers of singly occupied and doubly occupied lattice sites are good quantum numbers for U / t > 0. In contrast to often less controllable numerical studies, the use of such a representation reveals the carriers that couple to the charge probes and provides useful physical information on the microscopic processes behind the exotic charge transport properties of the 1D electronic correlated system under study.

  3. Model of charge-state distributions for electron cyclotron resonance ion source plasmas

    Directory of Open Access Journals (Sweden)

    D. H. Edgell

    1999-12-01

    Full Text Available A computer model for the ion charge-state distribution (CSD in an electron cyclotron resonance ion source (ECRIS plasma is presented that incorporates non-Maxwellian distribution functions, multiple atomic species, and ion confinement due to the ambipolar potential well that arises from confinement of the electron cyclotron resonance (ECR heated electrons. Atomic processes incorporated into the model include multiple ionization and multiple charge exchange with rate coefficients calculated for non-Maxwellian electron distributions. The electron distribution function is calculated using a Fokker-Planck code with an ECR heating term. This eliminates the electron temperature as an arbitrary user input. The model produces results that are a good match to CSD data from the ANL-ECRII ECRIS. Extending the model to 1D axial will also allow the model to determine the plasma and electrostatic potential profiles, further eliminating arbitrary user input to the model.

  4. Reversal permanent charge and reversal potential: case studies via classical Poisson–Nernst–Planck models

    International Nuclear Information System (INIS)

    Eisenberg, Bob; Liu, Weishi; Xu, Hongguo

    2015-01-01

    In this work, we are interested in effects of a simple profile of permanent charges on ionic flows. We determine when a permanent charge produces current reversal. We adopt the classical Poisson–Nernst–Planck (PNP) models of ionic flows for this study. The starting point of our analysis is the recently developed geometric singular perturbation approach for PNP models. Under the setting in the paper for case studies, we are able to identify a single governing equation for the existence and the value of the permanent charge for a current reversal. A number of interesting features are established. The related topic on reversal potential can be viewed as a dual problem and is briefly examined in this work too. (paper)

  5. Renormalized charge in a two-dimensional model of colloidal suspension from hypernetted chain approach.

    Science.gov (United States)

    Camargo, Manuel; Téllez, Gabriel

    2008-04-07

    The renormalized charge of a simple two-dimensional model of colloidal suspension was determined by solving the hypernetted chain approximation and Ornstein-Zernike equations. At the infinite dilution limit, the asymptotic behavior of the correlation functions is used to define the effective interactions between the components of the system and these effective interactions were compared to those derived from the Poisson-Boltzmann theory. The results we obtained show that, in contrast to the mean-field theory, the renormalized charge does not saturate, but exhibits a maximum value and then decays monotonically as the bare charge increases. The results also suggest that beyond the counterion layer near to the macroion surface, the ionic cloud is not a diffuse layer which can be handled by means of the linearized theory, as the two-state model claims, but a more complex structure is settled by the correlations between microions.

  6. Continuum Navier-Stokes modelling of water ow past fullerene molecules

    DEFF Research Database (Denmark)

    Walther, J. H.; Popadic, A.; Koumoutsakos, P.

    We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...

  7. Continuum Navier-Stokes modelling of water flow past fullerene molecules

    DEFF Research Database (Denmark)

    Walther, J. H.; Popadic, A.; Koumoutsakos, P.

    We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...

  8. Relative orientation of collagen molecules within a fibril: a homology model for homo sapiens type I collagen.

    Science.gov (United States)

    Collier, Thomas A; Nash, Anthony; Birch, Helen L; de Leeuw, Nora H

    2018-02-15

    Type I collagen is an essential extracellular protein that plays an important structural role in tissues that require high tensile strength. However, owing to the molecule's size, to date no experimental structural data are available for the Homo sapiens species. Therefore, there is a real need to develop a reliable homology model and a method to study the packing of the collagen molecules within the fibril. Through the use of the homology model and implementation of a novel simulation technique, we have ascertained the orientations of the collagen molecules within a fibril, which is currently below the resolution limit of experimental techniques. The longitudinal orientation of collagen molecules within a fibril has a significant effect on the mechanical and biological properties of the fibril, owing to the different amino acid side chains available at the interface between the molecules.

  9. Two-dimensional analytical model of double-gate tunnel FETs with interface trapped charges including effects of channel mobile charge carriers

    Science.gov (United States)

    Xu, Huifang; Dai, Yuehua

    2017-02-01

    A two-dimensional analytical model of double-gate (DG) tunneling field-effect transistors (TFETs) with interface trapped charges is proposed in this paper. The influence of the channel mobile charges on the potential profile is also taken into account in order to improve the accuracy of the models. On the basis of potential profile, the electric field is derived and the expression for the drain current is obtained by integrating the BTBT generation rate. The model can be used to study the impact of interface trapped charges on the surface potential, the shortest tunneling length, the drain current and the threshold voltage for varying interface trapped charge densities, length of damaged region as well as the structural parameters of the DG TFET and can also be utilized to design the charge trapped memory devices based on TFET. The biggest advantage of this model is that it is more accurate, and in its expression there are no fitting parameters with small calculating amount. Very good agreements for both the potential, drain current and threshold voltage are observed between the model calculations and the simulated results. Project supported by the National Natural Science Foundation of China (No. 61376106), the University Natural Science Research Key Project of Anhui Province (No. KJ2016A169), and the Introduced Talents Project of Anhui Science and Technology University.

  10. Electrolyte effects in a model of proton discharge on charged electrodes

    Science.gov (United States)

    Wiebe, Johannes; Kravchenko, Kateryna; Spohr, Eckhard

    2015-01-01

    We report results on the influence of NaCl electrolyte dissolved in water on proton discharge reactions from aqueous solution to charged platinum electrodes. We have extended a recently developed combined proton transfer/proton discharge model on the basis of empirical valence bond theory to include NaCl solutions with several different concentrations of cations and anions, both stoichiometric (1:1) compositions and non-stoichiometric ones with an excess of cations. The latter solutions partially screen the electrostatic potential from the surface charge of the negatively charged electrode. 500-1000 trajectories of a discharging proton were integrated by molecular dynamics simulations until discharge occurred, or for at most 1.5 ns. The results show a strong dependence on ionic strength, but only a weak dependence on the screening behavior, when comparing stoichiometric and non-stoichiometric solutions. Overall, the Na+ cations exert a more dominant effect on the discharge reaction, which we argue is likely due to the very rigid arrangements of the cations on the negatively polarized electrode surface. Thus, our model predicts, for the given and very high negative surface charge densities, the fastest discharge reaction for pure water, but obviously cannot take into account the fact that such high charge densities are even more out of reach experimentally than for higher electrolyte concentrations.

  11. Perturbed path integrals in imaginary time: Efficiently modeling nuclear quantum effects in molecules and materials

    Science.gov (United States)

    Poltavsky, Igor; DiStasio, Robert A.; Tkatchenko, Alexandre

    2018-03-01

    Nuclear quantum effects (NQE), which include both zero-point motion and tunneling, exhibit quite an impressive range of influence over the equilibrium and dynamical properties of molecules and materials. In this work, we extend our recently proposed perturbed path-integral (PPI) approach for modeling NQE in molecular systems [I. Poltavsky and A. Tkatchenko, Chem. Sci. 7, 1368 (2016)], which successfully combines the advantages of thermodynamic perturbation theory with path-integral molecular dynamics (PIMD), in a number of important directions. First, we demonstrate the accuracy, performance, and general applicability of the PPI approach to both molecules and extended (condensed-phase) materials. Second, we derive a series of estimators within the PPI approach to enable calculations of structural properties such as radial distribution functions (RDFs) that exhibit rapid convergence with respect to the number of beads in the PIMD simulation. Finally, we introduce an effective nuclear temperature formalism within the framework of the PPI approach and demonstrate that such effective temperatures can be an extremely useful tool in quantitatively estimating the "quantumness" associated with different degrees of freedom in the system as well as providing a reliable quantitative assessment of the convergence of PIMD simulations. Since the PPI approach only requires the use of standard second-order imaginary-time PIMD simulations, these developments enable one to include a treatment of NQE in equilibrium thermodynamic properties (such as energies, heat capacities, and RDFs) with the accuracy of higher-order methods but at a fraction of the computational cost, thereby enabling first-principles modeling that simultaneously accounts for the quantum mechanical nature of both electrons and nuclei in large-scale molecules and materials.

  12. Charge transfer processes in collisions of H+ ions with H2, D2, CO, CO2 CH4, C2H2, C2H6 and C3H8 molecules below 10 keV

    International Nuclear Information System (INIS)

    Kusakabe, T.; Buenker, R.J.; Kimura, M.

    2002-01-01

    Charge transfer processes resulting from collisions of H + ions with H 2 , D 2 , CO, CO 2 CH 4 , C 2 H 2 , C 2 H 6 and C 3 H 8 molecules have been investigated in the energy range of 0.2 to 4.0 keV experimentally and theoretically. The initial growth rate method was employed in the experiment for studying the dynamics and cross sections. Theoretical analysis based on a molecular-orbital expansion method for H 2 , D 2 , CO, CH 4 and C 2 H 2 targets was also carried out. The present results for the H 2 , CO and CO 2 molecules by H + impact are found to be in excellent accord with most of previous measurements above 1 keV, but they show some differences below this energy where our result displays a stronger energy-dependence. For CH 4 , C 2 H 2 , C 2 H 6 and C 3 H 8 targets, both experimental and theoretical results indicate that if one assumes vibrationally excited molecular ions (CH 4 + , C 2 H 2 + , C 2 H 6 + and C 3 H 8 + ) formed in the exit channel, then charge transfer processes sometimes become more favorable since these vibrationally excited fragments meet an accidental resonant condition. This is a clear indication of the role of vibrational excited states for charge transfer, and is an important realization for general understanding. (author)

  13. A surprising way to control the charge transport in molecular electronics: the subtle impact of the coverage of self-assembled monolayers of floppy molecules adsorbed on metallic electrodes.

    Science.gov (United States)

    Bâldea, Ioan

    2017-10-26

    Inspired by earlier attempts in organic electronics aiming at controlling charge injection from metals into organic materials by manipulating the Schottky energy barrier using self-assembled monolayers (SAMs), recent experimental and theoretical work in molecular electronics showed that metal-organic interfaces can be controlled via changes in the metal work function that are induced by SAMs. In this paper we indicate a different route to achieve interface-driven control over the charge transfer/transport at the molecular scale. It is based on the fact that, in floppy molecule based SAMs, the molecular conformation can be tuned by varying the coverage of the adsorbate. We demonstrate this effect with the aid of benchmark molecules that are often used to fabricate nanojunctions and consist of two rings that can easily rotate relative to each other. We show that, by varying the coverage of the SAM, the twisting angle φ of the considered molecular species can be modified by a factor of two. Given the fact that the low bias conductance G scales as cos 2  φ, this results in a change in G of over one order of magnitude for the considered molecular species. Tuning the twisting angle by controlling the SAM coverage may be significant, e.g., for current efforts to fabricate molecular switches. Conversely, the lack of control over the local SAM coverage may be problematic for the reproducibility and interpretation of the STM (scanning tunneling microscope) measurements on repeatedly forming single molecule break junctions.

  14. Net charge fluctuations and local charge compensation

    International Nuclear Information System (INIS)

    Fu Jinghua

    2006-01-01

    We propose net charge fluctuation as a measure of local charge correlation length. It is demonstrated that, in terms of a schematic multiperipheral model, net charge fluctuation satisfies the same Quigg-Thomas relation as satisfied by charge transfer fluctuation. Net charge fluctuations measured in finite rapidity windows depend on both the local charge correlation length and the size of the observation window. When the observation window is larger than the local charge correlation length, the net charge fluctuation only depends on the local charge correlation length, while forward-backward charge fluctuations always have strong dependence on the observation window size. Net charge fluctuations and forward-backward charge fluctuations measured in the present heavy ion experiments show characteristic features similar to those from multiperipheral models. But the data cannot all be understood within this simple model

  15. Charge quantization in the standard model and some of its extensions

    International Nuclear Information System (INIS)

    Foot, R.; Joshi, G.C.; Lew, H.; Volkas, R.R.

    1990-01-01

    Recent advances in the theoretical understanding of electric charge quantization in the Standard Model and some of its extensions are reviewed. The roles played by classical constraints, gauge and mixed gauge-gravitational anomaly cancellation and the demand of vector-like electromagnetic interactions, are discussed. An attempt is made to clearly explain and contrast the points of view of various authors. 17 refs

  16. 3D numerical surface charge model including relative permeability : the general theory

    NARCIS (Netherlands)

    Casteren, van D.T.E.H.; Paulides, J.J.H.; Lomonova, E.A.

    2014-01-01

    One of the still "open" issues within low-frequency magnetics is the inclusion of µr in the calculations using the magnetic charge method. In this paper a new iterative method to take the relative permeability into account is investigated. Results show that the model accurately accounts for the

  17. Polyhedral charge-packing model for blood pH changes in disease ...

    African Journals Online (AJOL)

    Administrator

    2007-05-02

    May 2, 2007 ... The six negatively charged hydroxyl ions occupy the six vertices of the octahedron, while the lone proton,. H+, occupies the octahedral hole at the centroid. ... ge packing can account for the common pH of 7.4 of mammals, in spite of other differences that are well known (Jackson, 1997). In the original model ...

  18. Charge superlattice effects on the electronic structure of a model acceptor graphite intercalation compound

    International Nuclear Information System (INIS)

    Campagnoli, G.; Tosatti, E.

    1981-08-01

    In the present attempt we have considered a model ordered situation (a super-superlattice) where starting from a basic stoichiometry C 8 X, a fraction 1/3 of the molecules acquire one electron, the remaining 2/3 being left neutral. We have performed an electronic structure calculation using tight-binding plus electrostatic (Hartree) self-consistency

  19. Non-destructive fast charging algorithm of lithium-ion batteries based on the control-oriented electrochemical model

    International Nuclear Information System (INIS)

    Chu, Zhengyu; Feng, Xuning; Lu, Languang; Li, Jianqiu; Han, Xuebing; Ouyang, Minggao

    2017-01-01

    Highlights: •A novel non-destructive fast charging algorithm of lithium-ion batteries is proposed. •A close-loop observer of lithium deposition status is constructed based on the SP2D model. •The charging current is modified online using the feedback of the lithium deposition status. •The algorithm can shorten the charging time and can be used for charging from different initial SOCs. •The post-mortem observation and degradation tests show that no lithium deposition occurs during fast charging. -- Abstract: Fast charging is critical for the application of lithium-ion batteries in electric vehicles. Conventional fast charging algorithms may shorten the cycle life of lithium-ion batteries and induce safety problems, such as internal short circuit caused by lithium deposition at the negative electrode. In this paper, a novel, non-destructive model-based fast charging algorithm is proposed. The fast charging algorithm is composed of two closed loops. The first loop includes an anode over-potential observer that can observe the status of lithium deposition online, whereas the second loop includes a feedback structure that can modify the current based on the observed status of lithium deposition. The charging algorithm enhances the charging current to maintain the observed anode over-potential near the preset threshold potential. Therefore, the fast charging algorithm can decrease the charging time while protecting the health of the battery. The fast charging algorithm is validated on a commercial large-format nickel cobalt manganese/graphite cell. The results showed that 96.8% of the battery capacity can be charged within 52 min. The post-mortem observation of the surface of the negative electrode and degradation tests revealed that the fast charging algorithm proposed here protected the battery from lithium deposition.

  20. Cosmic ray muon charge ratio derived from the new scaling variable model

    CERN Document Server

    Bhattacharya, D P

    1980-01-01

    The charge ratio of sea level muons has been estimated from the new scaling variable model and the CERN Intersecting Storage Ring data of Capiluppi et al. (1974) for pp to pi /sup +or-/X and pp to K/sup +or- /X inclusive reactions. The estimated muon charge ratio is found to be 1.21 and the result has been compared with the experimental data of Parker et al. (1969), Burnet et al. (1973), Ashley et al., and Muraki et al. (1979). (20 refs).

  1. One-dimensional chain of quantum molecule motors as a mathematical physics model for muscle fibers

    International Nuclear Information System (INIS)

    Si Tie-Yan

    2015-01-01

    A quantum chain model of multiple molecule motors is proposed as a mathematical physics theory for the microscopic modeling of classical force-velocity relation and tension transients in muscle fibers. The proposed model was a quantum many-particle Hamiltonian to predict the force-velocity relation for the slow release of muscle fibers, which has not yet been empirically defined and was much more complicated than the hyperbolic relationships. Using the same Hamiltonian model, a mathematical force-velocity relationship was proposed to explain the tension observed when the muscle was stimulated with an alternative electric current. The discrepancy between input electric frequency and the muscle oscillation frequency could be explained physically by the Doppler effect in this quantum chain model. Further more, quantum physics phenomena were applied to explore the tension time course of cardiac muscle and insect flight muscle. Most of the experimental tension transient curves were found to correspond to the theoretical output of quantum two- and three-level models. Mathematical modeling electric stimulus as photons exciting a quantum three-level particle reproduced most of the tension transient curves of water bug Lethocerus maximus. (special topic)

  2. Modelling the Effects of Parking Charge and Supply Policy Using System Dynamics Method

    Directory of Open Access Journals (Sweden)

    Zhenyu Mei

    2017-01-01

    Full Text Available Reasonable parking charge and supply policy are essential for the regular operation of the traffic in city center. This paper develops an evaluation model for parking policies using system dynamics. A quantitative study is conducted to examine the effects of parking charge and supply policy on traffic speed. The model, which is composed of three interrelated subsystems, first summarizes the travel cost of each travel mode and then calibrates the travel choice model through the travel mode subsystem. Finally, the subsystem that evaluates the state of traffic forecasts future car speed based on bureau of public roads (BPR function and generates new travel cost until the entire model reaches a steady state. The accuracy of the model is verified in Hangzhou Wulin business district. The related error of predicted speed is only 2.2%. The results indicate that the regular pattern of traffic speed and parking charge can be illustrated using the proposed model based on system dynamics, and the model infers that reducing the parking supply in core area will increase its congestion level and, under certain parking supply conditions, there exists an interval of possible pricing at which the service reaches a level that is fairly stable.

  3. LHC charge asymmetry as constraint on models for the Tevatron top anomaly

    International Nuclear Information System (INIS)

    Craig, Nathaniel; Kilic, Can; Strassler, Matthew J.

    2011-01-01

    The forward-backward asymmetry A FB tt in top quark production at the Tevatron has been observed to be anomalously large by both CDF and D0. It has been suggested that a model with a W ' coupling to td and ub might explain this anomaly, and other anomalies in B mesons. Single-top-quark production in this model is large, and arguably in conflict with Tevatron measurements. However the model might still be viable if A FB tt is somewhat smaller than its current measured central value. We show that even with smaller couplings, the model can be discovered (or strongly excluded) at the LHC using the 2010 data sets. We find that a suitable charge-asymmetry measurement is a powerful tool that can be used to constrain this and other sources of anomalous single-top production, and perhaps other new high-energy charge-asymmetric processes.

  4. Charge deposition model for investigating SE-microdose effect in trench power MOSFETs

    International Nuclear Information System (INIS)

    Wan Xin; Zhou Weisong; Liu Daoguang; Bo Hanliang; Xu Jun

    2015-01-01

    It was demonstrated that heavy ions can induce large current—voltage (I–V) characteristics shift in commercial trench power MOSFETs, named single event microdose effect (SE-microdose effect). A model is presented to describe this effect. This model calculates the charge deposition by a single heavy ion hitting oxide and the subsequent charge transport under an electric field. Holes deposited at the SiO 2 /Si interface by a Xe ion are calculated by using this model. The calculated results were then used in Sentaurus TCAD software to simulate a trench power MOSFET's I–V curve shift after a Xe ion has hit it. The simulation results are consistent with the related experiment's data. In the end, several factors which affect the SE-microdose effect in trench power MOSFETs are investigated by using this model. (paper)

  5. Charge deposition model for investigating SE-microdose effect in trench power MOSFETs

    Science.gov (United States)

    Xin, Wan; Weisong, Zhou; Daoguang, Liu; Hanliang, Bo; Jun, Xu

    2015-05-01

    It was demonstrated that heavy ions can induce large current—voltage (I-V) characteristics shift in commercial trench power MOSFETs, named single event microdose effect (SE-microdose effect). A model is presented to describe this effect. This model calculates the charge deposition by a single heavy ion hitting oxide and the subsequent charge transport under an electric field. Holes deposited at the SiO2/Si interface by a Xe ion are calculated by using this model. The calculated results were then used in Sentaurus TCAD software to simulate a trench power MOSFET's I-V curve shift after a Xe ion has hit it. The simulation results are consistent with the related experiment's data. In the end, several factors which affect the SE-microdose effect in trench power MOSFETs are investigated by using this model.

  6. A new model for spherically symmetric charged compact stars of embedding class 1

    Energy Technology Data Exchange (ETDEWEB)

    Maurya, S.K. [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman); Gupta, Y.K. [Raj Kumar Goel Institute of Technology, Department of Mathematics, Ghaziabad, U.P. (India); Ray, Saibal [Government College of Engineering and Ceramic Technology, Department of Physics, Kolkata, West Bengal (India); Deb, Debabrata [Indian Institute of Engineering Science and Technology, Department of Physics, Howrah, West Bengal (India)

    2017-01-15

    In the present study we search for a new stellar model with spherically symmetric matter and a charged distribution in a general relativistic framework. The model represents a compact star of embedding class 1. The solutions obtained here are general in nature, having the following two features: first of all, the metric becomes flat and also the expressions for the pressure, energy density, and electric charge become zero in all the cases if we consider the constant A = 0, which shows that our solutions represent the so-called 'electromagnetic mass model' [17], and, secondly, the metric function ν(r), for the limit n tending to infinity, converts to ν(r) = Cr{sup 2}+ ln B, which is the same as considered by Maurya et al. [11]. We have investigated several physical aspects of the model and find that all the features are acceptable within the requirements of contemporary theoretical studies and observational evidence. (orig.)

  7. Charge-changing transitions in an extended Lipkin-type model

    International Nuclear Information System (INIS)

    Mihut, I.; Stoica, S.; Suhonen, J.

    1997-01-01

    Charge-changing transition are considered in an extended Lipkin-Meshkov-Glick (LMG) model taking into account explicitly the proton and neutron degrees of freedom. The proton and neutron Hamiltonians are taken to be of the LMG form and in addition, a residual proton-neutron interaction is included. Model charge-changing operators and their action on eigenfunctions of the model Hamiltonian are defined. Transition amplitudes of these operators are calculated using exact eigenfunctions and then the RPA approximation. The best agreement between the two kinds of calculations was obtained when the correlated RPA ground state, instead of the uncorrelated HF ground state, is employed and when the proton-neutron residual interaction besides the proton-proton and neutron-neutron residual interactions is taken into account in the model Hamiltonian

  8. μ-τ symmetry and charged lepton mass hierarchy in a supersymmetric D4 model

    International Nuclear Information System (INIS)

    Hagedorn, C.; Ziegler, R.

    2010-01-01

    In this paper we discuss a supersymmetric D 4 xZ 5 model which leads to vanishing reactor mixing angle θ 13 =0 and maximal atmospheric mixing θ 23 =π/4 in the lepton sector at leading order, due to the preservation of nontrivial distinct D 4 subgroups in the charged lepton and neutrino sectors, respectively. The solar mixing angle θ 12 remains undetermined and is expected to be of order one. Since right-handed charged leptons transform as singlets under D 4 , the charged lepton mass hierarchy can be naturally accounted for. The model predicts inverted mass hierarchy for neutrinos. Additionally, we show that, unlike in most of the other models of this type, all vacuum expectation values of gauge singlets (flavons) can be determined through mass parameters of the superpotential. Next-to-leading order corrections to lepton masses and mixings are calculated and shown to be under control; in particular, the corrections to θ 23 =π/4 and θ 13 =0 are of the order of the generic expansion parameter ε≅0.04 and arise dominantly from the charged lepton sector.

  9. The EV Project Price/Fee Models for Publicly Accessible Charging

    Energy Technology Data Exchange (ETDEWEB)

    Francfort, James Edward [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-12-01

    As plug-in electric vehicles (PEVs) are introduced to the market place and gain more consumer acceptance, it is important for a robust and self-sustaining non-residential infrastructure of electric vehicle supply equipment (EVSE) to be established to meet the needs of PEV drivers. While federal and state financial incentives for electric vehicles were in place and remain so today, future incentives are uncertain. In order for PEVs to achieve mainstream adoption, an adequate and sustainable commercial or publicly available charging infrastructure was pursued by The EV Project to encourage increased PEV purchases by alleviating range anxiety, and by removing adoption barriers for consumers without a dedicated overnight parking location to provide a home-base charger. This included determining a business model for publicly accessible charge infrastructure. To establish this business model, The EV Project team created a fee for charge model along with various ancillary offerings related to charging that would generate revenue. And after placing chargers in the field the Project rolled out this fee structure.

  10. Heavy charged leptons in an SU(3)L x U(1)N model

    International Nuclear Information System (INIS)

    Pleitez, V.; Tonasse, M.D.

    1992-12-01

    An SU(3) L x U(1) N model for the electroweak interactions which includes additional heavy charged leptons is considered. These leptons have not strong constraints on their masses since they do not couple in the same way as the lightest leptons to the neutral-currents and also because new contributions to the muon g-2 factor already suppressed because of the massive new vector boson present in this model. (author)

  11. Atom and molecule projectile and fast aggregate excitation, ionization and dissociation in thin targets in the out-of-charge equilibrium field

    International Nuclear Information System (INIS)

    Clouvas, A.

    1985-12-01

    The aim of this experimental study is to confirm the possible existence of bound states for light atomic and molecular projectiles inside solid targets, in the MeV energy range. For this purpose we have used, various experimental methods such as charge state distribution measurements, energy loss measurements, beam foil spectroscopy and electron spectroscopy. It was confirmed that bound states of light atomic and molecular projectiles can exist in a solid medium. The various cross sections (charge exchange, excitation, ionisation, dissociation) relative to these bound states have been measured [fr

  12. Prediction of RNA secondary structures: from theory to models and real molecules

    International Nuclear Information System (INIS)

    Schuster, Peter

    2006-01-01

    RNA secondary structures are derived from RNA sequences, which are strings built form the natural four letter nucleotide alphabet, {AUGC}. These coarse-grained structures, in turn, are tantamount to constrained strings over a three letter alphabet. Hence, the secondary structures are discrete objects and the number of sequences always exceeds the number of structures. The sequences built from two letter alphabets form perfect structures when the nucleotides can form a base pair, as is the case with {GC} or {AU}, but the relation between the sequences and structures differs strongly from the four letter alphabet. A comprehensive theory of RNA structure is presented, which is based on the concepts of sequence space and shape space, being a space of structures. It sets the stage for modelling processes in ensembles of RNA molecules like evolutionary optimization or kinetic folding as dynamical phenomena guided by mappings between the two spaces. The number of minimum free energy (mfe) structures is always smaller than the number of sequences, even for two letter alphabets. Folding of RNA molecules into mfe energy structures constitutes a non-invertible mapping from sequence space onto shape space. The preimage of a structure in sequence space is defined as its neutral network. Similarly the set of suboptimal structures is the preimage of a sequence in shape space. This set represents the conformation space of a given sequence. The evolutionary optimization of structures in populations is a process taking place in sequence space, whereas kinetic folding occurs in molecular ensembles that optimize free energy in conformation space. Efficient folding algorithms based on dynamic programming are available for the prediction of secondary structures for given sequences. The inverse problem, the computation of sequences for predefined structures, is an important tool for the design of RNA molecules with tailored properties. Simultaneous folding or cofolding of two or more RNA

  13. Measurement and modeling of diffusion kinetics of a lipophilic molecule across rabbit cornea.

    Science.gov (United States)

    Gupta, Chhavi; Chauhan, Anuj; Mutharasan, Raj; Srinivas, Sangly P

    2010-04-01

    To develop a kinetic model for representing the diffusion and partitioning of Rhodamine B (RhB), a fluorescent lipophilic molecule, across the cornea for gaining insights into pharmacokinetics of topical drugs to the eye. Rabbit corneas mounted underneath a custom-built scanning microfluorometer were perfused with Ringers on both sides of the tissue. After a step change in RhB on the tear side, transients of trans-corneal fluorescence of RhB were measured at a depth resolution approximately 8 microm. RhB distribution exhibited discontinuities at the interface between epithelium and stroma, and between stroma and endothelium. In each of the layers, fluorescence was non-uniform. Fluorescence was elevated in the epithelium and endothelium relative to the stroma. Modeling of RhB transport by diffusion in each layer and stipulation of partitioning of RhB at the cellular interfaces were required to account for trans-corneal penetration kinetics of RhB. The model parameters, estimated using the unsteady state trans-corneal RhB profiles, were found to be sensitive, and the model predicted the experimental profiles accurately. Conventional pharmacokinetic models that depict cornea as a single compartment do not predict the depth-dependent kinetics of RhB penetration. The proposed model incorporates realistic transport mechanisms and thereby highlights the influence of physicochemical properties of drugs on trans-corneal kinetics.

  14. A radial distribution function-based open boundary force model for multi-centered molecules

    KAUST Repository

    Neumann, Philipp; Eckhardt, Wolfgang; Bungartz, Hans-Joachim

    2014-01-01

    We derive an expression for radial distribution function (RDF)-based open boundary forcing for molecules with multiple interaction sites. Due to the high-dimensionality of the molecule configuration space and missing rotational invariance, a

  15. Adhesion of Model Molecules to Metallic Surfaces, the Implications for Corrosion Protection

    International Nuclear Information System (INIS)

    De Wit, J. H. W.; Van den Brand, J.; De Wit, F. M.; Mol, J. M. C.

    2008-01-01

    The majority of the described experimental results deal with relatively pure aluminium. Variations were made in the pretreatment of the aluminum substrates and an investigation was performed on the resulting changes in oxide layer composition and chemistry. Subsequently, the bonding behavior of the surfaces was investigated by using model adhesion molecules. These molecules were chosen to represent the bonding functionality of an organic polymer. They were applied onto the pretreated surfaces as a monolayer and the bonding behavior was studied using infrared reflection absorption spectroscopy. A direct and clear relation was found between the hydroxyl fraction on the oxide surfaces and the amount of molecules that subsequently bonded to the surface. Moreover, it was found that most bonds between the oxide surface and organic functional groups are not stable in the presence of water. The best performance was obtained using molecules, which are capable of chemisorption with the oxide surface. Finally, it was found that freshly prepared relatively pure aluminum substrates, which are left in air, rapidly lose their bonding capacity towards organic functional groups. This can be attributed to the adsorption of contamination and water to the oxide surface. in addition the adhesion of a typical epoxy-coated aluminum system was investigated during exposure to water at different temperatures. The coating was found to quite rapidly lose its adhesion upon exposure to water. This rapid loss of adhesion corresponds well with the data where it was demonstrated that the studied epoxy coating only bonds through physisorptive hydrogen bonding, these bonds not being stable in the presence of water. After the initial loss the adhesion of the coating was however found to recover again and even exceeded the adhesion prior to exposure. The improvement could be ascribed to the growth of a thin oxyhydroxide layer on the aluminum substrate, which forms a new, water-stable and stronger bond

  16. Effect of intercellular adhesion molecule 1 expression in radiation otitis media murine model

    International Nuclear Information System (INIS)

    Wang Shengzi; Cheng Qingfang; Lu Shenbin; Liu Jianping; Wang Shuyi

    2003-01-01

    Objective: To characterize the dose- and time-dependent changes in intercellular adhesion molecule 1 (ICAM-1) expression and the role of this molecule as a mediator of middle ear inflammation induced by radiation. Methods: Radiation-induced otitis media animal models were established by using guinea pigs after 60 Co irradiation with 3 Gy/fraction per day, 5 times per week to a total dose of 15, 30, 45 Gy. The expression of ICAM-1 was studied by SP immunohistochemistry with the relation between radiation dose and infiltration of leukocytes investigated. Results: ICAM-1 was not expressed in the normal epithelium of the middle ear mucosa. Mucosal epithelium strongly expressed ICAM-1 after having been administered with 45 Gy of irradiation showing a significant correlation between the expression of ICAM-1 and the infiltration of leukocytes. Conclusions: Irradiation increases the expression of ICAM-1 in the middle ear mucosa. ICAM-1 may be related to the inflammation in the middle ear after irradiation

  17. Modeling of Sheath Ion-Molecule Reactions in Plasma Enhanced Chemical Vapor Deposition of Carbon Nanotubes

    Science.gov (United States)

    Hash, David B.; Govindan, T. R.; Meyyappan, M.

    2004-01-01

    In many plasma simulations, ion-molecule reactions are modeled using ion energy independent reaction rate coefficients that are taken from low temperature selected-ion flow tube experiments. Only exothermic or nearly thermoneutral reactions are considered. This is appropriate for plasma applications such as high-density plasma sources in which sheaths are collisionless and ion temperatures 111 the bulk p!asma do not deviate significantly from the gas temperature. However, for applications at high pressure and large sheath voltages, this assumption does not hold as the sheaths are collisional and ions gain significant energy in the sheaths from Joule heating. Ion temperatures and thus reaction rates vary significantly across the discharge, and endothermic reactions become important in the sheaths. One such application is plasma enhanced chemical vapor deposition of carbon nanotubes in which dc discharges are struck at pressures between 1-20 Torr with applied voltages in the range of 500-700 V. The present work investigates The importance of the inclusion of ion energy dependent ion-molecule reaction rates and the role of collision induced dissociation in generating radicals from the feedstock used in carbon nanotube growth.

  18. Looking For Physics Beyond The Standard Model: Searches For Charged Higgs Bosons At $e^{+}e^{-}$ Colliders

    CERN Document Server

    Kiiskinen, A P

    2004-01-01

    This thesis describes direct searches for pair production of charged Higgs bosons performed in the data collected by the DELPHI detector at the LEP collider at CERN. In addition, the possibilities to discover and study heavy charged Higgs bosons at possible future high-energy linear colliders are presented. The existence of charged Higgs bosons is predicted by many extensions of the Standard Model. A possible discovery of these particles would be a solid proof for physics beyond the Standard Model. Discovery of charged Higgs bosons, and measurement of their properties, would also provide useful information about the structure of the more general theory. New analysis methods were developed for the searches performed at LEP. A large, previously unexplored, mass range for cover but no evidence for the existence of the charged Higgs bosons was found. This allowed setting new lower mass limits for the charged Higgs boson within the framework of general two Higgs doublet models. Results have been interpreted and pr...

  19. A numerical model for charge transport and energy conversion of perovskite solar cells.

    Science.gov (United States)

    Zhou, Yecheng; Gray-Weale, Angus

    2016-02-14

    Based on the continuity equations and Poisson's equation, we developed a numerical model for perovskite solar cells. Due to different working mechanisms, the model for perovskite solar cells differs from that of silicon solar cells and Dye Sensitized Solar Cells. The output voltage and current are calculated differently, and in a manner suited in particular to perovskite organohalides. We report a test of our equations against experiment with good agreement. Using this numerical model, it was found that performances of solar cells increase with charge carrier's lifetimes, mobilities and diffusion lengths. The open circuit voltage (Voc) of a solar cell is dependent on light intensities, and charge carrier lifetimes. Diffusion length and light intensity determine the saturated current (Jsc). Additionally, three possible guidelines for the design and fabrication of perovskite solar cells are suggested by our calculations. Lastly, we argue that concentrator perovskite solar cells are promising.

  20. Ignition-and-Growth Modeling of NASA Standard Detonator and a Linear Shaped Charge

    Science.gov (United States)

    Oguz, Sirri

    2010-01-01

    The main objective of this study is to quantitatively investigate the ignition and shock sensitivity of NASA Standard Detonator (NSD) and the shock wave propagation of a linear shaped charge (LSC) after being shocked by NSD flyer plate. This combined explosive train was modeled as a coupled Arbitrary Lagrangian-Eulerian (ALE) model with LS-DYNA hydro code. An ignition-and-growth (I&G) reactive model based on unreacted and reacted Jones-Wilkins-Lee (JWL) equations of state was used to simulate the shock initiation. Various NSD-to-LSC stand-off distances were analyzed to calculate the shock initiation (or failure to initiate) and detonation wave propagation along the shaped charge. Simulation results were verified by experimental data which included VISAR tests for NSD flyer plate velocity measurement and an aluminum target severance test for LSC performance verification. Parameters used for the analysis were obtained from various published data or by using CHEETAH thermo-chemical code.

  1. Superconducting, magnetic, and charge correlations in the doped two-chain Hubbard model

    International Nuclear Information System (INIS)

    Asai, Y.

    1995-01-01

    We have studied the superconducting, magnetic, and charge correlation functions and the spin excitation spectrum in the doped two-chain Hubbard model by projector Monte Carlo and Lanczos diagonalization methods. The exponent of the interchain singlet superconducting correlation function, γ, is found to be close to 2.0 as long as two distinct noninteracting bands cross the Fermi level. Magnetic and charge correlation functions decay more rapidly than or as fast as the interchain singlet superconducting correlation function along the chains. The superconducting correlation in the doped two-chain Hubbard model is the most long-range correlation studied here. Implications of the results for the possible universality class of the doped two-chain Hubbard model are discussed

  2. Flocculation of Clay Colloids Induced by Model Polyelectrolytes: Effects of Relative Charge Density and Size.

    Science.gov (United States)

    Sakhawoth, Yasine; Michot, Laurent J; Levitz, Pierre; Malikova, Natalie

    2017-10-06

    Flocculation and its tuning are of utmost importance in the optimization of several industrial protocols in areas such as purification of waste water and civil engineering. Herein, we studied the polyelectrolyte-induced flocculation of clay colloids on a model system consisting of purified clay colloids of well-defined size fractions and ionene polyelectrolytes presenting regular and tunable chain charge density. To characterize ionene-induced clay flocculation, we turned to the combination of light absorbance (turbidity) and ζ-potential measurements, as well as adsorption isotherms. Our model system allowed us to identify the exact ratio of positive and negative charges in clay-ionene mixtures, the (c+/c-) ratio. For all samples studied, the onset of efficient flocculation occurred consistently at c+/c- ratios significantly below 1, which indicated the formation of highly ionene-deficient aggregates. At the same time, the ζ-potential measurements indicated an apparent zero charge on such aggregates. Thus, the ζ-potential values could not provide the stoichiometry inside the clay-ionene aggregates. The early onset of flocculation in clay-ionene mixtures is reminiscent of the behavior of multivalent salts and contrasts that of monovalent salts, for which a large excess amount of ions is necessary to achieve flocculation. Clear differences in the flocculation behavior are visible as a function of the ionene charge density, which governs the conformation of the ionene chains on the clay surface. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Exploring charge density analysis in crystals at high pressure: data collection, data analysis and advanced modelling.

    Science.gov (United States)

    Casati, Nicola; Genoni, Alessandro; Meyer, Benjamin; Krawczuk, Anna; Macchi, Piero

    2017-08-01

    The possibility to determine electron-density distribution in crystals has been an enormous breakthrough, stimulated by a favourable combination of equipment for X-ray and neutron diffraction at low temperature, by the development of simplified, though accurate, electron-density models refined from the experimental data and by the progress in charge density analysis often in combination with theoretical work. Many years after the first successful charge density determination and analysis, scientists face new challenges, for example: (i) determination of the finer details of the electron-density distribution in the atomic cores, (ii) simultaneous refinement of electron charge and spin density or (iii) measuring crystals under perturbation. In this context, the possibility of obtaining experimental charge density at high pressure has recently been demonstrated [Casati et al. (2016). Nat. Commun. 7, 10901]. This paper reports on the necessities and pitfalls of this new challenge, focusing on the species syn-1,6:8,13-biscarbonyl[14]annulene. The experimental requirements, the expected data quality and data corrections are discussed in detail, including warnings about possible shortcomings. At the same time, new modelling techniques are proposed, which could enable specific information to be extracted, from the limited and less accurate observations, like the degree of localization of double bonds, which is fundamental to the scientific case under examination.

  4. Numerical and experimental investigation on static electric charge model at stable cone-jet region

    Science.gov (United States)

    Hashemi, Ali Reza; Pishevar, Ahmad Reza; Valipouri, Afsaneh; Pǎrǎu, Emilian I.

    2018-03-01

    In a typical electro-spinning process, the steady stretching process of the jet beyond the Taylor cone has a significant effect on the dimensions of resulting nanofibers. Also, it sets up the conditions for the onset of the bending instability. The focus of this work is the modeling and simulation of the initial stable jet phase seen during the electro-spinning process. The perturbation method was applied to solve hydrodynamic equations, and the electrostatic equation was solved by a boundary integral method. These equations were coupled with the stress boundary conditions derived appropriate at the fluid-fluid interface. Perturbation equations were discretized by the second-order finite difference method, and the Newton method was implemented to solve the discretized nonlinear system. Also, the boundary element method was utilized to solve the electrostatic equation. In the theoretical study, the fluid is described as a leaky dielectric with charges only on the jet surface in dielectric air. In this study, electric charges were modeled as static. Comparison of numerical and experimental results shows that at low flow rates and high electric field, good agreement was achieved because of the superior importance of the charge transport by conduction rather than convection and charge concentration. In addition, the effect of unevenness of the electric field around the nozzle tip was experimentally studied through plate-plate geometry as well as point-plate geometry.

  5. Charged black holes in a generalized scalar–tensor gravity model

    Directory of Open Access Journals (Sweden)

    Yves Brihaye

    2017-09-01

    Full Text Available We study 4-dimensional charged and static black holes in a generalized scalar–tensor gravity model, in which a shift symmetry for the scalar field exists. For vanishing scalar field the solution corresponds to the Reissner–Nordström (RN solution, while solutions of the full scalar-gravity model have to be constructed numerically. We demonstrate that these black holes support Galilean scalar hair up to a maximal value of the scalar–tensor coupling that depends on the value of the charge and can be up to roughly twice as large as that for uncharged solutions. The Hawking temperature TH of the hairy black holes at maximal scalar–tensor coupling decreases continuously with the increase of the charge and reaches TH=0 for the highest possible charge that these solutions can carry. However, in this limit, the scalar–tensor coupling needs to vanish. The limiting solution hence corresponds to the extremal RN solution, which does not support regular Galilean scalar hair due to its AdS2×S2 near-horizon geometry.

  6. A generalized multi-dimensional mathematical model for charging and discharging processes in a supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Allu, Srikanth [ORNL; Velamur Asokan, Badri [Exxon Mobil Research and Engineering; Shelton, William A [Louisiana State University; Philip, Bobby [ORNL; Pannala, Sreekanth [ORNL

    2014-01-01

    A generalized three dimensional computational model based on unied formulation of electrode- electrolyte-electrode system of a electric double layer supercapacitor has been developed. The model accounts for charge transport across the solid-liquid system. This formulation based on volume averaging process is a widely used concept for the multiphase ow equations ([28] [36]) and is analogous to porous media theory typically employed for electrochemical systems [22] [39] [12]. This formulation is extended to the electrochemical equations for a supercapacitor in a consistent fashion, which allows for a single-domain approach with no need for explicit interfacial boundary conditions as previously employed ([38]). In this model it is easy to introduce the spatio-temporal variations, anisotropies of physical properties and it is also conducive for introducing any upscaled parameters from lower length{scale simulations and experiments. Due to the irregular geometric congurations including porous electrode, the charge transport and subsequent performance characteristics of the super-capacitor can be easily captured in higher dimensions. A generalized model of this nature also provides insight into the applicability of 1D models ([38]) and where multidimensional eects need to be considered. In addition, simple sensitivity analysis on key input parameters is performed in order to ascertain the dependence of the charge and discharge processes on these parameters. Finally, we demonstarted how this new formulation can be applied to non-planar supercapacitors

  7. Point charges optimally placed to represent the multipole expansion of charge distributions.

    Directory of Open Access Journals (Sweden)

    Ramu Anandakrishnan

    Full Text Available We propose an approach for approximating electrostatic charge distributions with a small number of point charges to optimally represent the original charge distribution. By construction, the proposed optimal point charge approximation (OPCA retains many of the useful properties of point multipole expansion, including the same far-field asymptotic behavior of the approximate potential. A general framework for numerically computing OPCA, for any given number of approximating charges, is described. We then derive a 2-charge practical point charge approximation, PPCA, which approximates the 2-charge OPCA via closed form analytical expressions, and test the PPCA on a set of charge distributions relevant to biomolecular modeling. We measure the accuracy of the new approximations as the RMS error in the electrostatic potential relative to that produced by the original charge distribution, at a distance 2x the extent of the charge distribution--the mid-field. The error for the 2-charge PPCA is found to be on average 23% smaller than that of optimally placed point dipole approximation, and comparable to that of the point quadrupole approximation. The standard deviation in RMS error for the 2-charge PPCA is 53% lower than that of the optimal point dipole approximation, and comparable to that of the point quadrupole approximation. We also calculate the 3-charge OPCA for representing the gas phase quantum mechanical charge distribution of a water molecule. The electrostatic potential calculated by the 3-charge OPCA for water, in the mid-field (2.8 Å from the oxygen atom, is on average 33.3% more accurate than the potential due to the point multipole expansion up to the octupole order. Compared to a 3 point charge approximation in which the charges are placed on the atom centers, the 3-charge OPCA is seven times more accurate, by RMS error. The maximum error at the oxygen-Na distance (2.23 Å is half that of the point multipole expansion up to the octupole

  8. Microencapsulation of a hydrophilic model molecule through vibration nozzle and emulsion phase inversion technologies.

    Science.gov (United States)

    Dorati, Rossella; Genta, Ida; Modena, Tiziana; Conti, Bice

    2013-01-01

    The goal of the present work was to evaluate and discuss vibration nozzle microencapsulation (VNM) technology combined to lyophilization, for the microencapsulation of a hydrophilic model molecule into a hydrophilic polymer. Fluorescein-loaded alginate microparticles prepared by VNM and emulsion phase inversion microencapsulation (EPIM) were lyophilized. Morphology, particle size distribution, lyophilized microspheres stability upon rehydration, drug loading and in vitro release were evaluated. Well-formed microspheres were obtained by the VNM technique, with higher yields of production (93.3-100%) and smaller particle size (d50138.10-158.00) than the EPIM microspheres. Rehydration upon lyophilization occurred in 30 min maintaining microsphere physical integrity. Fluorescein release was always faster from the microspheres obtained by VNM (364 h) than from those obtained by EPIM (504 h). The results suggest that VNM is a simple, easy to be scaled-up process suitable for the microencapsulation hydrophilic drugs.

  9. Regulatory framework and business models for charging plug-in electric vehicles: Infrastructure, agents, and commercial relationships

    International Nuclear Information System (INIS)

    Gomez San Roman, Tomas; Momber, Ilan; Rivier Abbad, Michel; Sanchez Miralles, Alvaro

    2011-01-01

    Electric vehicles (EVs) present efficiency and environmental advantages over conventional transportation. It is expected that in the next decade this technology will progressively penetrate the market. The integration of plug-in electric vehicles in electric power systems poses new challenges in terms of regulation and business models. This paper proposes a conceptual regulatory framework for charging EVs. Two new electricity market agents, the EV charging manager and the EV aggregator, in charge of developing charging infrastructure and providing charging services are introduced. According to that, several charging modes such as EV home charging, public charging on streets, and dedicated charging stations are formulated. Involved market agents and their commercial relationships are analysed in detail. The paper elaborates the opportunities to formulate more sophisticated business models for vehicle-to-grid applications under which the storage capability of EV batteries is used for providing peak power or frequency regulation to support the power system operation. Finally penetration phase dependent policy and regulatory recommendations are given concerning time-of-use pricing, smart meter deployment, stable and simple regulation for reselling energy on private property, roll-out of public charging infrastructure as well as reviewing of grid codes and operational system procedures for interactions between network operators and vehicle aggregators. - Highlights: → A conceptual regulatory framework for charging EVs is proposed. → 2 new agents, EV charging point manager, EV aggregator and their functions are introduced. → Depending on private or public access of charging points, contractual relations change. → A classification of charging scenarios alludes implications on regulatory topics. → EV penetration phase dependent policy and regulatory recommendations are given.

  10. Regulatory framework and business models for charging plug-in electric vehicles: Infrastructure, agents, and commercial relationships

    Energy Technology Data Exchange (ETDEWEB)

    Gomez San Roman, Tomas [Instituto de Investigacion Tecnologica, Universidad Pontificia Comillas, Madrid (Spain); Momber, Ilan, E-mail: ilan.momber@iit.upcomillas.es [Instituto de Investigacion Tecnologica, Universidad Pontificia Comillas, Madrid (Spain); Rivier Abbad, Michel; Sanchez Miralles, Alvaro [Instituto de Investigacion Tecnologica, Universidad Pontificia Comillas, Madrid (Spain)

    2011-10-15

    Electric vehicles (EVs) present efficiency and environmental advantages over conventional transportation. It is expected that in the next decade this technology will progressively penetrate the market. The integration of plug-in electric vehicles in electric power systems poses new challenges in terms of regulation and business models. This paper proposes a conceptual regulatory framework for charging EVs. Two new electricity market agents, the EV charging manager and the EV aggregator, in charge of developing charging infrastructure and providing charging services are introduced. According to that, several charging modes such as EV home charging, public charging on streets, and dedicated charging stations are formulated. Involved market agents and their commercial relationships are analysed in detail. The paper elaborates the opportunities to formulate more sophisticated business models for vehicle-to-grid applications under which the storage capability of EV batteries is used for providing peak power or frequency regulation to support the power system operation. Finally penetration phase dependent policy and regulatory recommendations are given concerning time-of-use pricing, smart meter deployment, stable and simple regulation for reselling energy on private property, roll-out of public charging infrastructure as well as reviewing of grid codes and operational system procedures for interactions between network operators and vehicle aggregators. - Highlights: > A conceptual regulatory framework for charging EVs is proposed. > 2 new agents, EV charging point manager, EV aggregator and their functions are introduced. > Depending on private or public access of charging points, contractual relations change. > A classification of charging scenarios alludes implications on regulatory topics. > EV penetration phase dependent policy and regulatory recommendations are given.

  11. A modified Poisson-Boltmann model including charge regulation for the adsorption of ionizable polyelectrolytes to charged interfaces, applied to lysozyme adsorption on silica

    NARCIS (Netherlands)

    Biesheuvel, P.M.; Veen, van der M.; Norde, W.

    2005-01-01

    The equilibrium adsorption of polyelectrolytes with multiple types of ionizable groups is described using a modified Poisson-Boltzmann equation including charge regulation of both the polymer and the interface. A one-dimensional mean-field model is used in which the electrostatic potential is

  12. Retention of U(VI) onto silica in presence of model organic molecules

    International Nuclear Information System (INIS)

    Pham, T.T.H.; Mercier-Bion, F.; Drot, R.; Lagarde, G.; Simoni, E.; Lambert, J.

    2008-01-01

    It is well-known that the organic matter influences the retention of ions onto mineral surfaces. However, the major part of concerned studies implies humic substances and complex solids. Another approach for identifying the sorption mechanisms is possible by studying simpler solids than those present in natural medium. So, silica is chosen as mineral surface because of its abundance in soils and of the presence of Si-O groups in clayey minerals. Uranium (VI) is selected as cation. Simple organic molecules like acetic (one carboxylic group) and oxalic (two carboxylic functions) acids are considered as models of the natural organic matter for understanding their role in the retention of U(VI) onto powders and slides of silica. Binary (organics/silica, U(VI)/silica) and ternary systems (organics/silica/U(VI)) are studied by complementary approaches. Sorption edges as function of pH are obtained by liquid scintillation methods and capillary electrophoresis. Different spectroscopic techniques are used to deduce the interactions between the organic matter and U(VI) sorbed onto the silica whose: Time-Resolved Laser induced Fluorescence Spectroscopy (TRLFS), X-ray Photoelectron Spectroscopy (XPS), Nuclear Microprobe Analysis (NMA). The results of the effect of these model organic molecules onto the U(VI) retention showed a good agreement between the different techniques. Concerning the acetic acid, there are not differences in the sorption percentages of uranyl (see the figure). All these results indicate that the uranyl-acetate complexes stay in the aqueous solution rather than sorbing onto the silica. On the contrary, oxalic acid influences the sorption of U(VI) onto the silica surface. The sorption percentage of U(VI) in the ternary system (oxalic acid/silica/U(VI)) is lower than the binary system (U(VI)/silica) (see the figure). So, the presence of oxalic acid decreases the sorption of U(VI) onto the silica surface. (authors)

  13. Analytical solutions of nonlocal Poisson dielectric models with multiple point charges inside a dielectric sphere

    Science.gov (United States)

    Xie, Dexuan; Volkmer, Hans W.; Ying, Jinyong

    2016-04-01

    The nonlocal dielectric approach has led to new models and solvers for predicting electrostatics of proteins (or other biomolecules), but how to validate and compare them remains a challenge. To promote such a study, in this paper, two typical nonlocal dielectric models are revisited. Their analytical solutions are then found in the expressions of simple series for a dielectric sphere containing any number of point charges. As a special case, the analytical solution of the corresponding Poisson dielectric model is also derived in simple series, which significantly improves the well known Kirkwood's double series expansion. Furthermore, a convolution of one nonlocal dielectric solution with a commonly used nonlocal kernel function is obtained, along with the reaction parts of these local and nonlocal solutions. To turn these new series solutions into a valuable research tool, they are programed as a free fortran software package, which can input point charge data directly from a protein data bank file. Consequently, different validation tests can be quickly done on different proteins. Finally, a test example for a protein with 488 atomic charges is reported to demonstrate the differences between the local and nonlocal models as well as the importance of using the reaction parts to develop local and nonlocal dielectric solvers.

  14. Equilibrium configurations of tripolar charges

    International Nuclear Information System (INIS)

    Yershov, V.N.

    2005-01-01

    It is shown that an ensemble of particles with tripolar (color) charges will necessarily cohere in a hierarchy of structures, from simple clusters and strings to complex aggregates and cyclic molecule-like structures. The basic combinatoric rule remains essentially the same on different levels of the hierarchy, thus leading to a pattern of resemblance between different levels. The number of primitive charges in each structure is determined by the symmetry of the combined effective potential of this structure. The outlined scheme can serve as a framework for building a model of composite fundamental fermions. (author)

  15. Distributed parameter modeling to prevent charge cancellation for discrete thickness piezoelectric energy harvester

    Science.gov (United States)

    Krishnasamy, M.; Qian, Feng; Zuo, Lei; Lenka, T. R.

    2018-03-01

    The charge cancellation due to the change of strain along single continuous piezoelectric layer can remarkably affect the performance of a cantilever based harvester. In this paper, analytical models using distributed parameters are developed with some extent of averting the charge cancellation in cantilever piezoelectric transducer where the piezoelectric layers are segmented at strain nodes of concerned vibration mode. The electrode of piezoelectric segments are parallelly connected with a single external resistive load in the 1st model (Model 1). While each bimorph piezoelectric layers are connected in parallel to a resistor to form an independent circuit in the 2nd model (Model 2). The analytical expressions of the closed-form electromechanical coupling responses in frequency domain under harmonic base excitation are derived based on the Euler-Bernoulli beam assumption for both models. The developed analytical models are validated by COMSOL and experimental results. The results demonstrate that the energy harvesting performance of the developed segmented piezoelectric layer models is better than the traditional model of continuous piezoelectric layer.

  16. Role of molecular charge in nucleocytoplasmic transport.

    Directory of Open Access Journals (Sweden)

    Alexander Goryaynov

    Full Text Available Transport of genetic materials and proteins between the nucleus and cytoplasm of eukaryotic cells is mediated by nuclear pore complexes (NPCs. A selective barrier formed by phenylalanine-glycine (FG nucleoporins (Nups with net positive charges in the NPC allows for passive diffusion of signal-independent small molecules and transport-receptor facilitated translocation of signal-dependent cargo molecules. Recently, negative surface charge was postulated to be another essential criterion for selective passage through the NPC. However, the charge-driven mechanism in determining the transport kinetics and spatial transport route for either passive diffusion or facilitated translocation remains obscure. Here we employed high-speed single-molecule fluorescence microscopy with an unprecedented spatiotemporal resolution of 9 nm and 400 µs to uncover these mechanistic fundamentals for nuclear transport of charged substrates through native NPCs. We found that electrostatic interaction between negative surface charges on transiting molecules and the positively charged FG Nups, although enhancing their probability of binding to the NPC, never plays a dominant role in determining their nuclear transport mode or spatial transport route. A 3D reconstruction of transport routes revealed that small signal-dependent endogenous cargo protein constructs with high positive surface charges that are destined to the nucleus, rather than repelled from the NPC as suggested in previous models, passively diffused through an axial central channel of the NPC in the absence of transport receptors. Finally, we postulated a comprehensive map of interactions between transiting molecules and FG Nups during nucleocytoplasmic transport by combining the effects of molecular size, signal and surface charge.

  17. Electron emission following collisions between multi-charged ions and D{sub 2} molecules; Etude de l'emission electronique induite par impact d'ion multicharge sur la molecule D{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Laurent, G

    2004-05-15

    Dissociative ionisation mechanisms induced in collisions involving a highly charged ion (S{sup 15+}, 13.6 MeV/u) and a molecular deuterium target, have been studied through momentum vector correlations of both the D{sup +} fragments and the electrons produced. An experimental apparatus has been developed in order to detect in coincidence all the charged particles produced during the collision. The measurement of their momentum vectors, which allows one to determine both their kinetic energy and direction of emission with respect to the projectile one, combines Time of Flight, Position Sensitive Detection, and multi-coincidence techniques. The correlation of the fragment and electron kinetic energies enables not only to determine branching ratios between the dissociative ionisation pathways, but also to separate unambiguously kinetic energy distributions of fragments associated to each process. Finally, the angular distributions of ejected electrons, as a function of the orientation of the molecular axis with respect to the projectile direction, are deduced from the spatial correlation. Measurements are compared to theoretical angular distributions obtained using the CDW-EIS (Continuum Distorted Wave-Eikonal Initial State) method. (author)

  18. Passing Current through Touching Molecules

    DEFF Research Database (Denmark)

    Schull, G.; Frederiksen, Thomas; Brandbyge, Mads

    2009-01-01

    The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...

  19. Multiple ionization dynamics of molecules in intense laser fields

    International Nuclear Information System (INIS)

    Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko

    2005-01-01

    A classical field-ionization model is developed for sequential multiple ionization of diatomic and linear triatomic molecules exposed to intense (∼ 10 15 W/cm 2 ) laser fields. The distance R ion of Coulomb explosion is calculated for a combination of fragment charges, by considering nonadiabatic excitation followed by field ionization associated with the inner and outer saddle points. For diatomic molecules (N 2 , NO, and I 2 ), the model explains behaviors observed in experiments, as R ion (21→31) ion (21→22) between competing charge-asymmetric and symmetric channels, and even-odd fluctuation along a principal pathway. For a triatomic molecule CO 2 , a comparison of the model with an experiment suggests that charge-symmetric (or nearly symmetric) channels are dominantly populated. (author)

  20. An electric vehicle driving behavior model in the traffic system with a wireless charging lane

    Science.gov (United States)

    He, Jia; Huang, Hai-Jun; Yang, Hai; Tang, Tie-Qiao

    2017-09-01

    In this paper, a car-following model is proposed to study each EV's (electric vehicle) motion behavior near the WCL (wireless charging lane) and a lane-changing rule is designed to describe the EV's lane-changing behavior. Then, the car-following model and lane-changing rule are used to explore each EV's micro driving behavior in a two-lane system with a WCL. Finally, the impacts of the WCL on each EV's motion behavior are investigated. The numerical results show that each EV should run slowly on the WCL if it needs charge of electricity, that the EV's lane-changing behavior has great effects on the whole system, that the delay time caused by the WCL turns more prominent when the traffic turns heavy, and that lane-changing frequently occurs near the WCL (especially at the downstream of the WCL).

  1. Synthesis of an A-D-A type of molecule used as electron acceptor for improving charge transfer in organic solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Chao-Zhi, E-mail: chzhzhang@sohu.com [Department of Chemistry, Nanjing University of Information Science & Technology, Nanjing 210044 (China); Gu, Shu-Duo; Shen, Dan; Yuan, Yang [Department of Chemistry, Nanjing University of Information Science & Technology, Nanjing 210044 (China); Zhang, Mingdao, E-mail: matchlessjimmy@163.com [Jiangsu Key Laboratory of Atmospheric Environment Monitoring and Pollution Control, Nanjing University of Information Science & Technology, Nanjing 210044 (China)

    2016-08-22

    Electron-accepting molecules play an important role in developing organic solar cells. A new type of A-D-A molecule, 3,6-di([7-(5-bromothiophen-2-yl)-1,5,2,4,6,8-dithiotetrazocin-3-yl]thiophen -2-yl)-9-(2-ethylhexyl)carbazole, was synthesized. The lowest unoccupied molecular orbital (LUMO) and highest occupied molecular orbital (HOMO) energy levels are −3.55 and −5.85 eV, respectively. Therefore, the A-D-A type of compound could be used as electron acceptor for fabricating organic solar cell with a high open circuit voltage. Gibbs free energy (−49.2 kJ/mol) reveals that the process of A-D-A acceptor accepting an electron from poly(3-hexylthiophene) at excited state is spontaneous. The value of entropy (118 J/mol) in the process of an electron transferring from P3HT to the A-D-A acceptor at organic interface suggests that electrons generated from separation of electron-hole pairs at donor/acceptor interface would be delocalized efficiently. Therefore, the A-D-A molecule would be a potential acceptor for efficient organic BHJ solar cells.

  2. Modelling of electric tree progression due to space charge modified fields

    International Nuclear Information System (INIS)

    Seralathan, K E; Mahajan, A; Gupta, Nandini

    2008-01-01

    Tree initiation and growth require localized field enhancement that results in material erosion and formation of tree channels. Tree progression is linked to partial discharges within the tree tubules, characterized by recurrent periods of activity followed by quiescent states. Charge builds up across the non-conducting tree channels during the inactive regime, and discharge follows. In this work, the role of the space charge modified field during the non-discharging regime in deciding the site of subsequent discharges and thereby shaping tree structures is studied. A simple stochastic model was developed, in order to understand the respective effects of charges trapped on the walls of tree tubules, at channel tips, or in the volume of the dielectric. While some charge distributions are seen to arrest tree growth, others encourage axial growth towards the other electrode, and some aid in producing bushy trees clustered around the needle tip. The effect of carbon deposition within tree channels, making them effectively conducting, was also investigated. The insights gained from the simulations were successfully used to explain tree growth in the laboratory under high- and low-field conditions

  3. Stochastic-hydrodynamic model of halo formation in charged particle beams

    Directory of Open Access Journals (Sweden)

    Nicola Cufaro Petroni

    2003-03-01

    Full Text Available The formation of the beam halo in charged particle accelerators is studied in the framework of a stochastic-hydrodynamic model for the collective motion of the particle beam. In such a stochastic-hydrodynamic theory the density and the phase of the charged beam obey a set of coupled nonlinear hydrodynamic equations with explicit time-reversal invariance. This leads to a linearized theory that describes the collective dynamics of the beam in terms of a classical Schrödinger equation. Taking into account space-charge effects, we derive a set of coupled nonlinear hydrodynamic equations. These equations define a collective dynamics of self-interacting systems much in the same spirit as in the Gross-Pitaevskii and Landau-Ginzburg theories of the collective dynamics for interacting quantum many-body systems. Self-consistent solutions of the dynamical equations lead to quasistationary beam configurations with enhanced transverse dispersion and transverse emittance growth. In the limit of a frozen space-charge core it is then possible to determine and study the properties of stationary, stable core-plus-halo beam distributions. In this scheme the possible reproduction of the halo after its elimination is a consequence of the stationarity of the transverse distribution which plays the role of an attractor for every other distribution.

  4. Charged patchy particle models in explicit salt: Ion distributions, electrostatic potentials, and effective interactions.

    Science.gov (United States)

    Yigit, Cemil; Heyda, Jan; Dzubiella, Joachim

    2015-08-14

    We introduce a set of charged patchy particle models (CPPMs) in order to systematically study the influence of electrostatic charge patchiness and multipolarity on macromolecular interactions by means of implicit-solvent, explicit-ion Langevin dynamics simulations employing the Gromacs software. We consider well-defined zero-, one-, and two-patched spherical globules each of the same net charge and (nanometer) size which are composed of discrete atoms. The studied mono- and multipole moments of the CPPMs are comparable to those of globular proteins with similar size. We first characterize ion distributions and electrostatic potentials around a single CPPM. Although angle-resolved radial distribution functions reveal the expected local accumulation and depletion of counter- and co-ions around the patches, respectively, the orientation-averaged electrostatic potential shows only a small variation among the various CPPMs due to space charge cancellations. Furthermore, we study the orientation-averaged potential of mean force (PMF), the number of accumulated ions on the patches, as well as the CPPM orientations along the center-to-center distance of a pair of CPPMs. We compare the PMFs to the classical Derjaguin-Verwey-Landau-Overbeek theory and previously introduced orientation-averaged Debye-Hückel pair potentials including dipolar interactions. Our simulations confirm the adequacy of the theories in their respective regimes of validity, while low salt concentrations and large multipolar interactions remain a challenge for tractable theoretical descriptions.

  5. A Boltzmann-weighted hopping model of charge transport in organic semicrystalline films

    KAUST Repository

    Kwiatkowski, Joe J.; Jimison, Leslie H.; Salleo, Alberto; Spakowitz, Andrew J.

    2011-01-01

    We present a model of charge transport in polycrystalline electronic films, which considers details of the microscopic scale while simultaneously allowing realistically sized films to be simulated. We discuss the approximations and assumptions made by the model, and rationalize its application to thin films of directionally crystallized poly(3-hexylthiophene). In conjunction with experimental data, we use the model to characterize the effects of defects in these films. Our findings support the hypothesis that it is the directional crystallization of these films, rather than their defects, which causes anisotropic mobilities. © 2011 American Institute of Physics.

  6. Competition between spin, charge, and bond waves in a Peierls-Hubbard model

    International Nuclear Information System (INIS)

    Venegas, P.A.; Henriquez, C.; Roessler, J.

    1996-01-01

    We study a one-dimensional extended Peierls-Hubbard model coupled to intracell and intercell phonons for a half-filled band. The calculations are made using the Hartree-Fock and adiabatic approximations for arbitrary temperature. In addition to static spin, charge, and bond density waves, we predict intermediate phases that lack inversion symmetry, and phase transitions that reduce symmetry on increasing temperature. copyright 1996 The American Physical Society

  7. Numerical modeling on homogeneous charge compression ignition combustion engine fueled by diesel-ethanol blends

    OpenAIRE

    Hanafi H.; Hasan M.M; Rahman M.M; Noor M.M; Kadirgama K.; Ramasamy D.

    2016-01-01

    This paper investigates the performance and emission characteristics of HCCI engines fueled with oxygenated fuels (ethanol blend). A modeling study was conducted to investigate the impact of ethanol addition on the performance, combustion and emission characteristics of a Homogeneous Charge Compression Ignition (HCCI) engine fueled by diesel. One dimensional simulation was conducted using the renowned commercial software for diesel and its blend fuels with 5% (E5) and 10% ethanol (E10) (in vo...

  8. Application of economic models to estimate the acceptability of a vehicle congestion charge

    Directory of Open Access Journals (Sweden)

    José Carlos Jiménez Serpa

    2017-07-01

    Full Text Available Introduction: Through the study of the problems generated by vehicular traffic congestion during periods of maximum demand, the negative externality of congestion would be assessed using Multinomial Logit, Mixed and econometric models, and willingness to pay through a Pigouvian rate. Objective: In this article, we propose to implement a congestion charge to manage vehicular demand, through the application of declared preference gages and econometric models. Methodology: The study consists of the execution of 6 steps or stages: Background of the problem, Context of study, Methodological Foundations, Specification and estimation of the model, Estimation of the function average cost user and social marginal cost, Results obtained Discussion and report. Results: Analyzing the models obtained from the 2053 observations made through the declared preference surveys, it was observed that in order to discourage the use of the private car, a rate of COP 7000 per vehicle entering the congestion area or area should be charged, which would decrease the Use of Auto Particular in 68.7%, referring to this behavior we can say that the government policies that set the collection of the congestion charge is a policy that does not fit the perception of the users. Conclusions: This research identified the rate that reflects as closely as possible the marginal social cost and the generalized costs of each trip in terms of the impacts on the others. Now if we consider the marginal cost due to congestion, we have that the current demand is excessive, the users enjoy the benefit at a cost of $ 3,100COP, but impose to others a quota of $22,152COP. Finally, it is necessary to strengthen the legal basis with the regulation and creation of a National Vehicle Electronic Identification System, which will allow, in principle, charges for congestion.

  9. The algebra of non-local charges in non-linear sigma models

    International Nuclear Information System (INIS)

    Abdalla, E.; Abdalla, M.C.B.; Brunelli, J.C.; Zadra, A.

    1994-01-01

    It is derived the complete Dirac algebra satisfied by non-local charges conserved in non-linear sigma models. Some examples of calculation are given for the O(N) symmetry group. The resulting algebra corresponds to a saturated cubic deformation (with only maximum order terms) of the Kac-Moody algebra. The results are generalized for when a Wess-Zumino term be present. In that case the algebra contains a minor order correction (sub-saturation). (author). 1 ref

  10. A hybrid, coupled approach for modeling charged fluids from the nano to the mesoscale

    Science.gov (United States)

    Cheung, James; Frischknecht, Amalie L.; Perego, Mauro; Bochev, Pavel

    2017-11-01

    We develop and demonstrate a new, hybrid simulation approach for charged fluids, which combines the accuracy of the nonlocal, classical density functional theory (cDFT) with the efficiency of the Poisson-Nernst-Planck (PNP) equations. The approach is motivated by the fact that the more accurate description of the physics in the cDFT model is required only near the charged surfaces, while away from these regions the PNP equations provide an acceptable representation of the ionic system. We formulate the hybrid approach in two stages. The first stage defines a coupled hybrid model in which the PNP and cDFT equations act independently on two overlapping domains, subject to suitable interface coupling conditions. At the second stage we apply the principles of the alternating Schwarz method to the hybrid model by using the interface conditions to define the appropriate boundary conditions and volume constraints exchanged between the PNP and the cDFT subdomains. Numerical examples with two representative examples of ionic systems demonstrate the numerical properties of the method and its potential to reduce the computational cost of a full cDFT calculation, while retaining the accuracy of the latter near the charged surfaces.

  11. Solar lanterns for domestic lighting in India. Viability of central charging station model

    International Nuclear Information System (INIS)

    Chaurey, A.; Kandpal, T.C.

    2009-01-01

    About 68 million households in India rely on kerosene as a fuel for domestic lighting. Kerosene-based lighting devices, not only for poor quality of light, but also for the risks of indoor air pollution and fire hazards, etc. are not a desired option for domestic lighting purposes. Solar lantern is a better alternative in terms of its quality of illumination, durability and versatility of use. The dissemination model for solar lantern in India has so far been based on cash sales with or without the incentive of capital subsidy. This paper analyses several dissemination models including rental and fee-for-service based on centralized solar charging station concept for CFL- and LED-based designs of solar lanterns available in India. The basis of comparison is the acceptable daily costs or rental to the user as well as to the owner of the charging station. Further, the paper studies the impact of likely escalation in kerosene price on the acceptable daily rental and estimates the amount of subsidy required to make the charging station model viable for disseminating solar lanterns among rural households. (author)

  12. A comprehensive model of ion diffusion and charge exchange in the cold Io torus

    Science.gov (United States)

    Barbosa, D. D.; Moreno, M. A.

    1988-01-01

    A comprehensive analytic model of radial diffusion in the cold Io torus is developed. The model involves a generalized molecular cloud theory of SO2 and its dissociation fragments SO, O2, S, and O, which are formed at a relatively large rate by solar UV photodissociation of SO2. The key component of the new theory is SO, which can react with S(+) through a near-resonant charge exchange process that is exothermic. This provides a mechanism for the rapid depletion of singly ionized sulfur in the cold torus and can account for the large decrease in the total flux tube content inward of Io's orbit. The model is used to demonstrate quantitatively the effects of radial diffusion in a charge exchange environment that acts as a combined source and sink for ions in various charge states. A detailed quantitative explanation for the O(2+) component of the cold torus is given, and insight is derived into the workings of the so-called plasma 'ribbon'.

  13. A stepped leader model for lightning including charge distribution in branched channels

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Wei; Zhang, Li [School of Electrical Engineering, Shandong University, Jinan 250061 (China); Li, Qingmin, E-mail: lqmeee@ncepu.edu.cn [Beijing Key Lab of HV and EMC, North China Electric Power University, Beijing 102206 (China); State Key Lab of Alternate Electrical Power System with Renewable Energy Sources, Beijing 102206 (China)

    2014-09-14

    The stepped leader process in negative cloud-to-ground lightning plays a vital role in lightning protection analysis. As lightning discharge usually presents significant branched or tortuous channels, the charge distribution along the branched channels and the stochastic feature of stepped leader propagation were investigated in this paper. The charge density along the leader channel and the charge in the leader tip for each lightning branch were approximated by introducing branch correlation coefficients. In combination with geometric characteristics of natural lightning discharge, a stochastic stepped leader propagation model was presented based on the fractal theory. By comparing simulation results with the statistics of natural lightning discharges, it was found that the fractal dimension of lightning trajectory in simulation was in the range of that observed in nature and the calculation results of electric field at ground level were in good agreement with the measurements of a negative flash, which shows the validity of this proposed model. Furthermore, a new equation to estimate the lightning striking distance to flat ground was suggested based on the present model. The striking distance obtained by this new equation is smaller than the value estimated by previous equations, which indicates that the traditional equations may somewhat overestimate the attractive effect of the ground.

  14. A stepped leader model for lightning including charge distribution in branched channels

    International Nuclear Information System (INIS)

    Shi, Wei; Zhang, Li; Li, Qingmin

    2014-01-01

    The stepped leader process in negative cloud-to-ground lightning plays a vital role in lightning protection analysis. As lightning discharge usually presents significant branched or tortuous channels, the charge distribution along the branched channels and the stochastic feature of stepped leader propagation were investigated in this paper. The charge density along the leader channel and the charge in the leader tip for each lightning branch were approximated by introducing branch correlation coefficients. In combination with geometric characteristics of natural lightning discharge, a stochastic stepped leader propagation model was presented based on the fractal theory. By comparing simulation results with the statistics of natural lightning discharges, it was found that the fractal dimension of lightning trajectory in simulation was in the range of that observed in nature and the calculation results of electric field at ground level were in good agreement with the measurements of a negative flash, which shows the validity of this proposed model. Furthermore, a new equation to estimate the lightning striking distance to flat ground was suggested based on the present model. The striking distance obtained by this new equation is smaller than the value estimated by previous equations, which indicates that the traditional equations may somewhat overestimate the attractive effect of the ground.

  15. Modeling spin selectivity in charge transfer across the DNA/Gold interface

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@sci.uut.ac.ir [Department of Physics, Urmia University of Technology, Urmia (Iran, Islamic Republic of); Fathizadeh, S. [Department of Physics, Urmia University of Technology, Urmia (Iran, Islamic Republic of); Akhshani, A. [Department of Physics, Urmia Branch, Islamic Azad University, Urmia (Iran, Islamic Republic of)

    2016-09-30

    Highlights: • DNA in spintronics is applied. Nearly pure spin current is observed in the system. • A combined spin-polaronic PBH model is proposed for spin transfer in DNA molecule. • Spin Hall effect in DNA due to spin–orbit coupling is verified. • The temperature dependence of Hall conductivity is appeared. • Regions of parameters were determined that polarization of spin current is maximum. - Abstract: Experimental results show that the photoelectrons emitted from the gold substrate due to laser radiation, passe through DNA nanowires with spin-polarized nature. This study proposes the use of chiral DNA molecule in spintronics and information processing. To investigate the spin transfer in DNA molecules, we established a theoretical model based on a combined spin-polaronic Peyrard–Bishop–Holstein model. Accordingly, a nearly pure spin current is appeared. The simultaneous effects of the incident radiation and external magnetic field create characteristic islands corresponding to the pure spin currents, which can be predicted and detected using the multifractal dimensions spectrum. We can verify the spin Hall effect on DNA oligomers through spin–orbit coupling. As such, we can proceed to our significant purpose, which is to create a nearly pure spin current for information transfer and determine the regions of parameter values from which the maximal polarization in spin current emerges.

  16. Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

    International Nuclear Information System (INIS)

    Teyssedre, G.; Laurent, C.; Vu, T. T. N.

    2015-01-01

    Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30–60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10 −14 –10 −13  m 2  V −1  s −1 for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets

  17. Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

    Science.gov (United States)

    Teyssedre, G.; Vu, T. T. N.; Laurent, C.

    2015-12-01

    Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30-60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10-14-10-13 m2 V-1 s-1 for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.

  18. Systemic Administration of Carbon Monoxide-Releasing Molecule-3 Protects the Skeletal Muscle in Porcine Model of Compartment Syndrome.

    Science.gov (United States)

    Bihari, Aurelia; Cepinskas, Gediminas; Sanders, David; Lawendy, Abdel-Rahman

    2018-05-01

    Acute limb compartment syndrome, a complication of musculoskeletal trauma, results in muscle necrosis and cell death. Carbon monoxide, liberated from the carbon monoxide-releasing molecule-3, has been shown protective in a rat model of compartment syndrome. The purpose of this study was to test the effect of carbon monoxide-releasing molecule-3 in a preclinical large animal model of compartment syndrome, with the ultimate goal of developing a pharmacologic adjunct treatment for compartment syndrome. Animal research study. Basic research laboratory in a hospital setting. Male Yorkshire-Landrace pigs (50-60 kg). Pigs underwent 6 hours of intracompartmental pressure elevation by infusing fluid into the anterior compartment of the right hind limb. Carbon monoxide-releasing molecule-3 was administered systemically (2 mg/kg, IV) at fasciotomy, followed by 3-hour reperfusion. Muscle perfusion, inflammation, injury, and apoptosis were assessed in the skeletal muscle. Systemic leukocyte activation was assessed during compartment syndrome and reperfusion. Elevation of hind limb intracompartmental pressure resulted in significant microvascular perfusion deficits (44% ± 1% continuously perfused capillaries in compartment syndrome vs 76% ± 4% in sham; p molecule-3 at fasciotomy increased the number of continuously perfused capillaries (68% ± 3%; p molecule-3 at fasciotomy offered protection against compartment syndrome-induced microvascular perfusion deficit, tissue injury, and systemic leukocyte activation. The data suggest the potential therapeutic application of carbon monoxide-releasing molecule-3 to patients at risk of developing compartment syndrome.

  19. Self-Consistent Approach to Global Charge Neutrality in Electrokinetics: A Surface Potential Trap Model

    Directory of Open Access Journals (Sweden)

    Li Wan

    2014-03-01

    Full Text Available In this work, we treat the Poisson-Nernst-Planck (PNP equations as the basis for a consistent framework of the electrokinetic effects. The static limit of the PNP equations is shown to be the charge-conserving Poisson-Boltzmann (CCPB equation, with guaranteed charge neutrality within the computational domain. We propose a surface potential trap model that attributes an energy cost to the interfacial charge dissociation. In conjunction with the CCPB, the surface potential trap can cause a surface-specific adsorbed charge layer σ. By defining a chemical potential μ that arises from the charge neutrality constraint, a reformulated CCPB can be reduced to the form of the Poisson-Boltzmann equation, whose prediction of the Debye screening layer profile is in excellent agreement with that of the Poisson-Boltzmann equation when the channel width is much larger than the Debye length. However, important differences emerge when the channel width is small, so the Debye screening layers from the opposite sides of the channel overlap with each other. In particular, the theory automatically yields a variation of σ that is generally known as the “charge regulation” behavior, attendant with predictions of force variation as a function of nanoscale separation between two charged surfaces that are in good agreement with the experiments, with no adjustable or additional parameters. We give a generalized definition of the ζ potential that reflects the strength of the electrokinetic effect; its variations with the concentration of surface-specific and surface-nonspecific salt ions are shown to be in good agreement with the experiments. To delineate the behavior of the electro-osmotic (EO effect, the coupled PNP and Navier-Stokes equations are solved numerically under an applied electric field tangential to the fluid-solid interface. The EO effect is shown to exhibit an intrinsic time dependence that is noninertial in its origin. Under a step-function applied

  20. A small molecule mitigates hearing loss in a mouse model of Usher syndrome III.

    Science.gov (United States)

    Alagramam, Kumar N; Gopal, Suhasini R; Geng, Ruishuang; Chen, Daniel H-C; Nemet, Ina; Lee, Richard; Tian, Guilian; Miyagi, Masaru; Malagu, Karine F; Lock, Christopher J; Esmieu, William R K; Owens, Andrew P; Lindsay, Nicola A; Ouwehand, Krista; Albertus, Faywell; Fischer, David F; Bürli, Roland W; MacLeod, Angus M; Harte, William E; Palczewski, Krzysztof; Imanishi, Yoshikazu

    2016-06-01

    Usher syndrome type III (USH3), characterized by progressive deafness, variable balance disorder and blindness, is caused by destabilizing mutations in the gene encoding the clarin-1 (CLRN1) protein. Here we report a new strategy to mitigate hearing loss associated with a common USH3 mutation CLRN1(N48K) that involves cell-based high-throughput screening of small molecules capable of stabilizing CLRN1(N48K), followed by a secondary screening to eliminate general proteasome inhibitors, and finally an iterative process to optimize structure-activity relationships. This resulted in the identification of BioFocus 844 (BF844). To test the efficacy of BF844, we developed a mouse model that mimicked the progressive hearing loss associated with USH3. BF844 effectively attenuated progressive hearing loss and prevented deafness in this model. Because the CLRN1(N48K) mutation causes both hearing and vision loss, BF844 could in principle prevent both sensory deficiencies in patients with USH3. Moreover, the strategy described here could help identify drugs for other protein-destabilizing monogenic disorders.

  1. A MODEL FOR THE ELECTRICALLY CHARGED CURRENT SHEET OF A PULSAR

    Energy Technology Data Exchange (ETDEWEB)

    DeVore, C. R.; Antiochos, S. K.; Black, C. E. [Heliophysics Science Division, NASA Goddard Space Flight Center, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States); Harding, A. K.; Kalapotharakos, C.; Kazanas, D.; Timokhin, A. N., E-mail: c.richard.devore@nasa.gov [Astrophysics Science Division, NASA Goddard Space Flight Center, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States)

    2015-03-10

    Global-scale solutions for the magnetosphere of a pulsar consist of a region of low-lying, closed magnetic field near the star, bounded by opposite-polarity regions of open magnetic field along which the pulsar wind flows into space. Separating these open-field regions is a magnetic discontinuity—an electric current sheet—consisting of generally nonneutral plasma. We have developed a self-consistent model for the internal equilibrium structure of the sheet by generalizing the charge-neutral Vlasov/Maxwell equilibria of Harris and Hoh to allow for net electric charge. The resulting equations for the electromagnetic field are solved analytically and numerically. Our results show that the internal thermal pressure needed to establish equilibrium force balance, and the associated effective current-sheet thickness and magnetization, can differ by orders of magnitude from the Harris/Hoh charge-neutral limit. The new model provides a starting point for kinetic or fluid investigations of instabilities that can cause magnetic reconnection and flaring in pulsar magnetospheres.

  2. A dynamic parking charge optimal control model under perspective of commuters' evolutionary game behavior

    Science.gov (United States)

    Lin, XuXun; Yuan, PengCheng

    2018-01-01

    In this research we consider commuters' dynamic learning effect by modeling the trip mode choice behavior from a new perspective of dynamic evolutionary game theory. We explore the behavior pattern of different types of commuters and study the evolution path and equilibrium properties under different traffic conditions. We further establish a dynamic parking charge optimal control (referred to as DPCOC) model to alter commuters' trip mode choice while minimizing the total social cost. Numerical tests show. (1) Under fixed parking fee policy, the evolutionary results are completely decided by the travel time and the only method for public transit induction is to increase the parking charge price. (2) Compared with fixed parking fee policy, DPCOC policy proposed in this research has several advantages. Firstly, it can effectively turn the evolutionary path and evolutionary stable strategy to a better situation while minimizing the total social cost. Secondly, it can reduce the sensitivity of trip mode choice behavior to traffic congestion and improve the ability to resist interferences and emergencies. Thirdly, it is able to control the private car proportion to a stable state and make the trip behavior more predictable for the transportation management department. The research results can provide theoretical basis and decision-making references for commuters' mode choice prediction, dynamic setting of urban parking charge prices and public transit induction.

  3. Phase behavior of mixtures of oppositely charged nanoparticles: Heterogeneous Poisson-Boltzmann cell model applied to lysozyme and succinylated lysozyme

    NARCIS (Netherlands)

    Biesheuvel, P.M.; Lindhoud, S.; Vries, de R.J.; Stuart, M.A.C.

    2006-01-01

    We study the phase behavior of mixtures of oppositely charged nanoparticles, both theoretically and experimentally. As an experimental model system we consider mixtures of lysozyme and lysozyme that has been chemically modified in such a way that its charge is nearly equal in magnitude but opposite

  4. Modelling of space-charge accumulation process in dielectrics of MDS structures under irradiation

    International Nuclear Information System (INIS)

    Gurtov, V.A.; Nazarov, A.I.; Travkov, I.V.

    1990-01-01

    Results of numerical modelling of radiation-induced space charge (RISC) accumulation in MOS structure silicon dioxide are given. Diffusion-drift model which takes account of trap heterogeneous distribution within dielectric volume and channeling of carriers captured at traps represents basis for calculations. Main physical processes affecting RISC accumulation are picked out and character of capture filling in dielectric volume under stress in MOS structure shutter during irradiation on the basis of comparison of experimental results for different thickness oxides with calculation data are predicted

  5. Phase diagram of the restricted primitive model: charge-ordering instability

    Directory of Open Access Journals (Sweden)

    O.V.Patsahan

    2004-01-01

    Full Text Available We study the phase behaviour of the restricted primitive model (RPM using a microscopic approach based on the method of collective variables with a reference system. Starting from the Hamiltonian of the RPM we derive the functional of the grand partition function given in terms of the two collective variables: the collective variables ρk and ck describing fluctuations of the total number density and charge density, respectively. Within the framework of the Gaussian approximation we found the boundary of stability with respect to fluctuations of the charge density. It is shown that due to the approximated character of the theory the boundary of stability is very sensitive to the particular choice of the long-range part of potential inside the hard core. This point is discussed in more detail.

  6. Z/sub N/ topology and charge confinement in SU(N) Higgs models

    International Nuclear Information System (INIS)

    Ezawa, Z.F.; Iwazaki, A.

    1981-01-01

    We analyze topological effects in frozen SU(N) Higgs models in continuous space-time, where topological excitations are Z/sub N/ vortices together with associated Z/sub N/ monopoles. The space dimension is either two or three. We show that vortex condensation generates magnetic gauge symmetry and that monopole condensation leads to a spontaneous breakdown of this symmetry. By summing up all possible excitation modes of Z/sub N/ vortices and Z/sub N/ monopoles, we derive an effective Lagrangian in the strong-coupling regime. We obtain the following conclusions: (i) if external charges are introduced in the fundamental representation, they are confined by electric vortex strings, and (ii) if external charges are introduced in the adjoint representation, they are screened completely

  7. Transfer of electrical space charge from corona between ground and thundercloud: Measurements and modeling

    Science.gov (United States)

    Soula, Serge

    1994-01-01

    The evolution of the vertical electric field profile deduced from simultaneous field measurements at several levels below a thundercloud shows the development of a space charge layer at least up to 600 m. The average charge density in the whole layer from 0 m to 600 m can reach about 1 nC m(exp -3). The ions are generated at the ground by corona effect and the production rate is evaluated with a new method from the comparison of field evolutions at the ground and at altitude after a lightning flash. The modeling of the relevant processes shows tht ground corona accounts for the observed field evolutions and that the aerosol particles concentration has a very large effect on the evolution of corona ions. However, with a realistic value for this concentration a large amount of ground corona ions reach the level of 600 m.

  8. Multiplicity of pre-scission charged particle emission by a statistical model

    International Nuclear Information System (INIS)

    Matsuse, Takehiro

    1996-01-01

    With introducing the limitation (E cut-off ) not to excite all statistically permitted scission parts in the phase integral at the scission point, we try to reproduce the multiplicity of pre-scission charged particle emission of 86 Kr (E lab =890 MeV)+ 27 Al by the cascade calculation of the extended Hauser-Feshbach method (EHM). The physical image is explained from a point of view of the life time for the statistical model of the compound nuclei. When E cut-off parameter is bout 80 MeV, the cross section of scission and the loss of pre-scission charged particle seemed to be reproduced. The average pre-scission time is about 1.7 x 10 -20 sec. The essential problem of the life time of compound nuclei is explained. (S.Y.)

  9. On the SLq(2) extension of the standard model and the concept of charge

    Science.gov (United States)

    Finkelstein, Robert J.

    2017-01-01

    Our SLq(2) extension of the standard model is constructed by replacing the elementary field operators, Ψ(x), of the standard model by Ψ̂mm‧j(x)D mm‧j where Dmm‧j is an element of the (2j + 1)-dimensional representation of the SLq(2) algebra, which is also the knot algebra. The allowed quantum states (j,m,m‧) are restricted by the topological conditions (j,m,m‧) = 1 2(N,w,r + o) postulated between the states of the quantum knot (j,m,m‧) and the corresponding classical knot (N,w,r + o) where the (N,w,r) are (the number of crossings, the writhe, the rotation) of the 2d projection of the corresponding oriented classical knot. Here, o is an odd number that is required by the difference in parity between w and r. There is also the empirical restriction on the allowed states (j,m,m‧) = 3(t,-t 3,-t0)L that holds at the j = 3 2 level, connecting quantum trefoils 3 2,m,m‧ with leptons and quarks 1 2,-t3,-t0L. The so-constructed knotted leptons and quarks turn out to be composed of three j = 1 2 particles which unexpectedly agree with the preon models of Harrari and Shupe. The j = 0 particles, being electroweak neutral, are dark and plausibly greatly outnumber the quarks and leptons. The SLq(2) or (j,m,m‧) measure of charge has a direct physical interpretation since 2j is the total number of preonic charges while 2m and 2m‧ are the numbers of writhe and rotation sources of preonic charge. The total SLq(2) charge of a particle, measured by writhe and rotation and composed of preons, sums the signs of the counterclockwise turns (+1) and clockwise turns (-1) that any energy-momentum current makes in going once around the knot. In this way, the handedness of the knot reduces charge to a geometric concept similar to the way that curvature of space-time encodes mass and energy. According to this model, the leptons and quarks are j = 3 2 particles, the preons are j = 1 2 particles, and the j = 0 particles are candidates for dark matter. It is possible to

  10. Prediction Model of Battery State of Charge and Control Parameter Optimization for Electric Vehicle

    Directory of Open Access Journals (Sweden)

    Bambang Wahono

    2015-07-01

    Full Text Available This paper presents the construction of a battery state of charge (SOC prediction model and the optimization method of the said model to appropriately control the number of parameters in compliance with the SOC as the battery output objectives. Research Centre for Electrical Power and Mechatronics, Indonesian Institute of Sciences has tested its electric vehicle research prototype on the road, monitoring its voltage, current, temperature, time, vehicle velocity, motor speed, and SOC during the operation. Using this experimental data, the prediction model of battery SOC was built. Stepwise method considering multicollinearity was able to efficiently develops the battery prediction model that describes the multiple control parameters in relation to the characteristic values such as SOC. It was demonstrated that particle swarm optimization (PSO succesfully and efficiently calculated optimal control parameters to optimize evaluation item such as SOC based on the model.

  11. Accuracy of maximum likelihood estimates of a two-state model in single-molecule FRET

    Energy Technology Data Exchange (ETDEWEB)

    Gopich, Irina V. [Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892 (United States)

    2015-01-21

    Photon sequences from single-molecule Förster resonance energy transfer (FRET) experiments can be analyzed using a maximum likelihood method. Parameters of the underlying kinetic model (FRET efficiencies of the states and transition rates between conformational states) are obtained by maximizing the appropriate likelihood function. In addition, the errors (uncertainties) of the extracted parameters can be obtained from the curvature of the likelihood function at the maximum. We study the standard deviations of the parameters of a two-state model obtained from photon sequences with recorded colors and arrival times. The standard deviations can be obtained analytically in a special case when the FRET efficiencies of the states are 0 and 1 and in the limiting cases of fast and slow conformational dynamics. These results are compared with the results of numerical simulations. The accuracy and, therefore, the ability to predict model parameters depend on how fast the transition rates are compared to the photon count rate. In the limit of slow transitions, the key parameters that determine the accuracy are the number of transitions between the states and the number of independent photon sequences. In the fast transition limit, the accuracy is determined by the small fraction of photons that are correlated with their neighbors. The relative standard deviation of the relaxation rate has a “chevron” shape as a function of the transition rate in the log-log scale. The location of the minimum of this function dramatically depends on how well the FRET efficiencies of the states are separated.

  12. Mechanism and models for collisional energy transfer in highly excited large polyatomic molecules

    International Nuclear Information System (INIS)

    Gilbert, R. G.

    1995-01-01

    Collisional energy transfer in highly excited molecules (say, 200-500 kJ mol -1 above the zero-point energy of reactant, or of product, for a recombination reaction) is reviewed. An understanding of this energy transfer is important in predicting and interpreting the pressure dependence of gas-phase rate coefficients for unimolecular and recombination reactions. For many years it was thought that this pressure dependence could be calculated from a single energy-transfer quantity, such as the average energy transferred per collision. However, the discovery of 'super collisions' (a small but significant fraction of collisions which transfer abnormally large amounts of energy) means that this simplistic approach needs some revision. The 'ordinary' (non-super) component of the distribution function for collisional energy transfer can be quantified either by empirical models (e.g., an exponential-down functional form) or by models with a physical basis, such as biased random walk (applicable to monatomic or diatomic collision partners) or ergodic (for polyatomic collision partners) treatments. The latter two models enable approximate expressions for the average energy transfer to be estimated from readily available molecular parameters. Rotational energy transfer, important for finding the pressure dependence for recombination reactions, can for these purposes usually be taken as transferring sufficient energy so that the explicit functional form is not required to predict the pressure dependence. The mechanism of 'ordinary' energy transfer seems to be dominated by low-frequency modes of the substrate, whereby there is sufficient time during a vibrational period for significant energy flow between the collision partners. Super collisions may involve sudden energy flow as an outer atom of the substrate is squashed between the substrate and the bath gas, and then is moved away from the interaction by large-amplitude motion such as a ring vibration or a rotation; improved

  13. Modeling of plug-in electric vehicle travel patterns and charging load based on trip chain generation

    Science.gov (United States)

    Wang, Dai; Gao, Junyu; Li, Pan; Wang, Bin; Zhang, Cong; Saxena, Samveg

    2017-08-01

    Modeling PEV travel and charging behavior is the key to estimate the charging demand and further explore the potential of providing grid services. This paper presents a stochastic simulation methodology to generate itineraries and charging load profiles for a population of PEVs based on real-world vehicle driving data. In order to describe the sequence of daily travel activities, we use the trip chain model which contains the detailed information of each trip, namely start time, end time, trip distance, start location and end location. A trip chain generation method is developed based on the Naive Bayes model to generate a large number of trips which are temporally and spatially coupled. We apply the proposed methodology to investigate the multi-location charging loads in three different scenarios. Simulation results show that home charging can meet the energy demand of the majority of PEVs in an average condition. In addition, we calculate the lower bound of charging load peak on the premise of lowest charging cost. The results are instructive for the design and construction of charging facilities to avoid excessive infrastructure.

  14. Increased charge transfer of Poly (ethylene oxide) based electrolyte by addition of small molecule and its application in dye-sensitized solar cells

    International Nuclear Information System (INIS)

    Muthuraaman, B.; Will, Geoffrey; Wang, Hongxia; Moonie, Paul; Bell, John

    2013-01-01

    A Poly (ethylene oxide) based polymer electrolyte impregnated with 2-Mercapto benzimidazole was comprehensively characterized by XRD, UV–visible spectroscopy, FTIR as well as electrochemical impedance spectroscopy. It was found that the crystallization of PEO was dramatically reduced and the ionic conductivity of the electrolyte was increased 4.5 fold by addition of 2-Mercapto benzimidazole. UV–visible and FTIR spectroscopes indicated the formation of charge transfer complex between 2-Mercapto benzimidazole and iodine of the electrolyte. Dye-sensitized solar cells with the polymer electrolytes were assembled. It was found that both the photocurrent density and photovoltage were enhanced with respect to the DSC without 2-Mercapto benzimidazole, leading to a 60% increase of the performance of the cell.

  15. Charge collection efficiency degradation induced by MeV ions in semiconductor devices: Model and experiment

    Energy Technology Data Exchange (ETDEWEB)

    Vittone, E., E-mail: ettore.vittone@unito.it [Department of Physics, NIS Research Centre and CNISM, University of Torino, via P. Giuria 1, 10125 Torino (Italy); Pastuovic, Z. [Centre for Accelerator Science (ANSTO), Locked bag 2001, Kirrawee DC, NSW 2234 (Australia); Breese, M.B.H. [Centre for Ion Beam Applications (CIBA), Department of Physics, National University of Singapore, Singapore 117542 (Singapore); Garcia Lopez, J. [Centro Nacional de Aceleradores (CNA), Sevilla University, J. Andalucia, CSIC, Av. Thomas A. Edison 7, 41092 Sevilla (Spain); Jaksic, M. [Department for Experimental Physics, Ruder Boškovic Institute (RBI), P.O. Box 180, 10002 Zagreb (Croatia); Raisanen, J. [Department of Physics, University of Helsinki, Helsinki 00014 (Finland); Siegele, R. [Centre for Accelerator Science (ANSTO), Locked bag 2001, Kirrawee DC, NSW 2234 (Australia); Simon, A. [International Atomic Energy Agency (IAEA), Vienna International Centre, P.O. Box 100, 1400 Vienna (Austria); Institute of Nuclear Research of the Hungarian Academy of Sciences (ATOMKI), Debrecen (Hungary); Vizkelethy, G. [Sandia National Laboratories (SNL), PO Box 5800, Albuquerque, NM (United States)

    2016-04-01

    Highlights: • We study the electronic degradation of semiconductors induced by ion irradiation. • The experimental protocol is based on MeV ion microbeam irradiation. • The radiation induced damage is measured by IBIC. • The general model fits the experimental data in the low level damage regime. • Key parameters relevant to the intrinsic radiation hardness are extracted. - Abstract: This paper investigates both theoretically and experimentally the charge collection efficiency (CCE) degradation in silicon diodes induced by energetic ions. Ion Beam Induced Charge (IBIC) measurements carried out on n- and p-type silicon diodes which were previously irradiated with MeV He ions show evidence that the CCE degradation does not only depend on the mass, energy and fluence of the damaging ion, but also depends on the ion probe species and on the polarization state of the device. A general one-dimensional model is derived, which accounts for the ion-induced defect distribution, the ionization profile of the probing ion and the charge induction mechanism. Using the ionizing and non-ionizing energy loss profiles resulting from simulations based on the binary collision approximation and on the electrostatic/transport parameters of the diode under study as input, the model is able to accurately reproduce the experimental CCE degradation curves without introducing any phenomenological additional term or formula. Although limited to low level of damage, the model is quite general, including the displacement damage approach as a special case and can be applied to any semiconductor device. It provides a method to measure the capture coefficients of the radiation induced recombination centres. They can be considered indexes, which can contribute to assessing the relative radiation hardness of semiconductor materials.

  16. Charge and transition densities of samarium isotopes in the interacting Boson model

    International Nuclear Information System (INIS)

    Moinester, M.A.; Alster, J.; Dieperink, A.E.L.

    1982-01-01

    The interacting boson approximation (IBA) model has been used to interpret the ground-state charge distributions and lowest 2 + transition charge densities of the even samarium isotopes for A = 144-154. Phenomenological boson transition densities associated with the nucleons comprising the s-and d-bosons of the IBA were determined via a least squares fit analysis of charge and transition densities in the Sm isotopes. The application of these boson trasition densities to higher excited 0 + and 2 + states of Sm, and to 0 + and 2 + transitions in neighboring nuclei, such as Nd and Gd, is described. IBA predictions for the transition densities of the three lowest 2 + levels of 154 Gd are given and compared to theoretical transition densities based on Hartree-Fock calculations. The deduced quadrupole boson transition densities are in fair agreement with densities derived previously from 150 Nd data. It is also shown how certain moments of the best fit boson transition densities can simply and sucessfully describe rms radii, isomer shifts, B(E2) strengths, and transition radii for the Sm isotopes. (orig.)

  17. Modelling of Coke Layer Collapse during Ore Charging in Ironmaking Blast Furnace by DEM

    Science.gov (United States)

    Narita, Yoichi; Mio, Hiroshi; Orimoto, Takashi; Nomura, Seiji

    2017-06-01

    A technical issue in an ironmaking blast furnace operation is to realize the optimum layer thickness and the radial distribution of burden (ore and coke) to enhance its efficiency and productivity. When ore particles are charged onto the already-embedded coke layer, the coke layer-collapse phenomenon occurs. The coke layer-collapse phenomenon has a significant effect on the distribution of ore and coke layer thickness in the radial direction. In this paper, the mechanical properties of coke packed bed under ore charging were investigated by the impact-loading test and the large-scale direct shear test. Experimental results show that the coke particle is broken by the impact force of ore charging, and the particle breakage leads to weaken of coke-layer strength. The expression of contact force for coke in Discrete Element Method (DEM) was modified based on the measured data, and it followed by the 1/3-scaled experiment on coke's collapse phenomena. Comparing a simulation by modified model to the 1/3-scaled experiment, they agreed well in the burden distribution.

  18. Molecules and Models The molecular structures of main group element compounds

    CERN Document Server

    Haaland, Arne

    2008-01-01

    This book provides a systematic description of the molecular structures and bonding in simple compounds of the main group elements with particular emphasis on bond distances, bond energies and coordination geometries. The description includes the structures of hydrogen, halogen and methyl derivatives of the elements in each group, some of these molecules are ionic, some polar covalent. The survey of molecules whose structures conform to well-established trends is followed byrepresentative examples of molecules that do not conform. We also describe electron donor-acceptor and hydrogen bonded co

  19. Magnetism of metallacrown single-molecule magnets: From a simplest model to realistic systems

    Science.gov (United States)

    Pavlyukh, Y.; Rentschler, E.; Elmers, H. J.; Hübner, W.; Lefkidis, G.

    2018-06-01

    Electronic and magnetic properties of molecular nanomagnets are determined by competing energy scales due to the crystal field splitting, the exchange interactions between transition metal atoms, and relativistic effects. We present a comprehensive theory embracing all these phenomena based on first-principles calculations. In order to achieve this goal, we start from the FeNi4 cluster as a paradigm. The system can be accurately described on the ab initio level yielding all expected electronic states in a range of multiplicities from 1 to 9, with a ferromagnetic ground state. By adding the spin-orbit coupling between them we obtain the zero-field splitting. This allows to introduce a spin Hamiltonian of a giant spin model, which operates on a smaller energy scale. We compare the computed parameters of this Hamiltonian with the experimental and theoretical magnetic anisotropy energies of the monolayer Ni/Cu(001). In line with them, we find that the anisotropy almost entirely originates from the second-order spin-orbit coupling, the spin-spin coupling constitutes only a small fraction. Finally, we include the ligand atoms in our consideration. This component has a decisive role for the stabilization of molecules in experimental synthesis and characterization, and also substantially complicates the theory by bringing the superexchange mechanisms into play. Since they are higher-order effects involving two hopping matrix elements, not every theory can describe them. Our generalization of the corresponding perturbation theory substantiates the use of complete active space methods for the description of superexchange. At the same time, our numerical results for the {CuFe4} system demonstrate that the Goodenough-Kanamori rules, which are often used to determine the sign of these exchange interactions, cannot deliver quantitative predictions due to the interplay of other mechanisms, e. g., involving multicenter Coulomb integrals. We conclude by comparing ab initio values

  20. Comparisons Between Model Predictions and Spectral Measurements of Charged and Neutral Particles on the Martian Surface

    Science.gov (United States)

    Kim, Myung-Hee Y.; Cucinotta, Francis A.; Zeitlin, Cary; Hassler, Donald M.; Ehresmann, Bent; Rafkin, Scot C. R.; Wimmer-Schweingruber, Robert F.; Boettcher, Stephan; Boehm, Eckart; Guo, Jingnan; hide

    2014-01-01

    Detailed measurements of the energetic particle radiation environment on the surface of Mars have been made by the Radiation Assessment Detector (RAD) on the Curiosity rover since August 2012. RAD is a particle detector that measures the energy spectrum of charged particles (10 to approx. 200 MeV/u) and high energy neutrons (approx 8 to 200 MeV). The data obtained on the surface of Mars for 300 sols are compared to the simulation results using the Badhwar-O'Neill galactic cosmic ray (GCR) environment model and the high-charge and energy transport (HZETRN) code. For the nuclear interactions of primary GCR through Mars atmosphere and Curiosity rover, the quantum multiple scattering theory of nuclear fragmentation (QMSFRG) is used. For describing the daily column depth of atmosphere, daily atmospheric pressure measurements at Gale Crater by the MSL Rover Environmental Monitoring Station (REMS) are implemented into transport calculations. Particle flux at RAD after traversing varying depths of atmosphere depends on the slant angles, and the model accounts for shielding of the RAD "E" dosimetry detector by the rest of the instrument. Detailed comparisons between model predictions and spectral data of various particle types provide the validation of radiation transport models, and suggest that future radiation environments on Mars can be predicted accurately. These contributions lend support to the understanding of radiation health risks to astronauts for the planning of various mission scenarios

  1. Feasibility Study of a Solar-Powered Electric Vehicle Charging Station Model

    Directory of Open Access Journals (Sweden)

    Bin Ye

    2015-11-01

    Full Text Available In China, the power sector is currently the largest carbon emitter and the transportation sector is the fastest-growing carbon emitter. This paper proposes a model of solar-powered charging stations for electric vehicles to mitigate problems encountered in China’s renewable energy utilization processes and to cope with the increasing power demand by electric vehicles for the near future. This study applies the proposed model to Shenzhen City to verify its technical and economic feasibility. Modeling results showed that the total net present value of a photovoltaic power charging station that meets the daily electricity demand of 4500 kWh is $3,579,236 and that the cost of energy of the combined energy system is $0.098/kWh. In addition, the photovoltaic powered electric vehicle model has pollutant reduction potentials of 99.8%, 99.7% and 100% for carbon dioxide, sulfur dioxide, and nitrogen oxides, respectively, compared with a traditional gasoline-fueled car. Sensitivity analysis results indicated that interest rate has a relatively strong influence on COE (Cost of Energy. An increase in the interest rate from 0% to 6% increases COE from $0.027/kWh to $0.097/kWh. This analysis also suggests that carbon pricing promotes renewable energy only when the price of carbon is above $20/t.

  2. Toward an innovative stochastic modeling of electric charges loss through dielectric

    Directory of Open Access Journals (Sweden)

    Micolau G.

    2016-01-01

    Full Text Available This paper deals with new stochastic modeling of very low tunneling currents in Non-Volatile Memories. For this purpose, we first develop current measurement method based on Floating Gate technique. In order to reach the long time behavior of electrical dynamic, we aim at using very basic tools (power supply, multimeter... but still having a very good current resolution. Also, our measurement is led in a very particular low-noise environment (underground laboratory allowing to keep the electrical contacts on the device under test as long as possible. After showing the feasibility of such measurements, we present a modeling approach of the charge loss process inside the Non-volatile Memories by using mathematical tool involving long memory effect. The model is based on stochastic counting process with memory effect yielding to a fractional relaxation equation for the charge loss over time. The main interest of the present model lies in the fact that the corresponding inversion problem involves only two parameters that can be carried out efficiently.

  3. Inner shell coulomb ionization by heavy charged particles studied by the SCA model

    International Nuclear Information System (INIS)

    Hansteen, J.M.

    1976-06-01

    An outline is given of the development of and some achievements hitherto gained from the semi-classical approximation (SCA) model of atomic Coulomb excitation by heavy charged particles. A few very recent results (1975-1976) are incorporated in the discussion. The SCA model has by now reached a mature state. Hence it seems reasonable to regard the atomic Coulomb excitation phenomenon as part of the extremely complicated excitation mechanism operative in the general ion-atom collision. A clear understanding of the complicated X-ray producing mechanisms in heavy-ion-atom collisions is lacking at present. Despite these facts, the conceptually simple SCA model has furthered our understanding far beyond initial expectations. Moreover, this model has at the same time provided a well-founded starting point for continued researches in this rapidly expanding field of physics. (JIW)

  4. Understanding sensitization behavior of lead selenide photoconductive detectors by charge separation model

    International Nuclear Information System (INIS)

    Zhao, Lihua; Qiu, Jijun; Weng, Binbin; Chang, Caleb; Yuan, Zijian; Shi, Zhisheng

    2014-01-01

    We introduce a charge separation model in this work to explain the mechanism of enhanced photoconductivity of polycrystalline lead salt photoconductors. Our results show that this model could clarify the heuristic fabrication processes of such lead salt detectors that were not well understood and often considered mysterious for nearly a century. The improved lifetime and performance of the device, e.g., responsivity, are attributed to the spatial separation of holes and electrons, hence less possibility of carrier recombination. This model shows that in addition to crystal quality the size of crystallites, the depth of outer conversion layer, and doping concentration could all affect detector performance. The simulation results agree well with experimental results and thus offer a very useful tool for further improvement of lead salt detectors. The model was developed with lead salt family of photoconductors in mind, but may well be applicable to a wider class of semiconducting films

  5. Model-Independent Characterization of Charge Diffusion in Thick Fully Depleted CCDs

    International Nuclear Information System (INIS)

    O'Connor, P.; Takacs, P.; Lawrence, D.; Frank, J.

    2011-01-01

    We present a new method to measure charge diffusion in charge-coupled devices (CCDs). The method is based on a statistical characterization of the shapes of charge clouds produced by low-energy X-rays using known properties of the two-dimensional Gaussian point-spread function (PSF). The algorithm produces reliable upper and lower bounds on the size of the PSF for photons converting near the entrance window of a device. It is optimally suited to the case of thick back-illuminated CCDs where the X-ray absorption length is smaller than the silicon thickness and the diffusion scale is of the same order as the pixel size. The only assumptions are that the charge cloud width is a monotonically increasing function of distance from the conversion point to the buried channel, and that the conversion probability is peaked at the surface. Otherwise, no physical models of carrier transport or knowledge of the electric field profile in the CCD are needed. In suboptimal conditions, the upper bound increases and the lower bound is unaffected, so confidence in the correctness of results is retained. The new method has been benchmarked against Monte Carlo simulations and tested on X-ray images measured on thick high-resistivity prototype CCDs for the Large Synoptic Survey Telescope. In Monte Carlo simulations of noiseless images having the optimal diffusion scale, the upper bound approximated the true PSF within 5%, increasing to 10% in simulations with added noise. Even with severely undersampled or truncated PSFs, the method brackets the true value to within 25%. Our method is accurate and computationally efficient and offers a fast and simple experimental setup.

  6. Developing Antimatter Containment Technology: Modeling Charged Particle Oscillations in a Penning-Malmberg Trap

    Science.gov (United States)

    Chakrabarti, S.; Martin, J. J.; Pearson, J. B.; Lewis, R. A.

    2003-01-01

    The NASA MSFC Propulsion Research Center (PRC) is conducting a research activity examining the storage of low energy antiprotons. The High Performance Antiproton Trap (HiPAT) is an electromagnetic system (Penning-Malmberg design) consisting of a 4 Tesla superconductor, a high voltage confinement electrode system, and an ultra high vacuum test section; designed with an ultimate goal of maintaining charged particles with a half-life of 18 days. Currently, this system is being experimentally evaluated using normal matter ions which are cheap to produce and relatively easy to handle and provide a good indication of overall trap behavior, with the exception of assessing annihilation losses. Computational particle-in-cell plasma modeling using the XOOPIC code is supplementing the experiments. Differing electrode voltage configurations are employed to contain charged particles, typically using flat, modified flat and harmonic potential wells. Ion cloud oscillation frequencies are obtained experimentally by amplification of signals induced on the electrodes by the particle motions. XOOPIC simulations show that for given electrode voltage configurations, the calculated charged particle oscillation frequencies are close to experimental measurements. As a two-dimensional axisymmetric code, XOOPIC cannot model azimuthal plasma variations, such as those induced by radio-frequency (RF) modulation of the central quadrupole electrode in experiments designed to enhance ion cloud containment. However, XOOPIC can model analytically varying electric potential boundary conditions and particle velocity initial conditions. Application of these conditions produces ion cloud axial and radial oscillation frequency modes of interest in achieving the goal of optimizing HiPAT for reliable containment of antiprotons.

  7. Effects of quantum chemistry models for bound electrons on positron annihilation spectra for atoms and small molecules

    International Nuclear Information System (INIS)

    Wang Feng; Ma Xiaoguang; Selvam, Lalitha; Gribakin, Gleb; Surko, Clifford M

    2012-01-01

    The Doppler-shift spectra of the γ-rays from positron annihilation in molecules were determined by using the momentum distribution of the annihilation electron–positron pair. The effect of the positron wavefunction on spectra was analysed in a recent paper (Green et al 2012 New J. Phys. 14 035021). In this companion paper, we focus on the dominant contribution to the spectra, which arises from the momenta of the bound electrons. In particular, we use computational quantum chemistry models (Hartree–Fock with two basis sets and density functional theory (DFT)) to calculate the wavefunctions of the bound electrons. Numerical results are presented for noble gases and small molecules such as H 2 , N 2 , O 2 , CH 4 and CF 4 . The calculations reveal relatively small effects on the Doppler-shift spectra from the level of inclusion of electron correlation energy in the models. For atoms, the difference in the full-width at half-maximum of the spectra obtained using the Hartree–Fock and DFT models does not exceed 2%. For molecules the difference can be much larger, reaching 8% for some molecular orbitals. These results indicate that the predicted positron annihilation spectra for molecules are generally more sensitive to inclusion of electron correlation energies in the quantum chemistry model than the spectra for atoms are. (paper)

  8. Theoretical aspects of electron transfer reactions of complex molecules

    DEFF Research Database (Denmark)

    Kuznetsov, A. M.; Ulstrup, Jens

    2001-01-01

    Features of electron transfer involving complex molecules are discussed. This notion presently refers to molecular reactants where charge transfer is accompanied by large molecular reorganization, and commonly used displaced harmonic oscillator models do not apply. It is shown that comprehensive...... theory of charge transfer in polar media offers convenient tools for the treatment of experimental data for such systems, with due account of large-amplitude strongly anharmonic intramolecular reorganization. Equations for the activation barrier and free energy relationships are provided, incorporating...

  9. Theory of Spin States of Quantum Dot Molecules

    Science.gov (United States)

    Ponomarev, I. V.; Reinecke, T. L.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Gammon, D.; Korenev, V. L.

    2007-04-01

    The photoluminescence spectrum of an asymmetric pair of coupled InAs quantum dots in an applied electric field shows a rich pattern of level anticrossings, crossings and fine structure that can be understood as a superposition of charge and spin configurations. We present a theoretical model that provides a description of the energy positions and intensities of the optical transitions in exciton, biexciton and charged exciton states of coupled quantum dots molecules.

  10. Nonuniversal critical behaviour in a model for charge density wave dynamics

    International Nuclear Information System (INIS)

    Ritala, R.K.; Hertz, J.A.

    1986-02-01

    We have studied short range fluctuations around the infinite-range model of charge density wave (CDW) dynamics. We find that the inhomogeneity of the local field, which is neglected in the infinite-range approximation has a dramatic effect on the transition. In the Bethe approximation the critical behaviour is nonuniversal. In particular, the current exponent is ζ = 3/2 log(z-1)/[log(z)]+log(1+f/J)], where z is the number of neighbors, f the pinning strength, and J the elastic coupling. (orig.)

  11. Advertising Pricing Models in Media Markets: Lump-Sum versus Per-Consumer Charges

    OpenAIRE

    Helmut Dietl; Markus Lang; Panlang Lin

    2012-01-01

    This paper develops a model of asymmetric competition between a pay and a free media platform. The pay media platform generates revenues from media consumers through subscription fees, while the free media platform generates revenues from charging advertisers either on a lump-sum basis (regime A) or on a per-consumer basis (regime B). We show that the free platform produces a higher advertising level and attracts more consumers in regime A than B although advertisers must pay more for ads and...

  12. High energy charge exchange np and antipp scattering using the dual fermion model

    International Nuclear Information System (INIS)

    Weigt, G.

    1976-01-01

    The five independent helicity amplitudes Phisub(i)(s, t) calculated by Mandelstam from the Neveu-Schwarz-Ramond model for fermion-antifermion scattering are used in the Regge limit for a phenomenological description of high energy np and antipp charge exchange scattering. A forward spike which widens with increasing energy as well as an energy dependence changing from lower to higher energy data are reproduced by these non-evasive dual Born amplitudes using π, A 2 and rho Regge pole t-channel exchanges. (author)

  13. Modelling of dielectric hysteresis loops in ferroelectric semiconductors with charged defects

    International Nuclear Information System (INIS)

    Morozovska, Anna N; Eliseev, Eugene A

    2004-01-01

    We have proposed the phenomenological description of dielectric hysteresis loops in ferroelectric semiconductors with charged defects and prevailing extrinsic conductivity. We have modified the Landau-Ginsburg approach and shown that the macroscopic state of the aforementioned inhomogeneous system can be described by three coupled equations for three order parameters. Both the experimentally observed coercive field values well below the thermodynamic values and the various hysteresis-loop deformations (constricted and double loops) have been obtained in the framework of our model. The obtained results quantitatively explain the ferroelectric switching in such ferroelectric materials as thick PZT films

  14. Modelling of charged satellite motion in Earth's gravitational and magnetic fields

    Science.gov (United States)

    Abd El-Bar, S. E.; Abd El-Salam, F. A.

    2018-05-01

    In this work Lagrange's planetary equations for a charged satellite subjected to the Earth's gravitational and magnetic force fields are solved. The Earth's gravity, and magnetic and electric force components are obtained and expressed in terms of orbital elements. The variational equations of orbit with the considered model in Keplerian elements are derived. The solution of the problem in a fully analytical way is obtained. The temporal rate of changes of the orbital elements of the spacecraft are integrated via Lagrange's planetary equations and integrals of the normalized Keplerian motion obtained by Ahmed (Astron. J. 107(5):1900, 1994).

  15. Study of the pressure dependence of dielectric properties of ionic crystals with the exchange-charge model

    Energy Technology Data Exchange (ETDEWEB)

    Batana, A; Faour, J

    1987-03-01

    The formalism of the exchange-charge model (ECM) is extended for studying the pressure dependence of the static dielectric constant and the volume dependence of the effective ionic charge for b.c.c. lattices. Calculated values for CsCl, CsBr, CsI, and TlBr together with the simple shell model values and experimental values are listed and discussed.

  16. Influence of fused aromatic ring on the stability of charge transfer complex between iodine and some five membered heterocyclic molecules through ultrasonic and spectral studies

    Science.gov (United States)

    Ulagendran, V.; Balu, P.; Kannappan, V.; Kumar, R.; Jayakumar, S.

    2017-08-01

    The charge transfer (CT) interaction between two fused heterocyclic compounds with basic pyrrole group as donors, viz., indole (IND) and carbazole (CAR), and iodine (acceptor) in DMSO medium is investigated by ultrasonic and UV-visible spectral methods at 303 K. The formation of CT complex in these systems is established from the trend in acoustical and excess thermo acoustical properties with molar concentration. The frequency acoustic spectra (FAS) is also carried out on these two systems for two fixed concentrations 0.002 M and 0.02 M, and in the frequency range 1 MHz-10 MHz to justify the frequency chosen for ultrasonic study. The absorption coefficient values in solution are computed and discussed. The formation constants of these complexes are determined using Kannappan equation in ultrasonic method. The formation of 1:1 complexes between iodine and IND, CAR was established by the theory of Benesi - Hildebrand in the UV-visible spectroscopic method. The stability constants of the CT complexes determined by spectroscopic and ultrasonic methods show a similar trend. These values also indicate that the presence of fused aromatic ring influences significantly when compared with K values of similar CT complexes of parent five membered heterocyclic compound (pyrrole) reported by us earlier.

  17. Equivalent charge source model based iterative maximum neighbor weight for sparse EEG source localization.

    Science.gov (United States)

    Xu, Peng; Tian, Yin; Lei, Xu; Hu, Xiao; Yao, Dezhong

    2008-12-01

    How to localize the neural electric activities within brain effectively and precisely from the scalp electroencephalogram (EEG) recordings is a critical issue for current study in clinical neurology and cognitive neuroscience. In this paper, based on the charge source model and the iterative re-weighted strategy, proposed is a new maximum neighbor weight based iterative sparse source imaging method, termed as CMOSS (Charge source model based Maximum neighbOr weight Sparse Solution). Different from the weight used in focal underdetermined system solver (FOCUSS) where the weight for each point in the discrete solution space is independently updated in iterations, the new designed weight for each point in each iteration is determined by the source solution of the last iteration at both the point and its neighbors. Using such a new weight, the next iteration may have a bigger chance to rectify the local source location bias existed in the previous iteration solution. The simulation studies with comparison to FOCUSS and LORETA for various source configurations were conducted on a realistic 3-shell head model, and the results confirmed the validation of CMOSS for sparse EEG source localization. Finally, CMOSS was applied to localize sources elicited in a visual stimuli experiment, and the result was consistent with those source areas involved in visual processing reported in previous studies.

  18. irGPU.proton.Net: Irregular strong charge interaction networks of protonatable groups in protein molecules--a GPU solver using the fast multipole method and statistical thermodynamics.

    Science.gov (United States)

    Kantardjiev, Alexander A

    2015-04-05

    A cluster of strongly interacting ionization groups in protein molecules with irregular ionization behavior is suggestive for specific structure-function relationship. However, their computational treatment is unconventional (e.g., lack of convergence in naive self-consistent iterative algorithm). The stringent evaluation requires evaluation of Boltzmann averaged statistical mechanics sums and electrostatic energy estimation for each microstate. irGPU: Irregular strong interactions in proteins--a GPU solver is novel solution to a versatile problem in protein biophysics--atypical protonation behavior of coupled groups. The computational severity of the problem is alleviated by parallelization (via GPU kernels) which is applied for the electrostatic interaction evaluation (including explicit electrostatics via the fast multipole method) as well as statistical mechanics sums (partition function) estimation. Special attention is given to the ease of the service and encapsulation of theoretical details without sacrificing rigor of computational procedures. irGPU is not just a solution-in-principle but a promising practical application with potential to entice community into deeper understanding of principles governing biomolecule mechanisms. © 2015 Wiley Periodicals, Inc.

  19. Numerical modeling of the initial fluctuation condensation stage with charge drops

    Science.gov (United States)

    Averina, T. A.; Zmievskaya, G. I.

    2016-11-01

    This paper deals with a mathematical model of the phase transition of the first kind at the initial stage of forming drops in a liquid or in melted state in a volume of steam with a fixed charge on drops. The model of the process is represented by superposition of random diffusion and jump stochastic processes. The algorithms for solving stochastic differential equations (SDEs) of the model of processes, which form the cluster size, allow one to calculate a distribution function of drops according to their size. The kinetic approach makes possible evaluate the role of the Rayleigh capillary instability at the initial condensation stage and to employ the analysis of electrodispersion mechanisms in the production of metal and semiconductor powders.

  20. Charge based DC compact modeling of bulk FinFET transistor

    Science.gov (United States)

    Cerdeira, A.; Garduño, I.; Tinoco, J.; Ritzenthaler, R.; Franco, J.; Togo, M.; Chiarella, T.; Claeys, C.

    2013-09-01

    Multiple-gate MOSFETs became an industrial reality in the last years. Due to a pragmatic trade-off between CMOS process baselines compatibility, improved performance compared to planar bulk architecture, and cost, bulk FinFETs emerged as the technological solution to provide downscaling for the 14/22 nm technological nodes. In this work, a charge based DC compact model based on the SDDG Model is demonstrated for this new generation of FinFET transistors and describes continuously the transistor characteristics in all operating regions. Validating the model against two bulk FinFET baselines (NMOS, PMOS, various gate lengths and EOT), an excellent agreement is found for transfer and output characteristics (linear and saturation regimes), transconductance/output conductance, and gm/IDS characteristics. Temperature dependence is also taken into account and validated (T range from 25 °C up to 175 °C).

  1. Kinetic energies of charged fragments resulting from multifragmentation and asymmetric fission of the C60 molecule in collisions with monocharged ions (2-130 keV)

    International Nuclear Information System (INIS)

    Rentenier, A; Bordenave-Montesquieu, D; Moretto-Capelle, P; Bordenave-Montesquieu, A

    2003-01-01

    Multifragmentation and asymmetric fission (AF) of the C 60 molecule induced by H + , H 2 + , H 3 + and He + ions at medium collision energies (2-130 keV) are considered. Momenta and kinetic energies of C n + fragment ions (n = 1- 12) are deduced from an analysis of time-of-flight spectra. In multifragmentation processes, momenta are found to be approximately constant when n > 2, a behaviour which explains that the most probable kinetic energy, as well as the width of the kinetic energy distributions, is found to be inversely proportional to the fragment size n; both momenta and kinetic energies are independent of the velocity and nature of the projectile, and hence of the energy deposit. A specific study of the AF shows that the kinetic energies of C 2 + , C 4 + and C 6 + fragments are also independent of the collision velocity and projectile species; a quantitative agreement is found with values deduced from kinetic energy release measurements by another group in electron impact experiments, and the observed decrease when the mass of the light fragment increases is also reproduced. A quantitative comparison of AF and multifragmentation for the n = 2, 4 and 6 fragment ions shows that kinetic energies in AF exceed that in multifragmentation, a result which explains the oscillations observed when momenta or kinetic energies of fragments are plotted against the n-value. The AF yield is also found to scale with the energy deposit in the collision velocity range extending below the velocity at the maximum of the electronic stopping power; except for protons, it remains negligible with respect to multifragmentation as soon as the total energy deposit exceeds about 100 eV

  2. Modeling the Charge Transport in Graphene Nano Ribbon Interfaces for Nano Scale Electronic Devices

    Science.gov (United States)

    Kumar, Ravinder; Engles, Derick

    2015-05-01

    In this research work we have modeled, simulated and compared the electronic charge transport for Metal-Semiconductor-Metal interfaces of Graphene Nano Ribbons (GNR) with different geometries using First-Principle calculations and Non-Equilibrium Green's Function (NEGF) method. We modeled junctions of Armchair GNR strip sandwiched between two Zigzag strips with (Z-A-Z) and Zigzag GNR strip sandwiched between two Armchair strips with (A-Z-A) using semi-empirical Extended Huckle Theory (EHT) within the framework of Non-Equilibrium Green Function (NEGF). I-V characteristics of the interfaces were visualized for various transport parameters. The distinct changes in conductance and I-V curves reported as the Width across layers, Channel length (Central part) was varied at different bias voltages from -1V to 1 V with steps of 0.25 V. From the simulated results we observed that the conductance through A-Z-A graphene junction is in the range of 10-13 Siemens whereas the conductance through Z-A-Z graphene junction is in the range of 10-5 Siemens. These suggested conductance controlled mechanisms for the charge transport in the graphene interfaces with different geometries is important for the design of graphene based nano scale electronic devices like Graphene FETs, Sensors.

  3. Charge and current orders in the spin-fermion model with overlapping hot spots

    Science.gov (United States)

    Volkov, Pavel A.; Efetov, Konstantin B.

    2018-04-01

    Experiments carried over the last years on the underdoped cuprates have revealed a variety of symmetry-breaking phenomena in the pseudogap state. Charge-density waves, breaking of C4 rotational symmetry as well as time-reversal symmetry breaking have all been observed in several cuprate families. In this regard, theoretical models where multiple nonsuperconducting orders emerge are of particular interest. We consider the recently introduced [Volkov and Efetov, Phys. Rev. B 93, 085131 (2016), 10.1103/PhysRevB.93.085131] spin-fermion model with overlapping `hot spots' on the Fermi surface. Focusing on the particle-hole instabilities we obtain a rich phase diagram with the chemical potential relative to the dispersion at (0 ,π );(π ,0 ) and the Fermi surface curvature in the antinodal regions being the control parameters. We find evidence for d-wave Pomeranchuk instability, d-form factor charge density waves, as well as commensurate and incommensurate staggered bond current phases similar to the d-density wave state. The current orders are found to be promoted by the curvature. Considering the appropriate parameter range for the hole-doped cuprates, we discuss the relation of our results to the pseudogap state and incommensurate magnetic phases of the cuprates.

  4. Evolution of charged species in propane/air flames: mass-spectrometric analysis and modelling

    International Nuclear Information System (INIS)

    Rodrigues, J M; Agneray, A; Jaffrezic, X; Bellenoue, M; Labuda, S; Leys, C; Chernukho, A P; Migoun, A N; Cenian, A; Savel'ev, A M; Titova, N S; Starik, A M

    2007-01-01

    Experimental and modelling studies of ion formation during combustion of propane/air mixtures are presented. The positive and negative ions mass/charge spectra in propane/air stoichiometric flame at atmospheric pressure are recorded in the range from 0 to 512 atomic mass units. The C 2 H 3 O + and HCO 2 - ions are found to be the most abundant ionic species in the flame front region. By increasing the distance from the flame front the ion composition changes significantly. In the burnt gas region the H 3 O + , NO + , CO 3 - , HCO 3 - ions are found to be the major charged species. To explain the experimental results the extended kinetic model describing the ion formation in flame and in the extraction system of the mass-spectrometer as well as ion-soot interaction is developed. It is shown that the ionic clusters, which are observed experimentally, form during the adiabatic expansion in the extraction system, and the presence of soot particles may change the total positive and negative ion concentrations in the gas phase

  5. The Weak Charge of the Proton. A Search For Physics Beyond the Standard Model

    Energy Technology Data Exchange (ETDEWEB)

    MacEwan, Scott J. [Univ. of Manitoba, Winnipeg, MB (Canada)

    2015-05-01

    The Qweak experiment, which completed running in May of 2012 at Jefferson Laboratory, has measured the parity-violating asymmetry in elastic electron-proton scattering at four-momentum transfer Q2 =0.025 (GeV/c)2 in order to provide the first direct measurement of the proton's weak charge, QWp. The Standard Model makes firm predictions for the weak charge; deviations from the predicted value would provide strong evidence of new physics beyond the Standard Model. Using an 89% polarized electron beam at 145 microA scattering from a 34.4 cm long liquid hydrogen target, scattered electrons were detected using an array of eight fused-silica detectors placed symmetric about the beam axis. The parity-violating asymmetry was then measured by reversing the helicity of the incoming electrons and measuring the normalized difference in rate seen in the detectors. The low Q2 enables a theoretically clean measurement; the higher-order hadronic corrections are constrained using previous parity-violating electron scattering world data. The experimental method will be discussed, with recent results constituting 4% of our total data and projections of our proposed uncertainties on the full data set.

  6. Charge-transport simulations in organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    May, Falk

    2012-07-06

    In this thesis we have extended the methods for microscopic charge-transport simulations for organic semiconductors, where weak intermolecular interactions lead to spatially localized charge carriers, and the charge transport occurs as an activated hopping process between diabatic states. In addition to weak electronic couplings between these states, different electrostatic environments in the organic material lead to a broadening of the density of states for the charge energies which limits carrier mobilities. The contributions to the method development include (i) the derivation of a bimolecular charge-transfer rate, (ii) the efficient evaluation of intermolecular (outer-sphere) reorganization energies, (iii) the investigation of effects of conformational disorder on intramolecular reorganization energies or internal site energies and (iv) the inclusion of self-consistent polarization interactions for calculation of charge energies. These methods were applied to study charge transport in amorphous phases of small molecules used in the emission layer of organic light emitting diodes (OLED). When bulky substituents are attached to an aromatic core in order to adjust energy levels or prevent crystallization, a small amount of delocalization of the frontier orbital to the substituents can increase electronic couplings between neighboring molecules. This leads to improved charge-transfer rates and, hence, larger charge-mobility. We therefore suggest using the mesomeric effect (as opposed to the inductive effect) when attaching substituents to aromatic cores, which is necessary for example in deep blue OLEDs, where the energy levels of a host molecule have to be adjusted to those of the emitter. Furthermore, the energy landscape for charges in an amorphous phase cannot be predicted by mesoscopic models because they approximate the realistic morphology by a lattice and represent molecular charge distributions in a multipole expansion. The microscopic approach shows that

  7. Machine learning models identify molecules active against the Ebola virus in vitro [version 3; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Sean Ekins

    2017-01-01

    Full Text Available The search for small molecule inhibitors of Ebola virus (EBOV has led to several high throughput screens over the past 3 years. These have identified a range of FDA-approved active pharmaceutical ingredients (APIs with anti-EBOV activity in vitro and several of which are also active in a mouse infection model. There are millions of additional commercially-available molecules that could be screened for potential activities as anti-EBOV compounds. One way to prioritize compounds for testing is to generate computational models based on the high throughput screening data and then virtually screen compound libraries. In the current study, we have generated Bayesian machine learning models with viral pseudotype entry assay and the EBOV replication assay data. We have validated the models internally and externally. We have also used these models to computationally score the MicroSource library of drugs to select those likely to be potential inhibitors. Three of the highest scoring molecules that were not in the model training sets, quinacrine, pyronaridine and tilorone, were tested in vitro and had EC50 values of 350, 420 and 230 nM, respectively. Pyronaridine is a component of a combination therapy for malaria that was recently approved by the European Medicines Agency, which may make it more readily accessible for clinical testing. Like other known antimalarial drugs active against EBOV, it shares the 4-aminoquinoline scaffold. Tilorone, is an investigational antiviral agent that has shown a broad array of biological activities including cell growth inhibition in cancer cells, antifibrotic properties, α7 nicotinic receptor agonist activity, radioprotective activity and activation of hypoxia inducible factor-1. Quinacrine is an antimalarial but also has use as an anthelmintic. Our results suggest data sets with less than 1,000 molecules can produce validated machine learning models that can in turn be utilized to identify novel EBOV inhibitors in

  8. Machine learning models identify molecules active against the Ebola virus in vitro [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Sean Ekins

    2015-10-01

    Full Text Available The search for small molecule inhibitors of Ebola virus (EBOV has led to several high throughput screens over the past 3 years. These have identified a range of FDA-approved active pharmaceutical ingredients (APIs with anti-EBOV activity in vitro and several of which are also active in a mouse infection model. There are millions of additional commercially-available molecules that could be screened for potential activities as anti-EBOV compounds. One way to prioritize compounds for testing is to generate computational models based on the high throughput screening data and then virtually screen compound libraries. In the current study, we have generated Bayesian machine learning models with viral pseudotype entry assay and the EBOV replication assay data. We have validated the models internally and externally. We have also used these models to computationally score the MicroSource library of drugs to select those likely to be potential inhibitors. Three of the highest scoring molecules that were not in the model training sets, quinacrine, pyronaridine and tilorone, were tested in vitro and had EC50 values of 350, 420 and 230 nM, respectively. Pyronaridine is a component of a combination therapy for malaria that was recently approved by the European Medicines Agency, which may make it more readily accessible for clinical testing. Like other known antimalarial drugs active against EBOV, it shares the 4-aminoquinoline scaffold. Tilorone, is an investigational antiviral agent that has shown a broad array of biological activities including cell growth inhibition in cancer cells, antifibrotic properties, α7 nicotinic receptor agonist activity, radioprotective activity and activation of hypoxia inducible factor-1. Quinacrine is an antimalarial but also has use as an anthelmintic. Our results suggest data sets with less than 1,000 molecules can produce validated machine learning models that can in turn be utilized to identify novel EBOV inhibitors in

  9. Machine learning models identify molecules active against the Ebola virus in vitro [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Sean Ekins

    2016-01-01

    Full Text Available The search for small molecule inhibitors of Ebola virus (EBOV has led to several high throughput screens over the past 3 years. These have identified a range of FDA-approved active pharmaceutical ingredients (APIs with anti-EBOV activity in vitro and several of which are also active in a mouse infection model. There are millions of additional commercially-available molecules that could be screened for potential activities as anti-EBOV compounds. One way to prioritize compounds for testing is to generate computational models based on the high throughput screening data and then virtually screen compound libraries. In the current study, we have generated Bayesian machine learning models with viral pseudotype entry assay and the EBOV replication assay data. We have validated the models internally and externally. We have also used these models to computationally score the MicroSource library of drugs to select those likely to be potential inhibitors. Three of the highest scoring molecules that were not in the model training sets, quinacrine, pyronaridine and tilorone, were tested in vitro and had EC50 values of 350, 420 and 230 nM, respectively. Pyronaridine is a component of a combination therapy for malaria that was recently approved by the European Medicines Agency, which may make it more readily accessible for clinical testing. Like other known antimalarial drugs active against EBOV, it shares the 4-aminoquinoline scaffold. Tilorone, is an investigational antiviral agent that has shown a broad array of biological activities including cell growth inhibition in cancer cells, antifibrotic properties, α7 nicotinic receptor agonist activity, radioprotective activity and activation of hypoxia inducible factor-1. Quinacrine is an antimalarial but also has use as an anthelmintic. Our results suggest data sets with less than 1,000 molecules can produce validated machine learning models that can in turn be utilized to identify novel EBOV inhibitors in

  10. Localized Models of Charged Particle Motion in Martian Crustal Magnetic Cusps

    Science.gov (United States)

    Brain, D. A.; Poppe, A. R.; Jarvinen, R.; Dong, Y.; Egan, H. L.; Fang, X.

    2017-12-01

    The induced magnetosphere of Mars is punctuated by localized but strong crustal magnetic fields that are observed to play host to a variety of phenomena typically associated with global magnetic fields, such as auroral processes and particle precipitation, field-aligned current systems, and ion outflow. Each of these phenomena occur on the night side, in small-scale magnetic `cusp' regions of vertically aligned field. Cusp regions are not yet capable of being spatially resolved in global scale models that include the ion kinetics necessary for simulating charged particle transport along cusps. Local models are therefore necessary if we are to understand how cusp processes operate at Mars. Here we present the first results of an effort to model the kinetic particle motion and electric fields in Martian cusps. We are adapting both a 1.5D Particle-in-Cell (PIC) model for lunar magnetic cusps regions to the Martian case and a hybrid model framework (used previously for the global Martian plasma interaction and for lunar magnetic anomaly regions) to cusps in 2D. By comparing the models we can asses the importance of electron kinetics in particle transport along cusp field lines. In this first stage of our study we model a moderately strong nightside cusp, with incident hot hydrogen plasma from above, and cold planetary (oxygen) plasma entering the simulation from below. We report on the spatial and temporal distribution of plasma along cusp field lines for this initial case.

  11. Modeling of monolayer charge-stabilized colloidal crystals with static hexagonal crystal lattice

    Science.gov (United States)

    Nagatkin, A. N.; Dyshlovenko, P. E.

    2018-01-01

    The mathematical model of monolayer colloidal crystals of charged hard spheres in liquid electrolyte is proposed. The particles in the monolayer are arranged into the two-dimensional hexagonal crystal lattice. The model enables finding elastic constants of the crystals from the stress-strain dependencies. The model is based on the nonlinear Poisson-Boltzmann differential equation. The Poisson-Boltzmann equation is solved numerically by the finite element method for any spatial configuration. The model has five geometrical and electrical parameters. The model is used to study the crystal with particles comparable in size with the Debye length of the electrolyte. The first- and second-order elastic constants are found for a broad range of densities. The model crystal turns out to be stable relative to small uniform stretching and shearing. It is also demonstrated that the Cauchy relation is not fulfilled in the crystal. This means that the pair effective interaction of any kind is not sufficient to proper model the elasticity of colloids within the one-component approach.

  12. Evaluation of Model Based State of Charge Estimation Methods for Lithium-Ion Batteries

    Directory of Open Access Journals (Sweden)

    Zhongyue Zou

    2014-08-01

    Full Text Available Four model-based State of Charge (SOC estimation methods for lithium-ion (Li-ion batteries are studied and evaluated in this paper. Different from existing literatures, this work evaluates different aspects of the SOC estimation, such as the estimation error distribution, the estimation rise time, the estimation time consumption, etc. The equivalent model of the battery is introduced and the state function of the model is deduced. The four model-based SOC estimation methods are analyzed first. Simulations and experiments are then established to evaluate the four methods. The urban dynamometer driving schedule (UDDS current profiles are applied to simulate the drive situations of an electrified vehicle, and a genetic algorithm is utilized to identify the model parameters to find the optimal parameters of the model of the Li-ion battery. The simulations with and without disturbance are carried out and the results are analyzed. A battery test workbench is established and a Li-ion battery is applied to test the hardware in a loop experiment. Experimental results are plotted and analyzed according to the four aspects to evaluate the four model-based SOC estimation methods.

  13. An exactly solvable model for multiphoton excitation of polyatomic molecules in the presence of collisions

    International Nuclear Information System (INIS)

    Strekalov, M L

    2013-01-01

    A theoretical study has been made on the non-stationary phenomena in the relaxation of highly vibrationally excited molecules under laser radiation giving rise to these molecules. An exact analytical solution to the master equation has been obtained in terms of Meixner polynomials with regard to VV and VT processes. The time-dependent vibrational distribution is used to obtain analytical expressions for the mean number of photons, stored on the vibrational degrees of freedom and transferred to a thermal bath. Using the latter result, an explicit expression is given for the average energy transfer as a function of time. Its dependence on the partial pressure of absorbing molecules has also been established. (paper)

  14. Negative differential mobility for negative carriers as revealed by space charge measurements on crosslinked polyethylene insulated model cables

    Energy Technology Data Exchange (ETDEWEB)

    Teyssedre, G., E-mail: gilbert.teyssedre@laplace.univ-tlse.fr; Laurent, C. [Université de Toulouse, UPS, INPT, LAPLACE (Laboratoire Plasma et Conversion d' Energie), 118 route de Narbonne, F-31062 Toulouse cedex 9 (France); CNRS, LAPLACE, F-31062 Toulouse (France); Vu, T. T. N. [Université de Toulouse, UPS, INPT, LAPLACE (Laboratoire Plasma et Conversion d' Energie), 118 route de Narbonne, F-31062 Toulouse cedex 9 (France); Electric Power University, 235 Hoang Quoc Viet, 10000 Hanoi (Viet Nam)

    2015-12-21

    Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30–60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10{sup −14}–10{sup −13} m{sup 2} V{sup −1} s{sup −1} for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.

  15. The thermoballistic transport model a novel approach to charge carrier transport in semiconductors

    CERN Document Server

    Lipperheide, Reinhard

    2014-01-01

    The book presents a comprehensive survey of the thermoballistic approach to charge carrier transport in semiconductors. This semi-classical approach, which the authors have developed over the past decade, bridges the gap between the opposing drift-diffusion and ballistic  models of carrier transport. While incorporating basic features of the latter two models, the physical concept underlying the thermoballistic approach constitutes a novel, unifying scheme. It is based on the introduction of "ballistic configurations" arising from a random partitioning of the length of a semiconducting sample into ballistic transport intervals. Stochastic averaging of the ballistic carrier currents over the ballistic configurations results in a position-dependent thermoballistic current, which is the key element of the thermoballistic concept and forms  the point of departure for the calculation of all relevant transport properties. In the book, the thermoballistic concept and its implementation are developed in great detai...

  16. MODELLING OF CHARGE CARRIER MOBILITY FOR TRANSPORT BETWEEN ELASTIC POLYACETYLENE-LIKE POLYMER NANORODS

    Directory of Open Access Journals (Sweden)

    M. Mensik

    2017-03-01

    Full Text Available A quantum model solving the charge carrier mobility between polyacetylene-like polymer nanorods is presented. The model assumes: a Quantum mechanical calculation of hole on-chain delocalization involving electron-phonon coupling leading to the Peierls instability, b Hybridization coupling between the polymer backbone and side-groups (or environmental states, which act as hole traps, and c Semiclassical description of the inter-chain hole transfer in an applied voltage based on Marcus theory. We have found that mobility resonantly depends on the hybridization coupling between polymer and linked groups. We observed also non-trivial mobility dependences on the difference of energies of the highest occupied molecular orbitals localized on the polymer backbone and side-groups, respectively, and hole concentration. Those findings are important for optimization of hybrid opto-electronic devices.

  17. Model of Organic Solar Cell Photocurrent Including the Effect of Charge Accumulation at Interfaces and Non-Uniform Carrier Generation

    DEFF Research Database (Denmark)

    Torto, Lorenzo; Cester, Andrea; Rizzo, Antonio

    2017-01-01

    We developed an improved model to fit the photocurrent density versus voltage in organic solar cells. The model has been validated by fitting data from P3HT:PCBM solar cells. Our model quantitatively accounts for the band bending near the electrodes caused by charge accumulation in the active layer...

  18. A Mathematical model to predict the US Airlines operation costs and airports charges per route per passenger

    NARCIS (Netherlands)

    Carmona Benitez, R.B.; Lodewijiks, G.

    2010-01-01

    A mathematical model to estimate the average airlines operational costs and airports charges per route is important for airlines companies trying to open new routes and for data generation for other purpose such as transport modeling, simulation modeling, investment analyses for airlines and

  19. Electron beam charging of insulators: A self-consistent flight-drift model

    International Nuclear Information System (INIS)

    Touzin, M.; Goeuriot, D.; Guerret-Piecourt, C.; Juve, D.; Treheux, D.; Fitting, H.-J.

    2006-01-01

    Electron beam irradiation and the self-consistent charge transport in bulk insulating samples are described by means of a new flight-drift model and an iterative computer simulation. Ballistic secondary electron and hole transport is followed by electron and hole drifts, their possible recombination and/or trapping in shallow and deep traps. The trap capture cross sections are the Poole-Frenkel-type temperature and field dependent. As a main result the spatial distributions of currents j(x,t), charges ρ(x,t), the field F(x,t), and the potential slope V(x,t) are obtained in a self-consistent procedure as well as the time-dependent secondary electron emission rate σ(t) and the surface potential V 0 (t). For bulk insulating samples the time-dependent distributions approach the final stationary state with j(x,t)=const=0 and σ=1. Especially for low electron beam energies E 0 G of a vacuum grid in front of the target surface. For high beam energies E 0 =10, 20, and 30 keV high negative surface potentials V 0 =-4, -14, and -24 kV are obtained, respectively. Besides open nonconductive samples also positive ion-covered samples and targets with a conducting and grounded layer (metal or carbon) on the surface have been considered as used in environmental scanning electron microscopy and common SEM in order to prevent charging. Indeed, the potential distributions V(x) are considerably small in magnitude and do not affect the incident electron beam neither by retarding field effects in front of the surface nor within the bulk insulating sample. Thus the spatial scattering and excitation distributions are almost not affected

  20. Charging and Screening in Nonpolar Solutions of Nonionizable Surfactants

    Science.gov (United States)

    Behrens, Sven

    2010-03-01

    Nonpolar liquids do not easily accommodate electric charges, but surfactant additives are often found to dramatically increase the solution conductivity and promote surface charging of suspended colloid particles. Such surfactant-mediated electrostatic effects have been associated with equilibrium charge fluctuations among reverse surfactant micelles and in some cases with the statistically rare ionization of individual surfactant molecules. Here we present experimental evidence that even surfactants without any ionizable group can mediate charging and charge screening in nonpolar oils, and that they can do so at surfactant concentrations well below the critical micelle concentration (cmc). Precision conductometry, light scattering, and Karl-Fischer titration of sorbitan oleate solutions in hexane, paired with electrophoretic mobility measur