WorldWideScience

Sample records for charged dna molecules

  1. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    OpenAIRE

    Buyukdagli, Sahin

    2016-01-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

  2. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S

    2007-01-01

    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  3. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    Science.gov (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  4. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  5. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  6. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  7. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  8. Interactions Between Charged Macroions Mediated by Molecules with Rod-like Charged Structures

    Directory of Open Access Journals (Sweden)

    Bohinc, K.

    2014-03-01

    Full Text Available A short review of recent theoretical advances in studies of the interaction between highly charged systems embedded in a solution of rod-like molecules is presented. The system is theoretically described by the functional density theory, where the correlations within the rod-like molecules are accounted for. We show that for sufficiently long molecules and large surface charge densities, an attractive force between like-charged surfaces arises due to the spatially distributed charges within the molecules. The added salt has an influence on the condition for the attractive force between like-charged surfaces. The theoretical results are compared with Monte Carlo simulations. Many phenomena motivate the study of the interaction between like-charged surfaces (DNA condensation, virus aggregation, yeast flocculation, cohesion of cement paste.

  9. Optical Spectroscopy Of Charged Quantum Dot Molecules

    Science.gov (United States)

    Scheibner, M.; Bracker, A. S.; Stinaff, E. A.; Doty, M. F.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.

    2007-04-01

    Coupling between two closely spaced quantum dots is observed by means of photoluminescence spectroscopy. Hole coupling is realized by rational crystal growth and heterostructure design. We identify molecular resonances of different excitonic charge states, including the important case of a doubly charged quantum dot molecule.

  10. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-01-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  11. Difference Raman spectroscopy of DNA molecules

    International Nuclear Information System (INIS)

    Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu

    2015-01-01

    In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule

  12. Nano-manipulation of single DNA molecules

    International Nuclear Information System (INIS)

    Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie

    2004-01-01

    Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)

  13. Electron microscope autoradiography of isolated DNA molecules

    International Nuclear Information System (INIS)

    Delain, Etienne; Bouteille, Michel

    1980-01-01

    Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections

  14. Charge transport through DNA based electronic barriers

    Science.gov (United States)

    Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

    2018-05-01

    We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

  15. Spectroscopy of Charged Quantum Dot Molecules

    Science.gov (United States)

    Stinaff, E. A.; Scheibner, M.; Bracker, A. S.; Ponomarev, I. V.; Ware, M. E.; Doty, M. F.; Reinecke, T. L.; Gammon, D.; Korenev, V. L.

    2006-03-01

    Spins of single charges in quantum dots are attractive for many quantum information and spintronic proposals. Scalable quantum information applications require the ability to entangle and operate on multiple spins in coupled quantum dots (CQDs). To further the understanding of these systems, we present detailed spectroscopic studies of InAs CQDs with control of the discrete electron or hole charging of the system. The optical spectrum reveals a pattern of energy anticrossings and crossings in the photoluminescence as a function of applied electric field. These features can be understood as a superposition of charge and spin configurations of the two dots and represent clear signatures of quantum mechanical coupling. The molecular resonance leading to these anticrossings is achieved at different electric fields for the optically excited (trion) states and the ground (hole) states allowing for the possibility of using the excited states for optically induced coupling of the qubits.

  16. Effects of Environmental Factors and Metallic Electrodes on AC Electrical Conduction Through DNA Molecule.

    Science.gov (United States)

    Abdalla, S; Obaid, A; Al-Marzouki, F M

    2017-12-01

    Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA moleculeDNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a

  17. Theory of Charged Quantum Dot Molecules

    Science.gov (United States)

    Ponomarev, I. V.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Ware, M. E.; Gammon, D.; Reinecke, T. L.; Korenev, V. L.

    2006-03-01

    Recent optical spectroscopy of excitonic molecules in coupled quantum dots (CQDs) tuned by electric field reveal a richer diversity in spectral line patterns than in their single quantum dot counterparts. We developed a theoretical model that allows us to classify energies and intensities of various PL transitions. In this approach the electric field induced resonance tunneling of the electron and hole states occurs at different biases due to the inherent asymmetry of CQDs. The truncated many-body basis configurations for each molecule are constructed from antisymmetrized products of single-particle states, where the electron occupies only one ground state level in single QD and the hole can occupy two lowest levels of CQD system. The Coulomb interaction between particles is treated with perturbation theory. As a result the observed PL spectral lines can be described with a small number of parameters. The theoretical predictions account well for recent experiments.

  18. Thermally induced charge current through long molecules

    Science.gov (United States)

    Zimbovskaya, Natalya A.; Nitzan, Abraham

    2018-01-01

    In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

  19. DNA-psoralen interaction: a single molecule experiment.

    Science.gov (United States)

    Rocha, M S; Viana, N B; Mesquita, O N

    2004-11-15

    By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  20. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  1. Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

  2. About the correlation between atomic charge fluctuations in a molecule

    International Nuclear Information System (INIS)

    Pitanga, P.; Giambiagi, M.S. de; Giambiagi, M.

    1987-01-01

    In this note, the features of the correlation between the electronic charge fluctuations of a pair of atoms within a molecule are analised. Through Schwarz's inequality for random operators in the Hilbert space, the softness of an atom in a molecule is related to its valence and to the softness of the other atoms. It is concluded that in the general case this correlation (from which in turn stems the chemical bond) in non-linear. (author) [pt

  3. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    Science.gov (United States)

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  4. Anisotropy in highly charged ion induced molecule fragmentation

    International Nuclear Information System (INIS)

    Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.

    2006-01-01

    Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)

  5. Electrochemical single-molecule conductivity of duplex and quadruplex DNA

    DEFF Research Database (Denmark)

    Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens

    2017-01-01

    Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...

  6. Quantifying DNA melting transitions using single-molecule force spectroscopy

    International Nuclear Information System (INIS)

    Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J

    2009-01-01

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  7. Quantifying DNA melting transitions using single-molecule force spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu

    2009-01-21

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  8. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  9. DNA analysis by single molecule stretching in nanofluidic biochips

    DEFF Research Database (Denmark)

    Abad, E.; Juarros, A.; Retolaza, A.

    2011-01-01

    Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

  10. Surface-confined electroactive molecules for multistate charge storage information.

    Science.gov (United States)

    Mas-Torrent, M; Rovira, C; Veciana, J

    2013-01-18

    Bi-stable molecular systems with potential for applications in binary memory devices are raising great interest for device miniaturization. Particular appealing are those systems that operate with electrical inputs since they are compatible with existing electronic technologies. The processing of higher memory densities in these devices could be accomplished by increasing the number of memory states in each cell, although this strategy has not been much explored yet. Here we highlight the recent advances devoted to the fabrication of charge-storage molecular surface-confined devices exhibiting multiple states. Mainly, this goal has been realized immobilizing a variety (or a combination) of electroactive molecules on a surface, although alternative approaches employing non-electroactive systems have also been described. Undoubtedly, the use of molecules with chemically tunable properties and nanoscale dimensions are raising great hopes for the devices of the future in which molecules can bring new perspectives such as multistability.

  11. Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

    Science.gov (United States)

    Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

    2018-05-01

    Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

  12. Effects of charged particles on DNA

    International Nuclear Information System (INIS)

    Eguchi-Kasai, Kiyomi; Itsukaichi, Hiromi; Murakami, Masahiro

    1995-01-01

    It can be noted that it is not simple double strand breaks (dsb) but the non-reparable breaks that are associated with high biological effectiveness in the cell killing effect for high LET radiation. Here, we have examined the effectiveness of fast neutrons and low (initial energy = 12 MeV/u) or high (135 MeV/u) energy charged particles on cell death in 19 mammalian cell lines including radiosensitive mutants. Some of the radiosensitive lines were deficient in DNA dsb repair such as LX830, M10, V3, and L5178Y-S cells and showed lower values of relative biological effectiveness (RBE) for fast neutrons if compared with their parent cell lines. The other lines of human ataxia-telangiectasia fibroblasts, irs 1, irs 2, irs 3 and irs 1SF cells, which were also radiosensitive but known as proficient in dsb repair, showed moderate RBEs. Dsb repair deficient mutants showed low RBE values for heavy ions. These experimental findings suggest that the DNA repair system does not play a major role against the attack of high linear energy transfer (LET) radiations. Therefore, we hypothesize that a main cause of cell death induced by high LET radiations is due to non-reparable dsb, which are produced at a higher rate compared to low LET radiations. (author)

  13. How to read and write mechanical information in DNA molecules

    Science.gov (United States)

    Schiessel, Helmut

    In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

  14. A single molecule DNA flow stretching microscope for undergraduates

    NARCIS (Netherlands)

    Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.

    2011-01-01

    The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

  15. Automation of a single-DNA molecule stretching device

    DEFF Research Database (Denmark)

    Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels

    2015-01-01

    We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

  16. DNA molecules and human therapeutics | Danquah | African Journal ...

    African Journals Online (AJOL)

    Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

  17. Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van

    2009-01-01

    We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

  18. DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

    Science.gov (United States)

    Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

    2015-09-16

    Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

  19. Electronic transport in single-helical protein molecules: Effects of multiple charge conduction pathways and helical symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.

    2016-07-15

    We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.

  20. Charge transport through image charged stabilized states in a single molecule single electron transistor device

    International Nuclear Information System (INIS)

    Hedegard, Per; Bjornholm, Thomas

    2005-01-01

    The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond

  1. Highly parallel translation of DNA sequences into small molecules.

    Directory of Open Access Journals (Sweden)

    Rebecca M Weisinger

    Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

  2. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  3. Studying DNA looping by single-molecule FRET.

    Science.gov (United States)

    Le, Tung T; Kim, Harold D

    2014-06-28

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

  4. Developing DNA nanotechnology using single-molecule fluorescence.

    Science.gov (United States)

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

    2014-06-17

    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  5. Ultrafast dynamics of solvation and charge transfer in a DNA-based biomaterial.

    Science.gov (United States)

    Choudhury, Susobhan; Batabyal, Subrata; Mondol, Tanumoy; Sao, Dilip; Lemmens, Peter; Pal, Samir Kumar

    2014-05-01

    Charge migration along DNA molecules is a key factor for DNA-based devices in optoelectronics and biotechnology. The association of a significant amount of water molecules in DNA-based materials for the intactness of the DNA structure and their dynamic role in the charge-transfer (CT) dynamics is less documented in contemporary literature. In the present study, we have used a genomic DNA-cetyltrimethyl ammonium chloride (CTMA) complex, a technological important biomaterial, and Hoechest 33258 (H258), a well-known DNA minor groove binder, as fluorogenic probe for the dynamic solvation studies. The CT dynamics of CdSe/ZnS quantum dots (QDs; 5.2 nm) embedded in the as-prepared and swollen biomaterial have also been studied and correlated with that of the timescale of solvation. We have extended our studies on the temperature-dependent CT dynamics of QDs in a nanoenvironment of an anionic, sodium bis(2-ethylhexyl)sulfosuccinate reverse micelle (AOT RMs), whereby the number of water molecules and their dynamics can be tuned in a controlled manner. A direct correlation of the dynamics of solvation and that of the CT in the nanoenvironments clearly suggests that the hydration barrier within the Arrhenius framework essentially dictates the charge-transfer dynamics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Charge transfer in pi-stacked systems including DNA

    International Nuclear Information System (INIS)

    Siebbeles, L.D.A.

    2003-01-01

    Charge migration in DNA is a subject of intense current study motivated by long-range detection of DNA damage and the potential application of DNA as a molecular wire in nanoscale electronic devices. A key structural element, which makes DNA a medium for long-range charge transfer, is the array of stacked base pairs in the interior of the double helix. The overlapping pi-orbitals of the nucleobases provide a pathway for motion of charge carriers generated on the stack. This 'pi-pathway' resembles the columnarly stacked macrocyclic cores in discotic materials such as triphenylenes. The structure of these pi-stacked systems is highly disordered with dynamic fluctuations occurring on picosecond to nanosecond time scales. Theoretical calculations, concerning the effects of structural disorder and nucleobase sequence in DNA, on the dynamics of charge carriers are presented. Electronic couplings and localization energies of charge carriers were calculated using density functional theory (DFT). Results for columnarly stacked triphenylenes and DNA nucleobases are compared. The results are used to provide insight into the factors that control the mobility of charge carriers. Further, experimental results on the site-selective oxidation of guanine nucleobases in DNA (hot spots for DNA damage) are analyzed on basis of the theoretical results

  7. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer

    2017-09-14

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.

  8. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson

    2013-01-01

    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  9. Structural Arrangement of Water Molecules around Highly Charged Nanoparticles: Molecular Dynamics Simulation

    International Nuclear Information System (INIS)

    Kim, Eunae; Yeom, Min Sun

    2014-01-01

    Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge

  10. Single-molecule mechanics of protein-labelled DNA handles

    Directory of Open Access Journals (Sweden)

    Vivek S. Jadhav

    2016-01-01

    Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

  11. Temperature Dependence of Charge Localization in High-Mobility, Solution-Crystallized Small Molecule Semiconductors Studied by Charge Modulation Spectroscopy

    DEFF Research Database (Denmark)

    Meneau, Aurélie Y. B.; Olivier, Yoann; Backlund, Tomas

    2016-01-01

    In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld-effect tran......In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld......-effect transistor and CMS measurements as a function of temperature that in certain molecular semiconductors, such as solution-processible pentacene, charge carriers become trapped at low temperatures in environments in which the charges become highly localized on individual molecules, while in some other molecules...

  12. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

    2006-01-01

    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  13. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  14. Analysis of DNA interactions using single-molecule force spectroscopy.

    Science.gov (United States)

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

    2013-06-01

    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  15. DNA replication at the single-molecule level

    NARCIS (Netherlands)

    Stratmann, S.A.; Oijen, A.M. van

    2014-01-01

    A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

  16. Charge Migration in DNA Perspectives from Physics, Chemistry, and Biology

    CERN Document Server

    Chakraborty, Tapash

    2007-01-01

    Charge migration through DNA has been the focus of considerable interest in recent years. A deeper understanding of the nature of charge transfer and transport along the double helix is important in fields as diverse as physics, chemistry and nanotechnology. It has also important implications in biology, in particular in DNA damage and repair. This book presents contributions from an international team of researchers active in this field. It contains a wide range of topics that includes the mathematical background of the quantum processes involved, the role of charge transfer in DNA radiation damage, a new approach to DNA sequencing, DNA photonics, and many others. This book should be of value to researchers in condensed matter physics, chemical physics, physical chemistry, and nanoscale sciences.

  17. [The effect of spermine on acid-base equilibrium in DNA molecule].

    Science.gov (United States)

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  18. Charge transfer through DNA/DNA duplexes and DNA/RNA hybrids: complex theoretical and experimental studies.

    Science.gov (United States)

    Kratochvílová, Irena; Vala, Martin; Weiter, Martin; Špérová, Miroslava; Schneider, Bohdan; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír

    2013-01-01

    Oligonucleotides conduct electric charge via various mechanisms and their characterization and understanding is a very important and complicated task. In this work, experimental (temperature dependent steady state fluorescence spectroscopy, time-resolved fluorescence spectroscopy) and theoretical (Density Functional Theory) approaches were combined to study charge transfer processes in short DNA/DNA and RNA/DNA duplexes with virtually equivalent sequences. The experimental results were consistent with the theoretical model - the delocalized nature of HOMO orbitals and holes, base stacking, electronic coupling and conformational flexibility formed the conditions for more effective short distance charge transfer processes in RNA/DNA hybrids. RNA/DNA and DNA/DNA charge transfer properties were strongly connected with temperature affected structural changes of molecular systems - charge transfer could be used as a probe of even tiny changes of molecular structures and settings. © 2013. Published by Elsevier B.V. All rights reserved.

  19. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  20. Single Molecule Study of DNA Organization and Recombination

    Science.gov (United States)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  1. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  2. DNA Charge Transport: From Chemical Principles to the Cell

    Science.gov (United States)

    Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.

    2016-01-01

    The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744

  3. Low energy cross section data for ion-molecule reactions in hydrogen systems and for charge transfer of multiply charged ions with atoms and molecules

    International Nuclear Information System (INIS)

    Okuno, Kazuhiko

    2007-04-01

    Systematic cross section measurements for ion-molecule reactions in hydrogen systems and for charge transfer of multiply charged ions in low energy collisions with atoms and molecules have been performed continuously by the identical apparatus installed with an octo-pole ion beam guide (OPIG) since 1980 till 2004. Recently, all of accumulated cross section data for a hundred collision systems has been entered into CMOL and CHART of the NIFS atomic and molecular numerical database together with some related cross section data. In this present paper, complicated ion-molecule reactions in hydrogen systems are revealed and the brief outlines of specific properties in low energy charge transfer collisions of multiply charged ions with atoms and molecules are introduced. (author)

  4. Effect of a Dual Charge on the DNA-Conjugated Redox Probe on DNA Sensing by Short Hairpin Beacons Tethered to Gold Electrodes.

    Science.gov (United States)

    Kékedy-Nagy, László; Shipovskov, Stepan; Ferapontova, Elena E

    2016-08-16

    Charges of redox species can critically affect both the interfacial state of DNA and electrochemistry of DNA-conjugated redox labels and, as a result, the electroanalytical performance of those systems. Here, we show that the kinetics of electron transfer (ET) between the gold electrode and methylene blue (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge of the MB molecule, and that affects the performance of genosensors exploiting MB-labeled hairpin DNA beacons. Positively charged MB binds to dsDNA via electrostatic and intercalative/groove binding, and this binding allows the DNA-mediated electrochemistry of MB intercalated into the duplex and, as a result, a complex mode of the electrochemical signal change upon hairpin hybridization to the target DNA, dominated by the "on-off" signal change mode at nanomolar levels of the analyzed DNA. When MB bears an additional carboxylic group, the negative charge provided by this group prevents intimate interactions between MB and DNA, and then the ET in duplexes is limited by the diffusion of the MB-conjugated dsDNA (the phenomenon first shown in Farjami , E. ; Clima , L. ; Gothelf , K. ; Ferapontova , E. E. Anal. Chem. 2011 , 83 , 1594 ) providing the robust "off-on" nanomolar DNA sensing. Those results can be extended to other intercalating redox probes and are of strategic importance for design and development of electrochemical hybridization sensors exploiting DNA nanoswitchable architectures.

  5. Inhibition of DNA glycosylases via small molecule purine analogs.

    Directory of Open Access Journals (Sweden)

    Aaron C Jacobs

    Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

  6. Single-molecule denaturation mapping of DNA in nanofluidic channels

    DEFF Research Database (Denmark)

    Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

    2010-01-01

    Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

  7. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    International Nuclear Information System (INIS)

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

    2007-01-01

    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  8. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  9. Topology of charge density of flucytosine and related molecules and characteristics of their bond charge distributions.

    Science.gov (United States)

    Murgich, Juan; Franco, Héctor J; San-Blas, Gioconda

    2006-08-24

    The molecular charge distribution of flucytosine (4-amino-5-fluoro-2-pyrimidone), uracil, 5-fluorouracil, and thymine was studied by means of density functional theory calculations (DFT). The resulting distributions were analyzed by means of the atoms in molecules (AIM) theory. Bonds were characterized through vectors formed with the charge density value, its Laplacian, and the bond ellipticity calculated at the bond critical point (BCP). Within each set of C=O, C-H, and N-H bonds, these vectors showed little dispersion. C-C bonds formed three different subsets, one with a significant degree of double bonding, a second corresponding to single bonds with a finite ellipticity produced by hyperconjugation, and a third one formed by a pure single bond. In N-C bonds, a decrease in bond length (an increase in double bond character) was not reflected as an increase in their ellipticity, as in all C-C bonds studied. It was also found that substitution influenced the N-C, C-O, and C-C bond ellipticity much more than density and its Laplacian at the BCP. The Laplacian of charge density pointed to the existence of both bonding and nonbonding maxima in the valence shell charge concentration of N, O, and F, while only bonding ones were found for the C atoms. The nonbonding maxima related to the sites for electrophilic attack and H bonding in O and N, while sites of nucleophilic attack were suggested by the holes in the valence shell of the C atoms of the carbonyl groups.

  10. DNA condensation by partially acetylated poly(amido amine) dendrimers: effects of dendrimer charge density on complex formation.

    Science.gov (United States)

    Yu, Shi; Li, Ming-Hsin; Choi, Seok Ki; Baker, James R; Larson, Ronald G

    2013-09-03

    The ability of poly(amido amine) (or PAMAM) dendrimers to condense semiflexible dsDNA and penetrate cell membranes gives them great potential in gene therapy and drug delivery but their high positive surface charge makes them cytotoxic. Here, we describe the effects of partial neutralization by acetylation on DNA condensation using light scattering, circular dichroism, and single molecule imaging of dendrimer-DNA complexes combed onto surfaces and tethered to those surfaces under flow. We find that DNA can be condensed by generation-five (G5) dendrimers even when the surface charges are more than 65% neutralized, but that such dendrimers bind negligibly when an end-tethered DNA is stretched in flow. We also find that when fully charged dendrimers are introduced by flow to end-tethered DNA, all DNA molecules become equally highly coated with dendrimers at a rate that becomes very fast at high dendrimer concentration, and that dendrimers remain bound during subsequent flow of dendrimer-free buffer. These results suggest that the presence of dendrimer-free DNA coexisting with dendrimer-bound DNA after bulk mixing of the two in solution may result from diffusion-limited irreversible dendrimer-DNA binding, rather than, or in addition to, the previously proposed cooperative binding mechanism of dendrimers to DNA.

  11. DNA Condensation by Partially Acetylated Poly(amido amine Dendrimers: Effects of Dendrimer Charge Density on Complex Formation

    Directory of Open Access Journals (Sweden)

    Ronald G. Larson

    2013-09-01

    Full Text Available The ability of poly(amido amine (or PAMAM dendrimers to condense semiflexible dsDNA and penetrate cell membranes gives them great potential in gene therapy and drug delivery but their high positive surface charge makes them cytotoxic. Here, we describe the effects of partial neutralization by acetylation on DNA condensation using light scattering, circular dichroism, and single molecule imaging of dendrimer-DNA complexes combed onto surfaces and tethered to those surfaces under flow. We find that DNA can be condensed by generation-five (G5 dendrimers even when the surface charges are more than 65% neutralized, but that such dendrimers bind negligibly when an end-tethered DNA is stretched in flow. We also find that when fully charged dendrimers are introduced by flow to end-tethered DNA, all DNA molecules become equally highly coated with dendrimers at a rate that becomes very fast at high dendrimer concentration, and that dendrimers remain bound during subsequent flow of dendrimer-free buffer. These results suggest that the presence of dendrimer-free DNA coexisting with dendrimer-bound DNA after bulk mixing of the two in solution may result from diffusion-limited irreversible dendrimer-DNA binding, rather than, or in addition to, the previously proposed cooperative binding mechanism of dendrimers to DNA.

  12. Single molecule DNA detection with an atomic vapor notch filter

    Energy Technology Data Exchange (ETDEWEB)

    Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)

    2015-12-01

    The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

  13. A study on interaction of DNA molecules and carbon nanotubes for an effective ejection of the molecules

    International Nuclear Information System (INIS)

    Wu, N.; Wang, Q.

    2012-01-01

    The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.

  14. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

    Science.gov (United States)

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria

    2017-09-21

    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

    International Nuclear Information System (INIS)

    Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

    2009-01-01

    We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

  16. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  17. Charge Transport in 2D DNA Tunnel Junction Diodes

    KAUST Repository

    Yoon, Minho

    2017-11-06

    Recently, deoxyribonucleic acid (DNA) is studied for electronics due to its intrinsic benefits such as its natural plenitude, biodegradability, biofunctionality, and low-cost. However, its applications are limited to passive components because of inherent insulating properties. In this report, a metal-insulator-metal tunnel diode with Au/DNA/NiOx junctions is presented. Through the self-aligning process of DNA molecules, a 2D DNA nanosheet is synthesized and used as a tunneling barrier, and semitransparent conducting oxide (NiOx ) is applied as a top electrode for resolving metal penetration issues. This molecular device successfully operates as a nonresonant tunneling diode, and temperature-variable current-voltage analysis proves that Fowler-Nordheim tunneling is a dominant conduction mechanism at the junctions. DNA-based tunneling devices appear to be promising prototypes for nanoelectronics using biomolecules.

  18. Charge Transport in 2D DNA Tunnel Junction Diodes

    KAUST Repository

    Yoon, Minho; Min, Sung-Wook; Dugasani, Sreekantha Reddy; Lee, Yong Uk; Oh, Min Suk; Anthopoulos, Thomas D.; Park, Sung Ha; Im, Seongil

    2017-01-01

    Recently, deoxyribonucleic acid (DNA) is studied for electronics due to its intrinsic benefits such as its natural plenitude, biodegradability, biofunctionality, and low-cost. However, its applications are limited to passive components because of inherent insulating properties. In this report, a metal-insulator-metal tunnel diode with Au/DNA/NiOx junctions is presented. Through the self-aligning process of DNA molecules, a 2D DNA nanosheet is synthesized and used as a tunneling barrier, and semitransparent conducting oxide (NiOx ) is applied as a top electrode for resolving metal penetration issues. This molecular device successfully operates as a nonresonant tunneling diode, and temperature-variable current-voltage analysis proves that Fowler-Nordheim tunneling is a dominant conduction mechanism at the junctions. DNA-based tunneling devices appear to be promising prototypes for nanoelectronics using biomolecules.

  19. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  20. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

    2008-01-01

    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  1. Charge-transfer interactions of Cr species with DNA.

    Science.gov (United States)

    Nowicka, Anna M; Matysiak-Brynda, Edyta; Hepel, Maria

    2017-10-01

    Interactions of Cr species with nucleic acids in living organisms depend strongly on Cr oxidation state and the environmental conditions. As the effects of these interactions range from benign to pre-mutagenic to carcinogenic, careful assessment of the hazard they pose to human health is necessary. We have investigated methods that would enable quantifying the DNA damage caused by Cr species under varying environmental conditions, including UV, O 2 , and redox potential, using simple instrumental techniques which could be in future combined into a field-deployable instrumentation. We have employed electrochemical quartz crystal nanogravimetry (EQCN), cyclic voltammetry (CV), and electrochemical impedance spectroscopy (EIS) to evaluate the extent of DNA damage expressed in terms of guanine oxidation yield (η) and changes in specific characteristics provided by these techniques. The effects of the interactions of Cr species with DNA were analyzed using a model calf thymus DNA (ctDNA) film on a gold electrode (Au@ctDNA) in different media, including: (i) Cr(VI), (ii) Cr(VI) reduced at -0.2V, (iii) Cr(III)+UV radiation+O 2 , and Cr(III), obtaining the η values: 7.4±1.4, 1.5±0.4, 1.1±0.31%, and 0%, respectively, thus quantifying the hazard posed. The EIS measurements have enabled utilizing the decrease in charge-transfer resistance (R ct ) for ferri/ferrocyanide redox probe at an Au@ctDNA electrode to assess the oxidative ctDNA damage by Cr(VI) species. In this case, circular dichroism indicates an extensive damage to the ctDNA hydrogen bonding. On the other hand, Cr(III) species have not induced any damage to ctDNA, although the EQCN measurements show an electrostatic binding to DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Challenging chemical concepts through charge density of molecules and crystals

    International Nuclear Information System (INIS)

    Gatti, Carlo

    2013-01-01

    Narrating my scientific career, I show in this paper how, starting as a computational and theoretical chemist, I got naturally involved with x-ray crystallographers because of the common interest in charge density and in the study of chemical bonds based on such an observable. The tools I devised and the conceptual developments I made to facilitate a profitable encounter between x-ray charge density and computational chemistry researchers are illustrated, with a special focus on the proposal and applications of the Source Function concept. (comment)

  3. Multiplex single-molecule interaction profiling of DNA barcoded proteins

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

    2014-01-01

    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  4. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

  5. Equilibrium distributions of free charged particles and molecules in systems with non-plane boundaries

    International Nuclear Information System (INIS)

    Usenko, A.S.

    1995-01-01

    The equilibrium space-inhomogeneous distributions of free and pair bound charged particles are calculated in the dipole approximation for the plasma-molecular cylinder and sphere. It is shown that the space and orientational distributions of charged particles and molecules in these systems are similar to those in the cases of plasma-molecular system restricted by one or two parallel planes. The influence of the parameters of outer medium and a plasma-molecular system on the space and orientational distributions of charged particles and molecules is studied in detail

  6. Charge migration induced by attosecond pulses in bio-relevant molecules

    International Nuclear Information System (INIS)

    Calegari, Francesca; Castrovilli, Mattea C; Nisoli, Mauro; Trabattoni, Andrea; Palacios, Alicia; Ayuso, David; Martín, Fernando; Greenwood, Jason B; Decleva, Piero

    2016-01-01

    After sudden ionization of a large molecule, the positive charge can migrate throughout the system on a sub-femtosecond time scale, purely guided by electronic coherences. The possibility to actively explore the role of the electron dynamics in the photo-chemistry of bio-relevant molecules is of fundamental interest for understanding, and perhaps ultimately controlling, the processes leading to damage, mutation and, more generally, to the alteration of the biological functions of the macromolecule. Attosecond laser sources can provide the extreme time resolution required to follow this ultrafast charge flow. In this review we will present recent advances in attosecond molecular science: after a brief description of the results obtained for small molecules, recent experimental and theoretical findings on charge migration in bio-relevant molecules will be discussed. (topical review)

  7. Modulation and Control of Charge Transport Through Single-Molecule Junctions.

    Science.gov (United States)

    Wang, Kun; Xu, Bingqian

    2017-02-01

    The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge

  8. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

  9. Crystal growth of new charge-transfer salts based on π-conjugated donor molecules

    Energy Technology Data Exchange (ETDEWEB)

    Morherr, Antonia, E-mail: morherr@stud.uni-frankfurt.de [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Witt, Sebastian [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Chernenkaya, Alisa [Graduate School Materials Science in Mainz, 55128 Mainz (Germany); Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bäcker, Jan-Peter [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Schönhense, Gerd [Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bolte, Michael [Institut für anorganische Chemie, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Krellner, Cornelius [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany)

    2016-09-01

    New charge transfer crystals of π-conjugated, aromatic molecules (phenanthrene and picene) as donors were obtained by physical vapor transport. The melting behavior, optimization of crystal growth and the crystal structure are reported for charge transfer salts with (fluorinated) tetracyanoquinodimethane (TCNQ-F{sub x}, x=0, 2, 4), which was used as acceptor material. The crystal structures were determined by single-crystal X-ray diffraction. Growth conditions for different vapor pressures in closed ampules were applied and the effect of these starting conditions for crystal size and quality is reported. The process of charge transfer was investigated by geometrical analysis of the crystal structure and by infrared spectroscopy on single crystals. With these three different acceptor strengths and the two sets of donor materials, it is possible to investigate the distribution of the charge transfer systematically. This helps to understand the charge transfer process in this class of materials with π-conjugated donor molecules.

  10. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

    1976-01-01

    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  11. Studying DNA Looping by Single-Molecule FRET

    OpenAIRE

    Le, Tung T.; Kim, Harold D.

    2014-01-01

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...

  12. Charge-Dipole Acceleration of Polar Gas Molecules towards Charged Nanoparticles: Involvement in Powerful Charge-Induced Catalysis of Heterophase Chemical Reactions and Ball Lightning Phenomenon

    Directory of Open Access Journals (Sweden)

    Oleg Meshcheryakov

    2010-01-01

    Full Text Available In humid air, the substantial charge-dipole attraction and electrostatic acceleration of surrounding water vapour molecules towards charged combustible nanoparticles cause intense electrostatic hydration and preferential oxidation of these nanoparticles by electrostatically accelerated polar water vapour molecules rather than nonaccelerated nonpolar oxygen gas molecules. Intense electrostatic hydration of charged combustible nanoparticles converts the nanoparticle's oxide-based shells into the hydroxide-based electrolyte shells, transforming these nanoparticles into reductant/air core-shell nanobatteries, periodically short-circuited by intraparticle field and thermionic emission. Partially synchronized electron emission breakdowns within trillions of nanoparticles-nanobatteries turn a cloud of charged nanoparticles-nanobatteries into a powerful radiofrequency aerosol generator. Electrostatic oxidative hydration and charge-catalyzed oxidation of charged combustible nanoparticles also contribute to a self-oscillating thermocycling process of evolution and periodic autoignition of inflammable gases near to the nanoparticle's surface. The described effects might be of interest for the improvement of certain nanotechnological heterophase processes and to better understand ball lightning phenomenon.

  13. Theory and simulation of charge transfer through DNA - nanotube contacts

    International Nuclear Information System (INIS)

    Rink, Gunda; Kong Yong; Koslowski, Thorsten

    2006-01-01

    We address the problem of charge transfer between a single-stranded adenine oligomer and semiconducting boron nitride nanotubes from a theoretical and numerical perspective. The model structures have been motivated by computer simulations; sample geometries are used as the input of an electronic structure theory that is based upon an extended Su-Schrieffer-Heeger Hamiltonian. By analyzing the emerging potential energy surfaces, we obtain hole transfer rates via Marcus' theory of charge transfer. In the presence of nanotubes, these rates exceed those of isolated DNA single strands by a factor of up to 10 4 . This enhancement can be rationalized and quantified as a combination of a template effect and the participation of the tube within a superexchange mechanism

  14. Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules.

    Science.gov (United States)

    Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin; Huang, Yingzhou

    2017-08-02

    The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-M x (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-M x complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS.

  15. Nanoinjection: pronuclear DNA delivery using a charged lance.

    Science.gov (United States)

    Aten, Quentin T; Jensen, Brian D; Tamowski, Susan; Wilson, Aubrey M; Howell, Larry L; Burnett, Sandra H

    2012-12-01

    We present a non-fluidic pronuclear injection method using a silicon microchip "nanoinjector" composed of a microelectromechanical system with a solid, electrically conductive lance. Unlike microinjection which uses fluid delivery of DNA, nanoinjection electrically accumulates DNA on the lance, the DNA-coated lance is inserted into the pronucleus, and DNA is electrically released. We compared nanoinjection and microinjection side-by-side over the course of 4 days, injecting 1,013 eggs between the two groups. Nanoinjected zygotes had significantly higher rates of integration per injected embryo, with 6.2% integration for nanoinjected embryos compared to 1.6% integration for microinjected embryos. This advantage is explained by nanoinjected zygotes' significantly higher viability in two stages of development: zygote progress to two-cell stage, and progress from two-cell stage embryos to birth. We observed that 77.6% of nanoinjected zygotes proceeded to two-cell stage compared to 54.7% of microinjected zygotes. Of the healthy two-cell stage embryos, 52.4% from the nanoinjection group and 23.9% from the microinjected group developed into pups. Structural advantages of the nanoinjector are likely to contribute to the high viability observed. For instance, because charge is used to retain and release DNA, extracellular fluid is not injected into the pronucleus and the cross-sectional area of the nanoinjection lance (0.06 µm(2)) is smaller than that of a microinjection pipette tip (0.78 µm(2)). According to results from the comparative nanoinjection versus microinjection study, we conclude that nanoinjection is a viable method of pronuclear DNA transfer which presents viability advantages over microinjection.

  16. Cross sections and rate coefficients for charge exchange reactions of protons with hydrocarbon molecules

    International Nuclear Information System (INIS)

    Janev, R.K.; Kato, T.; Wang, J.G.

    2001-05-01

    The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C x H y charge exchange reactions from thermal energies up to several hundreds keV for all C x H y molecules with x=1, 2, 3 and 1 ≤ y ≤ 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)

  17. Cross sections and rate coefficients for charge exchange reactions of protons with hydrocarbon molecules

    Energy Technology Data Exchange (ETDEWEB)

    Janev, R.K.; Kato, T. [National Inst. for Fusion Science, Toki, Gifu (Japan); Wang, J.G. [Department of Physics and Astronomy, University of Georgia, Athens (United States)

    2001-05-01

    The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C{sub x}H{sub y} charge exchange reactions from thermal energies up to several hundreds keV for all C{sub x}H{sub y} molecules with x=1, 2, 3 and 1 {<=} y {<=} 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)

  18. Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

    DEFF Research Database (Denmark)

    Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders

    2011-01-01

    We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

  19. Thermophoretic forces on DNA measured with a single-molecule spring balance

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe

    2014-01-01

    We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...

  20. DNA origami as biocompatible surface to match single-molecule and ensemble experiments

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-01-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  1. Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

    Science.gov (United States)

    Yadav, Hemendra; Sharma, Pulkit

    2017-11-01

    Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. The elastic theory of a single DNA molecule

    Indian Academy of Sciences (India)

    methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.

  3. Large tunable image-charge effects in single-molecule junctions.

    NARCIS (Netherlands)

    Perrin, M.L.; Verzijl, C.J.; Martin, C.A.; Shaikh, A.J.; Eelkema, R.; Esch, J.H. van; Ruitenbeek, J.M. van; Thijssen, J.M.; Zant, H.S. van der; Dulic, D.

    2013-01-01

    Metal/organic interfaces critically determine the characteristics of molecular electronic devices, because they influence the arrangement of the orbital levels that participate in charge transport. Studies on self-assembled monolayers show molecule-dependent energy-level shifts as well as

  4. Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET

    OpenAIRE

    Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William

    2018-01-01

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

  5. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

    Science.gov (United States)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

  6. Temperature dependence of positronium reactivities with charge transfer molecules in bilayer membranes

    International Nuclear Information System (INIS)

    Jean, Y.C.; Yu, C.; Wang, Y.Y.; Yeh, Y.Y.

    1984-01-01

    Rate constants for positronium atoms reacting chemically with charge-transfer molecules such as p-benzoquinone, nitrobenzene, and coenzyme Q-10 in a model bilayer membrane, dipalmitoylphosphatidylcholine (DPPC), have been measured at temperatures between 23 and 65 0 C. A strong variation of the positronium chemical reactivities, k/sub Ps/ was observed in these systems: k/sub Ps/ increases with increasing temperature until the pretransition temperature of the membrane reaches a maximum value near the main transition temperature and decreases at temperatures higher than the main transition temperature. This variation is interpreted in terms of fluidity and permeability changes associated with the phase transitions of membranes and in terms of charge-transfer-complex formation between the solubilized molecules and the polar head of the membrane. These results demonstrate that positronium and its annihilation characteristics can be employed to investigate charge transport phenomena and microstructural changes of real biological membranes

  7. Electron stereodynamics in coulomb explosion of molecules by slow highly charged ions

    International Nuclear Information System (INIS)

    Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko

    2008-01-01

    The three-center Coulombic over-the-barrier model is developed for Coulomb explosion of a homonuclear diatomic molecule in collisions with a slow (∼10 eV/amu) highly charged ion. A conventional two-step picture of multiple electron transfer followed by Coulomb explosion is far from appropriate because the molecule sets out to dissociate before the incident ion approaches the closest distance. We treat the formation of a quasi-molecule and its decay into the three moving atomic ions. Charge-asymmetric population between fragment ions observed in a triple-coincidence measurement is suggested to reflect the bond elongation during a collision. Collisions of Kr 8+ + N 2 are analyzed. (author)

  8. Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses

    International Nuclear Information System (INIS)

    Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.

    2003-01-01

    DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses

  9. Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

    Directory of Open Access Journals (Sweden)

    Marijn T J van Loenhout

    Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

  10. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

    Science.gov (United States)

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

    2010-01-19

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  11. Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru

    2010-01-01

    DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....

  12. Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

    International Nuclear Information System (INIS)

    Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.

    2007-01-01

    We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

  13. The effect of the charge density on the dipole moment of diatomic molecules

    International Nuclear Information System (INIS)

    Rosato, A.; Germano, J.S.E.

    1986-01-01

    The results of the calculation, using the Variational Cellular Method (VCM), of the electric dipole moment of several diatomic molecules are improved. In previous calculations, the electronic charge density was treated like a spherically symmetric function in the inscribed sphere within each cell and as being the same constant value for all intercellular regions. Since the results obtained with such an approximation have not been satisfactory, an improved approximation for the charge density in the intercellular regions is needed. It is considered that the charge density is still constant outside the inscribed sphere but with different values in each intercellular region. A new expression for the dipole moment is obtained, and applied to the diatomic molecules HF, CO, BF and CS. In addition, the corresponding dipole moment curves, potential energy curves and spectroscopic constants are calculated taking into consideration our approximation and the traditional approximation for the charge density. The results of the two models are compared with each other and with experimental results for all the molecules considered. (Author) [pt

  14. How to determine local stretching and tension in a flow-stretched DNA molecule

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders

    2016-01-01

    We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....

  15. One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

    Science.gov (United States)

    Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

    2015-01-31

    A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

  16. Interstellar Chemistry Gets More Complex With New Charged-Molecule Discovery

    Science.gov (United States)

    2007-07-01

    Astronomers using data from the National Science Foundation's Robert C. Byrd Green Bank Telescope (GBT) have found the largest negatively-charged molecule yet seen in space. The discovery of the third negatively-charged molecule, called an anion, in less than a year and the size of the latest anion will force a drastic revision of theoretical models of interstellar chemistry, the astronomers say. Molecule formation Formation Process of Large, Negatively-Charged Molecule in Interstellar Space CREDIT: Bill Saxton, NRAO/AUI/NSF Click on image for page of graphics and detailed information "This discovery continues to add to the diversity and complexity that is already seen in the chemistry of interstellar space," said Anthony J. Remijan of the National Radio Astronomy Observatory (NRAO). "It also adds to the number of paths available for making the complex organic molecules and other large molecular species that may be precursors to life in the giant clouds from which stars and planets are formed," he added. Two teams of scientists found negatively-charged octatetraynyl, a chain of eight carbon atoms and one hydrogen atom, in the envelope of gas around an old, evolved star and in a cold, dark cloud of molecular gas. In both cases, the molecule had an extra electron, giving it a negative charge. About 130 neutral and about a dozen positively-charged molecules have been discovered in space, but the first negatively-charged molecule was not discovered until late last year. The largest previously-discovered negative ion found in space has six carbon atoms and one hydrogen atom. "Until recently, many theoretical models of how chemical reactions evolve in interstellar space have largely neglected the presence of anions. This can no longer be the case, and this means that there are many more ways to build large organic molecules in cosmic environments than have been explored," said Jan M. Hollis of NASA's Goddard Space Flight Center (GSFC). Ultraviolet light from stars can

  17. Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

    Science.gov (United States)

    Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

    DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

  18. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    Science.gov (United States)

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  19. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  20. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev

    2017-01-01

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

  1. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  2. Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes

    Directory of Open Access Journals (Sweden)

    Kazuo Umemura

    2016-10-01

    Full Text Available Hybrids of DNA and carbon nanotubes (CNTs are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM, is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids.

  3. Charge transfer in dissociating iodomethane and fluoromethane molecules ionized by intense femtosecond X-ray pulses

    Directory of Open Access Journals (Sweden)

    Rebecca Boll

    2016-07-01

    Full Text Available Ultrafast electron transfer in dissociating iodomethane and fluoromethane molecules was studied at the Linac Coherent Light Source free-electron laser using an ultraviolet-pump, X-ray-probe scheme. The results for both molecules are discussed with respect to the nature of their UV excitation and different chemical properties. Signatures of long-distance intramolecular charge transfer are observed for both species, and a quantitative analysis of its distance dependence in iodomethane is carried out for charge states up to I21+. The reconstructed critical distances for electron transfer are in good agreement with a classical over-the-barrier model and with an earlier experiment employing a near-infrared pump pulse.

  4. DNA-Based Single-Molecule Electronics: From Concept to Function.

    Science.gov (United States)

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  5. DNA-Based Single-Molecule Electronics: From Concept to Function

    Science.gov (United States)

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  6. Influence of capture to excited states of multiply charged ion beams colliding with small molecules

    International Nuclear Information System (INIS)

    Montenegro, P; Monti, J M; Fojón, O A; Hanssen, J; Rivarola, R D

    2015-01-01

    Electron capture by multiply charged ions impacting on small molecules is theoretically investigated. Particular attention is paid to the case of biological targets. The interest is focused on the importance of the transition to excited final states which can play a dominant role on the total capture cross sections. Projectiles at intermediate and high collision energies are considered. Comparison with existing experimental data is shown. (paper)

  7. Nanoscale charge transfer in redox proteins and DNA: Towards biomolecular electronics

    International Nuclear Information System (INIS)

    Artés, Juan Manuel; López-Martínez, Montserrat; Díez-Pérez, Ismael; Sanz, Fausto; Gorostiza, Pau

    2014-01-01

    Understanding how charges move through and between biomolecules is a fundamental question that constitutes the basis for many biological processes. On the other hand, it has potential applications in the design of sensors based on biomolecules and single molecule devices. In this review we introduce the study of the electron transfer (ET) process in biomolecules, providing an overview of the fundamental theory behind it and the different experimental approaches. The ET in proteins is introduced by reviewing a complete electronic characterization of a redox protein (azurin) using electrochemical scanning tunnelling microscopy (ECSTM). The ET process in DNA is overviewed and results from different experimental approaches are discussed. Finally, future directions in the study of the ET process in biomolecules are introduced as well as examples of possible technological applications

  8. Charge transport through DNA/DNA duplexes and DNA/RNA hybrids: complex mechanism study

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Vala, M.; Weiter, M.; Špérová, M.; Schneider, Bohdan; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír

    2013-01-01

    Roč. 20, č. 1 (2013), s. 9-9 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /11./. 14.03.2013-16.03.2013, Nové Hrady] Institutional support: RVO:61388963 ; RVO:68378271 ; RVO:86652036 Keywords : charge transport * fluorescence spectroscopy * DFT Subject RIV: CF - Physical ; Theoretical Chemistry

  9. Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule

    Directory of Open Access Journals (Sweden)

    Satoshi Ohmura

    2016-01-01

    Full Text Available Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC-triethylene glycol (TEG–C60 molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D+ and A- in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.

  10. Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule

    Energy Technology Data Exchange (ETDEWEB)

    Ohmura, Satoshi, E-mail: s.ohmura.m4@cc.it-hiroshima.ac.jp [Research Center for Condensed Matter Physics, Department of Civil Engineering and Urban Design, Hiroshima Institute of Technology, Hiroshima 731-5193 (Japan); Tsuruta, Kenji [Department of Electrical and Electronic Engineering, Okayama University, Okayama 700-8530 (Japan); Shimojo, Fuyuki [Department of Physics, Kumamoto University, Kumamoto 860-8555 Japan (Japan); Nakano, Aiichiro [Collaboratory for Advanced Computing and Simulations, Department of Computer Science, Department of Physics & Astronomy, Department of Chemical Engineering & Materials Science, Department of Biological Sciences, University of Southern California, CA90089-024 (United States)

    2016-01-15

    Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC)-triethylene glycol (TEG)–C{sub 60} molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D{sup +} and A{sup -}) in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.

  11. Charge dependence of one and two electron processes in collisions between hydrogen molecules and fast projectiles

    International Nuclear Information System (INIS)

    Wells, E.; Ben-Itzhak, I.; Carnes, K.D.; Krishnamurthi, V.

    1996-01-01

    The ratio of double- to single-ionization (DI/SI) as well as the ratio of ionization-excitation to single-ionization (IE/SI) in hydrogen molecules was studied by examining the effect of the projectile charge on these processes. The DI/SI and IE/SI ratios were measured using the coincidence time of flight technique at a fixed velocity (1 MeV/amu) over a range of projectile charge states (q = 1-9,14,20). Preliminary results indicate that for a highly charged F 9+ projectile the DI/SI and IE/SI ratios are 6.8% and 24.7%, respectively, a large increase from the ratios of 0.13% and 1.95%, respectively, for H + projectiles. For low charge states, the DI/SI is negligible relative to the IE/SI ratio, while for more highly charged projectiles the DI/SI ratio becomes comparable to the IE/SI ratio. This indicates that double-ionization increases much more rapidly with projectile charge than ionization-excitation

  12. X-ray Pump–Probe Investigation of Charge and Dissociation Dynamics in Methyl Iodine Molecule

    Directory of Open Access Journals (Sweden)

    Li Fang

    2017-05-01

    Full Text Available Molecular dynamics is of fundamental interest in natural science research. The capability of investigating molecular dynamics is one of the various motivations for ultrafast optics. We present our investigation of photoionization and nuclear dynamics in methyl iodine (CH3I molecule with an X-ray pump X-ray probe scheme. The pump–probe experiment was realized with a two-mirror X-ray split and delay apparatus. Time-of-flight mass spectra at various pump–probe delay times were recorded to obtain the time profile for the creation of high charge states via sequential ionization and for molecular dissociation. We observed high charge states of atomic iodine up to 29+, and visualized the evolution of creating these high atomic ion charge states, including their population suppression and enhancement as the arrival time of the second X-ray pulse was varied. We also show the evolution of the kinetics of the high charge states upon the timing of their creation during the ionization-dissociation coupled dynamics. We demonstrate the implementation of X-ray pump–probe methodology for investigating X-ray induced molecular dynamics with femtosecond temporal resolution. The results indicate the footprints of ionization that lead to high charge states, probing the long-range potential curves of the high charge states.

  13. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

    Science.gov (United States)

    Zhang, Yuning; Reisner, Walter

    2013-03-01

    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

  14. Single-molecule analysis of DNA replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

    The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

  15. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

    Science.gov (United States)

    Izanloo, Cobra

    2017-09-02

    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  16. Anisotropic charge transport in large single crystals of π-conjugated organic molecules.

    Science.gov (United States)

    Hourani, Wael; Rahimi, Khosrow; Botiz, Ioan; Koch, Felix Peter Vinzenz; Reiter, Günter; Lienerth, Peter; Heiser, Thomas; Bubendorff, Jean-Luc; Simon, Laurent

    2014-05-07

    The electronic properties of organic semiconductors depend strongly on the nature of the molecules, their conjugation and conformation, their mutual distance and the orientation between adjacent molecules. Variations of intramolecular distances and conformation disturb the conjugation and perturb the delocalization of charges. As a result, the mobility considerably decreases compared to that of a covalently well-organized crystal. Here, we present electrical characterization of large single crystals made of the regioregular octamer of 3-hexyl-thiophene (3HT)8 using a conductive-atomic force microscope (C-AFM) in air. We find a large anisotropy in the conduction with charge mobility values depending on the crystallographic orientation of the single crystal. The smaller conduction is in the direction of π-π stacking (along the long axis of the single crystal) with a mobility value in the order of 10(-3) cm(2) V(-1) s(-1), and the larger one is along the molecular axis (in the direction normal to the single crystal surface) with a mobility value in the order of 0.5 cm(2) V(-1) s(-1). The measured current-voltage (I-V) curves showed that along the molecular axis, the current followed an exponential dependence corresponding to an injection mode. In the π-π stacking direction, the current exhibits a space charge limited current (SCLC) behavior, which allows us to estimate the charge carrier mobility.

  17. Visualizing electron dynamics in organic materials: Charge transport through molecules and angular resolved photoemission

    Science.gov (United States)

    Kümmel, Stephan

    Being able to visualize the dynamics of electrons in organic materials is a fascinating perspective. Simulations based on time-dependent density functional theory allow to realize this hope, as they visualize the flow of charge through molecular structures in real-space and real-time. We here present results on two fundamental processes: Photoemission from organic semiconductor molecules and charge transport through molecular structures. In the first part we demonstrate that angular resolved photoemission intensities - from both theory and experiment - can often be interpreted as a visualization of molecular orbitals. However, counter-intuitive quantum-mechanical electron dynamics such as emission perpendicular to the direction of the electrical field can substantially alter the picture, adding surprising features to the molecular orbital interpretation. In a second study we calculate the flow of charge through conjugated molecules. The calculations show in real time how breaks in the conjugation can lead to a local buildup of charge and the formation of local electrical dipoles. These can interact with neighboring molecular chains. As a consequence, collections of ''molecular electrical wires'' can show distinctly different characteristics than ''classical electrical wires''. German Science Foundation GRK 1640.

  18. Signatures of dynamics in charge transport through organic molecules; Dynamisches Verhalten beim Ladungstransport durch organische Molekuele

    Energy Technology Data Exchange (ETDEWEB)

    Secker, Daniel

    2008-06-03

    The aim of the thesis at hand was to investigate dynamical behaviour in charge transport through organic molecules experimentally with the help of the mechanically controlled break junction (MCBJ) technique. the thesis concentrates on the complex interaction between the molecular contact configuration and the electronic structure. it is shown that by variation of the electrode distance and so by a manipulation of the molecule and contact configuration the electronic structure as well as the coupling between the molecule and the electrodes is affected. The latter statement is an additional hint how closely I-V-characteristics depend on the molecular contact configuration. Depending on the applied voltage and so the electric field there are two different configurations preferred by the molecular contact. A potential barrier between these two states is the origin of the hysteresis. A central part of the thesis is dealing with measurements of the current noise. Finally it can be concluded that the detailed discussion reveals the strong effect of dynamical interactions between the atomic configuration of the molecular contact and the electronic structure on the charge transport in single molecule junctions. (orig.)

  19. Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules

    International Nuclear Information System (INIS)

    Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.

    1979-01-01

    The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage

  20. Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates

    DEFF Research Database (Denmark)

    Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru

    2012-01-01

    Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...

  1. Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

    Czech Academy of Sciences Publication Activity Database

    Hanzálek, Petr; Kypr, Jaroslav

    2001-01-01

    Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

  2. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

    2012-01-01

    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  3. Real-time single-molecule observation of rolling-circle DNA replication

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van

    2009-01-01

    We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

  4. Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

    NARCIS (Netherlands)

    Hohlbein, J.; Kapanidis, A.N.

    2016-01-01

    Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

  5. See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins

    NARCIS (Netherlands)

    van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.

    2008-01-01

    Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of

  6. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

    Science.gov (United States)

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

    2011-01-01

    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  7. Charge transport and magnetoresistance of G4-DNA molecular device modulated by counter ions and dephasing effect

    International Nuclear Information System (INIS)

    Kang, Da-wei; Sun, Meng-le; Zuo, Zheng-wei; Wang, Hui-xian; Lv, Shi-jie; Li, Xin-zhong; Li, Li-ben

    2016-01-01

    The charge transport properties of the G4-DNA molecular device in the presence of counter ions and dephasing effect are investigated based on the Green function method and Landauer–Büttiker theory. The currents through the G4-DNA molecular device depend on the interference patterns at different coupling configurations. There is an effective electrostatic interaction between the counter ions and the G4-DNA molecule which introduces disorder into the on-site energies of G bases. The current through the device can be enhanced by the small disorder which avoids the strong interference of electrons at the same energy in some coupling configurations, however the diagonal disorder can suppress the overall current due to the Anderson localization of charge carriers when the disorder is large. In the presence of dephasing effect the current through the device at all coupling configurations can be enhanced as a result of the phase coherence losing of electron. As for the magnetic field response, the magnetoresistance of the device is always suppressed by the counter ions and dephasing effect. - Highlights: • The counter ions can some times enhance the current through G4-DNA molecule. • The dephasing effect can enhance the current of the device at all four coupling configurations. • The magnetoresistance is always suppressed by the counter ions and dephasing effect.

  8. A 3D-DNA Molecule Made of PlayMais

    Science.gov (United States)

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  9. Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

    CERN Document Server

    Williams, Mark C

    2011-01-01

    This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

  10. Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

    Science.gov (United States)

    Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

    2018-03-05

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Separation and Characterization of DNA Molecules and Intermolecular Interactions in Pressure-Driven Micro Flow

    Science.gov (United States)

    Friedrich, Sarah; Wang, Tza-Huei

    Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.

  12. DNA minor groove binding of small molecules: Experimental and ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Eight indole derivatives were studied for their DNA binding ability using fluorescence quenching and molecular docking methods. These indole compounds have structural moieties similar as in few indole alkaloids. Experimental and theoretical studies have suggested that indole derivatives bind in the minor ...

  13. Radioprotection of DNA molecule by oxido-reduction's coenzymes

    International Nuclear Information System (INIS)

    Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.

    1978-01-01

    The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)

  14. Morse potential in DNA molecule – An experiment proposal

    Indian Academy of Sciences (India)

    2012-07-27

    Jul 27, 2012 ... We rely on the helicoidal Peyrard-Bishop model for DNA dynamics. Interaction between nucleotides at a same site belonging to different strands is modelled by a Morse potential energy. This potential depends on two parameters that are different for AT and CG pairs, which is a possible source for ...

  15. Reorganization energy upon charging a single molecule on an insulator measured by atomic force microscopy

    Science.gov (United States)

    Fatayer, Shadi; Schuler, Bruno; Steurer, Wolfram; Scivetti, Ivan; Repp, Jascha; Gross, Leo; Persson, Mats; Meyer, Gerhard

    2018-05-01

    Intermolecular single-electron transfer on electrically insulating films is a key process in molecular electronics1-4 and an important example of a redox reaction5,6. Electron-transfer rates in molecular systems depend on a few fundamental parameters, such as interadsorbate distance, temperature and, in particular, the Marcus reorganization energy7. This crucial parameter is the energy gain that results from the distortion of the equilibrium nuclear geometry in the molecule and its environment on charging8,9. The substrate, especially ionic films10, can have an important influence on the reorganization energy11,12. Reorganization energies are measured in electrochemistry13 as well as with optical14,15 and photoemission spectroscopies16,17, but not at the single-molecule limit and nor on insulating surfaces. Atomic force microscopy (AFM), with single-charge sensitivity18-22, atomic-scale spatial resolution20 and operable on insulating films, overcomes these challenges. Here, we investigate redox reactions of single naphthalocyanine (NPc) molecules on multilayered NaCl films. Employing the atomic force microscope as an ultralow current meter allows us to measure the differential conductance related to transitions between two charge states in both directions. Thereby, the reorganization energy of NPc on NaCl is determined as (0.8 ± 0.2) eV, and density functional theory (DFT) calculations provide the atomistic picture of the nuclear relaxations on charging. Our approach presents a route to perform tunnelling spectroscopy of single adsorbates on insulating substrates and provides insight into single-electron intermolecular transport.

  16. Electron-molecule chemistry and charging processes on organic ices and Titan's icy aerosol surrogates

    Science.gov (United States)

    Pirim, C.; Gann, R. D.; McLain, J. L.; Orlando, T. M.

    2015-09-01

    Electron-induced polymerization processes and charging events that can occur within Titan's atmosphere or on its surface were simulated using electron irradiation and dissociative electron attachment (DEA) studies of nitrogen-containing organic condensates. The DEA studies probe the desorption of H- from hydrogen cyanide (HCN), acetonitrile (CH3CN), and aminoacetonitrile (NH2CH2CN) ices, as well as from synthesized tholin materials condensed or deposited onto a graphite substrate maintained at low temperature (90-130 K). The peak cross sections for H- desorption during low-energy (3-15 eV) electron irradiation were measured and range from 3 × 10-21 to 2 × 10-18 cm2. Chemical and structural transformations of HCN ice upon 2 keV electron irradiation were investigated using X-ray photoelectron and Fourier-transform infrared spectroscopy techniques. The electron-beam processed materials displayed optical properties very similar to tholins produced by conventional discharge methods. Electron and negative ion trapping lead to 1011 charges cm-2 on a flat surface which, assuming a radius of 0.05 μm for Titan aerosols, is ∼628 charges/radius (in μm). The facile charge trapping indicates that electron interactions with nitriles and complex tholin-like molecules could affect the conductivity of Titan's atmosphere due to the formation of large negative ion complexes. These negatively charged complexes can also precipitate onto Titan's surface and possibly contribute to surface reactions and the formation of dunes.

  17. Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology

    DEFF Research Database (Denmark)

    Olsen, Eva Maria

    2012-01-01

    Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...

  18. Single Molecule Spectroelectrochemistry of Interfacial Charge Transfer Dynamics In Hybrid Organic Solar Cell

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Shanlin [Univ. of Alabama, Tuscaloosa, AL (United States)

    2014-11-16

    Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest that the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an

  19. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

    Science.gov (United States)

    Stigter, Dirk

    2004-07-01

    Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

  20. Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy

    International Nuclear Information System (INIS)

    Lee, Min Hyung; Song, Hyunwook

    2013-01-01

    We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects

  1. Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.

    Directory of Open Access Journals (Sweden)

    Mária Džunková

    Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.

  2. Systems Based Study of the Therapeutic Potential of Small Charged Molecules for the Inhibition of IL-1 Mediated Cartilage Degradation

    Science.gov (United States)

    Kar, Saptarshi; Smith, David W.; Gardiner, Bruce S.; Grodzinsky, Alan J.

    2016-01-01

    Inflammatory cytokines are key drivers of cartilage degradation in post-traumatic osteoarthritis. Cartilage degradation mediated by these inflammatory cytokines has been extensively investigated using in vitro experimental systems. Based on one such study, we have developed a computational model to quantitatively assess the impact of charged small molecules intended to inhibit IL-1 mediated cartilage degradation. We primarily focus on the simplest possible computational model of small molecular interaction with the IL-1 system—direct binding of the small molecule to the active site on the IL-1 molecule itself. We first use the model to explore the uptake and release kinetics of the small molecule inhibitor by cartilage tissue. Our results show that negatively charged small molecules are excluded from the negatively charged cartilage tissue and have uptake kinetics in the order of hours. In contrast, the positively charged small molecules are drawn into the cartilage with uptake and release timescales ranging from hours to days. Using our calibrated computational model, we subsequently explore the effect of small molecule charge and binding constant on the rate of cartilage degradation. The results from this analysis indicate that the small molecules are most effective in inhibiting cartilage degradation if they are either positively charged and/or bind strongly to IL-1α, or both. Furthermore, our results showed that the cartilage structural homeostasis can be restored by the small molecule if administered within six days following initial tissue exposure to IL-1α. We finally extended the scope of the computational model by simulating the competitive inhibition of cartilage degradation by the small molecule. Results from this model show that small molecules are more efficient in inhibiting cartilage degradation by binding directly to IL-1α rather than binding to IL-1α receptors. The results from this study can be used as a template for the design and

  3. A Polypeptide-DNA Hybrid with Selective Linking Capability Applied to Single Molecule Nano-Mechanical Measurements Using Optical Tweezers

    NARCIS (Netherlands)

    Moayed, F.; Mashaghi, A.; Tans, S.J.

    2013-01-01

    Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an

  4. One- and two-electron processes in collisions between hydrogen molecules and slow highly charged ions

    International Nuclear Information System (INIS)

    Wells, E.; Carnes, K.D.; Tawara, H.; Ali, R.; Sidky, Emil Y.; Illescas, Clara; Ben-Itzhak, I.

    2005-01-01

    A coincidence time-of-flight technique coupled with projectile charge state analysis was used to study electron capture in collisions between slow highly charged ions and hydrogen molecules. We found single electron capture with no target excitation to be the dominant process for both C 6+ projectiles at a velocity of 0.8 atomic units and Ar 11+ projectiles at v 0.63 a.u. Double electron capture and transfer excitation, however, were found to be comparable and occur about 30% of the time relative to single capture. Most projectiles (96%) auto-ionize quickly following double capture into doubly excited states. The data are compared to classical and quantum mechanical model calculations

  5. Charge transfer through amino groups-small molecules interface improving the performance of electroluminescent devices

    Science.gov (United States)

    Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Kus, Mahmut; Okur, Salih; Demic, Şerafettin; Demirak, Kadir; Kurt, Mustafa; Icli, Sıddık

    2016-05-01

    A carboxylic group functioned charge transporting was synthesized and self-assembled on an indium tin oxide (ITO) anode. A typical electroluminescent device [modified ITO/TPD (50 nm)/Alq3 (60 nm)/LiF (2 nm)/(120 nm)] was fabricated to investigate the effect of the amino groups-small molecules interface on the characteristics of the device. The increase in the surface work function of ITO is expected to facilitate the hole injection from the ITO anode to the Hole Transport Layer (HTL) in electroluminescence. The modified electroluminescent device could endure a higher current and showed a much higher luminance than the nonmodified one. For the produced electroluminescent devices, the I-V characteristics, optical characterization and quantum yields were performed. The external quantum efficiency of the modified electroluminescent device is improved as the result of the presence of the amino groups-small molecules interface.

  6. Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

    Directory of Open Access Journals (Sweden)

    Greta Zubaite

    2017-02-01

    Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

  7. Excitation of atoms and molecules in collisions with highly charged ions

    International Nuclear Information System (INIS)

    Watson, R.L.

    1991-01-01

    Much of the work this year has been directed toward studies of charge exchange and ionization in single collisions of heavy ions with gaseous atoms and molecules. A study of the double ionization of He by high energy N 7+ ions, which began last year, was extended up in energy to 40 MeV/amu. These measurements verified the deviations from the predictions of theory observed in our previous work and indicated that the energy required to reach the limiting value of the ratio of double-to-single ionization cross sections may be as high as 70 MeV/amu

  8. Elimination of Spurious Fractional Charges in Dissociating Molecules by Correcting the Shape of Approximate Kohn-Sham Potentials.

    Science.gov (United States)

    Komsa, Darya N; Staroverov, Viktor N

    2016-11-08

    Standard density-functional approximations often incorrectly predict that heteronuclear diatomic molecules dissociate into fractionally charged atoms. We demonstrate that these spurious charges can be eliminated by adapting the shape-correction method for Kohn-Sham potentials that was originally introduced to improve Rydberg excitation energies [ Phys. Rev. Lett. 2012 , 108 , 253005 ]. Specifically, we show that if a suitably determined fraction of electron charge is added to or removed from a frontier Kohn-Sham orbital level, the approximate Kohn-Sham potential of a stretched molecule self-corrects by developing a semblance of step structure; if this potential is used to obtain the electron density of the neutral molecule, charge delocalization is blocked and spurious fractional charges disappear beyond a certain internuclear distance.

  9. Effective charge model in the theory of infrared intensities and its application for study of charge di.stribution in the molecules of organometallic compounds

    International Nuclear Information System (INIS)

    Aleksanyan, V.T.; Samvelyan, S.Kh.

    1984-01-01

    General principles of plotting the parametric theory of IR spectrum intensities of polyatomic molecules are outlined. The development of the effective charges model in this theory is considered and the mathematical formalism of the first approximation of the method of effective atom charges is described in detail. The results of calculations of charges distribution in the Mo(CO) 6 , W(CO) 6 , Cp 2 V, Cp 2 Ru and others (Cp-cyclopentadiene), performed in the frame work of the outlined scheme are presented. It is shown that in the investigated carbonyles the effective charge on oxygen and metal atoms is negative, on carbon atom - positive. In dicyclopentavienyl complexes the effective charge on the metal atom is positive and is not over 0.6e; charge values on hydrogen and carbon atoms do not exceed, 0.10-0.15e. The notions of ''electrovalence'' of coordination bond and charge distribution in the case of metallocenes are not correlated

  10. Controlling charge current through a DNA based molecular transistor

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.

    2017-01-05

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.

  11. Charge trapping at organic/self-assembly molecule interfaces studied by electrical switching behaviour in a crosspoint structure

    International Nuclear Information System (INIS)

    Li Yun; Pan Lijia; Pu Lin; Shi Yi; Liu Chuan; Tsukagoshi, Kazuhito

    2012-01-01

    Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels. (paper)

  12. Charge trapping at organic/self-assembly molecule interfaces studied by electrical switching behaviour in a crosspoint structure

    Science.gov (United States)

    Li, Yun; Liu, Chuan; Pan, Lijia; Pu, Lin; Tsukagoshi, Kazuhito; Shi, Yi

    2012-01-01

    Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels.

  13. Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

    Science.gov (United States)

    Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

    2017-08-04

    Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

    Science.gov (United States)

    Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

    2012-02-01

    We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

  15. Cross-sections for inelastic collisions of fast charged particles with atoms and molecules

    International Nuclear Information System (INIS)

    Inokuti, M.

    1987-01-01

    Despite the long history of research, the current experimental data of the cross-sections, required for solving problems of radiological physics and dosimetry, are far from being complete or even satisfactory for tentative applications. Calculations are, in general, difficult and only in exceptional situations lead to reliable results. Thus, one practical approach to the cross-section determination is to test experimental data with general criteria. This is possible because cross-sections for various processes are related among themselves and with many other properties of atoms and molecules. For example, the Bethe theory indicates a close connection between photoabsorption and energy absorption by glancing collisions and puts many other useful constraints on the cross-section data. Development and use of these data constraints, first advanced by Platzman, can now be demonstrated in many examples. More recent studies concern the determination of the analytic expression most suitable for fitting the data on the oscillator strength distribution or the energy distribution of secondary electrons from ionizing collisions of charged particles. There are three areas to which major efforts should be directed: (1) Methods of absolute cross-section measurements, both for electron and ionic collisions, must be thoroughly reviewed so that sources of systematic errors may be identified and corrected. (2) Efforts should be devoted to the understanding of the data systematics, viz. the trends of cross-sections for a series of molecules. This is especially important because the variety of molecules relevant to radiological physics and radiation biology is so enormous that even the data presentation for each molecule will be impractical. (3) Electron and ionic collisions with molecules in condensed phases will be an important topic of study for years to come. Initial reports on efforts in this direction are encouraging. 49 refs

  16. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    OpenAIRE

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...

  17. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Science.gov (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  18. Invariance of molecular charge transport upon changes of extended molecule size and several related issues

    Directory of Open Access Journals (Sweden)

    Ioan Bâldea

    2016-03-01

    Full Text Available As a sanity test for the theoretical method employed, studies on (steady-state charge transport through molecular devices usually confine themselves to check whether the method in question satisfies the charge conservation. Another important test of the theory’s correctness is to check that the computed current does not depend on the choice of the central region (also referred to as the “extended molecule”. This work addresses this issue and demonstrates that the relevant transport and transport-related properties are indeed invariant upon changing the size of the extended molecule, when the embedded molecule can be described within a general single-particle picture (namely, a second-quantized Hamiltonian bilinear in the creation and annihilation operators. It is also demonstrates that the invariance of nonequilibrium properties is exhibited by the exact results but not by those computed approximately within ubiquitous wide- and flat-band limits (WBL and FBL, respectively. To exemplify the limitations of the latter, the phenomenon of negative differential resistance (NDR is considered. It is shown that the exactly computed current may exhibit a substantial NDR, while the NDR effect is absent or drastically suppressed within the WBL and FBL approximations. The analysis done in conjunction with the WBLs and FBLs reveals why general studies on nonequilibrium properties require a more elaborate theoretical than studies on linear response properties (e.g., ohmic conductance and thermopower at zero temperature. Furthermore, examples are presented that demonstrate that treating parts of electrodes adjacent to the embedded molecule and the remaining semi-infinite electrodes at different levels of theory (which is exactly what most NEGF-DFT approaches do is a procedure that yields spurious structures in nonlinear ranges of current–voltage curves.

  19. In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

    Science.gov (United States)

    Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

    2017-12-14

    Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  20. Repair of human DNA in molecules that replicate or remain unreplicated following ultraviolet irradiation

    International Nuclear Information System (INIS)

    Waters, R.

    1980-01-01

    The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not

  1. Role of geometrical shape in like-charge attraction of DNA.

    Science.gov (United States)

    Kuron, Michael; Arnold, Axel

    2015-03-01

    While the phenomenon of like-charge attraction of DNA is clearly observed experimentally and in simulations, mean-field theories fail to predict it. Kornyshev et al. argued that like-charge attraction is due to DNA's helical geometry and hydration forces. Strong-coupling (SC) theory shows that attraction of like-charged rods is possible through ion correlations alone at large coupling parameters, usually by multivalent counterions. However for SC theory to be applicable, counterion-counterion correlations perpendicular to the DNA strands need to be sufficiently small, which is not a priori the case for DNA even with trivalent counterions. We study a system containing infinitely long DNA strands and trivalent counterions by computer simulations employing varying degrees of coarse-graining. Our results show that there is always attraction between the strands, but its magnitude is indeed highly dependent on the specific shape of the strand. While discreteness of the charge distribution has little influence on the attractive forces, the role of the helical charge distribution is considerable: charged rods maintain a finite distance in equilibrium, while helices collapse to close contact with a phase shift of π, in full agreement with SC predictions. The SC limit is applicable because counterions strongly bind to the charged sites of the helices, so that helix-counterion interactions dominate over counterion-counterion interactions. Thus DNA's helical geometry is not crucial for like-charge DNA attraction, but strongly enhances it, and electrostatic interactions in the strong-coupling limit are sufficient to explain this attraction.

  2. Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution

    NARCIS (Netherlands)

    Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.

    2016-01-01

    We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell

  3. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  4. First Principles Modeling and Interpretation of Ionization-Triggered Charge Migration in Molecules

    Science.gov (United States)

    Bruner, Adam; Hernandez, Sam; Mauger, Francois; Abanador, Paul; Gaarde, Mette; Schafer, Ken; Lopata, Ken

    Modeling attosecond coherent charge migration in molecules is important for understanding initial steps of photochemistry and light harvesting processes. Ionization triggered hole migration can be difficult to characterize and interpret as the dynamics can be convoluted with excited states. Here, we introduce a real-time time-dependent density functional theory (RT-TDDFT) approach for modeling such dynamics from first principles. To isolate the specific hole dynamics from excited states, Fourier transform analysis and orbital occupations are used to provide a spatial hole representation in the frequency domain. These techniques are applied to hole transfer across a thiophene dimer as well as core-hole triggered valence motion in nitrosobenzene. This work was supported by U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under Award No. DE-SC0012462.

  5. Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

    Directory of Open Access Journals (Sweden)

    Scott S Walker

    Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

  6. DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

    Science.gov (United States)

    Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

    2017-12-06

    We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

  7. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    Science.gov (United States)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  8. Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

    Science.gov (United States)

    Kühnemund, M; Nilsson, M

    2015-05-15

    Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Spatiotemporal kinetics of γ-H2AX protein on charged particles induced DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Niu, H., E-mail: hniu@mx.nthu.edu.tw [Nuclear Science and Technology Development Center, National Tsing Hua University, Hsinchu, Taiwan (China); Chang, H.C. [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Hsinchu, Taiwan (China); Cho, I.C. [Institute for Radiological Research, Chang Gung University and Chang Gung Memorial Hospital, Taoyuan, Taiwan (China); Chen, C.H. [Nuclear Science and Technology Development Center, National Tsing Hua University, Hsinchu, Taiwan (China); Liu, C.S. [Cancer Center of Taipei Veterans General Hospital, Taipei, Taiwan (China); Chou, W.T. [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Hsinchu, Taiwan (China)

    2014-08-15

    Highlights: • Charged particles can induce more complex DNA damages, and these complex damages have higher ability to cause the cell death or cell carcinogenesis. • In this study, we used γ-H2AX protein to investigate the spatiotemporal kinetics of DNA double strand breaks in particle irradiated HeLa cells. • The HeLa cells were irradiated by 400 keV alpha-particles in four different dosages. • The result shows that a good linear relationship can be observed between foci number and radiation dose. • The data shows that the dissolution rate of γ-H2AX foci agree with the two components DNA repairing model, and it was decreasing as the radiation dose increased. • These results suggest that charged particles can induce more complex DNA damages and causing the retardation of DNA repair. - Abstract: In several researches, it has been demonstrated that charged particles can induce more complex DNA damages. These complex damages have higher ability to cause the cell death or cell carcinogenesis. For this reason, clarifying the DNA repair mechanism after charged particle irradiation plays an important role in the development of charged particle therapy and space exploration. Unfortunately, the detail spatiotemporal kinetic of DNA damage repair is still unclear. In this study, we used γ-H2AX protein to investigate the spatiotemporal kinetics of DNA double strand breaks in alpha-particle irradiated HeLa cells. The result shows that the intensity of γ-H2AX foci increased gradually, and reached to its maximum at 30 min after irradiation. A good linear relationship can be observed between foci intensity and radiation dose. After 30 min, the γ-H2AX foci intensity was decreased with time passed, but remained a large portion (∼50%) at 48 h passed. The data show that the dissolution rate of γ-H2AX foci agreed with two components DNA repairing model. These results suggest that charged particles can induce more complex DNA damages and causing the retardation of DNA

  10. Effect of charged and excited states on the decomposition of 1,1-diamino-2,2-dinitroethylene molecules

    International Nuclear Information System (INIS)

    Kimmel, Anna V.; Sushko, Peter V.; Shluger, Alexander L.; Kuklja, Maija M.

    2007-01-01

    The authors have calculated the electronic structure of individual 1,1-diamino-2,2-dinitroethylene molecules (FOX-7) in the gas phase by means of density functional theory with the hybrid B3LYP functional and 6-31+G(d,p) basis set and considered their dissociation pathways. Positively and negatively charged states as well as the lowest excited states of the molecule were simulated. They found that charging and excitation can not only reduce the activation barriers for decomposition reactions but also change the dominating chemistry from endo- to exothermic type. In particular, they found that there are two competing primary initiation mechanisms of FOX-7 decomposition: C-NO 2 bond fission and C-NO 2 to CONO isomerization. Electronic excitation or charging of FOX-7 disfavors CONO formation and, thus, terminates this channel of decomposition. However, if CONO is formed from the neutral FOX-7 molecule, charge trapping and/or excitation results in spontaneous splitting of an NO group accompanied by the energy release. Intramolecular hydrogen transfer is found to be a rare event in FOX-7 unless free electrons are available in the vicinity of the molecule, in which case HONO formation is a feasible exothermic reaction with a relatively low energy barrier. The effect of charged and excited states on other possible reactions is also studied. Implications of the obtained results to FOX-7 decomposition in condensed state are discussed

  11. Modeling spin selectivity in charge transfer across the DNA/Gold interface

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@sci.uut.ac.ir [Department of Physics, Urmia University of Technology, Urmia (Iran, Islamic Republic of); Fathizadeh, S. [Department of Physics, Urmia University of Technology, Urmia (Iran, Islamic Republic of); Akhshani, A. [Department of Physics, Urmia Branch, Islamic Azad University, Urmia (Iran, Islamic Republic of)

    2016-09-30

    Highlights: • DNA in spintronics is applied. Nearly pure spin current is observed in the system. • A combined spin-polaronic PBH model is proposed for spin transfer in DNA molecule. • Spin Hall effect in DNA due to spin–orbit coupling is verified. • The temperature dependence of Hall conductivity is appeared. • Regions of parameters were determined that polarization of spin current is maximum. - Abstract: Experimental results show that the photoelectrons emitted from the gold substrate due to laser radiation, passe through DNA nanowires with spin-polarized nature. This study proposes the use of chiral DNA molecule in spintronics and information processing. To investigate the spin transfer in DNA molecules, we established a theoretical model based on a combined spin-polaronic Peyrard–Bishop–Holstein model. Accordingly, a nearly pure spin current is appeared. The simultaneous effects of the incident radiation and external magnetic field create characteristic islands corresponding to the pure spin currents, which can be predicted and detected using the multifractal dimensions spectrum. We can verify the spin Hall effect on DNA oligomers through spin–orbit coupling. As such, we can proceed to our significant purpose, which is to create a nearly pure spin current for information transfer and determine the regions of parameter values from which the maximal polarization in spin current emerges.

  12. Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.

    Science.gov (United States)

    Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R

    2017-01-01

    During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

  13. Charge transfer through single molecule contacts: How reliable are rate descriptions?

    Directory of Open Access Journals (Sweden)

    Denis Kast

    2011-08-01

    Full Text Available Background: The trend for the fabrication of electrical circuits with nanoscale dimensions has led to impressive progress in the field of molecular electronics in the last decade. However, a theoretical description of molecular contacts as the building blocks of future devices is challenging, as it has to combine the properties of Fermi liquids in the leads with charge and phonon degrees of freedom on the molecule. Outside of ab initio schemes for specific set-ups, generic models reveal the characteristics of transport processes. Particularly appealing are descriptions based on transfer rates successfully used in other contexts such as mesoscopic physics and intramolecular electron transfer. However, a detailed analysis of this scheme in comparison with numerically exact solutions is still elusive.Results: We show that a formulation in terms of transfer rates provides a quantitatively accurate description even in domains of parameter space where strictly it is expected to fail, e.g., at lower temperatures. Typically, intramolecular phonons are distributed according to a voltage driven steady state that can only roughly be captured by a thermal distribution with an effective elevated temperature (heating. An extension of a master equation for the charge–phonon complex, to effectively include the impact of off-diagonal elements of the reduced density matrix, provides very accurate solutions even for stronger electron–phonon coupling.Conclusion: Rate descriptions and master equations offer a versatile model to describe and understand charge transfer processes through molecular junctions. Such methods are computationally orders of magnitude less expensive than elaborate numerical simulations that, however, provide exact solutions as benchmarks. Adjustable parameters obtained, e.g., from ab initio calculations allow for the treatment of various realizations. Even though not as rigorously formulated as, e.g., nonequilibrium Green’s function

  14. Synthesis, growth, structural modeling and physio-chemical properties of a charge transfer molecule: Guanidinium tosylate

    Science.gov (United States)

    Era, Paavai; Jauhar, RO. MU.; Vinitha, G.; Murugakoothan, P.

    2018-05-01

    An organic nonlinear optical material, guanidinium tosylate was synthesized adopting slow evaporation method and the crystals were harvested from aqueous methanolic medium with dimensions 13 × 9 × 3 mm3. Constitution of crystalline material was confirmed by single crystal X-ray diffraction study. The title compound crystallizes in the monoclinic crystal system with space group P21/c. The UV-vis-NIR spectral study of the grown crystal exhibits high transparency of 80% in the entire visible region with lower cut-off wavelength at 282 nm. Optimized molecular geometry of the grown crystal was obtained using density functional theory (DFT) and the frontier energy gaps calculated from the DFT aids to understand the charge transfer taking place in the molecule. The dielectric properties were studied as a function of temperature and frequency to find the charge distribution within the crystal. The titular compound is thermally stable up to 230 °C assessed by thermogravimetric and differential thermal analysis. Anisotropy in the mechanical behavior was observed while measuring for individual planes. The laser induced surface damage threshold of the grown crystal was measured to be 0.344 GW/cm2 for 1064 nm Nd:YAG laser radiation. Z-scan technique confirms the third-order nonlinear optical property with the ascertained nonlinear refractive index (n2), nonlinear absorption coefficient (β) and third order nonlinear susceptibility (χ(3)). Optical limiting study divulges that the transmitted output power step-up linearly with the increase of the input power at lower power realms and saturates from the threshold 24.95 mW/cm2 and amplitude 0.23 mW/cm2.

  15. Influence of charge on encapsulation and release behavior of small molecules in self-assembled layer-by-layer microcapsules.

    Science.gov (United States)

    Mandapalli, Praveen K; Labala, Suman; Vanamala, Deekshith; Koranglekar, Manali P; Sakimalla, Lakshmi A; Venuganti, Venkata Vamsi K

    2014-12-01

    The objective of this study is to investigate the influence of charge of model small molecules on their encapsulation and release behavior in layer-by-layer microcapsules (LbL-MC). Poly(styrene sulfonate) and poly(ethylene imine) were sequentially adsorbed on calcium carbonate sacrificial templates to prepare LbL-MC. Model molecules with varying charge, anionic - ascorbic acid, cationic - imatinib mesylate (IM) and neutral - 5-fluorouracil were encapsulated in LbL-MC. Free and encapsulated LbL-MC were characterized using zetasizer, FTIR spectroscope and differential scanning calorimeter. The influence of IM-loaded LbL-MC on cell viability was studied in B16F10 murine melanoma cells. Furthermore, biodistribution of IM-loaded LbL-MC with and without PEGylation was studied in BALB/c mice. Results showed spherical LbL-MC of 3.0 ± 0.4 μm diameter. Encapsulation efficiency of LbL-MC increased linearly (R(2 )= 0.89-0.99) with the increase in solute concentration. Increase in pH from 2 to 6 increased the encapsulation of charged molecules in LbL-MC. Charged molecules showed greater encapsulation efficiency in LbL-MC compared with neutral molecule. In vitro release kinetics showed Fickian and non-Fickian diffusion of small molecules, depending on the nature of molecular interactions with LbL-MC. At 50 μM concentration, free IM showed significantly (p < 0.05) more cytotoxicity compared with IM-loaded LbL-MC. Biodistribution studies showed that PEGylation of LbL-MC decreased the liver and spleen uptake of IM-encapsulated LbL-MC. In conclusion, LbL-MC can be developed as a potential carrier for small molecules depending on their physical and chemical properties.

  16. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    Science.gov (United States)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  17. Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

    2014-11-27

    In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

  18. Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

    Science.gov (United States)

    Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

    2014-01-01

    Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

  19. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    Science.gov (United States)

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  20. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

    2018-01-01

    Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

  1. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

    2018-01-10

    Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

  2. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

    Science.gov (United States)

    Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

    2003-10-01

    Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

  3. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  4. Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hsiu-Fang Fan

    2018-05-01

    Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

  5. Quantum mechanical calculations related to ionization and charge transfer in DNA

    International Nuclear Information System (INIS)

    Cauët, E; Liévin, J; Valiev, M; Weare, J H

    2012-01-01

    Ionization and charge migration in DNA play crucial roles in mechanisms of DNA damage caused by ionizing radiation, oxidizing agents and photo-irradiation. Therefore, an evaluation of the ionization properties of the DNA bases is central to the full interpretation and understanding of the elementary reactive processes that occur at the molecular level during the initial exposure and afterwards. Ab initio quantum mechanical (QM) methods have been successful in providing highly accurate evaluations of key parameters, such as ionization energies (IE) of DNA bases. Hence, in this study, we performed high-level QM calculations to characterize the molecular energy levels and potential energy surfaces, which shed light on ionization and charge migration between DNA bases. In particular, we examined the IEs of guanine, the most easily oxidized base, isolated and embedded in base clusters, and investigated the mechanism of charge migration over two and three stacked guanines. The IE of guanine in the human telomere sequence has also been evaluated. We report a simple molecular orbital analysis to explain how modifications in the base sequence are expected to change the efficiency of the sequence as a hole trap. Finally, the application of a hybrid approach combining quantum mechanics with molecular mechanics brings an interesting discussion as to how the native aqueous DNA environment affects the IE threshold of nucleobases.

  6. Single-molecule studies of DNA transcription using atomic force microscopy

    International Nuclear Information System (INIS)

    Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer

    2012-01-01

    Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)

  7. Bianthrone in a Single-Molecule Junction: Conductance Switching with a Bistable Molecule Facilitated by Image Charge Effects

    DEFF Research Database (Denmark)

    Bjørnholm, Thomas

    2010-01-01

    Bianthrone is a sterically hindered compound that exists in the form of two nonplanar isomers. Our experimental study of single-molecule junctions with bianthrone reveals persistent switching of electric conductance at low temperatures, which can be reasonably associated with molecular isomerizat...

  8. Electronic coupling effects and charge transfer between organic molecules and metal surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Forker, Roman

    2010-07-01

    We employ a variant of optical absorption spectroscopy, namely in situ differential reflectance spectroscopy (DRS), for an analysis of the structure-properties relations of thin epitaxial organic films. Clear correlations between the spectra and the differently intense coupling to the respective substrates are found. While rather broad and almost structureless spectra are obtained for a quaterrylene (QT) monolayer on Au(111), the spectral shape resembles that of isolated molecules when QT is grown on graphite. We even achieve an efficient electronic decoupling from the subjacent Au(111) by inserting an atomically thin organic spacer layer consisting of hexa-peri-hexabenzocoronene (HBC) with a noticeably dissimilar electronic behavior. These observations are further consolidated by a systematic variation of the metal substrate (Au, Ag, and Al), ranging from inert to rather reactive. For this purpose, 3,4,9,10-perylenetetracarboxylic dianhydride (PTCDA) is chosen to ensure comparability of the molecular film structures on the different metals, and also because its electronic alignment on various metal surfaces has previously been studied with great intensity. We present evidence for ionized PTCDA at several interfaces and propose the charge transfer to be related to the electronic level alignment governed by interface dipole formation on the respective metals. (orig.)

  9. Excitation of atoms and molecules in collisions with highly charged ions

    International Nuclear Information System (INIS)

    Watson, R.L.

    1993-01-01

    A study of the double ionization of He by high-energy N 7+ ions was extended up in energy to 40 MeV/amu. Coincidence time-of-flight studies of multicharged N 2 , O 2 , and CO molecular ions produced in collisions with 97-MeV Ar 14+ ions were completed. Analysis of the total kinetic energy distributions and comparison with the available data for CO 2+ and CO 3+ from synchrotron radiation experiments led to the conclusion that ionization by Ar-ion impact populates states having considerably higher excitation energies than those accessed by photoionization. The dissociation fractions for CO 1+ and CO 2+ molecular ions, and the branching ratios for the most prominent charge division channels of CO 2+ through CO 7+ were determined from time-of-flight singles and coincidence data. An experiment designed to investigate the orientation dependence of dissociative multielectron ionization of molecules by heavy ion impact was completed. Measurements of the cross sections for K-shell ionization of intermediate-Z elements by 30-MeV/amu H, N, Ne, and Ar ions were completed. The cross sections were determined for solid targets of Z = 13, 22, 26, 29, 32, 40, 42, 46, and 50 by recording the spectra of K x rays with a Si(Li) spectrometer

  10. Functionalized organic semiconductor molecules to enhance charge carrier injection in electroluminescent cell

    Science.gov (United States)

    Yalcin, Eyyup; Kara, Duygu Akin; Karakaya, Caner; Yigit, Mesude Zeliha; Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Demic, Serafettin; Kus, Mahmut; Aboulouard, Abdelkhalk

    2017-07-01

    Organic semiconductor (OSC) materials as a charge carrier interface play an important role to improve the device performance of organic electroluminescent cells. In this study, 4,4″-bis(diphenyl amino)-1,1':3‧,1″-terphenyl-5'-carboxylic acid (TPA) and 4,4″-di-9H-carbazol-9-yl-1,1':3‧,1″-terphenyl-5'-carboxylic acid (CAR) has been designed and synthesized to modify indium tin oxide (ITO) layer as interface. Bare ITO and PEDOT:PSS coated on ITO was used as reference anode electrodes for comparison. Furthermore, PEDOT:PSS coated over CAR/ITO and TPA/ITO to observe stability of OSC molecules and to completely cover the ITO surface. Electrical, optical and surface characterizations were performed for each device. Almost all modified devices showed around 36% decrease at the turn on voltage with respect to bare ITO. The current density of bare ITO, ITO/CAR and ITO/TPA were measured as 288, 1525 and 1869 A/m2, respectively. By increasing current density, luminance of modified devices showed much better performance with respect to unmodified devices.

  11. The effects of electric fields on charged molecules and particles in individual microenvironments

    Science.gov (United States)

    Jamieson, K. S.; ApSimon, H. M.; Jamieson, S. S.; Bell, J. N. B.; Yost, M. G.

    Measurements of small air ion concentrations, electrostatic potential and AC electric field strengths were taken in an office setting to investigate the link between electric fields and charged molecule and particle concentrations in individual microenvironments. The results obtained indicate that the electromagnetic environments individuals can be exposed to whilst indoors can often bear little resemblance to those experienced outdoors in nature, and that many individuals may spend large periods of their time in "Faraday cage"-like conditions exposed to inappropriate levels and types of electric fields that can reduce localised concentrations of biologically essential and microbiocidal small air ions. Such conditions may escalate their risk of infection from airborne contaminants, including microbes, whilst increasing localised surface contamination. The degree of "electro-pollution" that individuals are exposed to was shown to be influenced by the type of microenvironment they occupy, with it being possible for very different types of microenvironment to exist within the same room. It is suggested that adopting suitable electromagnetic hygiene/productivity guidelines that seek to replicate the beneficial effects created by natural environments may greatly mitigate such problems.

  12. Storage of charge carriers on emitter molecules in organic light-emitting diodes

    Science.gov (United States)

    Weichsel, Caroline; Burtone, Lorenzo; Reineke, Sebastian; Hintschich, Susanne I.; Gather, Malte C.; Leo, Karl; Lüssem, Björn

    2012-08-01

    Organic light-emitting diodes (OLEDs) using the red phosphorescent emitter iridium(III)bis(2-methyldibenzo[f,h]quinoxaline) (acetylacetonate) [Ir(MDQ)2(acac)] are studied by time-resolved electroluminescence measurements. A transient overshoot after voltage turn-off is found, which is attributed to electron accumulation on Ir(MDQ)2(acac) molecules. The mechanism is verified via impedance spectroscopy and by application of positive and negative off-voltages. We calculate the density of accumulated electrons and find that it scales linearly with the doping concentration of the emitter. Using thin quenching layers, we locate the position of the emission zone during normal OLED operation and after voltage turn-off. In addition, the transient overshoot is also observed in three-color white-emitting OLEDs. By time- and spectrally resolved measurements using a streak camera, we directly attribute the overshoot to electron accumulation on Ir(MDQ)2(acac). We propose that similar processes are present in many state-of-the-art OLEDs and believe that the quantification of charge carrier storage will help to improve the efficiency of OLEDs.

  13. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-05-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

  14. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET

    Directory of Open Access Journals (Sweden)

    Mengyi Yang

    2018-01-01

    Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing

  15. Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.

    Directory of Open Access Journals (Sweden)

    Jonghyun Park

    2010-11-01

    Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

  16. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Science.gov (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  17. Collisions of singly and doubly charged ions with oxygen molecules in the energy range 1 - 1800 (3600) eV

    International Nuclear Information System (INIS)

    Kuen, I.; Howorka, F.

    1983-01-01

    Absolute cross sections for the excitation of optically emitting states in collisions of He + , Ne + , Ar + , Kr + , B + , He ++ , Ne ++ and Ar ++ with oxygen molecules are measured, the energy range of the ion being1 - 1800 eV Lab for the singly charged and 1 - 3600 eV for the doubly charged ions. Seven important processes can be distinguished: charge exchange excitation of O 2 + band, O I, O II, X I and X II lines (X + , X ++ being the primary ion), direct excitation of X II and double charge exchange excitations. The energy dependences of the excitation cross sections are remarkably different for different processes but similar for one process with different ions. The sum total of all cross sections together for excitations which lead to light emission is on the order of a few square angstroms at 1000 eV c.m. energy. The results are of interest for surface investigations, plasma diagnostics and laser work. (Author)

  18. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-01-01

    and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image

  19. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    Energy Technology Data Exchange (ETDEWEB)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

    2016-04-19

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  20. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

    Science.gov (United States)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2018-02-01

    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA moleculesDNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  1. Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

    NARCIS (Netherlands)

    Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

    1999-01-01

    By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

  2. Charge reversible gold nanoparticles for high efficient absorption and desorption of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Wang Can; Zhuang Jiaqi; Jiang Shan; Li Jun; Yang Wensheng, E-mail: wsyang@jlu.edu.cn [Jilin University, State Key Laboratory of Supramolecular Structure and Materials, College of Chemistry (China)

    2012-10-15

    Mercaptoundecylamine and mercaptoundecanoic acid co-modified Au nanoparticles were prepared by two-step ligand exchange of 6-mercaptohexanoic acid modified gold nanoparticles. Such particles terminated by appropriate ratios of the amine and carboxyl groups (R{sub N/C}) were identified to show reversible charge on their surface, which were switchable by pH of the solution. The isoelectric point (IEP) of the particles is tunable by changing the ratios of the amine and carboxyl groups on the particle surfaces. The particles can absorb DNA effectively at pH lower than the IEP driven by the direct electrostatic interactions between DNA and the particle surface. When pH of the solutions was elevated to be higher than the IEP, the absorbed DNA can be released almost completely due to the electrostatic repulsion between the particle surface and DNA. With appropriate R{sub N/C} ratios of 0.8, the absorption and desorption efficiencies of DNA were 97 and 98%, respectively, corresponding an extraction efficiency of 95 %. Such particles with reversible surface charges allow the high efficient extraction of DNA by simply changing pH instead of by changing salt concentration in the conventional salt bridge method.Graphical Abstract.

  3. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  4. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    Science.gov (United States)

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

  5. DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

    Science.gov (United States)

    Eernisse, D J

    1992-04-01

    DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

  6. The adsorption-desorption transition of double-stranded DNA interacting with an oppositely charged dendrimer induced by multivalent anions.

    Science.gov (United States)

    Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi

    2014-05-28

    The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.

  7. Studies of charge transport in DNA films using the time-of-flight (TOF) technique

    Science.gov (United States)

    Yaney, Perry P.; Gorman, Timothy; Ouchen, Fahima; Grote, James G.

    2011-09-01

    Measurements were carried out on salmon DNA-based films, including as-received DNA (molecular weight, MW>2000 kDa) without and with hexacetyltrimethl-ammonium chloride (CTMA) surfactant, and sonicated DNA of MW~200 kDa with CTMA. The test specimens were spin-coated or drop-cast films on ITO-coated quartz slides with a gold charge-collecting electrode. To protect the films from atmospheric influences, the TOF devices were coated with a 200-400 nm polyurethane passivation layer. A quadrupled 20 ns, pulsed Nd:YAG laser with output at 266 nm was used for charge injection. The room temperature photoconductive transients were dispersive to varying degrees with hole mobilities in DNA materials films ranging between 2E-5 to 6E-3 cm2/Vs for fields ranging from 8 to 58 kV/cm. Only hole response was observed in DNA. The dispersive data were analyzed using a simple, quasi-empirical equation for the photocurrent transient data.

  8. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-05-01

    Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

  9. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

    Directory of Open Access Journals (Sweden)

    Toshitsugu Fujita

    2015-09-01

    Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  10. Charge transport through exciton shelves in cadmium chalcogenide quantum dot-DNA nano-bioelectronic thin films

    Science.gov (United States)

    Goodman, Samuel M.; Noh, Hyunwoo; Singh, Vivek; Cha, Jennifer N.; Nagpal, Prashant

    2015-02-01

    Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers.

  11. Charge transport through exciton shelves in cadmium chalcogenide quantum dot-DNA nano-bioelectronic thin films

    Energy Technology Data Exchange (ETDEWEB)

    Goodman, Samuel M.; Singh, Vivek [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Noh, Hyunwoo [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering Program and Department of Nanoengineering, University of California, 9500 Gilman Drive, La Jolla, San Diego, California 92093 (United States); Cha, Jennifer N. [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering Program and Department of Nanoengineering, University of California, 9500 Gilman Drive, La Jolla, San Diego, California 92093 (United States); Materials Science and Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Nagpal, Prashant, E-mail: pnagpal@colorado.edu [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); BioFrontiers Institute, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Renewable and Sustainable Energy Institute, University of Colorado Boulder, 2445 Kittredge Loop, Boulder, Colorado 80309 (United States)

    2015-02-23

    Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers.

  12. Charge transport through exciton shelves in cadmium chalcogenide quantum dot-DNA nano-bioelectronic thin films

    International Nuclear Information System (INIS)

    Goodman, Samuel M.; Singh, Vivek; Noh, Hyunwoo; Cha, Jennifer N.; Nagpal, Prashant

    2015-01-01

    Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers

  13. Electrostatic interactions between immunoglobulin (IgG) molecules and a charged sorbent

    NARCIS (Netherlands)

    Bremer, M.G.E.G.; Duval, J.; Norde, Willem; Lyklema, J.

    2004-01-01

    The influence of electrostatic interactions on the adsorption of IgG is examined both theoretically and experimentally. The long-range interaction between IgG and the charged sorbent surface is treated in terms of the DLVO theory taking into account the possibility of charge- and potential

  14. Exploring charge transport properties and functionality of molecule-nanoparticle ensembles

    NARCIS (Netherlands)

    Devid, Edwin Johan

    2015-01-01

    For more than 65 years, scientists have been fascinated by the idea to miniaturize electrical circuits toward the smallest length scales. One particular way is inspired by nature itself, specifically to assemble electrical components and switches from atoms and molecules. The molecules typically

  15. Electrical Matching at Metal/Molecule Contacts for Efficient Heterogeneous Charge Transfer.

    Science.gov (United States)

    Sato, Shino; Iwase, Shigeru; Namba, Kotaro; Ono, Tomoya; Hara, Kenji; Fukuoka, Atsushi; Uosaki, Kohei; Ikeda, Katsuyoshi

    2018-02-27

    In a metal/molecule hybrid system, unavoidable electrical mismatch exists between metal continuum states and frontier molecular orbitals. This causes energy loss in the electron conduction across the metal/molecule interface. For efficient use of energy in a metal/molecule hybrid system, it is necessary to control interfacial electronic structures. Here we demonstrate that electrical matching between a gold substrate and π-conjugated molecular wires can be obtained by using monatomic foreign metal interlayers, which can change the degree of d-π* back-donation at metal/anchor contacts. This interfacial control leads to energy level alignment between the Fermi level of the metal electrode and conduction molecular orbitals, resulting in resonant electron conduction in the metal/molecule hybrid system. When this method is applied to molecule-modified electrocatalysts, the heterogeneous electrochemical reaction rate is considerably improved with significant suppression of energy loss at the internal electron conduction.

  16. Overcoming the inhibitory effect of serum on lipofection by increasing the charge ratio of cationic liposome to DNA.

    Science.gov (United States)

    Yang, J P; Huang, L

    1997-09-01

    Since cationic liposome was first developed as a lipofection reagent, a drawback has been noted in that the efficiency of lipofection decreases dramatically after addition of serum to the lipofection medium. This drawback hampers the application of cationic liposome for systematic delivery of genes. In the present studies, we found that the effect of serum on DC-chol liposome-mediated lipofection is dependent on the charge ratio of liposome to DNA. Serum inhibited lipofection activity of the lipoplex at low charge ratios, whereas it enhanced the lipofection activity at high charge ratios. This phenomenon was observed using DOTAP/DOPE but not lipofectamine. Measurement of cellular association of DNA showed that serum could reduce the binding of lipoplex to cells at all tested charge ratios, i.e. 0-10.6. Removal of negatively charged proteins from serum by DEAE Sephacel column abolished the inhibitory effect of serum on lipofection. The fraction contained only negatively charged serum proteins which strongly inhibited lipofection at low charge ratios but not at higher charge ratios. Furthermore, preincubation of serum with positively charged polylysine, which neutralized negatively charged serum proteins, eliminated the inhibitory effect of serum on lipofection. In summary, inactivation of cationic liposome by serum is due to negatively charged serum proteins and it can be overcome by increasing charge ratio of cationic liposome-DNA lipoplexes or by neutralizing the serum with polylysine.

  17. Interaction of nucleic acids with electrically charged surfaces. VII. The effect of ionic strength of neutral medium on the conformation of dna adsorbed on the mercury electrode.

    Science.gov (United States)

    Brabec, V

    1980-02-01

    Triangular-wave direct current (d.c.) voltammetry at a hanging mercury drop electrode and phase-selective alternating current (a.c.) polarography at a dropping mercury electrode were used for the investigation of adsorption of double-helical (ds) DNA at mercury electrode surfaces from neutral solutions of 0.05-0.4 M HCOONH4. It was found for the potential region T (from -0.1 V up to ca. -1.0 V) that the height of voltammetric peaks of ds DNA is markedly influenced by the initial potential only at relatively low ionic strength (mu) (from 0.05 up to ca. 0.3). Also a decrease of differential capacity (measured by means of a.c. polarography) in the region T depended markedly on the electrode potential only at relatively low ionic strength. The following conclusions were made concerning the interaction of ds DNA with a mercury electrode charged to potentials of the region T in neutral medium of relatively low ionic strength mu potentials in the Vicinity of the zero charge potential a higher number of ds DNA segments can be opened, probably as a consequence of the strain which could act on the ds DNA molecule in the course of the segmental adsorption/desorption process.

  18. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.

    Science.gov (United States)

    Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai

    2018-01-09

    Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Mixed Domains Enhance Charge Generation and Extraction in Bulk-Heterojunction Solar Cells with Small-Molecule Donors

    KAUST Repository

    Alqahtani, Obaid

    2018-03-25

    The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.

  20. Mixed Domains Enhance Charge Generation and Extraction in Bulk-Heterojunction Solar Cells with Small-Molecule Donors

    KAUST Repository

    Alqahtani, Obaid; Babics, Maxime; Gorenflot, Julien; Savikhin, Victoria; Ferron, Thomas; Balawi, Ahmed H.; Paulke, Andreas; Kan, Zhipeng; Pope, Michael; Clulow, Andrew J.; Wolf, Jannic Sebastian; Burn, Paul L.; Gentle, Ian R.; Neher, Dieter; Toney, Michael F.; Laquai, Fré dé ric; Beaujuge, Pierre; Collins, Brian A.

    2018-01-01

    The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.

  1. Molecular Processes Studied at a Single-Molecule Level Using DNA Origami Nanostructures and Atomic Force Microscopy

    Directory of Open Access Journals (Sweden)

    Ilko Bald

    2014-09-01

    Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.

  2. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  3. The regiochemical distribution of positive charges along cholesterol polyamine carbamates plays significant roles in modulating DNA binding affinity and lipofection.

    Science.gov (United States)

    Geall, A J; Eaton, M A; Baker, T; Catterall, C; Blagbrough, I S

    1999-10-15

    We have quantified the effects of the regiochemical distribution of positive charges along the polyamine moiety in lipopolyamines for DNA molecular recognition. High affinity binding leads to charge neutralisation, DNA condensation and ultimately to lipofection. Binding affinities for calf thymus DNA were determined using an ethidium bromide displacement assay and condensation was detected by changes in turbidity using light scattering. The in vitro transfection competence of cholesterol polyamine carbamates was measured in CHO cells. In the design of DNA condensing and transfecting agents for non-viral gene therapy, the interrelationship of ammonium ions, not just their number, must be considered.

  4. A polypeptide-DNA hybrid with selective linking capability applied to single molecule nano-mechanical measurements using optical tweezers.

    Directory of Open Access Journals (Sweden)

    Fatemeh Moayed

    Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.

  5. Computational modeling of chemical reactions and interstitial growth and remodeling involving charged solutes and solid-bound molecules.

    Science.gov (United States)

    Ateshian, Gerard A; Nims, Robert J; Maas, Steve; Weiss, Jeffrey A

    2014-10-01

    Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio ( www.febio.org ). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the

  6. Diffusion of flexible, charged, nanoscopic molecules in solution: Size and pH dependence for PAMAM dendrimer

    Science.gov (United States)

    Maiti, Prabal K.; Bagchi, Biman

    2009-12-01

    In order to understand self-diffusion (D) of a charged, flexible, and porous nanoscopic molecule in water, we carry out very long, fully atomistic molecular dynamics simulation of PAMAM dendrimer up to eight generations in explicit salt water under varying pH. We find that while the radius of gyration (Rg) varies as N1/3, the self-diffusion constant (D ) scales, surprisingly, as N-α, with α =0.39 at high pH and 0.5 at neutral pH, indicating a dramatic breakdown of Stokes-Einstein relation for diffusion of charged nanoscopic molecules. The variation in D as a function of radius of gyration demonstrates the importance of treating water and ions explicitly in the diffusion process of a flexible nanoscopic molecule. In agreement with recent experiments, the self-diffusion constant increases with pH, revealing the importance of dielectric friction in the diffusion process. The shape of a dendrimer is found to fluctuate on a nanosecond time scale. We argue that this flexibility (and also the porosity) of the dendrimer may play an important role in determining the mean square displacement of the dendrimer and the breakdown of the Stokes-Einstein relation between diffusion constant and the radius.

  7. Nanofluidic single-molecule sorting of DNA: a new concept in separation and analysis of biomolecules towards ultimate level performance

    International Nuclear Information System (INIS)

    Yamamoto, Takatoki; Fujii, Teruo

    2010-01-01

    Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.

  8. Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe

  9. In silico single-molecule manipulation of DNA with rigid body dynamics.

    Directory of Open Access Journals (Sweden)

    Pascal Carrivain

    2014-02-01

    Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.

  10. Single-molecule packaging initiation in real time by a viral DNA packaging machine from bacteriophage T4.

    Science.gov (United States)

    Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip

    2014-10-21

    Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.

  11. Simulation Assisted Analysis of the Intrinsic Stiffness for Short DNA Molecules Imaged with Scanning Atomic Force Microscopy.

    Directory of Open Access Journals (Sweden)

    Haowei Wang

    Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.

  12. [Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

    Science.gov (United States)

    Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

    2013-01-01

    To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

  13. Recent measurements of low energy charge exchange cross sections for collisions of multicharged ions on neutral atoms and molecules

    International Nuclear Information System (INIS)

    Havener, Charles C.

    2001-01-01

    At ORNL Multicharged Ion Research Facility (MIRF), charge exchange (CX) cross sections have been measured for multicharged ions (MCI) on neutral atoms and molecules. The ORNL ion-atom merged-beam apparatus was used to measure single electron capture by MCI from H at eV/amu energies. A gas cell was used to measure single and double electron capture by MCI from a variety of molecular targets at keV collision energies. The merged-beams experiment has been successful in providing benchmark total electron capture measurements for several collision systems with a variety of multicharged ions on H or D

  14. Exploring Charge Transport in Guest Molecule Infiltrated Cu3(BTC)2 Metal Organic Framework

    Energy Technology Data Exchange (ETDEWEB)

    Leonard, Francois Leonard [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Stavila, Vitalie [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Allendorf, Mark D. [Sandia National Lab. (SNL-CA), Livermore, CA (United States)

    2014-09-01

    The goal of this Exploratory Express project was to expand the understanding of the physical properties of our recently discovered class of materials consisting of metal-organic frameworks with electroactive ‘guest’ molecules that together form an electrically conducting charge-transfer complex (molecule@MOF). Thin films of Cu3(BTC)2 were grown on fused silica using solution step-by-step growth and were infiltrated with the molecule tetracyanoquinodimethane (TCNQ). The infiltrated MOF films were extensively characterized using optical microscopy, scanning electron microscopy, Raman spectroscopy, electrical conductivity, and thermoelectric properties. Thermopower measurements on TCNQ@Cu3(BTC)2 revealed a positive Seebeck coefficient of ~400 μV/k, indicating that holes are the primary carriers in this material. The high value of the Seebeck coefficient and the expected low thermal conductivity suggest that molecule@MOF materials may be attractive for thermoelectric power conversion applications requiring low cost, solution-processable, and non-toxic active materials.

  15. A novel small molecule inhibitor of the DNA repair protein Ku70/80.

    Science.gov (United States)

    Weterings, Eric; Gallegos, Alfred C; Dominick, Lauren N; Cooke, Laurence S; Bartels, Trace N; Vagner, Josef; Matsunaga, Terry O; Mahadevan, Daruka

    2016-07-01

    Non-Homologous End-Joining (NHEJ) is the predominant pathway for the repair of DNA double strand breaks (DSBs) in human cells. The NHEJ pathway is frequently upregulated in several solid cancers as a compensatory mechanism for a separate DSB repair defect or for innate genomic instability, making this pathway a powerful target for synthetic lethality approaches. In addition, NHEJ reduces the efficacy of cancer treatment modalities which rely on the introduction of DSBs, like radiation therapy or genotoxic chemotherapy. Consequently, inhibition of the NHEJ pathway can modulate a radiation- or chemo-refractory disease presentation. The Ku70/80 heterodimer protein plays a pivotal role in the NHEJ process. It possesses a ring-shaped structure with high affinity for DSBs and serves as the first responder and central scaffold around which the rest of the repair complex is assembled. Because of this central position, the Ku70/80 dimer is a logical target for the disruption of the entire NHEJ pathway. Surprisingly, specific inhibitors of the Ku70/80 heterodimer are currently not available. We here describe an in silico, pocket-based drug discovery methodology utilizing the crystal structure of the Ku70/80 heterodimer. We identified a novel putative small molecule binding pocket and selected several potential inhibitors by computational screening. Subsequent biological screening resulted in the first identification of a compound with confirmed Ku-inhibitory activity in the low micro-molar range, capable of disrupting the binding of Ku70/80 to DNA substrates and impairing Ku-dependent activation of another NHEJ factor, the DNA-PKCS kinase. Importantly, this compound synergistically sensitized human cell lines to radiation treatment, indicating a clear potential to diminish DSB repair. The chemical scaffold we here describe can be utilized as a lead-generating platform for the design and development of a novel class of anti-cancer agents. Copyright © 2016 Elsevier B.V. All

  16. DNA Damage by Ionizing Radiation: Tandem Double Lesions by Charged Particles

    Science.gov (United States)

    Huo, Winifred M.; Chaban, Galina M.; Wang, Dunyou; Dateo, Christopher E.

    2005-01-01

    Oxidative damages by ionizing radiation are the source of radiation-induced carcinogenesis, damage to the central nervous system, lowering of the immune response, as well as other radiation-induced damages to human health. Monte Carlo track simulations and kinetic modeling of radiation damages to the DNA employ available molecular and cellular data to simulate the biological effect of high and low LET radiation io the DNA. While the simulations predict single and double strand breaks and base damages, so far all complex lesions are the result of stochastic coincidence from independent processes. Tandem double lesions have not yet been taken into account. Unlike the standard double lesions that are produced by two separate attacks by charged particles or radicals, tandem double lesions are produced by one single attack. The standard double lesions dominate at the high dosage regime. On the other hand, tandem double lesions do not depend on stochastic coincidences and become important at the low dosage regime of particular interest to NASA. Tandem double lesions by hydroxyl radical attack of guanine in isolated DNA have been reported at a dosage of radiation as low as 10 Gy. The formation of two tandem base lesions was found to be linear with the applied doses, a characteristic of tandem lesions. However, tandem double lesions from attack by a charged particle have not been reported.

  17. Ultrafast Charge Generation Pathways in Photovoltaic Blends Based on Novel Star-Shaped Conjugated Molecules

    NARCIS (Netherlands)

    Kozlov, Oleg V.; Luponosov, Yuriy N.; Ponomarenko, Sergei A.; Kausch-Busies, Nina; Paraschuk, Dmitry Yu; Olivier, Yoann; Beljonne, David; Cornil, Jerome; Pshenichnikov, Maxim S.

    2015-01-01

    The quest for new materials is one of the main factors propelling recent advances in organic photovoltaics. Star-shaped small molecules (SSMs) have been proven promising candidates as perspective donor material due to the increase in numbers of excitation pathways caused by the degeneracy of the

  18. Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

    Science.gov (United States)

    Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

    2017-11-01

    The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis

    Science.gov (United States)

    Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.

    2016-01-01

    Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595

  20. Charge transfer through DNA/DNA duplexes and DNA/RNA hybrids: complex theoretical and experimental studies

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Vala, M.; Weiter, M.; Špérová, M.; Schneider, Bohdan; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír

    180-181, Oct-Nov (2013), s. 127-134 ISSN 0301-4622 R&D Projects: GA TA ČR TA01011165; GA ČR(CZ) GAP304/10/1951; GA ČR GA13-27676S; GA ČR GA202/09/0193 Institutional support: RVO:68378271 ; RVO:86652036 ; RVO:61388963 Keywords : charge transfer in oligonucleotides * temperature dependent steady state fluorescence spectroscopy * time-resolved fluorescence spectroscopy Subject RIV: JJ - Other Materials; CC - Organic Chemistry (UOCHB-X) Impact factor: 2.319, year: 2013

  1. Single-molecule studies of DNA replication : Visualization of DNA replication by the T7 bacteriophage replisome at a single-molecule level

    NARCIS (Netherlands)

    Geertsema, Hylkje

    2014-01-01

    De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs

  2. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

    2009-07-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  3. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    International Nuclear Information System (INIS)

    Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

    2009-01-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  4. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    International Nuclear Information System (INIS)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y.; Taub, H.; Miskowiec, A.

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10 8 –10 9 V m −1 , which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10 8 V m −1 ) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10 8 V m −1 ) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1,2-dimyristoyl-sn-glycero-3

  5. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    Energy Technology Data Exchange (ETDEWEB)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y., E-mail: flemming@kemi.dtu.dk [Department of Chemistry, Technical University of Denmark, IK 207 DTU, DK-2800 Lyngby (Denmark); Taub, H.; Miskowiec, A. [Department of Physics and Astronomy and the University of Missouri Research Reactor,University of Missouri, Columbia, Missouri 65211 (United States)

    2016-04-14

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10{sup 8}–10{sup 9} V m{sup −1}, which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10{sup 8} V m{sup −1}) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10{sup 8} V m{sup −1}) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1

  6. Study on charge transfer reaction of several organic molecules with accelerated rare gas ions

    International Nuclear Information System (INIS)

    Takahasi, Makoto; Okuda, Sachiko; Arai, Eiichi; Ichinose, Akira; Takakubo, Masaaki.

    1984-01-01

    Observing the charge transfer mass spectra of ethylbenzene, cyclobutane and methanol in Ar and Xe ion impacts, we investigated the dependence of the secondary ion peak intensities (normalized to primary ion current and target pressure) on the translational energy of primary ions (0-3500 eV).In the case of ethylbenzene, several maxima of the secondary i on peak intensities were observed in Ar and Xe ion impacts. The correlation between the maxima and the primary ion energy was examined in terms of near adiabatic theory of Massey. Supplementary studies on the energy distribution of primary ion, charge transfer cross section between methanol and Xe ion, and final product analysis in rare gas ion irradiation on cyclobutane were described. (author)

  7. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    DEFF Research Database (Denmark)

    Rønnest, A. K.; Peters, Günther H.J.; Hansen, Flemming Yssing

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid...... compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have...... the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic...

  8. Charge exchange of excited mesic atoms of hydrogen isotopes in triple collisions with molecules

    International Nuclear Information System (INIS)

    Men'shikov, L.I.; Ponomarev, L.I.

    1985-01-01

    At high densities of deuterium-tritium mixture the probability for the occurrence of the isotope-exchange reaction (dμ)/sub n/+t → d+(tμ)/sub n/ from the excited states of n mesic atoms of deuterium is high in the triple collisions of mesic atoms with the molecules of hydrogen isotopes. This reaction should be taken into account in describing the kinetics of muon catalysis

  9. The effect of polymer size and charge of molecules on permeation through synovial membrane and accumulation in hyaline articular cartilage.

    Science.gov (United States)

    Sterner, B; Harms, M; Wöll, S; Weigandt, M; Windbergs, M; Lehr, C M

    2016-04-01

    The treatment of joint related diseases often involves direct intra-articular injections. For rational development of novel delivery systems with extended residence time in the joint, detailed understanding of transport and retention phenomena within the joint is mandatory. This work presents a systematic study on the in vitro permeation, penetration and accumulation of model polymers with differing charges and molecular weights in bovine joint tissue. Permeation experiments with bovine synovial membrane were performed with PEG polymers (6-200 kDa) and methylene blue in customized diffusion chambers. For polyethylene glycol, 2-fold (PEG 6 kDa), 3-fold (PEG 10 kDa) and 13-fold (PEG 35 kDa) retention by the synovial membrane in reference to the small molecule methylene blue was demonstrated. No PEG 200 kDa was found in the acceptor in detectable amounts after 48 h. This showed the potential for a distinct extension of joint residence times by increasing molecular weights. In addition, experiments with bovine cartilage tissue were conducted. The ability for positively charged, high molecular weight chitosans and HEMA-Co-TMAP (HCT) polymers (up to 233 kDa) to distribute throughout the entire cartilage matrix was demonstrated. In contrast, a distribution into cartilage was not observed for neutral PEG polymers (6-200 kDa). Furthermore, the positive charge density of different compounds (chitosan, HEMA-Co-TMAP, methylene blue, MSC C1 (neutral NCE) and MSC D1 (positively charged NCE) was found to correlate with their accumulation in bovine cartilage tissue. In summary, the results offer pre-clinical in vitro data, indicating that the modification of molecular size and charge of a substance has the potential to decelerate its clearance through the synovial membrane and to promote accumulation inside the cartilage matrix. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Repair of DNA double-strand breaks and cell killing by charged particles

    Science.gov (United States)

    Eguchi-Kasai, K.; Murakami, M.; Itsukaichi, H.; Fukutsu, K.; Yatagai, F.; Kanai, T.; Ohara, H.; Sato, K.

    It has been suggested that it is not simple double-strand breaks (dsb) but the non-reparable breaks which correlate well with the high biological effectiveness of high LET radiations for cell killing. We have compared the effects of charged particles on cell death in 3 pairs of cell lines which are normal or defective in the repair of DNA dsbs. For the cell lines SL3-147, M10, and SX10 which are deficient in DNA dsb repair, RBE values were close to unity for cell killing induced by charged particles with linear energy transfer (LET) up to 200 keV/mum and were even smaller than unity for the LET region greater than 300 keV/mum. The inactivation cross section (ICS) increased with LET for all 3 pairs. The ICS of dsb repair deficient mutants was always larger than that of their parents for all the LET ranges, but with increasing LET the difference in ICS between the mutant and its parent became smaller. Since a small difference in ICS remained at LET of about 300 keV/mum, dsb repair may still take place at this high LET, even if its role is apparently small. These results suggest that the DNA repair system does not play a major role in protection against the attack of high LET radiations and that a main cause of cell death is non-reparable dsb which are produced at a higher yield compared with low LET radiations. No correlation was observed between DNA content or nuclear area and ICS.

  11. On the electrostatics of DNA in chromatin

    Directory of Open Access Journals (Sweden)

    Klemen Bohinc

    2016-02-01

    Full Text Available We examine the interaction between DNA molecules immersed in an aqueous solution of oppositely charged, trivalent spermidine molecules. The DNA molecules are modeled as planar, likecharged surfaces immersed in an aqueous solution of multivalent, rod-like ions consisting of rigidly bonded point charges. An approximate field theory is used to determine the properties of this system from the weak to the intermediate through to the strong coupling regimes. In the weak coupling limit, the interaction between the charged surfaces is only repulsive, whereas in the intermediate coupling regime, the rod-like ions with spatial charge distribution can induce attractive force between the charged surfaces. In the strong coupling limit, the inter-ionic charge correlations induce attractive interaction at short separations between the surfaces. This theoretical study can give new insights in the problem of interaction between DNA molecules mediated by trivalent spermidine molecules.

  12. Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

    Science.gov (United States)

    Paximadis, M; Rey, M E

    2001-12-01

    The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

  13. Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Full text: Many objects in Nature - elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are build as self-consistent hierarchical systems and have the same homological construction in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to above said the corresponding partial motion are determinate. This determinism arises as a consequences of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe. The Huygens synchronization principle is substantiated at the microscopic level as the consequence of energy conservation law and resonance character of any interaction between wave systems. In this paper we demonstrated the universality of the Huygens synchronization principle independent of substance, fields, and interactions for microsystems. Thereby, webbing some arguments in favor of the mechanism - ORDER from ORDER, declared by Schrodinger is fundamental problem of contemporary science. We came to conclusion that a stable proton and neutron play the role of standard for other elementary particles and nuclei. They contain all necessary information about structure of other particles and nuclei. This information is used and reproduced by simple rational relations, according to the fundamental conservation law of energy momentum. We originated from the principles of commensurability and self-similarity. The commensurability and self-similarity result in the very unity of the world. The principle of

  14. Electron emission following collisions between multi-charged ions and D2 molecules

    International Nuclear Information System (INIS)

    Laurent, G.

    2004-05-01

    Dissociative ionisation mechanisms induced in collisions involving a highly charged ion (S 15+ , 13.6 MeV/u) and a molecular deuterium target, have been studied through momentum vector correlations of both the D + fragments and the electrons produced. An experimental apparatus has been developed in order to detect in coincidence all the charged particles produced during the collision. The measurement of their momentum vectors, which allows one to determine both their kinetic energy and direction of emission with respect to the projectile one, combines Time of Flight, Position Sensitive Detection, and multi-coincidence techniques. The correlation of the fragment and electron kinetic energies enables not only to determine branching ratios between the dissociative ionisation pathways, but also to separate unambiguously kinetic energy distributions of fragments associated to each process. Finally, the angular distributions of ejected electrons, as a function of the orientation of the molecular axis with respect to the projectile direction, are deduced from the spatial correlation. Measurements are compared to theoretical angular distributions obtained using the CDW-EIS (Continuum Distorted Wave-Eikonal Initial State) method. (author)

  15. The role of cytosine methylation on charge transport through a DNA strand

    Energy Technology Data Exchange (ETDEWEB)

    Qi, Jianqing, E-mail: jqqi@uw.edu; Anantram, M. P., E-mail: anantmp@uw.edu [Department of Electrical Engineering, University of Washington, Seattle, Washington 98195-2500 (United States); Govind, Niranjan, E-mail: niri.govind@pnnl.gov [William R. Wiley Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2015-09-07

    Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.

  16. Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

    Science.gov (United States)

    Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

    2010-04-22

    Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

  17. Cross-sections of charge and electronic states change of particles at ion-ion and ion-molecule collisions

    International Nuclear Information System (INIS)

    Panov, M.N.; Afrosimov, V.V.; Basalaev, A.A.; Guschina, N.A.; Nikulin, V.K.

    2006-01-01

    The interactions of protons and alpha-particles with hydrocarbons are investigated. A quantum-mechanical computation of the electronic structure of all hydrocarbons from methane to butane and its fragment ions was performed in the Hartree-Fock RHF/UHF approximation using a GAMESS program (General Atomic Molecular Electron Structure System). The correlation energy was taken into account within the framework of MP2 perturbation theory. The structural parameters of the hydrocarbon molecules and their charged and neutral fragments were calculated in two cases: in the geometry of the parent molecule or of the relaxation states. The difference of the full energy of the same fragments in and out of brackets gives us the vibration excitation energies of the fragments at the moment of creation. Additional Mulliken effective charges (in electron charge units) of atoms in the fragments have been calculated. The calculations show that removing one electron from the ethane molecule without electronic excitation produced a single charged molecular ion in vibration state with binding energy of hydrogen atoms, some decimal eV. As results we obtain C 2 H 6 + and C 2 H 5 + . Additional fragmentation of hydrocarbon needs electronic excitation of produced single charged ions. Cross sections for electron capture and excitation processes in collisions between the hydrogen-like He + , B 4+ and O 7+ ions have been evaluated. The purpose of the theory within this project during the period under review was to get for the first time new data on Single-Electron Capture (SEC) and Excitation Processes (EP) in collisions of He + (1s) ions with hydrogen-like impurity ions B 4+ (1s) and O 7+ (1s) in the energy range for He + ions from 0.2 MeV to 3.0 MeV. The calculations were carried out by using the method of close-coupling equations with basis sets of eleven and ten quasimolecular two-electron states for reactions (1, 2) and (3, 4), respectively (entrance channel, seven charge transfer channels

  18. Sequence-selective single-molecule alkylation with a pyrrole-imidazole polyamide visualized in a DNA nanoscaffold.

    Science.gov (United States)

    Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi

    2012-03-14

    We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.

  19. Interference effects in double ionization of spatially aligned hydrogen molecules by fast highly charged ions

    International Nuclear Information System (INIS)

    Landers, A.L.; Alnaser, A.S.; Tanis, J.A.; Wells, E.; Osipov, T.; Carnes, K.D.; Ben-Itzhak, I.; Cocke, C.L.; McGuire, J.H.

    2004-01-01

    Cross sections differential in target orientation angle were measured for 19 MeV F 8+ +D 2 collisions. Multihit position-sensitive detectors were used to isolate the double-ionization channel and determine a posteriori the full momentum vectors of both ejected D + fragments. A strong dependence of the double ionization cross section on the angle between the incident ion direction and the target molecular axis is observed with a ≅3.5:1 enhancement for molecules aligned perpendicular to the projectile axis. This clear asymmetry is attributed to interference effects, analogous to Young's two-slit experiment, arising from coherent contributions to the ionization from both atomic centers. The data are compared to a simple scattering model based on two center interference

  20. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)

    1999-02-01

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  1. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  2. Formation and decay of the intermediate quasistationary ion N-2 during charge exchange between fast H- ions and nitrogen molecules

    International Nuclear Information System (INIS)

    Kazanskii, A.K.

    1984-01-01

    The detachment of the electron from the H - ion during a collision with the nitrogen molecule at 1--6 keV occurs as a result of charge transfer to an unstable intermediate state of the molecular ion N - 2 and the subsequent decay of the ion. The formation process is described in the impulse approximation, and the motion of nuclei in the ion is treated quasiclassically. Expressions are obtained for the spectrum of emitted electrons and for the energy-loss spectrum of heavy particles. These expressions relate the spectra to the cross sections for the vibrational excitation of N 2 by electron impact. A convenient expression for the amplitude for the formation of the intermediate state is obtained in the ''boomerang'' model, and it is shown that one of the parameters, considered to be adjustable in traditional theory, can be calculated

  3. Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

    Science.gov (United States)

    Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

    2007-12-15

    The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

  4. Colorimetric and dynamic light scattering detection of DNA sequences by using positively charged gold nanospheres: a comparative study with gold nanorods

    Science.gov (United States)

    Pylaev, T. E.; Khanadeev, V. A.; Khlebtsov, B. N.; Dykman, L. A.; Bogatyrev, V. A.; Khlebtsov, N. G.

    2011-07-01

    We introduce a new genosensing approach employing CTAB (cetyltrimethylammonium bromide)-coated positively charged colloidal gold nanoparticles (GNPs) to detect target DNA sequences by using absorption spectroscopy and dynamic light scattering. The approach is compared with a previously reported method employing unmodified CTAB-coated gold nanorods (GNRs). Both approaches are based on the observation that whereas the addition of probe and target ssDNA to CTAB-coated particles results in particle aggregation, no aggregation is observed after addition of probe and nontarget DNA sequences. Our goal was to compare the feasibility and sensitivity of both methods. A 21-mer ssDNA from the human immunodeficiency virus type 1 HIV-1 U5 long terminal repeat (LTR) sequence and a 23-mer ssDNA from the Bacillus anthracis cryptic protein and protective antigen precursor (pagA) genes were used as ssDNA models. In the case of GNRs, unexpectedly, the colorimetric test failed with perfect cigar-like particles but could be performed with dumbbell and dog-bone rods. By contrast, our approach with cationic CTAB-coated GNPs is easy to implement and possesses excellent feasibility with retention of comparable sensitivity—a 0.1 nM concentration of target cDNA can be detected with the naked eye and 10 pM by dynamic light scattering (DLS) measurements. The specificity of our method is illustrated by successful DLS detection of one-three base mismatches in cDNA sequences for both DNA models. These results suggest that the cationic GNPs and DLS can be used for genosensing under optimal DNA hybridization conditions without any chemical modifications of the particle surface with ssDNA molecules and signal amplification. Finally, we discuss a more than two-three-order difference in the reported estimations of the detection sensitivity of colorimetric methods (0.1 to 10-100 pM) to show that the existing aggregation models are inconsistent with the detection limits of about 0.1-1 pM DNA and that

  5. Applications of the quasi-elastic light scattering to the study of dynamic properties of charged macro-molecules

    International Nuclear Information System (INIS)

    Gouesin-Menez, Renee

    1979-01-01

    The object of this research thesis is to study the modifications of dynamic properties of a macromolecule under the influence of variations of its medium, by using a frequency analysis of the spectrum of light scattered by a solution of particles. Thus, an important part of this thesis addresses the study and development of the scattering method and of its analysis by 'photon pulses', and the development and adjustment of an electrophoretic device to study light scattering by molecules submitted to an electric field. Then, hydrodynamic characteristics of some macromolecules have been measured with or without electric field. The studied molecular systems have been: calibrated spheres of latex polystyrene, a globular protein (bovine serum albumin), a polysaccharide (under the form of a rigid short stick), a flexible linear polyelectrolyte (polymethacrylate), and two DNA samples

  6. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  7. Manipulating the dipole layer of polar organic molecules on metal surfaces via different charge-transfer channels

    Science.gov (United States)

    Lin, Meng-Kai; Nakayama, Yasuo; Zhuang, Ying-Jie; Wang, Chin-Yung; Pi, Tun-Wen; Ishii, Hisao; Tang, S.-J.

    The key properties of organic films such as energy level alignment (ELA), work functions, and injection barriers are closely linked to this dipole layer. Using angle resolved photoemission spectroscopy (ARPES), we systemically investigate the coverage-dependent work functions and spectra line shapes of occupied molecular orbital states of a polar molecule, chloroaluminium phthalocyanine (ClAlPc), grown on Ag(111) to show that the orientations of the first ClAlPc layer can be manipulated via the molecule deposition rate and post annealing, causing ELA at organic-metal interface to differ for about 0.3 eV between Cl-up and Cl-down configuration. Moreover, by comparing the experimental results with the calculations based on both gas-phase model and realistic model of ClAlPc on Ag(111) , we evidence that the different orientations of ClAlPc dipole layers lead to different charge-transfer channels between ClAlPc and Ag, a key factor that controls the ELA at organic-metal interface.

  8. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules.

    Science.gov (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John

    2016-01-15

    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  9. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  10. Charge transport in DNA oligonucleotides with various base-pairing patterns

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Todorciuc, Tatiana; Král, Karel; Němec, Hynek; Bunček, M.; Šebera, Jakub; Záliš, Stanislav; Vokáčová, Zuzana; Sychrovský, Vladimír; Bednárová, Lucie; Mojzeš, P.; Schneider, Bohdan

    2010-01-01

    Roč. 114, č. 15 (2010), 5196–5205 ISSN 1520-6106 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA ČR GA202/07/0643; GA AV ČR IAA400550701; GA AV ČR KAN200100801; GA AV ČR KAN100400702; GA ČR GA202/09/0193 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z40400503; CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : DNA * charge transport * Scanning Tunneling Microscopy Subject RIV: CC - Organic Chemistry Impact factor: 3.603, year: 2010

  11. Counting molecules in cell-free DNA and single cells RNA

    OpenAIRE

    Karlsson, Kasper

    2016-01-01

    The field of Molecular Biology got started in earnest with the discovery of the molecular structure of DNA. This lead to a surge of interest into the relationships between DNA, RNA and proteins, and to the development of fundamental tools for manipulating those substances, such as cutting, ligating, amplifying, visualizing and size-selecting DNA. With these tools at hand it was possible to begin sequencing DNA, a process that took a leap forward in 2005 with the advent of Next Generation Sequ...

  12. A single thiazole orange molecule forms an exciplex in a DNA i-motif.

    Science.gov (United States)

    Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei

    2014-06-18

    A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.

  13. Adsorption of a cationic dye molecule on polystyrene microspheres in colloids: effect of surface charge and composition probed by second harmonic generation.

    Science.gov (United States)

    Eckenrode, Heather M; Jen, Shih-Hui; Han, Jun; Yeh, An-Gong; Dai, Hai-Lung

    2005-03-17

    Nonlinear optical probe, second harmonic generation (SHG), of the adsorption of the dye molecule malachite green (MG), in cationic form at pH polystyrene microspheres in aqueous solution is used to study the effect of surface charge and composition on molecular adsorption. Three types of polystyrene microspheres with different surface composition are investigated: (1) a sulfate terminated, anionic surface, (2) a neutral surface without any functional group termination, and (3) an amine terminated, cationic surface. The cationic dye was found to adsorb at all three surfaces, regardless of surface charge. The adsorption free energies, DeltaG's, measured for the three surfaces are -12.67, -12.39, and -10.46 kcal/mol, respectively, with the trend as expected from the charge interactions. The adsorption density on the anionic surface, where attractive charge-charge interaction dominates, is determined by the surface negative charge density. The adsorption densities on the neutral and cationic surfaces are on the other hand higher, perhaps as a result of a balance between minimizing repulsive charge interaction and maximizing attractive molecule-substrate and intermolecular interactions. The relative strength of the SH intensity per molecule, in combination of a model calculation, reveals that the C(2) axis of the MG molecule is nearly perpendicular to the surface on the anionic surface and tilts away from the surface norm when the surface is neutral and further away when cationic. Changing the pH of the solution may alter the surface charge and subsequently affect the adsorption configuration and SH intensity.

  14. Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

    Directory of Open Access Journals (Sweden)

    Zach Hensel

    Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

  15. Single-molecule conductance of a chemically modified, π-extended tetrathiafulvalene and its charge-transfer complex with F4TCNQ

    Directory of Open Access Journals (Sweden)

    Raúl García

    2015-06-01

    Full Text Available We describe the synthesis and single-molecule electrical transport properties of a molecular wire containing a π-extended tetrathiafulvalene (exTTF group and its charge-transfer complex with F4TCNQ. We form single-molecule junctions using the in situ break junction technique using a homebuilt scanning tunneling microscope with a range of conductance between 10 G0 down to 10−7 G0. Within this range we do not observe a clear conductance signature of the neutral parent molecule, suggesting either that its conductance is too low or that it does not form a stable junction. Conversely, we do find a clear conductance signature in the experiments carried out on the charge-transfer complex. Due to the fact we expected this species to have a higher conductance than the neutral molecule, we believe this supports the idea that the conductance of the neutral molecule is very low, below our measurement sensitivity. This idea is further supported by theoretical calculations. To the best of our knowledge, these are the first reported single-molecule conductance measurements on a molecular charge-transfer species.

  16. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  17. DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

    Science.gov (United States)

    Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

    2009-03-01

    The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

  18. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  19. Geant4-DNA coupling and validation in the GATE Monte Carlo platform for DNA molecules irradiation in a calculation grid environment

    International Nuclear Information System (INIS)

    Pham, Quang Trung

    2014-01-01

    The Monte Carlo simulation methods are successfully being used in various areas of medical physics but also at different scales, for example, from the radiation therapy treatment planning systems to the prediction of the effects of radiation in cancer cells. The Monte Carlo simulation platform GATE based on the Geant4 tool-kit offers features dedicated to simulations in medical physics (nuclear medicine and radiotherapy). For radiobiology applications, the Geant4-DNA physical models are implemented to track particles till very low energy (eV) and are adapted for estimation of micro-dosimetric quantities. In order to implement a multi-scale Monte Carlo platform, we first validated the physical models of Geant4-DNA, and integrated them into GATE. Finally, we validated this implementation in the context of radiation therapy and proton therapy. In order to validate the Geant4-DNA physical models, dose point kernels for monoenergetic electrons (10 keV to 100 keV) were simulated using the physical models of Geant4-DNA and were compared to those simulated with Geant4 Standard physical models and another Monte Carlo code EGSnrc. The range and the stopping powers of electrons (7.4 eV to 1 MeV) and protons (1 keV to 100 MeV) calculated with GATE/Geant4-DNA were then compared with literature. We proposed to simulate with the GATE platform the impact of clinical and preclinical beams on cellular DNA. We modeled a clinical proton beam of 193.1 MeV, 6 MeV clinical electron beam and a X-ray irradiator beam. The beams models were validated by comparing absorbed dose computed and measured in liquid water. Then, the beams were used to calculate the frequency of energy deposits in DNA represented by different geometries. First, the DNA molecule was represented by small cylinders: 2 nm x 2 nm (∼10 bp), 5 nm x 10 nm (nucleosome) and 25 nm x 25 nm (chromatin fiber). All these cylinders were placed randomly in a sphere of liquid water (500 nm radius). Then we reconstructed the DNA

  20. Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

    Science.gov (United States)

    Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

    2018-06-01

    It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

  1. Direct Atomic Force Microscopy Observation of DNA Tile Crystal Growth at the Single-Molecule Level

    OpenAIRE

    Evans, Constantine G.; Hariadi, Rizal F.; Winfree, Erik

    2012-01-01

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detach...

  2. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  3. Direct atomic force microscopy observation of DNA tile crystal growth at the single-molecule level.

    Science.gov (United States)

    Evans, Constantine G; Hariadi, Rizal F; Winfree, Erik

    2012-06-27

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detachments. We show that these statistics fit the widely used kinetic Tile Assembly Model and demonstrate AFM movies as a viable technique for directly investigating DNA tile systems during growth rather than after assembly.

  4. Size distribution of DNA molecules recovered from non-denaturing filter elution

    International Nuclear Information System (INIS)

    Bloecher, D.; Iliakis, G.

    1991-01-01

    DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)

  5. Crystal structure of the gamma-2 herpesvirus LANA DNA binding domain identifies charged surface residues which impact viral latency.

    Directory of Open Access Journals (Sweden)

    Bruno Correia

    Full Text Available Latency-associated nuclear antigen (LANA mediates γ2-herpesvirus genome persistence and regulates transcription. We describe the crystal structure of the murine gammaherpesvirus-68 LANA C-terminal domain at 2.2 Å resolution. The structure reveals an alpha-beta fold that assembles as a dimer, reminiscent of Epstein-Barr virus EBNA1. A predicted DNA binding surface is present and opposite this interface is a positive electrostatic patch. Targeted DNA recognition substitutions eliminated DNA binding, while certain charged patch mutations reduced bromodomain protein, BRD4, binding. Virus containing LANA abolished for DNA binding was incapable of viable latent infection in mice. Virus with mutations at the charged patch periphery exhibited substantial deficiency in expansion of latent infection, while central region substitutions had little effect. This deficiency was independent of BRD4. These results elucidate the LANA DNA binding domain structure and reveal a unique charged region that exerts a critical role in viral latent infection, likely acting through a host cell protein(s.

  6. Neutralized ion beam modification of cellulose membranes for study of ion charge effect on ion-beam-induced DNA transfer

    Science.gov (United States)

    Prakrajang, K.; Sangwijit, K.; Anuntalabhochai, S.; Wanichapichart, P.; Yu, L. D.

    2012-02-01

    Low-energy ion beam biotechnology (IBBT) has recently been rapidly developed worldwide. Ion-beam-induced DNA transfer is one of the important applications of IBBT. However, mechanisms involved in this application are not yet well understood. In this study plasma-neutralized ion beam was applied to investigate ion charge effect on induction of DNA transfer. Argon ion beam at 7.5 keV was neutralized by RF-driven plasma in the beam path and then bombarded cellulose membranes which were used as the mimetic plant cell envelope. Electrical properties such as impedance and capacitance of the membranes were measured after the bombardment. An in vitro experiment on plasmid DNA transfer through the cellulose membrane was followed up. The results showed that the ion charge input played an important role in the impedance and capacitance changes which would affect DNA transfer. Generally speaking, neutral particle beam bombardment of biologic cells was more effective in inducing DNA transfer than charged ion beam bombardment.

  7. ZRBA1, a Mixed EGFR/DNA Targeting Molecule, Potentiates Radiation Response Through Delayed DNA Damage Repair Process in a Triple Negative Breast Cancer Model

    Energy Technology Data Exchange (ETDEWEB)

    Heravi, Mitra [Department of Human Genetics, McGill University, Montreal (Canada); Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Kumala, Slawomir [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Rachid, Zakaria; Jean-Claude, Bertrand J. [Cancer Drug Research Laboratory, McGill University Health Center, Montreal (Canada); Radzioch, Danuta [Department of Human Genetics, McGill University, Montreal (Canada); Muanza, Thierry M., E-mail: tmuanza@yahoo.com [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada)

    2015-06-01

    Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Western blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.

  8. Visualization of DNA double-strand break repair: From molecules to cells

    NARCIS (Netherlands)

    Krawczyk, Przemek M.; Stap, Jan; Aten, Jacob A.

    2008-01-01

    DNA double-strand break (DSB) signaling and repair processes are positioned at the crossroad of nuclear pathways that regulate DNA replication, cell division, senescence and apoptosis. Importantly, errors in DSB repair may lead to lethal or potentially tumorigenic chromosome rearrangements.

  9. Enzymatic determination of photoproducts in DNA molecules damaged by UV radiation

    Energy Technology Data Exchange (ETDEWEB)

    Kleibl, K; Brozmanova, J [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Ustav Experimentalnej Onkologie

    1981-01-01

    Two basic analytical procedures are described for the detection of photoproducts in UV-irradiated DNA. In the former, the selective release of thymine dimers of the cyclobutane type (TT) from the UV-irradiated DNA during excision repair can be measured by chromatographic analysis of radioactive DNA hydrolysis products. The technique allows studying TT irrespective of other products. It is only reliable for UV doses higher than 5 Jm/sup -2/. In the latter, a Micrococcus luteus extract containing specific enzymes, ie., endonucleases, for the repair of UV-induced damage of DNA is used for the enzyme determination of pyrimidine dimers. The endonucleotide analysis of DNA damage can be applied both in vitro and in vivo. In the in-vitro detection, the efficacy of photoproduct determination attains almost 100% while in the in-vivo detection it ranges between 30% and 70% in dependence on the method used. 31 references are given.

  10. A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

    Science.gov (United States)

    Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2017-11-17

    The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

  11. Adsorption and transport of charged vs. neutral hydrophobic molecules at the membrane of murine erythroleukemia (MEL) cells.

    Science.gov (United States)

    Zeng, Jia; Eckenrode, Heather M; Dai, Hai-Lung; Wilhelm, Michael J

    2015-03-01

    The adsorption and transport of hydrophobic molecules at the membrane surface of pre- and post-DMSO induced differentiated murine erythroleukemia (MEL) cells were examined by time- and wavelength-resolved second harmonic light scattering. Two medium (MEL cell, neutral BCP does not. It is suggested that an electrostatic interaction between the opposite charges of the cation and the MEL cell surface is the primary driving force for adsorption. Comparisons of adsorption density and free energy, measured at different pH and cell morphology, indicate that the interaction is predominantly through sialic acid carboxyl groups. MG cation adsorption densities have been determined as (0.6±0.3)×10(6) μm(-2) on the surface of undifferentiated MEL cells, and (1.8±0.5)×10(7) μm(-2) on differentiated MEL cells, while the deduced adsorption free energies are effectively identical (ca. -10.9±0.1 and -10.8±0.1 kcal mol(-1), respectively). The measured MG densities indicate that the total number of surface carboxyl groups is largely conserved following differentiation, and therefore the density of carboxylic groups is much larger on the differentiated cell surface than the undifferentiated one. Finally, in contrast to synthetic liposomes and bacterial membranes, surface adsorbed MG cations are unable to traverse the MEL cell membrane. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. A Molecular Dynamics-Quantum Mechanics Theoretical Study of DNA-Mediated Charge Transport in Hydrated Ionic Liquids.

    Science.gov (United States)

    Meng, Zhenyu; Kubar, Tomas; Mu, Yuguang; Shao, Fangwei

    2018-05-08

    Charge transport (CT) through biomolecules is of high significance in the research fields of biology, nanotechnology, and molecular devices. Inspired by our previous work that showed the binding of ionic liquid (IL) facilitated charge transport in duplex DNA, in silico simulation is a useful means to understand the microscopic mechanism of the facilitation phenomenon. Here molecular dynamics simulations (MD) of duplex DNA in water and hydrated ionic liquids were employed to explore the helical parameters. Principal component analysis was further applied to capture the subtle conformational changes of helical DNA upon different environmental impacts. Sequentially, CT rates were calculated by a QM/MM simulation of the flickering resonance model based upon MD trajectories. Herein, MD simulation illustrated that the binding of ionic liquids can restrain dynamic conformation and lower the on-site energy of the DNA base. Confined movement among the adjacent base pairs was highly related to the increase of electronic coupling among base pairs, which may lead DNA to a CT facilitated state. Sequentially combining MD and QM/MM analysis, the rational correlations among the binding modes, the conformational changes, and CT rates illustrated the facilitation effects from hydrated IL on DNA CT and supported a conformational-gating mechanism.

  13. Effect of polysaccharide capsule of the microalgae Staurastrum iversenii var. americanum on diffusion of charged and uncharged molecules, using EPR technique

    International Nuclear Information System (INIS)

    Freire-Nordi, Cristina S.; Nascimento, Otaciro R.; Vieira, Armando A.H.; Nakaie, Clovis R.

    2006-01-01

    The existence of a mucilaginous envelope, sheath or capsule is usual in many desmids, but few data concerning its function are available. Previous studies of the transport function and permeation of molecules through the algae capsules were done using the algae Spondylosium panduriforme and Nephrocytium lunatum, the Electron Paramagnetic Resonance (EPR) technique, and different spin labels. The results suggested that the capsule functions as a selective diffusion medium. In the present work charged and uncharged molecules (spin labels group A) and Staurastrum iversenii var. americanum (Desmids),whose alga presents a great mucilaginous capsule, were used. Charged nitroxide molecules similar to amino acids (spin labels group B) were also used allowing a better understanding of the electrostatic effect in the permeation process across the capsule. The role of the cell capsule in the solute diffusion was evaluated by determining the capsulated and decapsulated cell permeation times. The permeation times for all spin labels tested in the cells lacking capsules were always shorter than those containing this physical barrier. The decay times of spin labels group A observed for S. iversenii were compared to other studied algae. The results regarding the diffusion of charged spin labels group B suggested that the interaction of cell capsule occurs more strongly with negatively charged molecules than with positively charged ones. The results obtained in this work with spin labels group A confirm that the capsule is an essential structure for the cell, and that due to the polar interactions with the spin labels, it plays an important role in the selection of small molecules. Several parameters, mainly those of electrostatic nature, seem to control the permeation across the algal capsules of spin labels group B, showing that structures which are similar to amino acids could diffuse across the interior of the algal cell. (author)

  14. 77 FR 54584 - Final Action Under the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH...

    Science.gov (United States)

    2012-09-05

    ... changes. Human gene transfer also raises scientific, medical, social, and ethical considerations that... currently reviewed under Section III-B-1, Experiments Involving the Cloning of Toxin Molecules with LD50 of...

  15. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-01-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners

  16. Size and number of DNA molecules from Chinese hamster ovary cells determined by molecular autoradiography

    International Nuclear Information System (INIS)

    Todd, M.B.

    1980-06-01

    A new method for visualization of separable subunits of DNA is described. Autoradiography of tritium-labeled DNA from one or a few nuclei, lysed with detergent, moderate salt, and proteases, and gently deposited on a filter, allows determination of subunit molecular weight, size distribution, number per nucleus, and organization. The shape of the size distribution of CHO subunit images is similar to that of CHO mitotic chromosomes, and the numbers of subunits per nucleus supports a model of eight subunits per chromosome

  17. Translocation of DNA Molecules through Nanopores with Salt Gradients: The Role of Osmotic Flow

    Science.gov (United States)

    Hatlo, Marius M.; Panja, Debabrata; van Roij, René

    2011-08-01

    Recent experiments of translocation of double-stranded DNA through nanopores [M. Wanunu , Nature Nanotech. 5, 160 (2009)NNAABX1748-338710.1038/nnano.2009.379] reveal that the DNA capture rate can be significantly influenced by a salt gradient across the pore. We show that osmotic flow combined with electrophoretic effects can quantitatively explain the experimental data on the salt-gradient dependence of the capture rate.

  18. Ionisation of atoms, molecules and biomolecules by impact of multiply charged ions of high energy: classical and quantal comparison

    International Nuclear Information System (INIS)

    Abbas, I.

    2008-05-01

    We have developed a relatively simple model to calculate total cross-sections of various ionizing processes involving ion-atom or ion-molecule collisions. This model is based on the Zarour and Saalmann model and has benefited from 2 other models: the classical over-barrier (COB) model and the classical trajectory Monte-Carlo (CTMC) model. The COB model is used to describe the initial conditions of the target's electrons and their process us of creation while the CTMC model is used to build the statistical aspects necessary to calculate the cross sections of the ionizing processes. 3 major improvements have been brought to the Zarour and Saalmann model. First, the particle-particle interactions have been described by a Coulombian potential which is more realistic. Secondly, the initial conditions in the target are better represented by taking into account in an aleatory manner the position and speed distributions of the electrons. Thirdly, the use of energy criteria instead of purely geometrical ones to describe the final situation of the electrons has led to a better determination of the possible ionizing events. We have validated our model by applying it first, in collisional systems involving multi-charged projectiles like H + , He 2+ , Li 3+ , C 6+ , O 8+ and Ne 10+ and simple targets like H, He and H 2 , for which a lot of experimental data is available. Then, we have studied collisions involving the water molecule for which experimental and experimental data exist. Satisfactorily results for H 2 O target has led us to study other biological targets like adenine or cytosine. We have shown that our results are valid for impact energies over 100 keV/uma and most satisfactorily results concern simple ionizing processes like simple capture and simple ionization. For more complex processes such as transfer-ionization, double capture or double ionization, our results are valid for helium and hydrogen targets. In the case of water, the cross-sections of double

  19. Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2015-01-07

    Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

  20. Small molecule probes finely differentiate between various ds- and ss-DNA and RNA by fluorescence, CD and NMR response

    Energy Technology Data Exchange (ETDEWEB)

    Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)

    2016-10-12

    Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.

  1. Molecular dynamics simulation studies of radiation damaged DNA. Molecules and repair enzymes

    International Nuclear Information System (INIS)

    Pinak, Miroslav

    2004-12-01

    Molecular dynamics (MD) studies on several radiation damages to DNA and their recognition by repair enzymes are introduced in order to describe the stepwise description of molecular process observed at radiation lesion sites. MD studies were performed on pyrimidine (thymine dimer, thymine glycol) and purine (8-oxoguanine) lesions using an MD simulation code AMBER 5.0. The force field was modified for each lesion. In all cases the significant structural changes in the DNA double helical structure were observed; a) the breaking of hydrogen bond network between complementary bases and resulting opening of the double helix (8-oxoguanine); b) the sharp bending of the DNA helix centered at the lesion site (thymine dimer, thymine glycol); and c) the flipping-out base on the strand complementary to the lesion (8-oxoguanine). These changes were related to the overall collapsing double helical structure around the lesion and might facilitate the docking of the repair enzyme into the DNA and formation of DNA-enzyme complex. In addition to the structural changes, at lesion sites there were found electrostatic interaction energy values different from those at native sites (thymine dimer -10 kcal/mol, thymine glycol -26 kcal/mol, 8-oxoguanine -48 kcal/mol). These values of electrostatic energy may discriminate lesion from values at native sites (thymine 0 kcal/mol, guanine -37 kcal/mol) and enable a repair enzyme to recognize a lesion during scanning DNA surface. The observed specific structural conformation and energetic properties at the lesions sites are factors that guide a repair enzyme to discriminate lesions from non-damaged native DNA segments. (author)

  2. Study of Auger effect in DNA when bound to molecules containing platinum. A possible application to hadrontherapy

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr

    2003-01-01

    Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.

  3. Yields of clustered DNA damage induced by charged-particle radiations of similar kinetic energy per nucleon: LET dependence in different DNA microenvironments

    International Nuclear Information System (INIS)

    Keszenman, D.J.; Sutherland, B.M.

    2010-01-01

    To determine the linear energy transfer (LET) dependence of the biological effects of densely ionizing radiation in relation to changes in the ionization density along the track, we measured the yields and spectrum of clustered DNA damages induced by charged particles of different atomic number but similar kinetic energy per nucleon in different DNA microenvironments. Yeast DNA embedded in agarose in solutions of different free radical scavenging capacity was irradiated with 1 GeV protons, 1 GeV/nucleon oxygen ions, 980 MeV/nucleon titanium ions or 968 MeV/nucleon iron ions. The frequencies of double-strand breaks (DSBs), abasic sites and oxypurine clusters were quantified. The total DNA damage yields per absorbed dose induced in non-radioquenching solution decreased with LET, with minor variations in radioquenching conditions being detected. However, the total damage yields per particle fluence increased with LET in both conditions, indicating a higher efficiency per particle to induce clustered DNA damages. The yields of DSBs and non-DSB clusters as well as the damage spectra varied with LET and DNA milieu, suggesting the involvement of more than one mechanism in the formation of the different types of clustered damages.

  4. The Holographic Electron Density Theorem, de-quantization, re-quantization, and nuclear charge space extrapolations of the Universal Molecule Model

    Science.gov (United States)

    Mezey, Paul G.

    2017-11-01

    Two strongly related theorems on non-degenerate ground state electron densities serve as the basis of "Molecular Informatics". The Hohenberg-Kohn theorem is a statement on global molecular information, ensuring that the complete electron density contains the complete molecular information. However, the Holographic Electron Density Theorem states more: the local information present in each and every positive volume density fragment is already complete: the information in the fragment is equivalent to the complete molecular information. In other words, the complete molecular information provided by the Hohenberg-Kohn Theorem is already provided, in full, by any positive volume, otherwise arbitrarily small electron density fragment. In this contribution some of the consequences of the Holographic Electron Density Theorem are discussed within the framework of the "Nuclear Charge Space" and the Universal Molecule Model. In the Nuclear Charge Space" the nuclear charges are regarded as continuous variables, and in the more general Universal Molecule Model some other quantized parameteres are also allowed to become "de-quantized and then re-quantized, leading to interrelations among real molecules through abstract molecules. Here the specific role of the Holographic Electron Density Theorem is discussed within the above context.

  5. A self-consistent phase-field approach to implicit solvation of charged molecules with Poisson–Boltzmann electrostatics

    Science.gov (United States)

    Sun, Hui; Wen, Jiayi; Zhao, Yanxiang; Li, Bo; McCammon, J. Andrew

    2015-01-01

    Dielectric boundary based implicit-solvent models provide efficient descriptions of coarse-grained effects, particularly the electrostatic effect, of aqueous solvent. Recent years have seen the initial success of a new such model, variational implicit-solvent model (VISM) [Dzubiella, Swanson, and McCammon Phys. Rev. Lett. 96, 087802 (2006) and J. Chem. Phys. 124, 084905 (2006)], in capturing multiple dry and wet hydration states, describing the subtle electrostatic effect in hydrophobic interactions, and providing qualitatively good estimates of solvation free energies. Here, we develop a phase-field VISM to the solvation of charged molecules in aqueous solvent to include more flexibility. In this approach, a stable equilibrium molecular system is described by a phase field that takes one constant value in the solute region and a different constant value in the solvent region, and smoothly changes its value on a thin transition layer representing a smeared solute-solvent interface or dielectric boundary. Such a phase field minimizes an effective solvation free-energy functional that consists of the solute-solvent interfacial energy, solute-solvent van der Waals interaction energy, and electrostatic free energy described by the Poisson–Boltzmann theory. We apply our model and methods to the solvation of single ions, two parallel plates, and protein complexes BphC and p53/MDM2 to demonstrate the capability and efficiency of our approach at different levels. With a diffuse dielectric boundary, our new approach can describe the dielectric asymmetry in the solute-solvent interfacial region. Our theory is developed based on rigorous mathematical studies and is also connected to the Lum–Chandler–Weeks theory (1999). We discuss these connections and possible extensions of our theory and methods. PMID:26723595

  6. A self-consistent phase-field approach to implicit solvation of charged molecules with Poisson-Boltzmann electrostatics.

    Science.gov (United States)

    Sun, Hui; Wen, Jiayi; Zhao, Yanxiang; Li, Bo; McCammon, J Andrew

    2015-12-28

    Dielectric boundary based implicit-solvent models provide efficient descriptions of coarse-grained effects, particularly the electrostatic effect, of aqueous solvent. Recent years have seen the initial success of a new such model, variational implicit-solvent model (VISM) [Dzubiella, Swanson, and McCammon Phys. Rev. Lett. 96, 087802 (2006) and J. Chem. Phys. 124, 084905 (2006)], in capturing multiple dry and wet hydration states, describing the subtle electrostatic effect in hydrophobic interactions, and providing qualitatively good estimates of solvation free energies. Here, we develop a phase-field VISM to the solvation of charged molecules in aqueous solvent to include more flexibility. In this approach, a stable equilibrium molecular system is described by a phase field that takes one constant value in the solute region and a different constant value in the solvent region, and smoothly changes its value on a thin transition layer representing a smeared solute-solvent interface or dielectric boundary. Such a phase field minimizes an effective solvation free-energy functional that consists of the solute-solvent interfacial energy, solute-solvent van der Waals interaction energy, and electrostatic free energy described by the Poisson-Boltzmann theory. We apply our model and methods to the solvation of single ions, two parallel plates, and protein complexes BphC and p53/MDM2 to demonstrate the capability and efficiency of our approach at different levels. With a diffuse dielectric boundary, our new approach can describe the dielectric asymmetry in the solute-solvent interfacial region. Our theory is developed based on rigorous mathematical studies and is also connected to the Lum-Chandler-Weeks theory (1999). We discuss these connections and possible extensions of our theory and methods.

  7. A new fast algorithm for solving the minimum spanning tree problem based on DNA molecules computation.

    Science.gov (United States)

    Wang, Zhaocai; Huang, Dongmei; Meng, Huajun; Tang, Chengpei

    2013-10-01

    The minimum spanning tree (MST) problem is to find minimum edge connected subsets containing all the vertex of a given undirected graph. It is a vitally important NP-complete problem in graph theory and applied mathematics, having numerous real life applications. Moreover in previous studies, DNA molecular operations usually were used to solve NP-complete head-to-tail path search problems, rarely for NP-hard problems with multi-lateral path solutions result, such as the minimum spanning tree problem. In this paper, we present a new fast DNA algorithm for solving the MST problem using DNA molecular operations. For an undirected graph with n vertex and m edges, we reasonably design flexible length DNA strands representing the vertex and edges, take appropriate steps and get the solutions of the MST problem in proper length range and O(3m+n) time complexity. We extend the application of DNA molecular operations and simultaneity simplify the complexity of the computation. Results of computer simulative experiments show that the proposed method updates some of the best known values with very short time and that the proposed method provides a better performance with solution accuracy over existing algorithms. Copyright © 2013 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  8. Nanoconfinement-enhanced conformational response of single DNA molecules to changes in ionic environment

    DEFF Research Database (Denmark)

    Reisner, Walter; Beech, J. P.; Larsen, Niels Bent

    2007-01-01

    100×100 nm in dimension. Surprisingly, we find that the variation of the persistence length alone with ionic strength is not enough to explain our results. The effect is due mainly to increasing self-avoidance created by the reduced screening of electrostatic interactions at low ionic strength......We show that the ionic environment plays a critical role in determining the configurational properties of DNA confined in silica nanochannels. The extension of DNA in the nanochannels increases as the ionic strength is reduced, almost tripling over two decades in ionic strength for channels around....... To quantify the increase in self-avoidance, we introduce a new parameter into the de Gennes theory: an effective DNA width that gives the increase in the excluded volume due to electrostatic repulsion....

  9. Investigations of solution-processed charge generation unit with low concentration of small molecule doped in p-type/HAT-CN{sub 6} for tandem OLED

    Energy Technology Data Exchange (ETDEWEB)

    Talik, N.A., E-mail: azrina_talik@hotmail.com [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yeoh, K.H. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Centre for Photonics and Advanced Materials Research (CPR), Lee Kong Chian Faculty of Engineering and Science, University Tunku Abdul Rahman, 43000 Kajang, Selangor (Malaysia); Ng, C.Y.B. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Tan, C.Y. [Centre of Advanced Manufacturing & Material Processing (AMMP), Department of Mechanical Engineering, Faculty of Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yap, B.K., E-mail: kbyap@uniten.edu.my [Centre of Microelectronic and Nano Engineering (CeMNE), College of Engineering, Universiti Tenaga Nasional, 43000 Kajang, Selangor (Malaysia)

    2016-01-15

    We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN{sub 6} has been used for tandem OLED. • The improvement attributes to the lower V{sub bi} and larger ΔV{sub L} in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.

  10. Investigations of solution-processed charge generation unit with low concentration of small molecule doped in p-type/HAT-CN6 for tandem OLED

    International Nuclear Information System (INIS)

    Talik, N.A.; Yeoh, K.H.; Ng, C.Y.B.; Tan, C.Y.; Yap, B.K.

    2016-01-01

    We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN 6 has been used for tandem OLED. • The improvement attributes to the lower V bi and larger ΔV L in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.

  11. Biofunctionalization of zinc oxide nanowires for DNA sensory applications

    Directory of Open Access Journals (Sweden)

    Rudolph Bettina

    2011-01-01

    Full Text Available Abstract We report on the biofunctionalization of zinc oxide nanowires for the attachment of DNA target molecules on the nanowire surface. With the organosilane glycidyloxypropyltrimethoxysilane acting as a bifunctional linker, amino-modified capture molecule oligonucleotides have been immobilized on the nanowire surface. The dye-marked DNA molecules were detected via fluorescence microscopy, and our results reveal a successful attachment of DNA capture molecules onto the nanowire surface. The electrical field effect induced by the negatively charged attached DNA molecules should be able to control the electrical properties of the nanowires and gives way to a ZnO nanowire-based biosensing device.

  12. Synthetic models related to DNA-intercalating molecules. Interactions between 8-alkoxypsoralen and adenine

    International Nuclear Information System (INIS)

    Decout, J.L.; Lhomme, J.

    1983-01-01

    To investigate the interactions and the photoreactions between furocoumarins and adenine, compounds in which a psoralen molecule is linked by different polymethylene bridges have been synthesised. Ring-ring intramolecular interactions are observed by UV spectroscopy. Thermodynamic parameters of these hydrophobic interactions are determined by the study of the variation of the hypochromic effect with temperature. (author)

  13. Integrated view of genome structure and sequence of a single DNA molecule in a nanofluidic device

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; L. V. Bauer, David

    2013-01-01

    as well as unique structural variation. Following its mapping, a molecule of interest was rescued fromthe chip;amplified and localized to a chromosome by FISH; and interrogated down to 1-bp resolution with a commercial sequencer, thereby reconciling haplotype-phased chromosome substructure with sequence....

  14. Investigation of multi-state charge-storage properties of redox-active organic molecules in silicon-molecular hybrid devices for DRAM and Flash applications

    Science.gov (United States)

    Gowda, Srivardhan Shivappa

    Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was

  15. Light of DNA-alkylating agents in castration-resistant prostate cancer cells: a novel mixed EGFR/DNA targeting combi-molecule.

    Science.gov (United States)

    Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang

    2017-01-01

    The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.

  16. Theoretical and experimental study of charge transfer through DNA: impact of mercury mediated T-Hg-T base pair

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Golan, Martin; Vala, M.; Špérová, M.; Weiter, M.; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír; Tanaka, Y.; Bickelhaupt, F.M.

    2014-01-01

    Roč. 118, č. 20 (2014), s. 5374-5381 ISSN 1520-6106 R&D Projects: GA TA ČR TA01011165; GA ČR(CZ) GA14-10279S; GA ČR GA13-26526S Institutional support: RVO:68378271 ; RVO:61388963 Keywords : charge transfer in DNA-Hg complexes * steady state fluorescence spectroscopy * density functional theory * electronic properties of biomolecules Subject RIV: BO - Biophysics Impact factor: 3.302, year: 2014

  17. Theoretical and experimental study of charge transfer through DNA: Impact of mercury attached to mismatched base pairs

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Golan, Martin; Vala, M.; Špérová, M.; Weiter, M.; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír

    2014-01-01

    Roč. 21, č. 1 (2014), s. 16 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /12./. 13.03.2014-15.03.2014, Nové Hrady] Institutional support: RVO:61388963 ; RVO:68378271 Keywords : metallo-DNA * T-Hg-T * steady-state fluorescence * charge transfer Subject RIV: CF - Physical ; Theoretical Chemistry

  18. DNA: The Molecule of Life. A Multimedia CD-ROM. [CD-ROM].

    Science.gov (United States)

    2001

    This CD-ROM is designed for classroom and individual use to teach and learn about DNA. Integrated animations, custom graphics, three-dimensional representations, photographs, and sound are featured for use in user-controlled activities. Interactive lessons are available to reinforce the subject material. Pre- and post-testing sections are also…

  19. True single-molecule DNA sequencing of a pleistocene horse bone

    DEFF Research Database (Denmark)

    Orlando, Ludovic Antoine Alexandre; Ginolhac, Aurélien; Raghavan, Maanasa

    2011-01-01

    -preserved Pleistocene horse bone using the Helicos HeliScope and Illumina GAIIx platforms, respectively. We find that the percentage of endogenous DNA sequences derived from the horse is higher among the Helicos data than Illumina data. This result indicates that the molecular biology tools used to generate sequencing...

  20. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  1. Charge Enhancement of Single-Stranded DNA in Negative Electrospray Ionization Using the Supercharging Reagent Meta-nitrobenzyl Alcohol

    Science.gov (United States)

    Brahim, Bessem; Alves, Sandra; Cole, Richard B.; Tabet, Jean-Claude

    2013-12-01

    Charge enhancement of single-stranded oligonucleotide ions in negative ESI mode is investigated. The employed reagent, meta-nitrobenzyl alcohol (m-NBA), was found to improve total signal intensity (Itot), increase the highest observed charge states (zhigh), and raise the average charge states (zavg) of all tested oligonucleotides analyzed in negative ESI. To quantify these increases, signal enhancement ratios (SER1%) and charge enhancement coefficients (CEC1%) were introduced. The SER1%, (defined as the quotient of total oligonucleotide ion abundances with 1 % m-NBA divided by total oligonucleotide abundance without m-NBA) was found to be greater than unity for every oligonucleotide tested. The CEC1% values (defined as the average charge state in the presence of 1 % m-NBA minus the average charge state in the absence of m-NBA) were found to be uniformly positive. Upon close inspection, the degree of charge enhancement for longer oligonucleotides was found to be dependent upon thymine density (i.e., the number and the location of phospho-thymidine units). A correlation between the charge enhancement induced by the presence of m-NBA and the apparent gas-phase acidity (largely determined by the sequence of thymine units but also by the presence of protons on other nucleobases) of multiply deprotonated oligonucleotide species, was thus established. Ammonium cations appeared to be directly involved in the m-NBA supercharging mechanism, and their role seems to be consistent with previously postulated ESI mechanisms describing desorption/ionization of single-stranded DNA into the gas phase.

  2. Investigation of sliding DNA clamp dynamics by single-molecule fluorescence, mass spectrometry and structure-based modeling

    Science.gov (United States)

    Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai

    2018-01-01

    Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283

  3. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.

    Science.gov (United States)

    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth

    2012-09-01

    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound.

  4. Interactive measurement and characterization of DNA molecules by analysis of AFM images

    Czech Academy of Sciences Publication Activity Database

    Marek, J.; Demjénová, E.; Tomori, Z.; Janáček, Jiří; Zolotová, I.; Valle, F.; Favre, M.; Dietler, G.

    2005-01-01

    Roč. 63, č. 2 (2005), s. 87-93 ISSN 1552-4922 Grant - others:VEGA(SK) 5048; VEGA(SK) 2185; CZ-SK(CZ) KONTAKT 139; Swiss National Science Foundation(CH) 2100-063746.00/1 Institutional research plan: CEZ:AV0Z5011922 Keywords : DNA * atomic force microscopy * interactive image analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.115, year: 2005

  5. Function of the UVR marker in dark repair of DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Sedliakova, M; Brozmanova, J; Slezarikova, V; Masek, F; Fandlova, E [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Vyskumny Ustav Onkologicky

    1975-01-01

    It was found earlier that the excision repair mechanism in Escherichia coli B/r Hcr/sup +/ could be depressed by pre-irradiation, amino acid and thymine starvation; such interference proved to have no appreciable influence on survival after ultraviolet irradiation. A comparison between Hcr/sup +/ and Hcr/sup -/ cells revealed that the former were capable of tolerating a greater amount of unexcised dimers than the latter. It is demonstrated in this paper that the above-mentioned pretreatment will depress excision activity also in cultures of E. coli K12 and E. coli 15T, both strains of the uvr/sup +/ rec/sup +/ genotype. A comparison of two E. coli K12 strains of the uvr/sup +/ and uvr/sup -/ genotype shows that uvr/sup +/ cells also have a greater capacity to tolerate unexcised dimers. To throw light on the nature of the increased capacity to tolerate unexcised dimers the restoration of DNA daughter chains in cells of the uvr/sup +/ and uvr/sup -/ genotype was compared and it was found that the integrity of uvr loci is a conditio sine qua non for an effective restoration of daughter chains, but that depression of excision activity by the mentioned pretreatment does not influence the restoration of DNA daughter chains. This suggests that uvr loci are involved not only in excision but also in the post-replication mechanism of DNA repair.

  6. Optimized assembly and covalent coupling of single-molecule DNA origami nanoarrays.

    Science.gov (United States)

    Gopinath, Ashwin; Rothemund, Paul W K

    2014-12-23

    Artificial DNA nanostructures, such as DNA origami, have great potential as templates for the bottom-up fabrication of both biological and nonbiological nanodevices at a resolution unachievable by conventional top-down approaches. However, because origami are synthesized in solution, origami-templated devices cannot easily be studied or integrated into larger on-chip architectures. Electrostatic self-assembly of origami onto lithographically defined binding sites on Si/SiO2 substrates has been achieved, but conditions for optimal assembly have not been characterized, and the method requires high Mg2+ concentrations at which most devices aggregate. We present a quantitative study of parameters affecting origami placement, reproducibly achieving single-origami binding at 94±4% of sites, with 90% of these origami having an orientation within ±10° of their target orientation. Further, we introduce two techniques for converting electrostatic DNA-surface bonds to covalent bonds, allowing origami arrays to be used under a wide variety of Mg2+-free solution conditions.

  7. Aptamer-conjugated DNA nano-ring as the carrier of drug molecules

    Science.gov (United States)

    Srivithya, Vellampatti; Roun, Heo; Sekhar Babu, Mitta; Hyung, Park Jae; Ha, Park Sung

    2018-03-01

    Due to its predictable self-assembly and structural stability, structural DNA nanotechnology is considered one of the main interdisciplinary subjects encompassing conventional nanotechnology and biotechnology. Here we have fabricated the mucin aptamer (MUC1)˗conjugated DNA nano˗ring intercalated with doxorubicin (DNRA˗DOX) as potential therapeutics for breast cancer. DNRA˗DOX exhibited significantly higher cytotoxicity to the MCF˗7 breast cancer cells than the controls, including DOX alone and the aptamer deficient DNA nano˗ring (DNR) with doxorubicin. Interactions between DOX and DNRA were studied using spectrophotometric measurements. Dose-dependent cytotoxicity was performed to prove that both DNR and DNRA were non-toxic to the cells. The drug release profile showed a controlled release of DOX at normal physiological pH 7.4, with approximately 61% released, but when exposed to lysosomal of pH 5.5, the corresponding 95% was released within 48 h. Owing to the presence of the aptamer, DNRA˗DOX was effectively taken up by the cancer cells, as confirmed by confocal microscopy, implying that it has potential for use in targeted drug delivery.

  8. Nanoscale charge localization induced by random orientations of organic molecules in hybrid perovskite CH3NH3PbI3

    Science.gov (United States)

    Ma, Jie; Wang, Lin-Wang

    2015-03-01

    Perovskite-based solar cells have achieved high solar-energy conversion efficiencies and attracted wide attentions nowadays. Despite the rapid progress in solar-cell devices, many fundamental issues of the hybrid perovskites have not been fully understood. Experimentally, it is well known that in CH3NH3PbI3, the organic molecules CH3NH3 are randomly orientated at the room temperature, but the impact of the random molecular orientation has not been investigated. Using linear-scaling ab-initiomethods, we have calculated the electronic structures of the tetragonal phase of CH3NH3PbI3 with randomly orientated organic molecules in large supercells up to ~20,000 atoms. Due to the dipole moment of the organic molecule, the random orientation creates a novel system with long-range potential fluctuations unlike alloys or other conventional disordered systems. We find that the charge densities of the conduction-band minimum and the valence-band maximum are localized separately in nanoscales due to the potential fluctuations. The charge localization causes electron-hole separation and reduces carrier recombination rates, which may contribute to the long carrier lifetime observed in experiments. We have also proposed a model to explain the charge localization.

  9. The effect of environmental factors on the electrical conductivity of a single oligo-DNA molecule measured using single-walled carbon nanotube nanoelectrodes

    International Nuclear Information System (INIS)

    Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon

    2008-01-01

    We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations

  10. Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

    Energy Technology Data Exchange (ETDEWEB)

    Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)

    2016-05-01

    Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.

  11. A DNA-Mediated Homogeneous Binding Assay for Proteins and Small Molecules

    DEFF Research Database (Denmark)

    Zhang, Zhao; Hejesen, Christian; Kjelstrup, Michael Brøndum

    2014-01-01

    . The shift occurs upon binding of a protein, for example, an antibody to its target. We demonstrate nanomolar detection of small molecules such as biotin, digoxigenin, vitamin D, and folate, in buffer and in plasma. The method is flexible, and we also show nanomolar detection of the respective antibodies......Optical detection of molecular targets typically requires immobilization, separation, or chemical or enzymatic processing. An important exception is aptamers that allow optical detection in solution based on conformational changes. This method, however, requires the laborious selection of aptamers...

  12. Thermodynamics on Soluble Carbon Nanotubes: How Do DNA Molecules Replace Surfactants on Carbon Nanotubes?

    Science.gov (United States)

    Kato, Yuichi; Inoue, Ayaka; Niidome, Yasuro; Nakashima, Naotoshi

    2012-01-01

    Here we represent thermodynamics on soluble carbon nanotubes that enables deep understanding the interactions between single-walled carbon nanotubes (SWNTs) and molecules. We selected sodium cholate and single-stranded cytosine oligo-DNAs (dCn (n = 4, 5, 6, 7, 8, 10, 15, and 20)), both of which are typical SWNT solubilizers, and successfully determined thermodynamic properties (ΔG, ΔH and ΔS values) for the exchange reactions of sodium cholate on four different chiralities of SWNTs ((n,m) = (6,5), (7,5), (10,2), and (8,6)) for the DNAs. Typical results contain i) the dC5 exhibited an exothermic exchange, whereas the dC6, 8, 10, 15, and 20 materials exhibited endothermic exchanges, and ii) the energetics of the dC4 and dC7 exchanges depended on the associated chiral indices and could be endothermic or exothermic. The presented method is general and is applicable to any molecule that interacts with nanotubes. The study opens a way for science of carbon nanotube thermodynamics. PMID:23066502

  13. Investigation of the charge effect on the electrochemical transduction in a quinone-based DNA sensor

    DEFF Research Database (Denmark)

    Reisberg, S.; Piro, B.; Noel, V.

    2008-01-01

    To elucidate the mechanism involved in the electrochemical transduction process of a conducting polymer-based DNA sensor, peptide nucleic acids (PNA) were used. PNA are DNA analogues having similar hybridization properties but are neutral. This allows to discriminate the electrostatic effect of D...... strands from the steric hindrance generated on the bioelectrode upon hybridization. It can be concluded that DNA conformational changes are determinant in the transduction process and that the electrostatic effect is negligible....

  14. Quantitative PCR--new diagnostic tool for quantifying specific mRNA and DNA molecules

    DEFF Research Database (Denmark)

    Schlemmer, B O; Sorensen, B S; Overgaard, J

    2004-01-01

    of a subset of ligands from the EGF system is increased in bladder cancer. Furthermore, measurement of the mRNA concentration gives important information such as the expression of these ligands correlated to the survival of the patients. In addition to the alterations at the mRNA level, changes also can occur...... at the DNA level in the EGF system. Thus, it has been demonstrated that the number of genes coding for the human epidermal growth factor receptor 2 (HER2) is increased in a number of breast tumors. It is now possible to treat breast cancer patients with a humanized antibody reacting with HER2...... of mRNA or DNA in biological samples. In this study quantitative PCR was used to investigate the role of the EGF (epidermal growth factor) system in cancer both for measurements of mRNA concentrations and for measurements of the number of copies of specific genes. It is shown that the mRNA expression...

  15. Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

    Science.gov (United States)

    Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

    2013-07-01

    The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.

  16. Xeroderma pigmentosum and other diseases of human premature aging and DNA repair: Molecules to patients

    Science.gov (United States)

    Niedernhofer, Laura J.; Bohr, Vilhelm A.; Sander, Miriam; Kraemer, Kenneth H.

    2012-01-01

    A workshop1 to share, consider and discuss the latest developments in understanding xeroderma pigmentosum and other human diseases caused by defects in nucleotide excision repair (NER) of DNA damage was held on September 21–24, 2010 in Virginia. It was attended by approximately 100 researchers and clinicians, as well as several patients and representatives of patient support groups. This was the third in a series of workshops with similar design and goals: to emphasize discussion and interaction among participants as well as open exchange of information and ideas. The participation of patients, their parents and physicians was an important feature of this and the preceding two workshops. Topics discussed included the natural history and clinical features of the diseases, clinical and laboratory diagnosis of these rare diseases, therapeutic strategies, mouse models of neurodegeneration, molecular analysis of accelerated aging, impact of transcriptional defects and mitochondrial dysfunction on neurodegeneration, and biochemical insights into mechanisms of NER and base excision repair. PMID:21708183

  17. Depletion-induced instability in protein-DNA mixtures: Influence of protein charge and size

    NARCIS (Netherlands)

    Vries, de R.J.

    2006-01-01

    While there is abundant experimental and theoretical work on polymer-induced DNA condensation, it is still unclear whether globular proteins can condense linear DNA or not. We develop a simple analytical approximation for the depletion attraction between rodlike segments of semiflexible

  18. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    International Nuclear Information System (INIS)

    Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui

    2011-01-01

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  19. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2011-01-24

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  20. DFT calculations of the charged states of N@C60 and Fe4 single molecule magnets investigated in tunneling spectroscopy

    Science.gov (United States)

    Nossa, Javier; Islam, Fhokrul; Canali, Carlo; Pederson, Mark

    2012-02-01

    For device applications of single molecule magnets (SMMs) in high-density information storage and quantum-state control it is essential that the magnetic properties of the molecules remain stable under the influence of metallic contacts or surface environment. Recent tunneling experiments [1, 2] on N@C60 and Fe4 SMM have shown that these molecules preserve their magnetic characteristics when they are used as the central island of single-electron transistors. Although quantum spin models have been used extensively to study theoretically tunneling spectroscopy of SMMs, it has been shown recently that the orbital degrees of freedom, which is absent in spin models, can significantly affect the tunneling conductance [3]. In this work we present first-principles calculations of the neutral and charged states of N@C60 and Fe4 SMMs, and discuss a strategy to include their properties into a theory of quantum transport. We also present results of the magnetic anisotropy for the different charge states of Fe4 and discuss their relevance for experiments [2] in the sequential tunneling and cotunnelling regimes. [4pt] [1]. N. Roch et al., Phys. Rev. B 83, 081407 (2011). [0pt] [2]. A.S. Zyazin et al., Nano Lett. 10, 3307 (2010). [0pt] [3]. L. Michalak et al., Phys. Rev. Lett. 104, 017202 (2010).

  1. Computational Characterization of Small Molecules Binding to the Human XPF Active Site and Virtual Screening to Identify Potential New DNA Repair Inhibitors Targeting the ERCC1-XPF Endonuclease

    Directory of Open Access Journals (Sweden)

    Francesco Gentile

    2018-04-01

    Full Text Available The DNA excision repair protein ERCC-1-DNA repair endonuclease XPF (ERCC1-XPF is a heterodimeric endonuclease essential for the nucleotide excision repair (NER DNA repair pathway. Although its activity is required to maintain genome integrity in healthy cells, ERCC1-XPF can counteract the effect of DNA-damaging therapies such as platinum-based chemotherapy in cancer cells. Therefore, a promising approach to enhance the effect of these therapies is to combine their use with small molecules, which can inhibit the repair mechanisms in cancer cells. Currently, there are no structures available for the catalytic site of the human ERCC1-XPF, which performs the metal-mediated cleavage of a DNA damaged strand at 5′. We adopted a homology modeling strategy to build a structural model of the human XPF nuclease domain which contained the active site and to extract dominant conformations of the domain using molecular dynamics simulations followed by clustering of the trajectory. We investigated the binding modes of known small molecule inhibitors targeting the active site to build a pharmacophore model. We then performed a virtual screening of the ZINC Is Not Commercial 15 (ZINC15 database to identify new ERCC1-XPF endonuclease inhibitors. Our work provides structural insights regarding the binding mode of small molecules targeting the ERCC1-XPF active site that can be used to rationally optimize such compounds. We also propose a set of new potential DNA repair inhibitors to be considered for combination cancer therapy strategies.

  2. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    Science.gov (United States)

    Spencer, J.; Gajdos, F.; Blumberger, J.

    2016-08-01

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  3. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    Energy Technology Data Exchange (ETDEWEB)

    Spencer, J.; Gajdos, F.; Blumberger, J., E-mail: j.blumberger@ucl.ac.uk [Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)

    2016-08-14

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  4. Adsorption behavior of n-butanol molecules on negatively charged surfaces of electrodes of mercury, gallium, and alloys In-Ga and Tl-Ga

    International Nuclear Information System (INIS)

    Damskin, B.B.; Baturina, O.A.; Vasil'ev, S.Yu.; Emets, V.V.; Kazarinov, V.E.

    1999-01-01

    Curves of differential capacitance in the interfaces Hg/H 2 O, Ga/H 2 O, (In-Ga)/H 2 O and (Tl-Ga)H 2 O in 0.05 M Na 2 SO 4 solutions with different additions of n-butanol have been obtained by the bridge method at a frequency of 420 Hz and temperature of 32 deg C. The method of regression analysis of the curves permitted ascertaining the adsorption parameters of n-butanol for the range of charges q, where there is no chemisorption of H 2 O dipoles. The data obtained suggested that the difference in the adsorption behaviour of organic molecules on the metals studied in the range of higher negative charges is largely determined by different electron electrochemical work functions, the definition being given by S. Trasatti [ru

  5. Microneedle arrays coated with charge reversal pH-sensitive copolymers improve antigen presenting cells-homing DNA vaccine delivery and immune responses.

    Science.gov (United States)

    Duong, Huu Thuy Trang; Kim, Nak Won; Thambi, Thavasyappan; Giang Phan, V H; Lee, Min Sang; Yin, Yue; Jeong, Ji Hoon; Lee, Doo Sung

    2018-01-10

    Successful delivery of a DNA vaccine to antigen-presenting cells and their subsequent stimulation of CD4 + and CD8 + T cell immunity remains an inefficient process. In general, the delivery of prophylactic vaccines is mainly mired by low transfection efficacy, poor immunogenicity, and safety issues from the materials employed. Currently, several strategies have been exploited to improve immunogenicity, but an effective strategy for safe and pain-free delivery of DNA vaccines is complicated. Herein, we report the rapid delivery of polyplex-based DNA vaccines using microneedle arrays coated with a polyelectrolyte multilayer assembly of charge reversal pH-responsive copolymer and heparin. The charge reversal pH-responsive copolymer, composed of oligo(sulfamethazine)-b-poly(ethylene glycol)-b-poly(amino urethane) (OSM-b-PEG-b-PAEU), was used as a triggering layer in the polyelectrolyte multilayer assembly on microneedles. Charge reversal characteristics of this copolymer, that is, the OSM-b-PEG-b-PAEU copolymer exhibit, positive charge at low pH (pH4.03) and becoming negative charge when exposed to physiological pH conditions (pH7.4), allowing the facile assembly and disassembly of polyelectrolyte multilayers. The electrostatic repulsion between heparin and OSM-b-PEG-b-PAEU charge reversal copolymer triggered the release of DNA vaccines. DNA vaccines laden on microneedles are effectively transfected into RAW 264.7 macrophage cells in vitro. Vaccination of BALB/c mice by DNA vaccine-loaded microneedle arrays coated with a polyelectrolyte multilayer generated antigen-specific robust immune responses. These findings provide potential strategy of charge reversal pH-responsive copolymers coated microneedles for DNA vaccine delivery. Copyright © 2017. Published by Elsevier B.V.

  6. Image charge effects in single-molecule junctions: Breaking of symmetries and negative-differential resistance in a benzene single-electron transistor

    DEFF Research Database (Denmark)

    Kaasbjerg, Kristen; Flensberg, K.

    2011-01-01

    and molecular symmetries remain unclear. Using a theoretical framework developed for semiconductor-nanostructure-based single-electron transistors (SETs), we demonstrate that the image charge interaction breaks the molecular symmetries in a benzene-based single-molecule transistor operating in the Coulomb...... blockade regime. This results in the appearance of a so-called blocking state, which gives rise to negative-differential resistance (NDR). We show that the appearance of NDR and its magnitude in the symmetry-broken benzene SET depends in a complicated way on the interplay between the many-body matrix...

  7. Partition coefficients of methylated DNA bases obtained from free energy calculations with molecular electron density derived atomic charges.

    Science.gov (United States)

    Lara, A; Riquelme, M; Vöhringer-Martinez, E

    2018-05-11

    Partition coefficients serve in various areas as pharmacology and environmental sciences to predict the hydrophobicity of different substances. Recently, they have also been used to address the accuracy of force fields for various organic compounds and specifically the methylated DNA bases. In this study, atomic charges were derived by different partitioning methods (Hirshfeld and Minimal Basis Iterative Stockholder) directly from the electron density obtained by electronic structure calculations in a vacuum, with an implicit solvation model or with explicit solvation taking the dynamics of the solute and the solvent into account. To test the ability of these charges to describe electrostatic interactions in force fields for condensed phases, the original atomic charges of the AMBER99 force field were replaced with the new atomic charges and combined with different solvent models to obtain the hydration and chloroform solvation free energies by molecular dynamics simulations. Chloroform-water partition coefficients derived from the obtained free energies were compared to experimental and previously reported values obtained with the GAFF or the AMBER-99 force field. The results show that good agreement with experimental data is obtained when the polarization of the electron density by the solvent has been taken into account, and when the energy needed to polarize the electron density of the solute has been considered in the transfer free energy. These results were further confirmed by hydration free energies of polar and aromatic amino acid side chain analogs. Comparison of the two partitioning methods, Hirshfeld-I and Minimal Basis Iterative Stockholder (MBIS), revealed some deficiencies in the Hirshfeld-I method related to the unstable isolated anionic nitrogen pro-atom used in the method. Hydration free energies and partitioning coefficients obtained with atomic charges from the MBIS partitioning method accounting for polarization by the implicit solvation model

  8. Production of gamma induced reactive oxygen species and damage of DNA molecule in HaCaT cells under euoxic and hypoxic condition

    International Nuclear Information System (INIS)

    Joseph, P.; Bhat, N.N.; Copplestone, D.; Narayana, Y.

    2014-01-01

    The paper deals with the study of gamma radiation induced reactive oxygen species (ROS) generation in normal human keratinocytes (HaCaT) cells and quantification of subsequent damages induced on DNA molecules. The DNA damages induced in cells after gamma irradiation has been analyzed using Alkaline comet assay. The ROS produced in the cells were quantified by measuring fluorescence after loading the cells with 2', 7' dichlorofluorescin diacetate, a dye that is oxidized into a highly fluorescent form in the presence of peroxides. Studies reveal that in HaCaT cells radical generation occurs when exposed to ionizing radiation and it increases with dose. The induced DNA damages also increases with dose and ROS generation. The study clearly shows the importance of ROS in DNA damage induction and the cells possessing elevated levels of DNA damage after radiation exposure is due to the effect of increased levels of intracellular ROS. (author)

  9. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  10. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  11. RADAMOL tool: Role of radiation quality and charge transfer in damage distribution along DNA oligomer

    Czech Academy of Sciences Publication Activity Database

    Štěpán, Václav; Davídková, Marie

    2014-01-01

    Roč. 68, č. 8 (2014), s. 240-247 ISSN 1434-6060 R&D Projects: GA MŠk LD12008; GA MŠk MP1002 Nano-IBCT Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:61389005 Keywords : radiation damage * ionizations * DNA Subject RIV: BO - Biophysics Impact factor: 1.228, year: 2014

  12. The Impact of Molecular p-Doping on Charge Transport in High-Mobility Small-Molecule/Polymer Blend Organic Transistors

    KAUST Repository

    Paterson, Alexandra F.

    2017-12-27

    Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.

  13. The Impact of Molecular p-Doping on Charge Transport in High-Mobility Small-Molecule/Polymer Blend Organic Transistors

    KAUST Repository

    Paterson, Alexandra F.; Lin, Yen-Hung; Mottram, Alexander D.; Fei, Zhuping; Niazi, Muhammad Rizwan; Kirmani, Ahmad R.; Amassian, Aram; Solomeshch, Olga; Tessler, Nir; Heeney, Martin; Anthopoulos, Thomas D.

    2017-01-01

    Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.

  14. Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands

    Directory of Open Access Journals (Sweden)

    Lindy L. Esterhuizen

    2012-09-01

    Full Text Available The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component or bipartite (two circular ssDNA components called DNA-A and DNA-B, many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-as or betasatellites (DNA-βs. Additionally, subgenomic molecules, also known as defective interfering (DIs DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world.

  15. Redox-Active Star Molecules Incorporating the 4-Benzoylpyridinium Cation - Implications for the Charge Transfer Along Branches vs. Across the Perimeter in Dendrimer

    Science.gov (United States)

    Leventis, Nicholas; Yang, Jinua; Fabrizio,Even F.; Rawashdeh, Abdel-Monem M.; Oh, Woon Su; Sotiriou-Leventis, Chariklia

    2004-01-01

    Dendrimers are self-repeating globular branched star molecules, whose fractal structure continues to fascinate, challenge, and inspire. Functional dendrimers may incorporate redox centers, and potential applications include antennae molecules for light harvesting, sensors, mediators, and artificial biomolecules. We report the synthesis and redox properties of four star systems incorporating the 4-benzoyl-N-alkylpyridinium cation; the redox potential varies along the branches but remains constant at fixed radii. Bulk electrolysis shows that at a semi-infinite time scale all redox centers are electrochemically accessible. However, voltammetric analysis (cyclic voltammetry and differential pulse voltammetry) shows that on1y two of the three redox-active centers in the perimeter are electrochemically accessible during potential sweeps as slow as 20 mV/s and as fast as 10 V/s. On the contrary, both redox centers along branches are accessible electrochemically within the same time frame. These results are explained in terms of slow through-space charge transfer and the globular 3-D folding of the molecules and are discussed in terms of their implications on the design of efficient redox functional dendrimers.

  16. Evidences from electron momentum spectroscopy for ultra-fast charge transfers and structural reorganizations in a floppy molecule: Ethanol

    International Nuclear Information System (INIS)

    Deleuze, Michael S; Hajgato, Balazs; Morini, Filippo

    2009-01-01

    Calculations of electron momentum distributions employing advanced Dyson orbital theories and statistical thermodynamics beyond the RRHO approximation fail to quantitatively reproduce the outermost momentum profile inferred from experiments on ethanol employing high resolution Electron Momentum Spectroscopy [1]. Study of the influence of nuclear dynamics in the initial ground state and final ionized state indicates that this discrepancy between theory and experiment reflects a charge transfer occurring during an ultra-fast dissociation of the ethanol radical cation into a methyl radical and H 2 C=O-H + .

  17. Probing DNA interactions with proteins using a single-molecule toolbox: inside the cell, in a test tube and in a computer.

    Science.gov (United States)

    Wollman, Adam J M; Miller, Helen; Zhou, Zhaokun; Leake, Mark C

    2015-04-01

    DNA-interacting proteins have roles in multiple processes, many operating as molecular machines which undergo dynamic meta-stable transitions to bring about their biological function. To fully understand this molecular heterogeneity, DNA and the proteins that bind to it must ideally be interrogated at a single molecule level in their native in vivo environments, in a time-resolved manner, fast enough to sample the molecular transitions across the free-energy landscape. Progress has been made over the past decade in utilizing cutting-edge tools of the physical sciences to address challenging biological questions concerning the function and modes of action of several different proteins which bind to DNA. These physiologically relevant assays are technically challenging but can be complemented by powerful and often more tractable in vitro experiments which confer advantages of the chemical environment with enhanced detection signal-to-noise of molecular signatures and transition events. In the present paper, we discuss a range of techniques we have developed to monitor DNA-protein interactions in vivo, in vitro and in silico. These include bespoke single-molecule fluorescence microscopy techniques to elucidate the architecture and dynamics of the bacterial replisome and the structural maintenance of bacterial chromosomes, as well as new computational tools to extract single-molecule molecular signatures from live cells to monitor stoichiometry, spatial localization and mobility in living cells. We also discuss recent developments from our laboratory made in vitro, complementing these in vivo studies, which combine optical and magnetic tweezers to manipulate and image single molecules of DNA, with and without bound protein, in a new super-resolution fluorescence microscope.

  18. Discrete and continuum modeling of solvent effects in a twisted intramolecular charge transfer system: The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule.

    Science.gov (United States)

    Modesto-Costa, Lucas; Borges, Itamar

    2018-08-05

    The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule is a prototypical system displaying twisted intramolecular (TICT) charge transfer effects. The ground and the first four electronic excited states (S 1 -S 4 ) in gas phase and upon solvation were studied. Charge transfer values as function of the torsion angle between the donor group (dimethylamine) and the acceptor moiety (benzonitrile) were explicitly computed. Potential energy curves were also obtained. The algebraic diagrammatic construction method at the second-order [ADC(2)] ab initio wave function was employed. Three solvents of increased polarities (benzene, DMSO and water) were investigated using discrete (average solvent electrostatic configuration - ASEC) and continuum (conductor-like screening model - COSMO) models. The results for the S 3 and S 4 excited states and the S 1 -S 4 charge transfer curves were not previously available in the literature. Electronic gas phase and solvent vertical spectra are in good agreement with previous theoretical and experimental results. In the twisted (90°) geometry the optical oscillator strengths have negligible values even for the S 2 bright state. Potential energy curves show two distinct pairs of curves intersecting at decreasing angles or not crossing in the more polar solvents. Charge transfer and electric dipole values allowed the rationalization of these results. The former effects are mostly independent of the solvent model and polarity. Although COSMO and ASEC solvent models mostly lead to similar results, there is an important difference: some crossings of the excitation energy curves appear only in the ASEC solvation model, which has important implications to the photochemistry of DMABN. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Conductivity of natural and modified DNA measured by scanning tunneling microscopy. The effect of sequence, charge and stacking

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Král, Karel; Bunček, M.; Víšková, A.; Nešpůrek, Stanislav; Kochalska, Anna; Todorciuc, Tatiana; Weiter, M.; Schneider, Bohdan

    2008-01-01

    Roč. 138, č. 1-2 (2008), s. 3-10 ISSN 0301-4622 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA AV ČR KAN200100801; GA ČR GA202/07/0643 Grant - others:Marie-Curie RTN BIMORE(XE) MRTN-CT-2006-035859 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z50520701 Keywords : DNA conductivity * charge transport in molecular systems * STM * electronic properties Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.362, year: 2008

  20. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

    Science.gov (United States)

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-06-03

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Impact of charged particle exposure on homologous DNA double-strand break repair in human blood-derived cells

    Directory of Open Access Journals (Sweden)

    Melanie eRall

    2015-11-01

    Full Text Available Ionizing radiation generates DNA double-strand breaks (DSB which, unless faithfully repaired, can generate chromosomal rearrangements in hematopoietic stem and/or progenitor cells (HSPC, potentially priming the cells towards a leukemic phenotype. Using an enhanced green fluorescent protein (EGFP-based reporter system, we recently identified differences in the removal of enzyme-mediated DSB in human HSPC versus mature peripheral blood lymphocytes (PBL, particularly regarding homologous DSB repair (HR. Assessment of chromosomal breaks via premature chromosome condensation or γH2AX foci indicated similar efficiency and kinetics of radiation-induced DSB formation and rejoining in PBL and HSPC. Prolonged persistence of chromosomal breaks was observed for higher LET charged particles which are known to induce more complex DNA damage compared to X rays. Consistent with HR deficiency in HSPC observed in our previous study, we noticed here pronounced focal accumulation of 53BP1 after X-ray and carbon ion exposure (intermediate LET in HSPC versus PBL. For higher LET, 53BP1 foci kinetics were similarly delayed in PBL and HSPC suggesting similar failure to repair complex DNA damage. Data obtained with plasmid reporter systems revealed a dose- and LET-dependent HR increase after X-ray, carbon ion and higher LET exposure, particularly in HR-proficient immortalized and primary lymphocytes, confirming preferential use of conservative HR in PBL for intermediate LET damage repair. HR measured adjacent to the leukemia-associated MLL breakpoint cluster sequence in reporter lines revealed dose-dependency of potentially leukemogenic rearrangements underscoring the risk of leukemia-induction by radiation treatment.

  3. Resonance Raman spectra of organic molecules absorbed on inorganic semiconducting surfaces: Contribution from both localized intramolecular excitation and intermolecular charge transfer excitation

    International Nuclear Information System (INIS)

    Ye, ChuanXiang; Zhao, Yi; Liang, WanZhen

    2015-01-01

    The time-dependent correlation function approach for the calculations of absorption and resonance Raman spectra (RRS) of organic molecules absorbed on semiconductor surfaces [Y. Zhao and W. Z. Liang, J. Chem. Phys. 135, 044108 (2011)] is extended to include the contribution of the intermolecular charge transfer (CT) excitation from the absorbers to the semiconducting nanoparticles. The results demonstrate that the bidirectionally interfacial CT significantly modifies the spectral line shapes. Although the intermolecular CT excitation makes the absorption spectra red shift slightly, it essentially changes the relative intensities of mode-specific RRS and causes the oscillation behavior of surface enhanced Raman spectra with respect to interfacial electronic couplings. Furthermore, the constructive and destructive interferences of RRS from the localized molecular excitation and CT excitation are observed with respect to the electronic coupling and the bottom position of conductor band. The interferences are determined by both excitation pathways and bidirectionally interfacial CT

  4. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  5. Cell-killing efficiency and number of platinum atoms binding to DNA, RNA and protein molecules of HeLa cells treated with combinations of hyperthermia and carboplatin

    International Nuclear Information System (INIS)

    Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.

    1999-01-01

    The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)

  6. General Method to Determine the Flux of Charged Molecules through Nanopores Applied to β-Lactamase Inhibitors and OmpF.

    Science.gov (United States)

    Ghai, Ishan; Pira, Alessandro; Scorciapino, Mariano Andrea; Bodrenko, Igor; Benier, Lorraine; Ceccarelli, Matteo; Winterhalter, Mathias; Wagner, Richard

    2017-03-16

    A major challenge in the discovery of the new antibiotics against Gram-negative bacteria is to achieve sufficiently fast permeation in order to avoid high doses causing toxic side effects. So far, suitable assays for quantifying the uptake of charged antibiotics into bacteria are lacking. We apply an electrophysiological zero-current assay using concentration gradients of β-lactamase inhibitors combined with single-channel conductance to quantify their flux rates through OmpF. Molecular dynamic simulations provide in addition details on the interactions between the nanopore wall and the charged solutes. In particular, the interaction barrier for three β-lactamase inhibitors is surprisingly as low as 3-5 kcal/mol and only slightly above the diffusion barrier of ions such as chloride. Within our macroscopic constant field model, we determine that at a zero-membrane potential a concentration gradient of 10 μM of avibactam, sulbactam, or tazobactam can create flux rates of roughly 620 molecules/s per OmpF trimer.

  7. The infra-red spectrum of the molecular dication (doubly positively charged molecule) D35Cl2+

    International Nuclear Information System (INIS)

    Abusen, R.A.

    1999-07-01

    The ion-beam/laser-beam spectrometer used in this work was designed, built and commissioned for the experimental investigation of doubly charged molecular species [Shiell 1995]. Using this spectrometer the photodissociation spectrum of the X 3 Σ - state of the molecular dication D 35 Cl 2+ was measured in the infrared. It has not yet been possible to assign and fit the observed transitions in the usual way, but comparisons of our spectra with ab-initio generated spectra show good agreement and form the basis for our preliminary assignments. Our preliminary analysis shows a good agreement between the measured spectra and an ab-initio theoretical spectra of the ν = 2-1 band, including the rotational constants and tunneling lifetimes, calculated from the potential energy of Bennett and McNab [1995]. The theoretical spectrum was brought into agreement with the measured spectra by moving its band origin by -21.1 cm -1 . The theoretical rotational constants that give good agreement with the spectrum are (in cm -1 ) B'' = 3.898, D'' = 3.561, H'' = 1.04 x 10 -9 , B' = 3.648, D' = 3.163 x 10 -4 , H' = -9.269 x 10 -8 . The shifted origin of the ν = 2-1 band is 994.3 cm -1 . A Fortran computer program was written to simulate 3Σ-3Σ vibration-rotation spectra. The theoretical spectrum obtained with this computer program has been compared with our measured spectrum. Our experimentally measured line widths and wavenumbers have been compared with the ab-initio theoretical spectrum and a good agreement obtained. This is good evidence that we are observing the ν=2-1 band of D 35 CI 2+ in the ground electronic state (X 3 Σ - state). Good agreement between measured and predicted hyperfine patterns was found using a Fermi contact constant (for the chlorine nucleus) of 190 MHz. (author)

  8. Conformation-related exciton localization and charge-pair formation in polythiophenes: ensemble and single-molecule study.

    Science.gov (United States)

    Sugimoto, Toshikazu; Habuchi, Satoshi; Ogino, Kenji; Vacha, Martin

    2009-09-10

    We study conformation-dependent photophysical properties of polythiophene (PT) by molecular dynamics simulations and by ensemble and single-molecule optical experiments. We use a graft copolymer consisting of a polythiophene backbone and long polystyrene branches and compare its properties with those obtained on the same polythiophene derivative without the side chains. Coarse-grain molecular dynamics simulations show that in a poor solvent, the PT without the side chains (PT-R) forms a globulelike conformation in which distances between any two conjugated segments on the chain are within the Forster radius for efficient energy transfer. In the PT with the polystyrene branches (PT-PS), the polymer main PT chain retains an extended coillike conformation, even in a poor solvent, and the calculated distances between conjugated segments favor energy transfer only between a few neighboring chromophores. The theoretical predictions are confirmed by measurements of fluorescence anisotropy and fluorescence blinking of the polymers' single chains. High anisotropy ratios and two-state blinking in PT-R are due to localization of the exciton on a single conjugated segment. These signatures of exciton localization are absent in single chains of PT-PS. Electric-field-induced quenching measured as a function of concentration of PT dispersed in an inert matrix showed that in well-isolated chains of PT-PS, the exciton dissociation is an intrachain process and that aggregation of the PT-R chains causes an increase in quenching due to the onset of interchain interactions. Measurements of the field-induced quenching on single chains indicate that in PT-R, the exciton dissociation is a slower process that takes place only after the exciton is localized on one conjugated segment.

  9. Current characteristics of λ-DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

    Science.gov (United States)

    Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi

    2017-03-01

    In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.

  10. Current characteristics of λ -DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

    International Nuclear Information System (INIS)

    Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Bai, Jintao; Li, Junjie; Gu, Changzhi

    2017-01-01

    In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ -DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices. (paper)

  11. Phase-Transfer Energetics of Small-Molecule Alcohols Across the Water-Hexane Interface: Molecular Dynamics Simulation Using Charge Equilibration Models

    Science.gov (United States)

    Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep

    2010-01-01

    We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than

  12. Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

    Science.gov (United States)

    Nayak, Alpana; Suresh, K. A.

    2008-08-01

    We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

  13. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

    Science.gov (United States)

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

    2005-01-01

    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  14. Irradiation of biological molecules (DNA and RNA bases) by proton impact in the velocity range of the Bragg peak (20-150 keV/amu)

    International Nuclear Information System (INIS)

    Tabet, J.

    2007-11-01

    The aim of this work was to study the ionization of DNA and RNA base molecules by proton impact at energies between 20 and 150 keV/amu. The experiments developed over the course of this project made it possible not only to study the fragmentation of uracil, thymine, adenine, and cytosine, but also to measure absolute cross sections for different ionization processes initiated by proton interactions with these important biological molecules. Firstly, the experimental system enabled the contributions of two key ionization processes to be separated: direct ionization and electron capture. The corresponding mass spectra were measured and analyzed on an event-by-event basis. For uracil, the branching ratios for these two processes were measured as function of the projectile velocity. Secondly, we have developed a system to measure absolute cross sections for the electron capture process. The production rate of neutral atoms compared to protons was measured for the four biological molecules: uracil, cytosine, thymine, and adenine at different vaporization temperatures. This production rate varies as a function of the thickness of the target jet traversed by the protons. Accordingly, a deposit experiment was developed in order to characterize the density of molecules in the targeted gas jets. Theoretical and experimental study of the total effusion and density-profile of the gaseous molecular beams enabled us to deduce the thickness of the target jets traversed by the protons. Thus it was possible to determine absolute cross sections for the ionization of each of the four isolated biological molecules by 80 keV protons impact. To our knowledge, this work provides the first experimental absolute cross sections for DNA and RNA base ionization processes initiated by proton impact in the velocity range corresponding to the Bragg peak. (author)

  15. Binding mechanisms of DNA/RNA nucleobases adsorbed on graphene under charging: first-principles van der Waals study

    Science.gov (United States)

    Gürel, Hikmet Hakan; Salmankurt, Bahadır

    2017-06-01

    Graphene is a 2D material that has attracted much attention due to its outstanding properties. Because of its high surface area and unique chemical and physical properties, graphene is a good candidate for biological applications. For this reason, a deep understanding of the mechanism of interaction of graphene with biomolecules is required. In this study, theoretical investigation of van der Waals effects has been conducted using density functional theory. Here we show that the order of the binding energies of five nucleobases with graphene is G  >  A  >  T  >  C  >   U. This trend is in good agreement with most of the theoretical and experimental data. Also, the effects of charging on the electronic and structural properties of the graphene-nucleubase systems are studied for the first time. We show that the binding energy can be changed by adding or removing an electron from the system. The results presented in this work provide fundamental insights into the quantum interactions of DNA with carbon-based nanostructures and will be useful for developments in biotechnology and nanotechnology.

  16. Enhancement of charge transport properties of small molecule semiconductors by controlling fluorine substitution and effects on photovoltaic properties of organic solar cells and perovskite solar cells.

    Science.gov (United States)

    Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung

    2016-11-01

    We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .

  17. Synthesis of furan-based DNA binders and their interaction with DNA

    International Nuclear Information System (INIS)

    Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef

    2006-01-01

    In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)

  18. Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

    Science.gov (United States)

    Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

    2014-05-01

    Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

  19. Single-molecule dynamics in nanofabricated traps

    Science.gov (United States)

    Cohen, Adam

    2009-03-01

    The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.

  20. Ultra-high-density 3D DNA arrays within nanoporous biocompatible membranes for single-molecule-level detection and purification of circulating nucleic acids

    Science.gov (United States)

    Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.

    2015-03-01

    Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated

  1. Theoretical study of stability and charge-transport properties of coronene molecule and some of its halogenated derivatives: A path to ambipolar organic-based materials?

    Energy Technology Data Exchange (ETDEWEB)

    Sancho-García, J. C., E-mail: jc.sancho@ua.es; Pérez-Jiménez, A. J., E-mail: aj.perez@ua.es [Departamento de Química Física, Universidad de Alicante, E-03080 Alicante (Spain)

    2014-10-07

    We have carefully investigated the structural and electronic properties of coronene and some of its fluorinated and chlorinated derivatives, including full periphery substitution, as well as the preferred orientation of the non-covalent dimer structures subsequently formed. We have paid particular attention to a set of methodological details, to first obtain single-molecule magnitudes as accurately as possible, including next the use of modern dispersion-corrected methods to tackle the corresponding non-covalently bound dimers. Generally speaking, this class of compounds is expected to self-assembly in neighboring π-stacks with dimer stabilization energies ranging from –20 to –30 kcal mol{sup −1} at close distances around 3.0–3.3 Å. Then, in a further step, we have also calculated hole and electron transfer rates of some suitable candidates for ambipolar materials, and corresponding charge mobility values, which are known to critically depend on the supramolecular organization of the samples. For coronene and per-fluorinated coronene, we have found high values for their hopping rates, although slightly smaller for the latter due to an increase (decrease) of the reorganization energies (electronic couplings)

  2. The shear flow processing of controlled DNA tethering and stretching for organic molecular electronics.

    Science.gov (United States)

    Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan

    2011-01-25

    DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.

  3. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    Science.gov (United States)

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  4. Conformation-dependent DNA attraction

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-05-01

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

  5. Pore Polarity and Charge Determine Differential Block of Kir1.1 and Kir7.1 Potassium Channels by Small-Molecule Inhibitor VU590.

    Science.gov (United States)

    Kharade, Sujay V; Sheehan, Jonathan H; Figueroa, Eric E; Meiler, Jens; Denton, Jerod S

    2017-09-01

    VU590 was the first publicly disclosed, submicromolar-affinity (IC 50 = 0.2 μ M), small-molecule inhibitor of the inward rectifier potassium (Kir) channel and diuretic target, Kir1.1. VU590 also inhibits Kir7.1 (IC 50 ∼ 8 μ M), and has been used to reveal new roles for Kir7.1 in regulation of myometrial contractility and melanocortin signaling. Here, we employed molecular modeling, mutagenesis, and patch clamp electrophysiology to elucidate the molecular mechanisms underlying VU590 inhibition of Kir1.1 and Kir7.1. Block of both channels is voltage- and K + -dependent, suggesting the VU590 binding site is located within the pore. Mutagenesis analysis in Kir1.1 revealed that asparagine 171 (N171) is the only pore-lining residue required for high-affinity block, and that substituting negatively charged residues (N171D, N171E) at this position dramatically weakens block. In contrast, substituting a negatively charged residue at the equivalent position in Kir7.1 enhances block by VU590, suggesting the VU590 binding mode is different. Interestingly, mutations of threonine 153 (T153) in Kir7.1 that reduce constrained polarity at this site (T153C, T153V, T153S) make wild-type and binding-site mutants (E149Q, A150S) more sensitive to block by VU590. The Kir7.1-T153C mutation enhances block by the structurally unrelated inhibitor VU714 but not by a higher-affinity analog ML418, suggesting that the polar side chain of T153 creates a barrier to low-affinity ligands that interact with E149 and A150. Reverse mutations in Kir1.1 suggest that this mechanism is conserved in other Kir channels. This study reveals a previously unappreciated role of membrane pore polarity in determination of Kir channel inhibitor pharmacology. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

  6. Conformation-dependent DNA attraction.

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-06-21

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.

  7. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  8. Release of DNA from polyelectrolyte multilayers fabricated using 'charge-shifting' cationic polymers: tunable temporal control and sequential, multi-agent release.

    Science.gov (United States)

    Sun, Bin; Lynn, David M

    2010-11-20

    We report an approach to the design of multilayered polyelectrolyte thin films (or 'polyelectrolyte multilayers', PEMs) that can be used to provide tunable control over the release of plasmid DNA (or multiple different DNA constructs) from film-coated surfaces. Our approach is based upon methods for the layer-by-layer assembly of DNA-containing thin films, and exploits the properties of a new class of cationic 'charge-shifting' polymers (amine functionalized polymers that undergo gradual changes in net charge upon side chain ester hydrolysis) to provide control over the rates at which these films erode and release DNA. We synthesized two 'charge-shifting' polymers (polymers 1 and 2) containing different side chain structures by ring-opening reactions of poly(2-alkenyl azlactone)s with two different tertiary amine functionalized alcohols (3-dimethylamino-1-propanol and 2-dimethylaminoethanol, respectively). Subsequent characterization revealed large changes in the rates of side chain ester hydrolysis for these two polymers; whereas the half-life for the hydrolysis of the esters in polymer 1 was ~200 days, the half-life for polymer 2 was ~6 days. We demonstrate that these large differences in side chain hydrolysis make possible the design of PEMs that erode and promote the surface-mediated release of DNA either rapidly (e.g., over ~3 days for films fabricated using polymer 2) or slowly (e.g., over ~1 month for films fabricated using polymer 1). We demonstrate further that it is possible to design films with release profiles that are intermediate to these two extremes by fabricating films using solutions containing different mixtures of these two polymers. This approach can thus expand the usefulness of these two polymers and achieve a broader range of DNA release profiles without the need to synthesize polymers with new structures or properties. Finally, we demonstrate that polymers 1 and 2 can be used to fabricate multilayered films with hierarchical structures that

  9. Periodically arranged benzene-linker molecules on boron-doped single-crystalline diamond films for DNA

    Czech Academy of Sciences Publication Activity Database

    Shin, D.; Tokuda, N.; Rezek, Bohuslav; Nebel, C.E.

    2006-01-01

    Roč. 8, - (2006), s. 844-850 ISSN 1388-2481 Institutional research plan: CEZ:AV0Z10100521 Keywords : electrochemical surface modification * single-crystalline CVD diamond * covalent DNA Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.484, year: 2006

  10. On-chip Detection of Rolling Circle Amplified DNA Molecules from Bacillus Globigii spores and Vibrio Cholerae

    DEFF Research Database (Denmark)

    Østerberg, Frederik Westergaard; Rizzi, Giovanni; Donolato, Marco

    2014-01-01

    For the first time DNA coils formed by rolling circle amplification are quantified on-chip by Brownian relaxation measurements on magnetic nanobeads using a magnetoresistive sensor. No external magnetic fields are required besides the magnetic field arising from the current through the sensor...

  11. Small molecule inhibitors uncover synthetic genetic interactions of human flap endonuclease 1 (FEN1 with DNA damage response genes.

    Directory of Open Access Journals (Sweden)

    Thomas A Ward

    Full Text Available Flap endonuclease 1 (FEN1 is a structure selective endonuclease required for proficient DNA replication and the repair of DNA damage. Cellularly active inhibitors of this enzyme have previously been shown to induce a DNA damage response and, ultimately, cell death. High-throughput screens of human cancer cell-lines identify colorectal and gastric cell-lines with microsatellite instability (MSI as enriched for cellular sensitivity to N-hydroxyurea series inhibitors of FEN1, but not the PARP inhibitor olaparib or other inhibitors of the DNA damage response. This sensitivity is due to a synthetic lethal interaction between FEN1 and MRE11A, which is often mutated in MSI cancers through instabilities at a poly(T microsatellite repeat. Disruption of ATM is similarly synthetic lethal with FEN1 inhibition, suggesting that disruption of FEN1 function leads to the accumulation of DNA double-strand breaks. These are likely a result of the accumulation of aberrant replication forks, that accumulate as a consequence of a failure in Okazaki fragment maturation, as inhibition of FEN1 is toxic in cells disrupted for the Fanconi anemia pathway and post-replication repair. Furthermore, RAD51 foci accumulate as a consequence of FEN1 inhibition and the toxicity of FEN1 inhibitors increases in cells disrupted for the homologous recombination pathway, suggesting a role for homologous recombination in the resolution of damage induced by FEN1 inhibition. Finally, FEN1 appears to be required for the repair of damage induced by olaparib and cisplatin within the Fanconi anemia pathway, and may play a role in the repair of damage associated with its own disruption.

  12. Binding of radiation-induced phenylalanine radicals to DNA

    International Nuclear Information System (INIS)

    Schans, G.P. van der; Rijn, C.J.S. van; Bleichrodt, J.F.

    1975-11-01

    When an aqueous solution of double-stranded DNA of bacteriophage PM2 containing phenylalanine and saturated with N 2 O is irradiated with γ-rays, radiation-induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA, most of the phenylalanine radicals bound are non-lethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. There are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules

  13. Close encounters with DNA

    Science.gov (United States)

    Maffeo, C.; Yoo, J.; Comer, J.; Wells, D. B.; Luan, B.; Aksimentiev, A.

    2014-01-01

    Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena and we review the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field. PMID:25238560

  14. Close encounters with DNA.

    Science.gov (United States)

    Maffeo, C; Yoo, J; Comer, J; Wells, D B; Luan, B; Aksimentiev, A

    2014-10-15

    Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena. We also discuss the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field.

  15. Study of the double charge-changing collision cross-sections of H+, D+, Li+ ions with organic molecules in the energy range 10-50 keV

    International Nuclear Information System (INIS)

    Farrokhi, S.

    1966-01-01

    The variation of the double charge-changing collision cross-sections of H + , D + , Li + ions with organic molecules (CH 4 , C 2 H 6 , C 3 H 8 , C 4 H 10 ) in the energy range 10-50 keV has been studied. Several maximums for σ 1-1 = f(E) have been shown. Their existence should be explained by the different possibilities of dissociating the target-molecules. The position of the maximums, for the H + → H - and D + → D - reactions is in good agreement with that defined by the Massey adiabatic relation. (author) [fr

  16. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    Science.gov (United States)

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Single-Molecule Titration in a Protein Nanoreactor Reveals the Protonation/Deprotonation Mechanism of a C:C Mismatch in DNA.

    Science.gov (United States)

    Ren, Hang; Cheyne, Cameron G; Fleming, Aaron M; Burrows, Cynthia J; White, Henry S

    2018-04-18

    Measurement of single-molecule reactions can elucidate microscopic mechanisms that are often hidden from ensemble analysis. Herein, we report the acid-base titration of a single DNA duplex confined within the wild-type α-hemolysin (α-HL) nanopore for up to 3 h, while monitoring the ionic current through the nanopore. Modulation between two states in the current-time trace for duplexes containing the C:C mismatch in proximity to the latch constriction of α-HL is attributed to the base flipping of the C:C mismatch. As the pH is lowered, the rate for the C:C mismatch to flip from the intra-helical state to the extra-helical state ( k intra-extra ) decreases, while the rate for base flipping from the extra-helical state to the intra-helical state ( k extra-intra ) remains unchanged. Both k intra-extra and k extra-intra are on the order of 1 × 10 -2 s -1 to 1 × 10 -1 s -1 and remain stable over the time scale of the measurement (several hours). Analysis of the pH-dependent kinetics of base flipping using a hidden Markov kinetic model demonstrates that protonation/deprotonation occurs while the base pair is in the intra-helical state. We also demonstrate that the rate of protonation is limited by transport of H + into the α-HL nanopore. Single-molecule kinetic isotope experiments exhibit a large kinetic isotope effect (KIE) for k intra-extra ( k H / k D ≈ 5) but a limited KIE for k extra-intra ( k H / k D ≈ 1.3), supporting our model. Our experiments correspond to the longest single-molecule measurements performed using a nanopore, and demonstrate its application in interrogating mechanisms of single-molecule reactions in confined geometries.

  18. Charge-transfer cross sections of ground state He+ ions in collisions with He atoms and simple molecules in the energy range below 4.0 keV

    International Nuclear Information System (INIS)

    Kusakabe, Toshio; Kitamuro, Satoshi; Nakai, Yohta; Tawara, Hiroyuki; Sasao, Mamiko

    2012-01-01

    Charge-transfer cross sections of the ground state He + ions in collisions with He atoms and simple molecules (H 2 , D 2 , N 2 , CO and CO 2 ) have been measured in the energy range of 0.20 to 4.0 keV with the initial growth rate method. Since previously published experimental data are scattered in the low energy region, the present observations would provide reasonably reliable cross section data below 4 keV. The charge transfer accompanied by dissociation of product molecular ion can be dominant at low energies for molecular targets. In He + + D 2 collisions, any isotope effect was not observed over the present energy range, compared to H 2 molecule. (author)

  19. Construction of a Holliday Junction in Small Circular DNA Molecules for Stable Motifs and Two-Dimensional Lattices.

    Science.gov (United States)

    Guo, Xin; Wang, Xue-Mei; Wei, Shuai; Xiao, Shou-Jun

    2018-04-12

    Design rules for DNA nanotechnology have been mostly learnt from using linear single-stranded (ss) DNA as the source material. For example, the core structure of a typical DAO (double crossover, antiparallel, odd half-turns) tile for assembling 2D lattices is constructed from only two linear ss-oligonucleotide scaffold strands, similar to two ropes making a square knot. Herein, a new type of coupled DAO (cDAO) tile and 2D lattices of small circular ss-oligonucleotides as scaffold strands and linear ss-oligonucleotides as staple strands are reported. A cDAO tile of cDAO-c64nt (c64nt: circular 64 nucleotides), shaped as a solid parallelogram, is constructed with a Holliday junction (HJ) at the center and two HJs at both poles of a c64nt; similarly, cDAO-c84nt, shaped as a crossed quadrilateral composed of two congruent triangles, is formed with a HJ at the center and four three-way junctions at the corners of a c84nt. Perfect 2D lattices were assembled from cDAO tiles: infinite nanostructures of nanoribbons, nanotubes, and nanorings, and finite nanostructures. The structural relationship between the visible lattices imaged by AFM and the corresponding invisible secondary and tertiary molecular structures of HJs, inclination angle of hydrogen bonds against the double-helix axis, and the chirality of the tile can be interpreted very well. This work could shed new light on DNA nanotechnology with unique circular tiles. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Interaction of cationic porphyrins with DNA: Importance of the number and position of the charges and minimum structural requirements for intercalation

    International Nuclear Information System (INIS)

    Sari, M.A.; Battioni, J.P.; Dupre, D.; Mansuy, D.; Le Pecq, J.B.

    1990-01-01

    Thirty-three porphyrins or metalloporphyrins corresponding to the general formula [meso-[N-methyl-4(or 3 or 2)-pyridiniumyl] n (aryl) 4-n porphyrin]M (M = H 2 , Cu II , or ClFe III ), with n = 2-4, have been synthesized and characterized by UV-visible and 1 H NMR spectroscopy and mass spectrometry. These porphyrins differ not only in the number (2-4) and position of their cationic charges but also in the steric requirements to reach even temporarily a completely planar geometry. Interaction of these porphyrins or metalloporphyrins with calf thymus DNA has been studied and their apparent affinity binding constants have been determined by use of a competition method with ethidium bromide which was applicable not only for all the free base porphyrins but also for their copper (II) or iron (III) complexes. Whatever their mode of binding may be, their apparent affinity binding constants were relatively high and a linear decrease of log K app with the number of porphyrin charges was observed. Studies of porphyrin-DNA interactions by UV and fluorescence spectroscopy, viscosimetry, and fluorescence energy transfer experiments showed that not only the tetracationic meso-tetrakis[N-methyl-4(or 3)-pyridiniumyl]porphyrins, which both involved four freely rotating meso-aryl groups, but also the corresponding tri- and dicationic porphyrins were able to intercalate into calf thymus DNA. These results show that only half of the porphyrin ring is necessary for intercalation to occur

  1. Vingt ans après (Twenty years after). Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    Science.gov (United States)

    Grosberg, Alexander Y.

    2016-09-01

    The effect of DNA topology simplification by type II topoisomerase enzymes was discovered experimentally by Rybenkov et al. [1] 20 years ago - which motivates me to borrow the title for this comment from Alexandre Dumas [2]. Ever since the original discovery, the effect keeps entertaining theorists - but the most surprising fact is that the original experiment was never repeated, let alone improved. I do not understand why it is so. In my opinion, there is an acute need of new experiments, not only repeating the original measurements, but also examining numerous other aspects of the phenomenon. In this sense, the review [3] by Vologodskii, one of the original discoverers, is both timely and important. In his review, Vologodskii concentrates on what I would call mechanical aspect of the problem - how bent are T- and G-segments, what kinds of juxtaposition are relevant, etc. The importance of these issues notwithstanding, I want to complement this approach, and to consider in greater detail the thermodynamics of the process. My main points are as follows: action of topo II enzyme violates detailed balance for DNA, leading to circular currents and dissipation (which is indeed quite a common occurrence in many living systems). These currents are potentially observable, and dissipation measurable, which should challenge experimenters. The main goal of this comment is to show how general phenomenological point of view allows to formulate theoretical prediction for the energy dissipation rate.

  2. The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

    International Nuclear Information System (INIS)

    Cortini, Ruggero; Cheng, Xiaolin

    2017-01-01

    Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order of 1k B T. Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.

  3. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

    Science.gov (United States)

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

    2015-08-01

    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  4. The P9 pocket of HLA-DQ2 (non-Aspbeta57) has no particular preference for negatively charged anchor residues found in other type 1 diabetes-predisposing non-Aspbeta57 MHC class II molecules

    DEFF Research Database (Denmark)

    Quarsten, H; Paulsen, G; Johansen, B H

    1998-01-01

    Susceptibility and resistance to type 1 diabetes are associated with MHC class II alleles that carry non-Asp and Asp at residue 57 of their beta chain respectively. The effect of Asp or non-Aspbeta57 may relate to a differential ability of distinct class II molecules to bind specific immuno......-pathogenic peptides. Recent studies in man and mouse have revealed that some type 1 diabetes-predisposing non-Aspbeta57 class II molecules (i.e. DQ8, DR4Dw15 and I-Ag7) preferentially bind peptides with a negatively charged anchor residue at P9. It has been suggested that this is a common feature of type 1 diabetes......-predisposing class II molecules. The molecular explanation for such a phenomenon could be that class II beta chains with Aspbeta57 form a salt bridge between Aspbeta57 and a conserved Arg of the a chain, whereas in non-Aspbeta57 molecules the Arg is unopposed and free to interact with negatively charged P9 peptide...

  5. Mechanistic study of DNA damage and radioprotection of small molecule treatment in the irradiated proliferating and quiescent human lung fibroblast cells

    International Nuclear Information System (INIS)

    Dai, Jiawen; Baskar, Rajamanickam

    2014-01-01

    Ionizing radiation is an invaluable diagnostic and treatment tool used in various clinical applications and also in cancer control. However, assessing normal tissue injury is of a great interest. Since radiation sensitivity varies with different phases of cell cycle, understanding how these cells differ in their sensitivity will help to prevent or reduce the radiation injury. We have used both proliferating and quiescent human normal lung fibroblast cells and investigated key proteins involved in the cell cycle, DNA damage and death, further the radioprotective role of small molecule after low doses (d ≤1Gy) of radiation exposure. Among the cell cycle/death proteins investigated, p53 and phosphorylation of p53 (Ser-15) were induced in both the proliferating and quiescent phases of cells when studied at different time intervals. In the proliferating cells after irradiation along with p53, cyclin dependent kinase (CDK) inhibitors p21, p27 were induced. However, similarly in the quiescent cells along with the p53, p21 and p27 were also induced. The DNA damage assessed by phosphorylation of histone H2AX expression showed an increase even in the non-dividing quiescent cells after 1 Gy of radiation exposure. Whereas cell cycle proteins Cyclin A and E and cell death proteins Bax and cytochrome-c did not show any increase in the quiescent cells. In conclusion, human normal lung fibroblast cells that are not actively dividing are also showed similar radiation response as of proliferating cells. Furthermore, proliferating and quiescent cells treated with small molecules attenuate p53 and its downstream target protein p21 indicating radioprotection of the cells. The specific activation of p53, phosphorylation of p53 (Ser-15), p21 and phosphorylation of histone H2AX following radiation doses of d ≤ 1 Gy in the quiescent cells demonstrated in this study may give us a better understanding about the radiation response of non-dividing fibroblast cells, which is present in many

  6. Impact of nanosilver on various DNA lesions and HPRT gene mutations - effects of charge and surface coating

    Czech Academy of Sciences Publication Activity Database

    Huk, A.; Izak-Nau, E.; el Yamani, N.; Uggerud, H.; Vadset, M.; Zasońska, Beata Anna; Duschl, A.; Dusinska, M.

    2015-01-01

    Roč. 12, 24 July (2015), 25_1-25_20 ISSN 1743-8977 Institutional support: RVO:61389013 Keywords : silver nanomaterials * surface charge * surface coating Subject RIV: CD - Macromolecular Chemistry Impact factor: 8.649, year: 2015

  7. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  8. Influence of turn (or fold) and local charge in fragmentation of the peptide analogue molecule CH3CO-Gly-NH2 following single-photon VUV (118.22 nm) ionization.

    Science.gov (United States)

    Bhattacharya, Atanu; Bernstein, Elliot R

    2011-10-06

    The radical cationic reactivity of the peptide analogue molecule CH(3)CO-Gly-NH(2) is addressed both experimentally and theoretically. The radical cation intermediate of CH(3)CO-Gly-NH(2) is created by single-photon ionization of this molecule at 118.22 nm (~10.5 eV). The two most stable conformers (C(7) and C(5)) of this molecule exhibit different folds along the backbone: the C(7) conformer has a γ-turn structure, and the C(5) conformer has a β-strand structure. The experimental results show that the radical cation intermediate of CH(3)CO-Gly-NH(2) dissociates and generates a fragment-ion signal at 73 amu that is observed through TOFMS. Theoretical results show how the fragment-ion signal at 73 amu is generated by only one conformer of CH(3)CO-Gly-NH(2) (C(7)) and how local charge and specific hydrogen bonding in the molecule influence fragmentation of the radical cation intermediate of CH(3)CO-Gly-NH(2). The specific fold of the molecule controls fragmentation of this reactive radical cation intermediate. Whereas the radical cation of the C(7) conformer dissociates through a hydrogen-transfer mechanism followed by HNCO elimination, the radical cation of the C(5) conformer does not dissociate at all. CASSCF calculations show that positive charge in the radical cationic C(7) conformer is localized at the NH(2)CO moiety of the molecular ion. This site-specific localization of the positive charge enhances the acidity of the terminal NH(2) group, facilitating hydrogen transfer from the NH(2) to the COCH(3) end of the molecular ion. Positive charge in the C(5) conformer of the CH(3)CO-Gly-NH(2) radical cation is, however, localized at the COCH(3) end of the molecular ion, and this conformer does not have enough energy to surmount the energy barrier to dissociation on the ion potential energy surface. CASSCF results show that conformation-specific localization of charge in the CH(3)CO-Gly-NH(2) molecular ion occurs as a result of the different hydrogen

  9. Charged residues in the H-NS linker drive DNA binding and gene silencing in single cells.

    Science.gov (United States)

    Gao, Yunfeng; Foo, Yong Hwee; Winardhi, Ricksen S; Tang, Qingnan; Yan, Jie; Kenney, Linda J

    2017-11-21

    Nucleoid-associated proteins (NAPs) facilitate chromosome organization in bacteria, but the precise mechanism remains elusive. H-NS is a NAP that also plays a major role in silencing pathogen genes. We used genetics, single-particle tracking in live cells, superresolution microscopy, atomic force microscopy, and molecular dynamics simulations to examine H-NS/DNA interactions in single cells. We discovered a role for the unstructured linker region connecting the N-terminal oligomerization and C-terminal DNA binding domains. In the present work we demonstrate that linker amino acids promote engagement with DNA. In the absence of linker contacts, H-NS binding is significantly reduced, although no change in chromosome compaction is observed. H-NS is not localized to two distinct foci; rather, it is scattered all around the nucleoid. The linker makes DNA contacts that are required for gene silencing, while chromosome compaction does not appear to be an important H-NS function.

  10. Single-Molecule Kinetics Reveal Cation-Promoted DNA Duplex Formation Through Ordering of Single-Stranded Helices

    Science.gov (United States)

    Dupuis, Nicholas F.; Holmstrom, Erik D.; Nesbitt, David J.

    2013-01-01

    In this work, the kinetics of short, fully complementary oligonucleotides are investigated at the single-molecule level. Constructs 6–9 bp in length exhibit single exponential kinetics over 2 orders of magnitude time for both forward (kon, association) and reverse (koff, dissociation) processes. Bimolecular rate constants for association are weakly sensitive to the number of basepairs in the duplex, with a 2.5-fold increase between 9 bp (k′on = 2.1(1) × 106 M−1 s−1) and 6 bp (k′on = 5.0(1) × 106 M−1 s−1) sequences. In sharp contrast, however, dissociation rate constants prove to be exponentially sensitive to sequence length, varying by nearly 600-fold over the same 9 bp (koff = 0.024 s−1) to 6 bp (koff = 14 s−1) range. The 8 bp sequence is explored in more detail, and the NaCl dependence of kon and koff is measured. Interestingly, konincreases by >40-fold (kon = 0.10(1) s−1 to 4.0(4) s−1 between [NaCl] = 25 mM and 1 M), whereas in contrast, koffdecreases by fourfold (0.72(3) s−1 to 0.17(7) s−1) over the same range of conditions. Thus, the equilibrium constant (Keq) increases by ≈160, largely due to changes in the association rate, kon. Finally, temperature-dependent measurements reveal that increased [NaCl] reduces the overall exothermicity (ΔΔH° > 0) of duplex formation, albeit by an amount smaller than the reduction in entropic penalty (−TΔΔS° duplex formation. PMID:23931323

  11. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  12. Solid-state nanopores for scanning single molecules and mimicking biology

    NARCIS (Netherlands)

    Kowalczyk, S.W.

    2011-01-01

    Solid-state nanopores, nanometer-size holes in a thin synthetic membrane, are a versatile tool for the detection and manipulation of charged biomolecules. This thesis describes mostly experimental work on DNA translocation through solid-state nanopores, which we study at the single-molecule level.

  13. Evidence for excited state intramolecular charge transfer reaction in donor-acceptor molecule 5-(4-dimethylamino-phenyl)-penta-2,4-dienoic acid methyl ester: Experimental and quantum chemical approach

    International Nuclear Information System (INIS)

    Kumar Paul, Bijan; Samanta, Anuva; Kar, Samiran; Guchhait, Nikhil

    2010-01-01

    Intramolecular charge transfer (ICT) reaction has been investigated in 5-(4-dimethylamino-phenyl)-penta-2,4-dienoic acid methyl ester (DPDAME) using spectroscopic techniques. The molecule DPDAME shows local emission in non-polar solvent and dual emission in polar solvents. Solvatochromic effects on the Stokes shifted emission band clearly demonstrate the charge transfer character of the excited state. Quantum chemical calculations have been performed at Hartree-Fock (HF) and density functional theoretical (DFT) levels to correlate the experimental findings. Potential energy curves (PECs) for the ICT reaction have been evaluated along the donor twist angle at DFT and time dependent density functional theory (TDDFT) levels for the ground and excited states, respectively, using B3LYP hybrid functional and 6-31G** basis set. The solvent effects on the spectral properties have been explored theoretically at the same level with time dependent density functional theory-polarized continuum model (TDDFT-PCM) and the theoretical results are found to well substantiate the solvent polarity dependent Stokes shifted emission of DPDAME. Huge enhancement of dipole moment (Δμ=16.42 D) of the molecule following photoexcitation dictates the highly polar character of the excited state. Although elucidation of PECs does not exactly predict the operation of ICT according to twisted intramolecular charge transfer (TICT) model in DPDAME, lowering of vertical transition energy as a function of the donor twist coordinate scripts the occurrence of red shifted emission as observed experimentally.

  14. Charge transfer processes in collisions of H+ ions with H2, D2, CO, CO2 CH4, C2H2, C2H6 and C3H8 molecules below 10 keV

    International Nuclear Information System (INIS)

    Kusakabe, T.; Buenker, R.J.; Kimura, M.

    2002-01-01

    Charge transfer processes resulting from collisions of H + ions with H 2 , D 2 , CO, CO 2 CH 4 , C 2 H 2 , C 2 H 6 and C 3 H 8 molecules have been investigated in the energy range of 0.2 to 4.0 keV experimentally and theoretically. The initial growth rate method was employed in the experiment for studying the dynamics and cross sections. Theoretical analysis based on a molecular-orbital expansion method for H 2 , D 2 , CO, CH 4 and C 2 H 2 targets was also carried out. The present results for the H 2 , CO and CO 2 molecules by H + impact are found to be in excellent accord with most of previous measurements above 1 keV, but they show some differences below this energy where our result displays a stronger energy-dependence. For CH 4 , C 2 H 2 , C 2 H 6 and C 3 H 8 targets, both experimental and theoretical results indicate that if one assumes vibrationally excited molecular ions (CH 4 + , C 2 H 2 + , C 2 H 6 + and C 3 H 8 + ) formed in the exit channel, then charge transfer processes sometimes become more favorable since these vibrationally excited fragments meet an accidental resonant condition. This is a clear indication of the role of vibrational excited states for charge transfer, and is an important realization for general understanding. (author)

  15. A surprising way to control the charge transport in molecular electronics: the subtle impact of the coverage of self-assembled monolayers of floppy molecules adsorbed on metallic electrodes.

    Science.gov (United States)

    Bâldea, Ioan

    2017-10-26

    Inspired by earlier attempts in organic electronics aiming at controlling charge injection from metals into organic materials by manipulating the Schottky energy barrier using self-assembled monolayers (SAMs), recent experimental and theoretical work in molecular electronics showed that metal-organic interfaces can be controlled via changes in the metal work function that are induced by SAMs. In this paper we indicate a different route to achieve interface-driven control over the charge transfer/transport at the molecular scale. It is based on the fact that, in floppy molecule based SAMs, the molecular conformation can be tuned by varying the coverage of the adsorbate. We demonstrate this effect with the aid of benchmark molecules that are often used to fabricate nanojunctions and consist of two rings that can easily rotate relative to each other. We show that, by varying the coverage of the SAM, the twisting angle φ of the considered molecular species can be modified by a factor of two. Given the fact that the low bias conductance G scales as cos 2  φ, this results in a change in G of over one order of magnitude for the considered molecular species. Tuning the twisting angle by controlling the SAM coverage may be significant, e.g., for current efforts to fabricate molecular switches. Conversely, the lack of control over the local SAM coverage may be problematic for the reproducibility and interpretation of the STM (scanning tunneling microscope) measurements on repeatedly forming single molecule break junctions.

  16. Theoretical and experimental study of charge transfer through DNA: Impact of mercury mediated T-Hg-T base pair

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Vala, M.; Weiter, M.; Páv, Ondřej; Šebera, Jakub; Sychrovský, Vladimír

    2015-01-01

    Roč. 22, č. 1 (2015), s. 20 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /13./. 19.03.2015-21.03.2015, Nové Hrady] Institutional support: RVO:61388963 ; RVO:68378271 Keywords : charge transfer * T-Hg-T * steady-state fluorescence Subject RIV: CF - Physical ; Theoretical Chemistry

  17. Probe DNA-Cisplatin Interaction with Solid-State Nanopores

    Science.gov (United States)

    Zhou, Zhi; Hu, Ying; Li, Wei; Xu, Zhi; Wang, Pengye; Bai, Xuedong; Shan, Xinyan; Lu, Xinghua; Nanopore Collaboration

    2014-03-01

    Understanding the mechanism of DNA-cisplatin interaction is essential for clinical application and novel drug design. As an emerging single-molecule technology, solid-state nanopore has been employed in biomolecule detection and probing DNA-molecule interactions. Herein, we reported a real-time monitoring of DNA-cisplatin interaction by employing solid-state SiN nanopores. The DNA-cisplatin interacting process is clearly classified into three stages by measuring the capture rate of DNA-cisplatin adducts. In the first stage, the negative charged DNA molecules were partially discharged due to the bonding of positive charged cisplatin and forming of mono-adducts. In the second stage, forming of DNA-cisplatin di-adducts with the adjacent bases results in DNA bending and softening. The capture rate increases since the softened bi-adducts experience a lower barrier to thread into the nanopores. In the third stage, complex structures, such as micro-loop, are formed and the DNA-cisplatin adducts are aggregated. The capture rate decreases to zero as the aggregated adduct grows to the size of the pore. The characteristic time of this stage was found to be linear with the diameter of the nanopore and this dynamic process can be described with a second-order reaction model. We are grateful to Laboratory of Microfabrication, Dr. Y. Yao, and Prof. R.C. Yu (Institute of Physics, Chinese Academy of Sciences) for technical assistance.

  18. Atom and molecule projectile and fast aggregate excitation, ionization and dissociation in thin targets in the out-of-charge equilibrium field

    International Nuclear Information System (INIS)

    Clouvas, A.

    1985-12-01

    The aim of this experimental study is to confirm the possible existence of bound states for light atomic and molecular projectiles inside solid targets, in the MeV energy range. For this purpose we have used, various experimental methods such as charge state distribution measurements, energy loss measurements, beam foil spectroscopy and electron spectroscopy. It was confirmed that bound states of light atomic and molecular projectiles can exist in a solid medium. The various cross sections (charge exchange, excitation, ionisation, dissociation) relative to these bound states have been measured [fr

  19. DNA Repair Systems

    Indian Academy of Sciences (India)

    DNA molecule which makes it ideal for storage and propagation of genetic information. ... of these errors are broadly referred to as DNA repair. DNA can ... changes occur in the human genome per day. ..... nails, frequent physical and mental.

  20. Spectrally resolved single-molecule electrometry

    Science.gov (United States)

    Ruggeri, F.; Krishnan, M.

    2018-03-01

    Escape-time electrometry is a recently developed experimental technique that offers the ability to measure the effective electrical charge of a single biomolecule in solution with sub-elementary charge precision. The approach relies on measuring the average escape-time of a single charged macromolecule or molecular species transiently confined in an electrostatic fluidic trap. Comparing the experiments with the predictions of a mean-field model of molecular electrostatics, we have found that the measured effective charge even reports on molecular conformation, e.g., folded or disordered state, and non-uniform charge distribution in disordered proteins or polyelectrolytes. Here we demonstrate the ability to use the spectral dimension to distinguish minute differences in electrical charge between individual molecules or molecular species in a single simultaneous measurement, under identical experimental conditions. Using one spectral channel for referenced measurement, this kind of photophysical distinguishability essentially eliminates the need for accurate knowledge of key experimental parameters, otherwise obtained through intensive characterization of the experimental setup. As examples, we demonstrate the ability to detect small differences (˜5%) in the length of double-stranded DNA fragments as well as single amino acid exchange in an intrinsically disordered protein, prothymosin α.

  1. Charge-resonance excitations in symmetric molecules - Comparison of linear response DFT with CC3 for the excited states of a model dimer

    DEFF Research Database (Denmark)

    Kuhlman, Thomas Scheby; Mikkelsen, Kurt V.; Møller, Klaus Braagaard

    2009-01-01

    to a reference CC3 calculation revealing a better description of the excited states by CAM-B3LYP than that of B3LYP. The Λ parameter introduced by Peach et al. [M.J.G. Peach, P. Benfield, T. Helgaker, D.J. Tozer, J. Chem. Phys. 128 (2008) 044118] does not always reveal the problematic charge-resonance states...

  2. Effective charge versus bare charge: an analytical estimate for colloids in the infinite dilution limit

    International Nuclear Information System (INIS)

    Aubouy, Miguel; Trizac, Emmanuel; Bocquet, Lyderic

    2003-01-01

    We propose an analytical approximation for the dependence of the effective charge on the bare charge for spherical and cylindrical macro-ions as a function of the size of the colloid and salt content, for the situation of a unique colloid immersed in a sea of electrolyte (where the definition of an effective charge is non-ambiguous). Our approach is based on the Poisson-Boltzmann (PB) mean-field theory. Mathematically speaking, our estimate is asymptotically exact in the limit κa >> 1, where a is the radius of the colloid and κ is the inverse screening length. In practice, a careful comparison with effective charge parameters, obtained by numerically solving the full nonlinear PB theory, proves that our estimate is good down to κa ∼ 1. This is precisely the limit appropriate to treat colloidal suspensions. A particular emphasis is put on the range of parameters suitable to describe both single and double strand DNA molecules under physiological conditions

  3. Electron emission following collisions between multi-charged ions and D{sub 2} molecules; Etude de l'emission electronique induite par impact d'ion multicharge sur la molecule D{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Laurent, G

    2004-05-15

    Dissociative ionisation mechanisms induced in collisions involving a highly charged ion (S{sup 15+}, 13.6 MeV/u) and a molecular deuterium target, have been studied through momentum vector correlations of both the D{sup +} fragments and the electrons produced. An experimental apparatus has been developed in order to detect in coincidence all the charged particles produced during the collision. The measurement of their momentum vectors, which allows one to determine both their kinetic energy and direction of emission with respect to the projectile one, combines Time of Flight, Position Sensitive Detection, and multi-coincidence techniques. The correlation of the fragment and electron kinetic energies enables not only to determine branching ratios between the dissociative ionisation pathways, but also to separate unambiguously kinetic energy distributions of fragments associated to each process. Finally, the angular distributions of ejected electrons, as a function of the orientation of the molecular axis with respect to the projectile direction, are deduced from the spatial correlation. Measurements are compared to theoretical angular distributions obtained using the CDW-EIS (Continuum Distorted Wave-Eikonal Initial State) method. (author)

  4. Passing Current through Touching Molecules

    DEFF Research Database (Denmark)

    Schull, G.; Frederiksen, Thomas; Brandbyge, Mads

    2009-01-01

    The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...

  5. Synthesis of an A-D-A type of molecule used as electron acceptor for improving charge transfer in organic solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Chao-Zhi, E-mail: chzhzhang@sohu.com [Department of Chemistry, Nanjing University of Information Science & Technology, Nanjing 210044 (China); Gu, Shu-Duo; Shen, Dan; Yuan, Yang [Department of Chemistry, Nanjing University of Information Science & Technology, Nanjing 210044 (China); Zhang, Mingdao, E-mail: matchlessjimmy@163.com [Jiangsu Key Laboratory of Atmospheric Environment Monitoring and Pollution Control, Nanjing University of Information Science & Technology, Nanjing 210044 (China)

    2016-08-22

    Electron-accepting molecules play an important role in developing organic solar cells. A new type of A-D-A molecule, 3,6-di([7-(5-bromothiophen-2-yl)-1,5,2,4,6,8-dithiotetrazocin-3-yl]thiophen -2-yl)-9-(2-ethylhexyl)carbazole, was synthesized. The lowest unoccupied molecular orbital (LUMO) and highest occupied molecular orbital (HOMO) energy levels are −3.55 and −5.85 eV, respectively. Therefore, the A-D-A type of compound could be used as electron acceptor for fabricating organic solar cell with a high open circuit voltage. Gibbs free energy (−49.2 kJ/mol) reveals that the process of A-D-A acceptor accepting an electron from poly(3-hexylthiophene) at excited state is spontaneous. The value of entropy (118 J/mol) in the process of an electron transferring from P3HT to the A-D-A acceptor at organic interface suggests that electrons generated from separation of electron-hole pairs at donor/acceptor interface would be delocalized efficiently. Therefore, the A-D-A molecule would be a potential acceptor for efficient organic BHJ solar cells.

  6. DNA molecules and human therapeutics

    African Journals Online (AJOL)

    PRECIOUS

    2009-12-29

    Dec 29, 2009 ... vectors, display non-toxicity and are simpler to develop. This review ... technology as well as a staged delivery mechanism for the introduction of plasmid-borne gene to target cells via the ... pathogen's gene to provide immunity against diseases by ... human cytomegalovirus, simian virus, human elongation.

  7. Expression of DNA Damage Response Molecules PARP1, γH2AX, BRCA1, and BRCA2 Predicts Poor Survival of Breast Carcinoma Patients

    Directory of Open Access Journals (Sweden)

    See-Hyoung Park

    2015-08-01

    Full Text Available BACKGROUND: Poly(ADP-ribose polymerase 1 (PARP1, γH2AX, BRCA1, and BRCA2 are conventional molecular indicators of DNA damage in cells and are often overexpressed in various cancers. In this study, we aimed, using immunohistochemical detection, whether the co-expression of PARP1, γH2AX, BRCA1, and BRCA2 in breast carcinoma (BCA tissue can provide more reliable prediction of survival of BCA patients. MATERIALS AND METHODS: We investigated immunohistochemical expression and prognostic significance of the expression of PARP1, γH2AX, BRCA1, and BRCA2 in 192 cases of BCAs. RESULTS: The expression of these four molecules predicted earlier distant metastatic relapse, shorter overall survival (OS, and relapse-free survival (RFS by univariate analysis. Multivariate analysis revealed the expression of PARP1, γH2AX, and BRCA2 as independent poor prognostic indicators of OS and RFS. In addition, the combined expressional pattern of BRCA1, BRCA2, PARP1, and γH2AX (CSbbph was an additional independent prognostic predictor for OS (P < .001 and RFS (P < .001. The 10-year OS rate was 95% in the CSbbph-low (CSbbph scores 0 and 1 subgroup, but that was only 35% in the CSbbph-high (CSbbph score 4 subgroup. CONCLUSION: This study has demonstrated that the individual and combined expression patterns of PARP1, γH2AX, BRCA1, and BRCA2 could be helpful in determining an accurate prognosis for BCA patients and for the selection of BCA patients who could potentially benefit from anti-PARP1 therapy with a combination of genotoxic chemotherapeutic agents.

  8. Control of electrical conduction in DNA using hole doping

    Science.gov (United States)

    Lee, Hea-Yeon; Taniguchi, Masateru; Yoo, K. H.; Otsuka, Youichi; Tanaka, Hidekazu; Kawai, Tomoji

    2002-03-01

    Control of electrical conduction in DNA using hole doping H.Y.Lee1, M.Taniguchi1, K.H.Yoo2, Y.Otsuka1 H.Tanaka1 and T.Kawai1 1The Institute of Scientific and Industrial Research(ISIR), Osaka University, Osaka, Japan. 2Department of Physics, Younsei University, Seoul, Korea Possible applications of DNA molecules in electronic devices and biosensors were suggested almost ten years ago A DNA structure containing a single type of base pair appears to be a good candidate for conduction along the \\x81E-electron clouds of the stacked bases. There have been lots of investigations on conduction mechanisms of the DNA molecules. However, it is not still clear whether the observed conductions of some DNA molecules come from motions of either ionic charges or other carriers. Although the basic mechanism for DNA-mediated charge transport should be understood for electronic applications, there have been divergent reports on its nature. And I will be present the research for the charge carrier conduction of DNA film under oxygen and iodine gas by using 10¡V100 nm gap. The doping studies using oxygen and iodine gas can provide a definite answer for the carrier conduction mechanism and also a possible method to control the carrier concentration in DNA molecules. Using oxygen and iodine adsorption experiments on the poly (dG)-poly (dC) DNA molecules, we will show that their conductance becomes increased easily by several orders of magnitudes due to the hole doping, which is a characteristic behavior of a p-type semiconductor. On the other hand, we will also show that the poly (dA) - poly (dT) DNA molecules behave as an n-type semiconductor. Our works indicate that the concentration and the type of carriers in the DNA molecules could be controlled using proper doping methods. We expect that this would be a major breakthrough in DNA-based nano-electronics, similar to the fact that the doped conductive has polyacetylene opened up a new field of electronics with exciting implications

  9. Increased charge transfer of Poly (ethylene oxide) based electrolyte by addition of small molecule and its application in dye-sensitized solar cells

    International Nuclear Information System (INIS)

    Muthuraaman, B.; Will, Geoffrey; Wang, Hongxia; Moonie, Paul; Bell, John

    2013-01-01

    A Poly (ethylene oxide) based polymer electrolyte impregnated with 2-Mercapto benzimidazole was comprehensively characterized by XRD, UV–visible spectroscopy, FTIR as well as electrochemical impedance spectroscopy. It was found that the crystallization of PEO was dramatically reduced and the ionic conductivity of the electrolyte was increased 4.5 fold by addition of 2-Mercapto benzimidazole. UV–visible and FTIR spectroscopes indicated the formation of charge transfer complex between 2-Mercapto benzimidazole and iodine of the electrolyte. Dye-sensitized solar cells with the polymer electrolytes were assembled. It was found that both the photocurrent density and photovoltage were enhanced with respect to the DSC without 2-Mercapto benzimidazole, leading to a 60% increase of the performance of the cell.

  10. Detection of Individual Molecules and Ions by Carbon Nanotube-Based Differential Resistive Pulse Sensor.

    Science.gov (United States)

    Peng, Ran; Tang, Xiaowu Shirley; Li, Dongqing

    2018-04-01

    This paper presents a new method of sensing single molecules and cations by a carbon nanotube (CNT)-based differential resistive pulse sensing (RPS) technique on a nanofluidic chip. A mathematical model for multichannel RPS systems is developed to evaluate the CNT-based RPS signals. Individual cations, rhodamine B dye molecules, and ssDNAs are detected successfully with high resolution and high signal-to-noise ratio. Differentiating ssDNAs with 15 and 30 nucleotides are achieved. The experimental results also show that translocation of negatively charged ssDNAs through a CNT decreases the electrical resistance of the CNT channel, while translocation of positively charged cations and rhodamine B molecules increases the electrical resistance of the CNT. The CNT-based nanofluidic device developed in this work provides a new avenue for single-molecule/ion detection and offers a potential strategy for DNA sequencing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Influence of fused aromatic ring on the stability of charge transfer complex between iodine and some five membered heterocyclic molecules through ultrasonic and spectral studies

    Science.gov (United States)

    Ulagendran, V.; Balu, P.; Kannappan, V.; Kumar, R.; Jayakumar, S.

    2017-08-01

    The charge transfer (CT) interaction between two fused heterocyclic compounds with basic pyrrole group as donors, viz., indole (IND) and carbazole (CAR), and iodine (acceptor) in DMSO medium is investigated by ultrasonic and UV-visible spectral methods at 303 K. The formation of CT complex in these systems is established from the trend in acoustical and excess thermo acoustical properties with molar concentration. The frequency acoustic spectra (FAS) is also carried out on these two systems for two fixed concentrations 0.002 M and 0.02 M, and in the frequency range 1 MHz-10 MHz to justify the frequency chosen for ultrasonic study. The absorption coefficient values in solution are computed and discussed. The formation constants of these complexes are determined using Kannappan equation in ultrasonic method. The formation of 1:1 complexes between iodine and IND, CAR was established by the theory of Benesi - Hildebrand in the UV-visible spectroscopic method. The stability constants of the CT complexes determined by spectroscopic and ultrasonic methods show a similar trend. These values also indicate that the presence of fused aromatic ring influences significantly when compared with K values of similar CT complexes of parent five membered heterocyclic compound (pyrrole) reported by us earlier.

  12. irGPU.proton.Net: Irregular strong charge interaction networks of protonatable groups in protein molecules--a GPU solver using the fast multipole method and statistical thermodynamics.

    Science.gov (United States)

    Kantardjiev, Alexander A

    2015-04-05

    A cluster of strongly interacting ionization groups in protein molecules with irregular ionization behavior is suggestive for specific structure-function relationship. However, their computational treatment is unconventional (e.g., lack of convergence in naive self-consistent iterative algorithm). The stringent evaluation requires evaluation of Boltzmann averaged statistical mechanics sums and electrostatic energy estimation for each microstate. irGPU: Irregular strong interactions in proteins--a GPU solver is novel solution to a versatile problem in protein biophysics--atypical protonation behavior of coupled groups. The computational severity of the problem is alleviated by parallelization (via GPU kernels) which is applied for the electrostatic interaction evaluation (including explicit electrostatics via the fast multipole method) as well as statistical mechanics sums (partition function) estimation. Special attention is given to the ease of the service and encapsulation of theoretical details without sacrificing rigor of computational procedures. irGPU is not just a solution-in-principle but a promising practical application with potential to entice community into deeper understanding of principles governing biomolecule mechanisms. © 2015 Wiley Periodicals, Inc.

  13. Kinetic energies of charged fragments resulting from multifragmentation and asymmetric fission of the C60 molecule in collisions with monocharged ions (2-130 keV)

    International Nuclear Information System (INIS)

    Rentenier, A; Bordenave-Montesquieu, D; Moretto-Capelle, P; Bordenave-Montesquieu, A

    2003-01-01

    Multifragmentation and asymmetric fission (AF) of the C 60 molecule induced by H + , H 2 + , H 3 + and He + ions at medium collision energies (2-130 keV) are considered. Momenta and kinetic energies of C n + fragment ions (n = 1- 12) are deduced from an analysis of time-of-flight spectra. In multifragmentation processes, momenta are found to be approximately constant when n > 2, a behaviour which explains that the most probable kinetic energy, as well as the width of the kinetic energy distributions, is found to be inversely proportional to the fragment size n; both momenta and kinetic energies are independent of the velocity and nature of the projectile, and hence of the energy deposit. A specific study of the AF shows that the kinetic energies of C 2 + , C 4 + and C 6 + fragments are also independent of the collision velocity and projectile species; a quantitative agreement is found with values deduced from kinetic energy release measurements by another group in electron impact experiments, and the observed decrease when the mass of the light fragment increases is also reproduced. A quantitative comparison of AF and multifragmentation for the n = 2, 4 and 6 fragment ions shows that kinetic energies in AF exceed that in multifragmentation, a result which explains the oscillations observed when momenta or kinetic energies of fragments are plotted against the n-value. The AF yield is also found to scale with the energy deposit in the collision velocity range extending below the velocity at the maximum of the electronic stopping power; except for protons, it remains negligible with respect to multifragmentation as soon as the total energy deposit exceeds about 100 eV

  14. Synthesis, spectroscopic characterization and structural investigations of a new charge transfer complex of 2,6-diaminopyridine with 3,5-dinitrobenzoic acid: DNA binding and antimicrobial studies

    Science.gov (United States)

    Khan, Ishaat M.; Ahmad, Afaq; Kumar, Sarvendra

    2013-03-01

    A new charge transfer (CT) complex [(DAPH)+(DNB)-] consisting of 2,6-diaminopyridine (DAP) as donor and 3,5-dinitrobenzoic acid (DNB-H) as acceptor, was synthesized and characterized by FTIR, 1H and 13C NMR, ESI mass spectroscopic and X-ray crystallographic techniques. The hydrogen bonding (N+-H⋯O-) plays an important role to consolidate the cation and anion together. CT complex shows a considerable interaction with Calf thymus DNA. The CT complex was also tested for its antibacterial activity against two Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis and two Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa strains by using Tetracycline as standard, and antifungal property against Aspergillus niger, Candida albicans, and Penicillium sp. by using Nystatin as standard. The results were compared with standard drugs and significant conclusions were obtained. A polymeric net work through H-bonding interactions between neighboring moieties was observed. This has been attributed to the formation of 1:1 type CT complex.

  15. A simple model for electrical charge in globular macromolecules and linear polyelectrolytes in solution

    Science.gov (United States)

    Krishnan, M.

    2017-05-01

    We present a model for calculating the net and effective electrical charge of globular macromolecules and linear polyelectrolytes such as proteins and DNA, given the concentration of monovalent salt and pH in solution. The calculation is based on a numerical solution of the non-linear Poisson-Boltzmann equation using a finite element discretized continuum approach. The model simultaneously addresses the phenomena of charge regulation and renormalization, both of which underpin the electrostatics of biomolecules in solution. We show that while charge regulation addresses the true electrical charge of a molecule arising from the acid-base equilibria of its ionizable groups, charge renormalization finds relevance in the context of a molecule's interaction with another charged entity. Writing this electrostatic interaction free energy in terms of a local electrical potential, we obtain an "interaction charge" for the molecule which we demonstrate agrees closely with the "effective charge" discussed in charge renormalization and counterion-condensation theories. The predictions of this model agree well with direct high-precision measurements of effective electrical charge of polyelectrolytes such as nucleic acids and disordered proteins in solution, without tunable parameters. Including the effective interior dielectric constant for compactly folded molecules as a tunable parameter, the model captures measurements of effective charge as well as published trends of pKa shifts in globular proteins. Our results suggest a straightforward general framework to model electrostatics in biomolecules in solution. In offering a platform that directly links theory and experiment, these calculations could foster a systematic understanding of the interrelationship between molecular 3D structure and conformation, electrical charge and electrostatic interactions in solution. The model could find particular relevance in situations where molecular crystal structures are not available or

  16. Serogroup-level resolution of the “Super-7” Shiga toxin-producing Escherichia coli using nanopore single-molecule DNA sequencing

    Science.gov (United States)

    DNA sequencing and other DNA-based methods, such as PCR, are now broadly used for detection and identification of bacterial foodborne pathogens. For the identification of foodborne bacterial pathogens, it is important to make taxonomic assignments to the species, or even subspecies level. Long-read ...

  17. Molecule nanoweaver

    Science.gov (United States)

    Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL

    2009-03-10

    A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.

  18. Patterning nanocrystals using DNA

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Shara Carol [Univ. of California, Berkeley, CA (United States)

    2003-01-01

    One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices

  19. Hysteresis in pressure-driven DNA denaturation.

    Directory of Open Access Journals (Sweden)

    Enrique Hernández-Lemus

    Full Text Available In the past, a great deal of attention has been drawn to thermal driven denaturation processes. In recent years, however, the discovery of stress-induced denaturation, observed at the one-molecule level, has revealed new insights into the complex phenomena involved in the thermo-mechanics of DNA function. Understanding the effect of local pressure variations in DNA stability is thus an appealing topic. Such processes as cellular stress, dehydration, and changes in the ionic strength of the medium could explain local pressure changes that will affect the molecular mechanics of DNA and hence its stability. In this work, a theory that accounts for hysteresis in pressure-driven DNA denaturation is proposed. We here combine an irreversible thermodynamic approach with an equation of state based on the Poisson-Boltzmann cell model. The latter one provides a good description of the osmotic pressure over a wide range of DNA concentrations. The resulting theoretical framework predicts, in general, the process of denaturation and, in particular, hysteresis curves for a DNA sequence in terms of system parameters such as salt concentration, density of DNA molecules and temperature in addition to structural and configurational states of DNA. Furthermore, this formalism can be naturally extended to more complex situations, for example, in cases where the host medium is made up of asymmetric salts or in the description of the (helical-like charge distribution along the DNA molecule. Moreover, since this study incorporates the effect of pressure through a thermodynamic analysis, much of what is known from temperature-driven experiments will shed light on the pressure-induced melting issue.

  20. Peptide Dendrimer/Lipid Hybrid Systems Are Efficient DNA Transfection Reagents: Structure–Activity Relationships Highlight the Role of Charge Distribution Across Dendrimer Generations

    Science.gov (United States)

    2013-01-01

    Efficient DNA delivery into cells is the prerequisite of the genetic manipulation of organisms in molecular and cellular biology as well as, ultimately, in nonviral gene therapy. Current reagents, however, are relatively inefficient, and structure–activity relationships to guide their improvement are hard to come by. We now explore peptide dendrimers as a new type of transfection reagent and provide a quantitative framework for their evaluation. A collection of dendrimers with cationic and hydrophobic amino acid motifs (such as KK, KA, KH, KL, and LL) distributed across three dendrimer generations was synthesized by a solid-phase protocol that provides ready access to dendrimers in milligram quantities. In conjunction with a lipid component (DOTMA/DOPE), the best reagent, G1,2,3-KL ((LysLeu)8(LysLysLeu)4(LysLysLeu)2LysGlySerCys-NH2), improves transfection by 6–10-fold over commercial reagents under their respective optimal conditions. Emerging structure–activity relationships show that dendrimers with cationic and hydrophobic residues distributed in each generation are transfecting most efficiently. The trigenerational dendritic structure has an advantage over a linear analogue worth up to an order of magnitude. The success of placing the decisive cationic charge patterns in inner shells rather than previously on the surface of macromolecules suggests that this class of dendrimers significantly differs from existing transfection reagents. In the future, this platform may be tuned further and coupled to cell-targeting moieties to enhance transfection and cell specificity. PMID:23682947

  1. DNA compaction by azobenzene-containing surfactant

    International Nuclear Information System (INIS)

    Zakrevskyy, Yuriy; Kopyshev, Alexey; Lomadze, Nino; Santer, Svetlana; Morozova, Elena; Lysyakova, Ludmila; Kasyanenko, Nina

    2011-01-01

    We report on the interaction of cationic azobenzene-containing surfactant with DNA investigated by absorption and fluorescence spectroscopy, dynamic light scattering, and atomic force microscopy. The properties of the surfactant can be controlled with light by reversible switching of the azobenzene unit, incorporated into the surfactant tail, between a hydrophobic trans (visible irradiation) and a hydrophilic cis (UV irradiation) configuration. The influence of the trans-cis isomerization of the azobenzene on the compaction process of DNA molecules and the role of both isomers in the formation and colloidal stability of DNA-surfactant complexes is discussed. It is shown that the trans isomer plays a major role in the DNA compaction process. The influence of the cis isomer on the DNA coil configuration is rather small. The construction of a phase diagram of the DNA concentration versus surfactant/DNA charge ratio allows distancing between three major phases: colloidally stable and unstable compacted globules, and extended coil conformation. There is a critical concentration of DNA above which the compacted globules can be hindered from aggregation and precipitation by adding an appropriate amount of the surfactant in the trans configuration. This is because of the compensation of hydrophobicity of the globules with an increasing amount of the surfactant. Below the critical DNA concentration, the compacted globules are colloidally stable and can be reversibly transferred with light to an extended coil state.

  2. Surface density dependence of PCR amplicon hybridization on PNA/DNA probe layers

    DEFF Research Database (Denmark)

    Yao, Danfeng; Kim, Junyoung; Yu, Fang

    2005-01-01

    at an intermediate sodium concentration (approximately 100 mM). These effects were mainly ascribed to the electrostatic cross talk among the hybridized DNA molecules and the secondary structure of PCR amplicons. For the negatively charged DNA probes, the hybridization reaction was subjected additionally to the DNA....../DNA electrostatic barrier, particularly in lower ionic strength range (e.g., 10 approximately 150 mM Na(+)). The electrostatic cross talk was shown to be largely reduced if the PNA probe layer was sufficiently diluted by following a strategic templated immobilization method. As a consequence, a pseudo...

  3. Direction of Intercalation of a bis-Ru(II) Complex to DNA Probed by a Minor Groove Binding Molecule 4',6-Diamidino-2-phenylindole

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Yoon Jung; Kim, Raeyeong; Chitrapriya, Nataraj; Kim, Seog K.; Bae, Inho [Yeungnam Univ., Gyeongsan (Korea, Republic of)

    2013-10-15

    Direction of intercalation to DNA of the planar dipyrido[3,2-a:2',3'-c]phenazine ligands (dppz) of a bis-Ru(II) complex namely, [Ru(1,10-phenanthroline){sub 2}dipyrido[3,2-a:2',3'-c]phenazine]{sup 2+} linkered by a 1,3-bis(4-pyridyl)propane, was investigated by probing the behavior of 4',6-diamidino-2-phenylindole (DAPI) that bound deep in the minor groove. Bis-intercalation of DPPZ resulted in a little blue shift and hyperchromism in DAPI absorption band, and a large decrease in DAPI fluorescence intensity which accompanied by an increase in the dppz emission intensity. Diminishing the intensity of the positive induced circular dichroism (CD) and linear dichroism (LD) were also observed. These spectral changes indicated that insertion of dppz ligand caused the change of the binding mode of DAPI, which probably moved to the exterior of DNA from the minor groove and interacted with the phospghate groups of DNA by electrostatic interaction. At the surface of DNA, DAPI binds at the phosphate groups of DNA by electrostatic attraction. Consequently, this observation indicated that the dppz ligand intercalated from the minor groove.

  4. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  5. PH- and salt-dependent molecular combing of DNA: experiments and phenomenological model

    International Nuclear Information System (INIS)

    Benke, Annegret; Pompe, Wolfgang; Mertig, Michael

    2011-01-01

    λ-DNA as well as plasmids can be successfully deposited by molecular combing on hydrophobic surfaces, for pH values ranging from 4 to 10. On polydimethylsiloxane (PDMS) substrates, the deposited DNA molecules are overstretched by about 60-100%. There is a significant influence of sodium ions (NaCl) on the surface density of the deposited DNA, with a maximum near to 100 mM NaCl for a DNA solution (28 ng μl -1 ) at pH 8. The combing process can be described by a micromechanical model including: (i) the adsorption of free moving coiled DNA at the substrate; (ii) the stretching of the coiled DNA by the preceding meniscus; (iii) the relaxation of the deposited DNA to the final length. The sticky ends of λ-DNA cause an adhesion force in the range of about 400 pN which allows a stable overstretching of the DNA by the preceding meniscus. The exposing of hidden hydrophobic bonds of the overstretched DNA leads to a stable deposition on the hydrophobic substrate. The pH-dependent density of deposited DNA as well as the observed influence of sodium ions can be explained by their screening of the negatively charged DNA backbone and sticky ends, respectively. The final DNA length can be derived from a balance of the stored elastic energy of the overstretched molecules and the energy of adhesion.

  6. Characterizing DNA condensation and conformational changes in organic solvents.

    Directory of Open Access Journals (Sweden)

    Fuyou Ke

    Full Text Available Organic solvents offer a new approach to formulate DNA into novel structures suitable for gene delivery. In this study, we examined the in situ behavior of DNA in N, N-dimethylformamide (DMF at low concentration via laser light scattering (LLS, TEM, UV absorbance and Zeta potential analysis. Results revealed that, in DMF, a 21bp oligonucleotide remained intact, while calf thymus DNA and supercoiled plasmid DNA were condensed and denatured. During condensation and denaturation, the size was decreased by a factor of 8-10, with calf thymus DNA forming spherical globules while plasmid DNA exhibited a toroid-like conformation. In the condensed state, DNA molecules were still able to release the counterions to be negatively charged, indicating that the condensation was mainly driven by the excluded volume interactions. The condensation induced by DMF was reversible for plasmid DNA but not for calf thymus DNA. When plasmid DNA was removed from DMF and resuspended in an aqueous solution, the DNA was quickly regained a double stranded configuration. These findings provide further insight into the behavior and condensation mechanism of DNA in an organic solvent and may aid in developing more efficient non-viral gene delivery systems.

  7. cDNA cloning and expression of a human platelet-derived growth factor (PDGF) receptor specific for B-chain-containing PDGF molecules

    International Nuclear Information System (INIS)

    Claesson-Welsh, L.; Eriksson, A.; Moren, A.; Severinsson, L.; Ek, B.; Ostman, A.; Betsholtz, C.; Heldin, C.H.

    1988-01-01

    The structure of the human receptor for platelet-derived growth factor (PDGF) has been deduced through cDNA cloning. A 5.45-kilobase-pair cDNA clone predicts a 1,106-amino-acid polypeptide, including the cleavable signal sequence. The overall amino acid sequence similarity with the murine PDGFR receptor is 85%. After transcription of the cDNA and translation in vitro, a PDGR receptor antiserum was used to immunoprecipitate a product of predicted size, which also could be phosphorylated in vitro. Stable introduction of the cDNA into Chinese hamster ovary (CHO) cells led to the expression of a 190-kilodalton component, which was immunoprecipitated by the PDGF receptor antiserum; this most probably represents the mature PDGF receptor. Binding assays with different /sup 125/I-labeled dimeric forms of PDGF A and B chains showed that the PDGFR receptor expressed in CHO cells bound PDGF-BB and, to a lesser extent, PDGF-AB, but not PDGF-AA

  8. Towards characterization of DNA structure under physiological conditions in vivo at the single-molecule level using single-pair FRET

    Czech Academy of Sciences Publication Activity Database

    Fessl, Tomáš; Adamec, František; Polívka, Tomáš; Foldynová-Trantírková, Silvie; Vácha, František; Trantírek, L.

    2012-01-01

    Roč. 40, č. 16 (2012), s. 10 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z50510513; CEZ:AV0Z60220518 Keywords : in-cell FRET * fluorescence * DNA * nucleic acid * ATTO * in vivo Subject RIV: BO - Biophysics Impact factor: 8.278, year: 2012

  9. Site-directed mutational analysis of structural interactions of low molecule compounds binding to the N-terminal 8 kDa domain of DNA polymerase β

    International Nuclear Information System (INIS)

    Murakami, Shizuka; Kamisuki, Shinji; Takata, Kei-ichi; Kasai, Nobuyuki; Kimura, Seisuke; Mizushina, Yoshiyuki; Ohta, Keisuke; Sugawara, Fumio; Sakaguchi, Kengo

    2006-01-01

    We previously reported the mode of inhibition of DNA polymerase β (pol. β) by long chain fatty acids and a bile acid, involving binding analyses to the N-terminal 8-kDa DNA binding domain. Here we describe a site-directed mutational analysis in which the key amino acids (L11, K35, H51, K60, L77, and T79), which are direct interaction sites in the domain, were substituted with K, A, A, A, K, and A, respectively. And their pol. β interactions with a C24-long chain fatty acid, nervonic acid (NA), and a bile acid, lithocholic acid (LCA), were investigated by gel mobility shift assay and NMR spectroscopy. In the case of K35A, there was complete loss of DNA binding activity while K60A hardly has any activity. In contrast the other mutations had no appreciable effects. Thus, K35 and K60 are key amino acid sites for binding to template DNA. The DNA binding activities of L11K, H51A, and T79A as well as the wild type were inhibited by NA to the same extent. T79A demonstrated a disturbed interaction with LCA. 1 H- 15 N HSQC NMR analysis indicated that despite their many similarities, the wild-type and the mutant proteins displayed some significant chemical shift differences. Not only were the substituted amino acid residues three-dimensionally shifted, but some amino acids which are positioned far distant from the key amino acids showed a shift. These results suggest that the interaction surface was significantly distorted with the result that LCA could not bind to the domain. These findings confirm our previous biochemical and 3D structural proposals concerning inhibition by NA and LCA

  10. DNA origami based Au–Ag-core–shell nanoparticle dimers with single-molecule SERS sensitivity† †Electronic supplementary information (ESI) available: Additional information about materials and methods, designs of DNA origami templates, height profiles, additional SERS spectra, assignment of DNA bands, SEM images, additional AFM images, FDTD simulations, additional reference spectra for Cy3 and detailed description of EF estimation, simulated absorption and scattering spectra. See DOI: 10.1039/c5nr08674d Click here for additional data file.

    Science.gov (United States)

    Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.

    2016-01-01

    DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. PMID:26892770

  11. Electrical manipulation of oligonucleotides grafted to charged surfaces.

    Science.gov (United States)

    Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc

    2006-09-21

    The electrical manipulation of short DNA molecules on surfaces offers novel functionalities with fascinating possibilities in the field of bio-interfaces. Here we present systematic investigations of the electrical interactions which govern the structure of oligonucleotides on charged gold surfaces. Successively, we address influences of the applied field strength, the role of DC electrode potentials, in particular for polycrystalline surfaces, as well as screening effects of the surrounding electrolyte solution. Data obtained for single and double stranded DNA exhibit differences which can be attributed to the dissimilar flexibility of the different molecular conformations. A comparison of the experimental results with a basic model shows how the alignment of the molecules adjusts according to a balance between electrically induced ordering and stochastic thermal motions. The presented conclusions are expected to be of general relevance for the behaviour of polyelectrolytes exposed to localized electric fields at interfaces.

  12. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...

  13. Controlling gene networks and cell fate with precision-targeted DNA-binding proteins and small-molecule-based genome readers.

    Science.gov (United States)

    Eguchi, Asuka; Lee, Garrett O; Wan, Fang; Erwin, Graham S; Ansari, Aseem Z

    2014-09-15

    Transcription factors control the fate of a cell by regulating the expression of genes and regulatory networks. Recent successes in inducing pluripotency in terminally differentiated cells as well as directing differentiation with natural transcription factors has lent credence to the efforts that aim to direct cell fate with rationally designed transcription factors. Because DNA-binding factors are modular in design, they can be engineered to target specific genomic sequences and perform pre-programmed regulatory functions upon binding. Such precision-tailored factors can serve as molecular tools to reprogramme or differentiate cells in a targeted manner. Using different types of engineered DNA binders, both regulatory transcriptional controls of gene networks, as well as permanent alteration of genomic content, can be implemented to study cell fate decisions. In the present review, we describe the current state of the art in artificial transcription factor design and the exciting prospect of employing artificial DNA-binding factors to manipulate the transcriptional networks as well as epigenetic landscapes that govern cell fate.

  14. Cavity-Type DNA Origami-Based Plasmonic Nanostructures for Raman Enhancement.

    Science.gov (United States)

    Zhao, Mengzhen; Wang, Xu; Ren, Shaokang; Xing, Yikang; Wang, Jun; Teng, Nan; Zhao, Dongxia; Liu, Wei; Zhu, Dan; Su, Shao; Shi, Jiye; Song, Shiping; Wang, Lihua; Chao, Jie; Wang, Lianhui

    2017-07-05

    DNA origami has been established as addressable templates for site-specific anchoring of gold nanoparticles (AuNPs). Given that AuNPs are assembled by charged DNA oligonucleotides, it is important to reduce the charge repulsion between AuNPs-DNA and the template to realize high yields. Herein, we developed a cavity-type DNA origami as templates to organize 30 nm AuNPs, which formed dimer and tetramer plasmonic nanostructures. Transmission electron microscopy images showed that high yields of dimer and tetramer plasmonic nanostructures were obtained by using the cavity-type DNA origami as the template. More importantly, we observed significant Raman signal enhancement from molecules covalently attached to the plasmonic nanostructures, which provides a new way to high-sensitivity Raman sensing.

  15. Single Molecule Nano-Metronome

    Science.gov (United States)

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2008-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  16. Structural and electrostatic regularities in interactions of homeodomains with operator DNA

    International Nuclear Information System (INIS)

    Chirgadze, Yu.N.; Ivanov, V.V.; Polozov, R.V.; Zheltukhin, E.I.; Sivozhelezov, V.S.

    2008-01-01

    Interfaces of five DNA-homeodomain complexes, selected by similarity of structures and patterns of contacting residues, were compared. The long-range stage of the recognition process was characterized by electrostatic potentials about 5 Angstroem away from molecular surfaces of both protein and DNA. For proteins, clear positive potential is displayed only at the side contacting DNA, while grooves of DNA display a strong negative potential. Thus, one functional role of electrostatics is guiding the protein into the DNA major groove. At the close-range stage, neutralization of the phosphate charges by positively charged residues is necessary for decreasing the strong electrostatic potential of DNA, allowing nucleotide bases to participate in formation of protein-DNA atomic contacts in the interface. The protein's recognizing α-helix was shown to form both invariant and variable contacts with DNA by means of the certain specific side groups, with water molecules participating in some of the contacts. The invariant contacts included the highly specific Asn-Ade hydrogen bonds, nonpolar contacts of hydrophobic amino acids serving as barriers for fixing the protein on DNA, and interface water molecule cluster providing local mobility necessary for the dissociation of the protein-DNA complex. One of the water molecules is invariant and located at the center of the interface. Invariant contacts of the proteins are mostly formed with the TAAT motive of promoter DNA's forward strand. They distinguish the homeodomain family from other DNA-binding proteins. Variable contacts are formed with the reverse strand and are responsible for the binding specificity within the homeodomain family

  17. Molecule Matters

    Indian Academy of Sciences (India)

    DMABN, has received tremendous attention for nearly five decades. ... lar Charge Transfer (TICT) mechanism. According to this. Figure 1. A pictorial illus- tration of dual .... However, unlike the ground state measurement, this experiment.

  18. Atkins' molecules

    CERN Document Server

    Atkins, Peters

    2003-01-01

    Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.

  19. Interstellar Molecules

    Science.gov (United States)

    Solomon, Philip M.

    1973-01-01

    Radioastronomy reveals that clouds between the stars, once believed to consist of simple atoms, contain molecules as complex as seven atoms and may be the most massive objects in our Galaxy. (Author/DF)

  20. Vibronic dephasing model for coherent-to-incoherent crossover in DNA

    Science.gov (United States)

    Karasch, Patrick; Ryndyk, Dmitry A.; Frauenheim, Thomas

    2018-05-01

    In this paper, we investigate the interplay between coherent and incoherent charge transport in cytosine-guanine (GC-) rich DNA molecules. Our objective is to introduce a physically grounded approach to dephasing in large molecules and to understand the length-dependent charge transport characteristics, and especially the crossover from the coherent tunneling to incoherent hopping regime at different temperatures. Therefore, we apply the vibronic dephasing model and compare the results to the Büttiker probe model which is commonly used to describe decoherence effects in charge transport. Using the full ladder model and simplified one-dimensional model of DNA, we consider molecular junctions with alternating and stacked GC sequences and compare our results to recent experimental measurements.

  1. Fluorescence Microscopy of Nanochannel-Confined DNA.

    Science.gov (United States)

    Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

    2018-01-01

    Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

  2. DNA-Mediated Electrochemistry

    Science.gov (United States)

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  3. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  4. Vibrational, structural and electronic properties investigation by DFT calculations and molecular docking studies with DNA topoisomerase II of strychnobrasiline type alkaloids: A theoretical approach for potentially bioactive molecules

    Science.gov (United States)

    Costa, Renyer A.; Oliveira, Kelson M. T.; Costa, Emmanoel Vilaça; Pinheiro, Maria L. B.

    2017-10-01

    A combined experimental and theoretical DFT study of the structural, vibrational and electronic properties of strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline is presented using the Becke three-parameter Lee-Yang-Parr function (B3LYP) and 6-311G(2d,p) basis set. The theoretical geometry optimization data were compared with the X-ray data for a similar structure in the associated literature, showing close values. The calculated HOMO-LUMO gap values showed that the presence of substituents in the benzene ring influences the quantum properties which are directly related to the reactive properties. Theoretical UV spectra agreed well with the measured experimental data, with bands assigned. In addition, Natural Bond Orbitals (NBOs), Mapped molecular electrostatic potential surface (MEPS) and NLO calculations were also performed at the same theory level. The theoretical vibrational analysis revealed several characteristic vibrations that may be used as a diagnostic tool for other strychnobrasiline type alkaloids, simplifying their identification and structural characterization. Molecular docking calculations with DNA Topoisomerase II-DNA complex showed binding free energies values of -8.0 and -9.5 kcal/mol for strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline respectively, while for amsacrine, used for the treatment of leukemia, the binding free energy ΔG presented a value of -10.0 kcal/mol, suggesting that strychnobrasiline derivative alkaloids might exhibit an antineoplastic activity.

  5. Theoretical description of biomolecular hydration - Application to A-DNA

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, A.E.; Hummer, G. [Los Alamos National Laboratory, NM (United States); Soumpasis, D.M. [Max Planck Inst. for Biophysical Chemistry, Goettingen (Germany)

    1994-12-31

    The local density of water molecules around a biomolecule is constructed from calculated two- and three-points correlation functions of polar solvents in water using a Potential-of-Mean-Force (PMF) expansion. As a simple approximation, the hydration of all polar (including charged) groups in a biomolecule is represented by the hydration of water oxygen in bulk water, and the effect of non-polar groups on hydration are neglected, except for excluded volume effects. Pair and triplet correlation functions are calculated by molecular dynamics simulations. We present calculations of the structural hydration for ideal A-DNA molecules with sequences [d(CG){sub 5}]{sub 2} and [d(C{sub 5}G{sub 5})]{sub 2}. We find that this method can accurately reproduce the hydration patterns of A-DNA observed in neutron diffraction experiments on oriented DNA fibers.

  6. Theoretical description of biomolecular hydration - Application to A-DNA

    International Nuclear Information System (INIS)

    Garcia, A.E.; Hummer, G.; Soumpasis, D.M.

    1994-01-01

    The local density of water molecules around a biomolecule is constructed from calculated two- and three-points correlation functions of polar solvents in water using a Potential-of-Mean-Force (PMF) expansion. As a simple approximation, the hydration of all polar (including charged) groups in a biomolecule is represented by the hydration of water oxygen in bulk water, and the effect of non-polar groups on hydration are neglected, except for excluded volume effects. Pair and triplet correlation functions are calculated by molecular dynamics simulations. We present calculations of the structural hydration for ideal A-DNA molecules with sequences [d(CG) 5 ] 2 and [d(C 5 G 5 )] 2 . We find that this method can accurately reproduce the hydration patterns of A-DNA observed in neutron diffraction experiments on oriented DNA fibers

  7. DNA: Structure and function

    DEFF Research Database (Denmark)

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir

    1998-01-01

    This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...

  8. Hole transfer in DNA studied by pulse radiolysis

    International Nuclear Information System (INIS)

    Majima, T.; Kawai, K.; Takada, T.

    2003-01-01

    Attention has been paid to charge transfer in DNA with respect to oxidation damage of DNA and nano bio-devices such as DNA molecular wire. We report hole transfer in DNA during pulse radiolysis of molecule-conjugated DNA (M-DNA). Direct measurement of the charge transfer in DNA has never been reported due to the low extinction coefficient of nucleobase radical ions and to difficult definition of nucleobases. We have used M-DNA in which M radical cation has enough extinction coefficient and distinct absorption. Radical cation was generated in M-DNA during pulse radiolysis in water, and hole transfer through DNA was monitored by time-resolved transient absorption spectra of the radical cations. Hole was generated in Py-DNA by pulse radiolysis in water. Hole transfer to Py through DNA was monitored by transient absorption of Py'+ at 465 nm. The hole hopping rate (k) from G-region to Py was determined to be 104 s-1 which decreased with intervening A-T base-pairs between Py and G-region. We suppose that G(-H+)-radical and C(+H+) basepair can alive in DNA more than 100 us and that this long lifetime is responsible to the long-distance hole transfer. The dependence of k against the distance between the G-region and Py led to the slope of 0.3 Angstroms-1 which is due to multi-step k with the smaller distance dependence. On the other hand, beta = 0.6 Angstroms-1 was found for the single-step k in DNA. On the basis of pulse radiolytic studied on various molecule-conjugated DNA, we found that hole transfer between two chromophores (A and B)-conjugated DNA increased with decreasing the distance between A and B and was accelerated slightly with increasing the number of Gs of the bridge between A and B, and that k was modulated by the bridged base sequences. We also found that weak distance dependent hole transfer in DNA by adenine hopping mechanism

  9. Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy

    Energy Technology Data Exchange (ETDEWEB)

    McEwen, Gerald D.; Chen Fan [Biological Engineering Program, Department of Biological and Irrigation Engineering, Utah State University, 4105 Old Main Hill, Logan, UT 84322-4105 (United States); Zhou Anhong, E-mail: Anhong.Zhou@usu.edu [Biological Engineering Program, Department of Biological and Irrigation Engineering, Utah State University, 4105 Old Main Hill, Logan, UT 84322-4105 (United States)

    2009-06-08

    Fundamental understanding of interfacial electron transfer (ET) among electrolyte/DNA/solid-surface will facilitate the design for electrical detection of DNA molecules. In this report, the electron transfer characteristics of synthetic DNA (sequence from pathogenic Cryptosporidium parvum) self-assembled on a gold surface was electrochemically studied. The effects of immobilization order on the interface ET related parameters such as diffusion coefficient (D{sub 0}), surface coverage ({theta}{sub R}), and monolayer thickness (d{sub i}) were determined by cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). DNA surface density ({Gamma}{sub DNA}) was determined by the integration of the charge of the electro-oxidation current peaks during the initial cyclic voltammetry scans. It was found that the DNA surface densities at different modifications followed the order: {Gamma}{sub DNA} (dsS-DNA/Au) > {Gamma}{sub DNA} (MCH/dsS-DNA/Au) > {Gamma}{sub DNA} (dsS-DNA/MCH/Au). It was also revealed that the electro-oxidation of the DNA modified gold surface would involve the oxidation of nucleotides (guanine and adenine) with a 5.51 electron transfer mechanism and the oxidative desorption of DNA and MCH molecules by a 3 electron transfer mechanism. STM topography and current image analysis indicated that the surface conductivity after each surface modification followed the order: dsS-DNA/Au < MCH/dsS-DNA/Au < oxidized MCH/dsS-DNA/Au < Hoechst/oxidized MCH/dsS-DNA/Au. The results from this study suggested a combination of variations in immobilization order may provide an alternative approach for the optimization of DNA hybridization and the further development for electrical detection of DNA.

  10. Real-time monitoring and manipulation of single bio-molecules in free solution

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hung-Wing [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    The observation and manipulation of single biomolecules allow their dynamic behaviors to be studied to provide insight into molecular genetics, biochip assembly, biosensor design, DNA biophysics. In a PDMS/glass microchannel, a nonuniform electroosmotic flow (EOF) was created. By using a scanning confocal fluorescence microscope and total internal-reflection fluorescence microscope (TIRFM), we demonstrated that negatively charged DNA molecules were focused by the nonuniform EOF into a thin layer at the glass surface. This phenomenon was applied to selectively detect target DNA molecules without requiring the separation of excessive probes and can be applied continuously to achieve high throughput. A variable-angle-TIRFM was constructed for imaging single DNA molecule dynamics at a solid/liquid interface. Implications we have are that the measured intensities cannot be used directly to determine the distances of molecules from the surface and the experimental counting results depict the distance-dependent dynamics of molecules near the surface; Molecules at low ionic strengths experience electrostatic repulsion at distances much further away from the surface than the calculated thickness of the electrical double layer. {delta}-DNA was employed as a nanoprobe for different functionalized surfaces to elucidate adsorption in chromatography. The 12-base unpaired ends of this DNA provide exposed purine and pyrimidine groups for adsorption. Patterns of self-assembled monolayers (SAMs) and patterns of metal oxides are generated. By recording the real-time dynamic motion of DNA molecules at the SAMs/aqueous interface, the various parameters governing the retention of an analyte during chromatographic separation can be studied. Even subtle differences among adsorptive forces can be revealed. Dynamic conformational changes of the prosthetic group, flavin adenine dinucleotide (FAD), in flavoprotein NADH peroxidase, in thioredoxin reductase, and in free solution were monitored

  11. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Science.gov (United States)

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  12. Strand Invasion Based Amplification (SIBA®: a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Directory of Open Access Journals (Sweden)

    Mark J Hoser

    Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  13. The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: direct observation of desorption and layer reorientation.

    Science.gov (United States)

    Arinaga, K; Rant, U; Tornow, M; Fujita, S; Abstreiter, G; Yokoyama, N

    2006-06-20

    We study the coadsorption of mercaptohexanol onto preimmobilized oligonucleotide layers on gold. Monitoring the position of the DNA relative to the surface by optical means directly shows the mercaptohexanol-induced desorption of DNA and the reorientation of surface-tethered strands in situ and in real time. By simultaneously recording the electrochemical electrode potential, we are able to demonstrate that changes in the layer conformation are predominantly of electrostatic origin and can be reversed by applying external bias to the substrate.

  14. Application of a Novel and Automated Branched DNA in Situ Hybridization Method for the Rapid and Sensitive Localization of mRNA Molecules in Plant Tissues

    Directory of Open Access Journals (Sweden)

    Andrew J. Bowling

    2014-04-01

    Full Text Available Premise of the study: A novel branched DNA detection technology, RNAscope in situ hybridization (ISH, originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. Methods and Results: Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC and phosphoenolpyruvate carboxykinase (PEPCK. Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. Conclusions: RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.

  15. Conformational Smear Characterization and Binning of Single-Molecule Conductance Measurements for Enhanced Molecular Recognition.

    Science.gov (United States)

    Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-01

    Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual