Investigation of magnetic and magneto-transport properties of ferromagnetic-charge ordered core-shell nanostructures

Science.gov (United States)

Das, Kalipada

2017-10-01

In our present study, we address in detail the magnetic and magneto-transport properties of ferromagnetic-charge ordered core-shell nanostructures. In these core-shell nanostructures, well-known half metallic La0.67Sr0.33MnO3 nanoparticles (average particle size, ˜20 nm) are wrapped by the charge ordered antiferromagnetic Pr0.67Ca0.33MnO3 (PCMO) matrix. The intrinsic properties of PCMO markedly modify it into such a core-shell form. The robustness of the PCMO matrix becomes fragile and melts at an external magnetic field (H) of ˜20 kOe. The analysis of magneto-transport data indicates the systematic reduction of the electron-electron and electron-magnon interactions in the presence of an external magnetic field in these nanostructures. The pronounced training effect appears in this phase separated compound, which was analyzed by considering the second order tunneling through the grain boundaries of the nanostructures. Additionally, the analysis of low field magnetoconductance data supports the second order tunneling and shows the close value of the universal limit (˜1.33).

Dihedral angle control to improve the charge transport properties of conjugated polymers in organic field effect transistors

Science.gov (United States)

Dharmapurikar, Satej S.; Chithiravel, Sundaresan; Mane, Manoj V.; Deshmukh, Gunvant; Krishnamoorthy, Kothandam

2018-03-01

Diketopyrrolopyrrole (DPP) and i-Indigo (i-Ind) are two monomers that are widely explored as active materials in organic field effect transistor and solar cells. These two molecules showed impressive charge carrier mobility due to better packing that are facilitated by quadrupoles. We hypothesized that the copolymers of these monomers would also exhibit high charge carrier mobility. However, we envisioned that the dihedral angle at the connecting point between the monomers will play a crucial role in packing as well as charge transport. To understand the impact of dihedral angle on charge transport, we synthesized three copolymers, wherein the DPP was sandwiched between benzenes, thiophenes and furans. The copolymer of i-Indigo and furan comprising DPP showed a band gap of 1.4 eV with a very high dihedral angle of 179°. The polymer was found to pack better and the coherence length was found to be 112 Å. The hole carrier mobility of these polymer was found to be highest among the synthesized polymer i.e. 0.01 cm2/vs. The copolymer comprising benzene did not transport hole and electrons. The dihedral angle at the connecting point between i and Indigo and benzene DPP was 143 Å, which the packing and consequently charge transport properties.

Simulations of charge transport in organic compounds

Energy Technology Data Exchange (ETDEWEB)

Vehoff, Thorsten

2010-05-05

We study the charge transport properties of organic liquid crystals, i.e. hexabenzocoronene and carbazole macrocycle, and single crystals, i.e. rubrene, indolocarbazole and benzothiophene derivatives (BTBT, BBBT). The aim is to find structure-property relationships linking the chemical structure as well as the morphology with the bulk charge carrier mobility of the compounds. To this end, molecular dynamics (MD) simulations are performed yielding realistic equilibrated morphologies. Partial charges and molecular orbitals are calculated based on single molecules in vacuum using quantum chemical methods. The molecular orbitals are then mapped onto the molecular positions and orientations, which allows calculation of the transfer integrals between nearest neighbors using the molecular orbital overlap method. Thus we obtain realistic transfer integral distributions and their autocorrelations. In case of organic crystals the differences between two descriptions of charge transport, namely semi-classical dynamics (SCD) in the small polaron limit and kinetic Monte Carlo (KMC) based on Marcus rates, are studied. The liquid crystals are investigated solely in the hopping limit. To simulate the charge dynamics using KMC, the centers of mass of the molecules are mapped onto lattice sites and the transfer integrals are used to compute the hopping rates. In the small polaron limit, where the electronic wave function is spread over a limited number of neighboring molecules, the Schroedinger equation is solved numerically using a semi-classical approach. The carbazole macrocycles form columnar structures arranged on a hexagonal lattice with side chains facing inwards, so columns can closely approach each other allowing inter-columnar and thus three-dimensional transport. We are able to show that, on the time-scales of charge transport, static disorder due to slow side chain motions is the main factor determining the mobility. The high mobility of rubrene is explained by two main

Two-Dimensional Charge Transport in Disordered Organic Semiconductors

NARCIS (Netherlands)

Brondijk, J. J.; Roelofs, W. S. C.; Mathijssen, S. G. J.; Shehu, A.; Cramer, T.; Biscarini, F.; Blom, P. W. M.; de Leeuw, D. M.

2012-01-01

We analyze the effect of carrier confinement on the charge-transport properties of organic field-effect transistors. Confinement is achieved experimentally by the use of semiconductors of which the active layer is only one molecule thick. The two-dimensional confinement of charge carriers provides

Transport properties of triarylamine based dendrimers studied by space charge limited current transients

Science.gov (United States)

Szymanski, Marek Z.; Kulszewicz-Bajer, Irena; Faure-Vincent, Jérôme; Djurado, David

2012-08-01

We have studied hole transport in triarylamine based dendrimer using space-charge-limited current transient technique. A mobility of 8 × 10-6 cm2/(V s) and a characteristic detrapping time of about 100 ms have been obtained. We found that quasi-ohmic contact is formed with gold. The obtained mobility differs from the apparent one given by the analysis of stationary current-voltage characteristics because of a limited contact efficiency. The comparison between transients obtained from fresh and aged samples reveals no change in mobility with aging. The deterioration of electrical properties is exclusively caused by trap formation and accumulation of ionic conducting impurities. Finally, repeated transient measurements have been applied to analyze the dynamics of charge trapping process.

Theoretical studies on the effect of benzene and thiophene groups on the charge transport properties of Isoindigo and its derivatives

Science.gov (United States)

Jia, Xu-Bo; Wei, Hui-Ling; Shi, Ya-Ting; Shi, Ya-Rui; Liu, Yu-Fang

2017-12-01

In this work, the charge transport properties of Isoindigo (II) and its derivatives which have the same hexyl chain were theoretically investigated by the Marcus-Hush theory combined with density functional theory (DFT). Here we demonstrate that the changes of benzene and thiophene groups in molecular structure have an important influence on the charge transport properties of organic semiconductor. The benzene rings of II are replaced by thiophenes to form the thienoisoindigo (TII), and the addition of benzene rings to the TII form the benzothienoisoindigo (BTII). The results show that benzene rings and thiophenes change the chemical structure of crystal molecules, which lead to different molecule stacking, thus, the length of hydrogen bond was changed. A shorter intermolecular hydrogen bond lead to tighter molecular stacking, which reduces the center-to-center distance and enhances the ability of charge transfer. At the same time, we theoretically demonstrated that II and BTII are the ambipolar organic semiconductor. BTII has better carrier mobility. The hole mobility far greater than electron mobility in TII, which is p-type organic semiconductor. Among all hopping path, we find that the distance of face-to-face stacking in II is the shortest and the electron-transport electronic coupling Ve is the largest, but II has not a largest anisotropic mobility, because the reorganization energy has a greater influence on the mobility than the electronic coupling. This work is helpful for designing ambipolar organic semiconductor materials with higher charge transport properties by introducing benzene ring and thiophene.

Charge transport in amorphous organic semiconductors

Energy Technology Data Exchange (ETDEWEB)

Lukyanov, Alexander

2011-03-15

Organic semiconductors with the unique combination of electronic and mechanical properties may offer cost-effective ways of realizing many electronic applications, e. g. large-area flexible displays, printed integrated circuits and plastic solar cells. In order to facilitate the rational compound design of organic semiconductors, it is essential to understand relevant physical properties e. g. charge transport. This, however, is not straightforward, since physical models operating on different time and length scales need to be combined. First, the material morphology has to be known at an atomistic scale. For this atomistic molecular dynamics simulations can be employed, provided that an atomistic force field is available. Otherwise it has to be developed based on the existing force fields and first principle calculations. However, atomistic simulations are typically limited to the nanometer length- and nanosecond time-scales. To overcome these limitations, systematic coarse-graining techniques can be used. In the first part of this thesis, it is demonstrated how a force field can be parameterized for a typical organic molecule. Then different coarse-graining approaches are introduced together with the analysis of their advantages and problems. When atomistic morphology is available, charge transport can be studied by combining the high-temperature Marcus theory with kinetic Monte Carlo simulations. The approach is applied to the hole transport in amorphous films of tris(8- hydroxyquinoline)aluminium (Alq{sub 3}). First the influence of the force field parameters and the corresponding morphological changes on charge transport is studied. It is shown that the energetic disorder plays an important role for amorphous Alq{sub 3}, defining charge carrier dynamics. Its spatial correlations govern the Poole-Frenkel behavior of the charge carrier mobility. It is found that hole transport is dispersive for system sizes accessible to simulations, meaning that calculated

i-CELIV technique for investigation of charge carriers transport properties

Energy Technology Data Exchange (ETDEWEB)

Važgėla, J., E-mail: julius.vazgela@ff.vu.lt; Genevičius, K.; Juška, G.

2016-10-20

The extraction of the injected charge carriers by linearly increasing voltage (i-CELIV) is a promising method for separate analysis of the holes and electrons transport properties in the bulk heterojunction layers. We are demonstrating how to establish the mobility dependence on the electric field and obtain more precise results by performing corrections in transit time by this technique. [6,6]-Phenyl C61 butyric acid methyl ester (PCBM) and poly[2,6-(4,4-bis-(2-ethylhexyl)-4H-cyclopenta [2,1-b;3,4-b′]dithiophene)-alt-4,7(2,1,3-benzothiadiazole)] (PCPDTBT) bulk heterojunctions with different blend ratios were experimentally tested with i-CELIV method. The hole and electron mobilities were found to be heavily imbalanced in the optimised 3:1 PCBM:PCPDTBT bulk heterojunction.

Role of mesoscopic morphology in charge transport of doped ...

Indian Academy of Sciences (India)

In doped polyaniline (PANI), the charge transport properties are determined by mesoscopic morphology, which in turn is controlled by the molecular recognition interactions among polymer chain, dopant and solvent. Molecular recognition plays a significant role in chain conformation and charge delocalization.

Correction: The effect of recombination under short-circuit conditions on the determination of charge transport properties in nanostructured photoelectrodes.

Science.gov (United States)

Villanueva-Cab, J; Anta, J A; Oskam, G

2016-05-28

Correction for 'The effect of recombination under short-circuit conditions on the determination of charge transport properties in nanostructured photoelectrodes' by J. Villanueva-Cab et al., Phys. Chem. Chem. Phys., 2016, 18, 2303-2308.

Charge transport properties of CdMnTe radiation detectors

Directory of Open Access Journals (Sweden)

Prokopovich D. A.

2012-10-01

Full Text Available Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading charge collection is reduced with increasing values of bias voltage. The electron drift velocity was calculated from the rise time distribution of the preamplifier output pulses at each measured bias. From the dependence of drift velocity on applied electric field the electron mobility was found to be μn = (718 ± 55 cm2/Vs at room temperature.

Charge Injection and Transport in Metal/Polymer Chains/Metal Sandwich Structure

International Nuclear Information System (INIS)

Hai-Hong, Li; Dong-Mei, Li; Yuan, Li; Kun, Gao; De-Sheng, Liu; Shi-Jie, Xie

2008-01-01

Using the tight-binding Su–Schrieffer–Heeger model and a nonadiabatic dynamic evolution method, we study the dynamic processes of the charge injection and transport in a metal/two coupled conjugated polymer chains/metal structure. It is found that the charge interchain transport is determined by the strength of the electric field and the magnitude of the voltage bias applied on the metal electrode. The stronger electric field and the larger voltage bias are both in favour of the charge interchain transport. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Charge transport properties of graphene: Effects of Cu-based gate electrode

Energy Technology Data Exchange (ETDEWEB)

Tang, Qide [School of Physics and Optoelectronics, Xiangtan University, Xiangtan 411105 (China); Zhang, C. X., E-mail: zhangchunxiao@xtu.edu.cn; Tang, Chao, E-mail: tang-chao@xtu.edu.cn; Zhong, Jianxin [School of Physics and Optoelectronics, Xiangtan University, Xiangtan 411105 (China); Hunan Provincial Key Laboratory of Micro-Nano Energy Materials and Devices, Xiangtan University, Hunan 411105 (China); He, Chaoyu [Hunan Provincial Key Laboratory of Micro-Nano Energy Materials and Devices, Xiangtan University, Hunan 411105 (China)

2016-07-21

Using the first-principles nonequilibrium Green's function method, we study effects of Cu and Ni@Cu used as the Cu-based gate electrode on the charge transport of graphene in the field effect transistors (FET). We find that the transmission of graphene decreases with both Cu and Ni@Cu absorbed in the scatter region. Especially, noticeable transmission gaps are present around the Femi level. The transmission gaps are still effective, and considerable cut-off regions are found under the non-equilibrium environment. The Ni@Cu depresses the transmission of graphene more seriously than the Cu and enlarges the transmission gap in armchair direction. The effects on the charge transport are attributed to the redistribution of electronic states of graphene. Both Cu and Ni@Cu induce the localization of states, so as to block the electronic transport. The Ni@Cu transforms the interaction between graphene and gate electrode from the physisorption to the chemisorption, and then induces more localized states, so that the transmission decreases further. Our results suggest that besides being used to impose gate voltage, the Cu-based gate electrode itself will have a considerable effect on the charge transport of graphene and induces noticeable transmission gap in the FET.

Charge transport model in nanodielectric composites based on quantum tunneling mechanism and dual-level traps

Energy Technology Data Exchange (ETDEWEB)

Li, Guochang; Chen, George, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China); School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ (United Kingdom); Li, Shengtao, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China)

2016-08-08

Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loading concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.

Charge transport properties of CdMnTe radiation detectors

Energy Technology Data Exchange (ETDEWEB)

Kim K.; Rafiel, R.; Boardman, M.; Reinhard, I.; Sarbutt, A.; Watt, G.; Watt, C.; Uxa, S.; Prokopovich, D.A.; Belas, E.; Bolotnikov, A.E.; James, R.B.

2012-04-11

Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe)radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading chargecollection is reduced with increasing values of bias voltage. The electron transit time was determined from time of flight measurements. From the dependence of drift velocity on applied electric field the electron mobility was found to be n = (718 55) cm2/Vs at room temperature.

The effect of hole transporting layer in charge accumulation properties of p-i-n perovskite solar cells

Directory of Open Access Journals (Sweden)

Fedros Galatopoulos

2017-07-01

Full Text Available The charge accumulation properties of p-i-n perovskite solar cells were investigated using three representative organic and inorganic hole transporting layer (HTL: (a Poly(3,4-ethylenedioxythiophene-poly(styrenesulfonate (PEDOT:PSS, Al 4083, (b copper-doped nickel oxide (Cu:NiOx, and (c Copper oxide (CuO. Through impedance spectroscopy analysis and modelling, it is shown that charge accumulation is decreased in the HTL/perovskite interface, between PEDOT:PSS to Cu:NiOx and CuO. This was indicative from the decrease in double layer capacitance (Cdl and interfacial charge accumulation capacitance (Cel, resulting in an increase to recombination resistance (Rrec, thus decreased charge recombination events between the three HTLs. Through AFM measurements, it is also shown that the reduced recombination events (followed by the increase in Rrec are also a result of increased grain size between the three HTLs, thus reduction in the grain boundary area. These charge accumulation properties of the three HTLs have resulted in an increase to the power conversion efficiency between the PEDOT:PSS (8.44%, Cu:NiOx (11.45%, and CuO (15.3%-based devices.

Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy

International Nuclear Information System (INIS)

Lee, Min Hyung; Song, Hyunwook

2013-01-01

We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects

Temperature dependent charge transport in poly(3-hexylthiophene) diodes

Science.gov (United States)

Rahaman, Abdulla Bin; Sarkar, Atri; Banerjee, Debamalya

2018-04-01

In this work, we present charge transport properties of poly(3-hexylthiophene) (P3HT) diodes under dark conditions. Temperature dependent current-voltage (J-V) characteristics shows that charge transport represents a transition from ohomic to trap limited current. The forward current density obeys a power law J˜Vm, m>2 represents the space charge limited current region in presence of traps within the band gap. Frequency dependent conductivity has been studied in a temperature range 150K-473K. The dc conductivity values show Arrhenius like behavior and it gives conductivity activation energy 223 meV. Temperature dependent conductivity indicates a thermodynamic transition of our system.

Magnetoresistance and charge transport in graphene governed by nitrogen dopants.

Science.gov (United States)

Rein, Markus; Richter, Nils; Parvez, Khaled; Feng, Xinliang; Sachdev, Hermann; Kläui, Mathias; Müllen, Klaus

2015-02-24

We identify the influence of nitrogen-doping on charge- and magnetotransport of single layer graphene by comparing doped and undoped samples. Both sample types are grown by chemical vapor deposition (CVD) and transferred in an identical process onto Si/SiO2 wafers. We characterize the samples by Raman spectroscopy as well as by variable temperature magnetotransport measurements. Over the entire temperature range, the charge transport properties of all undoped samples are in line with literature values. The nitrogen doping instead leads to a 6-fold increase in the charge carrier concentration up to 4 × 10(13) cm(-2) at room temperature, indicating highly effective doping. Additionally it results in the opening of a charge transport gap as revealed by the temperature dependence of the resistance. The magnetotransport exhibits a conspicuous sign change from positive Lorentz magnetoresistance (MR) in undoped to large negative MR that we can attribute to the doping induced disorder. At low magnetic fields, we use quantum transport signals to quantify the transport properties. Analyses based on weak localization models allow us to determine an orders of magnitude decrease in the phase coherence and scattering times for doped samples, since the dopants act as effective scattering centers.

Frequency dependent magneto-transport in charge transfer Co(II) complex

Energy Technology Data Exchange (ETDEWEB)

Shaw, Bikash Kumar; Saha, Shyamal K., E-mail: cnssks@iacs.res.in

2014-09-01

A charge transfer chelated system containing ferromagnetic metal centers is the ideal system to investigate the magneto-transport and magneto-dielectric effects due to the presence of both electronic as well as magnetic properties and their coupling. Magneto-transport properties in materials are usually studied through dc charge transport under magnetic field. As frequency dependent conductivity is an essential tool to understand the nature of carrier wave, its spatial extension and their mutual interaction, in the present work, we have investigated frequency dependent magneto-transport along with magnetization behavior in [Co{sub 2}(II)-(5-(4-PhMe)-1,3,4-oxadiazole-H{sup +}-2-thiolate){sub 5}](OAc){sub 4} metal complex to elucidate the nature of above quantities and their response under magnetic field in the transport property. We have used the existing model for ac conduction incorporating the field dependence to explain the frequency dependent magneto-transport. It is seen that the frequency dependent magneto-transport could be well explained using the existing model for ac conduction. -Highlights: • Chelated Co(II) complex is synthesized for magneto-transport applications. • Frequency dependent magneto-transport and magnetization behavior are studied. • Nature of carrier wave, its spatial extension is investigated under magnetic field. • Existing model for ac conduction is used with magnetic field dependence.

Correlation of nanostructure and charge transport properties of oxidized a -SiC:H films

Energy Technology Data Exchange (ETDEWEB)

Gordienko, S.O.; Nazarov, A.N.; Vasin, A.V.; Rusavsky, A.V.; Lysenko, V.S. [Lashkaryov Institute of Semiconductor Physics, National Academy of Sciences of Ukraine, Prospekt Nauki 41, 03028 Kyiv (Ukraine)

2012-06-15

This paper considers the influence of low temperature oxidation on structural and electrical properties of amorphous carbon-rich a -Si{sub 1-x}C{sub x}:H thin films fabricated by reactive RF magnetron sputtering. It is shown that oxidation leads to formation of SiO{sub x} matrix with graphite-like carbon inclusions. Such conductive precipitates has a strong effect on charge transport in oxidized a -Si{sub 1-x}C{sub x}:H films (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Charge transport in disordered organic field-effect transistors

NARCIS (Netherlands)

Tanase, Cristina; Blom, Paul W.M.; Meijer, Eduard J.; Leeuw, Dago M. de; Jabbour, GE; Carter, SA; Kido, J; Lee, ST; Sariciftci, NS

2002-01-01

The transport properties of poly(2,5-thienylene vinylene) (PTV) field-effect transistors (FET) have been investigated as a function of temperature under controlled atmosphere. In a disordered semiconductor as PTV the charge carrier mobility, dominated by hopping between localized states, is

Charge transport in a CoPt3 nanocrystal microwire

International Nuclear Information System (INIS)

Beecher, P.; De Marzi, G.; Quinn, A.J.; Redmond, G.; Shevchenko, E.V.; Weller, H.

2004-01-01

The electrical characteristics of single CoPt 3 nanocrystal microwires formed by magnetic field-directed growth from colloidal solutions are presented. The wires comprise disordered assemblies of discrete nanocrystals, separated from each other by protective organic ligand shells. Electrical data indicate that the activated charge transport properties of the wires are determined by the nanocrystal charging energy, governed by the size and capacitance of the individual nanocrystals. Focused ion beam-assisted deposition of Pt metal at the wire-electrode junctions is employed to optimize the wire-electrode contacts, whilst maintaining the nanocrystal-dominated transport characteristics of these one-dimensional nanocrystal structures

Effects of Packing Structure on the Optoelectronic and Charge Transport Properties in Poly(9,9-di-n-octylfluorene-alt-benzothiadiazole)

DEFF Research Database (Denmark)

Donley, C.L.; Zaumseil, J.; Andreasen, Jens Wenzel

2005-01-01

on the optoelectronic and charge transport properties of these films. A model based on quantum chemical calculations, wide-angle X-ray scattering, atomic force microscopy, Raman spectroscopy, photoluminescence, and electron mobility measurements was developed to describe the restructuring of the polymer film...

Charge transport problem

International Nuclear Information System (INIS)

Lee, E.P.

1977-01-01

In a recent report (UCID 17346, ''Relativistic Particle Beam in a Semi-Infinite Axially Symmetric conducting channel extending from a perfectly conducting plane,'' Dec. 13, 1976) Cooper and Neil demonstrate that the net charge transported by a beam pulse injected into a channel of finite conductivity equals the charge of the beam itself. The channel is taken to be infinite in the positive z direction, has finite radius and is terminated by a conducting ground plane at z =0. This result is not an obvious one, and it is restricted in its applicability by the special model assumed for the channel. It is the purpose to explain the result of Cooper and Neil in more qualitative terms and to make similar calculations using several other channel models. It must be emphasized that these calculations are not concerned with the fate of the transported charge after the pulse has stopped, but rather with how much charge leaves the ground plane assuming the pulse does not stop

Interpreting equilibrium-conductivity and conductivity-relaxation measurements to establish thermodynamic and transport properties for multiple charged defect conducting ceramics.

Science.gov (United States)

Zhu, Huayang; Ricote, Sandrine; Coors, W Grover; Kee, Robert J

2015-01-01

A model-based interpretation of measured equilibrium conductivity and conductivity relaxation is developed to establish thermodynamic, transport, and kinetics parameters for multiple charged defect conducting (MCDC) ceramic materials. The present study focuses on 10% yttrium-doped barium zirconate (BZY10). In principle, using the Nernst-Einstein relationship, equilibrium conductivity measurements are sufficient to establish thermodynamic and transport properties. However, in practice it is difficult to establish unique sets of properties using equilibrium conductivity alone. Combining equilibrium and conductivity-relaxation measurements serves to significantly improve the quantitative fidelity of the derived material properties. The models are developed using a Nernst-Planck-Poisson (NPP) formulation, which enables the quantitative representation of conductivity relaxations caused by very large changes in oxygen partial pressure.

Charge transport in non-polar and semi-polar III-V nitride heterostructures

International Nuclear Information System (INIS)

Konar, Aniruddha; Verma, Amit; Fang, Tian; Zhao, Pei; Jana, Raj; Jena, Debdeep

2012-01-01

Compared to the intense research focus on the optical properties, the transport properties in non-polar and semi-polar III-nitride semiconductors remain relatively unexplored to date. The purpose of this paper is to discuss charge-transport properties in non-polar and semi-polar orientations of GaN in a comparative fashion to what is known for transport in polar orientations. A comprehensive approach is adopted, starting from an investigation of the differences in the electronic bandstructure along different polar orientations of GaN. The polarization fields along various orientations are then discussed, followed by the low-field electron and hole mobilities. A number of scattering mechanisms that are specific to non-polar and semi-polar GaN heterostructures are identified, and their effects are evaluated. Many of these scattering mechanisms originate due to the coupling of polarization with disorder and defects in various incarnations depending on the crystal orientation. The effect of polarization orientation on carrier injection into quantum-well light-emitting diodes is discussed. This paper ends with a discussion of orientation-dependent high-field charge-transport properties including velocity saturation, instabilities and tunneling transport. Possible open problems and opportunities are also discussed. (paper)

Polarization and charge-transfer effect on the transport properties in two-dimensional electron gases/LaNiO3 heterostructure

Science.gov (United States)

Chen, M. J.; Ning, X. K.; Wang, Z. J.; Liu, P.; Wang, S. F.; Wang, J. L.; Fu, G. S.; Ma, S.; Liu, W.; Zhang, Z. D.

2018-01-01

The film thickness dependent transport properties of the LaNiO3 (LNO) layer epitaxially grown on LaAlO3/SrTiO3 (LAO) 2-dimensional electronic gas (2DEG) have been investigated. The ultrathin LNO films grown on the 2DEG have a sheet resistance below the values of h/e2 in all temperature ranges. The electron density is enhanced by more than one order of magnitude by capping LNO films. X-ray photoelectron spectroscopy shows that the interface undergoes unambiguous charge transfer and electronic reconstruction, leading to modulation doping of such atomically engineered complex oxide heterointerfaces. The polar-catastrophe of the 2DEG is directly linked to the electronic structure and transport properties of the LNO. The transport properties can be well modulated by the thickness of the LAO in the 2DEG, and the data can be well fitted with the polar-catastrophe scenario. These results suggest a general approach to tunable functional films in oxide heterostructures with the 2DEG.

Photovoltaic Properties in Interpenetrating Heterojunction Organic Solar Cells Utilizing MoO3 and ZnO Charge Transport Buffer Layers

Science.gov (United States)

Hori, Tetsuro; Moritou, Hiroki; Fukuoka, Naoki; Sakamoto, Junki; Fujii, Akihiko; Ozaki, Masanori

2010-01-01

Organic thin-film solar cells with a conducting polymer (CP)/fullerene (C60) interpenetrating heterojunction structure, fabricated by spin-coating a CP onto a C60 deposit thin film, have been investigated and demonstrated to have high efficiency. The photovoltaic properties of solar cells with a structure of indium-tin-oxide/C60/poly(3-hexylthiophene) (PAT6)/Au have been improved by the insertion of molybdenum trioxide (VI) (MoO3) and zinc oxide charge transport buffer layers. The enhanced photovoltaic properties have been discussed, taking into consideration the ground-state charge transfer between PAT6 and MoO3 by measurement of the differential absorption spectra and the suppressed contact resistance at the interface between the organic and buffer layers. PMID:28883360

Photovoltaic Properties in Interpenetrating Heterojunction Organic Solar Cells Utilizing MoO3 and ZnO Charge Transport Buffer Layers

Directory of Open Access Journals (Sweden)

Tetsuro Hori

2010-11-01

Full Text Available Organic thin-film solar cells with a conducting polymer (CP/fullerene (C60 interpenetrating heterojunction structure, fabricated by spin-coating a CP onto a C60 deposit thin film, have been investigated and demonstrated to have high efficiency. The photovoltaic properties of solar cells with a structure of indium-tin-oxide/C60/ poly(3-hexylthiophene (PAT6/Au have been improved by the insertion of molybdenum trioxide (VI (MoO3 and zinc oxide charge transport buffer layers. The enhanced photovoltaic properties have been discussed, taking into consideration the ground-state charge transfer between PAT6 and MoO3 by measurement of the differential absorption spectra and the suppressed contact resistance at the interface between the organic and buffer layers.

Charge transport in highly efficient iridium cored electrophosphorescent dendrimers

Science.gov (United States)

Markham, Jonathan P. J.; Samuel, Ifor D. W.; Lo, Shih-Chun; Burn, Paul L.; Weiter, Martin; Bässler, Heinz

2004-01-01

Electrophosphorescent dendrimers are promising materials for highly efficient light-emitting diodes. They consist of a phosphorescent core onto which dendritic groups are attached. Here, we present an investigation into the optical and electronic properties of highly efficient phosphorescent dendrimers. The effect of dendrimer structure on charge transport and optical properties is studied using temperature-dependent charge-generation-layer time-of-flight measurements and current voltage (I-V) analysis. A model is used to explain trends seen in the I-V characteristics. We demonstrate that fine tuning the mobility by chemical structure is possible in these dendrimers and show that this can lead to highly efficient bilayer dendrimer light-emitting diodes with neat emissive layers. Power efficiencies of 20 lm/W were measured for devices containing a second-generation (G2) Ir(ppy)3 dendrimer with a 1,3,5-tris(2-N-phenylbenzimidazolyl)benzene electron transport layer.

Electronic structure and charge transport in nonstoichiometric tantalum oxide

Science.gov (United States)

Perevalov, T. V.; Gritsenko, V. A.; Gismatulin, A. A.; Voronkovskii, V. A.; Gerasimova, A. K.; Aliev, V. Sh; Prosvirin, I. A.

2018-06-01

The atomic and electronic structure of nonstoichiometric oxygen-deficient tantalum oxide TaO x<2.5 grown by ion beam sputtering deposition was studied. The TaO x film content was analyzed by x-ray photoelectron spectroscopy and by quantum-chemistry simulation. TaO x is composed of Ta2O5, metallic tantalum clusters and tantalum suboxides. A method for evaluating the stoichiometry parameter of TaO x from the comparison of experimental and theoretical photoelectron valence band spectra is proposed. The charge transport properties of TaO x were experimentally studied and the transport mechanism was quantitatively analyzed with four theoretical dielectric conductivity models. It was found that the charge transport in almost stoichiometric and nonstoichiometric tantalum oxide can be consistently described by the phonon-assisted tunneling between traps.

Role of molecular charge in nucleocytoplasmic transport.

Directory of Open Access Journals (Sweden)

Alexander Goryaynov

Full Text Available Transport of genetic materials and proteins between the nucleus and cytoplasm of eukaryotic cells is mediated by nuclear pore complexes (NPCs. A selective barrier formed by phenylalanine-glycine (FG nucleoporins (Nups with net positive charges in the NPC allows for passive diffusion of signal-independent small molecules and transport-receptor facilitated translocation of signal-dependent cargo molecules. Recently, negative surface charge was postulated to be another essential criterion for selective passage through the NPC. However, the charge-driven mechanism in determining the transport kinetics and spatial transport route for either passive diffusion or facilitated translocation remains obscure. Here we employed high-speed single-molecule fluorescence microscopy with an unprecedented spatiotemporal resolution of 9 nm and 400 µs to uncover these mechanistic fundamentals for nuclear transport of charged substrates through native NPCs. We found that electrostatic interaction between negative surface charges on transiting molecules and the positively charged FG Nups, although enhancing their probability of binding to the NPC, never plays a dominant role in determining their nuclear transport mode or spatial transport route. A 3D reconstruction of transport routes revealed that small signal-dependent endogenous cargo protein constructs with high positive surface charges that are destined to the nucleus, rather than repelled from the NPC as suggested in previous models, passively diffused through an axial central channel of the NPC in the absence of transport receptors. Finally, we postulated a comprehensive map of interactions between transiting molecules and FG Nups during nucleocytoplasmic transport by combining the effects of molecular size, signal and surface charge.

Charge trapping and carrier transport mechanism in silicon-rich silicon oxynitride

International Nuclear Information System (INIS)

Yu Zhenrui; Aceves, Mariano; Carrillo, Jesus; Lopez-Estopier, Rosa

2006-01-01

The charge-trapping and carrier transport properties of silicon-rich silicon oxynitride (SRO:N) were studied. The SRO:N films were deposited by low pressure chemical vapor deposition. Infrared (IR) and transmission electron microscopic (TEM) measurements were performed to characterize their structural properties. Capacitance versus voltage and current versus voltage measurements (I-V) were used to study the charge-trapping and carrier transport mechanism. IR and TEM measurements revealed the existence of Si nanodots in SRO:N films. I-V measurements revealed that there are two conduction regimes divided by a threshold voltage V T . When the applied voltage is smaller than V T , the current is dominated by the charge transfer between the SRO:N and substrate; and in this regime only dynamic charging/discharging of the SRO:N layer is observed. When the voltage is larger than V T , the current increases rapidly and is dominated by the Poole-Frenkel mechanism; and in this regime, large permanent trapped charge density is obtained. Nitrogen incorporation significantly reduced the silicon nanodots or defects near the SRO:N/Si interface. However, a significant increase of the density of silicon nanodot in the bulk of the SRO:N layer is obtained

On the nature of high field charge transport in reinforced silicone dielectrics: Experiment and simulation

Energy Technology Data Exchange (ETDEWEB)

Huang, Yanhui, E-mail: huangy12@rpi.edu; Schadler, Linda S. [Department of Material Science and Engineering, Rensselaer Polytechnic Institute, 110 8th street, Troy, New York 12180 (United States)

2016-08-07

The high field charge injection and transport properties in reinforced silicone dielectrics were investigated by measuring the time-dependent space charge distribution and the current under dc conditions up to the breakdown field and were compared with the properties of other dielectric polymers. It is argued that the energy and spatial distribution of localized electronic states are crucial in determining these properties for polymer dielectrics. Tunneling to localized states likely dominates the charge injection process. A transient transport regime arises due to the relaxation of charge carriers into deep traps at the energy band tails and is successfully verified by a Monte Carlo simulation using the multiple-hopping model. The charge carrier mobility is found to be highly heterogeneous due to the non-uniform trapping. The slow moving electron packet exhibits a negative field dependent drift velocity possibly due to the spatial disorder of traps.

An alternative approach to charge transport in semiconducting electrodes

Science.gov (United States)

Thomchick, J.; Buoncristiani, A. M.

1980-01-01

The excess-carrier charge transport through the space-charge region of a semiconducting electrode is analyzed by a technique known as the flux method. In this approach reflection and transmission coefficients appropriate for a sheet of uniform semiconducting material describe its transport properties. A review is presented of the flux method showing that the results for a semiconductor electrode reduce in a limiting case to those previously found by Gaertner if the depletion layer is treated as a perfectly transmitting medium in which scattering and recombination are ignored. Then, in the framework of the flux method the depletion layer is considered more realistically by explicitly taking into account scattering and recombination processes which occur in this region.

Trap-controlled charge transport in corona-charged Teflon

International Nuclear Information System (INIS)

Gross, B.; Giacometti, J.A.; Ferreira, G.F.L.; Moreno A, R.A.

1980-01-01

The stability of negatively charged Teflon electrets is discussed. It is stated that it can only be explained by the assumption that the transport of excess charge is trap - controlled rather than mobility - controlled. (I.C.R.) [pt

Investigating anomalous transport of electrolytes in charged porous media

Science.gov (United States)

Skjøde Bolet, Asger Johannes; Mathiesen, Joachim

2017-04-01

Surface charge is know to play an important role in microfluidics devices when dealing with electrolytes and their transport properties. Similarly, surface charge could play a role for transport in porous rock with submicron pore sizes. Estimates of the streaming potentials and electro osmotic are mostly considered in simple geometries both using analytic and numerical tools, however it is unclear at present how realistic complex geometries will modify the dynamics. Our work have focused on doing numerical studies of the full three-dimensional Stokes-Poisson-Nernst-Planck problem for electrolyte transport in porous rock. As the numerical implementation, we have used a finite element solver made using the FEniCS project code base, which can both solve for a steady state configuration and the full transient. In the presentation, we will show our results on anomalous transport due to electro kinetic effects such as the streaming potential or the electro osmotic effect.

Triphenylamine-Thienothiophene Organic Charge-Transport Molecular Materials: Effect of Substitution Pattern on their Thermal, Photoelectrochemical, and Photovoltaic Properties.

Science.gov (United States)

Le, Thi Huong; Dao, Quang-Duy; Nghiêm, Mai-Phuong; Péralta, Sébastien; Guillot, Regis; Pham, Quoc Nghi; Fujii, Akihiko; Ozaki, Masanori; Goubard, Fabrice; Bui, Thanh-Tuân

2018-04-25

Two readily accessible thienothiophene-triphenylamine charge-transport materials have been synthesized by simply varying the substitution pattern of the triphenylamine groups on a central thienothiophene π-linker. The impact of the substitution pattern on the thermal, photoelectrochemical, and photovoltaic properties of these materials was evaluated and, based on theoretical and experimental studies, we found that the isomer in which the triphenylamine groups were located at the 2,5-positions of the thienothiophene core (TT-2,5-TPA) had better π-conjugation than the 3,6-isomer (TT-3,6-TPA). Whilst the thermal, morphological, and hydrophobic properties of the two materials were similar, their optoelectrochemical and photovoltaic properties were noticeably impacted. When applied as hole-transport materials in hybrid perovskite solar cells, the 2,5-isomer exhibited a power-conversion efficiency of 13.6 %, much higher than that of its 3,6-counterpart (0.7 %) under the same standard conditions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Influence of dehydrated nanotubed titanic acid on charge transport and luminescent properties of polymer light-emitting diodes with fluorescent dye

Science.gov (United States)

Qian, Lei; Bera, Debasis; Jin, Zhen-Sheng; Du, Zu-Liang; Xu, Zheng; Teng, Feng; Liu, Wei

2007-09-01

In this paper, we discuss the influence of dehydrated nanotubed titanic acid (DNTA) on charge transport and luminescent properties of polymer light-emitting diodes (PLEDs) doped with fluorescent dye. Photoluminescence results confirm the efficient energy transfer from PVK to 4-(dicyanom-ethylene)-2- t-butyl-6-(1,1,7,7-tetramethyljulolidyl-9-enyl)-4H-pyran (DCJTB) and tris-(8-hydroxtquinoline) aluminum (Alq 3) in a DNTA-doped device. The device showed lower turn-on voltages and higher charge current by doping with DNTA, which also caused a shift in the exciton's recombination region.

Enhancement of charge transport properties of small molecule semiconductors by controlling fluorine substitution and effects on photovoltaic properties of organic solar cells and perovskite solar cells.

Science.gov (United States)

Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung

2016-11-01

We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .

Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

Energy Technology Data Exchange (ETDEWEB)

Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

2016-04-19

By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

Effects of pressure and electrical charge on macromolecular transport across bovine lens basement membrane.

Science.gov (United States)

Ferrell, Nicholas; Cameron, Kathleen O; Groszek, Joseph J; Hofmann, Christina L; Li, Lingyan; Smith, Ross A; Bian, Aihua; Shintani, Ayumi; Zydney, Andrew L; Fissell, William H

2013-04-02

Molecular transport through the basement membrane is important for a number of physiological functions, and dysregulation of basement membrane architecture can have serious pathological consequences. The structure-function relationships that govern molecular transport in basement membranes are not fully understood. The basement membrane from the lens capsule of the eye is a collagen IV-rich matrix that can easily be extracted and manipulated in vitro. As such, it provides a convenient model for studying the functional relationships that govern molecular transport in basement membranes. Here we investigate the effects of increased transmembrane pressure and solute electrical charge on the transport properties of the lens basement membrane (LBM) from the bovine eye. Pressure-permeability relationships in LBM transport were governed primarily by changes in diffusive and convective contributions to solute flux and not by pressure-dependent changes in intrinsic membrane properties. The solute electrical charge had a minimal but statistically significant effect on solute transport through the LBM that was opposite of the expected electrokinetic behavior. The observed transport characteristics of the LBM are discussed in the context of established membrane transport modeling and previous work on the effects of pressure and electrical charge in other basement membrane systems. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Study of the charge transport characteristics of dendrimer molecular thin films

Energy Technology Data Exchange (ETDEWEB)

Li, J.C., E-mail: jcli@mail.neu.edu.cn; Han, N.; Wang, S.S.; Ba, D.C.

2011-05-31

In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.

Study of the charge transport characteristics of dendrimer molecular thin films

International Nuclear Information System (INIS)

Li, J.C.; Han, N.; Wang, S.S.; Ba, D.C.

2011-01-01

In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.

Electrolyte transport in neutral polymer gels embedded with charged inclusions

Science.gov (United States)

Hill, Reghan

2005-11-01

Ion permeable membranes are the basis of a variety of molecular separation technologies, including ion exchange, gel electrophoresis and dialysis. This work presents a theoretical model of electrolyte transport in membranes comprised of a continuous polymer gel embedded with charged spherical inclusions, e.g., biological cells and synthetic colloids. The microstructure mimics immobilized cell cultures, where electric fields have been used to promote nutrient transport. Because several important characteristics can, in principle, be carefully controlled, the theory provides a quantitative framework to help tailor the bulk properties for enhanced molecular transport, microfluidic pumping, and physicochemical sensing applications. This talk focuses on the electroosmotic flow driven by weak electric fields and electrolyte concentration gradients. Also of importance is the influence of charge on the effective ion diffusion coefficients, bulk electrical conductivity, and membrane diffusion potential.

The role of space charge compensation for ion beam extraction and ion beam transport (invited)

International Nuclear Information System (INIS)

Spädtke, Peter

2014-01-01

Depending on the specific type of ion source, the ion beam is extracted either from an electrode surface or from a plasma. There is always an interface between the (almost) space charge compensated ion source plasma, and the extraction region in which the full space charge is influencing the ion beam itself. After extraction, the ion beam is to be transported towards an accelerating structure in most cases. For lower intensities, this transport can be done without space charge compensation. However, if space charge is not negligible, the positive charge of the ion beam will attract electrons, which will compensate the space charge, at least partially. The final degree of Space Charge Compensation (SCC) will depend on different properties, like the ratio of generation rate of secondary particles and their loss rate, or the fact whether the ion beam is pulsed or continuous. In sections of the beam line, where the ion beam is drifting, a pure electrostatic plasma will develop, whereas in magnetic elements, these space charge compensating electrons become magnetized. The transport section will provide a series of different plasma conditions with different properties. Different measurement tools to investigate the degree of space charge compensation will be described, as well as computational methods for the simulation of ion beams with partial space charge compensation

Symmetry properties of the transport coefficients of charged particles in disordered materials

International Nuclear Information System (INIS)

Baird, J.K.

1979-01-01

The transport coefficients of a charged particle in an isotropic material are shown to be even functions of the applied electric field. We discuss the limitation which this result and its consequences place upon formulae used to represent these coefficients

The role of polymer dots on efficiency enhancement of organic solar cells: Improving charge transport property

Science.gov (United States)

Li, Jinfeng; Zhang, Xinyuan; Liu, Chunyu; Li, Zhiqi; He, Yeyuan; Zhang, Zhihui; Shen, Liang; Guo, Wenbin; Ruan, Shengping

2017-07-01

In this work, poly(9,9-dioctylfluorene)-co-(4,7-di-2-thienyl-2,1,3-benzothiadiazole) (PF-5DTBT) and copolymer poly(styrene-co-maleic anhydride) (PSMA) dots were prepared as additive for active layer doping to enhance the power conversion efficiency (PCE) of organic solar cells (OSCs), which based on poly[N-9″-hepta-decanyl-2,7-carbazole-alt-5,5-(4‧,7‧-di-2-thienyl-2‧,1‧,3‧-benzothiadiazole) (PCDTBT) and [6,6]-phenyl C71 butyric acid methyl-ester (PC71BM). A high efficiency of 7.40% was achieved due to increase of short-circuit current (Jsc) and fill factor (FF). The operation mechanism of OSCs doping with polymer dots was investigated, which demonstrated that the efficiency enhancement ascribes to improvement of electrical properties, such as exciton generation, exction dissociation, charge transport, and charge collection.

Charge Carrier Transport Properties of Vacuum Evaporated Anthrylvinylbenzene Thin Films

Directory of Open Access Journals (Sweden)

Haikel HRICHI

2014-05-01

Full Text Available The charge carrier conduction processes and dielectric properties of two new materials based on anthracene core structure, 1-(9 anthrylvinyl-4-benzyloxybenzene (AVB and 1,4- bis(9-anthrylvinylbenzene (AV2B diodes have been investigated using dc current density–voltage (J–V and AC impedance spectroscopy (100 Hz–10 MHz. The DC electrical properties of ITO/anthracene derivative /Al device showing an ohmic behavior at low voltages and switches to space charge limited current (SCLC conduction with exponential trap distribution at higher voltages. The best performance device was achieved from ITO/AVB/Al structure showing the high charge carrier mobility which has also been evaluated from SCLC as 6.55´10-6 cm/Vs. According to the impedance spectroscopy results the structures were modeled by equivalent circuit designed as a parallel resistor Rp and capacitor Cp network in series with resistor Rs. The evolution of the electrical parameters with frequency and bias voltage of these anthracene-based systems has been discussed. The conductivity s(w evolution with frequency and bias voltage was studied for ITO/anthracene derivatives/Al devices. The dc conductivity sdc for these devices has been determined. The ac conductivity sac showed a variation in angular frequency as A.ws with a critical exponent s< 1 suggesting a hopping conduction mechanism at high frequency.

On the Structure of the Fixed Charge Transportation Problem

Science.gov (United States)

Kowalski, K.

2005-01-01

This work extends the theory of the fixed charge transportation problem (FCTP), currently based mostly on a forty-year-old publication by Hirsch and Danzig. This paper presents novel properties that need to be considered by those using existing, or those developing new methods for optimizing FCTP. It also defines the problem in an easier way,…

Electronic transport in single-helical protein molecules: Effects of multiple charge conduction pathways and helical symmetry

Energy Technology Data Exchange (ETDEWEB)

Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.

2016-07-15

We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.

Charge-transport simulations in organic semiconductors

Energy Technology Data Exchange (ETDEWEB)

May, Falk

2012-07-06

In this thesis we have extended the methods for microscopic charge-transport simulations for organic semiconductors, where weak intermolecular interactions lead to spatially localized charge carriers, and the charge transport occurs as an activated hopping process between diabatic states. In addition to weak electronic couplings between these states, different electrostatic environments in the organic material lead to a broadening of the density of states for the charge energies which limits carrier mobilities. The contributions to the method development include (i) the derivation of a bimolecular charge-transfer rate, (ii) the efficient evaluation of intermolecular (outer-sphere) reorganization energies, (iii) the investigation of effects of conformational disorder on intramolecular reorganization energies or internal site energies and (iv) the inclusion of self-consistent polarization interactions for calculation of charge energies. These methods were applied to study charge transport in amorphous phases of small molecules used in the emission layer of organic light emitting diodes (OLED). When bulky substituents are attached to an aromatic core in order to adjust energy levels or prevent crystallization, a small amount of delocalization of the frontier orbital to the substituents can increase electronic couplings between neighboring molecules. This leads to improved charge-transfer rates and, hence, larger charge-mobility. We therefore suggest using the mesomeric effect (as opposed to the inductive effect) when attaching substituents to aromatic cores, which is necessary for example in deep blue OLEDs, where the energy levels of a host molecule have to be adjusted to those of the emitter. Furthermore, the energy landscape for charges in an amorphous phase cannot be predicted by mesoscopic models because they approximate the realistic morphology by a lattice and represent molecular charge distributions in a multipole expansion. The microscopic approach shows that

Charge carrier transport mechanisms in nanocrystalline indium oxide

International Nuclear Information System (INIS)

Forsh, E.A.; Marikutsa, A.V.; Martyshov, M.N.; Forsh, P.A.; Rumyantseva, M.N.; Gaskov, A.M.; Kashkarov, P.K.

2014-01-01

The charge transport properties of nanocrystalline indium oxide (In 2 O 3 ) are studied. A number of nanostructured In 2 O 3 samples with various nanocrystal sizes are prepared by sol–gel method and characterized using various techniques. The mean nanocrystals size varies from 7–8 nm to 18–20 nm depending on the conditions of their preparation. Structural characterizations of the In 2 O 3 samples are performed by means of transmission electron microscopy and X-ray diffraction. The analysis of dc and ac conductivity in a wide temperature range (T = 50–300 K) shows that at high temperatures charge carrier transport takes place over conduction band and at low temperatures a variable range hopping transport mechanism can be observed. We find out that the temperature of transition from one mechanism to another depends on nanocrystal size: the transition temperature rises when nanocrystals are bigger in size. The average hopping distance between two sites and the activation energy are calculated basing on the analysis of dc conductivity at low temperature. Using random barrier model we show a uniform hopping mechanism taking place in our samples and conclude that nanocrystalline In 2 O 3 can be regarded as a disordered system. - Highlights: • In 2 O 3 samples with various nanocrystal sizes are prepared by sol–gel method. • The mean nanocrystal size varies from 7–8 nm to 18–20 nm. • At high temperatures charge carrier transport takes place over conduction band. • At low temperatures a variable range hopping transport mechanism can be observed. • We show a uniform hopping mechanism taking place in our samples

Charge and spin transport in mesoscopic superconductors

Directory of Open Access Journals (Sweden)

M. J. Wolf

2014-02-01

Full Text Available Background: Non-equilibrium charge transport in superconductors has been investigated intensely in the 1970s and 1980s, mostly in the vicinity of the critical temperature. Much less attention has been paid to low temperatures and the role of the quasiparticle spin.Results: We report here on nonlocal transport in superconductor hybrid structures at very low temperatures. By comparing the nonlocal conductance obtained by using ferromagnetic and normal-metal detectors, we discriminate charge and spin degrees of freedom. We observe spin injection and long-range transport of pure, chargeless spin currents in the regime of large Zeeman splitting. We elucidate charge and spin transport by comparison to theoretical models.Conclusion: The observed long-range chargeless spin transport opens a new path to manipulate and utilize the quasiparticle spin in superconductor nanostructures.

Charge transport in organic crystals

Energy Technology Data Exchange (ETDEWEB)

Ortmann, Frank

2009-07-01

The understanding of charge transport is one of the central goals in the research on semiconducting crystals. For organic crystals this is particularly complicated due to the strength of the electron-phonon interaction which requires the description of a seamless transition between the limiting cases of a coherent band-transport mechanism and incoherent hopping. In this thesis, charge transport phenomena in organic crystals are studied by theoretical means. A theory for charge transport in organic crystals is developed which covers the whole temperature range from low T, where it reproduces an expression from the Boltzmann equation for band transport, via elevated T, where it generalizes Holstein's small-polaron theory to finite bandwidths, up to high T, for which a temperature dependence equal to Marcus' electron-transfer theory is obtained. Thereby, coherent band transport and thermally induced hopping are treated on equal footing while simultaneously treating the electron-phonon interaction non-perturbatively. By avoiding the approximation of narrow polaron bands the theory allows for the description of large and small polarons and serves as a starting point for computational studies. The theoretical description is completed by using ab initio material parameters for the selected crystals under study. These material parameters are taken from density functional theory calculations for durene, naphthalene, and guanine crystals. Besides the analysis of the transport mechanism, special focus is put on the study of the relationship between mobility anisotropy and structure of the crystals. This study is supported by a 3D-visualization method for the transport channels in such crystals which has been derived in this thesis. (orig.)

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

The electro-optical and charge transport study of imidazolidin derivative: Quantum chemical investigations

Directory of Open Access Journals (Sweden)

Ahmad Irfan

2016-11-01

Full Text Available Imidazolidin derivatives gained significant attention in our daily life from better biological activity to the semiconducting materials. The present investigation deals with the in depth study of (Z-2-sulfanylidene-5-(thiophen-2-ylmethylideneimidazolidin-4-one (STMI with respect to their structural, electronic, optical and charge transport properties as semiconducting material. The ground and first excited state geometries were optimized by applying density functional theory (DFT and time dependent DFT, respectively. The light has been shed on the frontier molecular orbitals (FMOs and observed comprehensible intramolecular charge transfer (ICT from the highest occupied molecular orbitals (HOMOs to the lowest unoccupied molecular orbitals (LUMOs. The absorption, emission, ionization potentials (IP, electron affinities (EA, total and partial densities of states and structure-property relationship have been discussed. Finally, hole as well as electron reorganization energies, transfer integrals and intrinsic mobilities have been calculated then charge transport behavior of STMI was discussed, intensively.

Crossover from band-like to thermally activated charge transport in organic transistors due to strain-induced traps

KAUST Repository

Mei, Yaochuan; Diemer, Peter J.; Niazi, Muhammad Rizwan; Hallani, Rawad K.; Jarolimek, Karol; Day, Cynthia S.; Risko, Chad; Anthony, John E.; Amassian, Aram; Jurchescu, Oana D.

2017-01-01

The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials

Unraveling the Solution-State Supramolecular Structures of Donor-Acceptor Polymers and their Influence on Solid-State Morphology and Charge-Transport Properties.

Science.gov (United States)

Zheng, Yu-Qing; Yao, Ze-Fan; Lei, Ting; Dou, Jin-Hu; Yang, Chi-Yuan; Zou, Lin; Meng, Xiangyi; Ma, Wei; Wang, Jie-Yu; Pei, Jian

2017-11-01

Polymer self-assembly in solution prior to film fabrication makes solution-state structures critical for their solid-state packing and optoelectronic properties. However, unraveling the solution-state supramolecular structures is challenging, not to mention establishing a clear relationship between the solution-state structure and the charge-transport properties in field-effect transistors. Here, for the first time, it is revealed that the thin-film morphology of a conjugated polymer inherits the features of its solution-state supramolecular structures. A "solution-state supramolecular structure control" strategy is proposed to increase the electron mobility of a benzodifurandione-based oligo(p-phenylene vinylene) (BDOPV)-based polymer. It is shown that the solution-state structures of the BDOPV-based conjugated polymer can be tuned such that it forms a 1D rod-like structure in good solvent and a 2D lamellar structure in poor solvent. By tuning the solution-state structure, films with high crystallinity and good interdomain connectivity are obtained. The electron mobility significantly increases from the original value of 1.8 to 3.2 cm 2 V -1 s -1 . This work demonstrates that "solution-state supramolecular structure" control is critical for understanding and optimization of the thin-film morphology and charge-transport properties of conjugated polymers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Charge splitters and charge transport junctions based on guanine quadruplexes

Science.gov (United States)

Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

2018-04-01

Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

Photoconductivity enhancement and charge transport properties in ruthenium-containing block copolymer/carbon nanotube hybrids.

Science.gov (United States)

Lo, Kin Cheung; Hau, King In; Chan, Wai Kin

2018-04-05

Functional polymer/carbon nanotube (CNT) hybrid materials can serve as a good model for light harvesting systems based on CNTs. This paper presents the synthesis of block copolymer/CNT hybrids and the characterization of their photocurrent responses by both experimental and computational approaches. A series of functional diblock copolymers was synthesized by reversible addition-fragmentation chain transfer polymerizations for the dispersion and functionalization of CNTs. The block copolymers contain photosensitizing ruthenium complexes and modified pyrene-based anchoring units. The photocurrent responses of the polymer/CNT hybrids were measured by photoconductive atomic force microscopy (PCAFM), from which the experimental data were analyzed by vigorous statistical models. The difference in photocurrent response among different hybrids was correlated to the conformations of the hybrids, which were elucidated by molecular dynamics simulations, and the electronic properties of polymers. The photoresponse of the block copolymer/CNT hybrids can be enhanced by introducing an electron-accepting block between the photosensitizing block and the CNT. We have demonstrated that the application of a rigorous statistical methodology can unravel the charge transport properties of these hybrid materials and provide general guidelines for the design of molecular light harvesting systems.

TTF/TCNQ-based thin films and microcrystals. Growth and charge transport phenomena

Energy Technology Data Exchange (ETDEWEB)

Solovyeva, Vita

2011-05-26

The thesis adresses several problems related to growth and charge transport phenomena in thin films of TTF-TCNQ and (BEDT-TTF)TCNQ. The following main new problems are addressed: - The influence of thin-film specific factors, such as the substrate material and growth-induced defects, on the Peierls transition temperature in TTF-TCNQ thin films was studied; - finite-size effects in TTF-TCNQ were investigated by considering transport properties in TTF-TCNQ microcrystals. The influence of the size of the crystal on the Peierls transition temperature was studied. In this context a new method of microcontact fabrication was employed to favor the measurements; - an analysis of radiation-induced defects in TTF-TCNQ thin films and microcrystals was performed. It was demonstrated than an electron beam can induce appreciable damage to the sample such that its electronic properties are strongly modified; - a bilayer growth method was established to fabricate (BEDT-TTF)TCNQ from the gas phase. This newly developed bilayer growth method was showed to be suitable for testing (BEDT-TTF)TCNQ charge-transfer phase formation; - the structure of the formed (BEDT-TTF)TCNQ charge-transfer compounds was analyzed by using a wide range of experimental techniques. An overview and the description of the basic physical principles underlying charge-transfer compounds is given in chapter 2. Experimental techniques used for the growth and characterization of thin films and microcrystals are presented in chapter 3. Chapter 4 gives an overview of the physical properties of the studied organic materials. Chapter 5 discussed the experimental study of TTF-TCNQ thin films. he Peierls transition in TTF-TCNQ is a consequence of the quasi-one-dimensional structure of the material and depends on different factors, studied in chapters 5 and 6. In contradistinction to TTF-TTCNQ, the (BEDT-TTF)TCNQ charge-transfer compound crystallizes in several different modifications with different physical properties

The thermoballistic transport model a novel approach to charge carrier transport in semiconductors

CERN Document Server

Lipperheide, Reinhard

2014-01-01

The book presents a comprehensive survey of the thermoballistic approach to charge carrier transport in semiconductors. This semi-classical approach, which the authors have developed over the past decade, bridges the gap between the opposing drift-diffusion and ballistic  models of carrier transport. While incorporating basic features of the latter two models, the physical concept underlying the thermoballistic approach constitutes a novel, unifying scheme. It is based on the introduction of "ballistic configurations" arising from a random partitioning of the length of a semiconducting sample into ballistic transport intervals. Stochastic averaging of the ballistic carrier currents over the ballistic configurations results in a position-dependent thermoballistic current, which is the key element of the thermoballistic concept and forms  the point of departure for the calculation of all relevant transport properties. In the book, the thermoballistic concept and its implementation are developed in great detai...

Modulation and Control of Charge Transport Through Single-Molecule Junctions.

Science.gov (United States)

Wang, Kun; Xu, Bingqian

2017-02-01

The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge

Solution processable semiconductor thin films: Correlation between morphological, structural, optical and charge transport properties

Science.gov (United States)

Isik, Dilek

This Ph.D. thesis is a result of multidisciplinary research bringing together fundamental concepts in thin film engineering, materials science, materials processing and characterization, electrochemistry, microfabrication, and device physics. Experiments were conducted by tackling scientific problems in the field of thin films and interfaces, with the aim to correlate the morphology, crystalline structure, electronic structure of thin films with the functional properties of the films and the performances of electronic devices based thereon. Furthermore, novel strategies based on interfacial phenomena at electrolyte/thin film interfaces were explored and exploited to control the electrical conductivity of the thin films. Three main chemical systems were the object of the studies performed during this Ph.D., two types of organic semiconductors (azomethine-based oligomers and polymers and soluble pentacene derivatives) and one metal oxide semiconductor (tungsten trioxide, WO3). To explore the morphological properties of the thin films, atomic force microscopy was employed. The morphological properties were further investigated by hyperspectral fluorescence microscopy and tentatively correlated to the charge transport properties of the films. X-ray diffraction (Grazing incidence XRD, GIXRD) was used to investigate the crystallinity of the film and the effect of the heat treatment on such crystallinity, as well as to understand the molecular arrangement of the organic molecules in the thin film. The charge transport properties of the films were evaluated in thin film transistor configuration. For electrolyte gated thin film transistors, time dependent transient measurements were conducted, in parallel to more conventional transistor characterizations, to explore the specific effects played on the gating by the anion and cation constituting the electrolyte. The capacitances of the electrical double layers at the electrolyte/WO3 interface were obtained from

Theory and simulation of charge transport in disordered organic semiconductors

NARCIS (Netherlands)

Bobbert, P.A.; Kondov, I.; Sutman, G.

2013-01-01

Charge transport in polymeric or small-molecule organic semiconductors used in organic light-emitting diodes (OLEDs) occurs by hopping of charges between sites at which the charges are localized. The energetic disorder in these semiconductors has a profound influence on the charge transport: charges

Symposium GC: Nanoscale Charge Transport in Excitonic Solar Cells

Energy Technology Data Exchange (ETDEWEB)

Bommisetty, Venkat [Univ. of South Dakota, Vermillion, SD (United States)

2011-06-23

This paper provides a summary only and table of contents of the sessions. Excitonic solar cells, including all-organic, hybrid organic-inorganic and dye-sensitized solar cells (DSSCs), offer strong potential for inexpensive and large-area solar energy conversion. Unlike traditional inorganic semiconductor solar cells, where all the charge generation and collection processes are well understood, these excitonic solar cells contain extremely disordered structures with complex interfaces which results in large variations in nanoscale electronic properties and has a strong influence on carrier generation, transport, dissociation and collection. Detailed understanding of these processes is important for fabrication of highly efficient solar cells. Efforts to improve efficiency are underway at a large number of research groups throughout the world focused on inorganic and organic semiconductors, photonics, photophysics, charge transport, nanoscience, ultrafast spectroscopy, photonics, semiconductor processing, device physics, device structures, interface structure etc. Rapid progress in this multidisciplinary area requires strong synergetic efforts among researchers from diverse backgrounds. Such effort can lead to novel methods for development of new materials with improved photon harvesting and interfacial treatments for improved carrier transport, process optimization to yield ordered nanoscale morphologies with well defined electronic structures.

Charge transportation in polyaniline/V2O5 composites

International Nuclear Information System (INIS)

Huguenin, Fritz; Torresi, Roberto M.

2004-01-01

In this work, composites formed from a mixture of V 2 O 5 and polyaniline (PANI) were investigated, for applications as cathode materials for secondary lithium batteries. Electrochemical quartz crystal microbalance (EQCM) data show that charge compensation in the [PANI] 0.3 V 2 O 5 nanocomposite is achieved predominantly by Li + migration. However, the charge compensation in the [PANI]V 2 O 5 microcomposite occurs by Li + and Cl O 4 - transport. Electrochemical Impedance Spectroscopy (EIS) measurements reveal several benefits of nanohybrid formation, including the achievement of shorter ionic diffusion pathways, the higher diffusion rate of the lithium ion and also the higher electronic conductivity, which are responsible for a synergetic effect of the energy storage properties. (author)

Charge Transport in LDPE Nanocomposites Part II—Computational Approach

Directory of Open Access Journals (Sweden)

Anh T. Hoang

2016-03-01

Full Text Available A bipolar charge transport model is employed to investigate the remarkable reduction in dc conductivity of low-density polyethylene (LDPE based material filled with uncoated nanofillers (reported in the first part of this work. The effect of temperature on charge transport is considered and the model outcomes are compared with measured conduction currents. The simulations reveal that the contribution of charge carrier recombination to the total transport process becomes more significant at elevated temperatures. Among the effects caused by the presence of nanoparticles, a reduced charge injection at electrodes has been found as the most essential one. Possible mechanisms for charge injection at different temperatures are therefore discussed.

Charge Transport in Conjugated Materials: From Theoretical Models to Experimental Systems

International Nuclear Information System (INIS)

Olivier, Yoann; Cornil, Jerome; Muccioli, Luca; Zannoni, Claudio

2008-01-01

Charge carrier mobility is the key quantity to characterize the charge transport properties in devices. Based on earlier work of Baessler and co-workers, we set up a Monte-Carlo approach that allows us to calculate mobility using transfer rates derived from Marcus theory. The parameters entering into the rate expression are evaluated by means of different quantum-chemical techniques. Our approach is applied here to a model one-dimensional system made of pentacene molecules as well as to real systems such as crystalline structures and columnar liquid crystal phases.

Methods for producing thin film charge selective transport layers

Science.gov (United States)

Hammond, Scott Ryan; Olson, Dana C.; van Hest, Marinus Franciscus Antonius Maria

2018-01-02

Methods for producing thin film charge selective transport layers are provided. In one embodiment, a method for forming a thin film charge selective transport layer comprises: providing a precursor solution comprising a metal containing reactive precursor material dissolved into a complexing solvent; depositing the precursor solution onto a surface of a substrate to form a film; and forming a charge selective transport layer on the substrate by annealing the film.

Charge transport through DNA based electronic barriers

Science.gov (United States)

Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

2018-05-01

We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

Charge transport and recombination dynamics in organic bulk heterojunction solar cells

Energy Technology Data Exchange (ETDEWEB)

Baumann, Andreas

2011-08-02

The charge transport in disordered organic bulk heterojunction (BHJ) solar cells is a crucial process affecting the power conversion efficiency (PCE) of the solar cell. With the need of synthesizing new materials for improving the power conversion efficiency of those cells it is important to study not only the photophysical but also the electrical properties of the new material classes. Thereby, the experimental techniques need to be applicable to operating solar cells. In this work, the conventional methods of transient photoconductivity (also known as ''Time-of-Flight'' (TOF)), as well as the transient charge extraction technique of ''Charge Carrier Extraction by Linearly Increasing Voltage'' (CELIV) are performed on different organic blend compositions. Especially with the latter it is feasible to study the dynamics - i.e. charge transport and charge carrier recombination - in bulk heterojunction (BHJ) solar cells with active layer thicknesses of 100-200 nm. For a well performing organic BHJ solar cells the morphology is the most crucial parameter finding a trade-off between an efficient photogeneration of charge carriers and the transport of the latter to the electrodes. Besides the morphology, the nature of energetic disorder of the active material blend and its influence on the dynamics are discussed extensively in this work. Thereby, the material system of poly(3-hexylthiophene-2,5-diyl) (P3HT) and [6,6]-phenyl-C{sub 61}butyric acid methyl ester (PC{sub 61}BM) serves mainly as a reference material system. New promising donor or acceptor materials and their potential for application in organic photovoltaics are studied in view of charge dynamics and compared with the reference system. With the need for commercialization of organic solar cells the question of the impact of environmental conditions on the PCE of the solar cells raises. In this work, organic BHJ solar cells exposed to synthetic air for finite duration are

Spiro-OMeTAD single crystals: Remarkably enhanced charge-carrier transport via mesoscale ordering

KAUST Repository

Shi, Dong

2016-04-15

We report the crystal structure and hole-transport mechanism in spiro-OMeTAD [2,2′,7,7′-tetrakis(N,N-di-p-methoxyphenyl-amine)9,9′-spirobifluorene], the dominant hole-transporting material in perovskite and solid-state dye-sensitized solar cells. Despite spiro-OMeTAD’s paramount role in such devices, its crystal structure was unknown because of highly disordered solution-processed films; the hole-transport pathways remained ill-defined and the charge carrier mobilities were low, posing a major bottleneck for advancing cell efficiencies. We devised an antisolvent crystallization strategy to grow single crystals of spiro-OMeTAD, which allowed us to experimentally elucidate its molecular packing and transport properties. Electronic structure calculations enabled us to map spiro-OMeTAD’s intermolecular charge-hopping pathways. Promisingly, single-crystal mobilities were found to exceed their thin-film counterparts by three orders of magnitude. Our findings underscore mesoscale ordering as a key strategy to achieving breakthroughs in hole-transport material engineering of solar cells.

A New Approach for Evaluating Charge Transport Properties of Semiconductor Detectors

International Nuclear Information System (INIS)

Kim, Kyung O; Kim, Jong Kyung; Kim, Soon Young; Ha, Jang Ho

2009-01-01

The semiconductor detectors (e.g., CdTe, CdZnTe, and HgI 2 ) have been widely used for radiation detection and medical imaging because of its various outstanding features such as excellent energy resolution, wide bandgap energy, room temperature operation, and so on. Unfortunately, the performance of these detectors is mainly limited by the charge transport properties of semiconductor, especially the mobility-lifetime products (i.e., (μτ) e and ((μτ) h ). Hence, the analysis on the mobility-lifetime products is very important for evaluating correct characteristics of semiconductor detectors. A commonly used method to analyze the mobilitylifetime products is based on their responses to α particle. However, the α particle method cannot evaluate the ((μτ)h product in many cases, because a semiconductor detector operating at positive bias voltages often yields the energy spectrum without the peaks. This method is also known to be very sensitive to the experimental conditions as well as surface conditions of the detector. In this study, a new approach with gamma-ray instead of α particle was carried out to solve the determination difficulty of the ((μτ) h product with common method. The special relation between the two mobility-lifetime products, which we call the 'Nural equation', was also developed to simply obtain each parameter based on Hecht equation

Characterization of dextran-grafted hydrophobic charge-induction resins: Structural properties, protein adsorption and transport.

Science.gov (United States)

Liu, Tao; Angelo, James M; Lin, Dong-Qiang; Lenhoff, Abraham M; Yao, Shan-Jing

2017-09-29

The structural and functional properties of a series of dextran-grafted and non-grafted hydrophobic charge-induction chromatographic (HCIC) agarose resins were characterized by macroscopic and microscopic techniques. The effects of dextran grafting and mobile phase conditions on the pore dimensions of the resins were investigated with inverse size exclusion chromatography (ISEC). A significantly lower pore radius (17.6nm) was found for dextran-grafted than non-grafted resins (29.5nm), but increased salt concentration would narrow the gap between the respective pore radii. Two proteins, human immunoglobulin G (hIgG) and bovine serum albumin (BSA), were used to examine the effect of protein characteristics. The results of adsorption isotherms showed that the dextran-grafted resin with high ligand density had substantially higher adsorption capacity and enhanced the salt-tolerance property for hIgG, but displayed a significantly smaller benefit for BSA adsorption. Confocal laser scanning microscopy (CLSM) showed that hIgG presented more diffuse and slower moving adsorption front compared to BSA during uptake into the resins because of the selective binding of multiple species from polyclonal IgG; polymer-grafting with high ligand density could enhance the rate of hIgG transport in the dextran-grafted resins without salt addition, but not for the case with high salt and BSA. The results indicate that microscopic analysis using ISEC and CLSM is useful to improve the mechanistic understanding of resin structure and of critical functional parameters involving protein adsorption and transport, which would guide the rational design of new resins and processes. Copyright © 2017. Published by Elsevier B.V.

Effect of five-membered ring and heteroatom substitution on charge transport properties of perylene discotic derivatives: A theoretical approach

Energy Technology Data Exchange (ETDEWEB)

Navarro, Amparo, E-mail: anavarro@ujaen.es; Fernández-Liencres, M. Paz; Peña-Ruiz, Tomás; Granadino-Roldán, José M.; Fernández-Gómez, Manuel [Departamento de Química Física y Analítica, Universidad de Jaén, Campus Las Lagunillas, E23071 Jaén (Spain); García, Gregorio [Instituto de Energía Solar and Departamento TFB, E.T.S.I. Telecomunicación, Universidad Politécnica de Madrid, Ciudad Universitaria, Madrid 28040 (Spain)

2016-08-07

Density functional theory calculations were carried out to investigate the evolvement of charge transport properties of a set of new discotic systems as a function of ring and heteroatom (B, Si, S, and Se) substitution on the basic structure of perylene. The replacement of six-membered rings by five-membered rings in the reference compound has shown a prominent effect on the electron reorganization energy that decreases ∼0.2 eV from perylene to the new carbon five-membered ring derivative. Heteroatom substitution with boron also revealed to lower the LUMO energy level and increase the electron affinity, therefore lowering the electron injection barrier compared to perylene. Since the rate of the charge transfer between two molecules in columnar discotic systems is strongly dependent on the orientation of the stacked cores, the total energy and transfer integral of a dimer as a disc is rotated with respect to the other along the stacking axis have been predicted. Aimed at obtaining a more realistic approach to the bulk structure, the molecular geometry of clusters made up of five discs was fully optimized, and charge transfer rate and mobilities were estimated for charge transport along a one dimensional pathway. Heteroatom substitution with selenium yields electron transfer integral values ∼0.3 eV with a relative disc orientation of 25°, which is the preferred angle according to the dimer energy profile. All the results indicate that the tetraselenium-substituted derivative, not synthetized so far, could be a promising candidate among those studied in this work for the fabrication of n-type semiconductors based on columnar discotic liquid crystals materials.

Poly(o-aminophenol) film electrodes synthesis, transport properties and practical applications

CERN Document Server

Tucceri, Ricardo

2014-01-01

This review book is concerned with the synthesis, charge transport properties and practical applications of poly (o-aminophenol) (POAP) film electrodes. It is divided into three parts. The first one has a particular emphasis on problems of synthesis and structure of POAP. The second part deals with the mechanism of charge transfer and charge transport processes occurring in the course of the redox reactions of POAP. The third part describes the promising applications of POAP in the different fields of sensors, electrocatalysis, bioelectrochemistry, corrosion protection, among others. This review covers the literature on POAP in the time period comprised between 1987 and 2013.

31 CFR 337.2 - Transportation charges and risks.

Science.gov (United States)

2010-07-01

... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Transportation charges and risks. 337... FEDERAL HOUSING ADMINISTRATION DEBENTURES Certificated Debentures § 337.2 Transportation charges and risks... to book-entry form, must be delivered at the expense and risk of the holder. Debentures bearing...

Charge transport parameters of HBC at different temperatures

Energy Technology Data Exchange (ETDEWEB)

Kirkpatrick, J. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom); Marcon, V.; Kremer, K.; Andrienko, D. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Nelson, J. [Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom)

2008-05-15

We study the dependence on temperature of the charge transport parameters for hexabenzocoronene (HBC). Following from Marcus theory, two charge transport parameters will be calculated: the transfer integral and the difference in site energies. These parameters are strongly dependent on the orientation and position of molecules. Position and orientation of molecules are determined using molecular dynamics. Transfer integrals are calculated from a simplified INDO method. A technique to compute energetic disorder, that is the spread in site energies for the charge carriers, is developed. In the herringbone phase transfer integrals are higher, but so is energetic disorder. We consider three derivatives of HBC with different side chains, which lead to different phase behaviour and distributions of charge transport parameters. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Electronic and transport properties of Cobalt-based valence tautomeric molecules and polymers

Science.gov (United States)

Chen, Yifeng; Calzolari, Arrigo; Buongiorno Nardelli, Marco

2011-03-01

The advancement of molecular spintronics requires further understandings of the fundamental electronic structures and transport properties of prototypical spintronics molecules and polymers. Here we present a density functional based theoretical study of the electronic structures of Cobalt-based valence tautomeric molecules Co III (SQ)(Cat)L Co II (SQ)2 L and their polymers, where SQ refers to the semiquinone ligand, and Cat the catecholate ligand, while L is a redox innocent backbone ligand. The conversion from low-spin Co III ground state to high-spin Co II excited state is realized by imposing an on-site potential U on the Co atom and elongating the Co-N bond. Transport properties are subsequently calculated by extracting electronic Wannier functions from these systems and computing the charge transport in the ballistic regime using a Non-Equilibrium Green's Function (NEGF) approach. Our transport results show distinct charge transport properties between low-spin ground state and high-spin excited state, hence suggesting potential spintronics devices from these molecules and polymers such as spin valves.

Absence of ballistic charge transport in the half-filled 1D Hubbard model

Science.gov (United States)

Carmelo, J. M. P.; Nemati, S.; Prosen, T.

2018-05-01

Whether in the thermodynamic limit of lattice length L → ∞, hole concentration mηz = - 2 Sηz/L = 1 -ne → 0, nonzero temperature T > 0, and U / t > 0 the charge stiffness of the 1D Hubbard model with first neighbor transfer integral t and on-site repulsion U is finite or vanishes and thus whether there is or there is no ballistic charge transport, respectively, remains an unsolved and controversial issue, as different approaches yield contradictory results. (Here Sηz = - (L -Ne) / 2 is the η-spin projection and ne =Ne / L the electronic density.) In this paper we provide an upper bound on the charge stiffness and show that (similarly as at zero temperature), for T > 0 and U / t > 0 it vanishes for mηz → 0 within the canonical ensemble in the thermodynamic limit L → ∞. Moreover, we show that at high temperature T → ∞ the charge stiffness vanishes as well within the grand-canonical ensemble for L → ∞ and chemical potential μ →μu where (μ -μu) ≥ 0 and 2μu is the Mott-Hubbard gap. The lack of charge ballistic transport indicates that charge transport at finite temperatures is dominated by a diffusive contribution. Our scheme uses a suitable exact representation of the electrons in terms of rotated electrons for which the numbers of singly occupied and doubly occupied lattice sites are good quantum numbers for U / t > 0. In contrast to often less controllable numerical studies, the use of such a representation reveals the carriers that couple to the charge probes and provides useful physical information on the microscopic processes behind the exotic charge transport properties of the 1D electronic correlated system under study.

Opto-electro-modulated transient photovoltage and photocurrent system for investigation of charge transport and recombination in solar cells.

Science.gov (United States)

Shi, Jiangjian; Li, Dongmei; Luo, Yanhong; Wu, Huijue; Meng, Qingbo

2016-12-01

An opto-electro-modulated transient photovoltage/photocurrent system has been developed to probe microscopic charge processes of a solar cell in its adjustable operating conditions. The reliability of this system is carefully determined by electric circuit simulations and experimental measurements. Using this system, the charge transport, recombination and storage properties of a conventional multicrystalline silicon solar cell under different steady-state bias voltages, and light illumination intensities are investigated. This system has also been applied to study the influence of the hole transport material layer on charge extraction and the microscopic charge processes behind the widely considered photoelectric hysteresis in perovskite solar cells.

Correlation of Disorder and Charge Transport in a Range of Indacenodithiophene-Based Semiconducting Polymers

KAUST Repository

Nikolka, Mark

2017-12-13

Over the past 25 years, various design motifs have emerged for the development of organic semiconductors for demanding applications in flexible organic light emitting diode display backplanes or even printed organic logic. Due to their large area uniformity paired with high charge carrier mobilities, conjugated polymers have attracted increasing attention in this respect. However, the performances delivered by current generation conjugated polymers still fall short of many industrial requirements demanding devices with ideal transistor characteristics and higher mobilities. The discovery of conjugated polymers with low energetic disorder, such as the indacenodithiophene-based polymer indacenodithiophene-co-benzothiadiazole, represent an exciting opportunity to breach this chasm if these materials can be further optimized while maintaining their low disorder. Here, it is shown how both the charge transport properties as well as the energetic disorder are affected by tuning the molecular structure of a large range of indacenodithiophene-based semiconducting polymer derivatives. This study allows to understand better the interplay between molecular design and structure of the polymer backbone and the degree of energetic disorder that governs the charge transport properties in thin polymer films.

BiOI/TiO2-nanorod array heterojunction solar cell: Growth, charge transport kinetics and photoelectrochemical properties

International Nuclear Information System (INIS)

Wang, Lingyun; Daoud, Walid A.

2015-01-01

Highlights: • BiOI/TiO 2 photoanodes were fabricated by a simple solvothermal/hydrothermal method. • BiOI/TiO 2 (PVP) showed a 13-fold increase in photocurrent density compared to TiO 2 . • Charge transport kinetics within the BiOI/TiO 2 heterojunctions are discussed. - Abstract: A series of BiOI/TiO 2 -nanorod array photoanodes were grown on fluorine-doped tin oxide (FTO) glass using a simple two-step solvothermal/hydrothermal method. The effects of the hydrothermal process, such as TiO 2 nanorod growth time, BiOI concentration and the role of surfactant, polyvinylpyrrolidone (PVP), on the growth of BiOI, were investigated. The heterojunctions were characterized by X-ray diffraction, UV–vis absorbance spectroscopy and scanning electron microscopy. The photoelectrochemical properties of the as-grown junctions, such as linear sweep voltammetry (LSV) behavior, photocurrent response and incident photon-to-electron conversion efficiency (IPCE) under Xenon lamp illumination, are presented. The cell with BiOI/TiO 2 (PVP) as photoanode can reach a short current density (J sc ) of 0.13 mA/cm 2 and open circuit voltage (V oc ) of 0.46 V vs. Ag/AgCl under the irradiation of a 300 W Xenon lamp. Compared to bare TiO 2 , the IPCE of BiOI/TiO 2 (PVP) increased 4–5 times at 380 nm. Furthermore, the charge transport kinetics within the heterojunction is also discussed

Charge-transport anisotropy in black phosphorus: critical dependence on the number of layers.

Science.gov (United States)

Banerjee, Swastika; Pati, Swapan K

2016-06-28

Phosphorene is a promising candidate for modern electronics because of the anisotropy associated with high electron-hole mobility. Additionally, superior mechanical flexibility allows the strain-engineering of various properties including the transport of charge carriers in phosphorene. In this work, we have shown the criticality of the number of layers to dictate the transport properties of black phosphorus. Trilayer black phosphorus (TBP) has been proposed as an excellent anisotropic material, based on the transport parameters using Boltzmann transport formalisms coupled with density functional theory. The mobilities of both the electron and the hole are found to be higher along the zigzag direction (∼10(4) cm(2) V(-1) s(-1) at 300 K) compared to the armchair direction (∼10(2) cm(2) V(-1) s(-1)), resulting in the intrinsic directional anisotropy. Application of strain leads to additional electron-hole anisotropy with 10(3) fold higher mobility for the electron compared to the hole. Critical strain for maximum anisotropic response has also been determined. Whether the transport anisotropy is due to the spatial or charge-carrier has been determined through analyses of the scattering process of electrons and holes, and their recombination as well as relaxation dynamics. In this context, we have derived two descriptors (S and F(k)), which are general enough for any 2D or quasi-2D systems. Information on the scattering involving purely the carrier states also helps to understand the layer-dependent photoluminescence and electron (hole) relaxation in black phosphorus. Finally, we justify trilayer black phosphorus (TBP) as the material of interest with excellent transport properties.

The Effect of Ketone Defects on the Charge Transport and Charge Recombination in Polyfluorenes

NARCIS (Netherlands)

Kuik, Martijn; Wetzelaer, Gert-Jan A. H.; Ladde, Jurre G.; Nicolai, Herman T.; Wildeman, Jurjen; Sweelssen, Jorgen; Blom, Paul W. M.; Sweelssen, Jörgen

2011-01-01

The effect of on-chain ketone defects on the charge transport of the polyfluorene derivative poly(9,9-dioctylfluorene) (PFO) is investigated. Using MoO3 as ohmic hole contact, the hole transport in a pristine PFO diode is observed to be limited by space-charge, whereas fluorenone contaminated PFO

The effect of ketone defects on the charge transport and charge recombination in polyfluorenes

NARCIS (Netherlands)

Kuik, M.; Wetzelaer, G.-J.A.H.; Laddé, J.G.; Nicolai, H.T.; Wildeman, J.; Sweelssen, J.; Blom, P.W.M.

2011-01-01

The effect of on-chain ketone defects on the charge transport of the polyfluorene derivative poly(9,9-dioctylfluorene) (PFO) is investigated. Using MoO3 as ohmic hole contact, the hole transport in a pristine PFO diode is observed to be limited by space-charge, whereas fluorenone contaminated PFO

Ultrafast Microscopy of Energy and Charge Transport

Science.gov (United States)

Huang, Libai

The frontier in solar energy research now lies in learning how to integrate functional entities across multiple length scales to create optimal devices. Advancing the field requires transformative experimental tools that probe energy transfer processes from the nano to the meso lengthscales. To address this challenge, we aim to understand multi-scale energy transport across both multiple length and time scales, coupling simultaneous high spatial, structural, and temporal resolution. In my talk, I will focus on our recent progress on visualization of exciton and charge transport in solar energy harvesting materials from the nano to mesoscale employing ultrafast optical nanoscopy. With approaches that combine spatial and temporal resolutions, we have recently revealed a new singlet-mediated triplet transport mechanism in certain singlet fission materials. This work demonstrates a new triplet exciton transport mechanism leading to favorable long-range triplet exciton diffusion on the picosecond and nanosecond timescales for solar cell applications. We have also performed a direct measurement of carrier transport in space and in time by mapping carrier density with simultaneous ultrafast time resolution and 50 nm spatial precision in perovskite thin films using transient absorption microscopy. These results directly visualize long-range carrier transport of 220nm in 2 ns for solution-processed polycrystalline CH3NH3PbI3 thin films. The spatially and temporally resolved measurements reported here underscore the importance of the local morphology and establish an important first step towards discerning the underlying transport properties of perovskite materials.

Variational multiscale models for charge transport.

Science.gov (United States)

Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin

2012-01-01

This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle

Variational multiscale models for charge transport

Science.gov (United States)

Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin

2012-01-01

This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle

Transport and Fatigue Properties of Ferroelectric Polymer P(VDF-TrFE) For Nonvolatile Memory Applications

KAUST Repository

Hanna, Amir

2012-01-01

injection and transport are believed to affect various properties of ferroelectric films such as remnant polarization values and polarization fatigue behavior.. Thus, this thesis aims to study charge injection in P(VDF-TrFE) and its transport properties as a

Charged-particle calculations using Boltzmann transport methods

International Nuclear Information System (INIS)

Hoffman, T.J.; Dodds, H.L. Jr.; Robinson, M.T.; Holmes, D.K.

1981-01-01

Several aspects of radiation damage effects in fusion reactor neutron and ion irradiation environments are amenable to treatment by transport theory methods. In this paper, multigroup transport techniques are developed for the calculation of charged particle range distributions, reflection coefficients, and sputtering yields. The Boltzmann transport approach can be implemented, with minor changes, in standard neutral particle computer codes. With the multigroup discrete ordinates code, ANISN, determination of ion and target atom distributions as functions of position, energy, and direction can be obtained without the stochastic error associated with atomistic computer codes such as MARLOWE and TRIM. With the multigroup Monte Carlo code, MORSE, charged particle effects can be obtained for problems associated with very complex geometries. Results are presented for several charged particle problems. Good agreement is obtained between quantities calculated with the multigroup approach and those obtained experimentally or by atomistic computer codes

The Role of Shape on Electronic Structure and Charge Transport in Faceted PbSe Nanocrystals

KAUST Repository

Kaushik, Ananth P.; Lukose, Binit; Clancy, Paulette

2014-01-01

We have determined the effect of shape on the charge transport characteristics of nanocrystals. Our study looked at the explicit determination of the electronic properties of faceted nanocrystals that essentially probe the limit of current

Transport and matching of low energy space charge dominated beams

International Nuclear Information System (INIS)

Pandit, V.S.

2013-01-01

The transport and matching of low energy high intensity beams from the ion source to the subsequent accelerating structure are of considerable interest in recent years for variety of applications such as Accelerator driven system (ADSS), transmutation of nuclear waste, spallation neutron sources etc. It is essential to perform detailed simulations with experimentation to predict the beam evolution in the presence of nonlinear self as well as external fields before the design of the next accelerating structure is finalized. In order to study and settle various physics and technical issues related with transport of space charge dominated beams we have developed a 2.45 GHz microwave ion source at VECC which is now delivering more than 10 mA proton beam current at 80 keV. We have successfully transported well collimated 8 mA proton beam through the solenoid based 3 meter long transport line and studied various beam properties. We have also studied the transport of beam through spiral inflector at low beam current ∼ 1mA. In this article we will discuss the beam transport issues and describe a technique for simulation of beam envelopes in presence of linear space charge effects. We use canonical description of the motion of a single particle and then obtain first order differential equations for evolution of the moments of beam ensemble by assuming uniform distribution of the beam. We will also discuss the methodology used in the simulations to understand the observed beam behaviour during transport. (author)

High-frequency acoustic charge transport in GaAs nanowires

NARCIS (Netherlands)

Büyükköse, S.; Hernandez-Minguez, A.; Vratzov, B.; Somaschini, C.; Geelhaar, L.; Riechert, H.; van der Wiel, Wilfred Gerard; Santos, P.V.

2014-01-01

The oscillating piezoelectric fields accompanying surface acoustic waves are able to transport charge carriers in semiconductor heterostructures. Here, we demonstrate high-frequency (above 1 GHz) acoustic charge transport in GaAs-based nanowires deposited on a piezoelectric substrate. The short

Noise And Charge Transport In Carbon Nanotube Devices

Science.gov (United States)

Reza, Shahed; Huynh, Quyen T.; Bosman, Gijs; Sippel, Jennifer; Rinzler, Andrew G.

2005-11-01

The charge transport and noise properties of three terminal, gated devices containing multiple, single wall, metallic and semiconductor carbon nanotubes have been measured as a function of gate and drain bias at 300K. Using pulsed bias the metallic tubes could be burned sequentially enabling the separation of measured conductance and low frequency excess noise into metallic and semiconductor contributions. The relative low frequency excess noise of the metallic tubes was about a factor 100 lower than that of the semiconductor tubes, whereas the conductance of the metallic tubes was significantly higher (10 to 50 times) than that of the semiconductor tubes.

Synthesis, characterization and charge transport mechanism of CdZnO nanorods

International Nuclear Information System (INIS)

Mahmoud, Waleed E.; Al-Ghamdi, A.A.; El-Tantawy, F.; Al-Heniti, S.

2009-01-01

ZnO and Cd-doped ZnO nanostructures were prepared by new facile method at 80 deg. C. XRD measurement indicated that both samples had typical hexagonal wurtzite structures. Transmission electron microscopy (TEM) measurement shows that rod-like crystals have been formed. EDX measurement confirms the incorporation of the cadmium ion into the crystalline lattice of ZnO and indicated that cadmium ions uniformly distributed on the surface of the rods. The doping with cadmium ions has a great influence on the optical properties of the ZnO. The electrical measurements of Cd-doped ZnO nanorod were measured. The current-voltage (I-V) characteristic curve revealed that the charge transport above 4 V is mainly non-linear due to grain boundary contribution. The complex impedance spectroscopy was confirmed that the grain boundary effect controls the charge transport mechanism through CdZnO ceramic material.

Simulation of charge transport in organic semiconductors: A time-dependent multiscale method based on nonequilibrium Green's functions

DEFF Research Database (Denmark)

Leitherer, Susanne; Jager, C. M.; Krause, A.

2017-01-01

In weakly interacting organic semiconductors, static disorder and dynamic disorder often have an important impact on transport properties. Describing charge transport in these systems requires an approach that correctly takes structural and electronic fluctuations into account. Here, we present...... are used in organic field-effect transistors....

Organic n-type materials for charge transport and charge storage applications.

Science.gov (United States)

Stolar, Monika; Baumgartner, Thomas

2013-06-21

Conjugated materials have attracted much attention toward applications in organic electronics in recent years. These organic species offer many advantages as potential replacement for conventional materials (i.e., silicon and metals) in terms of cheap fabrication and environmentally benign devices. While p-type (electron-donating or hole-conducting) materials have been extensively reviewed and researched, their counterpart n-type (electron-accepting or electron-conducting) materials have seen much less popularity despite the greater need for improvement. In addition to developing efficient charge transport materials, it is equally important to provide a means of charge storage, where energy can be used on an on-demand basis. This perspective is focused on discussing a selection of representative n-type materials and the efforts toward improving their charge-transport efficiencies. Additionally, this perspective will also highlight recent organic materials for battery components and the efforts that have been made to improve their environmental appeal.

Production, transport and charge capture measurements of highly charged recoil ions

International Nuclear Information System (INIS)

Trebus, U.E.

1989-01-01

An experiment is described to study highly charged recoil ions on-line to the heavy accelerator UNILAC at GSI. The highly charged recoil ions are produced by heavy-ion bombardment of a gas target. Subsequently the slow highly charged recoil ions are extracted from the ionization volume, and guided through a beam transport line to a Wien filter for charge state selection and to a collision region to study charge transfer processes. Several experiments were carried out to show the efficient charge state separation. Charge states up to q = 15 were observed. When using a retarding field analyzer cross sections for single electron capture were determined for different charge states of Xe q+ for q = 4 to 11 and He gas. The experiments demonstrated increasing charge transfer cross sections with increasing charge state q and indicated the effect of near resonant charge capture for q = 6. The flexible data acquisition system used, is described and other future experiments, such as for instance in flight ion-trapping are indicated in the appendix

Production, transport and charge capture measurements of highly charged recoil ions

International Nuclear Information System (INIS)

Trebus, U.E.

1989-05-01

An experiment is described to study highly charged recoil ions on-line to the heavy ion accelerator UNILAC at GSI. The highly charged recoil ions are produced by heavy ion bombardment of a gas target. Subsequently the slow highly charged recoil ions are extracted from the ionization volume, and guided through a beam transport line to a Wien filter for charge state selection and to a collision region to study charge transfer processes. Several experiments were carried out to show the efficient charge state separation. Charge states up to q=15 were observed. When using a retarding field analyzer cross sections for single electron capture were determined for different charge states of Xe q+ for q=4 to 11 and He gas. The experiments demonstrated increasing charge transfer cross sections with increasing charge state q and indicated the effect of near resonant charge capture for q=6. The flexible data acquisition system used, is described and other future experiments, such as for instance in flight ion-trapping are indicated in the appendix. (orig.)

Charge transport through molecular switches

International Nuclear Information System (INIS)

Jan van der Molen, Sense; Liljeroth, Peter

2010-01-01

We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)

Charge transport through molecular switches

Energy Technology Data Exchange (ETDEWEB)

Jan van der Molen, Sense [Kamerlingh Onnes Laboratorium, Leiden University, Niels Bohrweg 2, 2333 CA Leiden (Netherlands); Liljeroth, Peter, E-mail: molen@physics.leidenuniv.n [Condensed Matter and Interfaces, Debye Institute for Nanomaterials Science, University of Utrecht, PO Box 80000, 3508 TA Utrecht (Netherlands)

2010-04-07

We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)

Space charge compensation on the low energy beam transport of Linac4

CERN Document Server

AUTHOR|(SzGeCERN)733270; Scrivens, Richard; Jesus Castillo, Santos

Part of the upgrade program in the injector chains of the CERN accelerator complex is the replacement of the the proton accelerator Linac2 for the brand new Linac4 which will accelerate H$^-$ and its main goal is to increase the beam intensity in the next sections of the LHC accelerator chain. The Linac4 is now under commissioning and will use several ion sources to produce high intensity unbunched H$^-$ beams with different properties, and the low energy beam transport (LEBT) is the system in charge of match all these different beams to the Radio frequency quadrupole (RFQ). The space charge forces that spread the beam ions apart of each other and cause emittance growth limits the maximum intensity that can be transported in the LEBT, but the space charge of intense unbunched ion beams can be compensated by the generated ions by the impact ionization of the residual gas, which creates a source of secondary particles inside the beam pipe. For negative ion beams, the effect of the beam electric field is to ex...

Crossover from band-like to thermally activated charge transport in organic transistors due to strain-induced traps

KAUST Repository

Mei, Yaochuan

2017-08-02

The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials, leading to better design of high-performance materials for consumer applications. Here, we present experimental results that suggest that the inhomogeneous strain induced in organic semiconductor layers by the mismatch between the coefficients of thermal expansion (CTE) of the consecutive device layers of field-effect transistors generates trapping states that localize charge carriers. We observe a universal scaling between the activation energy of the transistors and the interfacial thermal expansion mismatch, in which band-like transport is observed for similar CTEs, and activated transport otherwise. Our results provide evidence that a high-quality semiconductor layer is necessary, but not sufficient, to obtain efficient charge-carrier transport in devices, and underline the importance of holistic device design to achieve the intrinsic performance limits of a given organic semiconductor. We go on to show that insertion of an ultrathin CTE buffer layer mitigates this problem and can help achieve band-like transport on a wide range of substrate platforms.

Crossover from band-like to thermally activated charge transport in organic transistors due to strain-induced traps.

Science.gov (United States)

Mei, Yaochuan; Diemer, Peter J; Niazi, Muhammad R; Hallani, Rawad K; Jarolimek, Karol; Day, Cynthia S; Risko, Chad; Anthony, John E; Amassian, Aram; Jurchescu, Oana D

2017-08-15

The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials, leading to better design of high-performance materials for consumer applications. Here, we present experimental results that suggest that the inhomogeneous strain induced in organic semiconductor layers by the mismatch between the coefficients of thermal expansion (CTE) of the consecutive device layers of field-effect transistors generates trapping states that localize charge carriers. We observe a universal scaling between the activation energy of the transistors and the interfacial thermal expansion mismatch, in which band-like transport is observed for similar CTEs, and activated transport otherwise. Our results provide evidence that a high-quality semiconductor layer is necessary, but not sufficient, to obtain efficient charge-carrier transport in devices, and underline the importance of holistic device design to achieve the intrinsic performance limits of a given organic semiconductor. We go on to show that insertion of an ultrathin CTE buffer layer mitigates this problem and can help achieve band-like transport on a wide range of substrate platforms.

Transport properties of monolayer and bilayer graphene p-n junctions with charge puddles in the quantum Hall regime

International Nuclear Information System (INIS)

Cheng Shuguang

2010-01-01

Recent experiments have confirmed that the electron-hole inhomogeneity in graphene is a new type of charge disorder. Motivated by such confirmation, we theoretically study the transport properties of a monolayer graphene (MLG) based p-n junction and a bilayer graphene (BLG) p-n junction in the quantum Hall regime where electron-hole puddles are considered. By using the non-equilibrium Green function method, both the current and conductance are obtained. We find that, in the presence of the electron-hole inhomogeneity, the lowest quantized conductance plateau at e 2 /h emerges in the MLG p-n junction under very small charge puddle disorder strength. For a BLG p-n junction, however, the conductance in the p-n region is enhanced with charge puddles, and the lowest quantized conductance plateau emerges at 2e 2 /h. Besides, when an ideal quantized conductance plateau is formed for a MLG p-n junction, the universal conductance fluctuation is found to be 2e 2 /3h. Furthermore, we also investigate the influence of Anderson disorder on such p-n junctions and the comparison and discussion are given accordingly. To compare the two models with different types of disorder, we investigate the conductance distribution specially. Finally the influence of disorder strength on the conductance of a MLG p-n junction is investigated.

Microscopic origins of charge transport in triphenylene systems

Science.gov (United States)

Thompson, Ian R.; Coe, Mary K.; Walker, Alison B.; Ricci, Matteo; Roscioni, Otello M.; Zannoni, Claudio

2018-06-01

We study the effects of molecular ordering on charge transport at the mesoscale level in a layer of ≈9000 hexa-octyl-thio-triphenylene discotic mesogens with dimensions of ≈20 ×20 ×60 nm3 . Ordered (columnar) and disordered isotropic morphologies are obtained from a combination of atomistic and coarse-grained molecular-dynamics simulations. Electronic structure codes are used to find charge hopping rates at the microscopic level. Energetic disorder is included through the Thole model. Kinetic Monte Carlo simulations then predict charge mobilities. We reproduce the large increase in mobility in going from an isotropic to a columnar morphology. To understand how these mobilities depend on the morphology and hopping rates, we employ graph theory to analyze charge trajectories by representing the film as a charge-transport network. This approach allows us to identify spatial correlations of molecule pairs with high transfer rates. These pairs must be linked to ensure good transport characteristics or may otherwise act as traps. Our analysis is straightforward to implement and will be a useful tool in linking materials to device performance, for example, to investigate the influence of local inhomogeneities in the current density. Our mobility-field curves show an increasing mobility with field, as would be expected for an organic semiconductor.

The effect of interfacial layers on charge transport in organic solar cell

Energy Technology Data Exchange (ETDEWEB)

Mbuyise, Xolani G.; Tonui, Patrick; Mola, Genene Tessema, E-mail: mola@ukzn.ac.za

2016-09-01

The effect of interfacial buffer layers in organic photovoltaic cell (OPV) whose active layer is composed of poly(3 hexylthiophene) (P3HT) and [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) blend was studied. The electrical properties of OPV devices produced with and without interfacial layers are compared and discussed in terms of measured parameters of the cells. The charge transport properties showed significant difference on the mobility and activation factor between the two types of device structures. The life time measurements in the unprotected conditions are also presented and discussed.

Competition between deformability and charge transport in semiconducting polymers for flexible and stretchable electronics

International Nuclear Information System (INIS)

Printz, Adam D.; Lipomi, Darren J.

2016-01-01

The primary goal of the field concerned with organic semiconductors is to produce devices with performance approaching that of silicon electronics, but with the deformability—flexibility and stretchability—of conventional plastics. However, an inherent competition between deformability and charge transport has long been observed in these materials, and achieving the extreme (or even moderate) deformability implied by the word “plastic” concurrently with high charge transport may be elusive. This competition arises because the properties needed for high carrier mobilities—e.g., rigid chains in π-conjugated polymers and high degrees of crystallinity in the solid state—are antithetical to deformability. On the device scale, this competition can lead to low-performance yet mechanically robust devices, or high-performance devices that fail catastrophically (e.g., cracking, cohesive failure, and delamination) under strain. There are, however, some observations that contradict the notion of the mutual exclusivity of electronic and mechanical performances. These observations suggest that this problem may not be a fundamental trade-off, but rather an inconvenience that may be negotiated by a logical selection of materials and processing conditions. For example, the selection of the poly(3-alkylthiophene) with a critical side-chain length—poly(3-heptylthiophene) (n = 7)—marries the high deformability of poly(3-octylthiophene) (n = 8) with the high electronic performance (as manifested in photovoltaic efficiency) of poly(3-hexylthiophene) (n = 6). This review explores the relationship between deformability and charge transport in organic semiconductors. The principal conclusions are that reducing the competition between these two parameters is in fact possible, with two demonstrated routes being: (1) incorporation of softer, insulating material into a stiffer, semiconducting material and (2) increasing disorder in a highly ordered film, but not

Competition between deformability and charge transport in semiconducting polymers for flexible and stretchable electronics

Energy Technology Data Exchange (ETDEWEB)

Printz, Adam D.; Lipomi, Darren J., E-mail: dlipomi@ucsd.edu [Department of NanoEngineering, University of California, San Diego, 9500 Gilman Drive, Mail Code 0448, La Jolla, California 92093-0448 (United States)

2016-06-15

The primary goal of the field concerned with organic semiconductors is to produce devices with performance approaching that of silicon electronics, but with the deformability—flexibility and stretchability—of conventional plastics. However, an inherent competition between deformability and charge transport has long been observed in these materials, and achieving the extreme (or even moderate) deformability implied by the word “plastic” concurrently with high charge transport may be elusive. This competition arises because the properties needed for high carrier mobilities—e.g., rigid chains in π-conjugated polymers and high degrees of crystallinity in the solid state—are antithetical to deformability. On the device scale, this competition can lead to low-performance yet mechanically robust devices, or high-performance devices that fail catastrophically (e.g., cracking, cohesive failure, and delamination) under strain. There are, however, some observations that contradict the notion of the mutual exclusivity of electronic and mechanical performances. These observations suggest that this problem may not be a fundamental trade-off, but rather an inconvenience that may be negotiated by a logical selection of materials and processing conditions. For example, the selection of the poly(3-alkylthiophene) with a critical side-chain length—poly(3-heptylthiophene) (n = 7)—marries the high deformability of poly(3-octylthiophene) (n = 8) with the high electronic performance (as manifested in photovoltaic efficiency) of poly(3-hexylthiophene) (n = 6). This review explores the relationship between deformability and charge transport in organic semiconductors. The principal conclusions are that reducing the competition between these two parameters is in fact possible, with two demonstrated routes being: (1) incorporation of softer, insulating material into a stiffer, semiconducting material and (2) increasing disorder in a highly ordered film, but not

Beamline for low-energy transport of highly charged ions at HITRAP

International Nuclear Information System (INIS)

Andelkovic, Z.; Herfurth, F.; Kotovskiy, N.; König, K.; Maaß, B.; Murböck, T.; Neidherr, D.; Schmidt, S.; Steinmann, J.; Vogel, M.; Vorobjev, G.

2015-01-01

A beamline for transport of highly charged ions with energies as low as a few keV/charge has been constructed and commissioned at GSI. Complementary to the existing infrastructure of the HITRAP facility for deceleration of highly charged ions from the GSI accelerator, the new beamline connects the HITRAP ion decelerator and an EBIT with the associated experimental setups. Therefore, the facility can now transport the decelerated heavy highly charged ions to the experiments or supply them offline with medium-heavy highly charged ions from the EBIT, both at energies as low as a few keV/charge. Here we present the design of the 20 m long beamline with the corresponding beam instrumentation, as well as its performance in terms of energy and transport efficiency

Charge transport across bulk heterojunction organic thin film

Energy Technology Data Exchange (ETDEWEB)

Tessema, Genene [University of Kwazulu-Natal, School of Physics, Scottsville (South Africa); Addis Ababa University, Department of Physics, Addis Ababa (Ethiopia)

2012-01-15

The transport of charges in organic photo-active film has been the focus of tremendous research in the past few decades with the view to understand the physics of the polymers. Bulk heterojunction type devices are particularly more interesting because of their high power conversion efficiency. We have fabricated organic PV cell based on sandwich type ITO/PEDOT:PSS/APFO green-6:PCBM/LiF/Al device structure. The space charge limited currents were investigated to be able to derive important transport parameters of the devices. The measured current agrees very well with trap free space charge limited transport theory. The zero field mobility and field activation factor found from the data were {mu} {sub 0}=(3.39{+-}0.2) x 10{sup -6} m{sup 2}/V sec and {gamma}=(8.3{+-}0.3) x 10{sup -4} (m/V){sup 1/2}, respectively. (orig.)

Investigation of transport properties of colossal magnetoresistive materials

International Nuclear Information System (INIS)

Kaurav, Netram

2006-01-01

The transport properties, i.e. resistivity, heat capacity, thermal conductivity and optical conductivity have been theoretically analysed for colossal magnetoresistive materials within the framework of double exchange mechanism. Following an effective interaction potential, we deduce acoustic (optical) phonon modes, coupling strength for electron-phonon and phonon-impurities, the phonon (magnon) scattering rate and constants characterise the scattering of charge and heat carriers with various disorders in the crystal. The theoretical models have been developed to account the anomalies observed in the transport phenomenon. It is noticed that electron-electron, electron-phonon and electron-magnon interactions are essential in discussing the transport behaviour of doped magnetites. (author)

BiOI/TiO{sub 2}-nanorod array heterojunction solar cell: Growth, charge transport kinetics and photoelectrochemical properties

Energy Technology Data Exchange (ETDEWEB)

Wang, Lingyun; Daoud, Walid A., E-mail: wdaoud@cityu.edu.hk

2015-01-01

Highlights: • BiOI/TiO{sub 2} photoanodes were fabricated by a simple solvothermal/hydrothermal method. • BiOI/TiO{sub 2} (PVP) showed a 13-fold increase in photocurrent density compared to TiO{sub 2}. • Charge transport kinetics within the BiOI/TiO{sub 2} heterojunctions are discussed. - Abstract: A series of BiOI/TiO{sub 2}-nanorod array photoanodes were grown on fluorine-doped tin oxide (FTO) glass using a simple two-step solvothermal/hydrothermal method. The effects of the hydrothermal process, such as TiO{sub 2} nanorod growth time, BiOI concentration and the role of surfactant, polyvinylpyrrolidone (PVP), on the growth of BiOI, were investigated. The heterojunctions were characterized by X-ray diffraction, UV–vis absorbance spectroscopy and scanning electron microscopy. The photoelectrochemical properties of the as-grown junctions, such as linear sweep voltammetry (LSV) behavior, photocurrent response and incident photon-to-electron conversion efficiency (IPCE) under Xenon lamp illumination, are presented. The cell with BiOI/TiO{sub 2} (PVP) as photoanode can reach a short current density (J{sub sc}) of 0.13 mA/cm{sup 2} and open circuit voltage (V{sub oc}) of 0.46 V vs. Ag/AgCl under the irradiation of a 300 W Xenon lamp. Compared to bare TiO{sub 2}, the IPCE of BiOI/TiO{sub 2} (PVP) increased 4–5 times at 380 nm. Furthermore, the charge transport kinetics within the heterojunction is also discussed.

Quadrupole transport experiment with space charge dominated cesium ion beam

International Nuclear Information System (INIS)

Faltens, A.; Keefe, D.; Kim, C.; Rosenblum, S.; Tiefenback, M.; Warwick, A.

1984-08-01

The purpose of the experiment is to investigate the beam current transport limit in a long quadrupole-focussed transport channel in the space charge dominated region where the space charge defocussing force is almost as large as the average focussing force of the channel

Simulation of photon and charge transport in X-ray imaging semiconductor sensors

CERN Document Server

Nilsson, H E; Hjelm, M; Bertilsson, K

2002-01-01

A fully stochastic model for the imaging properties of X-ray silicon pixel detectors is presented. Both integrating and photon counting configurations have been considered, as well as scintillator-coated structures. The model is based on three levels of Monte Carlo simulations; photon transport and absorption using MCNP, full band Monte Carlo simulation of charge transport and system level Monte Carlo simulation of the imaging performance of the detector system. In the case of scintillator-coated detectors, the light scattering in the detector layers has been simulated using a Monte Carlo method. The image resolution was found to be much lower in scintillator-coated systems due to large light spread in thick scintillator layers. A comparison between integrating and photon counting readout methods shows that the image resolution can be slightly enhanced using a photon-counting readout. In addition, the proposed model has been used to study charge-sharing effects on the energy resolution in photon counting dete...

Transportable charge in a periodic alternating gradient system

International Nuclear Information System (INIS)

Lee, E.P.; Fessenden, T.J.; Laslett, L.J.

1985-05-01

A simple set of formulas is derived which relate emittance, line charge density, matched maximum and average envelope radii, occupancy factors, and the (space charge) depressed and vacuum values of tune. This formulation is an improvement on the smooth limit approximation; deviations from exact (numerically determined) relations are on the order of +-2%, while the smooth limit values are in error by up to +-30%. This transport formalism is used to determine the limits of transportable line charge density in an electrostatic quadrupole array, with specific application to the low energy portion of the High Temperature Experiment of Heavy Ion Fusion Accelerator Research. The line charge density limit is found to be essentially proportional to the voltage on the pole faces and the fraction of occupied aperture area. A finite injection energy (greater than or equal to 2 MeV) is required to realize this limit, independent of particle mass

Charge transport in conjugated polymers: a multiscale picture

Science.gov (United States)

Ruehle, Victor; Kirkpatrick, James; Kremer, Kurt; Andrienko, Denis

2009-03-01

A framework to study charge transport in conjugated polymers using realistic morphologies is developed. First, the atomistic force field is refined using first-principles calculations. Systematic coarse graining is then performed to extend simulation times and system sizes accessible to molecular dynamics simulations. Material morphologies are generated using the coarse grained and atomistic models. Finally, the charge mobility is obtained using temperature activated hopping picture for charge transport [1]. The framework is tested on neutral and oxidized polypyrrole with different structural ordering [2]. [4pt] [1] J. Kirkpatrick, V. Marcon, J. Nelson, K. Kremer, D. Andrienko, Phys. Rev. Lett. 98, 227402 (2007)[0pt] [2] V. Ruehle, J. Kirkpatrick, K. Kremer, D. Andrienko, Phys. Stat. Solidi B, 245, 844 (2008)

DNA Charge Transport: From Chemical Principles to the Cell

Science.gov (United States)

Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.

2016-01-01

The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744

Lateral charge transport from heavy-ion tracks in integrated circuit chips

Science.gov (United States)

Zoutendyk, J. A.; Schwartz, H. R.; Nevill, L. R.

1988-01-01

A 256K DRAM has been used to study the lateral transport of charge (electron-hole pairs) induced by direct ionization from heavy-ion tracks in an IC. The qualitative charge transport has been simulated using a two-dimensional numerical code in cylindrical coordinates. The experimental bit-map data clearly show the manifestation of lateral charge transport in the creation of adjacent multiple-bit errors from a single heavy-ion track. The heavy-ion data further demonstrate the occurrence of multiple-bit errors from single ion tracks with sufficient stopping power. The qualitative numerical simulation results suggest that electric-field-funnel-aided (drift) collection accounts for single error generated by an ion passing through a charge-collecting junction, while multiple errors from a single ion track are due to lateral diffusion of ion-generated charge.

Universal transport characteristics of multiple topological superconducting wires with large charging energy

Energy Technology Data Exchange (ETDEWEB)

Kashuba, Oleksiy; Trauzettel, Bjoern [Institut fuer Theoretische Physik und Astrophysik, Universitaet Wuerzburg, 97074 Wuerzburg (Germany); Timm, Carsten [Institut fuer Theoretische Physik, TU Dresden, 01062 Dresden (Germany)

2016-07-01

The system with multiple Majorana states coupled to the normal lead can potentially support the interaction between Majorana fermions and electrons. Such system can be implemented by several floating topological superconducting wires with large charging energy asymmetrically coupled to two normal leads. The analysis of the renormalization flow shows that there is a single fixed point - the strong coupling limit of isotropic antiferromagnetic Kondo model. The topological Kondo-like interaction leads also to the selective renormalization of the tunneling coefficients, strongly enhancing one component and suppressing others. Thus, charging energy crucially changes the transport properties of the system leading to the universal single-channel conductance independently from the values of the initial leads-wires coupling.

The single-sink fixed-charge transportation problem: Applications and solution methods

DEFF Research Database (Denmark)

Goertz, Simon; Klose, Andreas

2007-01-01

The single-sink fixed-charge transportation problem (SSFCTP) consists in finding a minimum cost flow from a number of supplier nodes to a single demand node. Shipping costs comprise costs proportional to the amount shipped as well as a fixed-charge. Although the SSFCTP is an important special case...... of the well-known fixed-charge transportation problem, just a few methods for solving this problem have been proposed in the literature. After summarising some applications of this problem arising in manufacturing and transportation, we give an overview on approximation algorithms and worst-case results...

Varying the charge of small cations in liquid water: Structural, transport, and thermodynamical properties

Science.gov (United States)

Martelli, Fausto; Vuilleumier, Rodolphe; Simonin, Jean-Pierre; Spezia, Riccardo

2012-10-01

In this work, we show how increasing the charge of small cations affects the structural, thermodynamical, and dynamical properties of these ions in liquid water. We have studied the case of lanthanoid and actinoid ions, for which we have recently developed accurate polarizable force fields, and the ionic radius is in the 0.995-1.250 Å range, and explored the valency range from 0 to 4+. We found that the ion charge strongly structures the neighboring water molecules and that, in this range of charges, the hydration enthalpies exhibit a quadratic dependence with respect to the charge, in line with the Born model. The diffusion process follows two main regimes: a hydrodynamical regime for neutral or low charges, and a dielectric friction regime for high charges in which the contraction of the ionic radius along the series of elements causes a decrease of the diffusion coefficient. This latter behavior can be qualitatively described by theoretical models, such as the Zwanzig and the solvated ion models. However, these models need be modified in order to obtain agreement with the observed behavior in the full charge range. We have thus modified the solvated ion model by introducing a dependence of the bare ion radius as a function of the ionic charge. Besides agreement between theory and simulation this modification allows one to obtain an empirical unified model. Thus, by analyzing the contributions to the drag coefficient from the viscous and the dielectric terms, we are able to explain the transition from a regime in which the effect of viscosity dominates to one in which dielectric friction governs the motion of ions with radii of ca. 1 Å.

A hybrid charged-particle guide for studying (n, charged particle) reactions

International Nuclear Information System (INIS)

Haight, R.C.; White, R.M.; Zinkle, S.J.

1983-01-01

Charged-particle transport systems consisting of magnetic quadrupole lenses have been employed in recent years in the study of (n, charged particle) reactions. A new transport system was completed at the laboratory that is based both on magnetic lenses as well as electrostatic fields. The magnetic focusing of the charged-particle guide is provided by six magnetic quadrupole lenses arranged in a CDCCDC sequence (in the vertical plane). The electrostatic field is produced by a wire at high voltage which stretches the length of the guide and is physically at the centre of the magnetic axis. The magnetic lenses are used for charged particles above 5 MeV; the electrostatic guide is used for lower energies. This hybrid system possesses the excellent focusing and background rejection properties of other magnetic systems. For low energy charged-particles, the electrostatic transport avoids the narrow band-passes in charged-particle energy which are a problem with purely magnetic transport systems. This system is installed at the LLNL Cyclograaff facility for the study of (n, charged particle) reactions at neutron energies up to 35 MeV. (Auth.)

Surface structure, optoelectronic properties and charge transport in ZnO nanocrystal/MDMO-PPV multilayer films.

Science.gov (United States)

Lian, Qing; Chen, Mu; Mokhtar, Muhamad Z; Wu, Shanglin; Zhu, Mingning; Whittaker, Eric; O'Brien, Paul; Saunders, Brian R

2018-05-07

Blends of semiconducting nanocrystals and conjugated polymers continue to attract major research interest because of their potential applications in optoelectronic devices, such as solar cells, photodetectors and light-emitting diodes. In this study we investigate the surface structure, morphological and optoelectronic properties of multilayer films constructed from ZnO nanocrystals (NCs) and poly[2-methoxy-5-(3',7'-dimethyloctyloxy)-1,4-phenylenevinylene] (MDMO-PPV). The effects of layer number and ZnO concentration (C ZnO ) used on the multilayer film properties are investigated. An optimised solvent blend enabled well-controlled layers to be sequentially spin coated and the construction of multilayer films containing six ZnO NC (Z) and MDMO-PPV (M) layers (denoted as (ZM) 6 ). Contact angle data showed a strong dependence on C ZnO and indicated distinct differences in the coverage of MDMO-PPV by the ZnO NCs. UV-visible spectroscopy showed that the MDMO-PPV absorption increased linearly with the number of layers in the films and demonstrates highly tuneable light absorption. Photoluminescence spectra showed reversible quenching as well as a surprising red-shift of the MDMO-PPV emission peak. Solar cells were constructed to probe vertical photo-generated charge transport. The measurements showed that (ZM) 6 devices prepared using C ZnO = 14.0 mg mL -1 had a remarkably high open circuit voltage of ∼800 mV. The device power conversion efficiency was similar to that of a control bilayer device prepared using a much thicker MDMO-PPV layer. The results of this study provide insight into the structure-optoelectronic property relationships of new semiconducting multilayer films which should also apply to other semiconducting NC/polymer combinations.

The charge transport in an electrostatic belt generator

NARCIS (Netherlands)

Vermeer, A.; Strasters, B.A.

1975-01-01

The fluctuations in the charge transport system of an EN Tandem Van de Graaff accelerator have been investigated by means of a frequency spectrum analyser. Frequency spectra of the terminal ripple, the short-circuit current and the voltage at the belt charge screen have been measured. Also the

A common pathway for charge transport through voltage-sensing domains.

Science.gov (United States)

Chanda, Baron; Bezanilla, Francisco

2008-02-07

Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.

Macroscopic acoustoelectric charge transport in graphene

Science.gov (United States)

Bandhu, L.; Lawton, L. M.; Nash, G. R.

2013-09-01

We demonstrate macroscopic acoustoelectric transport in graphene, transferred onto piezoelectric lithium niobate substrates, between electrodes up to 500 μm apart. Using double finger interdigital transducers we have characterised the acoustoelectric current as a function of both surface acoustic wave intensity and frequency. The results are consistent with a relatively simple classical relaxation model, in which the acoustoelectric current is proportional to both the surface acoustic wave intensity and the attenuation of the wave caused by the charge transport.

Understanding charge transport and recombination losses in high performance polymer solar cells with non-fullerene acceptors

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xuning [HEEGER Beijing Research & Development Center; School of Chemistry; Beihang University; Beijing 100191; China; Zuo, Xiaobing [X-ray Science Division; Argonne National Laboratory; Argonne; USA; Xie, Shenkun [HEEGER Beijing Research & Development Center; School of Chemistry; Beihang University; Beijing 100191; China; Yuan, Jianyu [Jiangsu Key Laboratory for Carbon-Based Functional Materials & Devices; Institute of Functional Nano & Soft Materials (FUNSOM); Soochow University; Suzhou; P. R. China; Zhou, Huiqiong [CAS Key Laboratory of Nanosystem and Hierarchical Fabrication; CAS Center for Excellence in Nanoscience; National Center for Nanoscience and Technology; Beijing 100190; China; Zhang, Yuan [HEEGER Beijing Research & Development Center; School of Chemistry; Beihang University; Beijing 100191; China

2017-01-01

Photovoltaic characteristics, recombination and charge transport properties are investigated. The determined recombination reduction factor can reconcile the supreme device performance in organic solar cells using non-fullerene ITIC acceptor and severe carrier losses in all-polymer devices with P(NDI2OD-T2).

Charge and Spin Transport in Dilute Magnetic Semiconductors. Final report

International Nuclear Information System (INIS)

Ullrich, Carsten A.

2009-01-01

This proposal to the DOE outlines a three-year plan of research in theoretical and computational condensed-matter physics, with the aim of developing a microscopic theory for charge and spin dynamics in disordered materials with magnetic impurities. Important representatives of this class of materials are the dilute magnetic semiconductors (DMS), which have attracted great attention as a promising basis for spintronics devices. There is an intense experimental effort underway to study the transport properties of ferromagnetic DMS such as (Ga,Mn)As, and a number of interesting features have emerged: negative magnetoresistance, anomalous Hall effect, non-Drude dynamical conductivity, and resistivity maxima at the Curie temperature. Available theories have been able to account for some of these features, but at present we are still far away from a systematic microscopic understanding of transport in DMS. We propose to address this challenge by developing a theory of charge and spin dynamics based on a combination of the memory-function formalism and time-dependent density functional theory. This approach will be capable of dealing with two important issues: (a) the strong degree of correlated disorder in DMS, close to the localization transition (which invalidates the usual relaxation-time approximation to the Boltzmann equation), (b) the essentially unknown role of dynamical many-body effects such as spin Coulomb drag. We will calculate static and dynamical conductivities in DMS as functions of magnetic order and carrier density, which will advance our understanding of recent transport and infrared absorption measurements. Furthermore, we will study collective plasmon excitations in DMS (3D, 2D and quantum wells), whose linewidths could constitute a new experimental probe of the correlation of disorder, many-body effects and charge and spin dynamics in these materials.

Study of charge transport in composite blend of P3HT and PCBM

Science.gov (United States)

Kumar, Manoj; Kumar, Sunil; Upadhyaya, Aditi; Yadav, Anjali; Gupta, Saral K.; Singh, Amarjeet

2018-05-01

Poly (3-hexylthiophene-2,5diyl) (P3HT) as donor and [6,6]-phenyl C61 butyric acid methyl ester (PCBM) as acceptor are mostly used as active medium in polymeric electronic device. In this paper we have prepare the P3HT - PCBM based bulk hetero junction thin films by spin coating technique. The charge transport properties of P3HT:PCBM blends are investigated by the current-voltage measurements using Ag as an electron injecting electrode and ITO as a hole injecting contact. The current density v/s voltage relationships are analyzed in the backdrop of Schottky and Space charge limited current model.

19 CFR 351.515 - Internal transport and freight charges for export shipments.

Science.gov (United States)

2010-04-01

... shipments. 351.515 Section 351.515 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE... Internal transport and freight charges for export shipments. (a) Benefit—(1) In general. In the case of internal transport and freight charges on export shipments, a benefit exists to the extent that the charges...

Role of transport band edge variation on delocalized charge transport in high-mobility crystalline organic semiconductors

Science.gov (United States)

Kadashchuk, Andrey; Tong, Fei; Janneck, Robby; Fishchuk, Ivan I.; Mityashin, Alexander; Pavlica, Egon; Köhler, Anna; Heremans, Paul; Rolin, Cedric; Bratina, Gvido; Genoe, Jan

2017-09-01

We demonstrate that the degree of charge delocalization has a strong impact on polarization energy and thereby on the position of the transport band edge in organic semiconductors. This gives rise to long-range potential fluctuations, which govern the electronic transport through delocalized states in organic crystalline layers. This concept is employed to formulate an analytic model that explains a negative field dependence coupled with a positive temperature dependence of the charge mobility observed by a lateral time-of-flight technique in a high-mobility crystalline organic layer. This has important implications for the further understanding of the charge transport via delocalized states in organic semiconductors.

Longitudinal and transverse space charge limitations on transport of maximum power beams

International Nuclear Information System (INIS)

Khoe, T.K.; Martin, R.L.

1977-01-01

The maximum transportable beam power is a critical issue in selecting the most favorable approach to generating ignition pulses for inertial fusion with high energy accelerators. Maschke and Courant have put forward expressions for the limits on transport power for quadrupole and solenoidal channels. Included in a more general way is the self consistent effect of space charge defocusing on the power limit. The results show that no limits on transmitted power exist in principal. In general, quadrupole transport magnets appear superior to solenoids except for transport of very low energy and highly charged particles. Longitudinal space charge effects are very significant for transport of intense beams

Modelling of charge carrier transport in conjugated polymers doped by polar additives

Czech Academy of Sciences Publication Activity Database

Toman, Petr; Nešpůrek, Stanislav; Bartkowiak, W.

2009-01-01

Roč. 27, č. 3 (2009), s. 797-812 ISSN 0137-1339. [International Conference on Electrical and Related Properties of Organic Solids /11./. Piechowice, 13.07.2008-17.07.2008] R&D Projects: GA ČR GA203/06/0285; GA AV ČR KAN400720701; GA MŠk MEB050815 Institutional research plan: CEZ:AV0Z40500505 Keywords : conjugated polymers * charge carrier transport * molecular electronics Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.384, year: 2009

Effects of Confinement on Microstructure and Charge Transport in High Performance Semicrystalline Polymer Semiconductors

KAUST Repository

Himmelberger, Scott

2012-11-23

The film thickness of one of the most crystalline and highest performing polymer semiconductors, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b] thiophene) (PBTTT), is varied in order to determine the effects of interfaces and confinement on the microstructure and performance in organic field effect transistors (OFETs). Crystalline texture and overall film crystallinity are found to depend strongly on film thickness and thermal processing. The angular distribution of crystallites narrows upon both a decrease in film thickness and thermal annealing. These changes in the film microstructure are paired with thin-film transistor characterization and shown to be directly correlated with variations in charge carrier mobility. Charge transport is shown to be governed by film crystallinity in films below 20 nm and by crystalline orientation for thicker films. An optimal thickness is found for PBTTT at which the mobility is maximized in unannealed films and where mobility reaches a plateau at its highest value for annealed films. The effects of confinement on the morphology and charge transport properties of poly(2,5-bis(3-tetradecylthiophen-2-yl) thieno[3,2-b]thiophene) (PBTTT) are studied using quantitative X-ray diffraction and field-effect transistor measurements. Polymer crystallinity is found to limit charge transport in the thinnest films while crystalline texture and intergrain connectivity modulate carrier mobility in thicker films. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effects of Confinement on Microstructure and Charge Transport in High Performance Semicrystalline Polymer Semiconductors

KAUST Repository

Himmelberger, Scott; Dacuñ a, Javier; Rivnay, Jonathan; Jimison, Leslie H.; McCarthy-Ward, Thomas; Heeney, Martin; McCulloch, Iain; Toney, Michael F.; Salleo, Alberto

2012-01-01

The film thickness of one of the most crystalline and highest performing polymer semiconductors, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b] thiophene) (PBTTT), is varied in order to determine the effects of interfaces and confinement on the microstructure and performance in organic field effect transistors (OFETs). Crystalline texture and overall film crystallinity are found to depend strongly on film thickness and thermal processing. The angular distribution of crystallites narrows upon both a decrease in film thickness and thermal annealing. These changes in the film microstructure are paired with thin-film transistor characterization and shown to be directly correlated with variations in charge carrier mobility. Charge transport is shown to be governed by film crystallinity in films below 20 nm and by crystalline orientation for thicker films. An optimal thickness is found for PBTTT at which the mobility is maximized in unannealed films and where mobility reaches a plateau at its highest value for annealed films. The effects of confinement on the morphology and charge transport properties of poly(2,5-bis(3-tetradecylthiophen-2-yl) thieno[3,2-b]thiophene) (PBTTT) are studied using quantitative X-ray diffraction and field-effect transistor measurements. Polymer crystallinity is found to limit charge transport in the thinnest films while crystalline texture and intergrain connectivity modulate carrier mobility in thicker films. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Transport of electric charge in insulators

International Nuclear Information System (INIS)

Lopez C, E.

1979-01-01

In this work a review is made of important concepts in the study of the transport of electric charge in insulators. These concepts are: electrical contacts, transport regimes as viewed in the I-V characteristics, and photoinjection processes by internal photemission of holes or electrons from metals or semiconductors into insulators or by a virtual electrode using strongly absorbed light. Experimental results of photoinjection of holes and electrons into sulfur single crystals are analyzed using these concepts. The observation of the Mott-Gurney transition is reported for the first time. This is the transition between the region of space charge limited currents (SCLC) and the region of saturation of the current as a function of the applied voltage. A modified Mott-Gurney theoretical model is presented that is able to explain the whole I-V characteristic for uv and the internal photoemission of hopes and uv photoinjection of electrons. For the case of internal photoemission of electrons the conventional space charge limited current theory for an exponential distribution of traps is able to explain the experimental data. It is found that the crystals are of high purity since the total density of traps, as calculated from their exponential distribution, is Nsub(t) equals 1.8 X 10 14 cm -3 . (author)

Effect of Structure and Disorder on the Charge Transport in Defined Self-Assembled Monolayers of Organic Semiconductors.

Science.gov (United States)

Schmaltz, Thomas; Gothe, Bastian; Krause, Andreas; Leitherer, Susanne; Steinrück, Hans-Georg; Thoss, Michael; Clark, Timothy; Halik, Marcus

2017-09-26

Self-assembled monolayer field-effect transistors (SAMFETs) are not only a promising type of organic electronic device but also allow detailed analyses of structure-property correlations. The influence of the morphology on the charge transport is particularly pronounced, due to the confined monolayer of 2D-π-stacked organic semiconductor molecules. The morphology, in turn, is governed by relatively weak van-der-Waals interactions and is thus prone to dynamic structural fluctuations. Accordingly, combining electronic and physical characterization and time-averaged X-ray analyses with the dynamic information available at atomic resolution from simulations allows us to characterize self-assembled monolayer (SAM) based devices in great detail. For this purpose, we have constructed transistors based on SAMs of two molecules that consist of the organic p-type semiconductor benzothieno[3,2-b][1]benzothiophene (BTBT), linked to a C 11 or C 12 alkylphosphonic acid. Both molecules form ordered SAMs; however, our experiments show that the size of the crystalline domains and the charge-transport properties vary considerably in the two systems. These findings were confirmed by molecular dynamics (MD) simulations and semiempirical molecular-orbital electronic-structure calculations, performed on snapshots from the MD simulations at different times, revealing, in atomistic detail, how the charge transport in organic semiconductors is influenced and limited by dynamic disorder.

Diffusive charge transport in graphene

Science.gov (United States)

Chen, Jianhao

The physical mechanisms limiting the mobility of graphene on SiO 2 are studied and printed graphene devices on a flexible substrate are realized. Intentional addition of charged scattering impurities is used to study the effects of charged impurities. Atomic-scale defects are created by noble-gas ions irradiation to study the effect of unitary scatterers. The results show that charged impurities and atomic-scale defects both lead to conductivity linear in density in graphene, with a scattering magnitude that agrees quantitatively with theoretical estimates. While charged impurities cause intravalley scattering and induce a small change in the minimum conductivity, defects in graphene scatter electrons between the valleys and suppress the minimum conductivity below the metallic limit. Temperature-dependent measurements show that longitudinal acoustic phonons in graphene produce a small resistivity which is linear in temperature and independent of carrier density; at higher temperatures, polar optical phonons of the SiO2 substrate give rise to an activated, carrier density-dependent resistivity. Graphene is also made into high mobility transparent and flexible field effect device via the transfer-printing method. Together the results paint a complete picture of charge carrier transport in graphene on SiO2 in the diffusive regime, and show the promise of graphene as a novel electronic material that have potential applications not only on conventional inorganic substrates, but also on flexible substrates.

Disorder-tuned charge transport in organic semiconductors

Science.gov (United States)

Xu, Feng; Qiu, Dong; Yan, Dadong

2013-02-01

We propose that the polaron transport in organic semiconductors is remarkably tuned by the fluctuation of polarization energy. The tuning effect of energetic fluctuation not only causes a continuous transition from non-Arrhenius to Arrhenius temperature activated charge transport with increasing moderate disorder strengths but also results in a band-like conduction in the low disorder regime which benefits from the enhanced mobilities in shallow trap states. As a result, a unified description of polaron transport is obtained for a set of typical organic semiconductors.

Theoretical studies of optics and charge transport in organic conducting oligomers and polymers: Rational design of improved transparent and conducting polymers

Science.gov (United States)

Hutchison, Geoffrey Rogers

Theoretical studies on a variety of oligo- and polyheterocycles elucidate their optical and charge transport properties, suggesting new, improved transparent conductive polymers. First-principles calculations provide accurate methodologies for predicting both optical band gaps of neutral and cationic oligomers and intrinsic charge transfer rates. Multidimensional analysis reveals important motifs in chemical tailorability of oligoheterocycle optical and charge transport properties. The results suggest new directions for design of novel materials. Using both finite oligomer and infinite polymer calculations, the optical band gaps in polyheterocycles follow a modified particle-in-a-box formalism, scaling approximately as 1/N (where N is the number of monomer units) in short chains, saturating for long chains. Calculations demonstrate that band structure changes upon heteroatom substitution, (e.g., from polythiophene to polypyrrole) derive from heteroatom electron affinity. Further investigation of chemical variability in substituted oligoheterocycles using multidimensional statistics reveals the interplay between heteroatom and substituent in correlations between structure and redox/optical properties of neutral and cationic species. A linear correlation between band gaps of neutral and cationic species upon oxidation of conjugated oligomers, shows redshifts of optical absorption for most species and blueshifts for small band gap species. Interstrand charge-transport studies focus on two contributors to hopping-style charge transfer rates: internal reorganization energy and the electronic coupling matrix element. Statistical analysis of chemical variability of reorganization energies in oligoheterocycles proves the importance of reorganization energy in determining intrinsic charge transfer rates (e.g., charge mobility in unsubstituted oligothiophenes). Computed bandwidths across several oligothiophene crystal packing motifs show similar electron and hole bandwidths

An LP-based heuristic for the fixed charge transportation problem

DEFF Research Database (Denmark)

Klose, Andreas

2007-01-01

The fixed charge transportation problem consists in finding a minimum cost network flow from a set of suppliers to a set of customers. Beside costs proportional to quantities transported, transportation costs also include a fixed charge. The paper describes a linear programming based heuristic...... approach for computing lower and upper bounds on the minimal cost. To this end, the LP relaxation is iteratively strengthened by means of adding cuts; in each iteration the current LP solution is then used to guide a local search heuristic. In addition to standard polyhedral cuts as lifted cover...

New organic photorefractive material composed of a charge-transporting dendrimer and a stilbene chromophore

Science.gov (United States)

Bai, Jaeil; Ducharme, Stephen; Leonov, Alexei G.; Lu, Liu; Takacs, James M.

1999-10-01

In this report, we introduce new organic photorefractive composites consisting of charge transporting den-drimers highly doped with a stilbene nonlinear optic chromophore, The purpose of making these composites is to improve charge transport, by reducing inhomogeneity when compared to ordinary polymer-based systems. Because the structure of this material gives us freedom to control the orientation of charge transport agents synthetically, we can study the charge transport mechanism more systematically than in polymers. We discuss this point and present the characterization results for this material.

Charge transport in electrically doped amorphous organic semiconductors.

Science.gov (United States)

Yoo, Seung-Jun; Kim, Jang-Joo

2015-06-01

This article reviews recent progress on charge generation by doping and its influence on the carrier mobility in organic semiconductors (OSs). The doping induced charge generation efficiency is generally low in OSs which was explained by the integer charge transfer model and the hybrid charge transfer model. The ionized dopants formed by charge transfer between hosts and dopants can act as Coulomb traps for mobile charges, and the presence of Coulomb traps in OSs broadens the density of states (DOS) in doped organic films. The Coulomb traps strongly reduce the carrier hopping rate and thereby change the carrier mobility, which was confirmed by experiments in recent years. In order to fully understand the doping mechanism in OSs, further quantitative and systematic analyses of charge transport characteristics must be accomplished. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Numerical computation of discrete differential scattering cross sections for Monte Carlo charged particle transport

International Nuclear Information System (INIS)

Walsh, Jonathan A.; Palmer, Todd S.; Urbatsch, Todd J.

2015-01-01

Highlights: • Generation of discrete differential scattering angle and energy loss cross sections. • Gauss–Radau quadrature utilizing numerically computed cross section moments. • Development of a charged particle transport capability in the Milagro IMC code. • Integration of cross section generation and charged particle transport capabilities. - Abstract: We investigate a method for numerically generating discrete scattering cross sections for use in charged particle transport simulations. We describe the cross section generation procedure and compare it to existing methods used to obtain discrete cross sections. The numerical approach presented here is generalized to allow greater flexibility in choosing a cross section model from which to derive discrete values. Cross section data computed with this method compare favorably with discrete data generated with an existing method. Additionally, a charged particle transport capability is demonstrated in the time-dependent Implicit Monte Carlo radiative transfer code, Milagro. We verify the implementation of charged particle transport in Milagro with analytic test problems and we compare calculated electron depth–dose profiles with another particle transport code that has a validated electron transport capability. Finally, we investigate the integration of the new discrete cross section generation method with the charged particle transport capability in Milagro.

Semiconductor drift chamber: an application of a novel charge transport scheme

International Nuclear Information System (INIS)

Gatti, E.; Rehak, P.

1983-08-01

The purpose of this paper is to describe a novel charge tranport scheme in semiconductors in which the field responsible for the charge transport is independent of the depletion field. The application of the novel charge transport scheme leads to the following new semiconductor detectors: (1) Semiconductor Draft Chamber; (2) Ultra low capacitance - large semiconductor x-ray spectrometers and photodiodes; and (3) Fully depleted thick CCD. Special attention is paid to the concept of the Semiconductor Draft Chamber as a position sensing detector for high energy charged particles. Position resolution limiting factors are considered, and the values of the resolutions are given

Quantized charge transport in chiral Majorana edge modes

Science.gov (United States)

Rachel, Stephan; Mascot, Eric; Cocklin, Sagen; Vojta, Matthias; Morr, Dirk K.

2017-11-01

Majorana fermions can be realized as quasiparticles in topological superconductors, with potential applications in topological quantum computing. Recently, lattices of magnetic adatoms deposited on the surface of s -wave superconductors—Shiba lattices—have been proposed as a new platform for topological superconductivity. These systems possess the great advantage that they are accessible via scanning-probe techniques and thus enable the local manipulation and detection of Majorana modes. Using a nonequilibrium Green's function technique we demonstrate that the topological Majorana edge modes of nanoscopic Shiba islands display universal electronic and transport properties. Most remarkably, these Majorana modes possess a quantized charge conductance that is proportional to the topological Chern number, C , and carry a supercurrent whose chirality reflects the sign of C . These results establish nanoscopic Shiba islands as promising components in future topology-based devices.

Transport and Fatigue Properties of Ferroelectric Polymer P(VDF-TrFE) For Nonvolatile Memory Applications

KAUST Repository

Hanna, Amir

2012-06-01

Organic ferroelectrics polymers have recently received much interest for use in nonvolatile memory devices. The ferroelectric copolymer poly(vinylidene fluoride- trifluoroethylene) , P(VDF-TrFE), is a promising candidate due to its relatively high remnant polarization, low coercive field, fast switching times, easy processability, and low Curie transition. However, no detailed study of charge injection and current transport properties in P(VDF-TrFE) have been reported in the literature yet. Charge injection and transport are believed to affect various properties of ferroelectric films such as remnant polarization values and polarization fatigue behavior.. Thus, this thesis aims to study charge injection in P(VDF-TrFE) and its transport properties as a function of electrode material. Injection was studied for Al, Ag, Au and Pt electrodes. Higher work function metals such as Pt have shown less leakage current compared to lower work function metals such as Al for more than an order of magnitude. That implied n-type conduction behavior for P(VDF-TrFE), as well as electrons being the dominant injected carrier type. Charge transport was also studied as a function of temperature, and two major transport regimes were identified: 1) Thermionic emission over a Schottky barrier for low fields (E < 25 MV/m). 2) Space-Charge-Limited regime at higher fields (25 < E <120 MV/m). We have also studied the optical imprint phenomenon, the polarization fatigue resulting from a combination of broad band optical illumination and DC bias near the switching field. A setup was designed for the experiment, and validated by reproducing the reported effect in polycrystalline Pb(Zr,Ti)O3 , PZT, film. On the other hand, P(VDF-TrFE) film showed no polarization fatigue as a result of optical imprint test, which could be attributed to the large band gap of the material, and the low intensity of the UV portion of the arc lamp white light used for the experiment. Results suggest using high work

In situ characterization of the film coverage and the charge transport in the alkylated-organic thin film transistor

Science.gov (United States)

Watanabe, Takeshi; Koganezawa, Tomoyuki; Kikuchi, Mamoru; Muraoka, Hiroki; Ogawa, Satoshi; Yoshimoto, Noriyuki; Hirosawa, Ichiro

2018-03-01

We propose an in situ experimental method of investigating the correlations of the film coverage of the organic semiconductor layers and charge transport properties of organic thin film transistors during vacuum deposition. The coverage of each monolayer was estimated using the intensity of off-specular diffuse scattering and diffraction. Experimental data were obtained from the in situ measurements of two-dimensional grazing incidence X-ray scattering and charge transport. The source-drain current increased over the film coverage of the first monolayer (= 0.48). This is in agreement with the critical percolation coverage, indicating that the conductivities of the first and second monolayers are different.

Charging properties of a dust grain in collisional plasmas

International Nuclear Information System (INIS)

Khrapak, S.A.; Morfill, G.E.; Khrapak, A.G.; D'yachkov, L.G.

2006-01-01

Charging related properties of a small spherical grain immersed in a collisional plasma are investigated. Asymptotic expressions for charging fluxes, grain surface potential, long range electrostatic potential, and the properties of grain charge fluctuations due to the discrete nature of the charging process are obtained. These analytical results are in reasonable agreement with the available results of numerical modeling

Charging and Transport Dynamics of a Flow-Through Electrode Capacitive Deionization System.

Science.gov (United States)

Qu, Yatian; Campbell, Patrick G; Hemmatifar, Ali; Knipe, Jennifer M; Loeb, Colin K; Reidy, John J; Hubert, Mckenzie A; Stadermann, Michael; Santiago, Juan G

2018-01-11

We present a study of the interplay among electric charging rate, capacitance, salt removal, and mass transport in "flow-through electrode" capacitive deionization (CDI) systems. We develop two models describing coupled transport and electro-adsorption/desorption which capture salt removal dynamics. The first model is a simplified, unsteady zero-dimensional volume-averaged model which identifies dimensionless parameters and figures of merits associated with cell performance. The second model is a higher fidelity area-averaged model which captures both spatial and temporal responses of charging. We further conducted an experimental study of these dynamics and considered two salt transport regimes: (1) advection-limited regime and (2) dispersion-limited regime. We use these data to validate models. The study shows that, in the advection-limited regime, differential charge efficiency determines the salt adsorption at the early stage of the deionization process. Subsequently, charging transitions to a quasi-steady state where salt removal rate is proportional to applied current scaled by the inlet flow rate. In the dispersion-dominated regime, differential charge efficiency, cell volume, and diffusion rates govern adsorption dynamics and flow rate has little effect. In both regimes, the interplay among mass transport rate, differential charge efficiency, cell capacitance, and (electric) charging current governs salt removal in flow-through electrode CDI.

Mechanical and charge transport properties of alkanethiol self-assembled monolayers on Au (111) surface: The Role of Molecular Tilt

Energy Technology Data Exchange (ETDEWEB)

Mulleregan, Alice; Qi, Yabing; Ratera, Imma; Park, Jeong Y.; Ashby, Paul D.; Quek, Su Ying; Neaton, J. B.; Salmeron, Miquel

2007-11-12

The relationship between charge transport and mechanical properties of alkanethiol self-assembled monolayers (SAM) on Au(111) films has been investigated using an atomic force microscope with a conductive tip. Molecular tilts induced by the pressure applied by the tip cause stepwise increases in film conductivity. A decay constant {beta} = 0.57 {+-} 0.03 {angstrom}{sup -1} was found for the current passing through the film as a function of tip-substrate separation due to this molecular tilt. This is significantly smaller than the value of {approx} 1 {angstrom}{sup -1} found when the separation is changed by changing the length of the alkanethiol molecules. Calculations indicate that for isolated dithiol molecules S-bonded to hollow sites, the junction conductance does not vary significantly as a function of molecular tilt. The impact of S-Au bonding on SAM conductance is discussed.

Magneto-transport properties of a random distribution of few-layer graphene patches

International Nuclear Information System (INIS)

Iacovella, Fabrice; Mitioglu, Anatolie; Pierre, Mathieu; Raquet, Bertrand; Goiran, Michel; Plochocka, Paulina; Escoffier, Walter; Trinsoutrot, Pierre; Vergnes, Hugues; Caussat, Brigitte; Conédéra, Véronique

2014-01-01

In this study, we address the electronic properties of conducting films constituted of an array of randomly distributed few layer graphene patches and investigate on their most salient galvanometric features in the moderate and extreme disordered limit. We demonstrate that, in annealed devices, the ambipolar behaviour and the onset of Landau level quantization in high magnetic field constitute robust hallmarks of few-layer graphene films. In the strong disorder limit, however, the magneto-transport properties are best described by a variable-range hopping behaviour. A large negative magneto-conductance is observed at the charge neutrality point, in consistency with localized transport regime

Charge Transport in LDPE Nanocomposites Part I—Experimental Approach

Directory of Open Access Journals (Sweden)

Anh T. Hoang

2016-03-01

Full Text Available This work presents results of bulk conductivity and surface potential decay measurements on low-density polyethylene and its nanocomposites filled with uncoated MgO and Al2O3, with the aim to highlight the effect of the nanofillers on charge transport processes. Material samples at various filler contents, up to 9 wt %, were prepared in the form of thin films. The performed measurements show a significant impact of the nanofillers on reduction of material’s direct current (dc conductivity. The investigations thus focused on the nanocomposites having the lowest dc conductivity. Various mechanisms of charge generation and transport in solids, including space charge limited current, Poole-Frenkel effect and Schottky injection, were utilized for examining the experimental results. The mobilities of charge carriers were deduced from the measured surface potential decay characteristics and were found to be at least two times lower for the nanocomposites. The temperature dependencies of the mobilities were compared for different materials.

The Role of Shape on Electronic Structure and Charge Transport in Faceted PbSe Nanocrystals

KAUST Repository

Kaushik, Ananth P.

2014-03-25

We have determined the effect of shape on the charge transport characteristics of nanocrystals. Our study looked at the explicit determination of the electronic properties of faceted nanocrystals that essentially probe the limit of current computational reach, i.e., nanocrystals from 1.53 to 2.1 nm in diameter. These nanocrystals, which resemble PbSe systems, are either bare or covered in short ligands. They also differ in shape, octahedral vs cube-octahedral, and in superlattice symmetry (fcc vs bcc). We have provided insights on electron and hole coupling along different facets and overall charge mobility in bcc and fcc superlattices. We have determined that the relative areas of (100) to (111) facets, and facet atom types are important factors governing the optimization of charge transport. The calculated electronic density of states shows no role of -SCH3 - ligands on states near the band gap. Electron coupling between nanocrystals is significantly higher than that of hole coupling; thiol ligands lower the ratio between electron and hole couplings. Stronger coupling exists between smaller nanocrystals. © 2014 American Chemical Society.

Impact of Tortuosity on Charge-Carrier Transport in Organic Bulk Heterojunction Blends

Science.gov (United States)

Heiber, Michael C.; Kister, Klaus; Baumann, Andreas; Dyakonov, Vladimir; Deibel, Carsten; Nguyen, Thuc-Quyen

2017-11-01

The impact of the tortuosity of the charge-transport pathways through a bulk heterojunction film on the charge-carrier mobility is theoretically investigated using model morphologies and kinetic Monte Carlo simulations. The tortuosity descriptor provides a quantitative metric to characterize the quality of the charge-transport pathways, and model morphologies with controlled domain size and tortuosity are created using an anisotropic domain growth procedure. The tortuosity is found to be dependent on the anisotropy of the domain structure and is highly tunable. Time-of-flight charge-transport simulations on morphologies with a range of tortuosity values reveal that tortuosity can significantly reduce the magnitude of the mobility and the electric-field dependence relative to a neat material. These reductions are found to be further controlled by the energetic disorder and temperature. Most significantly, the sensitivity of the electric-field dependence to the tortuosity can explain the different experimental relationships previously reported, and exploiting this sensitivity could lead to simpler methods for characterizing and optimizing charge transport in organic solar cells.

Diffusive charge transport in graphene on SiO 2

Science.gov (United States)

Chen, J.-H.; Jang, C.; Ishigami, M.; Xiao, S.; Cullen, W. G.; Williams, E. D.; Fuhrer, M. S.

2009-07-01

We review our recent work on the physical mechanisms limiting the mobility of graphene on SiO 2. We have used intentional addition of charged scattering impurities and systematic variation of the dielectric environment to differentiate the effects of charged impurities and short-range scatterers. The results show that charged impurities indeed lead to a conductivity linear in density ( σ(n)∝n) in graphene, with a scattering magnitude that agrees quantitatively with theoretical estimates; increased dielectric screening reduces the scattering from charged impurities, but increases the scattering from short-range scatterers. We evaluate the effects of the corrugations (ripples) of graphene on SiO 2 on transport by measuring the height-height correlation function. The results show that the corrugations cannot mimic long-range (charged impurity) scattering effects, and have too small an amplitude-to-wavelength ratio to significantly affect the observed mobility via short-range scattering. Temperature-dependent measurements show that longitudinal acoustic phonons in graphene produce a resistivity that is linear in temperature and independent of carrier density; at higher temperatures, polar optical phonons of the SiO 2 substrate give rise to an activated, carrier density-dependent resistivity. Together the results paint a complete picture of charge carrier transport in graphene on SiO 2 in the diffusive regime.

The structural, electro-optical, charge transport and nonlinear optical properties of oxazole (4Z-4-Benzylidene-2-(4-methylphenyl-1,3-oxazol-5(4H-one derivative

Directory of Open Access Journals (Sweden)

Ahmad Irfan

2018-01-01

Full Text Available The oxazole compounds are being used for multifunctional purposes ranging from organic light emitting diodes, organic thin film transistors, and photovoltaic to the nonlinear optical materials. In this study, several structural, electro-optical, charge transport and nonlinear optical properties of (4Z-4-Benzylidene-2-(4-methylphenyl-1,3-oxazol-5(4H-one (BMPO have been investigated. Density functional theory (DFT and time dependent DFT are very accurate and reasonable approaches to optimize the ground and excited state geometries, respectively. Thus, in the present study DFT and TDDFT methods with the B3LYP/6-31G∗∗ levels of theory have been applied to shed some light on the structure-property relationship, frontier molecular orbitals (FMOs, optical properties. A clear intra-molecular charge transfer (ICT from the highest occupied molecular orbitals (HOMOs to the lowest unoccupied molecular orbitals (LUMOs has been observed. The ionization potentials (IP, electron affinities (EA, total and partial densities of states have been discussed intensively. The electron reorganization energy of oxazole compound (BMPO is smaller than the hole reorganization energy revealing that it might be good electron transport contender in OLED. The electron reorganization energy of BMPO is calculated to be 0.223 eV that is smaller than the perfluoropentacene (value is 0.250 eV, which is famous n-type semiconductor material. The first pathway of BMPO has almost comparable hole and electron transfer integral values whereas the calculated electron reorganization energy (0.223 eV is considerably lower than the hole reorganization energy (0.381 eV which leads to superior electron intrinsic mobility of the studied oxazole derivative as compared to the hole one. It is expected that BMPO might be excellent electron transport material.

Two-dimensional charge transport in self-organized, high-mobility conjugated polymers

DEFF Research Database (Denmark)

Sirringhaus, H.; Brown, P.J.; Friend, R.H.

1999-01-01

Self-organization in many solution-processed, semiconducting conjugated polymers results in complex microstructures, in which ordered microcrystalline domains are embedded in an amorphous matrix(I). This has important consequences for electrical properties of these materials: charge transport...... of the ordered microcrystalline domains in the conjugated polymer poly(3-hexylthiophene), P3HT, Self-organization in P3HT results in a lamella structure with two-dimensional conjugated sheets formed by interchain stacking. We find that, depending on processing conditions, the lamellae can adopt two different...... of polymer transistors in logic circuits(5) and active-matrix displays(4,6)....

Determination of charge carrier mobility of hole transporting polytriarylamine-based diodes

International Nuclear Information System (INIS)

Barea, Eva M.; Garcia-Belmonte, Germa; Sommer, Michael; Huettner, Sven; Bolink, Henk J.; Thelakkat, Mukundan

2010-01-01

Hole transport properties of three different side chain poly(triarylamines) have been determined by means of the analysis of steady-state current-voltage characteristics using co-planar diode structures. The interpretation is based on space-charge limited models with field-dependent mobility. Mobilities between ∼ 10 -8 and 10 -6 cm 2 V -1 s -1 are obtained. The highest mobility is achieved for poly(tetraphenylbenzidine) devices and the lowest for poly(triphenylamine) devices. Electron-rich methoxy substituents increase the mobility of poly(triphenylamine)s. A comparison of the mobility values with those obtained using organic field-effect transistors is also given.

Fractal like charge transport in polyaniline nanostructures

International Nuclear Information System (INIS)

Nath, Chandrani; Kumar, A.

2013-01-01

The structural and electrical properties of camphorsulfonic acid (CSA) doped nanotubes, and hydrochloric acid (HCl) doped nanofibers and nanoparticles of polyaniline have been studied as a function of doping level. The crystallinity increases with doping for all the nanostructures. Electrical transport measurements in the temperature range of 5–300 K show an increase in conductivity with doping for the nanostructures. All the nanostructures exhibit metal to insulator (MIT) transition below 40 K. The metallic behavior is ascribed to the electron–electron interaction effects. In the insulating regime of the nanotubes conduction follows the Mott quasi-1D variable range hopping model, whereas the conduction in the nanofibers and nanoparticles occur by variable range hopping of charge carriers among superlocalized states without and with Coulomb interaction, respectively. The smaller dopant size in case of HCl makes the polymer fractal resulting in superlocalization of electronic wave-functions. The confined morphology of the nanoparticles results in effective Coulomb interaction dominating the intersite hopping

Percolative transport in the vicinity of charge-order ferromagnetic ...

Indian Academy of Sciences (India)

field driven charge transport in the system is modelled on the basis of an inhomogeneous medium consisting of ... The charge-ordered phase for incommensurate distribution of man- ganese ions (i.e. ... position x = 0.35 measured in a constant voltage mode. The electric ... a drop in resistance on decreasing the temperature.

Transport Properties of the Organic Conductor (TMTSF)2BrO4: Evidence of Variable Range Hopping

DEFF Research Database (Denmark)

Mortensen, Kell; Jacobsen, Claus Schelde; Bechgaard, Klaus

1984-01-01

A study of d.c. and microwave conductivity and thermoelectric power of the organic conductor (TMTSF)2BrO4 is presented. The transport properties are in qualitative agreement with charge transport via variable-range hopping among localized states. The localization is attributed to the anions, which...

Modelling charge transport of discotic liquid-crystalline triindoles: the role of peripheral substitution.

Science.gov (United States)

Volpi, Riccardo; Camilo, Ana Claudia Santos; Filho, Demetrio A da Silva; Navarrete, Juan T López; Gómez-Lor, Berta; Delgado, M Carmen Ruiz; Linares, Mathieu

2017-09-13

We have performed a multiscale approach to study the influence of peripheral substitution in the semiconducting properties of discotic liquid-crystalline triindoles. Charge carrier mobility as high as 1.4 cm 2 V -1 s -1 was experimentally reported for triindoles substituted with alkynyl chains on the periphery (Gómez-Lor et al. Angew. Chem., Int. Ed., 2011, 50, 7399-7402). In this work, our goal is to get a deeper understanding of both the molecular electronic structure and microscopic factors affecting the charge transport properties in triindoles as a function of the spacer group connecting the central cores with the external alkyl chains (i.e., alkyne or phenyl spacers groups). To this end, we first perform Quantum Mechanical (QM) calculations to assess how the peripheral substitution affects the electronic structure and the internal reorganization energy. Secondly, boxes of stacked molecules were built and relaxed through molecular dynamics to obtain realistic structures. Conformational analysis and calculations of transfer integrals for closed neighbours were performed. Our results show that the insertion of ethynyl spacers between the central aromatic core and the flexible peripheral chains results in lower reorganization energies and enhanced intermolecular order within the stacks with a preferred cofacial 60° staggered conformation, which would result in high charge-carrier mobilities in good agreement with the experimental data. This work allows a deeper understanding of charge carrier mobility in columnar phases, linking the structural order at the molecular level to the property of interest, i.e. the charge carrier mobility. We hope that this understanding will improve the design of systems at the supramolecular level aiming at obtaining a more defined conducting channel, higher mobility and smaller fluctuations within the column.

Understanding charge transport in molecular electronics.

Science.gov (United States)

Kushmerick, J J; Pollack, S K; Yang, J C; Naciri, J; Holt, D B; Ratner, M A; Shashidhar, R

2003-12-01

For molecular electronics to become a viable technology the factors that control charge transport across a metal-molecule-metal junction need to be elucidated. We use an experimentally simple crossed-wire tunnel junction to interrogate how factors such as metal-molecule coupling, molecular structure, and the choice of metal electrode influence the current-voltage characteristics of a molecular junction.

Charge transport in polycrystalline alumina materials: application to the optimization of dielectric breakdown strength; Transport de charges dans les alumines polycristallines: application a l'optimisation de la rigidite dielectrique

Energy Technology Data Exchange (ETDEWEB)

Touzin, M.

2005-12-15

Dielectric breakdown constitutes an important limitation in the use of insulating materials under high-tension since it leads to the local fusion and the sublimation of material. The microstructure (average grain size, intergranular phase) has a great influence on the ability of material to resist this catastrophic phenomenon. Indeed, the interfaces between the various phases constitute potential sites of trapping for the charges. The optimization of the dielectric breakdown strength of a polycrystalline alumina sintered with a liquid phase passes necessarily through the control of the microstructural parameters. Thus, it is shown that by controlling the conditions of the process (rate of sintering aids, powder grain size and thermal cycle), it is possible to control the density (by the average grain size) but also the nature (by the crystallization or not of anorthite) of the grain boundaries. The study of the influence of these two parameters as well temperature on the properties of charge transport and storage was carried out by methods ICM and SEMME. The results, interpreted in light of the numerical simulation of the charge transport in bulk alumina sample during electron beam irradiation, allowed to highlight behaviors, and the corresponding microstructures, favourable to the dielectric breakdown resistance according to the considered temperature. Thus, at room temperature a high density of interfaces (low grain size and crystallized intergranular phase) makes it possible material to durably trap a great amount of charges, which leads to a high dielectric strength. On the other hand, at higher temperature, the presence of shallow traps (vitreous intergranular phase) supports the charge diffusion and makes it possible to delay breakdown. (author)

Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes.

Science.gov (United States)

Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

2016-11-10

We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS 2 ) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS 2 and pentacene. The pentacene/MoS 2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices.

Optical and transport properties of single crystal rubrene: A theoretical study

Energy Technology Data Exchange (ETDEWEB)

Chen, Lipeng [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore); Lu, Jing [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore); Faculty of Chemistry, Northeast Normal University, Changchun (China); Long, Guankui; Zheng, Fulu [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore); Zhang, Jingping [Faculty of Chemistry, Northeast Normal University, Changchun (China); Zhao, Yang, E-mail: YZhao@ntu.edu.sg [Division of Materials Science, Nanyang Technological University, Singapore 639798 (Singapore)

2016-12-20

Optical and charge transport properties of single crystal rubrene are investigated using the multi-mode Brownian oscillator (MBO) model, the charge hopping model with quantum nuclear tunneling, and the Munn–Silbey approach. The MBO model is adopted to calculate absorption and photoluminescence spectra, yielding results in excellent agreement with measurements. In addition, temperature dependence of zero phonon lines (ZPL) and phonon sidebands (PSBs) of absorption spectra is also examined using the MBO model, revealing a nearly linear dependence of line widths of the ZPL and the PSBs on temperature. Model parameters obtained from MBO fitting and TD-DFT computation are then utilized for hole mobility calculations. It is found that temperature dependence of the calculated mobility is in general agreement with measurements, exhibiting “band-like” transport behavior.

Charge-spin Transport in Surface-disordered Three-dimensional Topological Insulators

Science.gov (United States)

Peng, Xingyue

As one of the most promising candidates for the building block of the novel spintronic circuit, the topological insulator (TI) has attracted world-wide interest of study. Robust topological order protected by time-reversal symmetry (TRS) makes charge transport and spin generation in TIs significantly different from traditional three-dimensional (3D) or two-dimensional (2D) electronic systems. However, to date, charge transport and spin generation in 3D TIs are still primarily modeled as single-surface phenomena, happening independently on top and bottom surfaces. In this dissertation, I will demonstrate via both experimental findings and theoretical modeling that this "single surface'' theory neither correctly describes a realistic 3D TI-based device nor reveals the amazingly distinct physical picture of spin transport dynamics in 3D TIs. Instead, I present a new viewpoint of the spin transport dynamics where the role of the insulating yet topologically non-trivial bulk of a 3D TI becomes explicit. Within this new theory, many mysterious transport and magneto-transport anomalies can be naturally explained. The 3D TI system turns out to be more similar to its low dimensional sibling--2D TI rather than some other systems sharing the Dirac dispersion, such as graphene. This work not only provides valuable fundamental physical insights on charge-spin transport in 3D TIs, but also offers important guidance to the design of 3D TI-based spintronic devices.

Invariance of molecular charge transport upon changes of extended molecule size and several related issues

Directory of Open Access Journals (Sweden)

Ioan Bâldea

2016-03-01

Full Text Available As a sanity test for the theoretical method employed, studies on (steady-state charge transport through molecular devices usually confine themselves to check whether the method in question satisfies the charge conservation. Another important test of the theory’s correctness is to check that the computed current does not depend on the choice of the central region (also referred to as the “extended molecule”. This work addresses this issue and demonstrates that the relevant transport and transport-related properties are indeed invariant upon changing the size of the extended molecule, when the embedded molecule can be described within a general single-particle picture (namely, a second-quantized Hamiltonian bilinear in the creation and annihilation operators. It is also demonstrates that the invariance of nonequilibrium properties is exhibited by the exact results but not by those computed approximately within ubiquitous wide- and flat-band limits (WBL and FBL, respectively. To exemplify the limitations of the latter, the phenomenon of negative differential resistance (NDR is considered. It is shown that the exactly computed current may exhibit a substantial NDR, while the NDR effect is absent or drastically suppressed within the WBL and FBL approximations. The analysis done in conjunction with the WBLs and FBLs reveals why general studies on nonequilibrium properties require a more elaborate theoretical than studies on linear response properties (e.g., ohmic conductance and thermopower at zero temperature. Furthermore, examples are presented that demonstrate that treating parts of electrodes adjacent to the embedded molecule and the remaining semi-infinite electrodes at different levels of theory (which is exactly what most NEGF-DFT approaches do is a procedure that yields spurious structures in nonlinear ranges of current–voltage curves.

Simulating charge transport to understand the spectral response of Swept Charge Devices

Science.gov (United States)

Athiray, P. S.; Sreekumar, P.; Narendranath, S.; Gow, J. P. D.

2015-11-01

Context. Swept Charge Devices (SCD) are novel X-ray detectors optimized for improved spectral performance without any demand for active cooling. The Chandrayaan-1 X-ray Spectrometer (C1XS) experiment onboard the Chandrayaan-1 spacecraft used an array of SCDs to map the global surface elemental abundances on the Moon using the X-ray fluorescence (XRF) technique. The successful demonstration of SCDs in C1XS spurred an enhanced version of the spectrometer on Chandrayaan-2 using the next-generation SCD sensors. Aims: The objective of this paper is to demonstrate validation of a physical model developed to simulate X-ray photon interaction and charge transportation in a SCD. The model helps to understand and identify the origin of individual components that collectively contribute to the energy-dependent spectral response of the SCD. Furthermore, the model provides completeness to various calibration tasks, such as generating spectral matrices (RMFs - redistribution matrix files), estimating efficiency, optimizing event selection logic, and maximizing event recovery to improve photon-collection efficiency in SCDs. Methods: Charge generation and transportation in the SCD at different layers related to channel stops, field zones, and field-free zones due to photon interaction were computed using standard drift and diffusion equations. Charge collected in the buried channel due to photon interaction in different volumes of the detector was computed by assuming a Gaussian radial profile of the charge cloud. The collected charge was processed further to simulate both diagonal clocking read-out, which is a novel design exclusive for SCDs, and event selection logic to construct the energy spectrum. Results: We compare simulation results of the SCD CCD54 with measurements obtained during the ground calibration of C1XS and clearly demonstrate that our model reproduces all the major spectral features seen in calibration data. We also describe our understanding of interactions at

Simulation of charge generation and transport in semi-conductors under energetic-particle bombardment

International Nuclear Information System (INIS)

Martin, R.C.

1990-01-01

The passage of energetic ions through semiconductor devices generates excess charge which can produce logic upset, memory change, and device damage. This single event upset (SEU) phenomenon is increasingly important for satellite communications. Experimental and numerical simulation of SEUs is difficult because of the subnanosecond times and large charge densities within the ion track. The objective of this work is twofold: (1) the determination of the track structure and electron-hole pair generation profiles following the passage of an energetic ion; (2) the development and application of a new numerical method for transient charge transport in semiconductor devices. A secondary electron generation and transport model, based on the Monte Carlo method, is developed and coupled to an ion transport code to simulate ion track formation in silicon. A new numerical method is developed for the study of transient charge transport. The numerical method combines an axisymmetric quadratic finite-element formulation for the solution of the potential with particle simulation methods for electron and hole transport. Carrier transport, recombination, and thermal generation of both majority and minority carriers are included. To assess the method, transient one-dimensional solutions for silicon diodes are compared to a fully iterative finite-element method. Simulations of charge collection from ion tracks in three-dimensional axisymmetric devices are presented and compared to previous work. The results of this work for transient current pulses following charged ion passage are in agreement with recent experimental data

Charge transport through molecular rods with reduced pi-conjugation.

Science.gov (United States)

Lörtscher, Emanuel; Elbing, Mark; Tschudy, Meinrad; von Hänisch, Carsten; Weber, Heiko B; Mayor, Marcel; Riel, Heike

2008-10-24

A series of oligophenylene rods of increasing lengths is synthesized to investigate the charge-transport mechanisms. Methyl groups are attached to the phenyl rings to weaken the electronic overlap of the pi-subsystems along the molecular backbones. Out-of-plane rotation of the phenyl rings is confirmed in the solid state by means of X-ray analysis and in solution by using UV/Vis spectroscopy. The influence of the reduced pi-conjugation on the resonant charge transport is studied at the single-molecule level by using the mechanically controllable break-junction technique. Experiments are performed under ultra-high-vacuum conditions at low temperature (50 K). A linear increase of the conductance gap with increasing number of phenyl rings (from 260 meV for one ring to 580 meV for four rings) is revealed. In addition, the absolute conductance of the first resonant peaks does not depend on the length of the molecular wire. Resonant transport through the first molecular orbital is found to be dominated by charge-carrier injection into the molecule, rather than by the intrinsic resistance of the molecular wire length.

Electronic transport properties

International Nuclear Information System (INIS)

Young, W.H.

1985-01-01

The theory of the electron transport properties of liquid alkali metals is described. Conductivity coefficients, Boltzmann theory, Ziman theory, alkali form factors, Ziman theory and alkalis, Faber-Ziman alloy theory, Faber-Ziman theory and alkali-alkali methods, status of Ziman theory, and other transport properties, are all discussed. (UK)

Transportation charges in the gas industry

International Nuclear Information System (INIS)

Price, C.

1994-01-01

British Gas was privatized in 1986, a monopoly with no direct competition and only very light regulation of the tariff market. The regulator had an obligation to enable competition to develop in the unregulated, large-quantity, contract market. Competitors required access to the BG-owned transportation network. The government has recently rejected the recommendation of divestiture of the supply business, but has accelerated the advent of competition to the domestic market. This paper considers the role of BG's transport charges in these developments, using its past behaviour as a guide, and identifying the issues for future regulation and development of the gas market. (Author)

Charge injection and transport in quantum confined and disordered systems

NARCIS (Netherlands)

Houtepen, A.J.

2007-01-01

Quantum dots and conducting polymers are modern semiconductors with a high potential for applications such as lasers, LEDs, displays, solar cells etc. These applications require the controlled addition of charge carriers into the material and knowledge of the details of charge transport. This thesis

Intrinsic Charge Transport in Organic Field-Effect Transistors

Science.gov (United States)

Podzorov, Vitaly

2005-03-01

Organic field-effect transistors (OFETs) are essential components of modern electronics. Despite the rapid progress of organic electronics, understanding of fundamental aspects of the charge transport in organic devices is still lacking. Recently, the OFETs based on highly ordered organic crystals have been fabricated with innovative techniques that preserve the high quality of single-crystal organic surfaces. This technological progress facilitated the study of transport mechanisms in organic semiconductors [1-4]. It has been demonstrated that the intrinsic polaronic transport, not dominated by disorder, with a remarkably high mobility of ``holes'' μ = 20 cm^2/Vs can be achieved in these devices at room temperature [4]. The signatures of the intrinsic polaronic transport are the anisotropy of the carrier mobility and an increase of μ with cooling. These and other aspects of the charge transport in organic single-crystal FETs will be discussed. Co-authors are Etienne Menard, University of Illinois at Urbana Champaign; Valery Kiryukhin, Rutgers University; John Rogers, University of Illinois at Urbana Champaign; Michael Gershenson, Rutgers University. [1] V. Podzorov et al., Appl. Phys. Lett. 82, 1739 (2003); ibid. 83, 3504 (2003). [2] V. C. Sundar et al., Science 303, 1644 (2004). [3] R. W. I. de Boer et al., Phys. Stat. Sol. (a) 201, 1302 (2004). [4] V. Podzorov et al., Phys. Rev. Lett. 93, 086602 (2004).

Determination of charge carrier mobility of hole transporting polytriarylamine-based diodes

Energy Technology Data Exchange (ETDEWEB)

Barea, Eva M. [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, 12071 Castello (Spain); Garcia-Belmonte, Germa, E-mail: garciag@uji.e [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, 12071 Castello (Spain); Sommer, Michael; Huettner, Sven [Applied Functional Polymers, Universitaet Bayreuth, 95440 Bayreuth (Germany); Bolink, Henk J. [Molecular Science Institute-Universitat de Valencia, Poligon La Coma s/n, 46980 Paterna, Valencia (Spain); Thelakkat, Mukundan, E-mail: mukundan.thelakkat@uni-bayreuth.d [Applied Functional Polymers, Universitaet Bayreuth, 95440 Bayreuth (Germany)

2010-04-02

Hole transport properties of three different side chain poly(triarylamines) have been determined by means of the analysis of steady-state current-voltage characteristics using co-planar diode structures. The interpretation is based on space-charge limited models with field-dependent mobility. Mobilities between {approx} 10{sup -8} and 10{sup -6} cm{sup 2} V{sup -1} s{sup -1} are obtained. The highest mobility is achieved for poly(tetraphenylbenzidine) devices and the lowest for poly(triphenylamine) devices. Electron-rich methoxy substituents increase the mobility of poly(triphenylamine)s. A comparison of the mobility values with those obtained using organic field-effect transistors is also given.

Short chain molecular junctions: Charge transport versus dipole moment

International Nuclear Information System (INIS)

Ikram, I. Mohamed; Rabinal, M.K.

2015-01-01

Graphical abstract: - Highlights: • The role of dipole moment of organic molecules on molecular junctions has been studied. • Molecular junctions constituted using propargyl molecules of different dipole moments. • The electronic properties of the molecules were calculated using Gaussian software. • Junctions show varying rectification due to their varying dipole moment and orientation. - Abstract: The investigation of the influence of dipole moment of short chain organic molecules having three carbon atoms varying in end group on silicon surface was carried on. Here, we use three different molecules of propargyl series varying in dipole moment and its orientation to constitute molecular junctions. The charge transport mechanism in metal–molecules–semiconductor (MMS) junction obtained from current–voltage (I–V) characteristics shows the rectification behavior for two junctions whereas the other junction shows a weak rectification. The electronic properties of the molecules were calculated using Gaussian software package. The observed rectification behavior of these junctions is examined and found to be accounted to the orientation of dipole moment and electron cloud density distribution inside the molecules

Algorithms for solving the single-sink fixed-charge transportation problem

DEFF Research Database (Denmark)

Klose, Andreas

2006-01-01

The single-sink fixed-charge transportation problem is an important subproblem of the fixed-charge transportation problem. Just a few methods have been proposed in the literature to solve this problem. In this paper, solution approaches based on dynamic programming and implicit enumeration...... are revisited. It is shown how the problem size as well as the search space of a recently published dynamic programming method can be reduced by exploiting reduced cost information. Additionally, a further implicit enumeration approach relying on solution concepts for the binary knapsack problem is introduced...

Role of Molecular Weight Distribution on Charge Transport in Semiconducting Polymers

KAUST Repository

Himmelberger, Scott

2014-10-28

© 2014 American Chemical Society. Model semiconducting polymer blends of well-controlled molecular weight distributions are fabricated and demonstrated to be a simple method to control intermolecular disorder without affecting intramolecular order or degree of aggregation. Mobility measurements exhibit that even small amounts of low molecular weight material are detrimental to charge transport. Trends in charge carrier mobility can be reproduced by a simple analytical model which indicates that carriers have no preference for high or low molecular weight chains and that charge transport is limited by interchain hopping. These results quantify the role of long polymer tie-chains and demonstrate the need for controlled polydispersity for achieving high carrier mobilities.

Atomic transport properties

International Nuclear Information System (INIS)

Freyss, M.

2015-01-01

As presented in the first chapter of this book, atomic transport properties govern a large panel of nuclear fuel properties, from its microstructure after fabrication to its behaviour under irradiation: grain growth, oxidation, fission product release, gas bubble nucleation. The modelling of the atomic transport properties is therefore the key to understanding and predicting the material behaviour under irradiation or in storage conditions. In particular, it is noteworthy that many modelling techniques within the so-called multi-scale modelling scheme of materials make use of atomic transport data as input parameters: activation energies of diffusion, diffusion coefficients, diffusion mechanisms, all of which are then required to be known accurately. Modelling approaches that are readily used or which could be used to determine atomic transport properties of nuclear materials are reviewed here. They comprise, on the one hand, static atomistic calculations, in which the migration mechanism is fixed and the corresponding migration energy barrier is calculated, and, on the other hand, molecular dynamics calculations and kinetic Monte-Carlo simulations, for which the time evolution of the system is explicitly calculated. (author)

Charge transfer properties and photoelectrocatalytic activity of TiO{sub 2}/MWCNT hybrid

Energy Technology Data Exchange (ETDEWEB)

Jiang Liaochuan [Nano Science Research Center, School of Chemistry and Chemical Engineering, South China University of Technology, 381 Wushan Road, Guangzhou 510640 (China); Zhang Weide, E-mail: zhangwd@scut.edu.c [Nano Science Research Center, School of Chemistry and Chemical Engineering, South China University of Technology, 381 Wushan Road, Guangzhou 510640 (China)

2010-12-15

The vertically aligned multiwalled carbon nanotube (MWCNT) arrays on tantalum foils were successfully coated with TiO{sub 2} nanoparticles by a hydrothermal process. The prepared TiO{sub 2}/MWCNT hybrid was characterized by scanning electron microscopy and transmission electron microscopy. The charge transfer properties and photocatalytic degradation of rhodamine B with and without bias potential under UV irradiation were investigated. The MWCNTs promoted the separation of photoinduced carriers in the TiO{sub 2}, thus enhanced photocatalytic activity. Applying bias potential on the photoanode further enhanced its catalytic activity. The efficient charge transportation and high photoelectrocatalytic activity towards degradation of rhodamine B made this hybrid material promising for photocatalyst and for the development of photoelectrical devices.

Electric generation and ratcheted transport of contact-charged drops

Science.gov (United States)

Cartier, Charles A.; Graybill, Jason R.; Bishop, Kyle J. M.

2017-10-01

We describe a simple microfluidic system that enables the steady generation and efficient transport of aqueous drops using only a constant voltage input. Drop generation is achieved through an electrohydrodynamic dripping mechanism by which conductive drops grow and detach from a grounded nozzle in response to an electric field. The now-charged drops are transported down a ratcheted channel by contact charge electrophoresis powered by the same voltage input used for drop generation. We investigate how the drop size, generation frequency, and transport velocity depend on system parameters such as the liquid viscosity, interfacial tension, applied voltage, and channel dimensions. The observed trends are well explained by a series of scaling analyses that provide insight into the dominant physical mechanisms underlying drop generation and ratcheted transport. We identify the conditions necessary for achieving reliable operation and discuss the various modes of failure that can arise when these conditions are violated. Our results demonstrate that simple electric inputs can power increasingly complex droplet operations with potential opportunities for inexpensive and portable microfluidic systems.

Transport properties of ultrathin black phosphorus on hexagonal boron nitride

Energy Technology Data Exchange (ETDEWEB)

Doganov, Rostislav A.; Özyilmaz, Barbaros [Centre for Advanced 2D Materials and Graphene Research Centre, National University of Singapore, 6 Science Drive 2, 117546 Singapore (Singapore); Department of Physics, National University of Singapore, 2 Science Drive 3, 117542 Singapore (Singapore); Graduate School for Integrative Sciences and Engineering (NGS), National University of Singapore, 28 Medical Drive, 117456 Singapore (Singapore); Koenig, Steven P.; Yeo, Yuting [Centre for Advanced 2D Materials and Graphene Research Centre, National University of Singapore, 6 Science Drive 2, 117546 Singapore (Singapore); Department of Physics, National University of Singapore, 2 Science Drive 3, 117542 Singapore (Singapore); Watanabe, Kenji; Taniguchi, Takashi [National Institute for Materials Science, 1-1 Namiki, Tsukuba 305-0044 (Japan)

2015-02-23

Ultrathin black phosphorus, or phosphorene, is a two-dimensional material that allows both high carrier mobility and large on/off ratios. Similar to other atomic crystals, like graphene or layered transition metal dichalcogenides, the transport behavior of few-layer black phosphorus is expected to be affected by the underlying substrate. The properties of black phosphorus have so far been studied on the widely utilized SiO{sub 2} substrate. Here, we characterize few-layer black phosphorus field effect transistors on hexagonal boron nitride—an atomically smooth and charge trap-free substrate. We measure the temperature dependence of the field effect mobility for both holes and electrons and explain the observed behavior in terms of charged impurity limited transport. We find that in-situ vacuum annealing at 400 K removes the p-doping of few-layer black phosphorus on both boron nitride and SiO{sub 2} substrates and reduces the hysteresis at room temperature.

Ion Transport through Diffusion Layer Controlled by Charge Mosaic Membrane

Directory of Open Access Journals (Sweden)

Akira Yamauchi

2012-01-01

Full Text Available The kinetic transport behaviors in near interface of the membranes were studied using commercial anion and cation exchange membrane and charge mosaic membrane. Current-voltage curve gave the limiting current density that indicates the ceiling of conventional flux. From chronopotentiometry above the limiting current density, the transition time was estimated. The thickness of boundary layer was derived with conjunction with the conventional limiting current density and the transition time from steady state flux. On the other hand, the charge mosaic membrane was introduced in order to examine the ion transport on the membrane surface in detail. The concentration profile was discussed by the kinetic transport number with regard to the water dissociation (splitting on the membrane surface.

A n-vector model for charge transport in molecular semiconductors.

Science.gov (United States)

Jackson, Nicholas E; Kohlstedt, Kevin L; Chen, Lin X; Ratner, Mark A

2016-11-28

We develop a lattice model utilizing coarse-grained molecular sites to study charge transport in molecular semiconducting materials. The model bridges atomistic descriptions and structureless lattice models by mapping molecular structure onto sets of spatial vectors isomorphic with spin vectors in a classical n-vector Heisenberg model. Specifically, this model incorporates molecular topology-dependent orientational and intermolecular coupling preferences, including the direct inclusion of spatially correlated transfer integrals and site energy disorder. This model contains the essential physics required to explicitly simulate the interplay of molecular topology and correlated structural disorder, and their effect on charge transport. As a demonstration of its utility, we apply this model to analyze the effects of long-range orientational correlations, molecular topology, and intermolecular interaction strength on charge motion in bulk molecular semiconductors.

A general relationship between disorder, aggregation and charge transport in conjugated polymers

KAUST Repository

Noriega, Rodrigo; Rivnay, Jonathan; Vandewal, Koen; Koch, Felix P. V.; Stingelin, Natalie; Smith, Paul; Toney, Michael F.; Salleo, Alberto

2013-01-01

Conjugated polymer chains have many degrees of conformational freedom and interact weakly with each other, resulting in complex microstructures in the solid state. Understanding charge transport in such systems, which have amorphous and ordered phases exhibiting varying degrees of order, has proved difficult owing to the contribution of electronic processes at various length scales. The growing technological appeal of these semiconductors makes such fundamental knowledge extremely important for materials and process design. We propose a unified model of how charge carriers travel in conjugated polymer films. We show that in high-molecular-weight semiconducting polymers the limiting charge transport step is trapping caused by lattice disorder, and that short-range intermolecular aggregation is sufficient for efficient long-range charge transport. This generalization explains the seemingly contradicting high performance of recently reported, poorly ordered polymers and suggests molecular design strategies to further improve the performance of future generations of organic electronic materials. © 2013 Macmillan Publishers Limited. All rights reserved.

A general relationship between disorder, aggregation and charge transport in conjugated polymers

KAUST Repository

Noriega, Rodrigo

2013-08-04

Conjugated polymer chains have many degrees of conformational freedom and interact weakly with each other, resulting in complex microstructures in the solid state. Understanding charge transport in such systems, which have amorphous and ordered phases exhibiting varying degrees of order, has proved difficult owing to the contribution of electronic processes at various length scales. The growing technological appeal of these semiconductors makes such fundamental knowledge extremely important for materials and process design. We propose a unified model of how charge carriers travel in conjugated polymer films. We show that in high-molecular-weight semiconducting polymers the limiting charge transport step is trapping caused by lattice disorder, and that short-range intermolecular aggregation is sufficient for efficient long-range charge transport. This generalization explains the seemingly contradicting high performance of recently reported, poorly ordered polymers and suggests molecular design strategies to further improve the performance of future generations of organic electronic materials. © 2013 Macmillan Publishers Limited. All rights reserved.

Properties of Laser-Produced Highly Charged Heavy Ions for Direct Injection Scheme

CERN Document Server

Sakakibara, Kazuhiko; Hayashizaki, Noriyosu; Ito, Taku; Kashiwagi, Hirotsugu; Okamura, Masahiro

2005-01-01

To accelerate highly charged intense ion beam, we have developed the Direct Plasma Injection Scheme (DPIS) with laser ion source. In this scheme an ion beam from a laser ion source is injected directly to a RFQ linac without a low energy beam transport (LEBT) and the beam loss in the LEBT can be avoided. We achieved high current acceleration of carbon ions (60mA) by DPIS with the high current optimized RFQ. As the next setp we will use heavier elements like Ag, Pb, Al and Cu as target in LIS (using CO2, Nd-YAG or other laser) for DPIS and will examine properties of laser-produced plasma (the relationship of between charge state and laser power density, the current dependence of the distance from the target, etc).

Temperature-dependent charge transport mechanisms in carbon sphere/polyaniline composite

Science.gov (United States)

Nieves, Cesar A.; Martinez, Luis M.; Meléndez, Anamaris; Ortiz, Margarita; Ramos, Idalia; Pinto, Nicholas J.; Zimbovskaya, Natalya

2017-12-01

Charge transport in the temperature range 80 K electrons between polymeric chains in PANi-filled gaps between CS is the predominant transport mechanism through CS/PANi composites. The high conductivity of the CS/PANi composite makes the material attractive for the fabrication of devices and sensors.

Transporte de carga em compósitos de polianilina/V2O5 Charge transportation in polyaniline/V2O5 composites

Directory of Open Access Journals (Sweden)

Fritz Huguenin

2004-06-01

Full Text Available In this work, composites formed from a mixture of V2O5 and polyaniline (PANI were investigated, for applications as cathode materials for secondary lithium batteries. Electrochemical quartz crystal microbalance (EQCM data show that charge compensation in the [PANI]0.3V2O5 nanocomposite is achieved predominantly by Li+ migration. However, the charge compensation in the [PANI]V2O5 microcomposite occurs by Li+ and ClO4- transport. Electrochemical Impedance Spectroscopy (EIS measurements reveal several benefits of nanohybrid formation, including the achievement of shorter ionic diffusion pathways, the higher diffusion rate of the lithium ion and also the higher electronic conductivity, which are responsible for a synergetic effect of the energy storage properties.

Transport Properties of operational gas mixtures used at LHC

CERN Document Server

Assran, Yasser

2011-01-01

This report summarizes some useful data on the transport characteristics of gas mixtures which are required for detection of charged particles in gas detectors. We try to replace Freon used for RPC detector in the CMS experiment with another gas while maintaining the good properties of the Freon gas mixture unchanged. We try to switch to freonless gas mixture because Freon is not a green gas, it is very expensive and its availability is decreasing. Noble gases like Ar, He, Ne and Xe (with some quenchers like carbon dioxide, methane, ethane and isobutene) are investigated. Transport parameters like drift velocity, diffusion, Townsend coefficient, attachment coefficient and Lorentz angle are computed using Garfield software for different gas mixtures and compared with experimental data.

An improved charge transport system for the pelletron accelerator in Lund

International Nuclear Information System (INIS)

Hellborg, R.; Hakansson, K.

1988-01-01

Several improvements have been implemented in the chain charge transport system of a pelletron. The main new components are a modified support at ground for the chain accessories, a new power supply for the chain motor, including the possibility of variable chain speed, and pickup rings to monitor the relative amount of charge on individual cylinders of the chain. These modifications, together with the installation of a second chain, have resulted in improved operational reliability, a much smoother startup of the chain, and a doubled maximum chain current. The latter will simplify running the accelerator with heavy ions at maximum terminal voltage. The pickup rings have been found to be useful in diagnosing malfunctions in the charge transport system. (orig.)

Battery-powered transport systems. Possible methods of automatically charging drive batteries

Energy Technology Data Exchange (ETDEWEB)

1981-03-01

In modern driverless transport systems, not only easy maintenance of the drive battery is important but also automatic charging during times of standstill. Some systems are presented; one system is pointed out in particular in which 100 batteries can be charged at the same time.

Simulating charge transport in flexible systems

Directory of Open Access Journals (Sweden)

Timothy Clark

2015-12-01

Full Text Available Systems in which movements occur on two significantly different time domains, such as organic electronic components with flexible molecules, require different simulation techniques for the two time scales. In the case of molecular electronics, charge transport is complicated by the several different mechanisms (and theoretical models that apply in different cases. We cannot yet combine time scales of molecular and electronic movement in simulations of real systems. This review describes our progress towards this goal.

Ambipolar charge transport in organic field-effect transistors

NARCIS (Netherlands)

Smits, E.C.P.; Anthopoulos, T.D.; Setayesh, S.; Veenendaal, van E.; Coehoorn, R.; Blom, P.W.M.; Boer, de B.; Leeuw, de D.M.

2006-01-01

A model describing charge transport in disordered ambipolar organic field-effect transistors is presented. The basis of this model is the variable-range hopping in an exponential density of states developed for disordered unipolar organic transistors. We show that the model can be used to calculate

Charge-carrier transport in large-area epitaxial graphene

Energy Technology Data Exchange (ETDEWEB)

Kisslinger, Ferdinand; Popp, Matthias; Weber, Heiko B. [Lehrstuhl fuer Angewandte Physik, Friedrich-Alexander-Universitaet Erlangen-Nuernberg (FAU), Erlangen (Germany); Jobst, Johannes [Huygens-Kamerlingh Onnes Laboratorium, Leiden Institute of Physics, Leiden University (Netherlands); Shallcross, Sam [Lehrstuhl fuer theoretische Festkoerperphysik, Friedrich-Alexander-Universitaet Erlangen-Nuernberg (FAU), Erlangen (Germany)

2017-11-15

We present an overview of recent charge carrier transport experiments in both monolayer and bilayer graphene, with emphasis on the phenomena that appear in large-area samples. While many aspects of transport are based on quantum mechanical concepts, in the large-area limit classical corrections dominate and shape the magnetoresistance and the tunneling conductance. The discussed phenomena are very general and can, with little modification, be expected in any atomically thin 2D conductor. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

Electron-hole collision limited transport in charge-neutral bilayer graphene

Science.gov (United States)

Nam, Youngwoo; Ki, Dong-Keun; Soler-Delgado, David; Morpurgo, Alberto F.

2017-12-01

Ballistic transport occurs whenever electrons propagate without collisions deflecting their trajectory. It is normally observed in conductors with a negligible concentration of impurities, at low temperature, to avoid electron-phonon scattering. Here, we use suspended bilayer graphene devices to reveal a new regime, in which ballistic transport is not limited by scattering with phonons or impurities, but by electron-hole collisions. The phenomenon manifests itself in a negative four-terminal resistance that becomes visible when the density of holes (electrons) is suppressed by gate-shifting the Fermi level in the conduction (valence) band, above the thermal energy. For smaller densities, transport is diffusive, and the measured conductivity is reproduced quantitatively, with no fitting parameters, by including electron-hole scattering as the only process causing velocity relaxation. Experiments on a trilayer device show that the phenomenon is robust and that transport at charge neutrality is governed by the same physics. Our results provide a textbook illustration of a transport regime that had not been observed previously and clarify the nature of conduction through charge-neutral graphene under conditions in which carrier density inhomogeneity is immaterial. They also demonstrate that transport can be limited by a fully electronic mechanism, originating from the same microscopic processes that govern the physics of Dirac-like plasmas.

Transport of Cryptosporidium parvum Oocysts in Charge Heterogeneous Porous Media: Microfluidics Experiment and Numerical Simulation

Science.gov (United States)

Liu, Y.; Meng, X.; Guo, Z.; Zhang, C.; Nguyen, T. H.; Hu, D.; Ji, J.; Yang, X.

2017-12-01

Colloidal attachment on charge heterogeneous grains has significant environmental implications for transport of hazardous colloids, such as pathogens, in the aquifer, where iron, manganese, and aluminium oxide minerals are the major source of surface charge heterogeneity of the aquifer grains. A patchwise surface charge model is often used to describe the surface charge heterogeneity of the grains. In the patchwise model, the colloidal attachment efficiency is linearly correlated with the fraction of the favorable patches (θ=λ(θf - θu)+θu). However, our previous microfluidic study showed that the attachment efficiency of oocysts of Cryptosporidium parvum, a waterborne protozoan parasite, was not linear correlated with the fraction of the favorable patches (λ). In this study, we developed a pore scale model to simulate colloidal transport and attachment on charge heterogeneous grains. The flow field was simulated using the LBM method and colloidal transport and attachment were simulated using the Lagrange particle tracking method. The pore scale model was calibrated with experimental results of colloidal and oocyst transport in microfluidic devices and was then used to simulate oocyst transport in charge heterogeneous porous media under a variety of environmental relative conditions, i.e. the fraction of favorable patchwise, ionic strength, and pH. The results of the pore scale simulations were used to evaluate the effect of surface charge heterogeneity on upscaling of oocyst transport from pore to continuum scale and to develop an applicable correlation between colloidal attachment efficiency and the fraction of the favorable patches.

Manipulation of charge transport in thermoelectrics

Science.gov (United States)

Zhang, Xinyue; Pei, Yanzhong

2017-12-01

While numerous improvements have been achieved in thermoelectric materials by reducing the lattice thermal conductivity (κL), electronic approaches for enhancement can be as effective, or even more. A key challenge is decoupling Seebeck coefficient (S) from electrical conductivity (σ). The first order approximation - a single parabolic band assumption with acoustic scattering - leads the thermoelectric power factor (S2σ) to be maximized at a constant reduced Fermi level (η 0.67) and therefore at a given S of 167 μV/K. This simplifies the challenge of maximization of σ at a constant η, leading to a large number of degenerate transport channels (band degeneracy, Nv) and a fast transportation of charges (carrier mobility, μ). In this paper, existing efforts on this issue are summarized and future prospectives are given.

Thermodynamical and dynamical properties of charged BTZ black holes

Energy Technology Data Exchange (ETDEWEB)

Tang, Zi-Yu; Wang, Bin [Shanghai Jiao Tong University, Department of Physics and Astronomy, Center for Astronomy and Astrophysics, Shanghai (China); Zhang, Cheng-Yong [Peking University, Center for High-Energy Physics, Beijing (China); Kord Zangeneh, Mahdi [Shanghai Jiao Tong University, Department of Physics and Astronomy, Center for Astronomy and Astrophysics, Shanghai (China); Shahid Chamran University of Ahvaz, Physics Department, Faculty of Science, Ahvaz (Iran, Islamic Republic of); Research Institute for Astronomy and Astrophysics of Maragha (RIAAM)-Maragha, P. O. Box: 55134-441, Maragha (Iran, Islamic Republic of); Shiraz University, Physics Department and Biruni Observatory, College of Sciences, Shiraz (Iran, Islamic Republic of); Saavedra, Joel [Pontificia Universidad Catolica de Valparaiso, Instituto de Fisica, Valparaiso (Chile)

2017-06-15

We investigate the spacetime properties of BTZ black holes in the presence of the Maxwell field and Born-Infeld field and find rich properties in the spacetime structures when the model parameters are varied. Employing Landau-Lifshitz theory, we examine the thermodynamical phase transition in the charged BTZ black holes. We further study the dynamical perturbation in the background of the charged BTZ black holes and find different properties in the dynamics when the thermodynamical phase transition occurs. (orig.)

Optical properties of two-dimensional charge density wave materials

Science.gov (United States)

Sayers, Charles; Karbassi, Sara; Friedemann, Sven; da Como, Enrico

Titanium diselenide (TiSe2) is a member of the layered transition metal dichalcogenide (TMD) materials. It exhibits unusual chiral charge ordering below 190 K after undergoing an initial phase transition to a commensurate (2 x 2 x 2) charge density wave (CDW) at 200 K which is enhanced further in the monolayer. Recently, the first evidence of chirality in a CDW system was discovered in this material by scanning tunneling microscopy and time-resolved reflectivity experiments, where separate left and right handed charge-ordered domains were found to exist within a single sample. We have prepared single crystals of 1T-TiSe2 using iodine vapour transport, and confirmed their quality by x-ray analysis and charge transport measurements. Using a combination of polarised optical spectroscopy techniques in the mid to far infrared (4 to 700 meV photon energy), we have measured an anisotropy relating to the CDW gap. We discuss the results on the basis of chiral domains with different handedness and the nature of the CDW transition.

Symmetrization of mathematical model of charge transport in semiconductors

Directory of Open Access Journals (Sweden)

Alexander M. Blokhin

2002-11-01

Full Text Available A mathematical model of charge transport in semiconductors is considered. The model is a quasilinear system of differential equations. A problem of finding an additional entropy conservation law and system symmetrization are solved.

Investigation on photoluminescence quenching of CdSe/ZnS quantum dots by organic charge transporting materials

Directory of Open Access Journals (Sweden)

Yuqiu Qu

2015-12-01

Full Text Available The effect of different organic charge transporting materials on the photoluminescence of CdSe/ZnS core/shell quantum dots has been studied by means of steady-state and time-resolved photoluminescence spectroscopy. With an increase in concentration of the organic charge transporting material in the quantum dots solutions, the photoluminescence intensity of CdSe/ZnS quantum dots was quenched greatly and the fluorescence lifetime was shortened gradually. The quenching efficiency of CdSe/ZnS core/shell quantum dots decreased with increasing the oxidation potential of organic charge transporting materials. Based on the analysis, two pathways in the photoluminescence quenching process have been defined: static quenching and dynamic quenching. The dynamic quenching is correlated with hole transporting from quantum dots to the charge transporting materials.

Entanglements in Marginal Solutions: A Means of Tuning Pre-Aggregation of Conjugated Polymers with Positive Implications for Charge Transport

KAUST Repository

Hu, Hanlin

2015-06-17

The solution-processing of conjugated polymers, just like commodity polymers, is subject to solvent and molecular weight-dependent solubility, interactions and chain entanglements within the polymer, all of which can influence the crystallization and microstructure development in semi-crystalline polymers and consequently affect charge transport and optoelectronic properties. Disentanglement of polymer chains in marginal solvents was reported to work via ultrasonication, facilitating the formation of photophysically ordered polymer aggregates. In this contribution, we explore how a wide range of technologically relevant solvents and formulations commonly used in organic electronics influence chain entanglement and the aggregation behaviour of P3HT using a combination of rheological and spectrophotometric measurements. The specific viscosity of the solution offers an excellent indication of the degree of entanglements in the solution, which is found to be related to the solubility of P3HT in a given solvent. Moreover, deliberately disentangling the solution in the presence of solvophobic driving forces, leads consistently to formation of photophysically visible aggregates which is indicative of local and perhaps long range order in the solute. We show for a broad range of solvents and molecular weights that disentanglement ultimately leads to significant ordering of the polymer in the solid state and a commensurate increase in charge transport properties. In doing so we demonstrate a remarkable ability to tune the microstructure which has important implications for transport properties. We discuss its potential implications in the context of organic photovoltaics.

Entanglements in Marginal Solutions: A Means of Tuning Pre-Aggregation of Conjugated Polymers with Positive Implications for Charge Transport

KAUST Repository

Hu, Hanlin; Zhao, Kui; Fernandes, Nikhil J.; Boufflet, Pierre; Bannock, James Henry; Yu, Liyang; de Mello, John C; Stingelin, Natalie; Heeney, Martin; Giannelis, Emmanuel P.; Amassian, Aram

2015-01-01

The solution-processing of conjugated polymers, just like commodity polymers, is subject to solvent and molecular weight-dependent solubility, interactions and chain entanglements within the polymer, all of which can influence the crystallization and microstructure development in semi-crystalline polymers and consequently affect charge transport and optoelectronic properties. Disentanglement of polymer chains in marginal solvents was reported to work via ultrasonication, facilitating the formation of photophysically ordered polymer aggregates. In this contribution, we explore how a wide range of technologically relevant solvents and formulations commonly used in organic electronics influence chain entanglement and the aggregation behaviour of P3HT using a combination of rheological and spectrophotometric measurements. The specific viscosity of the solution offers an excellent indication of the degree of entanglements in the solution, which is found to be related to the solubility of P3HT in a given solvent. Moreover, deliberately disentangling the solution in the presence of solvophobic driving forces, leads consistently to formation of photophysically visible aggregates which is indicative of local and perhaps long range order in the solute. We show for a broad range of solvents and molecular weights that disentanglement ultimately leads to significant ordering of the polymer in the solid state and a commensurate increase in charge transport properties. In doing so we demonstrate a remarkable ability to tune the microstructure which has important implications for transport properties. We discuss its potential implications in the context of organic photovoltaics.

Tuning of Transport and Magnetic Properties in Epitaxial LaMnO3+δ Thin Films

Directory of Open Access Journals (Sweden)

J. Chen

2014-01-01

Full Text Available The effect of compressive strain on the transport and magnetic properties of epitaxial LaMnO3+δ thin films has been investigated. It is found that the transport and magnetic properties of the LaMnO3+δ thin films grown on the LaAlO3 substrates can be tuned by the compressive strain through varying film thickness. And the insulator-metal transition, charge/orbital ordering transition, and paramagnetic-ferromagnetic transition are suppressed by the compressive strain. Consequently, the related electronic and magnetic transition temperatures decrease with an increase in the compressive strain. The present results can be explained by the strain-controlled lattice deformation and the consequent orbital occupation. It indicates that the lattice degree of freedom is crucial for understanding the transport and magnetic properties of the strongly correlated LaMnO3+δ.

Microscopic studies of the fate of charges in organic semiconductors: Scanning Kelvin probe measurements of charge trapping, transport, and electric fields in p- and n-type devices

Science.gov (United States)

Smieska, Louisa Marion

Organic semiconductors could have wide-ranging applications in lightweight, efficient electronic circuits. However, several fundamental questions regarding organic electronic device behavior have not yet been fully addressed, including the nature of chemical charge traps, and robust models for injection and transport. Many studies focus on engineering devices through bulk transport measurements, but it is not always possible to infer the microscopic behavior leading to the observed measurements. In this thesis, we present scanning-probe microscope studies of organic semiconductor devices in an effort to connect local properties with local device behavior. First, we study the chemistry of charge trapping in pentacene transistors. Working devices are doped with known pentacene impurities and the extent of charge trap formation is mapped across the transistor channel. Trap-clearing spectroscopy is employed to measure an excitation of the pentacene charge trap species, enabling identification of the degradationrelated chemical trap in pentacene. Second, we examine transport and trapping in peryelene diimide (PDI) transistors. Local mobilities are extracted from surface potential profiles across a transistor channel, and charge injection kinetics are found to be highly sensitive to electrode cleanliness. Trap-clearing spectra generally resemble PDI absorption spectra, but one derivative yields evidence indicating variation in trap-clearing mechanisms for different surface chemistries. Trap formation rates are measured and found to be independent of surface chemistry, contradicting a proposed silanol trapping mechanism. Finally, we develop a variation of scanning Kelvin probe microscopy that enables measurement of electric fields through a position modulation. This method avoids taking a numeric derivative of potential, which can introduce high-frequency noise into the electric field signal. Preliminary data is presented, and the theoretical basis for electric field

Exciton shelves for charge and energy transport in third-generation quantum-dot devices

Science.gov (United States)

Goodman, Samuel; Singh, Vivek; Noh, Hyunwoo; Casamada, Josep; Chatterjee, Anushree; Cha, Jennifer; Nagpal, Prashant

2014-03-01

Quantum dots are semiconductor nanocrystallites with size-dependent quantum-confined energy levels. While they have been intensively investigated to utilize hot-carriers for photovoltaic applications, to bridge the mismatch between incident solar photons and finite bandgap of semiconductor photocells, efficient charge or exciton transport in quantum-dot films has proven challenging. Here we show development of new coupled conjugated molecular wires with ``exciton shelves'', or different energy levels, matched with the multiple energy levels of quantum dots. Using single nanoparticle and ensemble device measurements we show successful extraction and transport of both bandedge and high-energy charge carriers, and energy transport of excitons. We demonstrate using measurements of electronic density of states, that careful matching of energy states of quantum-dot with molecular wires is important, and any mismatch can generate midgap states leading to charge recombination and reduced efficiency. Therefore, these exciton-shelves and quantum dots can lead to development of next-generation photovoltaic and photodetection devices using simultaneous transport of bandedge and hot-carriers or energy transport of excitons in these nanostructured solution-processed films.

Charge transport in amorphous InGaZnO thin-film transistors

NARCIS (Netherlands)

Germs, W.C.; Adriaans, W.H.; Tripathi, A.K.; Roelofs, W.S.C.; Cobb, B.; Janssen, R.A.J.; Gelinck, G.H.; Kemerink, M.

2012-01-01

We investigate the mechanism of charge transport in indium gallium zinc oxide (a-IGZO), an amorphous metal-oxide semiconductor. We measured the field-effect mobility and the Seebeck coefficient (S=ΔV/ΔT) of a-IGZO in thin-film transistors as a function of charge-carrier density for different

Charge transport in amorphous InGaZnO thin film transistors

NARCIS (Netherlands)

Germs, W.C.; Adriaans, W.H.; Tripathi, A.K.; Roelofs, W.S.C.; Cobb, B.; Janssen, R.A.J.; Gelinck, G.H.; Kemerink, M.

2012-01-01

We investigate the mechanism of charge transport in indium gallium zinc oxide (a-IGZO), an amorphous metal-oxide semiconductor. We measured the field-effect mobility and the Seebeck coefficient (S=¿V/¿T) of a-IGZO in thin-film transistors as a function of charge-carrier density for different

Electrochemical and Electronic Charge Transport Properties of Ni-Doped LiMn2O4 Spinel Obtained from Polyol-Mediated Synthesis

Directory of Open Access Journals (Sweden)

Shuo Yang

2018-05-01

Full Text Available LiNi0.5Mn1.5O4 (LNMO spinel has been extensively investigated as one of the most promising high-voltage cathode candidates for lithium-ion batteries. The electrochemical performance of LNMO, especially its rate performance, seems to be governed by its crystallographic structure, which is strongly influenced by the preparation methods. Conventionally, LNMO materials are prepared via solid-state reactions, which typically lead to microscaled particles with only limited control over the particle size and morphology. In this work, we prepared Ni-doped LiMn2O4 (LMO spinel via the polyol method. The cycling stability and rate capability of the synthesized material are found to be comparable to the ones reported in literature. Furthermore, its electronic charge transport properties were investigated by local electrical transport measurements on individual particles by means of a nanorobotics setup in a scanning electron microscope, as well as by performing DFT calculations. We found that the scarcity of Mn3+ in the LNMO leads to a significant decrease in electronic conductivity as compared to undoped LMO, which had no obvious effect on the rate capability of the two materials. Our results suggest that the rate capability of LNMO and LMO materials is not limited by the electronic conductivity of the fully lithiated materials.

Models of charge transport and transfer in molecular switch tunnel junctions of bistable catenanes and rotaxanes

International Nuclear Information System (INIS)

Flood, Amar H.; Wong, Eric W.; Stoddart, J. Fraser

2006-01-01

The processes by which charge transfer can occur play a foundational role in molecular electronics. Here we consider simplified models of the transfer processes that could be present in bistable molecular switch tunnel junction (MSTJ) devices during one complete cycle of the device from its low- to high- and back to low-conductance state. The bistable molecular switches, which are composed of a monolayer of either switchable catenanes or rotaxanes, exist in either a ground-state co-conformation or a metastable one in which the conduction properties of the two co-conformations, when measured at small biases (+0.1 V), are significantly different irrespective of whether transport is dominated by tunneling or hopping. The voltage-driven generation (±2 V) of molecule-based redox states, which are sufficiently long-lived to allow the relative mechanical movements necessary to switch between the two co-conformations, rely upon unequal charge transfer rates on to and/or off of the molecules. Surface-enhanced Raman spectroscopy has been used to image the ground state of the bistable rotaxane in MSTJ-like devices. Consideration of these models provide new ways of looking at molecular electronic devices that rely, not only on nanoscale charge-transport, but also upon the bustling world of molecular motion in mechanically interlocked bistable molecules

Solving the Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem by Dynamic Programming

DEFF Research Database (Denmark)

Rauff Lind Christensen, Tue; Klose, Andreas; Andersen, Kim Allan

important aspects of supplier selection, an important application of the SSFCTP, this does not reflect the real life situation. First, transportation costs faced by many companies are in fact piecewise linear. Secondly, when suppliers offer discounts, either incremental or all-unit discounts, such savings......The Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem (SSFCMCTP) is a problem with versatile applications. This problem is a generalization of the Single-Sink, Fixed-Charge Transportation Problem (SSFCTP), which has a fixed-charge, linear cost structure. However, in at least two...... are neglected in the SSFCTP. The SSFCMCTP overcome this problem by incorporating a staircase cost structure in the cost function instead of the usual one used in SSFCTP. We present a dynamic programming algorithm for the resulting problem. To enhance the performance of the generic algorithm a number...

Understanding the effects of electronic polarization and delocalization on charge-transport levels in oligoacene systems

KAUST Repository

Sutton, Christopher; Tummala, Naga Rajesh; Kemper, Travis; Aziz, Saadullah G.; Sears, John; Coropceanu, Veaceslav; Bredas, Jean-Luc

2017-01-01

Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.

Understanding the effects of electronic polarization and delocalization on charge-transport levels in oligoacene systems

KAUST Repository

Sutton, Christopher

2017-06-13

Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.

Surface potential, charging and local current transport of individual Ge quantum dots grown by molecular beam epitaxy

Energy Technology Data Exchange (ETDEWEB)

Singha, R.K. [Department of Physics, Visva-Bharati, Santiniketan 731235 (India); Manna, S.; Bar, R.; Das, S. [Department of Physics, Indian Institute of Technology-Kharagpur, Kharagpur 721302 (India); Ray, S.K., E-mail: physkr@phy.iitkgp.ernet.in [Department of Physics, Indian Institute of Technology-Kharagpur, Kharagpur 721302 (India)

2017-06-15

Highlights: We have elaborately explained the individual Ge QD charging phenomena and current transport, which is very important to understand the Ge/Si nano devices. This paper will give a flavor to properly understand these phenomena linked together along with the photocurrent mechanism which is related to the Ge/Si valence band offset. • Both the CAFM and KPFM techniques point out the functionality of doping nature of the underneath Si substrate on the aforementioned characteristics of Ge QDs. • Analysis of the surface potential mapping using KPFM technique yields an approximate valence band offset measurement which is required to understand the intra-valence transition of holes for the realization of long wavelength infrared photodetector. • KPFM and CAFM can be utilized to explore the charging/discharging phenomena of dots and their composition variations. • Current-voltage (I–V) characteristics of the individual Ge QD strongly depends on the individual QD size. • Energy band diagrams for diamond tip and Ge QD shows the higher barrier for electrons and lower barrier for holes allowing the easy tunneling for holes to dominate the transport. - Abstract: It is fundamentally important to understand the nanoscale electronic properties of a single quantum dot (QD) contrary to an ensemble of QDs. Kelvin probe force microscopy (KPFM) and conductive atomic force microscopy (CAFM) are two important tools, which could be employed to probe surface potential, charging phenomena, and current transport mechanism of individual QD. We demonstrate the aforementioned characteristics of self-assembled Ge QDs, which was grown on Si substrates by solid source molecular beam epitaxy driven by the Stranski-Krastanov method. Study reveals that each Ge QD acts as charge storage node even at zero applied bias. The shape, size and density of QDs could be well probed by CAFM and KPFM, whereas QD facets could be better resolved by the conductive tip. The CAFM investigation

Surface charge accumulation of particles containing radionuclides in open air.

Science.gov (United States)

Kim, Yong-Ha; Yiacoumi, Sotira; Tsouris, Costas

2015-05-01

Radioactivity can induce charge accumulation on radioactive particles. However, electrostatic interactions caused by radioactivity are typically neglected in transport modeling of radioactive plumes because it is assumed that ionizing radiation leads to charge neutralization. The assumption that electrostatic interactions caused by radioactivity are negligible is evaluated here by examining charge accumulation and neutralization on particles containing radionuclides in open air. A charge-balance model is employed to predict charge accumulation on radioactive particles. It is shown that particles containing short-lived radionuclides can be charged with multiple elementary charges through radioactive decay. The presence of radioactive particles can significantly modify the particle charge distribution in open air and yield an asymmetric bimodal charge distribution, suggesting that strong electrostatic particle interactions may occur during short- and long-range transport of radioactive particles. Possible effects of transported radioactive particles on electrical properties of the local atmosphere are reported. The study offers insight into transport characteristics of airborne radionuclides. Results are useful in atmospheric transport modeling of radioactive plumes. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effect of surface charge of immortalized mouse cerebral endothelial cell monolayer on transport of charged solutes.

Science.gov (United States)

Yuan, Wei; Li, Guanglei; Gil, Eun Seok; Lowe, Tao Lu; Fu, Bingmei M

2010-04-01

Charge carried by the surface glycocalyx layer (SGL) of the cerebral endothelium has been shown to significantly modulate the permeability of the blood-brain barrier (BBB) to charged solutes in vivo. The cultured monolayer of bEnd3, an immortalized mouse cerebral endothelial cell line, is becoming a popular in vitro BBB model due to its easy growth and maintenance of many BBB characteristics over repeated passages. To test whether the SGL of bEnd3 monolayer carries similar charge as that in the intact BBB and quantify this charge, which can be characterized by the SGL thickness (L(f)) and charge density (C(mf)), we measured the solute permeability of bEnd3 monolayer to neutral solutes and to solutes with similar size but opposite charges: negatively charged alpha-lactalbumin (-11) and positively charged ribonuclease (+3). Combining the measured permeability data with a transport model across the cell monolayer, we predicted the L(f) and the C(mf) of bEnd3 monolayer, which is approximately 160 nm and approximately 25 mEq/L, respectively. We also investigated whether orosomucoid, a plasma glycoprotein modulating the charge of the intact BBB, alters the charge of bEnd3 monolayer. We found that 1 mg/mL orosomucoid would increase SGL charge density of bEnd3 monolayer to approximately 2-fold of its control value.

Optical conductivity and optical effective mass in a high-mobility organic semiconductor: Implications for the nature of charge transport

KAUST Repository

Li, Yuan

2014-12-03

We present a multiscale modeling of the infrared optical properties of the rubrene crystal. The results are in very good agreement with the experimental data that point to nonmonotonic features in the optical conductivity spectrum and small optical effective masses. We find that, in the static-disorder approximation, the nonlocal electron-phonon interactions stemming from low-frequency lattice vibrations can decrease the optical effective masses and lead to lighter quasiparticles. On the other hand, the charge-transport and infrared optical properties of the rubrene crystal at room temperature are demonstrated to be governed by localized carriers driven by inherent thermal disorders. Our findings underline that the presence of apparently light carriers in high-mobility organic semiconductors does not necessarily imply bandlike transport.

Optical conductivity and optical effective mass in a high-mobility organic semiconductor: Implications for the nature of charge transport

KAUST Repository

Li, Yuan; Yi, Yuanping; Coropceanu, Veaceslav; Bredas, Jean-Luc

2014-01-01

We present a multiscale modeling of the infrared optical properties of the rubrene crystal. The results are in very good agreement with the experimental data that point to nonmonotonic features in the optical conductivity spectrum and small optical effective masses. We find that, in the static-disorder approximation, the nonlocal electron-phonon interactions stemming from low-frequency lattice vibrations can decrease the optical effective masses and lead to lighter quasiparticles. On the other hand, the charge-transport and infrared optical properties of the rubrene crystal at room temperature are demonstrated to be governed by localized carriers driven by inherent thermal disorders. Our findings underline that the presence of apparently light carriers in high-mobility organic semiconductors does not necessarily imply bandlike transport.

Charge-ordering, magnetic and electric-transport properties of Bi0.6-xEuxCa0.4MnO3 (0.0≤x≤0.6)

International Nuclear Information System (INIS)

Yadava, Kamlesh; Varma, G.D.; Singh, M.P.; Razavi, F.S.

2012-01-01

We have studied structure, magnetic and transport properties of polycrystalline Bi 0.6-x Eu x Ca 0.4 MnO 3 (x=0.0, 0.1, 0.2, 0.3, 0.4, 0.5 and 0.6) perovskite manganites. Magnetic measurements show that the charge-ordering temperature (T CO ) decreases with increasing x up to x=0.4 and then slightly increases with further increasing x up to x=0.6. Further, the antiferromagnetic (AFM) ordering temperature (T N ) decreases with increasing x. At T N a transition to metamagnetic glass like state is also seen. Eu doping also leads to enhancement in the magnetic moment and a concomitant decrease in resistivity up to x=0.2 and then an increase in resistivity up to x=0.5. We propose that the local lattice distortion induced by the size mismatch between the A-site cations and 6s 2 character of Bi 3+ lone pair electron are responsible for the observed variation in physical properties. (author)

Charge transport in nanoscale vertical organic semiconductor pillar devices

NARCIS (Netherlands)

Wilbers, J.G.E.; Xu, B.; Bobbert, P.A.; de Jong, M.P.; van der Wiel, W.G.

2017-01-01

We report charge transport measurements in nanoscale vertical pillar structures incorporating ultrathin layers of the organic semiconductor poly(3-hexylthiophene) (P3HT). P3HT layers with thickness down to 5 nm are gently top-contacted using wedging transfer, yielding highly reproducible, robust

Charge carrier mobility and electronic properties of Al(Op3: impact of excimer formation

Directory of Open Access Journals (Sweden)

Andrea Magri

2015-05-01

Full Text Available We have studied the electronic properties and the charge carrier mobility of the organic semiconductor tris(1-oxo-1H-phenalen-9-olatealuminium(III (Al(Op3 both experimentally and theoretically. We experimentally estimated the HOMO and LUMO energy levels to be −5.93 and −3.26 eV, respectively, which were close to the corresponding calculated values. Al(Op3 was successfully evaporated onto quartz substrates and was clearly identified in the absorption spectra of both the solution and the thin film. A structured steady state fluorescence emission was detected in solution, whereas a broad, red-shifted emission was observed in the thin film. This indicates the formation of excimers in the solid state, which is crucial for the transport properties. The incorporation of Al(Op3 into organic thin film transistors (TFTs was performed in order to measure the charge carrier mobility. The experimental setup detected no electron mobility, while a hole mobility between 0.6 × 10−6 and 2.1 × 10−6 cm2·V−1·s−1 was measured. Theoretical simulations, on the other hand, predicted an electron mobility of 9.5 × 10−6 cm2·V−1·s−1 and a hole mobility of 1.4 × 10−4 cm2·V−1·s−1. The theoretical simulation for the hole mobility predicted an approximately one order of magnitude higher hole mobility than was observed in the experiment, which is considered to be in good agreement. The result for the electron mobility was, on the other hand, unexpected, as both the calculated electron mobility and chemical common sense (based on the capability of extended aromatic structures to efficiently accept and delocalize additional electrons suggest more robust electron charge transport properties. This discrepancy is explained by the excimer formation, whose inclusion in the multiscale simulation workflow is expected to bring the theoretical simulation and experiment into agreement.

Surface Charge Transfer Doping of Monolayer Phosphorene via Molecular Adsorption.

Science.gov (United States)

He, Yuanyuan; Xia, Feifei; Shao, Zhibin; Zhao, Jianwei; Jie, Jiansheng

2015-12-03

Monolayer phosphorene has attracted much attention owing to its extraordinary electronic, optical, and structural properties. Rationally tuning the electrical transport characteristics of monolayer phosphorene is essential to its applications in electronic and optoelectronic devices. Herein, we study the electronic transport behaviors of monolayer phosphorene with surface charge transfer doping of electrophilic molecules, including 2,3,5,6-tetrafluoro-7,7,8,8-tetracyanoquinodimethane (F4TCNQ), NO2, and MoO3, using density functional theory combined with the nonequilibrium Green's function formalism. F4TCNQ shows optimal performance in enhancing the p-type conductance of monolayer phosphorene. Static electronic properties indicate that the enhancement is originated from the charge transfer between adsorbed molecule and phosphorene layer. Dynamic transport behaviors demonstrate that additional channels for hole transport in host monolayer phosphorene were generated upon the adsorption of molecule. Our work unveils the great potential of surface charge transfer doping in tuning the electronic properties of monolayer phosphorene and is of significance to its application in high-performance devices.

Theoretical proposal for a magnetic resonance study of charge transport in organic semiconductors

Science.gov (United States)

Mkhitaryan, Vagharsh

Charge transport in disordered organic semiconductors occurs via carrier incoherent hops in a band of localized states. In the framework of continuous-time random walk the carrier on-site waiting time distribution (WTD) is one of the basic characteristics of diffusion. Besides, WTD is fundamentally related to the density of states (DOS) of localized states, which is a key feature of a material determining the optoelectric properties. However, reliable first-principle calculations of DOS in organic materials are not yet available and experimental characterization of DOS and WTD is desirable. We theoretically study the spin dynamics of hopping carriers and propose measurement schemes directly probing WTD, based on the zero-field spin relaxation and the primary (Hahn) spin echo. The proposed schemes are possible because, as we demonstrate, the long-time behavior of the zero-field relaxation and the primary echo is determined by WTD, both for the hyperfine coupling dominated and the spin-orbit coupling dominated spin dynamics. We also examine the dispersive charge transport, which is a non-Markovian sub-diffusive process characterized by non-stationarity. We show that the proposed schemes unambiguously capture the effects of non-stationarity, e.g., the aging behavior of random walks. This work was supported by the Department of Energy-Basic Energy Sciences under Contract No. DE-AC02-07CH11358.

Charge transport in organic light-emitting diodes. Experiments and simulations

Energy Technology Data Exchange (ETDEWEB)

Schober, Matthias

2012-11-01

This thesis is about the development and validation of a numerical model for the simulation of the current-voltage characteristics of organic thin-film devices. The focus is on the analysis of a white organic light-emitting diode (OLED) with fluorescent blue and phosphorescent red and green emitters. The simulation model describes the charge transport as a one-dimensional drift-diffusion current and is developed on the basis of the Scharfetter-Gummel method. It incorporates modern theories for the charge transport in disordered organic materials, which are considered by means of special functions for the diffusion coefficient and the charge-carrier mobility. The algorithm is designed such that it can switch between different models for mobility and calculates both transient and steady-state solutions. In the analysis of the OLED, electron and hole transport are investigated separately in series of single-carrier devices. These test devices incorporate parts of the layers in the OLED between symmetrically arranged injection layers that are electrically doped. Thereby, the OLED layer sequence is reconstructed step by step. The analysis of the test devices allows to obtain the numerous parameters which are required for the simulation of the complete OLED and reveals many interesting features of the OLED. For instance, it is shown how the accumulation of charge carriers in front of an interface barrier increases the mobility and the transfer rate across the interface. Furthermore, it is demonstrated how to identify charge-trapping states. This leads to the detection of deep trap states in the emission zone of the OLED -- an interesting aspect, since these states can function as recombination centers and may cause non-radiative losses. Moreover, various other effects such as interface dipoles and a slight freeze-out of active electric dopants in the injection layers are observed. In the simulations of the numerous test devices, the parameters are consistently applied

Solitary Model of the Charge Particle Transport in Collisionless Plasma

International Nuclear Information System (INIS)

Simonchik, L.V.; Trukhachev, F.M.

2006-01-01

The one-dimensional MHD solitary model of charged particle transport in plasma is developed. It is shown that self-consistent electric field of ion-acoustic solitons can displace charged particles in space, which can be a reason of local electric current generation. The displacement amount is order of a few Debye lengths. It is shown that the current associated with soliton cascade has pulsating nature with DC component. Methods of built theory verification in dusty plasma are proposed

Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

Energy Technology Data Exchange (ETDEWEB)

Bhattacharjee, Sourav, E-mail: sourav.bhattacharjee@wur.nl [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Opstal, Edward J. van; Alink, Gerrit M. [Wageningen University, Division of Toxicology (Netherlands); Marcelis, Antonius T. M.; Zuilhof, Han [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Rietjens, Ivonne M. C. M. [Wageningen University, Division of Toxicology (Netherlands)

2013-06-15

The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size {approx}45 nm) and polystyrene nanoparticles (PSNPs/size {approx}50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

Science.gov (United States)

Bhattacharjee, Sourav; van Opstal, Edward J.; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.

2013-06-01

The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size 45 nm) and polystyrene nanoparticles (PSNPs/size 50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

International Nuclear Information System (INIS)

Bhattacharjee, Sourav; Opstal, Edward J. van; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.

2013-01-01

The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size ∼45 nm) and polystyrene nanoparticles (PSNPs/size ∼50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

Engineering charge transport by heterostructuring solution-processed semiconductors

Science.gov (United States)

Voznyy, Oleksandr; Sutherland, Brandon R.; Ip, Alexander H.; Zhitomirsky, David; Sargent, Edward H.

2017-06-01

Solution-processed semiconductor devices are increasingly exploiting heterostructuring — an approach in which two or more materials with different energy landscapes are integrated into a composite system. Heterostructured materials offer an additional degree of freedom to control charge transport and recombination for more efficient optoelectronic devices. By exploiting energetic asymmetry, rationally engineered heterostructured materials can overcome weaknesses, augment strengths and introduce emergent physical phenomena that are otherwise inaccessible to single-material systems. These systems see benefit and application in two distinct branches of charge-carrier manipulation. First, they influence the balance between excitons and free charges to enhance electron extraction in solar cells and photodetectors. Second, they promote radiative recombination by spatially confining electrons and holes, which increases the quantum efficiency of light-emitting diodes. In this Review, we discuss advances in the design and composition of heterostructured materials, consider their implementation in semiconductor devices and examine unexplored paths for future advancement in the field.

Measurements of Lunar Dust Charging Properties by Electron Impact

Science.gov (United States)

Abbas, Mian M.; Tankosic, Dragana; Craven, Paul D.; Schneider, Todd A.; Vaughn, Jason A.; LeClair, Andre; Spann, James F.; Norwood, Joseph K.

2009-01-01

Dust grains in the lunar environment are believed to be electrostatically charged predominantly by photoelectric emissions resulting from solar UV radiation on the dayside, and on the nightside by interaction with electrons in the solar wind plasma. In the high vacuum environment on the lunar surface with virtually no atmosphere, the positive and negative charge states of micron/submicron dust grains lead to some unusual physical and dynamical dust phenomena. Knowledge of the electrostatic charging properties of dust grains in the lunar environment is required for addressing their hazardous effect on the humans and mechanical systems. It is well recognized that the charging properties of individual small micron size dust grains are substantially different from the measurements on bulk materials. In this paper we present the results of measurements on charging of individual Apollo 11 and Apollo 17 dust grains by exposing them to mono-energetic electron beams in the 10-100 eV energy range. The charging/discharging rates of positively and negatively charged particles of approx. 0.1 to 5 micron radii are discussed in terms of the sticking efficiencies and secondary electron yields. The secondary electron emission process is found to be a complex and effective charging/discharging mechanism for incident electron energies as low as 10-25 eV, with a strong dependence on particle size. Implications of the laboratory measurements on the nature of dust grain charging in the lunar environment are discussed.

Charge Carrier Transport and Photogeneration in P3HT:PCBM Photovoltaic Blends

KAUST Repository

Laquai, Frederic

2015-05-03

This article reviews the charge transport and photogeneration in bulk-heterojunction solar cells made from blend films of regioregular poly(3-hexylthiophene) (RR-P3HT) and methano­fullerene (PCBM). The charge transport, specifically the hole mobility in the RR-P3HT phase of the polymer:fullerene photovoltaic blend, is dramatically affected by thermal annealing. The hole mobility increases more than three orders of magnitude and reaches a value of up to 2 × 10−4 cm2 V−1 s−1 after the thermal annealing process as a result of an improved semi-crystallinity of the film. This significant increase of the hole mobility balances the electron and hole mobilities in a photovoltaic blend in turn reducing space-charge formation, and this is the most important factor for the strong enhancement of the photovoltaic efficiency compared to an as cast, that is, non-annealed device. In fact, the balanced charge carrier mobility in RR-P3HT:PCBM blends in combination with a field- and temperature-independent charge carrier generation and greatly reduced non-geminate recombination explains the large quantum efficiencies mea­sured in P3HT:PCBM photovoltaic devices.

Investigation of transport properties of FeTe compound

Science.gov (United States)

Lodhi, Pavitra Devi; Solanki, Neha; Choudhary, K. K.; Kaurav, Netram

2018-05-01

Transport properties of FeTe parent compound has been investigated by measurements of electrical resistivity, magnetic susceptibility and Seebeck coefficient. The sample was synthesized through a standard solid state reaction route via vacuum encapsulation and characterized by x-ray diffraction, which indicated a tetragonal phase with space group P4/nmm. The parent FeTe compound does not exhibit superconductivity but shows an anomaly in the resistivity measurement at around 67 K, which corresponds to a structural phase transition along with in the vicinity of a magnetic phase transition. In the low temperature regime, Seebeck coefficient, S(T), exhibited an anomalous dip feature and negative throughout the temperature range, indicating electron-like charge carrier conduction mechanism.

Chemical disorder and charge transport in ferromagnetic manganites

International Nuclear Information System (INIS)

Pickett, W.E.; Singh, D.J.

1997-01-01

Disorder broadening due to randomly distributed La 3+ and A 2+ (A=Ca,Sr,Ba) cations is combined with a virtual-crystal treatment of the average system to evaluate the effects on both majority and minority transport in the ferromagnetic La 2/3 A 1/3 MnO 3 system. The low-density minority carriers which lie in the band tail are localized by disorder, while the majority carriers retain long mean free paths reflected in the observed strongly metallic conductivity. In addition to obtaining transport parameters, we provide evidence that local distortions are due to nearby ionic charges rather than to ion size considerations. copyright 1997 The American Physical Society

Carbon materials for enhancing charge transport in the advancements of perovskite solar cells

Science.gov (United States)

Hu, Ruiyuan; Chu, Liang; Zhang, Jian; Li, Xing'ao; Huang, Wei

2017-09-01

Organic-inorganic halide perovskite solar cells (PSCs) have become a new favorite in the photovoltaic field, due to the boosted efficiency up to 22.1%. Despite a flow of achievements, there are certain challenges to simultaneously meet high efficiency, large scale, low cost and high stability. Due to the low cost, extensive sources, high electrical conductivity and chemical stability, carbon materials have made undeniable contributions to play positive roles in developing PSCs. Carbon materials not only have the favorable conductivity but also bipolar advantage, which can transfer both electrons and holes. In this review, we will discuss how the carbon materials transfer charge or accelerate charge transport by incorporation in PSCs. Carbon materials can replace transparent conductive oxide layers, and enhance electron transport in electron transport layers. Moreover, carbon materials with continuous structure, especially carbon nanotubes and graphene, can provide direct charge transport channel that make them suitable additives or even substitutes in hole transport layers. Especially, the successful application of carbon materials as counter electrodes makes the devices full-printable, low temperature and high stability. Finally, a brief outlook is provided on the future development of carbon materials for PSCs, which are expected to devote more contributions in the future photovoltaic market.

Effect of electric charge on the transperitoneal transport of plasma proteins during CAPD

NARCIS (Netherlands)

Buis, B.; Koomen, G. C.; Imholz, A. L.; Struijk, D. G.; Reddingius, R. E.; Arisz, L.; Krediet, R. T.

1996-01-01

BACKGROUND: Controversy exists as to whether electric charges of plasma proteins influence their transport across the peritoneal membrane during CAPD. Fixed negative charges in the peritoneal membrane are diminished during peritonitis in rats. METHODS: Peritoneal clearances of 10 proteins and their

Role of reduced pi-pi stacking in the charge transport in polyfluorene

International Nuclear Information System (INIS)

Bajpai, Manisha; Srivastava, Ritu; Dhar, Ravindra; Tiwari, R.S.

2016-01-01

Highlights: • Role of bulky copolymer on the hole transport properties of polyfluorene thin films has been studied. • Photophysical measurement shows that the introduction of a SY in PFO effectively suppresses pi-stacking/aggregation of conjugated polymers in the solid state. • Current density decreases on blending for a given applied bias. - Abstract: We investigated the effect of blending of a bulky copolymer on the hole transport properties of poly (9,9-dihexyl fluorenyl-2,7-diyl)(PFO) thin films (∼120 nm) at different temperatures by obtaining the current density-voltage measurement. The poly (phenylenevinylene) based copolymer ‘‘Super Yellow” (SY) has been used as a blending component. Such polymer blending matrix is useful as it combines the host polymer (PFO) with the guest polymer of bulky side groups where pi-pi stacking is hindered by bulky side groups. This makes polyflorene much interesting and versatile material for lighting application. It has been found that the current density decreases on blending for a given applied bias. We demonstrated that the current conduction mechanism is bulk limited. It has been analyzed by trapped charge limited currents (TCLC) with electric field. We conclude that the relatively low hole mobility in blends as compared to pristine PFO would result due to increase in the pi-pi stacking distance and disorder.

Role of reduced pi-pi stacking in the charge transport in polyfluorene

Energy Technology Data Exchange (ETDEWEB)

Bajpai, Manisha, E-mail: mansa83@gmail.com [Soft Materials Research Laboratory, Centre of Material Sciences, Institute of Interdisciplinary Studies, University of Allahabad, Allahabad 211002 (India); Department of Physics, Banaras Hindu University, Varanasi 221005 (India); Srivastava, Ritu [Centre for Organic Electronics, National Physical Laboratory (Council of Scientific and Industrial Research), Dr. K. S. Krishnan Road, New Delhi 110012 (India); Dhar, Ravindra [Soft Materials Research Laboratory, Centre of Material Sciences, Institute of Interdisciplinary Studies, University of Allahabad, Allahabad 211002 (India); Tiwari, R.S. [Department of Physics, Banaras Hindu University, Varanasi 221005 (India)

2016-10-15

Highlights: • Role of bulky copolymer on the hole transport properties of polyfluorene thin films has been studied. • Photophysical measurement shows that the introduction of a SY in PFO effectively suppresses pi-stacking/aggregation of conjugated polymers in the solid state. • Current density decreases on blending for a given applied bias. - Abstract: We investigated the effect of blending of a bulky copolymer on the hole transport properties of poly (9,9-dihexyl fluorenyl-2,7-diyl)(PFO) thin films (∼120 nm) at different temperatures by obtaining the current density-voltage measurement. The poly (phenylenevinylene) based copolymer ‘‘Super Yellow” (SY) has been used as a blending component. Such polymer blending matrix is useful as it combines the host polymer (PFO) with the guest polymer of bulky side groups where pi-pi stacking is hindered by bulky side groups. This makes polyflorene much interesting and versatile material for lighting application. It has been found that the current density decreases on blending for a given applied bias. We demonstrated that the current conduction mechanism is bulk limited. It has been analyzed by trapped charge limited currents (TCLC) with electric field. We conclude that the relatively low hole mobility in blends as compared to pristine PFO would result due to increase in the pi-pi stacking distance and disorder.

Terahertz transport dynamics of graphene charge carriers

DEFF Research Database (Denmark)

Buron, Jonas Christian Due

The electronic transport dynamics of graphene charge carriers at femtosecond (10-15 s) to picosecond (10-12 s) time scales are investigated using terahertz (1012 Hz) time-domain spectroscopy (THz-TDS). The technique uses sub-picosecond pulses of electromagnetic radiation to gauge the electrodynamic...... response of thin conducting films at up to multi-terahertz frequencies. In this thesis THz-TDS is applied towards two main goals; (1) investigation of the fundamental carrier transport dynamics in graphene at femtosecond to picosecond timescales and (2) application of terahertz time-domain spectroscopy...... to rapid and non-contact electrical characterization of large-area graphene, relevant for industrial integration. We show that THz-TDS is an accurate and reliable probe of graphene sheet conductance, and that the technique provides insight into fundamental aspects of the nanoscopic nature of conduction...

Adiabatic and Nonadiabatic Charge Transport in Li-S Batteries

DEFF Research Database (Denmark)

Park, Haesun; Kumar, Nitin; Melander, Marko

2018-01-01

The insulating nature of the redox end members in Li-S batteries, -S and Li2S, has the potential to limit the capacity and efficiency of this emerging energy storage system. Nevertheless, the mechanisms responsible for ionic and electronic transport in these materials remain a matter of debate...... studies, we conclude that low equilibrium carrier concentrations are responsible for sluggish charge transport in -S and Li2S. Thus, a potential strategy for improving the performance of Li-S batteries is to increase the concentrations of holes in these redox end members....

Observation of quantum interference in molecular charge transport

DEFF Research Database (Denmark)

Guedon, Constant M.; Valkenier, Hennie; Markussen, Troels

2012-01-01

for such behaviour has been indirect. Here, we report the observation of destructive quantum interference in charge transport through two-terminal molecular junctions at room temperature. We studied five different rigid p-conjugated molecular wires, all of which form self-assembled monolayers on a gold surface......, and find that the degree of interference can be controlled by simple chemical modifications of the molecular wire....

Design of the low energy beam transport line between CARIBU and the EBIS charge breeder

Energy Technology Data Exchange (ETDEWEB)

Perry, A., E-mail: aperry4@hawk.iit.edu [Argonne National Laboratory, Argonne, IL 60439, USA and Illinois Institute of Technology, Chicago, IL 60616 (United States); Ostroumov, P. N.; Barcikowski, A.; Dickerson, C.; Kondrashev, S. A.; Mustapha, B.; Savard, G. [Argonne National Laboratory, Argonne, IL 60439 (United States)

2015-01-09

An Electron Beam Ion Source Charge Breeder (EBIS-CB) has been developed to breed radioactive beams from the CAlifornium Rare Isotope Breeder Upgrade (CARIBU) facility at ATLAS. The EBIS-CB will replace the existing ECR charge breeder to increase the intensity and improve the purity of reaccelerated radioactive ion beams. The EBIS-CB is in the final stage of off-line commissioning. Currently, we are developing a low energy beam transport (LEBT) system to transfer CARIBU beams to the EBIS-CB. As was originally planned, an RFQ cooler-buncher will precede the EBIS-CB. Recently, it was decided to include a multi-reflection time-of-flight (MR-TOF) mass-spectrometer following the RFQ. MR-TOF is a relatively new technology used to purify beams with a mass-resolving power up to 3×10{sup 5} as was demonstrated in experiments at CERN/ISOLDE. Very high purity singly-charged radioactive ion beams will be injected into the EBIS for charge breeding and due to its inherent properties, the EBIS-CB will maintain the purity of the charge bred beams. Possible contamination of residual gas ions will be greatly suppressed by achieving ultra-high vacuum in the EBIS trap. This paper will present and discuss the design of the LEBT and the overall integration of the EBIS-CB into ATLAS.

EDITORIAL: Charge transport in non-metallic solids

Science.gov (United States)

Youngs, Ian J.; Almond, Darryl P.

2009-03-01

Workers engaged in a wide range of investigations of charge transport in non-metallic solids came together at a meeting of the Institute of Physics Dielectric Group, held in London on 2 April 2008. Topics included both ionic and electronic conduction, investigations of the fundamental mechanisms of charge transport, percolation, modelling the conduction process in both natural and man-made composite electrical and electromagnetic materials, the design and development of solids with specified conduction properties and the ac characteristics of non-metallic solids. In the first session, the long-standing problem of the anomalous power law increase in ac conductivity with frequency was addressed by a set of four presentations. Jeppe Dyre, an invited speaker from Roskilde University, Denmark, introduced the problem and stressed the universality of the frequency dependence observed in the ac conductivities of disordered non-metallic materials. He showed that it could be obtained from a simple random barrier model, independent of the barrier distribution. Darryl Almond, University of Bath, showed that the electrical responses of large networks of randomly positioned resistors and capacitors, simulating the microstructures of disordered two-phase (conductor insulator) materials, exhibit the same frequency dependence. He demonstrated their robustness to component value and distribution and suggested that it was an emergent property of these networks and of two-phase materials. Klaus Funke, an invited speaker from the University of Munster, Germany, presented a detailed model of ion motion in disordered ionic materials. He stressed the need to account for the concerted many-particle processes that occur whilst ions hop from site to site in response to an applied electric field. The conductivity spectra obtained from this work reproduce the same frequency dispersion and have the additional feature of conductivity saturation at high frequencies. Tony West, University of

Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

International Nuclear Information System (INIS)

Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

2004-01-01

Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

Semimetallic and charge-ordered α -(BEDT-TTF)2I3: On the role of disorder in dc transport and dielectric properties

Science.gov (United States)

Ivek, Tomislav; Čulo, Matija; Kuveždić, Marko; Tutiš, Eduard; Basletić, Mario; Mihaljević, Branimir; Tafra, Emil; Tomić, Silvia; Löhle, Anja; Dressel, Martin; Schweitzer, Dieter; Korin-Hamzić, Bojana

2017-08-01

α -(BEDT-TTF)2I3 is a prominent example of charge ordering among organic conductors. In this work, we explore the details of transport within the charge-ordered as well as semimetallic phase at ambient pressure. In the high-temperature semimetallic phase, the mobilities and concentrations of both electrons and holes conspire in such a way to create an almost temperature-independent conductivity as well as a low Hall effect. We explain these phenomena as a consequence of a predominantly interpocket scattering which equalizes mobilities of the two types of charge carriers. At low temperatures, within the insulating charge-ordered phase two channels of conduction can be discerned: a temperature-dependent activation, which follows the mean-field behavior, and a nearest-neighbor-hopping contribution. Together with negative magnetoresistance, the latter relies on the presence of disorder. The charge-ordered phase also features a prominent dielectric peak which bears a similarity to relaxor ferroelectrics. Its dispersion is determined by free-electron screening and pushed by disorder well below the transition temperature. The source of this disorder can be found in the anion layers which randomly perturb BEDT-TTF molecules through hydrogen bonds.

Charge and Spin Transport in Spin-orbit Coupled and Topological Systems

KAUST Repository

Ndiaye, Papa Birame

2017-10-31

In the search for low power operation of microelectronic devices, spin-based solutions have attracted undeniable increasing interest due to their intrinsic magnetic nonvolatility. The ability to electrically manipulate the magnetic order using spin-orbit interaction, associated with the recent emergence of topological spintronics with its promise of highly efficient charge-to-spin conversion in solid state, offer alluring opportunities in terms of system design. Although the related technology is still at its infancy, this thesis intends to contribute to this engaging field by investigating the nature of the charge and spin transport in spin-orbit coupled and topological systems using quantum transport methods. We identified three promising building blocks for next-generation technology, three classes of systems that possibly enhance the spin and charge transport efficiency: (i)- topological insulators, (ii)- spin-orbit coupled magnonic systems, (iii)- topological magnetic textures (skyrmions and 3Q magnetic state). Chapter 2 reviews the basics and essential concepts used throughout the thesis: the spin-orbit coupling, the mathematical notion of topology and its importance in condensed matter physics, then topological magnetism and a zest of magnonics. In Chapter 3, we study the spin-orbit torques at the magnetized interfaces of 3D topological insulators. We demonstrated that their peculiar form, compared to other spin-orbit torques, have important repercussions in terms of magnetization reversal, charge pumping and anisotropic damping. In Chapter 4, we showed that the interplay between magnon current jm and magnetization m in homogeneous ferromagnets with Dzyaloshinskii-Moriya (DM) interaction, produces a field-like torque as well as a damping-like torque. These DM torques mediated by spin wave can tilt the imeaveraged magnetization direction and are similar to Rashba torques for electronic systems. Moreover, the DM torque is more efficient when magnons are

Spin properties of charged Mn-doped quantum dota)

Science.gov (United States)

Besombes, L.; Léger, Y.; Maingault, L.; Mariette, H.

2007-04-01

The optical properties of individual quantum dots doped with a single Mn atom and charged with a single carrier are analyzed. The emission of the neutral, negatively and positively charged excitons coupled with a single magnetic atom (Mn) are observed in the same individual quantum dot. The spectrum of the charged excitons in interaction with the Mn atom shows a rich pattern attributed to a strong anisotropy of the hole-Mn exchange interaction slightly perturbed by a small valence-band mixing. The anisotropy in the exchange interaction between a single magnetic atom and a single hole is revealed by comparing the emission of a charged Mn-doped quantum dot in longitudinal and transverse magnetic field.

PATH: a lumped-element beam-transport simulation program with space charge

International Nuclear Information System (INIS)

Farrell, J.A.

1983-01-01

PATH is a group of computer programs for simulating charged-particle beam-transport systems. It was developed for evaluating the effects of some aberrations without a time-consuming integration of trajectories through the system. The beam-transport portion of PATH is derived from the well-known program, DECAY TURTLE. PATH contains all features available in DECAY TURTLE (including the input format) plus additional features such as a more flexible random-ray generator, longitudinal phase space, some additional beamline elements, and space-charge routines. One of the programs also provides a simulation of an Alvarez linear accelerator. The programs, originally written for a CDC 7600 computer system, also are available on a VAX-VMS system. All of the programs are interactive with input prompting for ease of use

Effect of d-wave pairing symmetry in transport properties of silicene-based superconductor junction

Science.gov (United States)

Vosoughi-nia, S.; Rashedi, G.; hajati, Y.

2018-06-01

We theoretically study the tunneling conductance of a normal/d-wave superconductor silicene junction using Blonder-Tinkham-Klapwijk (BTK) formalism. We discuss how the conductance spectra are affected by changing the chemical potential (μN) in the normal silicene region. It is obtained that the amplitude of the spin/valley-dependent Andreev reflection (AR) and charge conductance (G) of the junction can be strongly modulated by the orientation angle of superconductive gap (β) and perpendicular electric field (Ez). We demonstrate that the charge conductance exhibits an oscillatory behavior as a function of β by a period of π/2. Remarkably, variation of μN strongly modifies the amplitude of the oscillations and periodically there are transport gaps in the G - β oscillations for a range of μN. These findings suggest that one may experimentally tune the transport properties of the junction through changing β, Ez and μN.

Investigation of exciton photodissociation, charge transport and photovoltaic response of poly(N-vinyl carbazole):TiO2 nanocomposites for solar cell applications

International Nuclear Information System (INIS)

Dridi, C; Chaabane, H; Barlier, V; Davenas, J; Ouada, H Ben

2008-01-01

The photogeneration of charge carriers in spin-coated thin films of nanocrystalline (nc-)TiO 2 particles dispersed in a semiconducting polymer, poly(N-vinylcarbazole) (PVK), has been studied by photoluminescence and charge transport measurements. The solvent and the TiO 2 particle concentration have been selected to optimize the composite morphology. A large number of small domains leading to a large interface and an improved exciton dissociation could be obtained with tetrahydrofuran (THF). The charge transport mechanism and trap distribution at low and high voltage in ITO/nc-TiO 2 :PVK/Al diodes in the dark could be identified by current-voltage measurements and impedance spectroscopy. The transport mechanism is space charge limited with an exponential trap distribution in the high voltage regime (1-4 V), whereas a Schottky process with a barrier height of about 0.9 eV is observed at low bias voltages ( sc and open circuit voltage V oc for a 30% TiO 2 volume content corresponding to the morphology exhibiting the best dispersion of TiO 2 particles. A degradation of the photovoltaic properties is induced at higher compositions by the formation of larger TiO 2 aggregates. A procedure has been developed to extract the physical parameters from the J-V characteristics in the dark and under illumination on the basis of an equivalent circuit. The variation of the solar cell parameters with the TiO 2 composition confirms that the photovoltaic response is optimum for 30% TiO 2 volume content. It is concluded that the photovoltaic properties of nc-TiO 2 :PVK nanocomposites are controlled by the interfacial area between the donor and the acceptor material and are limited by the dispersion of the TiO 2 nanoparticles in the polymer

Charge carrier transport and photogeneration in P3HT:PCBM photovoltaic blends.

Science.gov (United States)

Laquai, Frédéric; Andrienko, Denis; Mauer, Ralf; Blom, Paul W M

2015-06-01

This article reviews the charge transport and photogeneration in bulk-heterojunction solar cells made from blend films of regioregular poly(3-hexylthiophene) (RR-P3HT) and methano-fullerene (PCBM). The charge transport, specifically the hole mobility in the RR-P3HT phase of the polymer:fullerene photovoltaic blend, is dramatically affected by thermal annealing. The hole mobility increases more than three orders of magnitude and reaches a value of up to 2 × 10(-4) cm(2) V(-1) s(-1) after the thermal annealing process as a result of an improved semi-crystallinity of the film. This significant increase of the hole mobility balances the electron and hole mobilities in a photovoltaic blend in turn reducing space-charge formation, and this is the most important factor for the strong enhancement of the photovoltaic efficiency compared to an as cast, that is, non-annealed device. In fact, the balanced charge carrier mobility in RR-P3HT:PCBM blends in combination with a field- and temperature-independent charge carrier generation and greatly reduced non-geminate recombination explains the large quantum efficiencies mea-sured in P3HT:PCBM photovoltaic devices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Pure crystal orientation and anisotropic charge transport in large-area hybrid perovskite films

KAUST Repository

Cho, Nam Chul

2016-11-10

Controlling crystal orientations and macroscopic morphology is vital to develop the electronic properties of hybrid perovskites. Here we show that a large-area, orientationally pure crystalline (OPC) methylammonium lead iodide (MAPbI3) hybrid perovskite film can be fabricated using a thermal-gradient-assisted directional crystallization method that relies on the sharp liquid-to-solid transition of MAPbI3 from ionic liquid solution. We find that the OPC films spontaneously form periodic microarrays that are distinguishable from general polycrystalline perovskite materials in terms of their crystal orientation, film morphology and electronic properties. X-ray diffraction patterns reveal that the film is strongly oriented in the (112) and (200) planes parallel to the substrate. This film is structurally confined by directional crystal growth, inducing intense anisotropy in charge transport. In addition, the low trap-state density (7.9 × 1013 cm−3) leads to strong amplified stimulated emission. This ability to control crystal orientation and morphology could be widely adopted in optoelectronic devices.

Defect chemistry of ''BaCuO2''. Pt. 2. Transport properties and nature of defects

International Nuclear Information System (INIS)

Chiodelli, G.; Consiglio Nazionale delle Ricerche, Pavia; Anselmi-Tamburini, U.; Consiglio Nazionale delle Ricerche, Pavia; Arimondi, M.; Consiglio Nazionale delle Ricerche, Pavia; Spinolo, G.; Consiglio Nazionale delle Ricerche, Pavia; Flor, G.; Consiglio Nazionale delle Ricerche, Pavia

1995-01-01

The charge transport properties of ''BaCuO 2 '' with 88:90 (Ba:Cu) cation ratio were characterized by thermopower, electrical conductivity and ionic transport number measurements in a wide range of temperature and oxygen partial pressure conditions. The nature of carriers is always represented by small polarons due to self-trapping of the electronic holes generated by the oxygen non-stoichiometry equilibrium. Some anomalies in carrier mobility as a function of temperature are shown not to be related to incomplete ionization of oxygen atoms on interstitial sites (orig.)

EBQ code: Transport of space-charge beams in axially symmetric devices

Science.gov (United States)

Paul, A. C.

1982-11-01

Such general-purpose space charge codes as EGUN, BATES, WODF, and TRANSPORT do not gracefully accommodate the simulation of relativistic space-charged beams propagating a long distance in axially symmetric devices where a high degree of cancellation has occurred between the self-magnetic and self-electric forces of the beam. The EBQ code was written specifically to follow high current beam particles where space charge is important in long distance flight in axially symmetric machines possessing external electric and magnetic field. EBQ simultaneously tracks all trajectories so as to allow procedures for charge deposition based on inter-ray separations. The orbits are treated in Cartesian geometry (position and momentum) with z as the independent variable. Poisson's equation is solved in cylindrical geometry on an orthogonal rectangular mesh. EBQ can also handle problems involving multiple ion species where the space charge from each must be included. Such problems arise in the design of ion sources where different charge and mass states are present.

EBQ code: transport of space-charge beams in axially symmetric devices

International Nuclear Information System (INIS)

Paul, A.C.

1982-11-01

Such general-purpose space charge codes as EGUN, BATES, WOLF, and TRANSPORT do not gracefully accommodate the simulation of relativistic space-charged beams propagating a long distance in axially symmetric devices where a high degree of cancellation has occurred between the self-magnetic and self-electric forces of the beam. The EBQ code was written specifically to follow high current beam particles where space charge is important in long distance flight in axially symmetric machines possessing external electric and magnetic field. EBQ simultaneously tracks all trajectories so as to allow procedures for charge deposition based on inter-ray separations. The orbits are treated in Cartesian geometry (position and momentum) with z as the independent variable. Poisson's equation is solved in cylindrical geometry on an orthogonal rectangular mesh. EBQ can also handle problems involving multiple ion species where the space charge from each must be included. Such problems arise in the design of ion sources where different charge and mass states are present

STM and transport measurements of highly charged ion modified materials

International Nuclear Information System (INIS)

Pomeroy, J.M.; Grube, H.; Perrella, A.C.; Gillaspy, J.D.

2007-01-01

Careful measurements of highly charged ions (HCIs) colliding with gases and surfaces have provided glimpses of intense electronic interactions, but a comprehensive model for the interaction mechanisms, time scales, and resultant nano-features that bridges materials systems is yet to be realized. At the National Institute of Standards and Technology (NIST) electron beam ion trap (EBIT) facility, new apparatus is now connected to the HCI beamline to allow preparation of clean, atomically flat surfaces of single crystals, e.g. gold, tungsten and silicon, and deposition and patterning of thin films, e.g. high resistivity oxides, ferromagnetic metals, normal metals and superconductors. Experiments reported here focus on the electronic and morphological structure of HCI induced nano-features. Current activities are focused on using in situ scanning tunneling microscope (STM) on Au(1 1 1) and (separately) ex situ transport measurements to study electronic properties within HCI modified magnetic multilayer systems. Specifically, we are fabricating magnetic multilayers similar to magnetic tunnel junctions (MTJs) (important in advanced magnetic field sensors and superconducting Josephson junction devices) and using HCIs to adjust critical electronic properties. The electrical response of the tunnel junction to HCIs provides a novel approach to performing HCI-induced nanostructure ensemble measurements

Plasma stream transport method (2) Use of charge exchange plasma source

International Nuclear Information System (INIS)

Tsuchimoto, T.

1978-01-01

The plasma stream transport method using a single plasma source has limitations for practical film deposition. Using a charge exchange phenomenon, a new plasma source is devised and tested by the plasma stream transport machine. Metals, silicon dioxide, and nitride films are deposited by this system. The mechanism of deposition under relatively high vacuum surrounding a silicon wafer is discussed as is the effect of radical atoms

Electrification Opportunities in the Transportation Sector and Impact of Residential Charging

Energy Technology Data Exchange (ETDEWEB)

Muratori, Matteo [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

2018-04-04

This presentation provides an overview of electrification opportunities in the transportation sector and present results of a study assessing the impact of residential charging on residential power demand and electric power distribution infrastructure.

Charge-transfer properties in the gas electron multiplier

International Nuclear Information System (INIS)

Han, Sanghyo; Kim, Yongkyun; Cho, Hyosung

2004-01-01

The charge transfer properties of a gas electron multiplier (GEM) were systematically investigated over a broad range of electric field configurations. The electron collection efficiency and the charge sharing were found to depend on the external fields, as well as on the GEM voltage. The electron collection efficiency increased with the collection field up to 90%, but was essentially independent of the drift field strength. A double conical GEM has a 10% gain increase with time due to surface charging by avalanche ions whereas this effect was eliminated with the cylindrical GEM. The positive-ion feedback is also estimated. (author)

Charge carrier transport mechanisms in perovskite CdTiO3 fibers

Directory of Open Access Journals (Sweden)

Z. Imran

2014-06-01

Full Text Available Electrical transport properties of electrospun cadmium titanate (CdTiO3 fibers have been investigated using ac and dc measurements. Air annealing of as spun fibers at 1000 °C yielded the single phase perovskite fibers having diameter ∼600 nm - 800 nm. Both the ac and dc electrical measurements were carried out at temperatures from 200 K – 420 K. The complex impedance plane plots revealed a single semicircular arc which indicates the interfacial effect due to grain boundaries of fibers. The dielectric properties obey the Maxwell-Wagner theory of interfacial polarization. In dc transport study at low voltages, data show Ohmic like behavior followed by space charge limited current (SCLC with traps at higher voltages at all temperatures (200 K – 420 K. Trap density in our fibers system is Nt = 6.27 × 1017 /cm3. Conduction mechanism in the sample is governed by 3-D variable range hopping (VRH from 200 K – 300 K. The localized density of states were found to be N(EF = 5.51 × 1021 eV−1 cm−3 at 2 V. Other VRH parameters such as hopping distance (Rhop and hopping energy (Whop were also calculated. In the high temperature range of 320 K – 420 K, conductivity follows the Arrhenius law. The activation energy found at 2 V is 0.10 eV. Temperature dependent and higher values of dielectric constant make the perovskite CdTiO3 fibers efficient material for capacitive energy storage devices.

Charge transport in non-irradiated and irradiated silicon detectors

International Nuclear Information System (INIS)

Leroy, C.; Roy, P.; Casse, G.L.; Glaser, M.; Grigoriev, E.; Lemeilleur, F.

1999-01-01

A model describing the transport of the charge carriers generated in n-type silicon detectors by ionizing particles is presented. In order to reproduce the experimental current pulse responses induced by α and β particles in non-irradiated and irradiated detectors up to fluences (PHI) much beyond the n to p-type inversion, an n-type region 15 μm deep is introduced on the p + side of the diode. This model also gives mobilities which decrease linearly up to fluences of around 5x10 13 particles/cm 2 and beyond, converging to saturation values of about 1000 and 450 cm 2 /V s for electrons and holes, respectively. The charge carrier lifetime degradation with increased fluence, due to trapping, is responsible for a predicted charge collection deficit for β particles and for α particles which is found to agree with direct CCE measurements. (author)

Charge-carrier transport in epitactical strontium titanate layers for the application in superconducting components

International Nuclear Information System (INIS)

Grosse, Veit

2011-01-01

In this thesis thin STO layers were epitactically deposited on YBCO for a subsequent electrical characterization. YBCO layers with a roughness of less than 2 nm (RMS), good out-of-plane orientation with a half-width in the rocking curve in the range (0.2..0.3) at only slightly diminished critical temperature could be reached. The STO layers exhibited also very good crystallographic properties. The charge-carrier transport in STO is mainly dominated by interface-limited processes. By means of an in thesis newly developed barrier model thereby the measured dependencies j(U,T) respectively σ(U,T) could be described very far-reachingly. At larger layer thicknesses and low temperatures the charge-carrier transport succeeds by hopping processes. So in the YBCO/STO/YBCO system the variable-range hopping could be identified as dominating transport process. Just above U>10 V a new behaviour is observed, which concerning its temperature dependence however is also tunnel-like. The STO layers exhibit here very large resistances, so that fields up to 10 7 ..10 8 V/m can be reached without flowing of significant leakage currents through the barrier. In the system YBCO/STO/Au the current transport can be principally in the same way as in the YBCO/STO/YBCO system. The special shape and above all the asymmetry of the barrier however work out very distinctly. It could be shown that at high temperatures according to the current direction a second barrier on the opposite electrode must be passed. So often observed breakdown effects can be well described. For STO layer-thicknesses in the range around 25 nm in the whole temperature range studied inelastic tunneling over chains of localized states was identified as dominating transport process. It could however for the first time be shown that at very low temperatures in the STO layers Coulomb blockades can be formed.

Experimental and Theoretical Demonstration on the Transport Properties of Fused Ring Host Materials for Organic Light-Emitting Diodes

Science.gov (United States)

Tse, S. C.; So, S. K.; Yeung, M. Y.; Lo, C. F.; Wen, S. W.; Chen, C. H.

2006-01-01

The charge transport properties of three tertiary-butyl (t-Bu) substituted anthracene derivatives (ADN), critical blue host materials for organic light-emitting diodes (OLEDs), have been investigated experimentally and computationally. From time-of-flight (TOF) measurements, all ADN compounds exhibit ambipolar characters. The hole and electron mobilities are in the range (1--5)× 10-7 cm2 V-1 s-1 under an external applied field of about 1 MV cm-1. Un-substituted ADN has the highest carrier mobilities while heavily t-Bu substituted ADN has the least. The electron and hole conducting properties of are consistent with ab initio calculation, which indicates that the frontier orbitals are localized mainly on the anthracene moiety. t-Bu substitutions in ADN increase the hopping path lengths among the molecules and hence reduce the electron and hole mobilities. The results demonstrate that t-Bu substitution is an effective means of engineering the conductivity of organic charge transporter for OLED applications.

Molecular structure of the discotic liquid crystalline phase of hexa-peri-hexabenzocoronene/oligothiophene hybrid and their charge transport properties

International Nuclear Information System (INIS)

Bag, Saientan; Maingi, Vishal; Maiti, Prabal K.; Yelk, Joe; Glaser, Matthew A.; Clark, Noel A.; Walba, David M.

2015-01-01

Using atomistic molecular dynamics simulation, we study the discotic columnar liquid crystalline (LC) phases formed by a new organic compound having hexa-peri-Hexabenzocoronene (HBC) core with six pendant oligothiophene units recently synthesized by Nan Hu et al. [Adv. Mater. 26, 2066 (2014)]. This HBC core based LC phase was shown to have electric field responsive behavior and has important applications in organic electronics. Our simulation results confirm the hexagonal arrangement of columnar LC phase with a lattice spacing consistent with that obtained from small angle X-ray diffraction data. We have also calculated various positional and orientational correlation functions to characterize the ordering of the molecules in the columnar arrangement. The molecules in a column are arranged with an average twist of 25° having an average inter-molecular separation of ∼5 Å. Interestingly, we find an overall tilt angle of 43° between the columnar axis and HBC core. We also simulate the charge transport through this columnar phase and report the numerical value of charge carrier mobility for this liquid crystal phase. The charge carrier mobility is strongly influenced by the twist angle and average spacing of the molecules in the column

Charge and Spin Transport in Spin-orbit Coupled and Topological Systems

KAUST Repository

Ndiaye, Papa Birame

2017-01-01

for next-generation technology, three classes of systems that possibly enhance the spin and charge transport efficiency: (i)- topological insulators, (ii)- spin-orbit coupled magnonic systems, (iii)- topological magnetic textures (skyrmions and 3Q magnetic

Charge transport in silicon nanocrystal superlattices in the terahertz regime

Czech Academy of Sciences Publication Activity Database

Němec, Hynek; Zajac, Vít; Kužel, Petr; Malý, P.; Gutsch, S.; Hiller, D.; Zacharias, M.

2015-01-01

Roč. 91, č. 19 (2015), "195443-1"-"195443-10" ISSN 1098-0121 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : silicon nanocrystals * charge transport * terahertz spectroscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.736, year: 2014

On the mechanism of charge transport in low density polyethylene

Science.gov (United States)

Upadhyay, Avnish K.; Reddy, C. C.

2017-08-01

Polyethylene based polymeric insulators, are being increasingly used in the power industry for their inherent advantages over conventional insulation materials. Specifically, modern power cables are almost made with these materials, replacing the mass-impregnated oil-paper cable technology. However, for ultra-high dc voltage applications, the use of these polymeric cables is hindered by ununderstood charge transport and accumulation. The conventional conduction mechanisms (Pool-Frenkel, Schottky, etc.) fail to track high-field charge transport in low density polyethylene, which is semi-crystalline in nature. Until now, attention was devoted mainly to the amorphous region of the material. In this paper, authors propose a novel mechanism for conduction in low density polyethylene, which could successfully track experimental results. As an implication, a novel, substantial relationship is established for electrical conductivity that could be effectively used for understanding conduction and breakdown in polyethylene, which is vital for successful development of ultra-high voltage dc cables.

Numerical design of electron guns and space charge limited transport systems

International Nuclear Information System (INIS)

Herrmannsfeldt, W.B.

1980-10-01

This paper describes the capabilities and limitations of computer programs used to design electron guns and similarly space-charge limited transport systems. Examples of computer generated plots from several different types of gun problems are included

Three-dimensional charge transport in organic semiconductor single crystals.

Science.gov (United States)

He, Tao; Zhang, Xiying; Jia, Jiong; Li, Yexin; Tao, Xutang

2012-04-24

Three-dimensional charge transport anisotropy in organic semiconductor single crystals - both plates and rods (above and below, respectively, in the figure) - is measured in well-performing organic field-effect transistors for the first time. The results provide an excellent model for molecular design and device preparation that leads to good performance. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Charge transport in dye-sensibilized porous zinc oxide films; Ladungstransport in farbstoffsensibilisierten poroesen Zinkoxidfilmen

Energy Technology Data Exchange (ETDEWEB)

Reemts, J.

2006-05-18

During the last decades, zinc oxide has attracted a lot of attention as an important material in various electrical, chemical, and optical applications. In the present work results are discussed gained from investigations of highly porous electrochemically deposited zinc oxide, which is a promising electrode material both in the area of solar energy conversion and sensor technology. The films were prepared by adding detergents during the electrodeposition process. The detergents have a structure-directing influence during the film deposition and, therefore, on the morphology of the films. The obtained electrodes can easily be sensitized for light or different chemicals by a simple adsorption of different molecules. In the present work I discuss the fundamental charge transport properties of electrochemically deposited zinc oxide films. Temperature-dependent measurements of the current-voltage characteristics are carried out and the spectral response of the photoconductivity is investigated. In order to understand the charge transport properties of this highly porous material, it is necessary to get a deeper insight in the electrode morphology. Therefore, different optical and scanning probe microscopy methods are used to characterize the inner structure of the electrodes. The electrical conductivity of the zinc oxide films can be seen as a thermally activated process, which can be explained by electronic transitions from the valence band of the zinc oxide to two shallow impurity levels. The current-voltage characteristic unveils a nonlinear behavior which can be explained by a space-charge-limited current model with traps distributed in energy. Upon excitation with different wavelengths, the conductivity of the zinc oxide increases already under sub-band gap illumination due to widely distributed trap states within the band gap. The transients of the photoconductivity follow a stretched exponential law with time scales in the range of several hours, either if the

Pore structure and function of synthetic nanopores with fixed charges: tip shape and rectification properties

Energy Technology Data Exchange (ETDEWEB)

RamIrez, Patricio [Departament de Fisica Aplicada, Universitat Politecnica de Valencia, E-46022 Valencia (Spain); Apel, Pavel Yu [Flerov Laboratory of Nuclear Reactions, Joint Institute for Nuclear Research, Joliot-Curie street 6, 141980 Dubna (Russian Federation); Cervera, Javier; Mafe, Salvador [Departament de Fisica de la Terra i Termodinamica, Universitat de Valencia, E-46100 Burjassot (Spain)], E-mail: patraho@fis.upv.es

2008-08-06

We present a complete theoretical study of the relationship between the structure (tip shape and dimensions) and function (selectivity and rectification) of asymmetric nanopores on the basis of previous experimental studies. The theoretical model uses a continuum approach based on the Nernst-Planck equations. According to our results, the nanopore transport properties, such as current-voltage (I-V) characteristics, conductance, rectification ratio, and selectivity, are dictated mainly by the shape of the pore tip (we have distinguished bullet-like, conical, trumpet-like, and hybrid shapes) and the concentration of pore surface charges. As a consequence, the nanopore performance in practical applications will depend not only on the base and tip openings but also on the pore shape. In particular, we show that the pore opening dimensions estimated from the pore conductance can be very different, depending on the pore shape assumed. The results obtained can also be of practical relevance for the design of nanopores, nanopipettes, and nanoelectrodes, where the electrical interactions between the charges attached to the nanostructure and the mobile charges confined in the reduced volume of the inside solution dictate the device performance in practical applications. Because single tracks are the elementary building blocks for nanoporous membranes, the understanding and control of their individual properties should also be crucial in protein separation, water desalination, and bio-molecule detection using arrays of identical nanopores.

Pore structure and function of synthetic nanopores with fixed charges: tip shape and rectification properties

International Nuclear Information System (INIS)

RamIrez, Patricio; Apel, Pavel Yu; Cervera, Javier; Mafe, Salvador

2008-01-01

We present a complete theoretical study of the relationship between the structure (tip shape and dimensions) and function (selectivity and rectification) of asymmetric nanopores on the basis of previous experimental studies. The theoretical model uses a continuum approach based on the Nernst-Planck equations. According to our results, the nanopore transport properties, such as current-voltage (I-V) characteristics, conductance, rectification ratio, and selectivity, are dictated mainly by the shape of the pore tip (we have distinguished bullet-like, conical, trumpet-like, and hybrid shapes) and the concentration of pore surface charges. As a consequence, the nanopore performance in practical applications will depend not only on the base and tip openings but also on the pore shape. In particular, we show that the pore opening dimensions estimated from the pore conductance can be very different, depending on the pore shape assumed. The results obtained can also be of practical relevance for the design of nanopores, nanopipettes, and nanoelectrodes, where the electrical interactions between the charges attached to the nanostructure and the mobile charges confined in the reduced volume of the inside solution dictate the device performance in practical applications. Because single tracks are the elementary building blocks for nanoporous membranes, the understanding and control of their individual properties should also be crucial in protein separation, water desalination, and bio-molecule detection using arrays of identical nanopores

Pore structure and function of synthetic nanopores with fixed charges: tip shape and rectification properties.

Science.gov (United States)

Ramírez, Patricio; Apel, Pavel Yu; Cervera, Javier; Mafé, Salvador

2008-08-06

We present a complete theoretical study of the relationship between the structure (tip shape and dimensions) and function (selectivity and rectification) of asymmetric nanopores on the basis of previous experimental studies. The theoretical model uses a continuum approach based on the Nernst-Planck equations. According to our results, the nanopore transport properties, such as current-voltage (I-V) characteristics, conductance, rectification ratio, and selectivity, are dictated mainly by the shape of the pore tip (we have distinguished bullet-like, conical, trumpet-like, and hybrid shapes) and the concentration of pore surface charges. As a consequence, the nanopore performance in practical applications will depend not only on the base and tip openings but also on the pore shape. In particular, we show that the pore opening dimensions estimated from the pore conductance can be very different, depending on the pore shape assumed. The results obtained can also be of practical relevance for the design of nanopores, nanopipettes, and nanoelectrodes, where the electrical interactions between the charges attached to the nanostructure and the mobile charges confined in the reduced volume of the inside solution dictate the device performance in practical applications. Because single tracks are the elementary building blocks for nanoporous membranes, the understanding and control of their individual properties should also be crucial in protein separation, water desalination, and bio-molecule detection using arrays of identical nanopores.

Iterated local search and record-to-record travel applied to the fixed charge transportation problem

DEFF Research Database (Denmark)

Andersen, Jeanne; Klose, Andreas

The fixed charge transportation problem (FCTP) is a well-known and difficult optimization problem with lots of applications in logistics. It consists in finding a minimum cost network flow from a set of suppliers to a set of customers. Beside costs proportional to quantities transported......, transportation costs do, however, include a fixed charge. Iterated local search and record-to-record travel are both simple local search based meta-heuristics that, to our knowledge, not yet have been applied to the FCTP. In this paper, we apply both types of search strategies and combine them into a single...

Analysis of charge transport in gels containing polyoxometallates using methods of different sensitivity to migration.

Science.gov (United States)

Caban, Karolina; Lewera, Adam; Zukowska, Grazyna Z; Kulesza, Pawel J; Stojek, Zbigniew; Jeffrey, Kenneth R

2006-08-04

Two methods have been used for examination of transport of charge in gels soaked with DMF and containing dissolved polyoxometallates. The first method is based on the analysis of both Cottrellian and steady-state currents and therefore is capable of giving the concentration of the electroactive redox centres and their transport (diffusion-type) coefficient. The second method provides the real diffusion coefficients, i.e. transport coefficients free of migrational influence, for both the substrate and the product of the electrode reaction. Several gels based on poly(methyl methacrylate), with charged (addition of 1-acrylamido-2-methyl-2-propanesulphonic acid to the polymerization mixture) and uncharged chains, have been used in the investigation. The ratio obtained for the diffusion coefficient (second method) and transport coefficient (first method) was smaller for the gels containing charged polymer chains than for the gels with uncharged chains. In part these changes could be explained by the contribution of migration to the transport of polyoxomatallates in the gels. However, the impact of the changes in the polymer-channel capacity at the electrode surface while the electrode process proceeds was also considered. These structural changes should affect differently the methods based on different time domains.

Transport properties of fission product vapors

International Nuclear Information System (INIS)

Im, K.H.; Ahluwalia, R.K.

1983-07-01

Kinetic theory of gases is used to calculate the transport properties of fission product vapors in a steam and hydrogen environment. Provided in tabular form is diffusivity of steam and hydrogen, viscosity and thermal conductivity of the gaseous mixture, and diffusivity of cesium iodide, cesium hydroxide, diatomic tellurium and tellurium dioxide. These transport properties are required in determining the thermal-hydraulics of and fission product transport in light water reactors

A reduced-cost iterated local search heuristic for the fixed-charge transportation problem

NARCIS (Netherlands)

Buson, Erika; Roberti, Roberto; Toth, Paolo

2014-01-01

The fixed-charge transportation problem (FCTP) is a generalization of the transportation problem where an additional fixed cost is paid for sending a flow from an origin to a destination. We propose an iterated local search heuristic based on the utilization of reduced costs for guiding the restart

Conformation sensitive charge transport in conjugated polymers

International Nuclear Information System (INIS)

Mattias Andersson, L.; Hedström, Svante; Persson, Petter

2013-01-01

Temperature dependent charge carrier mobility measurements using field effect transistors and density functional theory calculations are combined to show how the conformation dependent frontier orbital delocalization influences the hole- and electron mobilities in a donor-acceptor based polymer. A conformationally sensitive lowest unoccupied molecular orbital results in an electron mobility that decreases with increasing temperature above room temperature, while a conformationally stable highest occupied molecular orbital is consistent with a conventional hole mobility behavior and also proposed to be one of the reasons for why the material works well as a hole transporter in amorphous bulk heterojunction solar cells

Double path integral method for obtaining the mobility of the one-dimensional charge transport in molecular chain.

Science.gov (United States)

Yoo-Kong, Sikarin; Liewrian, Watchara

2015-12-01

We report on a theoretical investigation concerning the polaronic effect on the transport properties of a charge carrier in a one-dimensional molecular chain. Our technique is based on the Feynman's path integral approach. Analytical expressions for the frequency-dependent mobility and effective mass of the carrier are obtained as functions of electron-phonon coupling. The result exhibits the crossover from a nearly free particle to a heavily trapped particle. We find that the mobility depends on temperature and decreases exponentially with increasing temperature at low temperature. It exhibits large polaronic-like behaviour in the case of weak electron-phonon coupling. These results agree with the phase transition (A.S. Mishchenko et al., Phys. Rev. Lett. 114, 146401 (2015)) of transport phenomena related to polaron motion in the molecular chain.

Assessing the potential of different charging strategies for electric vehicle fleets in closed transport systems

International Nuclear Information System (INIS)

Schmidt, Johannes; Eisel, Matthias; Kolbe, Lutz M.

2014-01-01

A key reason for the low sales volumes of electric vehicles is their significantly higher purchasing price in comparison to conventional vehicles. However, various charging strategies can be applied to make these vehicles more profitable. In this paper, controlled charging concepts are transferred to commercial fleets operating in closed transport systems, as we found this field of application particularly well suited for the implementation of charging strategies. We analyzed data gathered in a field experiment conducted in a European port using electric vehicles in combination with a battery-swapping station to calculate the economic potentials of three charging scenarios: (1) optimizing energy procurement (2) trading load-shifting potential on control markets, and (3) a combination of the two. The findings indicate that all approaches are appropriate for reducing economic disadvantages of electric transport vehicles. Furthermore, we find that adjusting charging processes to avoid price peaks is more profitable than offering control reserve. Finally, focusing on the combination of both strategies seems to be most promising from an economic perspective. In this context, operational cost savings of more than 65% can be achieved compared to a similar dieselpowered vehicle when applying this strategy. - Highlights: • We model various charging strategies for electric transport vehicles. • The economic assessment is based on a field experiment with a port operator. • We consider the special market design of spot and ancillary service markets. • All charging strategies presented provide substantial cost-saving potentials. • Optimizing energy procurement is more profitable than offering control reserve

Anisotropic Transport and Magnetic Properties of Charge-Density-Wave Materials RSeTe_2 (R = La, Ce, Pr, Nd)

International Nuclear Information System (INIS)

Wang Pei-Pei; Long Yu-Jia; Zhao Ling-Xiao; Chen Dong; Xue Mian-Qi; Chen Gen-Fu

2015-01-01

Single crystals of RSeTe_2 (R = La, Ce, Pr, Nd) are synthesized using LiCl/RbCl flux. Transport and magnetic properties in the directions parallel and perpendicular to the a–c plane are investigated. We find that the resistivity anisotropy ρ_⊥/ρ_‖ lies in the range 486–615 for different compounds at 2 K, indicating the highly two-dimensional character. In both the orientations, the charge-density-wave transitions start near T_C_D_W = 284(3) K, 316(3) K, 359(3) K for NdSeTe_2, PrSeTe_2, CeSeTe_2, respectively, with a considerable increase in dc resistivity. While for LaSeTe_2, no obvious resistivity anomaly is observed up to 380 K. The value of T_C_D_W increases monotonically with the increasing lattice parameters. Below T_C_D_W, slight anomalies can be observed in NdSeTe_2, PrSeTe_2 and CeSeTe_2 with onset temperature at 193(3) K, 161(3) K, 108(3) K, respectively, decreasing as lattice parameters increase. Magnetic susceptibility measurements show that the valence state of rare earth ions are trivalence in these compounds. Antiferromagnetic-type magnetic order is formed in CeSeTe_2 at 2.1 K, while no magnetic transition is observed in PrSeTe_2 and NdSeTe_2 down to 1.8 K. (paper)

Nanostructured ZnO films: A study of molecular influence on transport properties by impedance spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Sappia, Luciano D.; Trujillo, Matias R. [Instituto Superior de Investigaciones Biológicas (INSIBIO), CONICET, Chacabuco 461, T4000ILI San Miguel de Tucumán (Argentina); Laboratorio de Medios e Interfases (LAMEIN), Departamento de Bioingeniería, Fac. de Cs. Exactas y Tecnología, Universidad Nacional de Tucumán, Av. Independencia 1800, 4000 San Miguel de Tucumán (Argentina); Lorite, Israel [Division of Superconductivity and Magnetism, Institute for Experimental Physics II, University of Leipzig, Linnéstrasse 5, 04103 Leipzig (Germany); Madrid, Rossana E., E-mail: rmadrid@herrera.unt.edu.ar [Instituto Superior de Investigaciones Biológicas (INSIBIO), CONICET, Chacabuco 461, T4000ILI San Miguel de Tucumán (Argentina); Laboratorio de Medios e Interfases (LAMEIN), Departamento de Bioingeniería, Fac. de Cs. Exactas y Tecnología, Universidad Nacional de Tucumán, Av. Independencia 1800, 4000 San Miguel de Tucumán (Argentina); Tirado, Monica [NanoProject and Laboratorio de Nanomateriales y Propiedades Dieléctricas, Departamento de Física, Universidad Nacional de Tucumán, Avenida Independencia 1800, Tucumán (Argentina); Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) (Argentina); and others

2015-10-15

Graphical abstract: - Highlights: • We study electrical transport in nanostructured ZnO films by impedance spectroscopy. • Bioaggregates on the surface produce strong changes in film transport properties. • This behavior is explained by modeling data with RC parallel circuits. • Electrical responses of ZnO films to aggregates are promising for biosensing. - Abstract: Nanomaterials based on ZnO have been used to build glucose sensors due to its high isoelectric point, which is important when a protein like Glucose Oxidase (GOx) is attached to a surface. It also creates a biologically friendly environment to preserve the activity of the enzyme. In this work we study the electrical transport properties of ZnO thin films (TFs) and single crystals (SC) in contact with different solutions by using impedance spectroscopy. We have found that the composition of the liquid, by means of the charge of the ions, produces strong changes in the transport properties of the TF. The enzyme GOx and phosphate buffer solutions have the major effect in the conduction through the films, which can be explained by the entrapment of carriers at the grain boundaries of the TFs. These results can help to design a new concept in glucose biosensing.

Two-Dimensional Spatial Imaging of Charge Transport in Germanium Crystals at Cryogenic Temperatures

Energy Technology Data Exchange (ETDEWEB)

Moffatt, Robert [Stanford Univ., CA (United States)

2016-03-01

In this dissertation, I describe a novel apparatus for studying the transport of charge in semiconductors at cryogenic temperatures. The motivation to conduct this experiment originated from an asymmetry observed between the behavior of electrons and holes in the germanium detector crystals used by the Cryogenic Dark Matter Search (CDMS). This asymmetry is a consequence of the anisotropic propagation of electrons in germanium at cryogenic temperatures. To better model our detectors, we incorporated this effect into our Monte Carlo simulations of charge transport. The purpose of the experiment described in this dissertation is to test those models in detail. Our measurements have allowed us to discover a shortcoming in our most recent Monte Carlo simulations of electrons in germanium. This discovery would not have been possible without the measurement of the full, two-dimensional charge distribution, which our experimental apparatus has allowed for the first time at cryogenic temperatures.

SLC injector simulation and tuning for high charge transport

International Nuclear Information System (INIS)

Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

1992-01-01

We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model. (Author) 5 figs., 7 refs

Charge transport in poly(p-phenylene vinylene) at low temperature and high electric field

NARCIS (Netherlands)

Katsouras, I.; Najafi, A.; Asadi, K.; Kronemeijer, A. J.; Oostra, A. J.; Koster, L. J. A.; de Leeuw, D. M.; Blom, P. W. M.

Charge transport in poly(2-methoxy, 5-(2'-ethyl-hexyloxy)-p-phenylene vinylene) (MEH-PPV)-based hole-only diodes is investigated at high electric fields and low temperatures using a novel diode architecture. Charge carrier densities that are in the range of those in a field-effect transistor are

Thermoelectric transport properties of high mobility organic semiconductors

Science.gov (United States)

Venkateshvaran, Deepak; Broch, Katharina; Warwick, Chris N.; Sirringhaus, Henning

2016-09-01

Transport in organic semiconductors has traditionally been investigated using measurements of the temperature and gate voltage dependent mobility of charge carriers within the channel of organic field-effect transistors (OFETs). In such measurements, the behavior of charge carrier mobility with temperature and gate voltage, studied together with carrier activation energies, provide a metric to quantify the extent of disorder within these van der Waals bonded materials. In addition to the mobility and activation energy, another potent but often-overlooked transport coefficient useful in understanding disorder is the Seebeck coefficient (also known as thermoelectric power). Fundamentally, the Seebeck coefficient represents the entropy per charge carrier in the solid state, and thus proves powerful in distinguishing materials in which charge carriers move freely from those where a high degree of disorder causes the induced carriers to remain trapped. This paper briefly covers the recent highlights in the field of organic thermoelectrics, showing how significant strides have been made both from an applied standpoint as well as from a viewpoint of fundamental thermoelectric transport physics. It shall be illustrated how thermoelectric transport parameters in organic semiconductors can be tuned over a significant range, and how this tunability facilitates an enhanced performance for heat-to-electricity conversion as well as quantifies energetic disorder and the nature of the density of states (DOS). The work of the authors shall be spotlighted in this context, illustrating how Seebeck coefficient measurements in the polymer indacenodithiophene-co-benzothiadiazole (IDTBT) known for its ultra-low degree of torsion within the polymer backbone, has a trend consistent with low disorder. 1 Finally, using examples of the small molecules C8-BTBT and C10-DNTT, it shall be discussed how the Seebeck coefficient can aid the estimation of the density and distribution of trap states

Blue Light Emitting Polyphenylene Dendrimers with Bipolar Charge Transport Moieties

Directory of Open Access Journals (Sweden)

Guang Zhang

2016-10-01

Full Text Available Two light-emitting polyphenylene dendrimers with both hole and electron transporting moieties were synthesized and characterized. Both molecules exhibited pure blue emission solely from the pyrene core and efficient surface-to-core energy transfers when characterized in a nonpolar environment. In particular, the carbazole- and oxadiazole-functionalized dendrimer (D1 manifested a pure blue emission from the pyrene core without showing intramolecular charge transfer (ICT in environments with increasing polarity. On the other hand, the triphenylamine- and oxadiazole-functionalized one (D2 displayed notable ICT with dual emission from both the core and an ICT state in highly polar solvents. D1, in a three-layer organic light emitting diode (OLED by solution processing gave a pure blue emission with Commission Internationale de l’Éclairage 1931 CIE xy = (0.16, 0.12, a peak current efficiency of 0.21 cd/A and a peak luminance of 2700 cd/m2. This represents the first reported pure blue dendrimer emitter with bipolar charge transport and surface-to-core energy transfer in OLEDs.

Blue Light Emitting Polyphenylene Dendrimers with Bipolar Charge Transport Moieties.

Science.gov (United States)

Zhang, Guang; Auer-Berger, Manuel; Gehrig, Dominik W; Blom, Paul W M; Baumgarten, Martin; Schollmeyer, Dieter; List-Kratochvil, E J W; Müllen, Klaus

2016-10-20

Two light-emitting polyphenylene dendrimers with both hole and electron transporting moieties were synthesized and characterized. Both molecules exhibited pure blue emission solely from the pyrene core and efficient surface-to-core energy transfers when characterized in a nonpolar environment. In particular, the carbazole- and oxadiazole-functionalized dendrimer ( D1 ) manifested a pure blue emission from the pyrene core without showing intramolecular charge transfer (ICT) in environments with increasing polarity. On the other hand, the triphenylamine- and oxadiazole-functionalized one ( D2 ) displayed notable ICT with dual emission from both the core and an ICT state in highly polar solvents. D1 , in a three-layer organic light emitting diode (OLED) by solution processing gave a pure blue emission with Commission Internationale de l'Éclairage 1931 CIE xy = (0.16, 0.12), a peak current efficiency of 0.21 cd/A and a peak luminance of 2700 cd/m². This represents the first reported pure blue dendrimer emitter with bipolar charge transport and surface-to-core energy transfer in OLEDs.

Long-range charge transport in single G-quadruplex DNA molecules

DEFF Research Database (Denmark)

Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

2014-01-01

DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

Structural, electronic transport and optical properties of functionalized quasi-2D TiC{sub 2} from first-principles calculations

Energy Technology Data Exchange (ETDEWEB)

Berdiyorov, G.R., E-mail: gberdiyorov@qf.org.qa; Madjet, M.E., E-mail: mmadjet@qf.org.qa

2016-12-30

Highlights: • Effect of surface termination on the optoelectronic properties of TiC{sub 2} is studied. • Fluorinated, oxidized and hydroxylated surfaces are considered. • Partial charges are calculated. • Absorption of the system increases by surface passivation. • Electronic transport reduces considerably due to the termination. - Abstract: Using the first-principles density functional theory, we study the effect of surface functionalization on the structural and optoelectronic properties of recently proposed quasi-two-dimensional material TiC{sub 2} [T. Zhao, S. Zhang, Y. Guo, Q. Wang, Nanoscale 8 (2016) 233]. Hydrogenated, fluorinated, oxidized and hydroxylated surfaces are considered. Significant changes in the lattice parameters and partial charge distributions are found due to the surface termination. Direct contribution of the adatoms to the system density of states near the Fermi level is obtained, which has a major impact on the optoelectronic properties of the material. For example, surface termination results in larger absorption in the visible range of the spectrum. The electronic transport is also affected by the surface functionalization: the current in the system can be reduced by an order of magnitude. These findings indicate the importance of the effects of surface passivation on optoelectronic properties of this quasi-2D material.

SLC injector simulation and tuning for high charge transport

International Nuclear Information System (INIS)

Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

1992-08-01

We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional ray-trace code with a two-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model

Molecular structure, photoluminescent and electroluminescent properties of bis(2-(4-methyl-2-hydroxyphenyl)benzothiazolate) zinc with excellent electron-transport characteristics

International Nuclear Information System (INIS)

Xu Huixia; Xu Bingshe; Fang Xiaohong; Yue Yan; Chen Liuqing; Wang Hua; Hao Yuying

2011-01-01

Highlights: → The synthesis, crystal structure and photophysical properties of Zn(4-MeBTZ) 2 were reported. → The electron-transport property was investigated by theoretical calculations and experimental. → We found that Zn(4-MeBTZ) 2 has a higher electron mobility than that of [Zn(BTZ) 2 ] 2 and the devices based on it have a lower turn-on voltage. - Abstract: In this article, the molecular structure, photoluminescent and electroluminescent properties of bis(2-(4-methyl-2-hydroxyphenyl) benzothiazolate) zinc (Zn(4-MeBTZ) 2 ) with good electron-transport characteristics were reported. This complex was identified as triclinic structure with the strong intermolecular π-π stacking interactions between the benzothiazolate/phenoxido rings and weak intramolecular hydrogen bonds by X-ray single-crystal diffraction. Quantum chemical method has been employed to investigate electron structure and charge transport property. The blue-green light emission was observed by fabricating double-layer devices using Zn(4-MeBTZ) 2 as electron-transport and NPB as hole-transport material. The performance of organic light-emitting devices based on Zn(4-MeBTZ) 2 is much better than that of the devices based on [Zn(BTZ) 2 ] 2 .

Theory of high-resolution tunneling spin transport on a magnetic skyrmion

Science.gov (United States)

Palotás, Krisztián; Rózsa, Levente; Szunyogh, László

2018-05-01

Tunneling spin transport characteristics of a magnetic skyrmion are described theoretically in magnetic scanning tunneling microscopy (STM). The spin-polarized charge current in STM (SP-STM) and tunneling spin transport vector quantities, the longitudinal spin current and the spin transfer torque, are calculated in high spatial resolution within the same theoretical framework. A connection between the conventional charge current SP-STM image contrasts and the magnitudes of the spin transport vectors is demonstrated that enables the estimation of tunneling spin transport properties based on experimentally measured SP-STM images. A considerable tunability of the spin transport vectors by the involved spin polarizations is also highlighted. These possibilities and the combined theory of tunneling charge and vector spin transport pave the way for gaining deep insight into electric-current-induced tunneling spin transport properties in SP-STM and to the related dynamics of complex magnetic textures at surfaces.

Capturing the effect of [PF3(C2F5)3]-vs. [PF6]-, flexible anion vs. rigid, and scaled charge vs. unit on the transport properties of [bmim]+-based ionic liquids: a comparative MD study.

Science.gov (United States)

Kowsari, Mohammad H; Ebrahimi, Soraya

2018-05-16

Comprehensive molecular dynamics simulations are performed to study the average single-particle dynamics and the transport properties of 1-butyl-3-methylimidazolium hexafluorophosphate, [bmim][PF6], and 1-butyl-3-methylimidazolium tris(pentafluoroethyl)trifluorophosphate, [bmim][FAP], ionic liquids (ILs) at 400 K. We applied one of the most widely used nonpolarizable all-atom force fields for ILs, both with the original unit (±1) charges on each ion and with the partial charges uniformly scaled to 80-85%, taking into account the average polarizability and tracing the experimentally compatible transport properties. In all simulations, [bmim]+ was considered to be flexible, while the effect of a flexible vs. rigid structure of the anions and the effect of two applied charge sets on the calculated properties were separately investigated in detail. The simulation results showed that replacing [PF6]- with [FAP]-, considering anion flexibility, and applying the charge-scaled model significantly enhanced the ionic self-diffusion, ionic conductivity, inverse viscosity, and hyper anion preference (HAP). Both of the calculated self-diffusion coefficients from the long-time linear slope of the mean-square displacement (MSD) and from the integration of the velocity autocorrelation function (VACF) for the centers of mass of the ions were used for evaluation of the ionic transference number, HAP, ideal Nernst-Einstein ionic conductivity (σNE), and the Stokes-Einstein viscosity. In addition, for quantification of the degree of complicated ionic association (known as the Nernst-Einstein deviation parameter, Δ) and ionicity phenomena in the two studied ILs, the ionic conductivity was determined more rigorously by the Green-Kubo integral of the electric-current autocorrelation function (ECACF), and then the σGK/σNE ratio was evaluated. It was found that the correlated motion of the (cationanion) neighbors in [bmim][FAP] is smaller than in [bmim][PF6]. The relaxation times of

Relationship between defect density and charge carrier transport in amorphous and microcrystalline silicon

International Nuclear Information System (INIS)

Astakhov, Oleksandr; Carius, Reinhard; Finger, Friedhelm; Petrusenko, Yuri; Borysenko, Valery; Barankov, Dmytro

2009-01-01

The influence of dangling-bond defects and the position of the Fermi level on the charge carrier transport properties in undoped and phosphorous doped thin-film silicon with structure compositions all the way from highly crystalline to amorphous is investigated. The dangling-bond density is varied reproducibly over several orders of magnitude by electron bombardment and subsequent annealing. The defects are investigated by electron-spin-resonance and photoconductivity spectroscopies. Comparing intrinsic amorphous and microcrystalline silicon, it is found that the relationship between defect density and photoconductivity is different in both undoped materials, while a similar strong influence of the position of the Fermi level on photoconductivity via the charge carrier lifetime is found in the doped materials. The latter allows a quantitative determination of the value of the transport gap energy in microcrystalline silicon. The photoconductivity in intrinsic microcrystalline silicon is, on one hand, considerably less affected by the bombardment but, on the other hand, does not generally recover with annealing of the defects and is independent from the spin density which itself can be annealed back to the as-deposited level. For amorphous silicon and material prepared close to the crystalline growth regime, the results for nonequilibrium transport fit perfectly to a recombination model based on direct capture into neutral dangling bonds over a wide range of defect densities. For the heterogeneous microcrystalline silicon, this model fails completely. The application of photoconductivity spectroscopy in the constant photocurrent mode (CPM) is explored for the entire structure composition range over a wide variation in defect densities. For amorphous silicon previously reported linear correlation between the spin density and the subgap absorption is confirmed for defect densities below 10 18 cm -3 . Beyond this defect level, a sublinear relation is found i.e., not

Thickness dependent charge transport in ferroelectric BaTiO3 heterojunctions

Science.gov (United States)

Singh, Pooja; Rout, P. K.; Singh, Manju; Rakshit, R. K.; Dogra, Anjana

2015-09-01

We have investigated the effect of ferroelectric barium titanate (BaTiO3) film thickness on the charge transport mechanism in pulsed laser deposited epitaxial metal-ferroelectric semiconductor junctions. The current (I)-voltage (V) measurements across the junctions comprising of 20-500 nm thick BaTiO3 and conducting bottom electrode (Nb: SrTiO3 substrate or La2/3Ca1/3MnO3 buffer layer) demonstrate the space charge limited conduction. Further analysis indicates a reduction in the ratio of free to trapped carriers with increasing thickness in spite of decreasing trap density. Such behaviour arises the deepening of the shallow trap levels (I-V curves implies a bipolar resistive switching behaviour, which can be explained in terms of charge trapping and de-trapping process.

Stochastic approach and fluctuation theorem for charge transport in diodes

Science.gov (United States)

Gu, Jiayin; Gaspard, Pierre

2018-05-01

A stochastic approach for charge transport in diodes is developed in consistency with the laws of electricity, thermodynamics, and microreversibility. In this approach, the electron and hole densities are ruled by diffusion-reaction stochastic partial differential equations and the electric field generated by the charges is determined with the Poisson equation. These equations are discretized in space for the numerical simulations of the mean density profiles, the mean electric potential, and the current-voltage characteristics. Moreover, the full counting statistics of the carrier current and the measured total current including the contribution of the displacement current are investigated. On the basis of local detailed balance, the fluctuation theorem is shown to hold for both currents.

Adaptive tree multigrids and simplified spherical harmonics approximation in deterministic neutral and charged particle transport

International Nuclear Information System (INIS)

Kotiluoto, P.

2007-05-01

A new deterministic three-dimensional neutral and charged particle transport code, MultiTrans, has been developed. In the novel approach, the adaptive tree multigrid technique is used in conjunction with simplified spherical harmonics approximation of the Boltzmann transport equation. The development of the new radiation transport code started in the framework of the Finnish boron neutron capture therapy (BNCT) project. Since the application of the MultiTrans code to BNCT dose planning problems, the testing and development of the MultiTrans code has continued in conventional radiotherapy and reactor physics applications. In this thesis, an overview of different numerical radiation transport methods is first given. Special features of the simplified spherical harmonics method and the adaptive tree multigrid technique are then reviewed. The usefulness of the new MultiTrans code has been indicated by verifying and validating the code performance for different types of neutral and charged particle transport problems, reported in separate publications. (orig.)

Mass and charge transport in micro and nanofluidic channels

DEFF Research Database (Denmark)

Mortensen, Niels Asger; Olesen, Laurits Højgaard; Okkels, Fridolin

2007-01-01

and charge transport coefficients that satisfy Onsager relations. In the limit of nonoverlapping Debye layers the transport coefficients are simply expressed in terms of parameters of the electrolyte as well as the hydraulic radiusR ¼ 2A=P with Aand P being the cross-sectional area and perimeter......, respectively. In particular, we consider the limits of thin nonoverlapping as well as strongly overlapping Debye layers, respectively, and calculate the corrections to the hydraulic resistance due to electrohydrodynamic interactions.......We consider laminar flow of incompressible electrolytes in long, straight channels driven by pressure and electroosmosis. We use aHilbert space eigenfunction expansion to address the general problem of an arbitrary cross section and obtain general results in linear-response theory for the mass...

Charge-order driven multiferroic and magneto-dielectric properties of rare earth manganates

International Nuclear Information System (INIS)

Serrao, Claudy Rayan; Sahu, Jyoti Ranjan; Ghosh, Anirban

2010-01-01

Charge-order driven magnetic ferroelectricity is shown to occur in several rare earth manganates of the general formula, Ln 1-x A x MnO 3 (Ln rare earth, A = alkaline earth). Charge-ordered manganates exhibit dielectric constant anomalies around the charge-ordering or the antiferromagnetic transition temperature. Magnetic fields have a marked effect on the dielectric properties of these compounds, indicating the presence of coupling between the magnetic and electrical order parameters. Magneto-dielectric properties are retained in small particles of the manganates. The observation of magneto-ferroelectricity in these manganates is in accordance with theoretical predictions. (author)

The electric charge of the aerosols under gamma radiation; La charge electrique des aerosols sous irradiation gamma

Energy Technology Data Exchange (ETDEWEB)

Gensdarmes, F.; Cetier, P.; Boulaud, D. [CEA/Saclay, Inst. de Protection et de Surete Nucleaire, IPSN/DPEA/SERAC, 91 - Gif-sur-Yvette (France); Renoux, A. [Paris-12 Univ., Lab. de Physique des Aerosols et de Transfert des Contaminations, 94 - Creteil (France)

2000-07-01

During a PWR type reactor accident, the gamma radiation may create a high ionized atmosphere. In such a situation the aerosols properties knowledge is useful to simulate the particles transport and deposit in the enclosed. The aim of this study is to determine the aerosol charges distribution in a high ionized medium, in function of the ionic properties of the medium. (A.L.B.)

Charge transport kinetics in a robust radical-substituted polymer/nanocarbon composite electrode

Science.gov (United States)

Sato, Kan; Oyaizu, Kenichi; Nishide, Hiroyuki

We have reported a series of organic radical-substituted polymers as new-type charge storage and transport materials which could be used for energy related devices such as batteries and solar cells. Redox-active radical moieties introduced to the non-conjugated polymer backbones enable the rapid electron transfer among the adjacent radical sites, and thus large diffusive flux of electrical charge at a bulk scale. Here we present the elucidated charge transport kinetics in a radical polymer/single-walled carbon nanotube (SWNT) composite electrode. The synergetic effect of electrical conduction by a three-dimensional SWNT network and electron self-exchange reaction by radical polymers contributed to the 105-fold (per 1 g of added SWNT) boosting of electrochemical reactions and exceptionally large current density (greater than 1 A/cm2) as a rechargeable electrode. A totally organic-based secondary battery with a submicron thickness was fabricated to demonstrate the splendid electrochemical performances. Grants-in-Aid for Scientific Research (No. 24225003, 15J00888) and the Leading Graduate Program in Science and Engineering, from the Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT).

Charge transport in disordered organic host-guest systems: effects of carrier density and electric field

NARCIS (Netherlands)

Yimer, Y.Y.; Bobbert, P.A.; Coehoorn, R.

2008-01-01

We investigate charge transport in disordered organic host–guest systems with a bimodal Gaussian density of states (DOS). The energy difference between the two Gaussians defines the trap depth. By solving the Pauli master equation for the hopping of charge carriers on a regular lattice with site

Transition from direct to inverted charge transport Marcus regions in molecular junctions via molecular orbital gating

Science.gov (United States)

Yuan, Li; Wang, Lejia; Garrigues, Alvar R.; Jiang, Li; Annadata, Harshini Venkata; Anguera Antonana, Marta; Barco, Enrique; Nijhuis, Christian A.

2018-04-01

Solid-state molecular tunnel junctions are often assumed to operate in the Landauer regime, which describes essentially activationless coherent tunnelling processes. In solution, on the other hand, charge transfer is described by Marcus theory, which accounts for thermally activated processes. In practice, however, thermally activated transport phenomena are frequently observed also in solid-state molecular junctions but remain poorly understood. Here, we show experimentally the transition from the Marcus to the inverted Marcus region in a solid-state molecular tunnel junction by means of intra-molecular orbital gating that can be tuned via the chemical structure of the molecule and applied bias. In the inverted Marcus region, charge transport is incoherent, yet virtually independent of temperature. Our experimental results fit well to a theoretical model that combines Landauer and Marcus theories and may have implications for the interpretation of temperature-dependent charge transport measurements in molecular junctions.

Unraveling Unprecedented Charge Carrier Mobility through Structure Property Relationship of Four Isomers of Didodecyl[1]benzothieno[3,2-b][1]benzothiophene.

Science.gov (United States)

Tsutsui, Yusuke; Schweicher, Guillaume; Chattopadhyay, Basab; Sakurai, Tsuneaki; Arlin, Jean-Baptiste; Ruzié, Christian; Aliev, Almaz; Ciesielski, Artur; Colella, Silvia; Kennedy, Alan R; Lemaur, Vincent; Olivier, Yoann; Hadji, Rachid; Sanguinet, Lionel; Castet, Frédéric; Osella, Silvio; Dudenko, Dmytro; Beljonne, David; Cornil, Jérôme; Samorì, Paolo; Seki, Shu; Geerts, Yves H

2016-09-01

The structural and electronic properties of four isomers of didodecyl[1]-benzothieno[3,2-b][1]benzothiophene (C12-BTBT) have been investigated. Results show the strong impact of the molecular packing on charge carrier transport and electronic polarization properties. Field-induced time-resolved microwave conductivity measurements unravel an unprecedented high average interfacial mobility of 170 cm(2) V(-1) s(-1) for the 2,7-isomer, holding great promise for the field of organic electronics. © 2016 The Authors. Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Experimental study on the supercritical startup and heat transport capability of a neon-charged cryogenic loop heat pipe

International Nuclear Information System (INIS)

Guo, Yuandong; Lin, Guiping; He, Jiang; Bai, Lizhan; Zhang, Hongxing; Miao, Jianyin

2017-01-01

Highlights: • A neon-charged CLHP integrated with a G-M cryocooler was designed and investigated. • The CLHP can realize the supercritical startup with an auxiliary heat load of 1.5 W. • Maximum heat transport capability of the CLHP was 4.5 W over a distance of 0.6 m. • There existed an optimum auxiliary heat load to expedite the supercritical startup. • There existed an optimum charged pressure to reach the largest heat transfer limit. - Abstract: Neon-charged cryogenic loop heat pipe (CLHP) can realize efficient cryogenic heat transport in the temperature range of 30–40 K, and promises great application potential in the thermal control of future space infrared exploration system. In this work, extensive experimental studies on the supercritical startup and heat transport capability of a neon-charged CLHP integrated with a G-M cryocooler were carried out, where the effects of the auxiliary heat load applied to the secondary evaporator and charged pressure of the working fluid were investigated. Experimental results showed that the CLHP could successfully realize the supercritical startup with an auxiliary heat load of 1.5 W, and there existed an optimum auxiliary heat load and charged pressure of the working fluid respectively, to achieve the maximum temperature drop rate of the primary evaporator during the supercritical startup. The CLHP could reach a maximum heat transport capability of 4.5 W over a distance of 0.6 m corresponding to the optimum charged pressure of the working fluid; however, the heat transport capability decreased with the increase of the auxiliary heat load. Furthermore, the inherent mechanisms responsible for the phenomena observed in the experiments were analyzed and discussed, to provide a better understanding from the theoretical view.

Effect of backbone structure on charge transport along isolated conjugated polymer chains

International Nuclear Information System (INIS)

Siebbeles, Laurens D.A.; Grozema, Ferdinand C.; Haas, Matthijs P. de; Warman, John M.

2005-01-01

Fast charge transport in conjugated polymers is essential for their application in opto-electronic devices. In the present paper, measurements and theoretical modeling of the mobility of excess charges along isolated chains of conjugated polymers in dilute solution are presented. Charge carriers were produced by irradiation of the polymer solution with 3-MeV electrons from a Van de Graaff accelerator. The mobilities of the charges along the polymer chains were obtained from time-resolved microwave conductivity measurements. The mobilities are strongly dependent on the chemical nature of the polymer backbone. Comparison of the experimental data with results from ab initio quantum mechanical calculations shows that the measured mobilities are strongly limited by torsional disorder, chemical defects and chain ends. Improvement of the structure of polymer backbones is therefore expected to significantly enhance the performance of these materials in 'plastic electronics'

Description of bipolar charge transport in polyethylene using a fluid model with a constant mobility: model prediction

International Nuclear Information System (INIS)

Le Roy, S; Segur, P; Teyssedre, G; Laurent, C

2004-01-01

We present a conduction model aimed at describing bipolar transport and space charge phenomena in low density polyethylene under dc stress. In the first part we recall the basic requirements for the description of charge transport and charge storage in disordered media with emphasis on the case of polyethylene. A quick review of available conduction models is presented and our approach is compared with these models. Then, the bases of the model are described and related assumptions are discussed. Finally, results on external current, trapped and free space charge distributions, field distribution and recombination rate are presented and discussed, considering a constant dc voltage, a step-increase of the voltage, and a polarization-depolarization protocol for the applied voltage. It is shown that the model is able to describe the general features reported for external current, electroluminescence and charge distribution in polyethylene

Low-Energy Electron Potentiometry: Contactless Imaging of Charge Transport on the Nanoscale.

Science.gov (United States)

Kautz, J; Jobst, J; Sorger, C; Tromp, R M; Weber, H B; van der Molen, S J

2015-09-04

Charge transport measurements form an essential tool in condensed matter physics. The usual approach is to contact a sample by two or four probes, measure the resistance and derive the resistivity, assuming homogeneity within the sample. A more thorough understanding, however, requires knowledge of local resistivity variations. Spatially resolved information is particularly important when studying novel materials like topological insulators, where the current is localized at the edges, or quasi-two-dimensional (2D) systems, where small-scale variations can determine global properties. Here, we demonstrate a new method to determine spatially-resolved voltage maps of current-carrying samples. This technique is based on low-energy electron microscopy (LEEM) and is therefore quick and non-invasive. It makes use of resonance-induced contrast, which strongly depends on the local potential. We demonstrate our method using single to triple layer graphene. However, it is straightforwardly extendable to other quasi-2D systems, most prominently to the upcoming class of layered van der Waals materials.

Charge transport in disordered organic host-guest systems: effects of carrier density and electric field

NARCIS (Netherlands)

Yimer, Y.Y.; Bobbert, P.A.; Coehoorn, R.

2009-01-01

We investigate charge transport in disordered organic host–guest systems with a bimodal Gaussian density of states. The energy difference between the peaks of the two Gaussians defines the trap depth. By solving the Pauli master equation for the hopping of charge carriers on a regular lattice we

Study of static properties of magnetron-type space charges

International Nuclear Information System (INIS)

Delcroix, Jean-Loup

1953-01-01

This research thesis reports an in-depth analysis of physical properties of static regimes to address the issue of space charges. This theoretical study of the Hull magnetron is followed by the description of experiments on the Hull magnetron which highlight transitions between the different regimes. Then, another theoretical approach aims at generalising the magnetron theory, based on other types of magnetron theory (general equations of magnetron-type space charges, inverted Hull magnetron theory, circular field magnetron theory)

Coulombic interactions and multicomponent ionic dispersion during transport of charged species in heterogeneous porous media

DEFF Research Database (Denmark)

Muniruzzaman, Muhammad; Rolle, Massimo

Electrochemical cross-coupling plays a significant role for transport of charged species in porous media [1, 2]. In this study we performed flow-through experiments in a quasi two-dimensional setup using dilute solutions of strong electrolytes to study the influence of charge interactions on mass...... occurred. To quantitatively interpret the outcomes of our laboratory experiments in the spatially variable flow fields we developed a two dimensional numerical model based on a multicomponent formulation, on charge conservation and on the accurate description of transverse dispersion. The results...... of the multicomponent transport simulations were compared with the high-resolution (5 mm spacing) concentration measurements of the ionic species at the outlet of the flow-through domain. The excellent agreement between the measured concentrations and the results of purely forward numerical simulations demonstrates...

SUPRATHERMAL ELECTRONS IN THE SOLAR CORONA: CAN NONLOCAL TRANSPORT EXPLAIN HELIOSPHERIC CHARGE STATES?

International Nuclear Information System (INIS)

Cranmer, Steven R.

2014-01-01

There have been several ideas proposed to explain how the Sun's corona is heated and how the solar wind is accelerated. Some models assume that open magnetic field lines are heated by Alfvén waves driven by photospheric motions and dissipated after undergoing a turbulent cascade. Other models posit that much of the solar wind's mass and energy is injected via magnetic reconnection from closed coronal loops. The latter idea is motivated by observations of reconnecting jets and also by similarities of ion composition between closed loops and the slow wind. Wave/turbulence models have also succeeded in reproducing observed trends in ion composition signatures versus wind speed. However, the absolute values of the charge-state ratios predicted by those models tended to be too low in comparison with observations. This Letter refines these predictions by taking better account of weak Coulomb collisions for coronal electrons, whose thermodynamic properties determine the ion charge states in the low corona. A perturbative description of nonlocal electron transport is applied to an existing set of wave/turbulence models. The resulting electron velocity distributions in the low corona exhibit mild suprathermal tails characterized by ''kappa'' exponents between 10 and 25. These suprathermal electrons are found to be sufficiently energetic to enhance the charge states of oxygen ions, while maintaining the same relative trend with wind speed that was found when the distribution was assumed to be Maxwellian. The updated wave/turbulence models are in excellent agreement with solar wind ion composition measurements

Design study of low-energy beam transport for multi-charge beams at RAON

Science.gov (United States)

Bahng, Jungbae; Qiang, Ji; Kim, Eun-San

2015-12-01

The Rare isotope Accelerator Of Newness (RAON) at the Rare Isotope Science Project (RISP) is being designed to simultaneously accelerate beams with multiple charge states. It includes a driver superconducting (SC) linac for producing 200 MeV/u and 400 kW continuous wave (CW) heavy ion beams from protons to uranium. The RAON consists of a few electron cyclotron resonance ion sources, a low-energy beam transport (LEBT) system, a CW 81.25 MHz, 500 keV/u radio frequency quadrupole (RFQ) accelerator, a medium-energy beam transport system, the SC linac, and a charge-stripper system. The LEBT system for the RISP accelerator facility consists of a high-voltage platform, two 90° dipoles, a multi-harmonic buncher (MHB), solenoids, electrostatic quadrupoles, a velocity equalizer, and a diagnostic system. The ECR ion sources are located on a high-voltage platform to reach an initial beam energy of 10 keV/u. After extraction, the ion beam is transported through the LEBT system to the RFQ accelerator. The generated charge states are selected by an achromatic bending system and then bunched by the MHB in the LEBT system. The MHB is used to achieve a small longitudinal emittance in the RFQ by generating a sawtooth wave with three harmonics. In this paper, we present the results and issues of the beam dynamics of the LEBT system.

Design study of low-energy beam transport for multi-charge beams at RAON

Energy Technology Data Exchange (ETDEWEB)

Bahng, Jungbae [Department of Physics, Kyungpook National University, Daegu 41566 (Korea, Republic of); Qiang, Ji [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Kim, Eun-San, E-mail: eskim1@korea.ac.kr [Department of Accelerator Science, Graduate School, Korea University Sejong Campus, Sejong 30019 (Korea, Republic of)

2015-12-21

The Rare isotope Accelerator Of Newness (RAON) at the Rare Isotope Science Project (RISP) is being designed to simultaneously accelerate beams with multiple charge states. It includes a driver superconducting (SC) linac for producing 200 MeV/u and 400 kW continuous wave (CW) heavy ion beams from protons to uranium. The RAON consists of a few electron cyclotron resonance ion sources, a low-energy beam transport (LEBT) system, a CW 81.25 MHz, 500 keV/u radio frequency quadrupole (RFQ) accelerator, a medium-energy beam transport system, the SC linac, and a charge-stripper system. The LEBT system for the RISP accelerator facility consists of a high-voltage platform, two 90° dipoles, a multi-harmonic buncher (MHB), solenoids, electrostatic quadrupoles, a velocity equalizer, and a diagnostic system. The ECR ion sources are located on a high-voltage platform to reach an initial beam energy of 10 keV/u. After extraction, the ion beam is transported through the LEBT system to the RFQ accelerator. The generated charge states are selected by an achromatic bending system and then bunched by the MHB in the LEBT system. The MHB is used to achieve a small longitudinal emittance in the RFQ by generating a sawtooth wave with three harmonics. In this paper, we present the results and issues of the beam dynamics of the LEBT system.

Electronic transport properties of nanostructured MnSi-films

Science.gov (United States)

Schroeter, D.; Steinki, N.; Scarioni, A. Fernández; Schumacher, H. W.; Süllow, S.; Menzel, D.

2018-05-01

MnSi, which crystallizes in the cubic B20 structure, shows intriguing magnetic properties involving the existence of skyrmions in the magnetic phase diagram. Bulk MnSi has been intensively investigated and thoroughly characterized, in contrast to MnSi thin film, which exhibits widely varying properties in particular with respect to electronic transport. In this situation, we have set out to reinvestigate the transport properties in MnSi thin films by means of studying nanostructure samples. In particular, Hall geometry nanostructures were produced to determine the intrinsic transport properties.

Theory of thermal and charge transport in diffusive normal metal / superconductor junctions

NARCIS (Netherlands)

Yokoyama, T.; Tanaka, Y.; Golubov, Alexandre Avraamovitch; Asano, Y.

2005-01-01

Thermal and charge transport in diffusive normal metal (DN)/insulator/s-, d-, and p-wave superconductor junctions are studied based on the Usadel equation with the Nazarov's generalized boundary condition. We derive a general expression of the thermal conductance in unconventional superconducting

TRANSPORT: a computer program for designing charged particle beam transport systems

International Nuclear Information System (INIS)

Brown, K.L.; Rothacker, F.; Carey, D.C.; Iselin, C.

1977-05-01

TRANSPORT is a first- and second-order matrix multiplication computer program intended for the design of static-magnetic beam transport systems. It has been in existence in various evolutionary versions since 1963. The present version, described in the manual given, includes both first- and second-order fitting capabilities. TRANSPORT will step through the beam line, element by element, calculating the properties of the beam or other quantities, described below, where requested. Therefore one of the first elements is a specification of the phase space region occupied by the beam entering the system. Magnets and intervening spaces and other elements then follow in the sequence in which they occur in the beam line. Specifications of calculations to be done or of configurations other than normal are placed in the same sequence, at the point where their effect is to be made

Charge transport mechanism in p-type copper ion containing triazine thiolate metallopolymer thin film devices

Science.gov (United States)

K, Deepak; Roy, Amit; Anjaneyulu, P.; Kandaiah, Sakthivel; Pinjare, Sampatrao L.

2017-10-01

The charge transport mechanism in copper ions containing 1,3,5-Triazine-2,4,6-trithiolate (CuTCA) based polymer device in sandwich (Ag/CuTCA/Cu) geometry is studied. The current-voltage (I-V) characteristics of the metallopolymer CuTCA device have shown a transition in the charge transport mechanism from Ohmic to Space-charge limited conduction when temperature and voltage are varied. The carriers in CuTCA devices exhibit hopping transport, in which carriers hop from one site to the other. The hole mobility in this polymer device is found to be dependent on electric field E ( μpα√{E } ) and temperature, which suggests that the polymer has inherent disorder. The electric-field coefficient γ and zero-field mobility μ0 are temperature dependent. The values of mobility and activation energies are estimated from temperature (90-140 K) dependent charge transport studies and found to be in the range of 1 × 10-11-8 × 10-12 m2/(V s) and 16.5 meV, respectively. Temperature dependent electric-field coefficient γ is in the order of 17.8 × 10-4 (m/V)1/2, and the value of zero-field mobility μ0 is in the order of 1.2 × 10-11 m2/(V s) at 140 K. A constant phase element (Q) is used to model the device parameters, which are extracted using the Impedance spectroscopy technique. The bandgap of the polymer is estimated to be 2.6 eV from UV-Vis reflectance spectra.

Scientific Computation Application Partnerships in Materials and Chemical Sciences, Charge Transfer and Charge Transport in Photoactivated Systems, Developing Electron-Correlated Methods for Excited State Structure and Dynamics in the NWChem Software Suite

Energy Technology Data Exchange (ETDEWEB)

Cramer, Christopher J. [Univ. of Minnesota, Minneapolis, MN (United States)

2017-11-12

Charge transfer and charge transport in photoactivated systems are fundamental processes that underlie solar energy capture, solar energy conversion, and photoactivated catalysis, both organometallic and enzymatic. We developed methods, algorithms, and software tools needed for reliable treatment of the underlying physics for charge transfer and charge transport, an undertaking with broad applicability to the goals of the fundamental-interaction component of the Department of Energy Office of Basic Energy Sciences and the exascale initiative of the Office of Advanced Scientific Computing Research.

Interface-Engineered Charge-Transport Properties in Benzenedithiol Molecular Electronic Junctions via Chemically p-Doped Graphene Electrodes.

Science.gov (United States)

Jang, Yeonsik; Kwon, Sung-Joo; Shin, Jaeho; Jeong, Hyunhak; Hwang, Wang-Taek; Kim, Junwoo; Koo, Jeongmin; Ko, Taeg Yeoung; Ryu, Sunmin; Wang, Gunuk; Lee, Tae-Woo; Lee, Takhee

2017-12-06

In this study, we fabricated and characterized vertical molecular junctions consisting of self-assembled monolayers of benzenedithiol (BDT) with a p-doped multilayer graphene electrode. The p-type doping of a graphene film was performed by treating pristine graphene (work function of ∼4.40 eV) with trifluoromethanesulfonic (TFMS) acid, producing a significantly increased work function (∼5.23 eV). The p-doped graphene-electrode molecular junctions statistically showed an order of magnitude higher current density and a lower charge injection barrier height than those of the pristine graphene-electrode molecular junctions, as a result of interface engineering. This enhancement is due to the increased work function of the TFMS-treated p-doped graphene electrode in the highest occupied molecular orbital-mediated tunneling molecular junctions. The validity of these results was proven by a theoretical analysis based on a coherent transport model that considers asymmetric couplings at the electrode-molecule interfaces.

An Electronic Structure Approach to Charge Transfer and Transport in Molecular Building Blocks for Organic Optoelectronics

Science.gov (United States)

Hendrickson, Heidi Phillips

A fundamental understanding of charge separation in organic materials is necessary for the rational design of optoelectronic devices suited for renewable energy applications and requires a combination of theoretical, computational, and experimental methods. Density functional theory (DFT) and time-dependent (TD)DFT are cost effective ab-initio approaches for calculating fundamental properties of large molecular systems, however conventional DFT methods have been known to fail in accurately characterizing frontier orbital gaps and charge transfer states in molecular systems. In this dissertation, these shortcomings are addressed by implementing an optimally-tuned range-separated hybrid (OT-RSH) functional approach within DFT and TDDFT. The first part of this thesis presents the way in which RSH-DFT addresses the shortcomings in conventional DFT. Environmentally-corrected RSH-DFT frontier orbital energies are shown to correspond to thin film measurements for a set of organic semiconducting molecules. Likewise, the improved RSH-TDDFT description of charge transfer excitations is benchmarked using a model ethene dimer and silsesquioxane molecules. In the second part of this thesis, RSH-DFT is applied to chromophore-functionalized silsesquioxanes, which are currently investigated as candidates for building blocks in optoelectronic applications. RSH-DFT provides insight into the nature of absorptive and emissive states in silsesquioxanes. While absorption primarily involves transitions localized on one chromophore, charge transfer between chromophores and between chromophore and silsesquioxane cage have been identified. The RSH-DFT approach, including a protocol accounting for complex environmental effects on charge transfer energies, was tested and validated against experimental measurements. The third part of this thesis addresses quantum transport through nano-scale junctions. The ability to quantify a molecular junction via spectroscopic methods is crucial to their

Coulombic charge ice

Science.gov (United States)

McClarty, P. A.; O'Brien, A.; Pollmann, F.

2014-05-01

We consider a classical model of charges ±q on a pyrochlore lattice in the presence of long-range Coulomb interactions. This model first appeared in the early literature on charge order in magnetite [P. W. Anderson, Phys. Rev. 102, 1008 (1956), 10.1103/PhysRev.102.1008]. In the limit where the interactions become short ranged, the model has a ground state with an extensive entropy and dipolar charge-charge correlations. When long-range interactions are introduced, the exact degeneracy is broken. We study the thermodynamics of the model and show the presence of a correlated charge liquid within a temperature window in which the physics is well described as a liquid of screened charged defects. The structure factor in this phase, which has smeared pinch points at the reciprocal lattice points, may be used to detect charge ice experimentally. In addition, the model exhibits fractionally charged excitations ±q/2 which are shown to interact via a 1/r potential. At lower temperatures, the model exhibits a transition to a long-range ordered phase. We are able to treat the Coulombic charge ice model and the dipolar spin ice model on an equal footing by mapping both to a constrained charge model on the diamond lattice. We find that states of the two ice models are related by a staggering field which is reflected in the energetics of these two models. From this perspective, we can understand the origin of the spin ice and charge ice ground states as coming from a dipolar model on a diamond lattice. We study the properties of charge ice in an external electric field, finding that the correlated liquid is robust to the presence of a field in contrast to the case of spin ice in a magnetic field. Finally, we comment on the transport properties of Coulombic charge ice in the correlated liquid phase.

TRANSPORT PROPERTIES FOR REFRIGERANT MIXTURES

Directory of Open Access Journals (Sweden)

V. Geller

2014-06-01

Full Text Available A set of models to predict viscosity and thermal conductivity of refrigerant mixtures is developed. A general model for viscosity and thermal conductivity use the three contributions sum form (the dilute-gas terms, the residual terms, and the liquid terms. The corresponding states model is recommended to predict the dense gas transport properties over a range of reduced density from 0 to 2. It is shown that the RHS model provides the most reliable results for the saturated-liquid and the compressed-liquid transport properties over a range of given temperatures from 0,5 to 0,95.

Simulating liquid water for determining its structural and transport properties

International Nuclear Information System (INIS)

Arismendi-Arrieta, Daniel; Medina, Juan S.; Fanourgakis, George S.; Prosmiti, Rita; Delgado-Barrio, Gerardo

2014-01-01

Molecular dynamics simulations are carried out for calculating structural and transport properties of pure liquid water, such as radial distribution functions and self-diffusion and viscosity coefficients, respectively. We employed reparameterized versions of the ab initio water potential by Niesar, Clementi and Corongiu (NCC). In order to investigate the role of the electrostatic contribution, the partial charges of the NCC model are adjusted so that to reproduce the dipole moment values of the SPC/E, SPC/Fw and TIP4P/2005 water models. The single and collective transport coefficients are obtained by employing the Green–Kubo relations at various temperatures. Additionally, in order to overcome convergence difficulties arising from the long correlation times of the stress-tensor autocorrelation functions, a previously reported fitting scheme was employed. The present results indicate that there is a significant relationship between the dipole moment value of the model, and the calculated transport coefficients. We found that by adjusting the molecular dipole moment of the NCC to the value of the TIP4P/2005, the obtained values for the self-diffusion and viscosity coefficients are in better agreement with experiment, compared to the values obtained with the original NCC model. Even though the predictions of the present model exhibits an overall correct behavior, we conclude that further improvements are still required. In order to achieve that, a careful reparameterization of the repulsion–dispersion terms of the potential model is proposed. Also, the effect of the inclusion of many-body effects such as polarizability, should also be investigated. - Highlights: ► Transport properties of liquid water are important in bio-simulations. ► Self-diffusion coefficient, shear and bulk viscosities calculations from NVE molecular dynamics simulations. ► Their comparison with experimental data provides information on intermolecular forces, and serve to develop water

Temperature-dependent charge injection and transport in pentacene thin-film transistors

International Nuclear Information System (INIS)

Kim, Dong Wook; Shin, Hyunji; Choi, Jong Sun; Park, Ji-Ho; Park, Jaehoon

2015-01-01

The electrical characteristics of p-channel pentacene thin-film transistors (TFTs) were analyzed at different operating temperatures ranging from 253 to 353 K. An improvement in the drain current and field-effect mobility of the pentacene TFTs is observed with increasing temperature. From the Arrhenius plots of field-effect mobility extracted at various temperatures, a lower activation energy of 99.34 meV was obtained when the device is operating in the saturation region. Such observation is ascribed to the thermally activated hole transport through the pentacene grain boundaries. On the other hand, it was found that the Au/pentacene contact significantly affects the TFTs electrical characteristics in the linear region, which resulted in a higher activation energy. The activation energy based on the linear field-effect mobility, which increased from 344.61 to 444.70 meV with decreasing temperature, implies the charge-injection-limited electrical behavior of pentacene TFTs at low temperatures. The thermally induced electrical characteristic variations in pentacene TFTs can thus be studied through the temperature dependence of the charge injection and transport processes. (paper)

Semiconductor nanoparticles with spatial separation of charge carriers: synthesis and optical properties

International Nuclear Information System (INIS)

Vasiliev, Roman B; Dirin, Dmitry N; Gaskov, Alexander M

2011-01-01

The results of studies on core/shell semiconductor nanoparticles with spatial separation of photoexcited charge carriers are analyzed and generalized. Peculiarities of the electronic properties of semiconductor/semiconductor heterojunctions formed inside such particles are considered. Data on the effect of spatial separation of charge carriers on the optical properties of nanoparticles including spectral shifts of the exciton bands, absorption coefficients and electron–hole pair recombination times are presented. Methods of synthesis of core/shell semiconductor nanoparticles in solutions are discussed. Specific features of the optical properties of anisotropic semiconductor nanoparticles with the semiconductor/semiconductor junctions are noted. The bibliography includes 165 references.

A multi-agent quantum Monte Carlo model for charge transport: Application to organic field-effect transistors

International Nuclear Information System (INIS)

Bauer, Thilo; Jäger, Christof M.; Jordan, Meredith J. T.; Clark, Timothy

2015-01-01

We have developed a multi-agent quantum Monte Carlo model to describe the spatial dynamics of multiple majority charge carriers during conduction of electric current in the channel of organic field-effect transistors. The charge carriers are treated by a neglect of diatomic differential overlap Hamiltonian using a lattice of hydrogen-like basis functions. The local ionization energy and local electron affinity defined previously map the bulk structure of the transistor channel to external potentials for the simulations of electron- and hole-conduction, respectively. The model is designed without a specific charge-transport mechanism like hopping- or band-transport in mind and does not arbitrarily localize charge. An electrode model allows dynamic injection and depletion of charge carriers according to source-drain voltage. The field-effect is modeled by using the source-gate voltage in a Metropolis-like acceptance criterion. Although the current cannot be calculated because the simulations have no time axis, using the number of Monte Carlo moves as pseudo-time gives results that resemble experimental I/V curves

A multi-agent quantum Monte Carlo model for charge transport: Application to organic field-effect transistors

Energy Technology Data Exchange (ETDEWEB)

Bauer, Thilo; Jäger, Christof M. [Department of Chemistry and Pharmacy, Computer-Chemistry-Center and Interdisciplinary Center for Molecular Materials, Friedrich-Alexander-Universität Erlangen-Nürnberg, Nägelsbachstrasse 25, 91052 Erlangen (Germany); Jordan, Meredith J. T. [School of Chemistry, University of Sydney, Sydney, NSW 2006 (Australia); Clark, Timothy, E-mail: tim.clark@fau.de [Department of Chemistry and Pharmacy, Computer-Chemistry-Center and Interdisciplinary Center for Molecular Materials, Friedrich-Alexander-Universität Erlangen-Nürnberg, Nägelsbachstrasse 25, 91052 Erlangen (Germany); Centre for Molecular Design, University of Portsmouth, Portsmouth PO1 2DY (United Kingdom)

2015-07-28

We have developed a multi-agent quantum Monte Carlo model to describe the spatial dynamics of multiple majority charge carriers during conduction of electric current in the channel of organic field-effect transistors. The charge carriers are treated by a neglect of diatomic differential overlap Hamiltonian using a lattice of hydrogen-like basis functions. The local ionization energy and local electron affinity defined previously map the bulk structure of the transistor channel to external potentials for the simulations of electron- and hole-conduction, respectively. The model is designed without a specific charge-transport mechanism like hopping- or band-transport in mind and does not arbitrarily localize charge. An electrode model allows dynamic injection and depletion of charge carriers according to source-drain voltage. The field-effect is modeled by using the source-gate voltage in a Metropolis-like acceptance criterion. Although the current cannot be calculated because the simulations have no time axis, using the number of Monte Carlo moves as pseudo-time gives results that resemble experimental I/V curves.

Space charge compensation in the Linac4 low energy beam transport line with negative hydrogen ions

Energy Technology Data Exchange (ETDEWEB)

Valerio-Lizarraga, Cristhian A., E-mail: cristhian.alfonso.valerio.lizarraga@cern.ch [CERN, Geneva (Switzerland); Departamento de Investigación en Física, Universidad de Sonora, Hermosillo (Mexico); Lallement, Jean-Baptiste; Lettry, Jacques; Scrivens, Richard [CERN, Geneva (Switzerland); Leon-Monzon, Ildefonso [Facultad de Ciencias Fisico-Matematicas, Universidad Autónoma de Sinaloa, Culiacan (Mexico); Midttun, Øystein [CERN, Geneva (Switzerland); University of Oslo, Oslo (Norway)

2014-02-15

The space charge effect of low energy, unbunched ion beams can be compensated by the trapping of ions or electrons into the beam potential. This has been studied for the 45 keV negative hydrogen ion beam in the CERN Linac4 Low Energy Beam Transport using the package IBSimu [T. Kalvas et al., Rev. Sci. Instrum. 81, 02B703 (2010)], which allows the space charge calculation of the particle trajectories. The results of the beam simulations will be compared to emittance measurements of an H{sup −} beam at the CERN Linac4 3 MeV test stand, where the injection of hydrogen gas directly into the beam transport region has been used to modify the space charge compensation degree.

Transport properties of diazonium functionalized graphene: chiral two-dimensional hole gases

International Nuclear Information System (INIS)

Huang Ping; Jing Long; Zhu Huarui; Gao Xueyun

2012-01-01

The electric transport properties of diazonium functionalized graphene (DFG) were investigated. The temperature dependence of the resistivity (ρ-T) and the Shubnikov-de Haas oscillation of the DFG revealed two-dimensional hole gas (2DHG) behaviors. The DFGs exhibited unusual weak localization behaviors in which both inelastic and chirality-breaking elastic scattering processes should be taken into account, meaning that graphene chirality was maintained. Because of the giant decrease in the diffusion coefficient, the scattering rates remained relatively low in the presence of suppression of the scattering lengths. The decreases of both the mean free path and the Fermi velocity were responsible for the suppression of the diffusion coefficient and hence the charge mobility. (paper)

Transport, charge exchange and loss of energetic heavy ions in the earth's radiation belts - Applicability and limitations of theory

Science.gov (United States)

Spjeldvik, W. N.

1981-01-01

Computer simulations of processes which control the relative abundances of ions in the trapping regions of geospace are compared with observations from discriminating ion detectors. Energy losses due to Coulomb collisions between ions and exospheric neutrals are considered, along with charge exchange losses and internal charge exchanges. The time evolution of energetic ion fluxes of equatorially mirroring ions under radial diffusion is modelled to include geomagnetic and geoelectric fluctutations. Limits to the validity of diffusion transport theory are discussed, and the simulation is noted to contain provisions for six ionic charge states and the source effect on the radiation belt oxygen ion distributions. Comparisons are made with ion flux data gathered on Explorer 45 and ISEE-1 spacecraft and results indicate that internal charge exchanges cause the radiation belt ion charge state to be independent of source charge rate characteristics, and relative charge state distribution is independent of the radially diffusive transport rate below the charge state redistribution zone.

A numerical study on the charge transport in TPD/Alq3-based organic light emitting diodes.

Science.gov (United States)

Kim, K S; Hwang, Y W; Lee, H G; Won, T Y

2014-08-01

We report our simulation study on the charge transport characteristic of the multi-layer structure for organic light emitting diodes (OLEDs). We performed a numerical simulation on a multilayer structure comprising a hole transport layer (HTL), an emission layer (EML), and an electron transport layer (ETL) between both electrodes. The material of the HTL is TPD (N,N'-Bis (3-methylphenyl)-N,N'-bis(phenyl) benzidine), and the ETL includes Alq3 (Tris (8-hyroxyquinolinato) aluminium). Here, we investigated the parameters such as recombination rates which influence the efficiency of the charge transport between layers in bilayer OLEDs. We also analyzed a transient response during the turn on/off period and the carrier transport in accordance with the variation of the injection barrier and applied voltage. In addition, our numerical simulation revealed that the insertion of the EML affects the photonic characteristics in bilayer structure and also the efficiency due to the difference in the internal barrier height.

Electron transport properties in ZnO nanowires/poly(3-hexylthiophene) hybrid nanostructure

International Nuclear Information System (INIS)

Cheng Ke; Cheng Gang; Wang Shujie; Fu Dongwei; Zou Bingsuo; Du Zuliang

2010-01-01

The ZnO nanowires (NWs) array/poly(3-hexylthiophene) (P3HT) hybrid prototype device was fabricated. An ultraviolet (UV) light of λ = 350 nm is used to investigate the photo-electric properties of the ZnO NWs array and hybrid structure. In this way, we can avoid the excitation of P3HT, which can give us a real electron transport ability of ZnO NWs itself. Our results demonstrated a higher and faster photo-electric response of 3 s for the hybrid structure while 9 s for the ZnO NWs array. The surface states related slow photo-electric response was also observed for them. The charge transfer mechanism and the influence of surface states were discussed. The current work provides us profound understandings on the electron transport ability of ZnO NWs array in a working hybrid polymer solar cell, which is crucial for optimizing the device performance.

Correlation of transarterial transport of various dextrans with their physicochemical properties.

Science.gov (United States)

Elmalak, O; Lovich, M A; Edelman, E

2000-11-01

Local vascular drug delivery provides elevated concentrations of drug in the target tissue while minimizing systemic side effects. To better characterize local pharmacokinetics we examined the arterial transport of locally applied dextran and dextran derivatives in vivo. Using a two-compartment pharmacokinetic model to correct the measured transmural flux of these compounds for systemic redistribution and elimination as delivered from a photopolymerizable hydrogel surrounding rat carotid arteries, we found that the diffusivities and the transendothelial permeabilities were strongly dependent on molecular weight and charge. For neutral dextrans, the effective diffusive resistance in the media increased with molecular weight approximately 4.1-fold between the molecular weights of 10 and 282 kDa. Similarly, endothelial resistance increased 28-fold over the same molecular weight range. The effective medial diffusive resistance was unaffected by cationic charge as such molecules moved identically to neutral compounds, but increased approximately 40% when dextrans were negatively charged. Transendothelial resistance was 20-fold lower for the cationic dextrans, and 11-fold higher for the anionic dextrans, when both were compared to neutral counterparts. These results suggest that, while low molecular weight drugs will rapidly traverse the arterial wall with the endothelium posing a minimal barrier, the reverse is true for high molecular weight agents. With these data, the deposition and distribution of locally released vasotherapeutic compounds might be predicted based upon chemical properties, such as molecular weight and charge.

Transport Properties in Nuclear Pasta

Science.gov (United States)

Caplan, Matthew; Horowitz, Charles; Berry, Donald; da Silva Schneider, Andre

2016-09-01

At the base of the inner crust of neutron stars, where matter is near the nuclear saturation density, nuclear matter arranges itself into exotic shapes such as cylinders and slabs, called `nuclear pasta.' Lepton scattering from these structures may govern the transport properties of the inner crust; electron scattering from protons in the pasta determines the thermal and electrical conductivity, as well as the shear viscosity of the inner crust. These properties may vary in pasta structures which form at various densities, temperatures, and proton fractions. In this talk, we report on our calculations of lepton transport in nuclear pasta and the implication for neutron star observables.

Structural properties of water around uncharged and charged carbon nanotubes

International Nuclear Information System (INIS)

Dezfoli, Amir Reza Ansari; Mehrabian, Mozaffar Ali; Rafsanjani, Hassan Hashemipour

2013-01-01

Studying the structural properties of water molecules around the carbon nanotubes is very important in a wide variety of carbon nanotubes applications. We studied the number of hydrogen bonds, oxygen and hydrogen density distributions, and water orientation around carbon nanotubes. The water density distribution for all carbon nanotubes was observed to have the same feature. In water-carbon nanotubes interface, a high-density region of water molecules exists around carbon nanotubes. The results reveal that the water orientation around carbon nanotubes is roughly dependent on carbon nanotubes surface charge. The water molecules in close distances to carbon nanotubes were found to make an HOH plane nearly perpendicular to the water-carbon nanotubes interface for carbon nanotubes with negative surface charge. For uncharged carbon nanotubes and carbon nanotubes with positive surface charge, the HOH plane was in tangential orientation with water-carbon nanotubes interface. There was also a significant reduction in hydrogen bond of water region around carbon nanotubes as compared with hydrogen bond in bulk water. This reduction was very obvious for carbon nanotubes with positive surface charge. In addition, the calculation of dynamic properties of water molecules in water-CNT interface revealed that there is a direct relation between the number of Hbonds and self-diffusion coefficient of water molecules

Charge Carrier Transport Mechanism Based on Stable Low Voltage Organic Bistable Memory Device.

Science.gov (United States)

Ramana, V V; Moodley, M K; Kumar, A B V Kiran; Kannan, V

2015-05-01

A solution processed two terminal organic bistable memory device was fabricated utilizing films of polymethyl methacrylate PMMA/ZnO/PMMA on top of ITO coated glass. Electrical characterization of the device structure showed that the two terminal device exhibited favorable switching characteristics with an ON/OFF ratio greater than 1 x 10(4) when the voltage was swept between - 2 V and +3 V. The device maintained its state after removal of the bias voltage. The device did not show degradation after a 1-h retention test at 120 degrees C. The memory functionality was consistent even after fifty cycles of operation. The charge transport switching mechanism is discussed on the basis of carrier transport mechanism and our analysis of the data shows that the charge carrier trans- port mechanism of the device during the writing process can be explained by thermionic emission (TE) and space-charge-limited-current (SCLC) mechanism models while erasing process could be explained by the FN tunneling mechanism. This demonstration provides a class of memory devices with the potential for low-cost, low-power consumption applications, such as a digital memory cell.

Simulations of charge transport in organic light emitting diodes

International Nuclear Information System (INIS)

Martin, Simon James

2002-01-01

In this thesis, two approaches to the modelling of charge transport in organic light emitting diodes (OLEDs) are presented. The first is a drift-diffusion model, normally used when considering conventional crystalline inorganic semiconductors (e.g. Si or lll-V's) which have well defined energy bands. In this model, electron and hole transport is described using the current continuity equations and the drift-diffusion current equations, and coupled to Poisson's equation. These equations are solved with the appropriate boundary conditions, which for OLEDs are Schottky contacts; carriers are injected by thermionic emission and tunnelling. The disordered nature of the organic semiconductors is accounted for by the inclusion of field-dependent carrier mobilities and Langevin optical recombination. The second approach treats the transport of carriers in disordered organic semi-conductors as a hopping process between spatially and energetically disordered sites. This method has been used previously to account for the observed temperature and electric field dependence of carrier mobilities in disordered organic semiconductors. A hopping transport model has been developed which accounts explicitly for the structure in highly ordered films of rigid rod liquid-crystalline conjugated polymers. Chapter 2 discusses the formation of metal-semiconductor contacts, and current injection processes in OLEDs. If the barrier to carrier injection at a metal-semiconductor contact is small, or the contact is Ohmic, then the current may be space charge limited; this second limiting regime of current flow for OLEDs is also described. The remainder of Chapter 2 describes the drift-diffusion model used in this work in some detail. Chapter 3 contains results obtained from modelling the J-V characteristics of single-layer OLEDs, which are compared to experimental data in order to validate the drift-diffusion model. Chapter 4 contains results of simulating bi-layer OLEDs; rather than examining J

Peculiarities of charge transport in a semiconductor gas discharge electronic devices

International Nuclear Information System (INIS)

Koch, E.; Chivi, M.; Salamov, B.G.; Salamov, B.G.

2009-01-01

The memory effect in planar semiconductor gas discharge system at different pressures (15-760) and interelectrode distance (60-445 μm) were experimentally studied. The study was performed on the bases of current-voltage characteristic (CVC) measurements with the time lag of several hours of afterglow periods. The influence of the active space-charge remaining from previous discharge on the breakdown voltage has been analyzed using the CVC method for different conductivity of semiconductor GaAs photocathode. On the other hand, the CVC data for subsequent dates present a correlation of memory effect and hysteresis behaviour. The explanation of such relation is based on the influence of long-lived active charges on the electronic transport mechanism of semiconductor material

Design rules for charge-transport efficient host materials for phosphorescent organic light-emitting diodes.

Science.gov (United States)

May, Falk; Al-Helwi, Mustapha; Baumeier, Björn; Kowalsky, Wolfgang; Fuchs, Evelyn; Lennartz, Christian; Andrienko, Denis

2012-08-22

The use of blue phosphorescent emitters in organic light-emitting diodes (OLEDs) imposes demanding requirements on a host material. Among these are large triplet energies, the alignment of levels with respect to the emitter, the ability to form and sustain amorphous order, material processability, and an adequate charge carrier mobility. A possible design strategy is to choose a π-conjugated core with a high triplet level and to fulfill the other requirements by using suitable substituents. Bulky substituents, however, induce large spatial separations between conjugated cores, can substantially reduce intermolecular electronic couplings, and decrease the charge mobility of the host. In this work we analyze charge transport in amorphous 2,8-bis(triphenylsilyl)dibenzofuran, an electron-transporting material synthesized to serve as a host in deep-blue OLEDs. We show that mesomeric effects delocalize the frontier orbitals over the substituents recovering strong electronic couplings and lowering reorganization energies, especially for electrons, while keeping energetic disorder small. Admittance spectroscopy measurements reveal that the material has indeed a high electron mobility and a small Poole-Frenkel slope, supporting our conclusions. By linking electronic structure, molecular packing, and mobility, we provide a pathway to the rational design of hosts with high charge mobilities.

A Generalized Boltzmann Fokker-Planck Method for Coupled Charged Particle Transport

Energy Technology Data Exchange (ETDEWEB)

Prinja, Anil K

2012-01-09

The goal of this project was to develop and investigate the performance of reduced-physics formulations of high energy charged particle (electrons, protons and heavier ions) transport that are computationally more efficient than not only analog Monte Carlo methods but also the established condensed history Monte Carlo technique. Charged particles interact with matter by Coulomb collisions with target nuclei and electrons, by bremsstrahlung radiation loss and by nuclear reactions such as spallation and fission. Of these, inelastic electronic collisions and elastic nuclear collisions are the dominant cause of energy-loss straggling and angular deflection or range straggling of a primary particle. These collisions are characterized by extremely short mean free paths (sub-microns) and highly peaked, near-singular differential cross sections about forward directions and zero energy loss, with the situation for protons and heavier ions more extreme than for electrons. For this reason, analog or truephysics single-event Monte Carlo simulation, while possible in principle, is computationally prohibitive for routine calculation of charged particle interaction phenomena.

Charge transport in organic molecular semiconductors from first principles: The bandlike hole mobility in a naphthalene crystal

Science.gov (United States)

Lee, Nien-En; Zhou, Jin-Jian; Agapito, Luis A.; Bernardi, Marco

2018-03-01

Predicting charge transport in organic molecular crystals is notoriously challenging. Carrier mobility calculations in organic semiconductors are dominated by quantum chemistry methods based on charge hopping, which are laborious and only moderately accurate. We compute from first principles the electron-phonon scattering and the phonon-limited hole mobility of naphthalene crystal in the framework of ab initio band theory. Our calculations combine GW electronic bandstructures, ab initio electron-phonon scattering, and the Boltzmann transport equation. The calculated hole mobility is in very good agreement with experiment between 100 -300 K , and we can predict its temperature dependence with high accuracy. We show that scattering between intermolecular phonons and holes regulates the mobility, though intramolecular phonons possess the strongest coupling with holes. We revisit the common belief that only rigid molecular motions affect carrier dynamics in organic molecular crystals. Our paper provides a quantitative and rigorous framework to compute charge transport in organic crystals and is a first step toward reconciling band theory and carrier hopping computational methods.

Trapping-charging ability and electrical properties study of amorphous insulator by dielectric spectroscopy

International Nuclear Information System (INIS)

Mekni, Omar; Arifa, Hakim; Askri, Besma; Yangui, Béchir; Raouadi, Khaled; Damamme, Gilles

2014-01-01

Usually, the trapping phenomenon in insulating materials is studied by injecting charges using a Scanning Electron Microscope. In this work, we use the dielectric spectroscopy technique for showing a correlation between the dielectric properties and the trapping-charging ability of insulating materials. The evolution of the complex permittivity (real and imaginary parts) as a function of frequency and temperature reveals different types of relaxation according to the trapping ability of the material. We found that the space charge relaxation at low frequencies affects the real part of the complex permittivity ε ′ and the dissipation factor Tan(δ). We prove that the evolution of the imaginary part of the complex permittivity against temperature ε ″ =f(T) reflects the phenomenon of charge trapping and detrapping as well as trapped charge evolution Q p (T). We also use the electric modulus formalism to better identify the space charge relaxation. The investigation of trapping or conductive nature of insulating materials was mainly made by studying the activation energy and conductivity. The conduction and trapping parameters are determined using the Correlated Barrier Hopping (CBH) model in order to confirm the relation between electrical properties and charge trapping ability.

Thermal generation and mobility of charge carriers in collective proton transport in hydrogen-bonded chains

International Nuclear Information System (INIS)

Peyrard, M.; Boesch, R.; Kourakis, I.

1991-01-01

The transport of protons in hydrogen-bonded systems is a long standing problem which has not yet obtained a satisfactorily theoretical description. Although this problem was examined first for ice, it is relevant in many systems and in particular in biology for the transport along proteins or for proton conductance across membranes, an essential process in cell life. The broad relevance makes the study of proton conduction very appealing. Since the original work of Bernal and Fowler on ice, the idea that the transport occurs through chains of hydrogen bonds has been well accepted. Such ''proton wires'' were invoked by Nagle and Morowitz for proton transport across membranes proteins and more recently across lipid bilayers. In this report, we assume the existence of such an hydrogen-bonded chain and discuss its consequences on the dynamics of the charge carriers. We show that this assumption leads naturally to the idea of soliton transport and we put a special emphasis on the role of the coupling between the protons and heavy ions motions. The model is presented. We show how the coupling affects strongly the dynamics of the charge carriers and we discuss the role it plays in the thermal generation of carriers. The work presented has been performed in 1986 and 87 with St. Pnevmatikos and N. Flyzanis and was then completed in collaboration with D. Hochstrasser and H. Buettner. Therefore the results presented in this part are not new but we think that they are appropriate in the context of this multidisciplinary workshop because they provide a rather complete example of the soliton picture for proton conduction. This paper discusses the thermal generation of the charge carriers when the coupling between the protons and heavy ions dynamics is taken into account. The results presented in this part are very recent and will deserve further analysis but they already show that the coupling can assist for the formation of the charge carriers

Quantifying TEMPO Redox Polymer Charge Transport toward the Organic Radical Battery.

Science.gov (United States)

Karlsson, Christoffer; Suga, Takeo; Nishide, Hiroyuki

2017-03-29

To design new and better organic active battery materials in a rational fashion, fundamental parameters of the charge transport must be studied. Herein we report on the electronic conductivity by electron diffusion in a TEMPO-containing redox polymer, and the reorganization energy of the TEMPO self-exchange in an organic solvent is determined for the first time. The electronic conductivity was 8.5 μS/cm at E 0 and corresponded to a redox hopping mechanism. The apparent electron diffusion coefficient was 1.9 × 10 -9 cm 2 /s at room temperature, and at short times the ion diffusion was limiting with a diffusion coefficient of 6.5 × 10 -10 cm 2 /s. The reorganization energy was determined to be 1.01 eV, indicating a rather polar chemical environment for the TEMPO groups. The implications for the usage of this type of materials in organic energy storage are discussed. As conductivity through 10 μm was demonstrated, we show that, if sufficient swellability can be ensured, charge can be transported through several micrometer thick layers in a battery electrode without any conducting additive.

Transport properties of molecular junctions

CERN Document Server

Zimbovskaya, Natalya A

2013-01-01

A comprehensive overview of the physical mechanisms that control electron transport and the characteristics of metal-molecule-metal (MMM) junctions is presented. As far as possible, methods and formalisms presented elsewhere to analyze electron transport through molecules are avoided. This title introduces basic concepts—a description of the electron transport through molecular junctions—and briefly describes relevant experimental methods. Theoretical methods commonly used to analyze the electron transport through molecules are presented. Various effects that manifest in the electron transport through MMMs, as well as the basics of density-functional theory and its applications to electronic structure calculations in molecules are presented. Nanoelectronic applications of molecular junctions and similar systems are discussed as well. Molecular electronics is a diverse and rapidly growing field. Transport Properties of Molecular Junctions presents an up-to-date survey of the field suitable for researchers ...

Bipolar charge transport in PCPDTBT-PCBM bulk-heterojunctions for photovoltaic applications

Energy Technology Data Exchange (ETDEWEB)

Morana, Mauro [Konarka Austria GmbH, 4040 Linz (Austria); Dipartimento di Ingegeria Elettrica ed Elettronica, Universita di Cagliari (Italy); Wegscheider, Matthias; Bonanni, Alberta [Johannes Kepler University, Institute of Solid State Physics, Linz (Austria); Kopidakis, Nikos; Shaheen, Sean [National Renewable Energy Laboratory, Golden, CO (United States); Scharber, Markus; Brabec, Christoph [Konarka Austria GmbH, 4040 Linz (Austria); Zhu, Zhengguo; Waller, David; Gaudiana, Russell [Konarka Technologies Inc., Lowell, MA (United States)

2008-06-24

An experimental study of the transport properties of a low-bandgap conjugated polymer giving high photovoltaic quantum efficiencies in the near infrared spectral region (E{sub g-opt}{proportional_to} 1.35 eV) is presented. Using a organic thin film transistor geometry, we demonstrate a relatively high in-plane hole mobility, up to 1.5. x 10{sup -2} cm{sup 2} V{sup -1} s{sup -1} and quantify the electron mobility at 3 x . 10{sup -5} cm{sup 2} V{sup -1} s{sup -1} on a SiO{sub 2} dielectric. In addition, singular contact behavior results in bipolar quasi-Ohmic injection both from low and high workfunction metals like LiF/Al and Au. X-ray investigations revealed a degree of interchain {pi}-stacking that is probably embedded in a disordered matrix. Disorder also manifests itself in a strong positive field dependence of the hole mobility from the electric field. In blends made with the electron acceptor methanofullerene [6,6]-phenyl C{sub 61} butyric acid methyl ester (PCBM), the transistor characteristics suggest a relatively unfavorable intermixing of the two components for the application to photovoltaic devices. We attribute this to a too fine dispersion of [C60]-PCBM in the polymer matrix, that is also confirmed by the quenching of the photoluminescence signal measured in PCPDTBT [C60]-PCBM films with various composition. We show that a higher degree of phase separation can be induced during the film formation by using 1,8-octanedithiol (ODT), which leads to a more efficient electron percolation in the [C60]-PCBM. In addition, the experimental results, in combination with those of solar cells seem to support the correlation between the blend morphology and charge recombination. We tentatively propose that the drift length, and similarly the electrical fill factor, can be limited by the recombination of holes with electrons trapped on isolated [C60]-PCBM clusters. Ionized and isolated [C60]-PCBM molecules can modify the local electric field in the solar cell by build

Adsorption properties of subtropical and tropical variable charge soils: Implications from climate change and biochar amendment

Energy Technology Data Exchange (ETDEWEB)

Xu, Ren-Kou; Qafoku, Nikolla; Van Ranst, Eric; Li, Jiu-yu; Jiang, Jun

2016-01-25

This review paper attempts to summarize the progress made in research efforts conducted over the last years to study the surface chemical properties of the tropical and subtropical soils, usually called variable charge soils, and the way they response to different management practices. The paper is composed of an introductory section that provides a brief discussion on the surface chemical properties of these soils, and five other review sections. The focus of these sections is on the evolution of surface chemical properties during the development of the variable charge properties (second section), interactions between oppositely charged particles and the resulting effects on the soil properties and especially on soil acidity (third section), the surface effects of low molecular weight organic acids sorbed to mineral surfaces and the chemical behavior of aluminum (fourth section), and the crop straw derived biochar induced changes of the surface chemical properties of these soils (fifth section). A discussion on the effect of climate change variables on the properties of the variable charge soils is included at the end of this review paper (sixth section).

Charge transport mechanisms of graphene/semiconductor Schottky barriers: A theoretical and experimental study

International Nuclear Information System (INIS)

Zhong, Haijian; Liu, Zhenghui; Xu, Gengzhao; Shi, Lin; Fan, Yingmin; Yang, Hui; Xu, Ke; Wang, Jianfeng; Ren, Guoqiang

2014-01-01

Graphene has been proposed as a material for semiconductor electronic and optoelectronic devices. Understanding the charge transport mechanisms of graphene/semiconductor Schottky barriers will be crucial for future applications. Here, we report a theoretical model to describe the transport mechanisms at the interface of graphene and semiconductors based on conventional semiconductor Schottky theory and a floating Fermi level of graphene. The contact barrier heights can be estimated through this model and be close to the values obtained from the experiments, which are lower than those of the metal/semiconductor contacts. A detailed analysis reveals that the barrier heights are as the function of the interface separations and dielectric constants, and are influenced by the interfacial states of semiconductors. Our calculations show how this behavior of lowering barrier heights arises from the Fermi level shift of graphene induced by the charge transfer owing to the unique linear electronic structure

Charge transport through image charged stabilized states in a single molecule single electron transistor device

International Nuclear Information System (INIS)

Hedegard, Per; Bjornholm, Thomas

2005-01-01

The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond

Charge Transport Phenomena in Detectors of the Cryogenic Dark Matter Search

Science.gov (United States)

Sundqvist, Kyle

2008-03-01

The Cryogenic Dark Matter Search (CDMS) seeks to detect putative weakly-interacting massive particles (WIMPS), which could explain the dark matter problem in cosmology and particle physics. By simultaneously measuring the number of charge carriers and the energy in athermal phonons created by particle interactions in intrinsic Ge and Si crystals at a temperature of 40 mK, a signature response for each event is produced. This response, combined with phonon pulse-shape information, allows CDMS to actively discriminate candidate WIMP interactions with nuclei apart from electromagnetic radioactive background which interacts with electrons. The challenges associated with these techniques are unique. Carrier drift-fields are maintained at only a few V/cm, else drift-emitted Luke-Neganov phonons would dominate the phonons of the original interaction. Under such conditions, carrier scattering is dominated by zero-point fluctuations of the lattice ions. It has been an open question how well the 8 Kelvin data prominent in the literature depicts this case. We compare the simulated transport properties of electrons and holes in Ge at 40 mK and at 8 K, and apply this understanding to our detectors.

Influence of surface charge on the transport characteristics of nanowire-field effect transistors in liquid environments

Energy Technology Data Exchange (ETDEWEB)

Nozaki, Daijiro, E-mail: daijiro.nozaki@gmail.com, E-mail: research@nano.tu-dresden.de [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Kunstmann, Jens [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Theoretical Chemistry, Department of Chemistry and Food Chemistry, TU Dresden, 01062 Dresden (Germany); Zörgiebel, Felix [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Center for Advancing Electronics Dresden (cfAED), TU Dresden, 01062 Dresden (Germany); Cuniberti, Gianaurelio [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Center for Advancing Electronics Dresden (cfAED), TU Dresden, 01062 Dresden (Germany); Dresden Center for Computational Materials Science (DCCMS), TU Dresden, 01062 Dresden (Germany)

2015-05-18

One dimensional nanowire field effect transistors (NW-FETs) are a promising platform for sensor applications. The transport characteristics of NW-FETs are strongly modified in liquid environment due to the charging of surface functional groups accompanied with protonation or deprotonation. In order to investigate the influence of surface charges and ionic concentrations on the transport characteristics of Schottky-barrier NW-FETs, we have combined the modified Poisson-Boltzmann theory with the Landauer-Büttiker transport formalism. For a typical device, the model is able to capture the reduction of the sensitivity of NW-FETs in ionic solutions due to the screening from counter ions as well as a local gating from surface functional groups. Our approach allows to model, to investigate, and to optimize realistic Schottky-barrier NW-FET devices in liquid environment.

Characterization of Charge-Carrier Transport in Semicrystalline Polymers: Electronic Couplings, Site Energies, and Charge-Carrier Dynamics in Poly(bithiophene- alt -thienothiophene) [PBTTT

KAUST Repository

Poelking, Carl; Cho, Eunkyung; Malafeev, Alexander; Ivanov, Viktor; Kremer, Kurt; Risko, Chad; Bré das, Jean-Luc; Andrienko, Denis

2013-01-01

We establish a link between the microscopic ordering and the charge-transport parameters for a highly crystalline polymeric organic semiconductor, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b]thiophene) (PBTTT). We find that the nematic and dynamic order parameters of the conjugated backbones, as well as their separation, evolve linearly with temperature, while the side-chain dynamic order parameter and backbone paracrystallinity change abruptly upon the (also experimentally observed) melting of the side chains around 400 K. The distribution of site energies follows the behavior of the backbone paracrystallinity and can be treated as static on the time scale of a single-charge transfer reaction. On the contrary, the electronic couplings between adjacent backbones are insensitive to side-chain melting and vary on a much faster time scale. The hole mobility, calculated after time-averaging of the electronic couplings, reproduces well the value measured in a short-channel thin-film transistor. The results underline that to secure efficient charge transport in lamellar arrangements of conjugated polymers: (i) the electronic couplings should present high average values and fast dynamics, and (ii) the energetic disorder (paracrystallinity) should be small. © 2013 American Chemical Society.

Characterization of Charge-Carrier Transport in Semicrystalline Polymers: Electronic Couplings, Site Energies, and Charge-Carrier Dynamics in Poly(bithiophene- alt -thienothiophene) [PBTTT

KAUST Repository

Poelking, Carl

2013-01-31

We establish a link between the microscopic ordering and the charge-transport parameters for a highly crystalline polymeric organic semiconductor, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b]thiophene) (PBTTT). We find that the nematic and dynamic order parameters of the conjugated backbones, as well as their separation, evolve linearly with temperature, while the side-chain dynamic order parameter and backbone paracrystallinity change abruptly upon the (also experimentally observed) melting of the side chains around 400 K. The distribution of site energies follows the behavior of the backbone paracrystallinity and can be treated as static on the time scale of a single-charge transfer reaction. On the contrary, the electronic couplings between adjacent backbones are insensitive to side-chain melting and vary on a much faster time scale. The hole mobility, calculated after time-averaging of the electronic couplings, reproduces well the value measured in a short-channel thin-film transistor. The results underline that to secure efficient charge transport in lamellar arrangements of conjugated polymers: (i) the electronic couplings should present high average values and fast dynamics, and (ii) the energetic disorder (paracrystallinity) should be small. © 2013 American Chemical Society.

Coherent Charge Transport in Ballistic InSb Nanowire Josephson Junctions

Science.gov (United States)

Li, S.; Kang, N.; Fan, D. X.; Wang, L. B.; Huang, Y. Q.; Caroff, P.; Xu, H. Q.

2016-01-01

Hybrid InSb nanowire-superconductor devices are promising for investigating Majorana modes and topological quantum computation in solid-state devices. An experimental realisation of ballistic, phase-coherent superconductor-nanowire hybrid devices is a necessary step towards engineering topological superconducting electronics. Here, we report on a low-temperature transport study of Josephson junction devices fabricated from InSb nanowires grown by molecular-beam epitaxy and provide a clear evidence for phase-coherent, ballistic charge transport through the nanowires in the junctions. We demonstrate that our devices show gate-tunable proximity-induced supercurrent and clear signatures of multiple Andreev reflections in the differential conductance, indicating phase-coherent transport within the junctions. We also observe periodic modulations of the critical current that can be associated with the Fabry-Pérot interference in the nanowires in the ballistic transport regime. Our work shows that the InSb nanowires grown by molecular-beam epitaxy are of excellent material quality and hybrid superconducting devices made from these nanowires are highly desirable for investigation of the novel physics in topological states of matter and for applications in topological quantum electronics. PMID:27102689

Charge transport and contact resistance in coplanar devices based on colloidal polyaniline dispersion

Czech Academy of Sciences Publication Activity Database

Masillamani, A. M.; Peřinka, N.; Hajná, Milena; Stejskal, Jaroslav; Tondelier, D.; Bonnassieux, Y.; Vanel, J.-C.; Geffroy, B.; Mencaraglia, D.

2016-01-01

Roč. 54, č. 17 (2016), s. 1710-1716 ISSN 0887-6266 R&D Projects: GA ČR(CZ) GA13-00270S Institutional support: RVO:61389013 Keywords : charge transport * colloidal dispersion * colloids Subject RIV: JI - Composite Materials Impact factor: 2.838, year: 2016

Secondary electron emission and self-consistent charge transport in semi-insulating samples

Energy Technology Data Exchange (ETDEWEB)

Fitting, H.-J. [Institute of Physics, University of Rostock, Universitaetsplatz 3, D-18051 Rostock (Germany); Touzin, M. [Unite Materiaux et Transformations, UMR CNRS 8207, Universite de Lille 1, F-59655 Villeneuve d' Ascq (France)

2011-08-15

Electron beam induced self-consistent charge transport and secondary electron emission (SEE) in insulators are described by means of an electron-hole flight-drift model (FDM) now extended by a certain intrinsic conductivity (c) and are implemented by an iterative computer simulation. Ballistic secondary electrons (SE) and holes, their attenuation to drifting charge carriers, and their recombination, trapping, and field- and temperature-dependent detrapping are included. As a main result the time dependent ''true'' secondary electron emission rate {delta}(t) released from the target material and based on ballistic electrons and the spatial distributions of currents j(x,t), charges {rho}(x,t), field F(x,t), and potential V(x,t) are obtained where V{sub 0} = V(0,t) presents the surface potential. The intrinsic electronic conductivity limits the charging process and leads to a conduction sample current to the support. In that case the steady-state total SE yield will be fixed below the unit: i.e., {sigma} {eta} + {delta} < 1.

Laboratory Studies of Charging Properties of Dust Grains in Astrophysical/Planetary Environments

Science.gov (United States)

Tankosic, D.; Abbas, M. M.

2012-01-01

Dust grains in various astrophysical environments are generally charged electrostatically by photoelectric emissions with UV/X-ray radiation, as well as by electron/ion impact. Knowledge of physical and optical properties of individual dust grains is required for understanding of the physical and dynamical processes in space environments and the role of dust in formation of stellar and planetary systems. In this paper we focus on charging of individual micron/submicron dust grains by processes that include: (a) UV photoelectric emissions involving incident photon energies higher than the work function of the material and b) electron impact, where low energy electrons are scattered or stick to the dust grains, thereby charging the dust grains negatively, and at sufficiently high energies the incident electrons penetrate the grain leading to excitation and emission of electrons referred to as secondary electron emission (SEE). It is well accepted that the charging properties of individual micron/submicron size dust grains are expected to be substantially different from the bulk materials. However, no viable models for calculation of the charging properties of individual micron size dust grains are available at the present time. Therefore, the photoelectric yields, and secondary electron emission yields of micron-size dust grains have to be obtained by experimental methods. Currently, very limited experimental data are available for charging of individual micron-size dust grains. Our experimental results, obtained on individual, micron-size dust grains levitated in an electrodynamic balance facility (at NASA-MSFC), show that: (1) The measured photoelectric yields are substantially higher than the bulk values given in the literature and indicate a particle size dependence with larger particles having order-of-magnitude higher values than for submicron-size grains; (2) dust charging by low energy electron impact is a complex process. Also, our measurements indicate that

Quantitative description of charge-carrier transport in a white organic light-emitting diode

Science.gov (United States)

Schober, M.; Anderson, M.; Thomschke, M.; Widmer, J.; Furno, M.; Scholz, R.; Lüssem, B.; Leo, K.

2011-10-01

We present a simulation model for the analysis of charge-carrier transport in organic thin-film devices, and apply it to a three-color white hybrid organic light-emitting diode (OLED) with fluorescent blue and phosphorescent red and green emission. We simulate a series of single-carrier devices, which reconstruct the OLED layer sequence step by step. Thereby, we determine the energy profiles for hole and electron transport, show how to discern bulk from interface limitation, and identify trap states.

Charged Hadron Properties in Background Electric Fields

International Nuclear Information System (INIS)

Detmold, William; Tiburzi, Brian C.; Walker-Loud, Andre

2010-01-01

We report on a lattice calculation demonstrating a novel new method to extract the electric polarizability of charged pseudo-scalar mesons by analyzing two point correlation functions computed in classical background electric fields. A staple component of any electrodynamics or quantum mechanics course is the electric polarizability. Neutral material immersed in a weak external field polarizes, internally setting up an electric dipole moment, aligned so as to minimize the energy. At the atomic level, the electron clouds are distorted creating these microscopic dipole moments. The same process occurs at the hadronic level but the polarization effects are now constrained by the strong force. Polarizabilities of these bound QCD states can be viewed as a distortion of the charged pion cloud of a given hadron. One can use lattice QCD to non-perturbatively compute the quark and gluon interactions in the presence of background electric (or magnetic) fields. For sufficiently weak background fields, the low energy properties of the hadrons can be rigorously computed using effective field theory. With this treatment, a picture of hadrons emerges from chiral dynamics: that of a hadronic core surrounded by a pseudoscalar meson cloud. As some pseudoscalar mesons are charged, polarizabilities of hadrons encode the stiffness of the charged meson cloud (as well as that of the core). The form of pseudoscalar meson polarizabilities is consequently strongly constrained by chiral dynamics. However, beyond the leading order, the results depend upon essentially unknown low-energy constants, which must currently be estimated in a model-dependent fashion. In the case of the charged pion, the experimental measurement of the polarizability has proven difficult, both in the original measurement as well as the most recent published result. Currently, there is a 2-3 sigma discrepancy between the two-loop cPT prediction and the measured charged pion polarizability. New results with higher

Opto-electronic and quantum transport properties of semiconductor nanostructures

Energy Technology Data Exchange (ETDEWEB)

Sabathil, M.

2005-01-01

In this work a novel and efficient method for the calculation of the ballistic transport properties of open semiconductor nanostructures connected to external reservoirs is presented. It is based on the Green's function formalism and reduces the effort to obtain the transmission and the carrier density to a single solution of a hermitian eigenvalue problem with dimensions proportional to the size of the decoupled device and the multiple inversion of a small matrix with dimensions proportional to the size of the contacts to the leads. Using this method, the 4-band GaAs hole transport through a 2-dimensional three-terminal T-junction device, and the resonant tunneling current through a 3-dimensional InAs quantum dot molecule embedded into an InP heterostructure have been calculated. The further extension of the method into a charge self-consistent scheme enables the efficient prediction of the IV-characteristics of highly doped nanoscale field effect transistors in the ballistic regime, including the influence of quasi bound states and the exchange-correlation interaction. Buettiker probes are used to emulate the effect of inelastic scattering on the current for simple 1D devices, systematically analyzing the dependence of the density of states and the resulting self-consistent potential on the scattering strength. The second major topic of this work is the modeling of the optical response of quantum confined neutral and charged excitons in single and coupled self-assembled InGaAs quantum dots. For this purpose the existing device simulator nextnano{sup 3} has been extended to incorporate particle-particle interactions within the means of density functional theory in local density approximation. In this way the exciton transition energies for neutral and charged excitons as a function of an externally applied electric field have been calculated, revealing a systematic reduction of the intrinsic dipole with the addition of extra holes to the exciton, a finding

The Effect of Dopant-Free Hole-Transport Polymers on Charge Generation and Recombination in Cesium-Bismuth-Iodide Solar Cells.

Science.gov (United States)

Zhu, Huimin; Johansson, Malin B; Johansson, Erik M J

2018-03-22

The photovoltaic characteristics of CsBi 3 I 10 -based solar cells with three dopant-free hole-conducting polymers are investigated. The effect on charge generation and charge recombination in the solar cells using the different polymers is studied and the results indicate that the choice of polymer strongly affects the device properties. Interestingly, for the solar cell with poly[[2,3-bis(3-octyloxyphenyl)-5,8-quinoxalinediyl]-2,5-thiophenediyl] (TQ1), the photon-to-current conversion spectrum is highly improved in the red wavelength region, suggesting that the polymer also contributes to the photocurrent generation in this case. This report provides a new direction for further optimization of Bi-halide solar cells by using dopant-free hole-transporting polymers and shows that the energy levels and the interaction between the Bi-halide and the conducting polymers are very important for solar cell performance. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Influence of magnetic impurities on charge transport in diffusive-normal-metal/superconductor junctions

NARCIS (Netherlands)

Yokoyama, T.; Tanaka, Y.; Golubov, Alexandre Avraamovitch; Inoue, J.; Asano, Y.

2005-01-01

Charge transport in the diffusive normal metal (DN)/insulator/s- and d-wave superconductor junctions is studied in the presence of magnetic impurities in DN in the framework of the quasiclassical Usadel equations with the generalized boundary conditions. The cases of s- and d-wave superconducting

CET89 - CHEMICAL EQUILIBRIUM WITH TRANSPORT PROPERTIES, 1989

Science.gov (United States)

Mcbride, B.

1994-01-01

Scientists and engineers need chemical equilibrium composition data to calculate the theoretical thermodynamic properties of a chemical system. This information is essential in the design and analysis of equipment such as compressors, turbines, nozzles, engines, shock tubes, heat exchangers, and chemical processing equipment. The substantial amount of numerical computation required to obtain equilibrium compositions and transport properties for complex chemical systems led scientists at NASA's Lewis Research Center to develop CET89, a program designed to calculate the thermodynamic and transport properties of these systems. CET89 is a general program which will calculate chemical equilibrium compositions and mixture properties for any chemical system with available thermodynamic data. Generally, mixtures may include condensed and gaseous products. CET89 performs the following operations: it 1) obtains chemical equilibrium compositions for assigned thermodynamic states, 2) calculates dilute-gas transport properties of complex chemical mixtures, 3) obtains Chapman-Jouguet detonation properties for gaseous species, 4) calculates incident and reflected shock properties in terms of assigned velocities, and 5) calculates theoretical rocket performance for both equilibrium and frozen compositions during expansion. The rocket performance function allows the option of assuming either a finite area or an infinite area combustor. CET89 accommodates problems involving up to 24 reactants, 20 elements, and 600 products (400 of which may be condensed). The program includes a library of thermodynamic and transport properties in the form of least squares coefficients for possible reaction products. It includes thermodynamic data for over 1300 gaseous and condensed species and transport data for 151 gases. The subroutines UTHERM and UTRAN convert thermodynamic and transport data to unformatted form for faster processing. The program conforms to the FORTRAN 77 standard, except for

Space Charge Correction on Emittance Measurement of Low Energy Electron Beams

Energy Technology Data Exchange (ETDEWEB)

Treado, Colleen J.; /Massachusetts U., Amherst

2012-09-07

The goal of any particle accelerator is to optimize the transport of a charged particle beam along a set path by confining the beam to a small region close to the design trajectory and directing it accurately along the beamline. To do so in the simplest fashion, accelerators use a system of magnets that exert approximately linear electromagnetic forces on the charged beam. These electromagnets bend the beam along the desired path, in the case of bending magnets, and constrain the beam to the desired area through alternating focusing and defocusing effects, in the case of quadrupole magnets. We can model the transport of such a beam through transfer matrices representing the actions of the various beamline elements. However, space charge effects, produced from self electric fields within the beam, defocus the beam and must be accounted for in the calculation of beam emittance. We present below the preliminary results of a MATLAB code built to model the transport of a charged particle beam through an accelerator and measure the emittance under the influence of space charge effects. We demonstrate the method of correctly calculating the emittance of a beam under space charge effects using a least square fit to determine the initial properties of the beam given the beam size measured at a specific point after transport.

Heterojunction PbS nanocrystal solar cells with oxide charge-transport layers.

Science.gov (United States)

Hyun, Byung-Ryool; Choi, Joshua J; Seyler, Kyle L; Hanrath, Tobias; Wise, Frank W

2013-12-23

Oxides are commonly employed as electron-transport layers in optoelectronic devices based on semiconductor nanocrystals, but are relatively rare as hole-transport layers. We report studies of NiO hole-transport layers in PbS nanocrystal photovoltaic structures. Transient fluorescence experiments are used to verify the relevant energy levels for hole transfer. On the basis of these results, planar heterojunction devices with ZnO as the photoanode and NiO as the photocathode were fabricated and characterized. Solution-processed devices were used to systematically study the dependence on nanocrystal size and achieve conversion efficiency as high as 2.5%. Optical modeling indicates that optimum performance should be obtained with thinner oxide layers than can be produced reliably by solution casting. Room-temperature sputtering allows deposition of oxide layers as thin as 10 nm, which enables optimization of device performance with respect to the thickness of the charge-transport layers. The best devices achieve an open-circuit voltage of 0.72 V and efficiency of 5.3% while eliminating most organic material from the structure and being compatible with tandem structures.

Disorder Effects in Charge Transport and Spin Response of Topological Insulators

Science.gov (United States)

Zhao, Lukas Zhonghua

Topological insulators are a class of solids in which the non-trivial inverted bulk band structure gives rise to metallic surface states that are robust against impurity backscattering. First principle calculations predicted Bi2Te3, Sb2Te3 and Bi2Se3 to be three-dimensional (3D) topological insulators with a single Dirac cone on the surface. The topological surface states were subsequently observed by angle-resolved photoemission (ARPES) and scanning tunneling microscopy (STM). The investigations of charge transport through topological surfaces of 3D topological insulators, however, have faced a major challenge due to large charge carrier densities in the bulk donated by randomly distributed defects such as vacancies and antisites. This bulk disorder intermixes surface and bulk conduction channels, thereby complicating access to the low-energy (Dirac point) charge transport or magnetic response and resulting in the relatively low measured carrier mobilities. Moreover, charge inhomogeneity arising from bulk disorder can result in pronounced nanoscale spatial fluctuations of energy on the surface, leading to the formation of surface `puddles' of different carrier types. Great efforts have been made to combat the undesirable effects of disorder in 3D topological insulators and to reduce bulk carriers through chemical doping, nanostructure fabrication, and electric gating. In this work we have developed a new way to reduce bulk carrier densities using high-energy electron irradiation, thereby allowing us access to the topological surface quantum channels. We also found that disorder in 3D topological insulators can be beneficial. It can play an important part in enabling detection of unusual magnetic response from Dirac fermions and in uncovering new excitations, namely surface superconductivity in Dirac `puddles'. In Chapter 3 we show how by using differential magnetometry we could probe spin rotation in the 3D topological material family (Bi2Se 3, Bi2Te3 and Sb2Te3

Nonlinear transport properties of non-ideal systems

International Nuclear Information System (INIS)

Pavlov, G A

2009-01-01

The theory of nonlinear transport is elaborated to determine the Burnett transport properties of non-ideal multi-element plasma and neutral systems. The procedure for the comparison of the phenomenological conservation equations of a continuous dense medium and the microscopic equations for dynamical variable operators is used for the definition of these properties. The Mori algorithm is developed to derive the equations of motion of dynamical value operators of a non-ideal system in the form of the generalized nonlinear Langevin equations. In consequence, the microscopic expressions of transport coefficients corresponding to second-order thermal disturbances (temperature, mass velocity, etc) have been found in the long wavelength and low frequency limits

Charge Transport Phenomena in Peptide Molecular Junctions

International Nuclear Information System (INIS)

Luchini, A.; Petricoin, E.F.; Geho, D.H.; Liotta, L.A.; Long, D.P.; Vaisman, I.I.

2008-01-01

Inelastic electron tunneling spectroscopy (IETS) is a valuable in situ spectroscopic analysis technique that provides a direct portrait of the electron transport properties of a molecular species. In the past, IETS has been applied to small molecules. Using self-assembled nano electronic junctions, IETS was performed for the first time on a large polypeptide protein peptide in the phosphorylated and native form, yielding interpretable spectra. A reproducible 10-fold shift of the I/V characteristics of the peptide was observed upon phosphorylation. Phosphorylation can be utilized as a site-specific modification to alter peptide structure and thereby influence electron transport in peptide molecular junctions. It is envisioned that kinases and phosphatases may be used to create tunable systems for molecular electronics applications, such as biosensors and memory devices.

Charge transport models for reliability engineering of semiconductor devices

International Nuclear Information System (INIS)

Bina, M.

2014-01-01

The simulation of semiconductor devices is important for the assessment of device lifetimes before production. In this context, this work investigates the influence of the charge carrier transport model on the accuracy of bias temperature instability and hot-carrier degradation models in MOS devices. For this purpose, a four-state defect model based on a non-radiative multi phonon (NMP) theory is implemented to study the bias temperature instability. However, the doping concentrations typically used in nano-scale devices correspond to only a small number of dopants in the channel, leading to fluctuations of the electrostatic potential. Thus, the granularity of the doping cannot be ignored in these devices. To study the bias temperature instability in the presence of fluctuations of the electrostatic potential, the advanced drift diffusion device simulator Minimos-NT is employed. In a first effort to understand the bias temperature instability in p-channel MOSFETs at elevated temperatures, data from direct-current-current-voltage measurements is successfully reproduced using a four-state defect model. Differences between the four-state defect model and the commonly employed trapping model from Shockley, Read and Hall (SRH) have been investigated showing that the SRH model is incapable of reproducing the measurement data. This is in good agreement with the literature, where it has been extensively shown that a model based on SRH theory cannot reproduce the characteristic time constants found in BTI recovery traces. Upon inspection of recorded recovery traces after bias temperature stress in n-channel MOSFETs it is found that the gate current is strongly correlated with the drain current (recovery trace). Using a random discrete dopant model and non-equilibrium greens functions it is shown that direct tunnelling cannot explain the magnitude of the gate current reduction. Instead it is found that trap-assisted tunnelling, modelled using NMP theory, is the cause of this

Thermodynamic and transport properties of gaseous tetrafluoromethane in chemical equilibrium

Science.gov (United States)

Hunt, J. L.; Boney, L. R.

1973-01-01

Equations and in computer code are presented for the thermodynamic and transport properties of gaseous, undissociated tetrafluoromethane (CF4) in chemical equilibrium. The computer code calculates the thermodynamic and transport properties of CF4 when given any two of five thermodynamic variables (entropy, temperature, volume, pressure, and enthalpy). Equilibrium thermodynamic and transport property data are tabulated and pressure-enthalpy diagrams are presented.

Transport properties site descriptive model. Guidelines for evaluation and modelling

International Nuclear Information System (INIS)

Berglund, Sten; Selroos, Jan-Olof

2004-04-01

This report describes a strategy for the development of Transport Properties Site Descriptive Models within the SKB Site Investigation programme. Similar reports have been produced for the other disciplines in the site descriptive modelling (Geology, Hydrogeology, Hydrogeochemistry, Rock mechanics, Thermal properties, and Surface ecosystems). These reports are intended to guide the site descriptive modelling, but also to provide the authorities with an overview of modelling work that will be performed. The site descriptive modelling of transport properties is presented in this report and in the associated 'Strategy for the use of laboratory methods in the site investigations programme for the transport properties of the rock', which describes laboratory measurements and data evaluations. Specifically, the objectives of the present report are to: Present a description that gives an overview of the strategy for developing Site Descriptive Models, and which sets the transport modelling into this general context. Provide a structure for developing Transport Properties Site Descriptive Models that facilitates efficient modelling and comparisons between different sites. Provide guidelines on specific modelling issues where methodological consistency is judged to be of special importance, or where there is no general consensus on the modelling approach. The objectives of the site descriptive modelling process and the resulting Transport Properties Site Descriptive Models are to: Provide transport parameters for Safety Assessment. Describe the geoscientific basis for the transport model, including the qualitative and quantitative data that are of importance for the assessment of uncertainties and confidence in the transport description, and for the understanding of the processes at the sites. Provide transport parameters for use within other discipline-specific programmes. Contribute to the integrated evaluation of the investigated sites. The site descriptive modelling of

Charge Transport Along Phenylenevinylene Molecular Wires

OpenAIRE

2006-01-01

Abstract A model to calculate the mobility of charges along molecular wires is presented. The model is based on the tight-binding approximation and combines a quantum mechanical description of the charge with a classical description of the structural degrees of freedom. It is demonstrated that the average mobility of charge carriers along molecular wires can be obtained by time-propagation of states which are initially localised. The model is used to calculate the mobility of charg...

Solving the Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem by Dynamic Programming

DEFF Research Database (Denmark)

Christensen, Tue; Andersen, Kim Allan; Klose, Andreas

2013-01-01

This paper considers a minimum-cost network flow problem in a bipartite graph with a single sink. The transportation costs exhibit a staircase cost structure because such types of transportation cost functions are often found in practice. We present a dynamic programming algorithm for solving...... this so-called single-sink, fixed-charge, multiple-choice transportation problem exactly. The method exploits heuristics and lower bounds to peg binary variables, improve bounds on flow variables, and reduce the state-space variable. In this way, the dynamic programming method is able to solve large...... instances with up to 10,000 nodes and 10 different transportation modes in a few seconds, much less time than required by a widely used mixed-integer programming solver and other methods proposed in the literature for this problem....

Integral transport theory for charged particles in electric and magnetic fields

International Nuclear Information System (INIS)

Boffi, V.C.; Molinari, V.G.

1979-01-01

An integral transport theory for charged particles which, in the presence of electric and magnetic fields, diffuse by collisions against the atoms (or molecules) of a host medium is proposed. The combined effects of both the external fields and the mechanisms of scattering, removal and creation in building up the distribution function of the charged particles considered are investigated. The eigenvalue problem associated with the sourceless case of the given physical situation is also commented. Applications of the theory to a purely velocity-dependent problem and to a space-dependent problem, respectively, are illustrated for the case of a separable isotropic scattering kernel of synthetic type. Calculations of the distribution function, of the total current density and of relevant electrical conductivity are then carried out for different specializations of the external fields. (author)

Polarization of electron-beam irradiated LDPE films: contribution to charge generation and transport

Science.gov (United States)

Banda, M. E.; Griseri, V.; Teyssèdre, G.; Le Roy, S.

2018-04-01

Electron-beam irradiation is an alternative way to generate charges in insulating materials, at controlled position and quantity, in order to monitor their behaviour in regard to transport phenomena under the space charge induced electric field or external field applied. In this study, low density polyethylene (LDPE) films were irradiated by a 80 keV electron-beam with a flux of 1 nA cm‑2 during 10 min in an irradiation chamber under vacuum conditions, and were then characterized outside the chamber using three experimental methods. The electrical behaviour of the irradiated material was assessed by space charge measurements using the pulsed electro-acoustic (PEA) method under dc stress. The influence of the applied electric field polarity and amplitude has been tested in order to better understand the charge behaviour after electron-beam irradiation. Fourier transform infra-red spectroscopy (FTIR) and photoluminescence (PL) measurements were performed to evaluate the impact of the electron beam irradiation, i.e. deposited charges and energy, on the chemical structure of the irradiated samples. The present results show that the electrical behaviour in LDPE after irradiation is mostly driven by charges, i.e. by physical process functions of the electric field, and that changes in the chemical structure seems to be mild.

Properties of structural steels melted out of high-purity charge

International Nuclear Information System (INIS)

Marchenko, V.N.; Sergeeva, T.K.; Kondakova, N.K.; Morozov, V.P.; Madorskij, L.L.

1993-01-01

A comparative evaluation has been made of impurities, mechanical properties and hydrogen embirittlement parameters for steels type 40Kh and 40KhS produced by electrometallurgical method with the use of direct reduced charge (DR-steels) and melted in an open-hearth furnace. Investigation results have shown that 40Kh and 40KhS Dr-steels have more coarse austenitic grains and experience more complete transformation of martensite into ferritic-pearlitic mixture on tempering. Threshold stresses increase 2.5 times due to purity enhancement at the expense of application of direct reduced charge

Effet Hall quantique, liquides de Luttinger et charges fractionnaires

Science.gov (United States)

Roche, Patrice; Rodriguez, V.; Glattli, D. Christian

We review some basic properties of the Fractional Quantum Hall Effect and particularly address the physics of the edge states. The chiral Luttinger liquid properties of the edges are discussed and probed experimentally using transport measurements. Shot noise measurements, which allow determination of the quasiparticle charge are also discussed. To cite this article: P. Roche et al., C. R. Physique 3 (2002) 717-732.

The electric charge of the aerosols under gamma radiation

International Nuclear Information System (INIS)

Gensdarmes, F.; Cetier, P.; Boulaud, D.; Gensdarmes, F.; Renoux, A.

2000-01-01

During a PWR type reactor accident, the gamma radiation may create a high ionized atmosphere. In such a situation the aerosols properties knowledge is useful to simulate the particles transport and deposit in the enclosed. The aim of this study is to determine the aerosol charges distribution in a high ionized medium, in function of the ionic properties of the medium. (A.L.B.)

Photoluminescence and charge-transport characteristics of nano-columnar titanium dioxide films prepared by rf-sputtering on alumina templates

Science.gov (United States)

Kheirandish, E.; Hosseini, T.; Yavarishad, N.; King, S.; Kouklin, N.

2018-02-01

The current study presents the synthesis and characterization of poly-crystalline TiO2 thin-film prepared by rf-sputtering on top of a highly regimented nanoporous Au-coated Al2O3 substrate. The film’s physical and electronic properties were characterized via SEM, EDS, x-ray diffraction and RAMAN spectroscopy as well as temperature dependent photoluminescence (PL) and I-V measurements. The films feature a 1D, columnar-like structure and exhibit a medium strength, spectrally-broad light emission in the UV-visible range. PL emission shows a weak T-dependence and is attributed to interband electronic transitions and defect-assisted radiative recombinations. The charge transport is confirmed to be polaronic in nature with both thermally-assisted hopping and quantum mechanical tunneling regulating a charge flow within the columns in the intermediate temperature regime of ˜200-320 K. These results open a door to utilizing nano-textured substrates/scaffolds to produce electronic-grade anatase TiO2 by sputtering for advanced opto-electronic device applications.

Charge Transport in Two-Photon Semiconducting Structures for Solar Fuels.

Science.gov (United States)

Liu, Guohua; Du, Kang; Haussener, Sophia; Wang, Kaiying

2016-10-20

Semiconducting heterostructures are emerging as promising light absorbers and offer effective electron-hole separation to drive solar chemistry. This technology relies on semiconductor composites or photoelectrodes that work in the presence of a redox mediator and that create cascade junctions to promote surface catalytic reactions. Rational tuning of their structures and compositions is crucial to fully exploit their functionality. In this review, we describe the possibilities of applying the two-photon concept to the field of solar fuels. A wide range of strategies including the indirect combination of two semiconductors by a redox couple, direct coupling of two semiconductors, multicomponent structures with a conductive mediator, related photoelectrodes, as well as two-photon cells are discussed for light energy harvesting and charge transport. Examples of charge extraction models from the literature are summarized to understand the mechanism of interfacial carrier dynamics and to rationalize experimental observations. We focus on a working principle of the constituent components and linking the photosynthetic activity with the proposed models. This work gives a new perspective on artificial photosynthesis by taking simultaneous advantages of photon absorption and charge transfer, outlining an encouraging roadmap towards solar fuels. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fundamental aspects of plasma chemical physics transport

CERN Document Server

Capitelli, Mario; Laricchiuta, Annarita

2013-01-01

Fundamental Aspects of Plasma Chemical Physics: Tranpsort develops basic and advanced concepts of plasma transport to the modern treatment of the Chapman-Enskog method for the solution of the Boltzmann transport equation. The book invites the reader to consider actual problems of the transport of thermal plasmas with particular attention to the derivation of diffusion- and viscosity-type transport cross sections, stressing the role of resonant charge-exchange processes in affecting the diffusion-type collision calculation of viscosity-type collision integrals. A wide range of topics is then discussed including (1) the effect of non-equilibrium vibrational distributions on the transport of vibrational energy, (2) the role of electronically excited states in the transport properties of thermal plasmas, (3) the dependence of transport properties on the multitude of Saha equations for multi-temperature plasmas, and (4) the effect of the magnetic field on transport properties. Throughout the book, worked examples ...

Effect of Surface Hydration on Antifouling Properties of Mixed Charged Polymers.

Science.gov (United States)

Leng, Chuan; Huang, Hao; Zhang, Kexin; Hung, Hsiang-Chieh; Xu, Yao; Li, Yaoxin; Jiang, Shaoyi; Chen, Zhan

2018-05-07

Interfacial water structure on a polymer surface in water (or surface hydration) is related to the antifouling activity of the polymer. Zwitterionic polymer materials exhibit excellent antifouling activity due to their strong surface hydration. It was proposed to replace zwitterionic polymers using mixed charged polymers because it is much easier to prepare mixed charged polymer samples with much lower costs. In this study, using sum frequency generation (SFG) vibrational spectroscopy, we investigated interfacial water structures on mixed charged polymer surfaces in water, and how such structures change while exposing to salt solutions and protein solutions. The 1:1 mixed charged polymer exhibits excellent antifouling property while other mixed charged polymers with different ratios of the positive/negative charges do not. It was found that on the 1:1 mixed charged polymer surface, SFG water signal is dominated by the contribution of the strongly hydrogen bonded water molecules, indicating strong hydration of the polymer surface. The responses of the 1:1 mixed charged polymer surface to salt solutions are similar to those of zwitterionic polymers. Interestingly, exposure to high concentrations of salt solutions leads to stronger hydration of the 1:1 mixed charged polymer surface after replacing the salt solution with water. Protein molecules do not substantially perturb the interfacial water structure on the 1:1 mixed charged polymer surface and do not adsorb to the surface, showing that this mixed charged polymer is an excellent antifouling material.

Charge transport through superconductor/Anderson-insulator interfaces

International Nuclear Information System (INIS)

Frydman, A.; Ovadyahu, Z.

1997-01-01

We report on a study of charge transport through superconductor-insulator-superconductor and normal metal endash insulator endash superconductor structures (SIS and NIS junctions, respectively) where the insulator is of the Anderson type. Devices which are characterized by a junction resistance larger than 10 kΩ show behavior which is typical of Giaever tunnel junctions. In structures having smaller resistance, several peculiar features are observed. In the SIS junctions, Josephson coupling is detected over distances much larger then the typical insulator localization length. In addition, a series of resistance peaks appears at voltages of 2Δ/n, where Δ is the superconducting gap. The NIS Junctions exhibit a large resistance dip at subgap bias. We discuss possible interpretations of these findings and suggest that they may result from the presence of high transmission channels through the barrier region. copyright 1997 The American Physical Society

Enhanced charge transport and photovoltaic performance of PBDTTT-C-T/PC70BM solar cells via UV-ozone treatment.

Science.gov (United States)

Adhikary, Prajwal; Venkatesan, Swaminathan; Adhikari, Nirmal; Maharjan, Purna P; Adebanjo, Olusegun; Chen, Jihua; Qiao, Qiquan

2013-10-21

In this work, the electron transport layer of PBDTTT-C-T/PC70BM polymer solar cells were subjected to UV-ozone treatment, leading to improved cell performances from 6.46% to 8.34%. The solar cell efficiency reached a maximum of 8.34% after an optimal 5 minute UV-ozone treatment, and then decreased if treated for a longer time. To the best of our knowledge, the mechanism behind the effects of UV-ozone treatment on the improvement of charge transport and cell performance is not fully understood. We have developed a fundamental understanding of the UV-ozone treatment mechanism, which explains both the enhancements in charge transport and photovoltaic performance at an optimal treatment time, and also the phenomenon whereby further treatment time leads to a drop in cell efficiency. Transient photocurrent measurements indicated that the cell charge transport times were 1370 ns, 770 ns, 832 ns, 867 ns, and 1150 ns for the 0 min, 5 min, 10 min, 15 min, and 20 min UV-ozone treatment times, respectively. Therefore the 5 min UV-ozone treatment time led to the shortest transport time and the most efficient charge transport in the cells. The 5 min UV-ozone treated sample exhibited the highest peak intensity (E2) in the Raman spectra of the treated films, at about 437 cm(-1), indicating that it possessed the best wurtzite phase crystallinity of the ZnO films. Further increasing the UV-ozone treatment time from 5 to 20 min induced the formation of p-type defects (e.g. interstitial oxygen atoms), pushing the ZnO Fermi-level further away from the vacuum level, and decreasing the wurtzite crystallinity.

Electronic properties of disordered Weyl semimetals at charge neutrality

Science.gov (United States)

Holder, Tobias; Huang, Chia-Wei; Ostrovsky, Pavel M.

2017-11-01

Weyl semimetals have been intensely studied as a three-dimensional realization of a Dirac-like excitation spectrum where the conduction bands and valence bands touch at isolated Weyl points in momentum space. Like in graphene, this property entails various peculiar electronic properties. However, recent theoretical studies have suggested that resonant scattering from rare regions can give rise to a nonzero density of states even at charge neutrality. Here, we give a detailed account of this effect and demonstrate how the semimetallic nature is suppressed at the lowest scales. To this end, we develop a self-consistent T -matrix approach to investigate the density of states beyond the limit of weak disorder. Our results show a nonvanishing density of states at the Weyl point, which exhibits a nonanalytic dependence on the impurity density. This unusually strong effect of rare regions leads to a revised estimate for the conductivity close to the Weyl point and emphasizes possible deviations from semimetallic behavior in dirty Weyl semimetals at charge neutrality even with very low impurity concentration.