Variational multiscale models for charge transport.
Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin
2012-01-01
This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle
Variational multiscale models for charge transport
Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin
2012-01-01
This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle
A n-vector model for charge transport in molecular semiconductors.
Jackson, Nicholas E; Kohlstedt, Kevin L; Chen, Lin X; Ratner, Mark A
2016-11-28
We develop a lattice model utilizing coarse-grained molecular sites to study charge transport in molecular semiconducting materials. The model bridges atomistic descriptions and structureless lattice models by mapping molecular structure onto sets of spatial vectors isomorphic with spin vectors in a classical n-vector Heisenberg model. Specifically, this model incorporates molecular topology-dependent orientational and intermolecular coupling preferences, including the direct inclusion of spatially correlated transfer integrals and site energy disorder. This model contains the essential physics required to explicitly simulate the interplay of molecular topology and correlated structural disorder, and their effect on charge transport. As a demonstration of its utility, we apply this model to analyze the effects of long-range orientational correlations, molecular topology, and intermolecular interaction strength on charge motion in bulk molecular semiconductors.
Symmetrization of mathematical model of charge transport in semiconductors
Directory of Open Access Journals (Sweden)
Alexander M. Blokhin
2002-11-01
Full Text Available A mathematical model of charge transport in semiconductors is considered. The model is a quasilinear system of differential equations. A problem of finding an additional entropy conservation law and system symmetrization are solved.
Energy Technology Data Exchange (ETDEWEB)
Li, Guochang; Chen, George, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China); School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ (United Kingdom); Li, Shengtao, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China)
2016-08-08
Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loading concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.
International Nuclear Information System (INIS)
Lee, E.P.
1977-01-01
In a recent report (UCID 17346, ''Relativistic Particle Beam in a Semi-Infinite Axially Symmetric conducting channel extending from a perfectly conducting plane,'' Dec. 13, 1976) Cooper and Neil demonstrate that the net charge transported by a beam pulse injected into a channel of finite conductivity equals the charge of the beam itself. The channel is taken to be infinite in the positive z direction, has finite radius and is terminated by a conducting ground plane at z =0. This result is not an obvious one, and it is restricted in its applicability by the special model assumed for the channel. It is the purpose to explain the result of Cooper and Neil in more qualitative terms and to make similar calculations using several other channel models. It must be emphasized that these calculations are not concerned with the fate of the transported charge after the pulse has stopped, but rather with how much charge leaves the ground plane assuming the pulse does not stop
Charge transport in organic semiconductors.
Bässler, Heinz; Köhler, Anna
2012-01-01
Modern optoelectronic devices, such as light-emitting diodes, field-effect transistors and organic solar cells require well controlled motion of charges for their efficient operation. The understanding of the processes that determine charge transport is therefore of paramount importance for designing materials with improved structure-property relationships. Before discussing different regimes of charge transport in organic semiconductors, we present a brief introduction into the conceptual framework in which we interpret the relevant photophysical processes. That is, we compare a molecular picture of electronic excitations against the Su-Schrieffer-Heeger semiconductor band model. After a brief description of experimental techniques needed to measure charge mobilities, we then elaborate on the parameters controlling charge transport in technologically relevant materials. Thus, we consider the influences of electronic coupling between molecular units, disorder, polaronic effects and space charge. A particular focus is given to the recent progress made in understanding charge transport on short time scales and short length scales. The mechanism for charge injection is briefly addressed towards the end of this chapter.
International Nuclear Information System (INIS)
Le Roy, S; Segur, P; Teyssedre, G; Laurent, C
2004-01-01
We present a conduction model aimed at describing bipolar transport and space charge phenomena in low density polyethylene under dc stress. In the first part we recall the basic requirements for the description of charge transport and charge storage in disordered media with emphasis on the case of polyethylene. A quick review of available conduction models is presented and our approach is compared with these models. Then, the bases of the model are described and related assumptions are discussed. Finally, results on external current, trapped and free space charge distributions, field distribution and recombination rate are presented and discussed, considering a constant dc voltage, a step-increase of the voltage, and a polarization-depolarization protocol for the applied voltage. It is shown that the model is able to describe the general features reported for external current, electroluminescence and charge distribution in polyethylene
Solitary Model of the Charge Particle Transport in Collisionless Plasma
International Nuclear Information System (INIS)
Simonchik, L.V.; Trukhachev, F.M.
2006-01-01
The one-dimensional MHD solitary model of charged particle transport in plasma is developed. It is shown that self-consistent electric field of ion-acoustic solitons can displace charged particles in space, which can be a reason of local electric current generation. The displacement amount is order of a few Debye lengths. It is shown that the current associated with soliton cascade has pulsating nature with DC component. Methods of built theory verification in dusty plasma are proposed
The thermoballistic transport model a novel approach to charge carrier transport in semiconductors
Lipperheide, Reinhard
2014-01-01
The book presents a comprehensive survey of the thermoballistic approach to charge carrier transport in semiconductors. This semi-classical approach, which the authors have developed over the past decade, bridges the gap between the opposing drift-diffusion and ballistic models of carrier transport. While incorporating basic features of the latter two models, the physical concept underlying the thermoballistic approach constitutes a novel, unifying scheme. It is based on the introduction of "ballistic configurations" arising from a random partitioning of the length of a semiconducting sample into ballistic transport intervals. Stochastic averaging of the ballistic carrier currents over the ballistic configurations results in a position-dependent thermoballistic current, which is the key element of the thermoballistic concept and forms the point of departure for the calculation of all relevant transport properties. In the book, the thermoballistic concept and its implementation are developed in great detai...
Charge Transport Processes in Molecular Junctions
Smith, Christopher Eugene
Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (chemically gated to modulate the transport. These results help advance our understanding of transport behavior in semiconducting molecular thin films, and open opportunities to engineer improved electronic functionality into molecular devices.
Role of molecular charge in nucleocytoplasmic transport.
Directory of Open Access Journals (Sweden)
Alexander Goryaynov
Full Text Available Transport of genetic materials and proteins between the nucleus and cytoplasm of eukaryotic cells is mediated by nuclear pore complexes (NPCs. A selective barrier formed by phenylalanine-glycine (FG nucleoporins (Nups with net positive charges in the NPC allows for passive diffusion of signal-independent small molecules and transport-receptor facilitated translocation of signal-dependent cargo molecules. Recently, negative surface charge was postulated to be another essential criterion for selective passage through the NPC. However, the charge-driven mechanism in determining the transport kinetics and spatial transport route for either passive diffusion or facilitated translocation remains obscure. Here we employed high-speed single-molecule fluorescence microscopy with an unprecedented spatiotemporal resolution of 9 nm and 400 µs to uncover these mechanistic fundamentals for nuclear transport of charged substrates through native NPCs. We found that electrostatic interaction between negative surface charges on transiting molecules and the positively charged FG Nups, although enhancing their probability of binding to the NPC, never plays a dominant role in determining their nuclear transport mode or spatial transport route. A 3D reconstruction of transport routes revealed that small signal-dependent endogenous cargo protein constructs with high positive surface charges that are destined to the nucleus, rather than repelled from the NPC as suggested in previous models, passively diffused through an axial central channel of the NPC in the absence of transport receptors. Finally, we postulated a comprehensive map of interactions between transiting molecules and FG Nups during nucleocytoplasmic transport by combining the effects of molecular size, signal and surface charge.
Charge Transport in LDPE Nanocomposites Part II—Computational Approach
Directory of Open Access Journals (Sweden)
Anh T. Hoang
2016-03-01
Full Text Available A bipolar charge transport model is employed to investigate the remarkable reduction in dc conductivity of low-density polyethylene (LDPE based material filled with uncoated nanofillers (reported in the first part of this work. The effect of temperature on charge transport is considered and the model outcomes are compared with measured conduction currents. The simulations reveal that the contribution of charge carrier recombination to the total transport process becomes more significant at elevated temperatures. Among the effects caused by the presence of nanoparticles, a reduced charge injection at electrodes has been found as the most essential one. Possible mechanisms for charge injection at different temperatures are therefore discussed.
Charge transport models for reliability engineering of semiconductor devices
International Nuclear Information System (INIS)
Bina, M.
2014-01-01
The simulation of semiconductor devices is important for the assessment of device lifetimes before production. In this context, this work investigates the influence of the charge carrier transport model on the accuracy of bias temperature instability and hot-carrier degradation models in MOS devices. For this purpose, a four-state defect model based on a non-radiative multi phonon (NMP) theory is implemented to study the bias temperature instability. However, the doping concentrations typically used in nano-scale devices correspond to only a small number of dopants in the channel, leading to fluctuations of the electrostatic potential. Thus, the granularity of the doping cannot be ignored in these devices. To study the bias temperature instability in the presence of fluctuations of the electrostatic potential, the advanced drift diffusion device simulator Minimos-NT is employed. In a first effort to understand the bias temperature instability in p-channel MOSFETs at elevated temperatures, data from direct-current-current-voltage measurements is successfully reproduced using a four-state defect model. Differences between the four-state defect model and the commonly employed trapping model from Shockley, Read and Hall (SRH) have been investigated showing that the SRH model is incapable of reproducing the measurement data. This is in good agreement with the literature, where it has been extensively shown that a model based on SRH theory cannot reproduce the characteristic time constants found in BTI recovery traces. Upon inspection of recorded recovery traces after bias temperature stress in n-channel MOSFETs it is found that the gate current is strongly correlated with the drain current (recovery trace). Using a random discrete dopant model and non-equilibrium greens functions it is shown that direct tunnelling cannot explain the magnitude of the gate current reduction. Instead it is found that trap-assisted tunnelling, modelled using NMP theory, is the cause of this
Charge and spin transport in mesoscopic superconductors
Directory of Open Access Journals (Sweden)
M. J. Wolf
2014-02-01
Full Text Available Background: Non-equilibrium charge transport in superconductors has been investigated intensely in the 1970s and 1980s, mostly in the vicinity of the critical temperature. Much less attention has been paid to low temperatures and the role of the quasiparticle spin.Results: We report here on nonlocal transport in superconductor hybrid structures at very low temperatures. By comparing the nonlocal conductance obtained by using ferromagnetic and normal-metal detectors, we discriminate charge and spin degrees of freedom. We observe spin injection and long-range transport of pure, chargeless spin currents in the regime of large Zeeman splitting. We elucidate charge and spin transport by comparison to theoretical models.Conclusion: The observed long-range chargeless spin transport opens a new path to manipulate and utilize the quasiparticle spin in superconductor nanostructures.
Absence of ballistic charge transport in the half-filled 1D Hubbard model
Carmelo, J. M. P.; Nemati, S.; Prosen, T.
2018-05-01
Whether in the thermodynamic limit of lattice length L → ∞, hole concentration mηz = - 2 Sηz/L = 1 -ne → 0, nonzero temperature T > 0, and U / t > 0 the charge stiffness of the 1D Hubbard model with first neighbor transfer integral t and on-site repulsion U is finite or vanishes and thus whether there is or there is no ballistic charge transport, respectively, remains an unsolved and controversial issue, as different approaches yield contradictory results. (Here Sηz = - (L -Ne) / 2 is the η-spin projection and ne =Ne / L the electronic density.) In this paper we provide an upper bound on the charge stiffness and show that (similarly as at zero temperature), for T > 0 and U / t > 0 it vanishes for mηz → 0 within the canonical ensemble in the thermodynamic limit L → ∞. Moreover, we show that at high temperature T → ∞ the charge stiffness vanishes as well within the grand-canonical ensemble for L → ∞ and chemical potential μ →μu where (μ -μu) ≥ 0 and 2μu is the Mott-Hubbard gap. The lack of charge ballistic transport indicates that charge transport at finite temperatures is dominated by a diffusive contribution. Our scheme uses a suitable exact representation of the electrons in terms of rotated electrons for which the numbers of singly occupied and doubly occupied lattice sites are good quantum numbers for U / t > 0. In contrast to often less controllable numerical studies, the use of such a representation reveals the carriers that couple to the charge probes and provides useful physical information on the microscopic processes behind the exotic charge transport properties of the 1D electronic correlated system under study.
Charge Transport in Conjugated Materials: From Theoretical Models to Experimental Systems
International Nuclear Information System (INIS)
Olivier, Yoann; Cornil, Jerome; Muccioli, Luca; Zannoni, Claudio
2008-01-01
Charge carrier mobility is the key quantity to characterize the charge transport properties in devices. Based on earlier work of Baessler and co-workers, we set up a Monte-Carlo approach that allows us to calculate mobility using transfer rates derived from Marcus theory. The parameters entering into the rate expression are evaluated by means of different quantum-chemical techniques. Our approach is applied here to a model one-dimensional system made of pentacene molecules as well as to real systems such as crystalline structures and columnar liquid crystal phases.
International Nuclear Information System (INIS)
Bauer, Thilo; Jäger, Christof M.; Jordan, Meredith J. T.; Clark, Timothy
2015-01-01
We have developed a multi-agent quantum Monte Carlo model to describe the spatial dynamics of multiple majority charge carriers during conduction of electric current in the channel of organic field-effect transistors. The charge carriers are treated by a neglect of diatomic differential overlap Hamiltonian using a lattice of hydrogen-like basis functions. The local ionization energy and local electron affinity defined previously map the bulk structure of the transistor channel to external potentials for the simulations of electron- and hole-conduction, respectively. The model is designed without a specific charge-transport mechanism like hopping- or band-transport in mind and does not arbitrarily localize charge. An electrode model allows dynamic injection and depletion of charge carriers according to source-drain voltage. The field-effect is modeled by using the source-gate voltage in a Metropolis-like acceptance criterion. Although the current cannot be calculated because the simulations have no time axis, using the number of Monte Carlo moves as pseudo-time gives results that resemble experimental I/V curves
Energy Technology Data Exchange (ETDEWEB)
Bauer, Thilo; Jäger, Christof M. [Department of Chemistry and Pharmacy, Computer-Chemistry-Center and Interdisciplinary Center for Molecular Materials, Friedrich-Alexander-Universität Erlangen-Nürnberg, Nägelsbachstrasse 25, 91052 Erlangen (Germany); Jordan, Meredith J. T. [School of Chemistry, University of Sydney, Sydney, NSW 2006 (Australia); Clark, Timothy, E-mail: tim.clark@fau.de [Department of Chemistry and Pharmacy, Computer-Chemistry-Center and Interdisciplinary Center for Molecular Materials, Friedrich-Alexander-Universität Erlangen-Nürnberg, Nägelsbachstrasse 25, 91052 Erlangen (Germany); Centre for Molecular Design, University of Portsmouth, Portsmouth PO1 2DY (United Kingdom)
2015-07-28
We have developed a multi-agent quantum Monte Carlo model to describe the spatial dynamics of multiple majority charge carriers during conduction of electric current in the channel of organic field-effect transistors. The charge carriers are treated by a neglect of diatomic differential overlap Hamiltonian using a lattice of hydrogen-like basis functions. The local ionization energy and local electron affinity defined previously map the bulk structure of the transistor channel to external potentials for the simulations of electron- and hole-conduction, respectively. The model is designed without a specific charge-transport mechanism like hopping- or band-transport in mind and does not arbitrarily localize charge. An electrode model allows dynamic injection and depletion of charge carriers according to source-drain voltage. The field-effect is modeled by using the source-gate voltage in a Metropolis-like acceptance criterion. Although the current cannot be calculated because the simulations have no time axis, using the number of Monte Carlo moves as pseudo-time gives results that resemble experimental I/V curves.
Modeling charge transport properties of cyano-substituted PPV
International Nuclear Information System (INIS)
Correia, Helena M.G.; Ramos, Marta M.D.
2003-01-01
In recent years, poly (p-phenylenevinylene) (PPV) and its derivatives have attracted much interest due to their applications in light-emitting diodes (LEDs). One of the issues that determine device performance is the transport of charge carriers along the polymer strands. For that reason, we investigate the influence of cyano substitution on geometry and electronic behaviour of PPV chains using self-consistent quantum molecular dynamics simulations. Our results suggest that substitution by cyano groups induce distortion in the PPV chains and a charge rearrangement among the polymer atoms. Specifically addressed is the issue concerning estimates of charge (electron and hole) mobility by computer experiments. Significant differences have been found both in the strength of the electric field needed to move positive and negative charge carriers along the polymer chain as well as in charge mobility
Charging and Transport Dynamics of a Flow-Through Electrode Capacitive Deionization System.
Qu, Yatian; Campbell, Patrick G; Hemmatifar, Ali; Knipe, Jennifer M; Loeb, Colin K; Reidy, John J; Hubert, Mckenzie A; Stadermann, Michael; Santiago, Juan G
2018-01-11
We present a study of the interplay among electric charging rate, capacitance, salt removal, and mass transport in "flow-through electrode" capacitive deionization (CDI) systems. We develop two models describing coupled transport and electro-adsorption/desorption which capture salt removal dynamics. The first model is a simplified, unsteady zero-dimensional volume-averaged model which identifies dimensionless parameters and figures of merits associated with cell performance. The second model is a higher fidelity area-averaged model which captures both spatial and temporal responses of charging. We further conducted an experimental study of these dynamics and considered two salt transport regimes: (1) advection-limited regime and (2) dispersion-limited regime. We use these data to validate models. The study shows that, in the advection-limited regime, differential charge efficiency determines the salt adsorption at the early stage of the deionization process. Subsequently, charging transitions to a quasi-steady state where salt removal rate is proportional to applied current scaled by the inlet flow rate. In the dispersion-dominated regime, differential charge efficiency, cell volume, and diffusion rates govern adsorption dynamics and flow rate has little effect. In both regimes, the interplay among mass transport rate, differential charge efficiency, cell capacitance, and (electric) charging current governs salt removal in flow-through electrode CDI.
Arbabi, Vahid; Pouran, Behdad; Weinans, Harrie; Zadpoor, Amir A
2016-06-14
Charged and uncharged solutes penetrate through cartilage to maintain the metabolic function of chondrocytes and to possibly restore or further breakdown the cartilage tissue in different stages of osteoarthritis. In this study the transport of charged solutes across the various zones of cartilage was quantified, taken into account the physicochemical interactions between the solute and the cartilage constituents. A multiphasic finite-bath finite element (FE) model was developed to simulate equine cartilage diffusion experiments that used a negatively charged contrast agent (ioxaglate) in combination with serial micro-computed tomography (micro-CT) to measure the diffusion. By comparing the FE model with the experimental data both the diffusion coefficient of ioxaglate and the fixed charge density (FCD) were obtained. In the multiphasic model, cartilage was divided into multiple (three) zones to help understand how diffusion coefficient and FCD vary across cartilage thickness. The direct effects of charged solute-FCD interaction on diffusion were investigated by comparing the diffusion coefficients derived from the multiphasic and biphasic-solute models. We found a relationship between the FCD obtained by the multiphasic model and ioxaglate partitioning obtained from micro-CT experiments. Using our multi-zone multiphasic model, diffusion coefficient of the superficial zone was up to ten-fold higher than that of the middle zone, while the FCD of the middle zone was up to almost two-fold higher than that of the superficial zone. In conclusion, the developed finite-bath multiphasic model provides us with a non-destructive method by which we could obtain both diffusion coefficient and FCD of different cartilage zones. The outcomes of the current work will also help understand how charge of the bath affects the diffusion of a charged molecule and also predict the diffusion behavior of a charged solute across articular cartilage. Copyright © 2016 Elsevier Ltd. All
Charge-transport simulations in organic semiconductors
Energy Technology Data Exchange (ETDEWEB)
May, Falk
2012-07-06
In this thesis we have extended the methods for microscopic charge-transport simulations for organic semiconductors, where weak intermolecular interactions lead to spatially localized charge carriers, and the charge transport occurs as an activated hopping process between diabatic states. In addition to weak electronic couplings between these states, different electrostatic environments in the organic material lead to a broadening of the density of states for the charge energies which limits carrier mobilities. The contributions to the method development include (i) the derivation of a bimolecular charge-transfer rate, (ii) the efficient evaluation of intermolecular (outer-sphere) reorganization energies, (iii) the investigation of effects of conformational disorder on intramolecular reorganization energies or internal site energies and (iv) the inclusion of self-consistent polarization interactions for calculation of charge energies. These methods were applied to study charge transport in amorphous phases of small molecules used in the emission layer of organic light emitting diodes (OLED). When bulky substituents are attached to an aromatic core in order to adjust energy levels or prevent crystallization, a small amount of delocalization of the frontier orbital to the substituents can increase electronic couplings between neighboring molecules. This leads to improved charge-transfer rates and, hence, larger charge-mobility. We therefore suggest using the mesomeric effect (as opposed to the inductive effect) when attaching substituents to aromatic cores, which is necessary for example in deep blue OLEDs, where the energy levels of a host molecule have to be adjusted to those of the emitter. Furthermore, the energy landscape for charges in an amorphous phase cannot be predicted by mesoscopic models because they approximate the realistic morphology by a lattice and represent molecular charge distributions in a multipole expansion. The microscopic approach shows that
Xu, Guangwei
2018-02-22
Charge transport governs the operation and performance of organic diodes. Illuminating the charge-transfer/transport processes across the interfaces and the bulk organic semiconductors is at the focus of intensive investigations. Traditionally, the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I–V characteristics, still represents a major challenge. Here, the electrical potential distribution in planar organic diodes is investigated by using the scanning Kelvin probe force microscopy technique, a method that can clearly separate the contact and bulk regimes of charge transport. Interestingly, by applying to devices based on novel, high mobility organic materials, the space-charge-limited-current-like I–V curves, which are previously believed to be a result of the bulk transport, are surprisingly but unambiguously demonstrated to be caused by contact-limited conduction. A model accounting is developed for the transport properties of both the two metal/organic interfaces and the bulk. The results indicate that pure interface-dominated transport can indeed give rise to I–V curves similar to those caused by bulk transport. These findings provide a new insight into the charge injection and transport processes in organic diodes.
Charge transport in electrically doped amorphous organic semiconductors.
Yoo, Seung-Jun; Kim, Jang-Joo
2015-06-01
This article reviews recent progress on charge generation by doping and its influence on the carrier mobility in organic semiconductors (OSs). The doping induced charge generation efficiency is generally low in OSs which was explained by the integer charge transfer model and the hybrid charge transfer model. The ionized dopants formed by charge transfer between hosts and dopants can act as Coulomb traps for mobile charges, and the presence of Coulomb traps in OSs broadens the density of states (DOS) in doped organic films. The Coulomb traps strongly reduce the carrier hopping rate and thereby change the carrier mobility, which was confirmed by experiments in recent years. In order to fully understand the doping mechanism in OSs, further quantitative and systematic analyses of charge transport characteristics must be accomplished. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A Boltzmann-weighted hopping model of charge transport in organic semicrystalline films
Kwiatkowski, Joe J.; Jimison, Leslie H.; Salleo, Alberto; Spakowitz, Andrew J.
2011-01-01
We present a model of charge transport in polycrystalline electronic films, which considers details of the microscopic scale while simultaneously allowing realistically sized films to be simulated. We discuss the approximations and assumptions made by the model, and rationalize its application to thin films of directionally crystallized poly(3-hexylthiophene). In conjunction with experimental data, we use the model to characterize the effects of defects in these films. Our findings support the hypothesis that it is the directional crystallization of these films, rather than their defects, which causes anisotropic mobilities. © 2011 American Institute of Physics.
Macroscopic acoustoelectric charge transport in graphene
Bandhu, L.; Lawton, L. M.; Nash, G. R.
2013-09-01
We demonstrate macroscopic acoustoelectric transport in graphene, transferred onto piezoelectric lithium niobate substrates, between electrodes up to 500 μm apart. Using double finger interdigital transducers we have characterised the acoustoelectric current as a function of both surface acoustic wave intensity and frequency. The results are consistent with a relatively simple classical relaxation model, in which the acoustoelectric current is proportional to both the surface acoustic wave intensity and the attenuation of the wave caused by the charge transport.
Trap-controlled charge transport in corona-charged Teflon
International Nuclear Information System (INIS)
Gross, B.; Giacometti, J.A.; Ferreira, G.F.L.; Moreno A, R.A.
1980-01-01
The stability of negatively charged Teflon electrets is discussed. It is stated that it can only be explained by the assumption that the transport of excess charge is trap - controlled rather than mobility - controlled. (I.C.R.) [pt
Charge Injection and Transport in Metal/Polymer Chains/Metal Sandwich Structure
International Nuclear Information System (INIS)
Hai-Hong, Li; Dong-Mei, Li; Yuan, Li; Kun, Gao; De-Sheng, Liu; Shi-Jie, Xie
2008-01-01
Using the tight-binding Su–Schrieffer–Heeger model and a nonadiabatic dynamic evolution method, we study the dynamic processes of the charge injection and transport in a metal/two coupled conjugated polymer chains/metal structure. It is found that the charge interchain transport is determined by the strength of the electric field and the magnitude of the voltage bias applied on the metal electrode. The stronger electric field and the larger voltage bias are both in favour of the charge interchain transport. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Ambipolar charge transport in organic field-effect transistors
Smits, E.C.P.; Anthopoulos, T.D.; Setayesh, S.; Veenendaal, van E.; Coehoorn, R.; Blom, P.W.M.; Boer, de B.; Leeuw, de D.M.
2006-01-01
A model describing charge transport in disordered ambipolar organic field-effect transistors is presented. The basis of this model is the variable-range hopping in an exponential density of states developed for disordered unipolar organic transistors. We show that the model can be used to calculate
Charge transport in conjugated polymers: a multiscale picture
Ruehle, Victor; Kirkpatrick, James; Kremer, Kurt; Andrienko, Denis
2009-03-01
A framework to study charge transport in conjugated polymers using realistic morphologies is developed. First, the atomistic force field is refined using first-principles calculations. Systematic coarse graining is then performed to extend simulation times and system sizes accessible to molecular dynamics simulations. Material morphologies are generated using the coarse grained and atomistic models. Finally, the charge mobility is obtained using temperature activated hopping picture for charge transport [1]. The framework is tested on neutral and oxidized polypyrrole with different structural ordering [2]. [4pt] [1] J. Kirkpatrick, V. Marcon, J. Nelson, K. Kremer, D. Andrienko, Phys. Rev. Lett. 98, 227402 (2007)[0pt] [2] V. Ruehle, J. Kirkpatrick, K. Kremer, D. Andrienko, Phys. Stat. Solidi B, 245, 844 (2008)
Kadashchuk, Andrey; Tong, Fei; Janneck, Robby; Fishchuk, Ivan I.; Mityashin, Alexander; Pavlica, Egon; Köhler, Anna; Heremans, Paul; Rolin, Cedric; Bratina, Gvido; Genoe, Jan
2017-09-01
We demonstrate that the degree of charge delocalization has a strong impact on polarization energy and thereby on the position of the transport band edge in organic semiconductors. This gives rise to long-range potential fluctuations, which govern the electronic transport through delocalized states in organic crystalline layers. This concept is employed to formulate an analytic model that explains a negative field dependence coupled with a positive temperature dependence of the charge mobility observed by a lateral time-of-flight technique in a high-mobility crystalline organic layer. This has important implications for the further understanding of the charge transport via delocalized states in organic semiconductors.
Modeling the Charge Transport in Graphene Nano Ribbon Interfaces for Nano Scale Electronic Devices
Kumar, Ravinder; Engles, Derick
2015-05-01
In this research work we have modeled, simulated and compared the electronic charge transport for Metal-Semiconductor-Metal interfaces of Graphene Nano Ribbons (GNR) with different geometries using First-Principle calculations and Non-Equilibrium Green's Function (NEGF) method. We modeled junctions of Armchair GNR strip sandwiched between two Zigzag strips with (Z-A-Z) and Zigzag GNR strip sandwiched between two Armchair strips with (A-Z-A) using semi-empirical Extended Huckle Theory (EHT) within the framework of Non-Equilibrium Green Function (NEGF). I-V characteristics of the interfaces were visualized for various transport parameters. The distinct changes in conductance and I-V curves reported as the Width across layers, Channel length (Central part) was varied at different bias voltages from -1V to 1 V with steps of 0.25 V. From the simulated results we observed that the conductance through A-Z-A graphene junction is in the range of 10-13 Siemens whereas the conductance through Z-A-Z graphene junction is in the range of 10-5 Siemens. These suggested conductance controlled mechanisms for the charge transport in the graphene interfaces with different geometries is important for the design of graphene based nano scale electronic devices like Graphene FETs, Sensors.
Microscopic origins of charge transport in triphenylene systems
Thompson, Ian R.; Coe, Mary K.; Walker, Alison B.; Ricci, Matteo; Roscioni, Otello M.; Zannoni, Claudio
2018-06-01
We study the effects of molecular ordering on charge transport at the mesoscale level in a layer of ≈9000 hexa-octyl-thio-triphenylene discotic mesogens with dimensions of ≈20 ×20 ×60 nm3 . Ordered (columnar) and disordered isotropic morphologies are obtained from a combination of atomistic and coarse-grained molecular-dynamics simulations. Electronic structure codes are used to find charge hopping rates at the microscopic level. Energetic disorder is included through the Thole model. Kinetic Monte Carlo simulations then predict charge mobilities. We reproduce the large increase in mobility in going from an isotropic to a columnar morphology. To understand how these mobilities depend on the morphology and hopping rates, we employ graph theory to analyze charge trajectories by representing the film as a charge-transport network. This approach allows us to identify spatial correlations of molecule pairs with high transfer rates. These pairs must be linked to ensure good transport characteristics or may otherwise act as traps. Our analysis is straightforward to implement and will be a useful tool in linking materials to device performance, for example, to investigate the influence of local inhomogeneities in the current density. Our mobility-field curves show an increasing mobility with field, as would be expected for an organic semiconductor.
Impact of Tortuosity on Charge-Carrier Transport in Organic Bulk Heterojunction Blends
Heiber, Michael C.; Kister, Klaus; Baumann, Andreas; Dyakonov, Vladimir; Deibel, Carsten; Nguyen, Thuc-Quyen
2017-11-01
The impact of the tortuosity of the charge-transport pathways through a bulk heterojunction film on the charge-carrier mobility is theoretically investigated using model morphologies and kinetic Monte Carlo simulations. The tortuosity descriptor provides a quantitative metric to characterize the quality of the charge-transport pathways, and model morphologies with controlled domain size and tortuosity are created using an anisotropic domain growth procedure. The tortuosity is found to be dependent on the anisotropy of the domain structure and is highly tunable. Time-of-flight charge-transport simulations on morphologies with a range of tortuosity values reveal that tortuosity can significantly reduce the magnitude of the mobility and the electric-field dependence relative to a neat material. These reductions are found to be further controlled by the energetic disorder and temperature. Most significantly, the sensitivity of the electric-field dependence to the tortuosity can explain the different experimental relationships previously reported, and exploiting this sensitivity could lead to simpler methods for characterizing and optimizing charge transport in organic solar cells.
Simulating charge transport to understand the spectral response of Swept Charge Devices
Athiray, P. S.; Sreekumar, P.; Narendranath, S.; Gow, J. P. D.
2015-11-01
Context. Swept Charge Devices (SCD) are novel X-ray detectors optimized for improved spectral performance without any demand for active cooling. The Chandrayaan-1 X-ray Spectrometer (C1XS) experiment onboard the Chandrayaan-1 spacecraft used an array of SCDs to map the global surface elemental abundances on the Moon using the X-ray fluorescence (XRF) technique. The successful demonstration of SCDs in C1XS spurred an enhanced version of the spectrometer on Chandrayaan-2 using the next-generation SCD sensors. Aims: The objective of this paper is to demonstrate validation of a physical model developed to simulate X-ray photon interaction and charge transportation in a SCD. The model helps to understand and identify the origin of individual components that collectively contribute to the energy-dependent spectral response of the SCD. Furthermore, the model provides completeness to various calibration tasks, such as generating spectral matrices (RMFs - redistribution matrix files), estimating efficiency, optimizing event selection logic, and maximizing event recovery to improve photon-collection efficiency in SCDs. Methods: Charge generation and transportation in the SCD at different layers related to channel stops, field zones, and field-free zones due to photon interaction were computed using standard drift and diffusion equations. Charge collected in the buried channel due to photon interaction in different volumes of the detector was computed by assuming a Gaussian radial profile of the charge cloud. The collected charge was processed further to simulate both diagonal clocking read-out, which is a novel design exclusive for SCDs, and event selection logic to construct the energy spectrum. Results: We compare simulation results of the SCD CCD54 with measurements obtained during the ground calibration of C1XS and clearly demonstrate that our model reproduces all the major spectral features seen in calibration data. We also describe our understanding of interactions at
Percolative transport in the vicinity of charge-order ferromagnetic ...
Indian Academy of Sciences (India)
field driven charge transport in the system is modelled on the basis of an inhomogeneous medium consisting of ... The charge-ordered phase for incommensurate distribution of man- ganese ions (i.e. ... position x = 0.35 measured in a constant voltage mode. The electric ... a drop in resistance on decreasing the temperature.
Charge transport in amorphous organic semiconductors
Energy Technology Data Exchange (ETDEWEB)
Lukyanov, Alexander
2011-03-15
Organic semiconductors with the unique combination of electronic and mechanical properties may offer cost-effective ways of realizing many electronic applications, e. g. large-area flexible displays, printed integrated circuits and plastic solar cells. In order to facilitate the rational compound design of organic semiconductors, it is essential to understand relevant physical properties e. g. charge transport. This, however, is not straightforward, since physical models operating on different time and length scales need to be combined. First, the material morphology has to be known at an atomistic scale. For this atomistic molecular dynamics simulations can be employed, provided that an atomistic force field is available. Otherwise it has to be developed based on the existing force fields and first principle calculations. However, atomistic simulations are typically limited to the nanometer length- and nanosecond time-scales. To overcome these limitations, systematic coarse-graining techniques can be used. In the first part of this thesis, it is demonstrated how a force field can be parameterized for a typical organic molecule. Then different coarse-graining approaches are introduced together with the analysis of their advantages and problems. When atomistic morphology is available, charge transport can be studied by combining the high-temperature Marcus theory with kinetic Monte Carlo simulations. The approach is applied to the hole transport in amorphous films of tris(8- hydroxyquinoline)aluminium (Alq{sub 3}). First the influence of the force field parameters and the corresponding morphological changes on charge transport is studied. It is shown that the energetic disorder plays an important role for amorphous Alq{sub 3}, defining charge carrier dynamics. Its spatial correlations govern the Poole-Frenkel behavior of the charge carrier mobility. It is found that hole transport is dispersive for system sizes accessible to simulations, meaning that calculated
Simulations of charge transport in organic compounds
Energy Technology Data Exchange (ETDEWEB)
Vehoff, Thorsten
2010-05-05
features: first, the shifted cofacial alignment of its molecules, and second, the high center of mass vibrational frequency. In comparsion to SCD, only KMC based on Marcus rates is capable of describing neighbors with low coupling and of taking static disorder into account three-dimensionally. SCD, despite its one-dimensionality, is valuable for crystals with strong coupling and little disorder. It also allows correct treatment of dynamical effects, such as intermolecular vibrations of the molecules. Rate equations are incapable of this, because simulations are performed on static snapshots. We have thus shown strengths and weaknesses of two state of the art models used to study charge transport in organic compounds, partially developed a program to compute and visualize transfer integral distributions and other charge transport properties, and found structure-mobility relations for several promising organic semiconductors. (orig.)
Role of Molecular Weight Distribution on Charge Transport in Semiconducting Polymers
Himmelberger, Scott
2014-10-28
© 2014 American Chemical Society. Model semiconducting polymer blends of well-controlled molecular weight distributions are fabricated and demonstrated to be a simple method to control intermolecular disorder without affecting intramolecular order or degree of aggregation. Mobility measurements exhibit that even small amounts of low molecular weight material are detrimental to charge transport. Trends in charge carrier mobility can be reproduced by a simple analytical model which indicates that carriers have no preference for high or low molecular weight chains and that charge transport is limited by interchain hopping. These results quantify the role of long polymer tie-chains and demonstrate the need for controlled polydispersity for achieving high carrier mobilities.
Frequency dependent magneto-transport in charge transfer Co(II) complex
Energy Technology Data Exchange (ETDEWEB)
Shaw, Bikash Kumar; Saha, Shyamal K., E-mail: cnssks@iacs.res.in
2014-09-01
A charge transfer chelated system containing ferromagnetic metal centers is the ideal system to investigate the magneto-transport and magneto-dielectric effects due to the presence of both electronic as well as magnetic properties and their coupling. Magneto-transport properties in materials are usually studied through dc charge transport under magnetic field. As frequency dependent conductivity is an essential tool to understand the nature of carrier wave, its spatial extension and their mutual interaction, in the present work, we have investigated frequency dependent magneto-transport along with magnetization behavior in [Co{sub 2}(II)-(5-(4-PhMe)-1,3,4-oxadiazole-H{sup +}-2-thiolate){sub 5}](OAc){sub 4} metal complex to elucidate the nature of above quantities and their response under magnetic field in the transport property. We have used the existing model for ac conduction incorporating the field dependence to explain the frequency dependent magneto-transport. It is seen that the frequency dependent magneto-transport could be well explained using the existing model for ac conduction. -Highlights: • Chelated Co(II) complex is synthesized for magneto-transport applications. • Frequency dependent magneto-transport and magnetization behavior are studied. • Nature of carrier wave, its spatial extension is investigated under magnetic field. • Existing model for ac conduction is used with magnetic field dependence.
Charge-spin Transport in Surface-disordered Three-dimensional Topological Insulators
Peng, Xingyue
As one of the most promising candidates for the building block of the novel spintronic circuit, the topological insulator (TI) has attracted world-wide interest of study. Robust topological order protected by time-reversal symmetry (TRS) makes charge transport and spin generation in TIs significantly different from traditional three-dimensional (3D) or two-dimensional (2D) electronic systems. However, to date, charge transport and spin generation in 3D TIs are still primarily modeled as single-surface phenomena, happening independently on top and bottom surfaces. In this dissertation, I will demonstrate via both experimental findings and theoretical modeling that this "single surface'' theory neither correctly describes a realistic 3D TI-based device nor reveals the amazingly distinct physical picture of spin transport dynamics in 3D TIs. Instead, I present a new viewpoint of the spin transport dynamics where the role of the insulating yet topologically non-trivial bulk of a 3D TI becomes explicit. Within this new theory, many mysterious transport and magneto-transport anomalies can be naturally explained. The 3D TI system turns out to be more similar to its low dimensional sibling--2D TI rather than some other systems sharing the Dirac dispersion, such as graphene. This work not only provides valuable fundamental physical insights on charge-spin transport in 3D TIs, but also offers important guidance to the design of 3D TI-based spintronic devices.
Liu, Y.; Meng, X.; Guo, Z.; Zhang, C.; Nguyen, T. H.; Hu, D.; Ji, J.; Yang, X.
2017-12-01
Colloidal attachment on charge heterogeneous grains has significant environmental implications for transport of hazardous colloids, such as pathogens, in the aquifer, where iron, manganese, and aluminium oxide minerals are the major source of surface charge heterogeneity of the aquifer grains. A patchwise surface charge model is often used to describe the surface charge heterogeneity of the grains. In the patchwise model, the colloidal attachment efficiency is linearly correlated with the fraction of the favorable patches (θ=λ(θf - θu)+θu). However, our previous microfluidic study showed that the attachment efficiency of oocysts of Cryptosporidium parvum, a waterborne protozoan parasite, was not linear correlated with the fraction of the favorable patches (λ). In this study, we developed a pore scale model to simulate colloidal transport and attachment on charge heterogeneous grains. The flow field was simulated using the LBM method and colloidal transport and attachment were simulated using the Lagrange particle tracking method. The pore scale model was calibrated with experimental results of colloidal and oocyst transport in microfluidic devices and was then used to simulate oocyst transport in charge heterogeneous porous media under a variety of environmental relative conditions, i.e. the fraction of favorable patchwise, ionic strength, and pH. The results of the pore scale simulations were used to evaluate the effect of surface charge heterogeneity on upscaling of oocyst transport from pore to continuum scale and to develop an applicable correlation between colloidal attachment efficiency and the fraction of the favorable patches.
Charge transport in organic crystals
Energy Technology Data Exchange (ETDEWEB)
Ortmann, Frank
2009-07-01
The understanding of charge transport is one of the central goals in the research on semiconducting crystals. For organic crystals this is particularly complicated due to the strength of the electron-phonon interaction which requires the description of a seamless transition between the limiting cases of a coherent band-transport mechanism and incoherent hopping. In this thesis, charge transport phenomena in organic crystals are studied by theoretical means. A theory for charge transport in organic crystals is developed which covers the whole temperature range from low T, where it reproduces an expression from the Boltzmann equation for band transport, via elevated T, where it generalizes Holstein's small-polaron theory to finite bandwidths, up to high T, for which a temperature dependence equal to Marcus' electron-transfer theory is obtained. Thereby, coherent band transport and thermally induced hopping are treated on equal footing while simultaneously treating the electron-phonon interaction non-perturbatively. By avoiding the approximation of narrow polaron bands the theory allows for the description of large and small polarons and serves as a starting point for computational studies. The theoretical description is completed by using ab initio material parameters for the selected crystals under study. These material parameters are taken from density functional theory calculations for durene, naphthalene, and guanine crystals. Besides the analysis of the transport mechanism, special focus is put on the study of the relationship between mobility anisotropy and structure of the crystals. This study is supported by a 3D-visualization method for the transport channels in such crystals which has been derived in this thesis. (orig.)
Transport of electric charge in insulators
International Nuclear Information System (INIS)
Lopez C, E.
1979-01-01
In this work a review is made of important concepts in the study of the transport of electric charge in insulators. These concepts are: electrical contacts, transport regimes as viewed in the I-V characteristics, and photoinjection processes by internal photemission of holes or electrons from metals or semiconductors into insulators or by a virtual electrode using strongly absorbed light. Experimental results of photoinjection of holes and electrons into sulfur single crystals are analyzed using these concepts. The observation of the Mott-Gurney transition is reported for the first time. This is the transition between the region of space charge limited currents (SCLC) and the region of saturation of the current as a function of the applied voltage. A modified Mott-Gurney theoretical model is presented that is able to explain the whole I-V characteristic for uv and the internal photoemission of hopes and uv photoinjection of electrons. For the case of internal photoemission of electrons the conventional space charge limited current theory for an exponential distribution of traps is able to explain the experimental data. It is found that the crystals are of high purity since the total density of traps, as calculated from their exponential distribution, is Nsub(t) equals 1.8 X 10 14 cm -3 . (author)
International Nuclear Information System (INIS)
Walsh, Jonathan A.; Palmer, Todd S.; Urbatsch, Todd J.
2015-01-01
Highlights: • Generation of discrete differential scattering angle and energy loss cross sections. • Gauss–Radau quadrature utilizing numerically computed cross section moments. • Development of a charged particle transport capability in the Milagro IMC code. • Integration of cross section generation and charged particle transport capabilities. - Abstract: We investigate a method for numerically generating discrete scattering cross sections for use in charged particle transport simulations. We describe the cross section generation procedure and compare it to existing methods used to obtain discrete cross sections. The numerical approach presented here is generalized to allow greater flexibility in choosing a cross section model from which to derive discrete values. Cross section data computed with this method compare favorably with discrete data generated with an existing method. Additionally, a charged particle transport capability is demonstrated in the time-dependent Implicit Monte Carlo radiative transfer code, Milagro. We verify the implementation of charged particle transport in Milagro with analytic test problems and we compare calculated electron depth–dose profiles with another particle transport code that has a validated electron transport capability. Finally, we investigate the integration of the new discrete cross section generation method with the charged particle transport capability in Milagro.
International Nuclear Information System (INIS)
Flood, Amar H.; Wong, Eric W.; Stoddart, J. Fraser
2006-01-01
The processes by which charge transfer can occur play a foundational role in molecular electronics. Here we consider simplified models of the transfer processes that could be present in bistable molecular switch tunnel junction (MSTJ) devices during one complete cycle of the device from its low- to high- and back to low-conductance state. The bistable molecular switches, which are composed of a monolayer of either switchable catenanes or rotaxanes, exist in either a ground-state co-conformation or a metastable one in which the conduction properties of the two co-conformations, when measured at small biases (+0.1 V), are significantly different irrespective of whether transport is dominated by tunneling or hopping. The voltage-driven generation (±2 V) of molecule-based redox states, which are sufficiently long-lived to allow the relative mechanical movements necessary to switch between the two co-conformations, rely upon unequal charge transfer rates on to and/or off of the molecules. Surface-enhanced Raman spectroscopy has been used to image the ground state of the bistable rotaxane in MSTJ-like devices. Consideration of these models provide new ways of looking at molecular electronic devices that rely, not only on nanoscale charge-transport, but also upon the bustling world of molecular motion in mechanically interlocked bistable molecules
Charge splitters and charge transport junctions based on guanine quadruplexes
Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.
2018-04-01
Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.
Electronic structure and charge transport in nonstoichiometric tantalum oxide
Perevalov, T. V.; Gritsenko, V. A.; Gismatulin, A. A.; Voronkovskii, V. A.; Gerasimova, A. K.; Aliev, V. Sh; Prosvirin, I. A.
2018-06-01
The atomic and electronic structure of nonstoichiometric oxygen-deficient tantalum oxide TaO x<2.5 grown by ion beam sputtering deposition was studied. The TaO x film content was analyzed by x-ray photoelectron spectroscopy and by quantum-chemistry simulation. TaO x is composed of Ta2O5, metallic tantalum clusters and tantalum suboxides. A method for evaluating the stoichiometry parameter of TaO x from the comparison of experimental and theoretical photoelectron valence band spectra is proposed. The charge transport properties of TaO x were experimentally studied and the transport mechanism was quantitatively analyzed with four theoretical dielectric conductivity models. It was found that the charge transport in almost stoichiometric and nonstoichiometric tantalum oxide can be consistently described by the phonon-assisted tunneling between traps.
Magnetoresistance and charge transport in graphene governed by nitrogen dopants.
Rein, Markus; Richter, Nils; Parvez, Khaled; Feng, Xinliang; Sachdev, Hermann; Kläui, Mathias; Müllen, Klaus
2015-02-24
We identify the influence of nitrogen-doping on charge- and magnetotransport of single layer graphene by comparing doped and undoped samples. Both sample types are grown by chemical vapor deposition (CVD) and transferred in an identical process onto Si/SiO2 wafers. We characterize the samples by Raman spectroscopy as well as by variable temperature magnetotransport measurements. Over the entire temperature range, the charge transport properties of all undoped samples are in line with literature values. The nitrogen doping instead leads to a 6-fold increase in the charge carrier concentration up to 4 × 10(13) cm(-2) at room temperature, indicating highly effective doping. Additionally it results in the opening of a charge transport gap as revealed by the temperature dependence of the resistance. The magnetotransport exhibits a conspicuous sign change from positive Lorentz magnetoresistance (MR) in undoped to large negative MR that we can attribute to the doping induced disorder. At low magnetic fields, we use quantum transport signals to quantify the transport properties. Analyses based on weak localization models allow us to determine an orders of magnitude decrease in the phase coherence and scattering times for doped samples, since the dopants act as effective scattering centers.
Theory and simulation of charge transport in disordered organic semiconductors
Bobbert, P.A.; Kondov, I.; Sutman, G.
2013-01-01
Charge transport in polymeric or small-molecule organic semiconductors used in organic light-emitting diodes (OLEDs) occurs by hopping of charges between sites at which the charges are localized. The energetic disorder in these semiconductors has a profound influence on the charge transport: charges
Charge transport in organic light-emitting diodes. Experiments and simulations
Energy Technology Data Exchange (ETDEWEB)
Schober, Matthias
2012-11-01
This thesis is about the development and validation of a numerical model for the simulation of the current-voltage characteristics of organic thin-film devices. The focus is on the analysis of a white organic light-emitting diode (OLED) with fluorescent blue and phosphorescent red and green emitters. The simulation model describes the charge transport as a one-dimensional drift-diffusion current and is developed on the basis of the Scharfetter-Gummel method. It incorporates modern theories for the charge transport in disordered organic materials, which are considered by means of special functions for the diffusion coefficient and the charge-carrier mobility. The algorithm is designed such that it can switch between different models for mobility and calculates both transient and steady-state solutions. In the analysis of the OLED, electron and hole transport are investigated separately in series of single-carrier devices. These test devices incorporate parts of the layers in the OLED between symmetrically arranged injection layers that are electrically doped. Thereby, the OLED layer sequence is reconstructed step by step. The analysis of the test devices allows to obtain the numerous parameters which are required for the simulation of the complete OLED and reveals many interesting features of the OLED. For instance, it is shown how the accumulation of charge carriers in front of an interface barrier increases the mobility and the transfer rate across the interface. Furthermore, it is demonstrated how to identify charge-trapping states. This leads to the detection of deep trap states in the emission zone of the OLED -- an interesting aspect, since these states can function as recombination centers and may cause non-radiative losses. Moreover, various other effects such as interface dipoles and a slight freeze-out of active electric dopants in the injection layers are observed. In the simulations of the numerous test devices, the parameters are consistently applied
Sutton, Christopher; Tummala, Naga Rajesh; Kemper, Travis; Aziz, Saadullah G.; Sears, John; Coropceanu, Veaceslav; Bredas, Jean-Luc
2017-01-01
Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.
Sutton, Christopher
2017-06-13
Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.
Simulating charge transport in flexible systems
Directory of Open Access Journals (Sweden)
Timothy Clark
2015-12-01
Full Text Available Systems in which movements occur on two significantly different time domains, such as organic electronic components with flexible molecules, require different simulation techniques for the two time scales. In the case of molecular electronics, charge transport is complicated by the several different mechanisms (and theoretical models that apply in different cases. We cannot yet combine time scales of molecular and electronic movement in simulations of real systems. This review describes our progress towards this goal.
Methods for producing thin film charge selective transport layers
Hammond, Scott Ryan; Olson, Dana C.; van Hest, Marinus Franciscus Antonius Maria
2018-01-02
Methods for producing thin film charge selective transport layers are provided. In one embodiment, a method for forming a thin film charge selective transport layer comprises: providing a precursor solution comprising a metal containing reactive precursor material dissolved into a complexing solvent; depositing the precursor solution onto a surface of a substrate to form a film; and forming a charge selective transport layer on the substrate by annealing the film.
Study of the charge transport characteristics of dendrimer molecular thin films
Energy Technology Data Exchange (ETDEWEB)
Li, J.C., E-mail: jcli@mail.neu.edu.cn; Han, N.; Wang, S.S.; Ba, D.C.
2011-05-31
In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.
Study of the charge transport characteristics of dendrimer molecular thin films
International Nuclear Information System (INIS)
Li, J.C.; Han, N.; Wang, S.S.; Ba, D.C.
2011-01-01
In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.
Charge transport properties of a twisted DNA molecule: A renormalization approach
Energy Technology Data Exchange (ETDEWEB)
Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2016-10-20
In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.
Charge transport through DNA based electronic barriers
Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj
2018-05-01
We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.
International Nuclear Information System (INIS)
Qiu Gang; Joshi, Abhijit S.; Dennison, C.R.; Knehr, K.W.; Kumbur, E.C.; Sun Ying
2012-01-01
The vanadium redox flow battery (VRFB) has emerged as a viable grid-scale energy storage technology that offers cost-effective energy storage solutions for renewable energy applications. In this paper, a novel methodology is introduced for modeling of the transport mechanisms of electrolyte flow, species and charge in the VRFB at the pore scale of the electrodes; that is, at the level where individual carbon fiber geometry and electrolyte flow are directly resolved. The detailed geometry of the electrode is obtained using X-ray computed tomography (XCT) and calibrated against experimentally determined pore-scale characteristics (e.g., pore and fiber diameter, porosity, and surface area). The processed XCT data is then used as geometry input for modeling of the electrochemical processes in the VRFB. The flow of electrolyte through the pore space is modeled using the lattice Boltzmann method (LBM) while the finite volume method (FVM) is used to solve the coupled species and charge transport and predict the performance of the VRFB under various conditions. An electrochemical model using the Butler–Volmer equations is used to provide species and charge coupling at the surfaces of the carbon fibers. Results are obtained for the cell potential distribution, as well as local concentration, overpotential and current density profiles under galvanostatic discharge conditions. The cell performance is investigated as a function of the electrolyte flow rate and external drawing current. The model developed here provides a useful tool for building the structure–property–performance relationship of VRFB electrodes.
Electrolyte transport in neutral polymer gels embedded with charged inclusions
Hill, Reghan
2005-11-01
Ion permeable membranes are the basis of a variety of molecular separation technologies, including ion exchange, gel electrophoresis and dialysis. This work presents a theoretical model of electrolyte transport in membranes comprised of a continuous polymer gel embedded with charged spherical inclusions, e.g., biological cells and synthetic colloids. The microstructure mimics immobilized cell cultures, where electric fields have been used to promote nutrient transport. Because several important characteristics can, in principle, be carefully controlled, the theory provides a quantitative framework to help tailor the bulk properties for enhanced molecular transport, microfluidic pumping, and physicochemical sensing applications. This talk focuses on the electroosmotic flow driven by weak electric fields and electrolyte concentration gradients. Also of importance is the influence of charge on the effective ion diffusion coefficients, bulk electrical conductivity, and membrane diffusion potential.
Charge carrier transport mechanisms in nanocrystalline indium oxide
International Nuclear Information System (INIS)
Forsh, E.A.; Marikutsa, A.V.; Martyshov, M.N.; Forsh, P.A.; Rumyantseva, M.N.; Gaskov, A.M.; Kashkarov, P.K.
2014-01-01
The charge transport properties of nanocrystalline indium oxide (In 2 O 3 ) are studied. A number of nanostructured In 2 O 3 samples with various nanocrystal sizes are prepared by sol–gel method and characterized using various techniques. The mean nanocrystals size varies from 7–8 nm to 18–20 nm depending on the conditions of their preparation. Structural characterizations of the In 2 O 3 samples are performed by means of transmission electron microscopy and X-ray diffraction. The analysis of dc and ac conductivity in a wide temperature range (T = 50–300 K) shows that at high temperatures charge carrier transport takes place over conduction band and at low temperatures a variable range hopping transport mechanism can be observed. We find out that the temperature of transition from one mechanism to another depends on nanocrystal size: the transition temperature rises when nanocrystals are bigger in size. The average hopping distance between two sites and the activation energy are calculated basing on the analysis of dc conductivity at low temperature. Using random barrier model we show a uniform hopping mechanism taking place in our samples and conclude that nanocrystalline In 2 O 3 can be regarded as a disordered system. - Highlights: • In 2 O 3 samples with various nanocrystal sizes are prepared by sol–gel method. • The mean nanocrystal size varies from 7–8 nm to 18–20 nm. • At high temperatures charge carrier transport takes place over conduction band. • At low temperatures a variable range hopping transport mechanism can be observed. • We show a uniform hopping mechanism taking place in our samples
31 CFR 337.2 - Transportation charges and risks.
2010-07-01
... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Transportation charges and risks. 337... FEDERAL HOUSING ADMINISTRATION DEBENTURES Certificated Debentures § 337.2 Transportation charges and risks... to book-entry form, must be delivered at the expense and risk of the holder. Debentures bearing...
Charge transport parameters of HBC at different temperatures
Energy Technology Data Exchange (ETDEWEB)
Kirkpatrick, J. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom); Marcon, V.; Kremer, K.; Andrienko, D. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Nelson, J. [Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom)
2008-05-15
We study the dependence on temperature of the charge transport parameters for hexabenzocoronene (HBC). Following from Marcus theory, two charge transport parameters will be calculated: the transfer integral and the difference in site energies. These parameters are strongly dependent on the orientation and position of molecules. Position and orientation of molecules are determined using molecular dynamics. Transfer integrals are calculated from a simplified INDO method. A technique to compute energetic disorder, that is the spread in site energies for the charge carriers, is developed. In the herringbone phase transfer integrals are higher, but so is energetic disorder. We consider three derivatives of HBC with different side chains, which lead to different phase behaviour and distributions of charge transport parameters. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
A general relationship between disorder, aggregation and charge transport in conjugated polymers
Noriega, Rodrigo; Rivnay, Jonathan; Vandewal, Koen; Koch, Felix P. V.; Stingelin, Natalie; Smith, Paul; Toney, Michael F.; Salleo, Alberto
2013-01-01
Conjugated polymer chains have many degrees of conformational freedom and interact weakly with each other, resulting in complex microstructures in the solid state. Understanding charge transport in such systems, which have amorphous and ordered phases exhibiting varying degrees of order, has proved difficult owing to the contribution of electronic processes at various length scales. The growing technological appeal of these semiconductors makes such fundamental knowledge extremely important for materials and process design. We propose a unified model of how charge carriers travel in conjugated polymer films. We show that in high-molecular-weight semiconducting polymers the limiting charge transport step is trapping caused by lattice disorder, and that short-range intermolecular aggregation is sufficient for efficient long-range charge transport. This generalization explains the seemingly contradicting high performance of recently reported, poorly ordered polymers and suggests molecular design strategies to further improve the performance of future generations of organic electronic materials. © 2013 Macmillan Publishers Limited. All rights reserved.
A general relationship between disorder, aggregation and charge transport in conjugated polymers
Noriega, Rodrigo
2013-08-04
Conjugated polymer chains have many degrees of conformational freedom and interact weakly with each other, resulting in complex microstructures in the solid state. Understanding charge transport in such systems, which have amorphous and ordered phases exhibiting varying degrees of order, has proved difficult owing to the contribution of electronic processes at various length scales. The growing technological appeal of these semiconductors makes such fundamental knowledge extremely important for materials and process design. We propose a unified model of how charge carriers travel in conjugated polymer films. We show that in high-molecular-weight semiconducting polymers the limiting charge transport step is trapping caused by lattice disorder, and that short-range intermolecular aggregation is sufficient for efficient long-range charge transport. This generalization explains the seemingly contradicting high performance of recently reported, poorly ordered polymers and suggests molecular design strategies to further improve the performance of future generations of organic electronic materials. © 2013 Macmillan Publishers Limited. All rights reserved.
International Nuclear Information System (INIS)
Martin, R.C.
1990-01-01
The passage of energetic ions through semiconductor devices generates excess charge which can produce logic upset, memory change, and device damage. This single event upset (SEU) phenomenon is increasingly important for satellite communications. Experimental and numerical simulation of SEUs is difficult because of the subnanosecond times and large charge densities within the ion track. The objective of this work is twofold: (1) the determination of the track structure and electron-hole pair generation profiles following the passage of an energetic ion; (2) the development and application of a new numerical method for transient charge transport in semiconductor devices. A secondary electron generation and transport model, based on the Monte Carlo method, is developed and coupled to an ion transport code to simulate ion track formation in silicon. A new numerical method is developed for the study of transient charge transport. The numerical method combines an axisymmetric quadratic finite-element formulation for the solution of the potential with particle simulation methods for electron and hole transport. Carrier transport, recombination, and thermal generation of both majority and minority carriers are included. To assess the method, transient one-dimensional solutions for silicon diodes are compared to a fully iterative finite-element method. Simulations of charge collection from ion tracks in three-dimensional axisymmetric devices are presented and compared to previous work. The results of this work for transient current pulses following charged ion passage are in agreement with recent experimental data
Yuan, Wei; Li, Guanglei; Gil, Eun Seok; Lowe, Tao Lu; Fu, Bingmei M
2010-04-01
Charge carried by the surface glycocalyx layer (SGL) of the cerebral endothelium has been shown to significantly modulate the permeability of the blood-brain barrier (BBB) to charged solutes in vivo. The cultured monolayer of bEnd3, an immortalized mouse cerebral endothelial cell line, is becoming a popular in vitro BBB model due to its easy growth and maintenance of many BBB characteristics over repeated passages. To test whether the SGL of bEnd3 monolayer carries similar charge as that in the intact BBB and quantify this charge, which can be characterized by the SGL thickness (L(f)) and charge density (C(mf)), we measured the solute permeability of bEnd3 monolayer to neutral solutes and to solutes with similar size but opposite charges: negatively charged alpha-lactalbumin (-11) and positively charged ribonuclease (+3). Combining the measured permeability data with a transport model across the cell monolayer, we predicted the L(f) and the C(mf) of bEnd3 monolayer, which is approximately 160 nm and approximately 25 mEq/L, respectively. We also investigated whether orosomucoid, a plasma glycoprotein modulating the charge of the intact BBB, alters the charge of bEnd3 monolayer. We found that 1 mg/mL orosomucoid would increase SGL charge density of bEnd3 monolayer to approximately 2-fold of its control value.
The Effect of Ketone Defects on the Charge Transport and Charge Recombination in Polyfluorenes
Kuik, Martijn; Wetzelaer, Gert-Jan A. H.; Ladde, Jurre G.; Nicolai, Herman T.; Wildeman, Jurjen; Sweelssen, Jorgen; Blom, Paul W. M.; Sweelssen, Jörgen
2011-01-01
The effect of on-chain ketone defects on the charge transport of the polyfluorene derivative poly(9,9-dioctylfluorene) (PFO) is investigated. Using MoO3 as ohmic hole contact, the hole transport in a pristine PFO diode is observed to be limited by space-charge, whereas fluorenone contaminated PFO
The effect of ketone defects on the charge transport and charge recombination in polyfluorenes
Kuik, M.; Wetzelaer, G.-J.A.H.; Laddé, J.G.; Nicolai, H.T.; Wildeman, J.; Sweelssen, J.; Blom, P.W.M.
2011-01-01
The effect of on-chain ketone defects on the charge transport of the polyfluorene derivative poly(9,9-dioctylfluorene) (PFO) is investigated. Using MoO3 as ohmic hole contact, the hole transport in a pristine PFO diode is observed to be limited by space-charge, whereas fluorenone contaminated PFO
Ferrell, Nicholas; Cameron, Kathleen O; Groszek, Joseph J; Hofmann, Christina L; Li, Lingyan; Smith, Ross A; Bian, Aihua; Shintani, Ayumi; Zydney, Andrew L; Fissell, William H
2013-04-02
Molecular transport through the basement membrane is important for a number of physiological functions, and dysregulation of basement membrane architecture can have serious pathological consequences. The structure-function relationships that govern molecular transport in basement membranes are not fully understood. The basement membrane from the lens capsule of the eye is a collagen IV-rich matrix that can easily be extracted and manipulated in vitro. As such, it provides a convenient model for studying the functional relationships that govern molecular transport in basement membranes. Here we investigate the effects of increased transmembrane pressure and solute electrical charge on the transport properties of the lens basement membrane (LBM) from the bovine eye. Pressure-permeability relationships in LBM transport were governed primarily by changes in diffusive and convective contributions to solute flux and not by pressure-dependent changes in intrinsic membrane properties. The solute electrical charge had a minimal but statistically significant effect on solute transport through the LBM that was opposite of the expected electrokinetic behavior. The observed transport characteristics of the LBM are discussed in the context of established membrane transport modeling and previous work on the effects of pressure and electrical charge in other basement membrane systems. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.
SLC injector simulation and tuning for high charge transport
International Nuclear Information System (INIS)
Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.
1992-01-01
We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model. (Author) 5 figs., 7 refs
Charged-particle calculations using Boltzmann transport methods
International Nuclear Information System (INIS)
Hoffman, T.J.; Dodds, H.L. Jr.; Robinson, M.T.; Holmes, D.K.
1981-01-01
Several aspects of radiation damage effects in fusion reactor neutron and ion irradiation environments are amenable to treatment by transport theory methods. In this paper, multigroup transport techniques are developed for the calculation of charged particle range distributions, reflection coefficients, and sputtering yields. The Boltzmann transport approach can be implemented, with minor changes, in standard neutral particle computer codes. With the multigroup discrete ordinates code, ANISN, determination of ion and target atom distributions as functions of position, energy, and direction can be obtained without the stochastic error associated with atomistic computer codes such as MARLOWE and TRIM. With the multigroup Monte Carlo code, MORSE, charged particle effects can be obtained for problems associated with very complex geometries. Results are presented for several charged particle problems. Good agreement is obtained between quantities calculated with the multigroup approach and those obtained experimentally or by atomistic computer codes
High-frequency acoustic charge transport in GaAs nanowires
Büyükköse, S.; Hernandez-Minguez, A.; Vratzov, B.; Somaschini, C.; Geelhaar, L.; Riechert, H.; van der Wiel, Wilfred Gerard; Santos, P.V.
2014-01-01
The oscillating piezoelectric fields accompanying surface acoustic waves are able to transport charge carriers in semiconductor heterostructures. Here, we demonstrate high-frequency (above 1 GHz) acoustic charge transport in GaAs-based nanowires deposited on a piezoelectric substrate. The short
Charge transport in metal oxide nanocrystal-based materials
Runnerstrom, Evan Lars
There is probably no class of materials more varied, more widely used, or more ubiquitous than metal oxides. Depending on their composition, metal oxides can exhibit almost any number of properties. Of particular interest are the ways in which charge is transported in metal oxides: devices such as displays, touch screens, and smart windows rely on the ability of certain metal oxides to conduct electricity while maintaining visible transparency. Smart windows, fuel cells, and other electrochemical devices additionally rely on efficient transport of ionic charge in and around metal oxides. Colloidal synthesis has enabled metal oxide nanocrystals to emerge as a relatively new but highly tunable class of materials. Certain metal oxide nanocrystals, particularly highly doped metal oxides, have been enjoying rapid development in the last decade. As in myriad other materials systems, structure dictates the properties of metal oxide nanocrystals, but a full understanding of how nanocrystal synthesis, the processing of nanocrystal-based materials, and the structure of nanocrystals relate to the resulting properties of nanocrystal-based materials is still nascent. Gaining a fundamental understanding of and control over these structure-property relationships is crucial to developing a holistic understanding of metal oxide nanocrystals. The unique ability to tune metal oxide nanocrystals by changing composition through the introduction of dopants or by changing size and shape affords a way to study the interplay between structure, processing, and properties. This overall goal of this work is to chemically synthesize colloidal metal oxide nanocrystals, process them into useful materials, characterize charge transport in materials based on colloidal metal oxide nanocrystals, and develop ways to manipulate charge transport. In particular, this dissertation characterizes how the charge transport properties of metal oxide nanocrystal-based materials depend on their processing and
Charge transport in non-irradiated and irradiated silicon detectors
International Nuclear Information System (INIS)
Leroy, C.; Roy, P.; Casse, G.L.; Glaser, M.; Grigoriev, E.; Lemeilleur, F.
1999-01-01
A model describing the transport of the charge carriers generated in n-type silicon detectors by ionizing particles is presented. In order to reproduce the experimental current pulse responses induced by α and β particles in non-irradiated and irradiated detectors up to fluences (PHI) much beyond the n to p-type inversion, an n-type region 15 μm deep is introduced on the p + side of the diode. This model also gives mobilities which decrease linearly up to fluences of around 5x10 13 particles/cm 2 and beyond, converging to saturation values of about 1000 and 450 cm 2 /V s for electrons and holes, respectively. The charge carrier lifetime degradation with increased fluence, due to trapping, is responsible for a predicted charge collection deficit for β particles and for α particles which is found to agree with direct CCE measurements. (author)
SLC injector simulation and tuning for high charge transport
International Nuclear Information System (INIS)
Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.
1992-08-01
We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional ray-trace code with a two-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model
Organic n-type materials for charge transport and charge storage applications.
Stolar, Monika; Baumgartner, Thomas
2013-06-21
Conjugated materials have attracted much attention toward applications in organic electronics in recent years. These organic species offer many advantages as potential replacement for conventional materials (i.e., silicon and metals) in terms of cheap fabrication and environmentally benign devices. While p-type (electron-donating or hole-conducting) materials have been extensively reviewed and researched, their counterpart n-type (electron-accepting or electron-conducting) materials have seen much less popularity despite the greater need for improvement. In addition to developing efficient charge transport materials, it is equally important to provide a means of charge storage, where energy can be used on an on-demand basis. This perspective is focused on discussing a selection of representative n-type materials and the efforts toward improving their charge-transport efficiencies. Additionally, this perspective will also highlight recent organic materials for battery components and the efforts that have been made to improve their environmental appeal.
Production, transport and charge capture measurements of highly charged recoil ions
International Nuclear Information System (INIS)
Trebus, U.E.
1989-01-01
An experiment is described to study highly charged recoil ions on-line to the heavy accelerator UNILAC at GSI. The highly charged recoil ions are produced by heavy-ion bombardment of a gas target. Subsequently the slow highly charged recoil ions are extracted from the ionization volume, and guided through a beam transport line to a Wien filter for charge state selection and to a collision region to study charge transfer processes. Several experiments were carried out to show the efficient charge state separation. Charge states up to q = 15 were observed. When using a retarding field analyzer cross sections for single electron capture were determined for different charge states of Xe q+ for q = 4 to 11 and He gas. The experiments demonstrated increasing charge transfer cross sections with increasing charge state q and indicated the effect of near resonant charge capture for q = 6. The flexible data acquisition system used, is described and other future experiments, such as for instance in flight ion-trapping are indicated in the appendix
Production, transport and charge capture measurements of highly charged recoil ions
International Nuclear Information System (INIS)
Trebus, U.E.
1989-05-01
An experiment is described to study highly charged recoil ions on-line to the heavy ion accelerator UNILAC at GSI. The highly charged recoil ions are produced by heavy ion bombardment of a gas target. Subsequently the slow highly charged recoil ions are extracted from the ionization volume, and guided through a beam transport line to a Wien filter for charge state selection and to a collision region to study charge transfer processes. Several experiments were carried out to show the efficient charge state separation. Charge states up to q=15 were observed. When using a retarding field analyzer cross sections for single electron capture were determined for different charge states of Xe q+ for q=4 to 11 and He gas. The experiments demonstrated increasing charge transfer cross sections with increasing charge state q and indicated the effect of near resonant charge capture for q=6. The flexible data acquisition system used, is described and other future experiments, such as for instance in flight ion-trapping are indicated in the appendix. (orig.)
Charge transport in highly efficient iridium cored electrophosphorescent dendrimers
Markham, Jonathan P. J.; Samuel, Ifor D. W.; Lo, Shih-Chun; Burn, Paul L.; Weiter, Martin; Bässler, Heinz
2004-01-01
Electrophosphorescent dendrimers are promising materials for highly efficient light-emitting diodes. They consist of a phosphorescent core onto which dendritic groups are attached. Here, we present an investigation into the optical and electronic properties of highly efficient phosphorescent dendrimers. The effect of dendrimer structure on charge transport and optical properties is studied using temperature-dependent charge-generation-layer time-of-flight measurements and current voltage (I-V) analysis. A model is used to explain trends seen in the I-V characteristics. We demonstrate that fine tuning the mobility by chemical structure is possible in these dendrimers and show that this can lead to highly efficient bilayer dendrimer light-emitting diodes with neat emissive layers. Power efficiencies of 20 lm/W were measured for devices containing a second-generation (G2) Ir(ppy)3 dendrimer with a 1,3,5-tris(2-N-phenylbenzimidazolyl)benzene electron transport layer.
Simulations of charge transport in organic light emitting diodes
International Nuclear Information System (INIS)
Martin, Simon James
2002-01-01
In this thesis, two approaches to the modelling of charge transport in organic light emitting diodes (OLEDs) are presented. The first is a drift-diffusion model, normally used when considering conventional crystalline inorganic semiconductors (e.g. Si or lll-V's) which have well defined energy bands. In this model, electron and hole transport is described using the current continuity equations and the drift-diffusion current equations, and coupled to Poisson's equation. These equations are solved with the appropriate boundary conditions, which for OLEDs are Schottky contacts; carriers are injected by thermionic emission and tunnelling. The disordered nature of the organic semiconductors is accounted for by the inclusion of field-dependent carrier mobilities and Langevin optical recombination. The second approach treats the transport of carriers in disordered organic semi-conductors as a hopping process between spatially and energetically disordered sites. This method has been used previously to account for the observed temperature and electric field dependence of carrier mobilities in disordered organic semiconductors. A hopping transport model has been developed which accounts explicitly for the structure in highly ordered films of rigid rod liquid-crystalline conjugated polymers. Chapter 2 discusses the formation of metal-semiconductor contacts, and current injection processes in OLEDs. If the barrier to carrier injection at a metal-semiconductor contact is small, or the contact is Ohmic, then the current may be space charge limited; this second limiting regime of current flow for OLEDs is also described. The remainder of Chapter 2 describes the drift-diffusion model used in this work in some detail. Chapter 3 contains results obtained from modelling the J-V characteristics of single-layer OLEDs, which are compared to experimental data in order to validate the drift-diffusion model. Chapter 4 contains results of simulating bi-layer OLEDs; rather than examining J
Three-dimensional charge transport in organic semiconductor single crystals.
He, Tao; Zhang, Xiying; Jia, Jiong; Li, Yexin; Tao, Xutang
2012-04-24
Three-dimensional charge transport anisotropy in organic semiconductor single crystals - both plates and rods (above and below, respectively, in the figure) - is measured in well-performing organic field-effect transistors for the first time. The results provide an excellent model for molecular design and device preparation that leads to good performance. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Two-Dimensional Spatial Imaging of Charge Transport in Germanium Crystals at Cryogenic Temperatures
Energy Technology Data Exchange (ETDEWEB)
Moffatt, Robert [Stanford Univ., CA (United States)
2016-03-01
In this dissertation, I describe a novel apparatus for studying the transport of charge in semiconductors at cryogenic temperatures. The motivation to conduct this experiment originated from an asymmetry observed between the behavior of electrons and holes in the germanium detector crystals used by the Cryogenic Dark Matter Search (CDMS). This asymmetry is a consequence of the anisotropic propagation of electrons in germanium at cryogenic temperatures. To better model our detectors, we incorporated this effect into our Monte Carlo simulations of charge transport. The purpose of the experiment described in this dissertation is to test those models in detail. Our measurements have allowed us to discover a shortcoming in our most recent Monte Carlo simulations of electrons in germanium. This discovery would not have been possible without the measurement of the full, two-dimensional charge distribution, which our experimental apparatus has allowed for the first time at cryogenic temperatures.
Charge injection and transport properties of an organic light-emitting diode
Directory of Open Access Journals (Sweden)
Peter Juhasz
2016-01-01
Full Text Available The charge behavior of organic light emitting diode (OLED is investigated by steady-state current–voltage technique and impedance spectroscopy at various temperatures to obtain activation energies of charge injection and transport processes. Good agreement of activation energies obtained by steady-state and frequency-domain was used to analyze their contributions to the charge injection and transport. We concluded that charge is injected into the OLED device mostly through the interfacial states at low voltage region, whereas the thermionic injection dominates in the high voltage region. This comparison of experimental techniques demonstrates their capabilities of identification of major bottleneck of charge injection and transport.
Beamline for low-energy transport of highly charged ions at HITRAP
International Nuclear Information System (INIS)
Andelkovic, Z.; Herfurth, F.; Kotovskiy, N.; König, K.; Maaß, B.; Murböck, T.; Neidherr, D.; Schmidt, S.; Steinmann, J.; Vogel, M.; Vorobjev, G.
2015-01-01
A beamline for transport of highly charged ions with energies as low as a few keV/charge has been constructed and commissioned at GSI. Complementary to the existing infrastructure of the HITRAP facility for deceleration of highly charged ions from the GSI accelerator, the new beamline connects the HITRAP ion decelerator and an EBIT with the associated experimental setups. Therefore, the facility can now transport the decelerated heavy highly charged ions to the experiments or supply them offline with medium-heavy highly charged ions from the EBIT, both at energies as low as a few keV/charge. Here we present the design of the 20 m long beamline with the corresponding beam instrumentation, as well as its performance in terms of energy and transport efficiency
Charge transport across bulk heterojunction organic thin film
Energy Technology Data Exchange (ETDEWEB)
Tessema, Genene [University of Kwazulu-Natal, School of Physics, Scottsville (South Africa); Addis Ababa University, Department of Physics, Addis Ababa (Ethiopia)
2012-01-15
The transport of charges in organic photo-active film has been the focus of tremendous research in the past few decades with the view to understand the physics of the polymers. Bulk heterojunction type devices are particularly more interesting because of their high power conversion efficiency. We have fabricated organic PV cell based on sandwich type ITO/PEDOT:PSS/APFO green-6:PCBM/LiF/Al device structure. The space charge limited currents were investigated to be able to derive important transport parameters of the devices. The measured current agrees very well with trap free space charge limited transport theory. The zero field mobility and field activation factor found from the data were {mu} {sub 0}=(3.39{+-}0.2) x 10{sup -6} m{sup 2}/V sec and {gamma}=(8.3{+-}0.3) x 10{sup -4} (m/V){sup 1/2}, respectively. (orig.)
Charge-coupled-device X-ray detector performance model
Bautz, M. W.; Berman, G. E.; Doty, J. P.; Ricker, G. R.
1987-01-01
A model that predicts the performance characteristics of CCD detectors being developed for use in X-ray imaging is presented. The model accounts for the interactions of both X-rays and charged particles with the CCD and simulates the transport and loss of charge in the detector. Predicted performance parameters include detective and net quantum efficiencies, split-event probability, and a parameter characterizing the effective thickness presented by the detector to cosmic-ray protons. The predicted performance of two CCDs of different epitaxial layer thicknesses is compared. The model predicts that in each device incomplete recovery of the charge liberated by a photon of energy between 0.1 and 10 keV is very likely to be accompanied by charge splitting between adjacent pixels. The implications of the model predictions for CCD data processing algorithms are briefly discussed.
Equivalent circuit modeling of space charge dominated magnetically insulated transmission lines
Energy Technology Data Exchange (ETDEWEB)
Hiraoka, Kazuki; Nakajima, Mitsuo; Horioka, Kazuhiko
1997-12-31
A new equivalent circuit model for space charge dominated MITLs (Magnetically Insulated Transmission Lines) was developed. MITLs under high power operation are dominated with space charge current flowing between anode and cathode. Conventional equivalent circuit model does not account for space charge effects on power flow. The model was modified to discuss the power transportation through the high power MITLs. With this model, it is possible to estimate the effects of space charge current on the power flow efficiency, without using complicated particle code simulations. (author). 3 figs., 3 refs.
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
Quadrupole transport experiment with space charge dominated cesium ion beam
International Nuclear Information System (INIS)
Faltens, A.; Keefe, D.; Kim, C.; Rosenblum, S.; Tiefenback, M.; Warwick, A.
1984-08-01
The purpose of the experiment is to investigate the beam current transport limit in a long quadrupole-focussed transport channel in the space charge dominated region where the space charge defocussing force is almost as large as the average focussing force of the channel
Simulation of photon and charge transport in X-ray imaging semiconductor sensors
Nilsson, H E; Hjelm, M; Bertilsson, K
2002-01-01
A fully stochastic model for the imaging properties of X-ray silicon pixel detectors is presented. Both integrating and photon counting configurations have been considered, as well as scintillator-coated structures. The model is based on three levels of Monte Carlo simulations; photon transport and absorption using MCNP, full band Monte Carlo simulation of charge transport and system level Monte Carlo simulation of the imaging performance of the detector system. In the case of scintillator-coated detectors, the light scattering in the detector layers has been simulated using a Monte Carlo method. The image resolution was found to be much lower in scintillator-coated systems due to large light spread in thick scintillator layers. A comparison between integrating and photon counting readout methods shows that the image resolution can be slightly enhanced using a photon-counting readout. In addition, the proposed model has been used to study charge-sharing effects on the energy resolution in photon counting dete...
Transportable charge in a periodic alternating gradient system
International Nuclear Information System (INIS)
Lee, E.P.; Fessenden, T.J.; Laslett, L.J.
1985-05-01
A simple set of formulas is derived which relate emittance, line charge density, matched maximum and average envelope radii, occupancy factors, and the (space charge) depressed and vacuum values of tune. This formulation is an improvement on the smooth limit approximation; deviations from exact (numerically determined) relations are on the order of +-2%, while the smooth limit values are in error by up to +-30%. This transport formalism is used to determine the limits of transportable line charge density in an electrostatic quadrupole array, with specific application to the low energy portion of the High Temperature Experiment of Heavy Ion Fusion Accelerator Research. The line charge density limit is found to be essentially proportional to the voltage on the pole faces and the fraction of occupied aperture area. A finite injection energy (greater than or equal to 2 MeV) is required to realize this limit, independent of particle mass
Two-Dimensional Charge Transport in Disordered Organic Semiconductors
Brondijk, J. J.; Roelofs, W. S. C.; Mathijssen, S. G. J.; Shehu, A.; Cramer, T.; Biscarini, F.; Blom, P. W. M.; de Leeuw, D. M.
2012-01-01
We analyze the effect of carrier confinement on the charge-transport properties of organic field-effect transistors. Confinement is achieved experimentally by the use of semiconductors of which the active layer is only one molecule thick. The two-dimensional confinement of charge carriers provides
Energy Technology Data Exchange (ETDEWEB)
Bhattacharjee, Sourav, E-mail: sourav.bhattacharjee@wur.nl [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Opstal, Edward J. van; Alink, Gerrit M. [Wageningen University, Division of Toxicology (Netherlands); Marcelis, Antonius T. M.; Zuilhof, Han [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Rietjens, Ivonne M. C. M. [Wageningen University, Division of Toxicology (Netherlands)
2013-06-15
The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size {approx}45 nm) and polystyrene nanoparticles (PSNPs/size {approx}50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).
Bhattacharjee, Sourav; van Opstal, Edward J.; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.
2013-06-01
The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size 45 nm) and polystyrene nanoparticles (PSNPs/size 50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).
International Nuclear Information System (INIS)
Bhattacharjee, Sourav; Opstal, Edward J. van; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.
2013-01-01
The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size ∼45 nm) and polystyrene nanoparticles (PSNPs/size ∼50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).
Charge Transport Along Phenylenevinylene Molecular Wires
2006-01-01
Abstract A model to calculate the mobility of charges along molecular wires is presented. The model is based on the tight-binding approximation and combines a quantum mechanical description of the charge with a classical description of the structural degrees of freedom. It is demonstrated that the average mobility of charge carriers along molecular wires can be obtained by time-propagation of states which are initially localised. The model is used to calculate the mobility of charg...
Kim, Y S; Balland, V; Limoges, B; Costentin, C
2017-07-21
Cyclic voltammetry is a particularly useful tool for characterizing charge accumulation in conductive materials. A simple model is presented to evaluate proton transport effects on charge storage in conductive materials associated with a redox process coupled with proton insertion in the bulk material from an aqueous buffered solution, a situation frequently encountered in metal oxide materials. The interplay between proton transport inside and outside the materials is described using a formulation of the problem through introduction of dimensionless variables that allows defining the minimum number of parameters governing the cyclic voltammetry response with consideration of a simple description of the system geometry. This approach is illustrated by analysis of proton insertion in a mesoporous TiO 2 film.
Lateral charge transport from heavy-ion tracks in integrated circuit chips
Zoutendyk, J. A.; Schwartz, H. R.; Nevill, L. R.
1988-01-01
A 256K DRAM has been used to study the lateral transport of charge (electron-hole pairs) induced by direct ionization from heavy-ion tracks in an IC. The qualitative charge transport has been simulated using a two-dimensional numerical code in cylindrical coordinates. The experimental bit-map data clearly show the manifestation of lateral charge transport in the creation of adjacent multiple-bit errors from a single heavy-ion track. The heavy-ion data further demonstrate the occurrence of multiple-bit errors from single ion tracks with sufficient stopping power. The qualitative numerical simulation results suggest that electric-field-funnel-aided (drift) collection accounts for single error generated by an ion passing through a charge-collecting junction, while multiple errors from a single ion track are due to lateral diffusion of ion-generated charge.
The single-sink fixed-charge transportation problem: Applications and solution methods
DEFF Research Database (Denmark)
Goertz, Simon; Klose, Andreas
2007-01-01
The single-sink fixed-charge transportation problem (SSFCTP) consists in finding a minimum cost flow from a number of supplier nodes to a single demand node. Shipping costs comprise costs proportional to the amount shipped as well as a fixed-charge. Although the SSFCTP is an important special case...... of the well-known fixed-charge transportation problem, just a few methods for solving this problem have been proposed in the literature. After summarising some applications of this problem arising in manufacturing and transportation, we give an overview on approximation algorithms and worst-case results...
The charge transport in an electrostatic belt generator
Vermeer, A.; Strasters, B.A.
1975-01-01
The fluctuations in the charge transport system of an EN Tandem Van de Graaff accelerator have been investigated by means of a frequency spectrum analyser. Frequency spectra of the terminal ripple, the short-circuit current and the voltage at the belt charge screen have been measured. Also the
A common pathway for charge transport through voltage-sensing domains.
Chanda, Baron; Bezanilla, Francisco
2008-02-07
Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.
Temperature dependent charge transport in poly(3-hexylthiophene) diodes
Rahaman, Abdulla Bin; Sarkar, Atri; Banerjee, Debamalya
2018-04-01
In this work, we present charge transport properties of poly(3-hexylthiophene) (P3HT) diodes under dark conditions. Temperature dependent current-voltage (J-V) characteristics shows that charge transport represents a transition from ohomic to trap limited current. The forward current density obeys a power law J˜Vm, m>2 represents the space charge limited current region in presence of traps within the band gap. Frequency dependent conductivity has been studied in a temperature range 150K-473K. The dc conductivity values show Arrhenius like behavior and it gives conductivity activation energy 223 meV. Temperature dependent conductivity indicates a thermodynamic transition of our system.
19 CFR 351.515 - Internal transport and freight charges for export shipments.
2010-04-01
... shipments. 351.515 Section 351.515 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE... Internal transport and freight charges for export shipments. (a) Benefit—(1) In general. In the case of internal transport and freight charges on export shipments, a benefit exists to the extent that the charges...
Longitudinal and transverse space charge limitations on transport of maximum power beams
International Nuclear Information System (INIS)
Khoe, T.K.; Martin, R.L.
1977-01-01
The maximum transportable beam power is a critical issue in selecting the most favorable approach to generating ignition pulses for inertial fusion with high energy accelerators. Maschke and Courant have put forward expressions for the limits on transport power for quadrupole and solenoidal channels. Included in a more general way is the self consistent effect of space charge defocusing on the power limit. The results show that no limits on transmitted power exist in principal. In general, quadrupole transport magnets appear superior to solenoids except for transport of very low energy and highly charged particles. Longitudinal space charge effects are very significant for transport of intense beams
Energy Technology Data Exchange (ETDEWEB)
Huang, Yanhui, E-mail: huangy12@rpi.edu; Schadler, Linda S. [Department of Material Science and Engineering, Rensselaer Polytechnic Institute, 110 8th street, Troy, New York 12180 (United States)
2016-08-07
The high field charge injection and transport properties in reinforced silicone dielectrics were investigated by measuring the time-dependent space charge distribution and the current under dc conditions up to the breakdown field and were compared with the properties of other dielectric polymers. It is argued that the energy and spatial distribution of localized electronic states are crucial in determining these properties for polymer dielectrics. Tunneling to localized states likely dominates the charge injection process. A transient transport regime arises due to the relaxation of charge carriers into deep traps at the energy band tails and is successfully verified by a Monte Carlo simulation using the multiple-hopping model. The charge carrier mobility is found to be highly heterogeneous due to the non-uniform trapping. The slow moving electron packet exhibits a negative field dependent drift velocity possibly due to the spatial disorder of traps.
Modelling dust transport in tokamaks
International Nuclear Information System (INIS)
Martin, J.D.; Martin, J.D.; Bacharis, M.; Coppins, M.; Counsell, G.F.; Allen, J.E.; Counsell, G.F.
2008-01-01
The DTOKS code, which models dust transport through tokamak plasmas, is described. The floating potential and charge of a dust grain in a plasma and the fluxes of energy to and from it are calculated. From this model, the temperature of the dust grain can be estimated. A plasma background is supplied by a standard tokamak edge modelling code (B2SOLPS5.0), and dust transport through MAST (the Mega-Amp Spherical Tokamak) and ITER plasmas is presented. We conclude that micron-radius tungsten dust can reach the separatrix in ITER. (authors)
Diffusive charge transport in graphene
Chen, Jianhao
The physical mechanisms limiting the mobility of graphene on SiO 2 are studied and printed graphene devices on a flexible substrate are realized. Intentional addition of charged scattering impurities is used to study the effects of charged impurities. Atomic-scale defects are created by noble-gas ions irradiation to study the effect of unitary scatterers. The results show that charged impurities and atomic-scale defects both lead to conductivity linear in density in graphene, with a scattering magnitude that agrees quantitatively with theoretical estimates. While charged impurities cause intravalley scattering and induce a small change in the minimum conductivity, defects in graphene scatter electrons between the valleys and suppress the minimum conductivity below the metallic limit. Temperature-dependent measurements show that longitudinal acoustic phonons in graphene produce a small resistivity which is linear in temperature and independent of carrier density; at higher temperatures, polar optical phonons of the SiO2 substrate give rise to an activated, carrier density-dependent resistivity. Graphene is also made into high mobility transparent and flexible field effect device via the transfer-printing method. Together the results paint a complete picture of charge carrier transport in graphene on SiO2 in the diffusive regime, and show the promise of graphene as a novel electronic material that have potential applications not only on conventional inorganic substrates, but also on flexible substrates.
Disorder-tuned charge transport in organic semiconductors
Xu, Feng; Qiu, Dong; Yan, Dadong
2013-02-01
We propose that the polaron transport in organic semiconductors is remarkably tuned by the fluctuation of polarization energy. The tuning effect of energetic fluctuation not only causes a continuous transition from non-Arrhenius to Arrhenius temperature activated charge transport with increasing moderate disorder strengths but also results in a band-like conduction in the low disorder regime which benefits from the enhanced mobilities in shallow trap states. As a result, a unified description of polaron transport is obtained for a set of typical organic semiconductors.
International Nuclear Information System (INIS)
Hedegard, Per; Bjornholm, Thomas
2005-01-01
The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond
An LP-based heuristic for the fixed charge transportation problem
DEFF Research Database (Denmark)
Klose, Andreas
2007-01-01
The fixed charge transportation problem consists in finding a minimum cost network flow from a set of suppliers to a set of customers. Beside costs proportional to quantities transported, transportation costs also include a fixed charge. The paper describes a linear programming based heuristic...... approach for computing lower and upper bounds on the minimal cost. To this end, the LP relaxation is iteratively strengthened by means of adding cuts; in each iteration the current LP solution is then used to guide a local search heuristic. In addition to standard polyhedral cuts as lifted cover...
Energy Technology Data Exchange (ETDEWEB)
Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.
2016-07-15
We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.
Modelling of charge carrier transport in conjugated polymers doped by polar additives
Czech Academy of Sciences Publication Activity Database
Toman, Petr; Nešpůrek, Stanislav; Bartkowiak, W.
2009-01-01
Roč. 27, č. 3 (2009), s. 797-812 ISSN 0137-1339. [International Conference on Electrical and Related Properties of Organic Solids /11./. Piechowice, 13.07.2008-17.07.2008] R&D Projects: GA ČR GA203/06/0285; GA AV ČR KAN400720701; GA MŠk MEB050815 Institutional research plan: CEZ:AV0Z40500505 Keywords : conjugated polymers * charge carrier transport * molecular electronics Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.384, year: 2009
Role of mesoscopic morphology in charge transport of doped ...
Indian Academy of Sciences (India)
In doped polyaniline (PANI), the charge transport properties are determined by mesoscopic morphology, which in turn is controlled by the molecular recognition interactions among polymer chain, dopant and solvent. Molecular recognition plays a significant role in chain conformation and charge delocalization.
Bai, Jaeil; Ducharme, Stephen; Leonov, Alexei G.; Lu, Liu; Takacs, James M.
1999-10-01
In this report, we introduce new organic photorefractive composites consisting of charge transporting den-drimers highly doped with a stilbene nonlinear optic chromophore, The purpose of making these composites is to improve charge transport, by reducing inhomogeneity when compared to ordinary polymer-based systems. Because the structure of this material gives us freedom to control the orientation of charge transport agents synthetically, we can study the charge transport mechanism more systematically than in polymers. We discuss this point and present the characterization results for this material.
Directory of Open Access Journals (Sweden)
Haoming Liu
2018-04-01
Full Text Available With the advance of battery energy technology, electric vehicles (EV are catching more and more attention. One of the influencing factors of electric vehicles large-scale application is the availability of charging stations and convenience of charging. It is important to investigate how to make reserving charging strategies and ensure electric vehicles are charged with shorter time and lower charging expense whenever charging request is proposed. This paper proposes a reserving charging decision-making model for electric vehicles that move to certain destinations and need charging services in consideration of traffic conditions and available charging resources at the charging stations. Besides, the interactive mechanism is described to show how the reserving charging system works, as well as the rolling records-based credit mechanism where extra charges from EV is considered to hedge default behavior. With the objectives of minimizing driving time and minimizing charging expenses, an optimization model with two objective functions is formulated. Then the optimizations are solved by a K shortest paths algorithm based on a weighted directed graph, where the time and distance factors are respectively treated as weights of corresponding edges of transportation networks. Case studies show the effectiveness and validity of the proposed route plan and reserving charging decision-making model.
Energy Technology Data Exchange (ETDEWEB)
Nozaki, Daijiro, E-mail: daijiro.nozaki@gmail.com, E-mail: research@nano.tu-dresden.de [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Kunstmann, Jens [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Theoretical Chemistry, Department of Chemistry and Food Chemistry, TU Dresden, 01062 Dresden (Germany); Zörgiebel, Felix [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Center for Advancing Electronics Dresden (cfAED), TU Dresden, 01062 Dresden (Germany); Cuniberti, Gianaurelio [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Center for Advancing Electronics Dresden (cfAED), TU Dresden, 01062 Dresden (Germany); Dresden Center for Computational Materials Science (DCCMS), TU Dresden, 01062 Dresden (Germany)
2015-05-18
One dimensional nanowire field effect transistors (NW-FETs) are a promising platform for sensor applications. The transport characteristics of NW-FETs are strongly modified in liquid environment due to the charging of surface functional groups accompanied with protonation or deprotonation. In order to investigate the influence of surface charges and ionic concentrations on the transport characteristics of Schottky-barrier NW-FETs, we have combined the modified Poisson-Boltzmann theory with the Landauer-Büttiker transport formalism. For a typical device, the model is able to capture the reduction of the sensitivity of NW-FETs in ionic solutions due to the screening from counter ions as well as a local gating from surface functional groups. Our approach allows to model, to investigate, and to optimize realistic Schottky-barrier NW-FET devices in liquid environment.
Semiconductor drift chamber: an application of a novel charge transport scheme
International Nuclear Information System (INIS)
Gatti, E.; Rehak, P.
1983-08-01
The purpose of this paper is to describe a novel charge tranport scheme in semiconductors in which the field responsible for the charge transport is independent of the depletion field. The application of the novel charge transport scheme leads to the following new semiconductor detectors: (1) Semiconductor Draft Chamber; (2) Ultra low capacitance - large semiconductor x-ray spectrometers and photodiodes; and (3) Fully depleted thick CCD. Special attention is paid to the concept of the Semiconductor Draft Chamber as a position sensing detector for high energy charged particles. Position resolution limiting factors are considered, and the values of the resolutions are given
Steiner, Florian; Poelking, Carl; Niedzialek, Dorota; Andrienko, Denis; Nelson, Jenny
2017-05-03
We present a multi-scale model for charge transport across grain boundaries in molecular electronic materials that incorporates packing disorder, electrostatic and polarisation effects. We choose quasi two-dimensional films of tri-isopropylsilylethynyl pentacene (TIPS-P) as a model system representative of technologically relevant crystalline organic semiconductors. We use atomistic molecular dynamics, with a force-field specific for TIPS-P, to generate and equilibrate polycrystalline two-dimensional thin films. The energy landscape is obtained by calculating contributions from electrostatic interactions and polarization. The variation in these contributions leads to energetic barriers between grains. Subsequently, charge transport is simulated using a kinetic Monte-Carlo algorithm. Two-grain systems with varied mutual orientation are studied. We find relatively little effect of long grain boundaries due to the presence of low impedance pathways. However, effects could be more pronounced for systems with limited inter-grain contact areas. Furthermore, we present a lattice model to generalize the model for small molecular systems. In the general case, depending on molecular architecture and packing, grain boundaries can result in interfacial energy barriers, traps or a combination of both with qualitatively different effects on charge transport.
International Nuclear Information System (INIS)
Zhong, Haijian; Liu, Zhenghui; Xu, Gengzhao; Shi, Lin; Fan, Yingmin; Yang, Hui; Xu, Ke; Wang, Jianfeng; Ren, Guoqiang
2014-01-01
Graphene has been proposed as a material for semiconductor electronic and optoelectronic devices. Understanding the charge transport mechanisms of graphene/semiconductor Schottky barriers will be crucial for future applications. Here, we report a theoretical model to describe the transport mechanisms at the interface of graphene and semiconductors based on conventional semiconductor Schottky theory and a floating Fermi level of graphene. The contact barrier heights can be estimated through this model and be close to the values obtained from the experiments, which are lower than those of the metal/semiconductor contacts. A detailed analysis reveals that the barrier heights are as the function of the interface separations and dielectric constants, and are influenced by the interfacial states of semiconductors. Our calculations show how this behavior of lowering barrier heights arises from the Fermi level shift of graphene induced by the charge transfer owing to the unique linear electronic structure
Charge Transport in LDPE Nanocomposites Part I—Experimental Approach
Directory of Open Access Journals (Sweden)
Anh T. Hoang
2016-03-01
Full Text Available This work presents results of bulk conductivity and surface potential decay measurements on low-density polyethylene and its nanocomposites filled with uncoated MgO and Al2O3, with the aim to highlight the effect of the nanofillers on charge transport processes. Material samples at various filler contents, up to 9 wt %, were prepared in the form of thin films. The performed measurements show a significant impact of the nanofillers on reduction of material’s direct current (dc conductivity. The investigations thus focused on the nanocomposites having the lowest dc conductivity. Various mechanisms of charge generation and transport in solids, including space charge limited current, Poole-Frenkel effect and Schottky injection, were utilized for examining the experimental results. The mobilities of charge carriers were deduced from the measured surface potential decay characteristics and were found to be at least two times lower for the nanocomposites. The temperature dependencies of the mobilities were compared for different materials.
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
Diffusive charge transport in graphene on SiO 2
Chen, J.-H.; Jang, C.; Ishigami, M.; Xiao, S.; Cullen, W. G.; Williams, E. D.; Fuhrer, M. S.
2009-07-01
We review our recent work on the physical mechanisms limiting the mobility of graphene on SiO 2. We have used intentional addition of charged scattering impurities and systematic variation of the dielectric environment to differentiate the effects of charged impurities and short-range scatterers. The results show that charged impurities indeed lead to a conductivity linear in density ( σ(n)∝n) in graphene, with a scattering magnitude that agrees quantitatively with theoretical estimates; increased dielectric screening reduces the scattering from charged impurities, but increases the scattering from short-range scatterers. We evaluate the effects of the corrugations (ripples) of graphene on SiO 2 on transport by measuring the height-height correlation function. The results show that the corrugations cannot mimic long-range (charged impurity) scattering effects, and have too small an amplitude-to-wavelength ratio to significantly affect the observed mobility via short-range scattering. Temperature-dependent measurements show that longitudinal acoustic phonons in graphene produce a resistivity that is linear in temperature and independent of carrier density; at higher temperatures, polar optical phonons of the SiO 2 substrate give rise to an activated, carrier density-dependent resistivity. Together the results paint a complete picture of charge carrier transport in graphene on SiO 2 in the diffusive regime.
Charge transport properties of metal/metal-phthalocyanine/n-Si structures
Energy Technology Data Exchange (ETDEWEB)
Hussain, Afzal
2010-12-16
In present work the charge transport properties of metal/metal-phthalocyanine/n-Si structures with low (N{sub D} = 4 x 10{sup 14} cm{sup -3}), medium (N{sub D}=1 x 10{sup 16} cm{sup -3}) and high (N{sub D}=2 x 10{sup 19} cm{sup -3}) doped n-Si as injecting electrode and the effect of air exposure of the vacuum evaporated metal-phthalocyanine film in these structures is investigated. The results obtained through temperature dependent electrical characterizations of the structures suggest that in terms of dominant conduction mechanism in the corresponding devices Schottky-type conduction mechanism dominates the charge transport in low-bias region of these devices up to 0.8 V, 0.302 V and 0.15 V in case of low, medium and high doped n-Silicon devices. For higher voltages, in each case of devices, the space-charge-limited conduction, controlled by exponential trap distribution, is found to dominate the charge transport properties of the devices. The interface density of states at the CuPc/n-Si interface of the devices are found to be lower in case of lower work function difference at the CuPc/n-Si interface of the devices. The results also suggest that the work function difference at the CuPc/n-Si interface of these devices causes charge transfer at the interface and these phenomena results in formation of interface dipole. The width of the Schottky depletion region at the CuPc/n-Si interface of these devices is found to be higher with higher work function difference at the interface. The investigation of charge transport properties of Al/ZnPc/medium n-Si and Au/ZnPc/ medium n-Si devices suggest that the Schottky depletion region formed at the ZnPc/n-Si interface of these devices determines the charge transport in the low-bias region of both the devices. Therefore, the Schottky-type (injection limited) and the space-charge-limited (bulk limited) conduction are observed in the low and the high bias regions of these devices, respectively. The determined width of the
Density functional theory calculations of charge transport properties ...
Indian Academy of Sciences (India)
ZIRAN CHEN
2017-08-04
Aug 4, 2017 ... properties of 'plate-like' coronene topological structures ... Keywords. Organic semiconductors; density functional theory; charge carrier mobility; ambipolar transport; ..... nology Department of Sichuan Province (Grant Number.
Understanding charge transport in molecular electronics.
Kushmerick, J J; Pollack, S K; Yang, J C; Naciri, J; Holt, D B; Ratner, M A; Shashidhar, R
2003-12-01
For molecular electronics to become a viable technology the factors that control charge transport across a metal-molecule-metal junction need to be elucidated. We use an experimentally simple crossed-wire tunnel junction to interrogate how factors such as metal-molecule coupling, molecular structure, and the choice of metal electrode influence the current-voltage characteristics of a molecular junction.
Effect of backbone structure on charge transport along isolated conjugated polymer chains
International Nuclear Information System (INIS)
Siebbeles, Laurens D.A.; Grozema, Ferdinand C.; Haas, Matthijs P. de; Warman, John M.
2005-01-01
Fast charge transport in conjugated polymers is essential for their application in opto-electronic devices. In the present paper, measurements and theoretical modeling of the mobility of excess charges along isolated chains of conjugated polymers in dilute solution are presented. Charge carriers were produced by irradiation of the polymer solution with 3-MeV electrons from a Van de Graaff accelerator. The mobilities of the charges along the polymer chains were obtained from time-resolved microwave conductivity measurements. The mobilities are strongly dependent on the chemical nature of the polymer backbone. Comparison of the experimental data with results from ab initio quantum mechanical calculations shows that the measured mobilities are strongly limited by torsional disorder, chemical defects and chain ends. Improvement of the structure of polymer backbones is therefore expected to significantly enhance the performance of these materials in 'plastic electronics'
DEFF Research Database (Denmark)
Muniruzzaman, Muhammad; Rolle, Massimo
Electrochemical cross-coupling plays a significant role for transport of charged species in porous media [1, 2]. In this study we performed flow-through experiments in a quasi two-dimensional setup using dilute solutions of strong electrolytes to study the influence of charge interactions on mass...... occurred. To quantitatively interpret the outcomes of our laboratory experiments in the spatially variable flow fields we developed a two dimensional numerical model based on a multicomponent formulation, on charge conservation and on the accurate description of transverse dispersion. The results...... of the multicomponent transport simulations were compared with the high-resolution (5 mm spacing) concentration measurements of the ionic species at the outlet of the flow-through domain. The excellent agreement between the measured concentrations and the results of purely forward numerical simulations demonstrates...
Charge transport in a CoPt3 nanocrystal microwire
International Nuclear Information System (INIS)
Beecher, P.; De Marzi, G.; Quinn, A.J.; Redmond, G.; Shevchenko, E.V.; Weller, H.
2004-01-01
The electrical characteristics of single CoPt 3 nanocrystal microwires formed by magnetic field-directed growth from colloidal solutions are presented. The wires comprise disordered assemblies of discrete nanocrystals, separated from each other by protective organic ligand shells. Electrical data indicate that the activated charge transport properties of the wires are determined by the nanocrystal charging energy, governed by the size and capacitance of the individual nanocrystals. Focused ion beam-assisted deposition of Pt metal at the wire-electrode junctions is employed to optimize the wire-electrode contacts, whilst maintaining the nanocrystal-dominated transport characteristics of these one-dimensional nanocrystal structures
Yuan, Li; Wang, Lejia; Garrigues, Alvar R.; Jiang, Li; Annadata, Harshini Venkata; Anguera Antonana, Marta; Barco, Enrique; Nijhuis, Christian A.
2018-04-01
Solid-state molecular tunnel junctions are often assumed to operate in the Landauer regime, which describes essentially activationless coherent tunnelling processes. In solution, on the other hand, charge transfer is described by Marcus theory, which accounts for thermally activated processes. In practice, however, thermally activated transport phenomena are frequently observed also in solid-state molecular junctions but remain poorly understood. Here, we show experimentally the transition from the Marcus to the inverted Marcus region in a solid-state molecular tunnel junction by means of intra-molecular orbital gating that can be tuned via the chemical structure of the molecule and applied bias. In the inverted Marcus region, charge transport is incoherent, yet virtually independent of temperature. Our experimental results fit well to a theoretical model that combines Landauer and Marcus theories and may have implications for the interpretation of temperature-dependent charge transport measurements in molecular junctions.
The Effect of Voltage Charging on the Transport Properties of Gold Nanotube Membranes.
Experton, Juliette; Martin, Charles R
2018-05-01
Porous membranes are used in chemical separations and in many electrochemical processes and devices. Research on the transport properties of a unique class of porous membranes that contain monodisperse gold nanotubes traversing the entire membrane thickness is reviewed here. These gold nanotubes can act as conduits for ionic and molecular transports through the membrane. Because the tubes are electronically conductive, they can be electrochemically charged by applying a voltage to the membrane. How this "voltage charging" affects the transport properties of gold nanotube membranes is the subject of this Review. Experiments showing that voltage charging can be used to reversibly switch the membrane between ideally cation- and anion-transporting states are reviewed. Voltage charging can also be used to enhance the ionic conductivity of gold nanotube membranes. Finally, voltage charging to accomplish electroporation of living bacteria as they pass through gold nanotube membranes is reviewed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Investigating anomalous transport of electrolytes in charged porous media
Skjøde Bolet, Asger Johannes; Mathiesen, Joachim
2017-04-01
Surface charge is know to play an important role in microfluidics devices when dealing with electrolytes and their transport properties. Similarly, surface charge could play a role for transport in porous rock with submicron pore sizes. Estimates of the streaming potentials and electro osmotic are mostly considered in simple geometries both using analytic and numerical tools, however it is unclear at present how realistic complex geometries will modify the dynamics. Our work have focused on doing numerical studies of the full three-dimensional Stokes-Poisson-Nernst-Planck problem for electrolyte transport in porous rock. As the numerical implementation, we have used a finite element solver made using the FEniCS project code base, which can both solve for a steady state configuration and the full transient. In the presentation, we will show our results on anomalous transport due to electro kinetic effects such as the streaming potential or the electro osmotic effect.
International Nuclear Information System (INIS)
Schmidt, Johannes; Eisel, Matthias; Kolbe, Lutz M.
2014-01-01
A key reason for the low sales volumes of electric vehicles is their significantly higher purchasing price in comparison to conventional vehicles. However, various charging strategies can be applied to make these vehicles more profitable. In this paper, controlled charging concepts are transferred to commercial fleets operating in closed transport systems, as we found this field of application particularly well suited for the implementation of charging strategies. We analyzed data gathered in a field experiment conducted in a European port using electric vehicles in combination with a battery-swapping station to calculate the economic potentials of three charging scenarios: (1) optimizing energy procurement (2) trading load-shifting potential on control markets, and (3) a combination of the two. The findings indicate that all approaches are appropriate for reducing economic disadvantages of electric transport vehicles. Furthermore, we find that adjusting charging processes to avoid price peaks is more profitable than offering control reserve. Finally, focusing on the combination of both strategies seems to be most promising from an economic perspective. In this context, operational cost savings of more than 65% can be achieved compared to a similar dieselpowered vehicle when applying this strategy. - Highlights: • We model various charging strategies for electric transport vehicles. • The economic assessment is based on a field experiment with a port operator. • We consider the special market design of spot and ancillary service markets. • All charging strategies presented provide substantial cost-saving potentials. • Optimizing energy procurement is more profitable than offering control reserve
Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy
International Nuclear Information System (INIS)
Lee, Min Hyung; Song, Hyunwook
2013-01-01
We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects
Charge transport through molecular rods with reduced pi-conjugation.
Lörtscher, Emanuel; Elbing, Mark; Tschudy, Meinrad; von Hänisch, Carsten; Weber, Heiko B; Mayor, Marcel; Riel, Heike
2008-10-24
A series of oligophenylene rods of increasing lengths is synthesized to investigate the charge-transport mechanisms. Methyl groups are attached to the phenyl rings to weaken the electronic overlap of the pi-subsystems along the molecular backbones. Out-of-plane rotation of the phenyl rings is confirmed in the solid state by means of X-ray analysis and in solution by using UV/Vis spectroscopy. The influence of the reduced pi-conjugation on the resonant charge transport is studied at the single-molecule level by using the mechanically controllable break-junction technique. Experiments are performed under ultra-high-vacuum conditions at low temperature (50 K). A linear increase of the conductance gap with increasing number of phenyl rings (from 260 meV for one ring to 580 meV for four rings) is revealed. In addition, the absolute conductance of the first resonant peaks does not depend on the length of the molecular wire. Resonant transport through the first molecular orbital is found to be dominated by charge-carrier injection into the molecule, rather than by the intrinsic resistance of the molecular wire length.
Quantitative description of charge-carrier transport in a white organic light-emitting diode
Schober, M.; Anderson, M.; Thomschke, M.; Widmer, J.; Furno, M.; Scholz, R.; Lüssem, B.; Leo, K.
2011-10-01
We present a simulation model for the analysis of charge-carrier transport in organic thin-film devices, and apply it to a three-color white hybrid organic light-emitting diode (OLED) with fluorescent blue and phosphorescent red and green emission. We simulate a series of single-carrier devices, which reconstruct the OLED layer sequence step by step. Thereby, we determine the energy profiles for hole and electron transport, show how to discern bulk from interface limitation, and identify trap states.
Transportation charges in the gas industry
International Nuclear Information System (INIS)
Price, C.
1994-01-01
British Gas was privatized in 1986, a monopoly with no direct competition and only very light regulation of the tariff market. The regulator had an obligation to enable competition to develop in the unregulated, large-quantity, contract market. Competitors required access to the BG-owned transportation network. The government has recently rejected the recommendation of divestiture of the supply business, but has accelerated the advent of competition to the domestic market. This paper considers the role of BG's transport charges in these developments, using its past behaviour as a guide, and identifying the issues for future regulation and development of the gas market. (Author)
Charge injection and transport in quantum confined and disordered systems
Houtepen, A.J.
2007-01-01
Quantum dots and conducting polymers are modern semiconductors with a high potential for applications such as lasers, LEDs, displays, solar cells etc. These applications require the controlled addition of charge carriers into the material and knowledge of the details of charge transport. This thesis
Intrinsic Charge Transport in Organic Field-Effect Transistors
Podzorov, Vitaly
2005-03-01
Organic field-effect transistors (OFETs) are essential components of modern electronics. Despite the rapid progress of organic electronics, understanding of fundamental aspects of the charge transport in organic devices is still lacking. Recently, the OFETs based on highly ordered organic crystals have been fabricated with innovative techniques that preserve the high quality of single-crystal organic surfaces. This technological progress facilitated the study of transport mechanisms in organic semiconductors [1-4]. It has been demonstrated that the intrinsic polaronic transport, not dominated by disorder, with a remarkably high mobility of ``holes'' μ = 20 cm^2/Vs can be achieved in these devices at room temperature [4]. The signatures of the intrinsic polaronic transport are the anisotropy of the carrier mobility and an increase of μ with cooling. These and other aspects of the charge transport in organic single-crystal FETs will be discussed. Co-authors are Etienne Menard, University of Illinois at Urbana Champaign; Valery Kiryukhin, Rutgers University; John Rogers, University of Illinois at Urbana Champaign; Michael Gershenson, Rutgers University. [1] V. Podzorov et al., Appl. Phys. Lett. 82, 1739 (2003); ibid. 83, 3504 (2003). [2] V. C. Sundar et al., Science 303, 1644 (2004). [3] R. W. I. de Boer et al., Phys. Stat. Sol. (a) 201, 1302 (2004). [4] V. Podzorov et al., Phys. Rev. Lett. 93, 086602 (2004).
Charge carrier relaxation model in disordered organic semiconductors
International Nuclear Information System (INIS)
Lu, Nianduan; Li, Ling; Sun, Pengxiao; Liu, Ming
2013-01-01
The relaxation phenomena of charge carrier in disordered organic semiconductors have been demonstrated and investigated theoretically. An analytical model describing the charge carrier relaxation is proposed based on the pure hopping transport theory. The relation between the material disorder, electric field and temperature and the relaxation phenomena has been discussed in detail, respectively. The calculated results reveal that the increase of electric field and temperature can promote the relaxation effect in disordered organic semiconductors, while the increase of material disorder will weaken the relaxation. The proposed model can explain well the stretched-exponential law by adopting the appropriate parameters. The calculation shows a good agreement with the experimental data for organic semiconductors
Algorithms for solving the single-sink fixed-charge transportation problem
DEFF Research Database (Denmark)
Klose, Andreas
2006-01-01
The single-sink fixed-charge transportation problem is an important subproblem of the fixed-charge transportation problem. Just a few methods have been proposed in the literature to solve this problem. In this paper, solution approaches based on dynamic programming and implicit enumeration...... are revisited. It is shown how the problem size as well as the search space of a recently published dynamic programming method can be reduced by exploiting reduced cost information. Additionally, a further implicit enumeration approach relying on solution concepts for the binary knapsack problem is introduced...
Energy Technology Data Exchange (ETDEWEB)
Spencer, J.; Gajdos, F.; Blumberger, J., E-mail: j.blumberger@ucl.ac.uk [Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)
2016-08-14
We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.
Spencer, J.; Gajdos, F.; Blumberger, J.
2016-08-01
We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.
Spjeldvik, W. N.
1981-01-01
Computer simulations of processes which control the relative abundances of ions in the trapping regions of geospace are compared with observations from discriminating ion detectors. Energy losses due to Coulomb collisions between ions and exospheric neutrals are considered, along with charge exchange losses and internal charge exchanges. The time evolution of energetic ion fluxes of equatorially mirroring ions under radial diffusion is modelled to include geomagnetic and geoelectric fluctutations. Limits to the validity of diffusion transport theory are discussed, and the simulation is noted to contain provisions for six ionic charge states and the source effect on the radiation belt oxygen ion distributions. Comparisons are made with ion flux data gathered on Explorer 45 and ISEE-1 spacecraft and results indicate that internal charge exchanges cause the radiation belt ion charge state to be independent of source charge rate characteristics, and relative charge state distribution is independent of the radially diffusive transport rate below the charge state redistribution zone.
Charge Transport in Two-Photon Semiconducting Structures for Solar Fuels.
Liu, Guohua; Du, Kang; Haussener, Sophia; Wang, Kaiying
2016-10-20
Semiconducting heterostructures are emerging as promising light absorbers and offer effective electron-hole separation to drive solar chemistry. This technology relies on semiconductor composites or photoelectrodes that work in the presence of a redox mediator and that create cascade junctions to promote surface catalytic reactions. Rational tuning of their structures and compositions is crucial to fully exploit their functionality. In this review, we describe the possibilities of applying the two-photon concept to the field of solar fuels. A wide range of strategies including the indirect combination of two semiconductors by a redox couple, direct coupling of two semiconductors, multicomponent structures with a conductive mediator, related photoelectrodes, as well as two-photon cells are discussed for light energy harvesting and charge transport. Examples of charge extraction models from the literature are summarized to understand the mechanism of interfacial carrier dynamics and to rationalize experimental observations. We focus on a working principle of the constituent components and linking the photosynthetic activity with the proposed models. This work gives a new perspective on artificial photosynthesis by taking simultaneous advantages of photon absorption and charge transfer, outlining an encouraging roadmap towards solar fuels. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Xu, Guangwei; Gao, Nan; Lu, Congyan; Wang, Wei; Ji, Zhuoyu; Bi, Chong; Han, Zhiheng; Lu, Nianduan; Yang, Guanhua; Li, Yuan; Liu, Qi; Li, Ling; Liu, Ming
2018-01-01
, the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I
Electric generation and ratcheted transport of contact-charged drops
Cartier, Charles A.; Graybill, Jason R.; Bishop, Kyle J. M.
2017-10-01
We describe a simple microfluidic system that enables the steady generation and efficient transport of aqueous drops using only a constant voltage input. Drop generation is achieved through an electrohydrodynamic dripping mechanism by which conductive drops grow and detach from a grounded nozzle in response to an electric field. The now-charged drops are transported down a ratcheted channel by contact charge electrophoresis powered by the same voltage input used for drop generation. We investigate how the drop size, generation frequency, and transport velocity depend on system parameters such as the liquid viscosity, interfacial tension, applied voltage, and channel dimensions. The observed trends are well explained by a series of scaling analyses that provide insight into the dominant physical mechanisms underlying drop generation and ratcheted transport. We identify the conditions necessary for achieving reliable operation and discuss the various modes of failure that can arise when these conditions are violated. Our results demonstrate that simple electric inputs can power increasingly complex droplet operations with potential opportunities for inexpensive and portable microfluidic systems.
Ion Transport through Diffusion Layer Controlled by Charge Mosaic Membrane
Directory of Open Access Journals (Sweden)
Akira Yamauchi
2012-01-01
Full Text Available The kinetic transport behaviors in near interface of the membranes were studied using commercial anion and cation exchange membrane and charge mosaic membrane. Current-voltage curve gave the limiting current density that indicates the ceiling of conventional flux. From chronopotentiometry above the limiting current density, the transition time was estimated. The thickness of boundary layer was derived with conjunction with the conventional limiting current density and the transition time from steady state flux. On the other hand, the charge mosaic membrane was introduced in order to examine the ion transport on the membrane surface in detail. The concentration profile was discussed by the kinetic transport number with regard to the water dissociation (splitting on the membrane surface.
An alternative approach to charge transport in semiconducting electrodes
Thomchick, J.; Buoncristiani, A. M.
1980-01-01
The excess-carrier charge transport through the space-charge region of a semiconducting electrode is analyzed by a technique known as the flux method. In this approach reflection and transmission coefficients appropriate for a sheet of uniform semiconducting material describe its transport properties. A review is presented of the flux method showing that the results for a semiconductor electrode reduce in a limiting case to those previously found by Gaertner if the depletion layer is treated as a perfectly transmitting medium in which scattering and recombination are ignored. Then, in the framework of the flux method the depletion layer is considered more realistically by explicitly taking into account scattering and recombination processes which occur in this region.
Charge transport and recombination dynamics in organic bulk heterojunction solar cells
Energy Technology Data Exchange (ETDEWEB)
Baumann, Andreas
2011-08-02
The charge transport in disordered organic bulk heterojunction (BHJ) solar cells is a crucial process affecting the power conversion efficiency (PCE) of the solar cell. With the need of synthesizing new materials for improving the power conversion efficiency of those cells it is important to study not only the photophysical but also the electrical properties of the new material classes. Thereby, the experimental techniques need to be applicable to operating solar cells. In this work, the conventional methods of transient photoconductivity (also known as ''Time-of-Flight'' (TOF)), as well as the transient charge extraction technique of ''Charge Carrier Extraction by Linearly Increasing Voltage'' (CELIV) are performed on different organic blend compositions. Especially with the latter it is feasible to study the dynamics - i.e. charge transport and charge carrier recombination - in bulk heterojunction (BHJ) solar cells with active layer thicknesses of 100-200 nm. For a well performing organic BHJ solar cells the morphology is the most crucial parameter finding a trade-off between an efficient photogeneration of charge carriers and the transport of the latter to the electrodes. Besides the morphology, the nature of energetic disorder of the active material blend and its influence on the dynamics are discussed extensively in this work. Thereby, the material system of poly(3-hexylthiophene-2,5-diyl) (P3HT) and [6,6]-phenyl-C{sub 61}butyric acid methyl ester (PC{sub 61}BM) serves mainly as a reference material system. New promising donor or acceptor materials and their potential for application in organic photovoltaics are studied in view of charge dynamics and compared with the reference system. With the need for commercialization of organic solar cells the question of the impact of environmental conditions on the PCE of the solar cells raises. In this work, organic BHJ solar cells exposed to synthetic air for finite duration are
Modulation and Control of Charge Transport Through Single-Molecule Junctions.
Wang, Kun; Xu, Bingqian
2017-02-01
The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge
Temperature-dependent charge transport mechanisms in carbon sphere/polyaniline composite
Nieves, Cesar A.; Martinez, Luis M.; Meléndez, Anamaris; Ortiz, Margarita; Ramos, Idalia; Pinto, Nicholas J.; Zimbovskaya, Natalya
2017-12-01
Charge transport in the temperature range 80 K electrons between polymeric chains in PANi-filled gaps between CS is the predominant transport mechanism through CS/PANi composites. The high conductivity of the CS/PANi composite makes the material attractive for the fabrication of devices and sensors.
Charge transport in disordered organic field-effect transistors
Tanase, Cristina; Blom, Paul W.M.; Meijer, Eduard J.; Leeuw, Dago M. de; Jabbour, GE; Carter, SA; Kido, J; Lee, ST; Sariciftci, NS
2002-01-01
The transport properties of poly(2,5-thienylene vinylene) (PTV) field-effect transistors (FET) have been investigated as a function of temperature under controlled atmosphere. In a disordered semiconductor as PTV the charge carrier mobility, dominated by hopping between localized states, is
Volpi, Riccardo; Camilo, Ana Claudia Santos; Filho, Demetrio A da Silva; Navarrete, Juan T López; Gómez-Lor, Berta; Delgado, M Carmen Ruiz; Linares, Mathieu
2017-09-13
We have performed a multiscale approach to study the influence of peripheral substitution in the semiconducting properties of discotic liquid-crystalline triindoles. Charge carrier mobility as high as 1.4 cm 2 V -1 s -1 was experimentally reported for triindoles substituted with alkynyl chains on the periphery (Gómez-Lor et al. Angew. Chem., Int. Ed., 2011, 50, 7399-7402). In this work, our goal is to get a deeper understanding of both the molecular electronic structure and microscopic factors affecting the charge transport properties in triindoles as a function of the spacer group connecting the central cores with the external alkyl chains (i.e., alkyne or phenyl spacers groups). To this end, we first perform Quantum Mechanical (QM) calculations to assess how the peripheral substitution affects the electronic structure and the internal reorganization energy. Secondly, boxes of stacked molecules were built and relaxed through molecular dynamics to obtain realistic structures. Conformational analysis and calculations of transfer integrals for closed neighbours were performed. Our results show that the insertion of ethynyl spacers between the central aromatic core and the flexible peripheral chains results in lower reorganization energies and enhanced intermolecular order within the stacks with a preferred cofacial 60° staggered conformation, which would result in high charge-carrier mobilities in good agreement with the experimental data. This work allows a deeper understanding of charge carrier mobility in columnar phases, linking the structural order at the molecular level to the property of interest, i.e. the charge carrier mobility. We hope that this understanding will improve the design of systems at the supramolecular level aiming at obtaining a more defined conducting channel, higher mobility and smaller fluctuations within the column.
International Nuclear Information System (INIS)
Saïdi, Sami; Bouzitoun, Mouna; Mannaî, Aymen; Gmati, Fethi; Derouiche, Hassen; Mohamed, Abdellatif Belhadj
2013-01-01
Polyaniline–Poly(vinylidene) fluoride (PANI–PVDF) composites were prepared by adding PANI to the PVDF by different weight percentages p % (p = 0, 5, 10, 20, … until 100%). The dc and ac electrical conductivity were studied as a function of PANI percentage in the temperature range 303–453 K. The percolation threshold was found to be equal to 2.95%. When the amount of PANI varies from 5 to 30%, the charge transport mechanism was found to be governed by Mott's three-dimensional variable range hopping model and the dc conductivity decreases within this range. For p > 30%, the conductivity increases and the charge transport mechanism are better fitted by a fluctuation induced tunnelling model (FIT). By calculating the distance ‘s’ between two successive clusters (the distance between two active imines centres (=N + H–) of PANI) from the FIT model, we deduce that electron charge transfer is done by inter-chain hopping for the range [p = 40 to 60%] and by intra-chain hopping for p = 70 to 90%. Some insights about the contribution of the ionic charge transport for PANI concentrations in the interval 5% < p < 30% were obtained using impedance measurements at different frequencies. X-ray diffraction measurements, Fourier transform infrared spectroscopy and scanning electron microscopy were used to investigate the effect of PANI on the structure and morphology of composites. (paper)
Charge Carrier Transport Mechanism Based on Stable Low Voltage Organic Bistable Memory Device.
Ramana, V V; Moodley, M K; Kumar, A B V Kiran; Kannan, V
2015-05-01
A solution processed two terminal organic bistable memory device was fabricated utilizing films of polymethyl methacrylate PMMA/ZnO/PMMA on top of ITO coated glass. Electrical characterization of the device structure showed that the two terminal device exhibited favorable switching characteristics with an ON/OFF ratio greater than 1 x 10(4) when the voltage was swept between - 2 V and +3 V. The device maintained its state after removal of the bias voltage. The device did not show degradation after a 1-h retention test at 120 degrees C. The memory functionality was consistent even after fifty cycles of operation. The charge transport switching mechanism is discussed on the basis of carrier transport mechanism and our analysis of the data shows that the charge carrier trans- port mechanism of the device during the writing process can be explained by thermionic emission (TE) and space-charge-limited-current (SCLC) mechanism models while erasing process could be explained by the FN tunneling mechanism. This demonstration provides a class of memory devices with the potential for low-cost, low-power consumption applications, such as a digital memory cell.
K, Deepak; Roy, Amit; Anjaneyulu, P.; Kandaiah, Sakthivel; Pinjare, Sampatrao L.
2017-10-01
The charge transport mechanism in copper ions containing 1,3,5-Triazine-2,4,6-trithiolate (CuTCA) based polymer device in sandwich (Ag/CuTCA/Cu) geometry is studied. The current-voltage (I-V) characteristics of the metallopolymer CuTCA device have shown a transition in the charge transport mechanism from Ohmic to Space-charge limited conduction when temperature and voltage are varied. The carriers in CuTCA devices exhibit hopping transport, in which carriers hop from one site to the other. The hole mobility in this polymer device is found to be dependent on electric field E ( μpα√{E } ) and temperature, which suggests that the polymer has inherent disorder. The electric-field coefficient γ and zero-field mobility μ0 are temperature dependent. The values of mobility and activation energies are estimated from temperature (90-140 K) dependent charge transport studies and found to be in the range of 1 × 10-11-8 × 10-12 m2/(V s) and 16.5 meV, respectively. Temperature dependent electric-field coefficient γ is in the order of 17.8 × 10-4 (m/V)1/2, and the value of zero-field mobility μ0 is in the order of 1.2 × 10-11 m2/(V s) at 140 K. A constant phase element (Q) is used to model the device parameters, which are extracted using the Impedance spectroscopy technique. The bandgap of the polymer is estimated to be 2.6 eV from UV-Vis reflectance spectra.
Energy Technology Data Exchange (ETDEWEB)
Kashuba, Oleksiy; Trauzettel, Bjoern [Institut fuer Theoretische Physik und Astrophysik, Universitaet Wuerzburg, 97074 Wuerzburg (Germany); Timm, Carsten [Institut fuer Theoretische Physik, TU Dresden, 01062 Dresden (Germany)
2016-07-01
The system with multiple Majorana states coupled to the normal lead can potentially support the interaction between Majorana fermions and electrons. Such system can be implemented by several floating topological superconducting wires with large charging energy asymmetrically coupled to two normal leads. The analysis of the renormalization flow shows that there is a single fixed point - the strong coupling limit of isotropic antiferromagnetic Kondo model. The topological Kondo-like interaction leads also to the selective renormalization of the tunneling coefficients, strongly enhancing one component and suppressing others. Thus, charging energy crucially changes the transport properties of the system leading to the universal single-channel conductance independently from the values of the initial leads-wires coupling.
Charge Transport in Spiro-OMeTAD Investigated through Space-Charge-Limited Current Measurements
Röhr, Jason A.; Shi, Xingyuan; Haque, Saif A.; Kirchartz, Thomas; Nelson, Jenny
2018-04-01
Extracting charge-carrier mobilities for organic semiconductors from space-charge-limited conduction measurements is complicated in practice by nonideal factors such as trapping in defects and injection barriers. Here, we show that by allowing the bandlike charge-carrier mobility, trap characteristics, injection barrier heights, and the shunt resistance to vary in a multiple-trapping drift-diffusion model, a numerical fit can be obtained to the entire current density-voltage curve from experimental space-charge-limited current measurements on both symmetric and asymmetric 2 ,2',7 ,7' -tetrakis(N ,N -di-4-methoxyphenylamine)-9 ,9' -spirobifluorene (spiro-OMeTAD) single-carrier devices. This approach yields a bandlike mobility that is more than an order of magnitude higher than the effective mobility obtained using analytical approximations, such as the Mott-Gurney law and the moving-electrode equation. It is also shown that where these analytical approximations require a temperature-dependent effective mobility to achieve fits, the numerical model can yield a temperature-, electric-field-, and charge-carrier-density-independent mobility. Finally, we present an analytical model describing trap-limited current flow through a semiconductor in a symmetric single-carrier device. We compare the obtained charge-carrier mobility and trap characteristics from this analytical model to the results from the numerical model, showing excellent agreement. This work shows the importance of accounting for traps and injection barriers explicitly when analyzing current density-voltage curves from space-charge-limited current measurements.
Fundamentals of charged particle transport in gases and condensed matter
Robson, Robert E; Hildebrandt, Malte
2018-01-01
This book offers a comprehensive and cohesive overview of transport processes associated with all kinds of charged particles, including electrons, ions, positrons, and muons, in both gases and condensed matter. The emphasis is on fundamental physics, linking experiment, theory and applications. In particular, the authors discuss: The kinetic theory of gases, from the traditional Boltzmann equation to modern generalizations A complementary approach: Maxwell’s equations of change and fluid modeling Calculation of ion-atom scattering cross sections Extension to soft condensed matter, amorphous materials Applications: drift tube experiments, including the Franck-Hertz experiment, modeling plasma processing devices, muon catalysed fusion, positron emission tomography, gaseous radiation detectors Straightforward, physically-based arguments are used wherever possible to complement mathematical rigor.
An improved charge transport system for the pelletron accelerator in Lund
International Nuclear Information System (INIS)
Hellborg, R.; Hakansson, K.
1988-01-01
Several improvements have been implemented in the chain charge transport system of a pelletron. The main new components are a modified support at ground for the chain accessories, a new power supply for the chain motor, including the possibility of variable chain speed, and pickup rings to monitor the relative amount of charge on individual cylinders of the chain. These modifications, together with the installation of a second chain, have resulted in improved operational reliability, a much smoother startup of the chain, and a doubled maximum chain current. The latter will simplify running the accelerator with heavy ions at maximum terminal voltage. The pickup rings have been found to be useful in diagnosing malfunctions in the charge transport system. (orig.)
Battery-powered transport systems. Possible methods of automatically charging drive batteries
Energy Technology Data Exchange (ETDEWEB)
1981-03-01
In modern driverless transport systems, not only easy maintenance of the drive battery is important but also automatic charging during times of standstill. Some systems are presented; one system is pointed out in particular in which 100 batteries can be charged at the same time.
Modelling of the charge carrier mobility in disordered linear polymer materials
Czech Academy of Sciences Publication Activity Database
Toman, Petr; Menšík, Miroslav; Bartkowiak, W.; Pfleger, Jiří
2017-01-01
Roč. 19, č. 11 (2017), s. 7760-7771 ISSN 1463-9076 R&D Projects: GA ČR(CZ) GA15-05095S Grant - others:AV ČR(CZ) M200501204 Program:M Institutional support: RVO:61389013 Keywords : charge carrier mobility * conjugated polymer * charge transport modelling Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 4.123, year: 2016
Secondary electron emission and self-consistent charge transport in semi-insulating samples
Energy Technology Data Exchange (ETDEWEB)
Fitting, H.-J. [Institute of Physics, University of Rostock, Universitaetsplatz 3, D-18051 Rostock (Germany); Touzin, M. [Unite Materiaux et Transformations, UMR CNRS 8207, Universite de Lille 1, F-59655 Villeneuve d' Ascq (France)
2011-08-15
Electron beam induced self-consistent charge transport and secondary electron emission (SEE) in insulators are described by means of an electron-hole flight-drift model (FDM) now extended by a certain intrinsic conductivity (c) and are implemented by an iterative computer simulation. Ballistic secondary electrons (SE) and holes, their attenuation to drifting charge carriers, and their recombination, trapping, and field- and temperature-dependent detrapping are included. As a main result the time dependent ''true'' secondary electron emission rate {delta}(t) released from the target material and based on ballistic electrons and the spatial distributions of currents j(x,t), charges {rho}(x,t), field F(x,t), and potential V(x,t) are obtained where V{sub 0} = V(0,t) presents the surface potential. The intrinsic electronic conductivity limits the charging process and leads to a conduction sample current to the support. In that case the steady-state total SE yield will be fixed below the unit: i.e., {sigma} {eta} + {delta} < 1.
Study of charge transport in composite blend of P3HT and PCBM
Kumar, Manoj; Kumar, Sunil; Upadhyaya, Aditi; Yadav, Anjali; Gupta, Saral K.; Singh, Amarjeet
2018-05-01
Poly (3-hexylthiophene-2,5diyl) (P3HT) as donor and [6,6]-phenyl C61 butyric acid methyl ester (PCBM) as acceptor are mostly used as active medium in polymeric electronic device. In this paper we have prepare the P3HT - PCBM based bulk hetero junction thin films by spin coating technique. The charge transport properties of P3HT:PCBM blends are investigated by the current-voltage measurements using Ag as an electron injecting electrode and ITO as a hole injecting contact. The current density v/s voltage relationships are analyzed in the backdrop of Schottky and Space charge limited current model.
Patel, Saumya K; Khedkar, Vijay M; Jha, Prakash C; Jasrai, Yogesh T; Pandya, Himanshu A; George, Linz-Buoy; Highland, Hyacinth N; Skelton, Adam A
2016-01-01
Phytochemicals of Catharanthus roseus Linn. and Tylophora indica have been known for their inhibition of malarial parasite, Plasmodium falciparum in cell culture. Resistance to chloroquine (CQ), a widely used antimalarial drug, is due to the CQ resistance transporter (CRT) system. The present study deals with computational modeling of Plasmodium falciparum chloroquine resistance transporter (PfCRT) protein and development of charged environment to mimic a condition of resistance. The model of PfCRT was developed using Protein homology/analogy engine (PHYRE ver 0.2) and was validated based on the results obtained using PSI-PRED. Subsequently, molecular interactions of selected phytochemicals extracted from C. roseus Linn. and T. indica were studied using multiple-iterated genetic algorithm-based docking protocol in order to investigate the translocation of these legends across the PfCRT protein. Further, molecular dynamics studies exhibiting interaction energy estimates of these compounds within the active site of the protein showed that compounds are more selective toward PfCRT. Clusters of conformations with the free energy of binding were estimated which clearly demonstrated the potential channel and by this means the translocation across the PfCRT is anticipated.
Charge-carrier transport in large-area epitaxial graphene
Energy Technology Data Exchange (ETDEWEB)
Kisslinger, Ferdinand; Popp, Matthias; Weber, Heiko B. [Lehrstuhl fuer Angewandte Physik, Friedrich-Alexander-Universitaet Erlangen-Nuernberg (FAU), Erlangen (Germany); Jobst, Johannes [Huygens-Kamerlingh Onnes Laboratorium, Leiden Institute of Physics, Leiden University (Netherlands); Shallcross, Sam [Lehrstuhl fuer theoretische Festkoerperphysik, Friedrich-Alexander-Universitaet Erlangen-Nuernberg (FAU), Erlangen (Germany)
2017-11-15
We present an overview of recent charge carrier transport experiments in both monolayer and bilayer graphene, with emphasis on the phenomena that appear in large-area samples. While many aspects of transport are based on quantum mechanical concepts, in the large-area limit classical corrections dominate and shape the magnetoresistance and the tunneling conductance. The discussed phenomena are very general and can, with little modification, be expected in any atomically thin 2D conductor. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Electron-hole collision limited transport in charge-neutral bilayer graphene
Nam, Youngwoo; Ki, Dong-Keun; Soler-Delgado, David; Morpurgo, Alberto F.
2017-12-01
Ballistic transport occurs whenever electrons propagate without collisions deflecting their trajectory. It is normally observed in conductors with a negligible concentration of impurities, at low temperature, to avoid electron-phonon scattering. Here, we use suspended bilayer graphene devices to reveal a new regime, in which ballistic transport is not limited by scattering with phonons or impurities, but by electron-hole collisions. The phenomenon manifests itself in a negative four-terminal resistance that becomes visible when the density of holes (electrons) is suppressed by gate-shifting the Fermi level in the conduction (valence) band, above the thermal energy. For smaller densities, transport is diffusive, and the measured conductivity is reproduced quantitatively, with no fitting parameters, by including electron-hole scattering as the only process causing velocity relaxation. Experiments on a trilayer device show that the phenomenon is robust and that transport at charge neutrality is governed by the same physics. Our results provide a textbook illustration of a transport regime that had not been observed previously and clarify the nature of conduction through charge-neutral graphene under conditions in which carrier density inhomogeneity is immaterial. They also demonstrate that transport can be limited by a fully electronic mechanism, originating from the same microscopic processes that govern the physics of Dirac-like plasmas.
Manipulation of charge transport in thermoelectrics
Zhang, Xinyue; Pei, Yanzhong
2017-12-01
While numerous improvements have been achieved in thermoelectric materials by reducing the lattice thermal conductivity (κL), electronic approaches for enhancement can be as effective, or even more. A key challenge is decoupling Seebeck coefficient (S) from electrical conductivity (σ). The first order approximation - a single parabolic band assumption with acoustic scattering - leads the thermoelectric power factor (S2σ) to be maximized at a constant reduced Fermi level (η 0.67) and therefore at a given S of 167 μV/K. This simplifies the challenge of maximization of σ at a constant η, leading to a large number of degenerate transport channels (band degeneracy, Nv) and a fast transportation of charges (carrier mobility, μ). In this paper, existing efforts on this issue are summarized and future prospectives are given.
Directory of Open Access Journals (Sweden)
Yuqiu Qu
2015-12-01
Full Text Available The effect of different organic charge transporting materials on the photoluminescence of CdSe/ZnS core/shell quantum dots has been studied by means of steady-state and time-resolved photoluminescence spectroscopy. With an increase in concentration of the organic charge transporting material in the quantum dots solutions, the photoluminescence intensity of CdSe/ZnS quantum dots was quenched greatly and the fluorescence lifetime was shortened gradually. The quenching efficiency of CdSe/ZnS core/shell quantum dots decreased with increasing the oxidation potential of organic charge transporting materials. Based on the analysis, two pathways in the photoluminescence quenching process have been defined: static quenching and dynamic quenching. The dynamic quenching is correlated with hole transporting from quantum dots to the charge transporting materials.
Numerical modelling of ion transport in flames
Han, Jie
2015-10-20
This paper presents a modelling framework to compute the diffusivity and mobility of ions in flames. The (n, 6, 4) interaction potential is adopted to model collisions between neutral and charged species. All required parameters in the potential are related to the polarizability of the species pair via semi-empirical formulas, which are derived using the most recently published data or best estimates. The resulting framework permits computation of the transport coefficients of any ion found in a hydrocarbon flame. The accuracy of the proposed method is evaluated by comparing its predictions with experimental data on the mobility of selected ions in single-component neutral gases. Based on this analysis, the value of a model constant available in the literature is modified in order to improve the model\\'s predictions. The newly determined ion transport coefficients are used as part of a previously developed numerical approach to compute the distribution of charged species in a freely propagating premixed lean CH4/O2 flame. Since a significant scatter of polarizability data exists in the literature, the effects of changes in polarizability on ion transport properties and the spatial distribution of ions in flames are explored. Our analysis shows that changes in polarizability propagate with decreasing effect from binary transport coefficients to species number densities. We conclude that the chosen polarizability value has a limited effect on the ion distribution in freely propagating flames. We expect that the modelling framework proposed here will benefit future efforts in modelling the effect of external voltages on flames. Supplemental data for this article can be accessed at http://dx.doi.org/10.1080/13647830.2015.1090018. © 2015 Taylor & Francis.
Charge transport properties of graphene: Effects of Cu-based gate electrode
Energy Technology Data Exchange (ETDEWEB)
Tang, Qide [School of Physics and Optoelectronics, Xiangtan University, Xiangtan 411105 (China); Zhang, C. X., E-mail: zhangchunxiao@xtu.edu.cn; Tang, Chao, E-mail: tang-chao@xtu.edu.cn; Zhong, Jianxin [School of Physics and Optoelectronics, Xiangtan University, Xiangtan 411105 (China); Hunan Provincial Key Laboratory of Micro-Nano Energy Materials and Devices, Xiangtan University, Hunan 411105 (China); He, Chaoyu [Hunan Provincial Key Laboratory of Micro-Nano Energy Materials and Devices, Xiangtan University, Hunan 411105 (China)
2016-07-21
Using the first-principles nonequilibrium Green's function method, we study effects of Cu and Ni@Cu used as the Cu-based gate electrode on the charge transport of graphene in the field effect transistors (FET). We find that the transmission of graphene decreases with both Cu and Ni@Cu absorbed in the scatter region. Especially, noticeable transmission gaps are present around the Femi level. The transmission gaps are still effective, and considerable cut-off regions are found under the non-equilibrium environment. The Ni@Cu depresses the transmission of graphene more seriously than the Cu and enlarges the transmission gap in armchair direction. The effects on the charge transport are attributed to the redistribution of electronic states of graphene. Both Cu and Ni@Cu induce the localization of states, so as to block the electronic transport. The Ni@Cu transforms the interaction between graphene and gate electrode from the physisorption to the chemisorption, and then induces more localized states, so that the transmission decreases further. Our results suggest that besides being used to impose gate voltage, the Cu-based gate electrode itself will have a considerable effect on the charge transport of graphene and induces noticeable transmission gap in the FET.
Heterojunction PbS nanocrystal solar cells with oxide charge-transport layers.
Hyun, Byung-Ryool; Choi, Joshua J; Seyler, Kyle L; Hanrath, Tobias; Wise, Frank W
2013-12-23
Oxides are commonly employed as electron-transport layers in optoelectronic devices based on semiconductor nanocrystals, but are relatively rare as hole-transport layers. We report studies of NiO hole-transport layers in PbS nanocrystal photovoltaic structures. Transient fluorescence experiments are used to verify the relevant energy levels for hole transfer. On the basis of these results, planar heterojunction devices with ZnO as the photoanode and NiO as the photocathode were fabricated and characterized. Solution-processed devices were used to systematically study the dependence on nanocrystal size and achieve conversion efficiency as high as 2.5%. Optical modeling indicates that optimum performance should be obtained with thinner oxide layers than can be produced reliably by solution casting. Room-temperature sputtering allows deposition of oxide layers as thin as 10 nm, which enables optimization of device performance with respect to the thickness of the charge-transport layers. The best devices achieve an open-circuit voltage of 0.72 V and efficiency of 5.3% while eliminating most organic material from the structure and being compatible with tandem structures.
Exciton shelves for charge and energy transport in third-generation quantum-dot devices
Goodman, Samuel; Singh, Vivek; Noh, Hyunwoo; Casamada, Josep; Chatterjee, Anushree; Cha, Jennifer; Nagpal, Prashant
2014-03-01
Quantum dots are semiconductor nanocrystallites with size-dependent quantum-confined energy levels. While they have been intensively investigated to utilize hot-carriers for photovoltaic applications, to bridge the mismatch between incident solar photons and finite bandgap of semiconductor photocells, efficient charge or exciton transport in quantum-dot films has proven challenging. Here we show development of new coupled conjugated molecular wires with ``exciton shelves'', or different energy levels, matched with the multiple energy levels of quantum dots. Using single nanoparticle and ensemble device measurements we show successful extraction and transport of both bandedge and high-energy charge carriers, and energy transport of excitons. We demonstrate using measurements of electronic density of states, that careful matching of energy states of quantum-dot with molecular wires is important, and any mismatch can generate midgap states leading to charge recombination and reduced efficiency. Therefore, these exciton-shelves and quantum dots can lead to development of next-generation photovoltaic and photodetection devices using simultaneous transport of bandedge and hot-carriers or energy transport of excitons in these nanostructured solution-processed films.
Charge transport in amorphous InGaZnO thin-film transistors
Germs, W.C.; Adriaans, W.H.; Tripathi, A.K.; Roelofs, W.S.C.; Cobb, B.; Janssen, R.A.J.; Gelinck, G.H.; Kemerink, M.
2012-01-01
We investigate the mechanism of charge transport in indium gallium zinc oxide (a-IGZO), an amorphous metal-oxide semiconductor. We measured the field-effect mobility and the Seebeck coefficient (S=ΔV/ΔT) of a-IGZO in thin-film transistors as a function of charge-carrier density for different
Charge transport in amorphous InGaZnO thin film transistors
Germs, W.C.; Adriaans, W.H.; Tripathi, A.K.; Roelofs, W.S.C.; Cobb, B.; Janssen, R.A.J.; Gelinck, G.H.; Kemerink, M.
2012-01-01
We investigate the mechanism of charge transport in indium gallium zinc oxide (a-IGZO), an amorphous metal-oxide semiconductor. We measured the field-effect mobility and the Seebeck coefficient (S=¿V/¿T) of a-IGZO in thin-film transistors as a function of charge-carrier density for different
Energy Technology Data Exchange (ETDEWEB)
Sheppard, Colin; Waraich, Rashid; Campbell, Andrew; Pozdnukov, Alexei; Gopal, Anand R.
2017-05-01
This report summarizes the BEAM modeling framework (Behavior, Energy, Mobility, and Autonomy) and its application to simulating plug-in electric vehicle (PEV) mobility, energy consumption, and spatiotemporal charging demand. BEAM is an agent-based model of PEV mobility and charging behavior designed as an extension to MATSim (the Multi-Agent Transportation Simulation model). We apply BEAM to the San Francisco Bay Area and conduct a preliminary calibration and validation of its prediction of charging load based on observed charging infrastructure utilization for the region in 2016. We then explore the impact of a variety of common modeling assumptions in the literature regarding charging infrastructure availability and driver behavior. We find that accurately reproducing observed charging patterns requires an explicit representation of spatially disaggregated charging infrastructure as well as a more nuanced model of the decision to charge that balances tradeoffs people make with regards to time, cost, convenience, and range anxiety.
Charge trapping and carrier transport mechanism in silicon-rich silicon oxynitride
International Nuclear Information System (INIS)
Yu Zhenrui; Aceves, Mariano; Carrillo, Jesus; Lopez-Estopier, Rosa
2006-01-01
The charge-trapping and carrier transport properties of silicon-rich silicon oxynitride (SRO:N) were studied. The SRO:N films were deposited by low pressure chemical vapor deposition. Infrared (IR) and transmission electron microscopic (TEM) measurements were performed to characterize their structural properties. Capacitance versus voltage and current versus voltage measurements (I-V) were used to study the charge-trapping and carrier transport mechanism. IR and TEM measurements revealed the existence of Si nanodots in SRO:N films. I-V measurements revealed that there are two conduction regimes divided by a threshold voltage V T . When the applied voltage is smaller than V T , the current is dominated by the charge transfer between the SRO:N and substrate; and in this regime only dynamic charging/discharging of the SRO:N layer is observed. When the voltage is larger than V T , the current increases rapidly and is dominated by the Poole-Frenkel mechanism; and in this regime, large permanent trapped charge density is obtained. Nitrogen incorporation significantly reduced the silicon nanodots or defects near the SRO:N/Si interface. However, a significant increase of the density of silicon nanodot in the bulk of the SRO:N layer is obtained
Sanz-Gorrachategui, Iván; Bernal, Carlos; Oyarbide, Estanis; Garayalde, Erik; Aizpuru, Iosu; Canales, Jose María; Bono-Nuez, Antonio
2018-02-01
The optimization of the battery pack in an off-grid Photovoltaic application must consider the minimum sizing that assures the availability of the system under the worst environmental conditions. Thus, it is necessary to predict the evolution of the state of charge of the battery under incomplete daily charging and discharging processes and fluctuating temperatures over day-night cycles. Much of previous development work has been carried out in order to model the short term evolution of battery variables. Many works focus on the on-line parameter estimation of available charge, using standard or advanced estimators, but they are not focused on the development of a model with predictive capabilities. Moreover, normally stable environmental conditions and standard charge-discharge patterns are considered. As the actual cycle-patterns differ from the manufacturer's tests, batteries fail to perform as expected. This paper proposes a novel methodology to model these issues, with predictive capabilities to estimate the remaining charge in a battery after several solar cycles. A new non-linear state space model is proposed as a basis, and the methodology to feed and train the model is introduced. The new methodology is validated using experimental data, providing only 5% of error at higher temperatures than the nominal one.
Liu, Yu-Heng; Jiang, Cheng-Min; Lin, Hsiao-Yi; Wang, Tahui; Tsai, Wen-Jer; Lu, Tao-Cheng; Chen, Kuang-Chao; Lu, Chih-Yuan
2017-07-01
We use a random telegraph signal method to investigate nitride trapped hole lateral transport in a charge trap flash memory. The concept of this method is to utilize an interface oxide trap and its associated random telegraph signal as an internal probe to detect a local channel potential change resulting from nitride charge lateral movement. We apply different voltages to the drain of a memory cell and vary a bake temperature in retention to study the electric field and temperature dependence of hole lateral movement in a nitride. Thermal energy absorption by trapped holes in lateral transport is characterized. Mechanisms of hole lateral transport in retention are investigated. From the measured and modeled results, we find that thermally assisted trap-to-band tunneling is a major trapped hole emission mechanism in nitride hole lateral transport.
Surface charge accumulation of particles containing radionuclides in open air.
Kim, Yong-Ha; Yiacoumi, Sotira; Tsouris, Costas
2015-05-01
Radioactivity can induce charge accumulation on radioactive particles. However, electrostatic interactions caused by radioactivity are typically neglected in transport modeling of radioactive plumes because it is assumed that ionizing radiation leads to charge neutralization. The assumption that electrostatic interactions caused by radioactivity are negligible is evaluated here by examining charge accumulation and neutralization on particles containing radionuclides in open air. A charge-balance model is employed to predict charge accumulation on radioactive particles. It is shown that particles containing short-lived radionuclides can be charged with multiple elementary charges through radioactive decay. The presence of radioactive particles can significantly modify the particle charge distribution in open air and yield an asymmetric bimodal charge distribution, suggesting that strong electrostatic particle interactions may occur during short- and long-range transport of radioactive particles. Possible effects of transported radioactive particles on electrical properties of the local atmosphere are reported. The study offers insight into transport characteristics of airborne radionuclides. Results are useful in atmospheric transport modeling of radioactive plumes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Solving the Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem by Dynamic Programming
DEFF Research Database (Denmark)
Rauff Lind Christensen, Tue; Klose, Andreas; Andersen, Kim Allan
important aspects of supplier selection, an important application of the SSFCTP, this does not reflect the real life situation. First, transportation costs faced by many companies are in fact piecewise linear. Secondly, when suppliers offer discounts, either incremental or all-unit discounts, such savings......The Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem (SSFCMCTP) is a problem with versatile applications. This problem is a generalization of the Single-Sink, Fixed-Charge Transportation Problem (SSFCTP), which has a fixed-charge, linear cost structure. However, in at least two...... are neglected in the SSFCTP. The SSFCMCTP overcome this problem by incorporating a staircase cost structure in the cost function instead of the usual one used in SSFCTP. We present a dynamic programming algorithm for the resulting problem. To enhance the performance of the generic algorithm a number...
Modeling of radiation-induced charge trapping in MOS devices under ionizing irradiation
Energy Technology Data Exchange (ETDEWEB)
Petukhov, M. A., E-mail: m.a.petukhov@gmail.com; Ryazanov, A. I. [National Research Center Kurchatov Institute (Russian Federation)
2016-12-15
The numerical model of the radiation-induced charge trapping process in the oxide layer of a MOS device under ionizing irradiation is developed; the model includes carrier transport, hole capture by traps in different states, recombination of free electrons and trapped holes, kinetics of hydrogen ions which can be accumulated in the material during transistor manufacture, and accumulation and charging of interface states. Modeling of n-channel MOSFET behavior under 1 MeV photon irradiation is performed. The obtained dose dependences of the threshold voltage shift and its contributions from trapped holes and interface states are in good agreement with experimental data.
Symposium GC: Nanoscale Charge Transport in Excitonic Solar Cells
Energy Technology Data Exchange (ETDEWEB)
Bommisetty, Venkat [Univ. of South Dakota, Vermillion, SD (United States)
2011-06-23
This paper provides a summary only and table of contents of the sessions. Excitonic solar cells, including all-organic, hybrid organic-inorganic and dye-sensitized solar cells (DSSCs), offer strong potential for inexpensive and large-area solar energy conversion. Unlike traditional inorganic semiconductor solar cells, where all the charge generation and collection processes are well understood, these excitonic solar cells contain extremely disordered structures with complex interfaces which results in large variations in nanoscale electronic properties and has a strong influence on carrier generation, transport, dissociation and collection. Detailed understanding of these processes is important for fabrication of highly efficient solar cells. Efforts to improve efficiency are underway at a large number of research groups throughout the world focused on inorganic and organic semiconductors, photonics, photophysics, charge transport, nanoscience, ultrafast spectroscopy, photonics, semiconductor processing, device physics, device structures, interface structure etc. Rapid progress in this multidisciplinary area requires strong synergetic efforts among researchers from diverse backgrounds. Such effort can lead to novel methods for development of new materials with improved photon harvesting and interfacial treatments for improved carrier transport, process optimization to yield ordered nanoscale morphologies with well defined electronic structures.
Kinetic phenomena in charged particle transport in gases, swarm parameters and cross section data
International Nuclear Information System (INIS)
Petrovic, Z Lj; Suvakov, M; Nikitovic, Z; Dujko, S; Sasic, O; Jovanovic, J; Malovic, G; Stojanovic, V
2007-01-01
In this review we discuss the current status of the physics of charged particle swarms, mainly electrons. The whole field is analysed mainly through its relationship to plasma modelling and illustrated by some recent examples developed mainly by our group. The measurements of the swarm coefficients and the availability of the data are briefly discussed. More time is devoted to the development of complete electron-molecule cross section sets along with recent examples such as NO, CF 4 and HBr. We extend the discussion to the availability of ion and fast neutral data and how swarm experiments may serve to provide new data. As a point where new insight into the kinetics of charge particle transport is provided, the role of kinetic phenomena is discussed and recent examples are listed. We focus here on giving two examples on how non-conservative processes make dramatic effects in transport, the negative absolute mobility and the negative differential conductivity for positrons in argon. Finally we discuss the applicability of swarm data in plasma modelling and the relationship to other fields where swarm experiments and analysis make significant contributions. (topical review)
Energy Technology Data Exchange (ETDEWEB)
Girard, A.; Perrer, Douysset; Melin, G. [Dept. de Recherche Fondamentale sur la Matiere Condensee CEA Centre d' Etudes de Grenoble, 38 (France)
1999-07-01
The paper has the following contents: 1. Introduction; 2. Electron transport. 2.1. Experiments - Lifetime measurements - Contradiction. 2.2. Modelling; 3. Ion transport. 3.1. Experiments - Measurement of argon K{sub {alpha}}. 3.2. Lifetime. 3.3. Proposed model, controversy; 4. Conclusion. A setup of the experiment and the results concerning the electron density, energy content, mean energy, current density, electron lifetime and lifetime of electron energy as a function of rf power are presented. The results are interpreted and modelled. Also, the experimental setup for the study of ion transport is presented. The density of argon ions is determined by means of the high resolution X ray spectra which, by making use of a simple collisional radiative model, is able to single out the argon K{sub {alpha}} rays corresponding to different ions. These results are also interpreted and modelled. In conclusion, with an electron dynamics controlled by rf, due to a high mirror ratio, the losses are limited. According to the scale law the higher the frequency the higher is the energy content of the electrons and consequently the higher are the performances. The ions are cool and colliding. Their lifetime increases with the charge. If it increases linearly their transport is controlled by the spatial diffusion in the ambipolar electric field. A correct lifetime requires plasma of high dimensions and low ionic temperature.
A numerical model for charge transport and energy conversion of perovskite solar cells.
Zhou, Yecheng; Gray-Weale, Angus
2016-02-14
Based on the continuity equations and Poisson's equation, we developed a numerical model for perovskite solar cells. Due to different working mechanisms, the model for perovskite solar cells differs from that of silicon solar cells and Dye Sensitized Solar Cells. The output voltage and current are calculated differently, and in a manner suited in particular to perovskite organohalides. We report a test of our equations against experiment with good agreement. Using this numerical model, it was found that performances of solar cells increase with charge carrier's lifetimes, mobilities and diffusion lengths. The open circuit voltage (Voc) of a solar cell is dependent on light intensities, and charge carrier lifetimes. Diffusion length and light intensity determine the saturated current (Jsc). Additionally, three possible guidelines for the design and fabrication of perovskite solar cells are suggested by our calculations. Lastly, we argue that concentrator perovskite solar cells are promising.
Fractal like charge transport in polyaniline nanostructures
International Nuclear Information System (INIS)
Nath, Chandrani; Kumar, A.
2013-01-01
The structural and electrical properties of camphorsulfonic acid (CSA) doped nanotubes, and hydrochloric acid (HCl) doped nanofibers and nanoparticles of polyaniline have been studied as a function of doping level. The crystallinity increases with doping for all the nanostructures. Electrical transport measurements in the temperature range of 5–300 K show an increase in conductivity with doping for the nanostructures. All the nanostructures exhibit metal to insulator (MIT) transition below 40 K. The metallic behavior is ascribed to the electron–electron interaction effects. In the insulating regime of the nanotubes conduction follows the Mott quasi-1D variable range hopping model, whereas the conduction in the nanofibers and nanoparticles occur by variable range hopping of charge carriers among superlocalized states without and with Coulomb interaction, respectively. The smaller dopant size in case of HCl makes the polymer fractal resulting in superlocalization of electronic wave-functions. The confined morphology of the nanoparticles results in effective Coulomb interaction dominating the intersite hopping
The role of space charge compensation for ion beam extraction and ion beam transport (invited)
International Nuclear Information System (INIS)
Spädtke, Peter
2014-01-01
Depending on the specific type of ion source, the ion beam is extracted either from an electrode surface or from a plasma. There is always an interface between the (almost) space charge compensated ion source plasma, and the extraction region in which the full space charge is influencing the ion beam itself. After extraction, the ion beam is to be transported towards an accelerating structure in most cases. For lower intensities, this transport can be done without space charge compensation. However, if space charge is not negligible, the positive charge of the ion beam will attract electrons, which will compensate the space charge, at least partially. The final degree of Space Charge Compensation (SCC) will depend on different properties, like the ratio of generation rate of secondary particles and their loss rate, or the fact whether the ion beam is pulsed or continuous. In sections of the beam line, where the ion beam is drifting, a pure electrostatic plasma will develop, whereas in magnetic elements, these space charge compensating electrons become magnetized. The transport section will provide a series of different plasma conditions with different properties. Different measurement tools to investigate the degree of space charge compensation will be described, as well as computational methods for the simulation of ion beams with partial space charge compensation
Charge transport properties of CdMnTe radiation detectors
Directory of Open Access Journals (Sweden)
Prokopovich D. A.
2012-10-01
Full Text Available Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading charge collection is reduced with increasing values of bias voltage. The electron drift velocity was calculated from the rise time distribution of the preamplifier output pulses at each measured bias. From the dependence of drift velocity on applied electric field the electron mobility was found to be μn = (718 ± 55 cm2/Vs at room temperature.
A multichannel model for the self-consistent analysis of coherent transport in graphene nanoribbons.
Mencarelli, Davide; Pierantoni, Luca; Farina, Marco; Di Donato, Andrea; Rozzi, Tullio
2011-08-23
In this contribution, we analyze the multichannel coherent transport in graphene nanoribbons (GNRs) by a scattering matrix approach. We consider the transport properties of GNR devices of a very general form, involving multiple bands and multiple leads. The 2D quantum transport over the whole GNR surface, described by the Schrödinger equation, is strongly nonlinear as it implies calculation of self-generated and externally applied electrostatic potentials, solutions of the 3D Poisson equation. The surface charge density is computed as a balance of carriers traveling through the channel at all of the allowed energies. Moreover, formation of bound charges corresponding to a discrete modal spectrum is observed and included in the model. We provide simulation examples by considering GNR configurations typical for transistor devices and GNR protrusions that find an interesting application as cold cathodes for X-ray generation. With reference to the latter case, a unified model is required in order to couple charge transport and charge emission. However, to a first approximation, these could be considered as independent problems, as in the example. © 2011 American Chemical Society
Charge transport in nanoscale vertical organic semiconductor pillar devices
Wilbers, J.G.E.; Xu, B.; Bobbert, P.A.; de Jong, M.P.; van der Wiel, W.G.
2017-01-01
We report charge transport measurements in nanoscale vertical pillar structures incorporating ultrathin layers of the organic semiconductor poly(3-hexylthiophene) (P3HT). P3HT layers with thickness down to 5 nm are gently top-contacted using wedging transfer, yielding highly reproducible, robust
International Nuclear Information System (INIS)
Peyrard, M.; Boesch, R.; Kourakis, I.
1991-01-01
The transport of protons in hydrogen-bonded systems is a long standing problem which has not yet obtained a satisfactorily theoretical description. Although this problem was examined first for ice, it is relevant in many systems and in particular in biology for the transport along proteins or for proton conductance across membranes, an essential process in cell life. The broad relevance makes the study of proton conduction very appealing. Since the original work of Bernal and Fowler on ice, the idea that the transport occurs through chains of hydrogen bonds has been well accepted. Such ''proton wires'' were invoked by Nagle and Morowitz for proton transport across membranes proteins and more recently across lipid bilayers. In this report, we assume the existence of such an hydrogen-bonded chain and discuss its consequences on the dynamics of the charge carriers. We show that this assumption leads naturally to the idea of soliton transport and we put a special emphasis on the role of the coupling between the protons and heavy ions motions. The model is presented. We show how the coupling affects strongly the dynamics of the charge carriers and we discuss the role it plays in the thermal generation of carriers. The work presented has been performed in 1986 and 87 with St. Pnevmatikos and N. Flyzanis and was then completed in collaboration with D. Hochstrasser and H. Buettner. Therefore the results presented in this part are not new but we think that they are appropriate in the context of this multidisciplinary workshop because they provide a rather complete example of the soliton picture for proton conduction. This paper discusses the thermal generation of the charge carriers when the coupling between the protons and heavy ions dynamics is taken into account. The results presented in this part are very recent and will deserve further analysis but they already show that the coupling can assist for the formation of the charge carriers
Fast algorithms for transport models. Final report, June 1, 1993--May 31, 1994
International Nuclear Information System (INIS)
Manteuffel, T.
1994-12-01
The focus of this project is the study of multigrid and multilevel algorithms for the numerical solution of Boltzmann models of the transport of neutral and charged particles. In previous work a fast multigrid algorithm was developed for the numerical solution of the Boltzmann model of neutral particle transport in slab geometry assuming isotropic scattering. The new algorithm is extremely fast in the thick diffusion limit; the multigrid v-cycle convergence factor approaches zero as the mean-free-path between collisions approaches zero, independent of the mesh. Also, a fast multilevel method was developed for the numerical solution of the Boltzmann model of charged particle transport in the thick Fokker-Plank limit for slab geometry. Parallel implementations were developed for both algorithms
Heterojunction PbS Nanocrystal Solar Cells with Oxide Charge-Transport Layers
Hyun, Byung-Ryool
2013-12-23
Oxides are commonly employed as electron-transport layers in optoelectronic devices based on semiconductor nanocrystals, but are relatively rare as hole-transport layers. We report studies of NiO hole-transport layers in PbS nanocrystal photovoltaic structures. Transient fluorescence experiments are used to verify the relevant energy levels for hole transfer. On the basis of these results, planar heterojunction devices with ZnO as the photoanode and NiO as the photocathode were fabricated and characterized. Solution-processed devices were used to systematically study the dependence on nanocrystal size and achieve conversion efficiency as high as 2.5%. Optical modeling indicates that optimum performance should be obtained with thinner oxide layers than can be produced reliably by solution casting. Roomerature sputtering allows deposition of oxide layers as thin as 10 nm, which enables optimization of device performance with respect to the thickness of the charge-transport layers. The best devices achieve an open-circuit voltage of 0.72 V and efficiency of 5.3% while eliminating most organic material from the structure and being compatible with tandem structures. © 2013 American Chemical Society.
Transport and matching of low energy space charge dominated beams
International Nuclear Information System (INIS)
Pandit, V.S.
2013-01-01
The transport and matching of low energy high intensity beams from the ion source to the subsequent accelerating structure are of considerable interest in recent years for variety of applications such as Accelerator driven system (ADSS), transmutation of nuclear waste, spallation neutron sources etc. It is essential to perform detailed simulations with experimentation to predict the beam evolution in the presence of nonlinear self as well as external fields before the design of the next accelerating structure is finalized. In order to study and settle various physics and technical issues related with transport of space charge dominated beams we have developed a 2.45 GHz microwave ion source at VECC which is now delivering more than 10 mA proton beam current at 80 keV. We have successfully transported well collimated 8 mA proton beam through the solenoid based 3 meter long transport line and studied various beam properties. We have also studied the transport of beam through spiral inflector at low beam current ∼ 1mA. In this article we will discuss the beam transport issues and describe a technique for simulation of beam envelopes in presence of linear space charge effects. We use canonical description of the motion of a single particle and then obtain first order differential equations for evolution of the moments of beam ensemble by assuming uniform distribution of the beam. We will also discuss the methodology used in the simulations to understand the observed beam behaviour during transport. (author)
Ultrafast Microscopy of Energy and Charge Transport
Huang, Libai
The frontier in solar energy research now lies in learning how to integrate functional entities across multiple length scales to create optimal devices. Advancing the field requires transformative experimental tools that probe energy transfer processes from the nano to the meso lengthscales. To address this challenge, we aim to understand multi-scale energy transport across both multiple length and time scales, coupling simultaneous high spatial, structural, and temporal resolution. In my talk, I will focus on our recent progress on visualization of exciton and charge transport in solar energy harvesting materials from the nano to mesoscale employing ultrafast optical nanoscopy. With approaches that combine spatial and temporal resolutions, we have recently revealed a new singlet-mediated triplet transport mechanism in certain singlet fission materials. This work demonstrates a new triplet exciton transport mechanism leading to favorable long-range triplet exciton diffusion on the picosecond and nanosecond timescales for solar cell applications. We have also performed a direct measurement of carrier transport in space and in time by mapping carrier density with simultaneous ultrafast time resolution and 50 nm spatial precision in perovskite thin films using transient absorption microscopy. These results directly visualize long-range carrier transport of 220nm in 2 ns for solution-processed polycrystalline CH3NH3PbI3 thin films. The spatially and temporally resolved measurements reported here underscore the importance of the local morphology and establish an important first step towards discerning the underlying transport properties of perovskite materials.
Engineering charge transport by heterostructuring solution-processed semiconductors
Voznyy, Oleksandr; Sutherland, Brandon R.; Ip, Alexander H.; Zhitomirsky, David; Sargent, Edward H.
2017-06-01
Solution-processed semiconductor devices are increasingly exploiting heterostructuring — an approach in which two or more materials with different energy landscapes are integrated into a composite system. Heterostructured materials offer an additional degree of freedom to control charge transport and recombination for more efficient optoelectronic devices. By exploiting energetic asymmetry, rationally engineered heterostructured materials can overcome weaknesses, augment strengths and introduce emergent physical phenomena that are otherwise inaccessible to single-material systems. These systems see benefit and application in two distinct branches of charge-carrier manipulation. First, they influence the balance between excitons and free charges to enhance electron extraction in solar cells and photodetectors. Second, they promote radiative recombination by spatially confining electrons and holes, which increases the quantum efficiency of light-emitting diodes. In this Review, we discuss advances in the design and composition of heterostructured materials, consider their implementation in semiconductor devices and examine unexplored paths for future advancement in the field.
Determination of charge carrier mobility of hole transporting polytriarylamine-based diodes
International Nuclear Information System (INIS)
Barea, Eva M.; Garcia-Belmonte, Germa; Sommer, Michael; Huettner, Sven; Bolink, Henk J.; Thelakkat, Mukundan
2010-01-01
Hole transport properties of three different side chain poly(triarylamines) have been determined by means of the analysis of steady-state current-voltage characteristics using co-planar diode structures. The interpretation is based on space-charge limited models with field-dependent mobility. Mobilities between ∼ 10 -8 and 10 -6 cm 2 V -1 s -1 are obtained. The highest mobility is achieved for poly(tetraphenylbenzidine) devices and the lowest for poly(triphenylamine) devices. Electron-rich methoxy substituents increase the mobility of poly(triphenylamine)s. A comparison of the mobility values with those obtained using organic field-effect transistors is also given.
Charge transport properties of CdMnTe radiation detectors
Energy Technology Data Exchange (ETDEWEB)
Kim K.; Rafiel, R.; Boardman, M.; Reinhard, I.; Sarbutt, A.; Watt, G.; Watt, C.; Uxa, S.; Prokopovich, D.A.; Belas, E.; Bolotnikov, A.E.; James, R.B.
2012-04-11
Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe)radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading chargecollection is reduced with increasing values of bias voltage. The electron transit time was determined from time of flight measurements. From the dependence of drift velocity on applied electric field the electron mobility was found to be n = (718 55) cm2/Vs at room temperature.
Charge Carrier Transport and Photogeneration in P3HT:PCBM Photovoltaic Blends
Laquai, Frederic
2015-05-03
This article reviews the charge transport and photogeneration in bulk-heterojunction solar cells made from blend films of regioregular poly(3-hexylthiophene) (RR-P3HT) and methanofullerene (PCBM). The charge transport, specifically the hole mobility in the RR-P3HT phase of the polymer:fullerene photovoltaic blend, is dramatically affected by thermal annealing. The hole mobility increases more than three orders of magnitude and reaches a value of up to 2 × 10−4 cm2 V−1 s−1 after the thermal annealing process as a result of an improved semi-crystallinity of the film. This significant increase of the hole mobility balances the electron and hole mobilities in a photovoltaic blend in turn reducing space-charge formation, and this is the most important factor for the strong enhancement of the photovoltaic efficiency compared to an as cast, that is, non-annealed device. In fact, the balanced charge carrier mobility in RR-P3HT:PCBM blends in combination with a field- and temperature-independent charge carrier generation and greatly reduced non-geminate recombination explains the large quantum efficiencies measured in P3HT:PCBM photovoltaic devices.
Chemical disorder and charge transport in ferromagnetic manganites
International Nuclear Information System (INIS)
Pickett, W.E.; Singh, D.J.
1997-01-01
Disorder broadening due to randomly distributed La 3+ and A 2+ (A=Ca,Sr,Ba) cations is combined with a virtual-crystal treatment of the average system to evaluate the effects on both majority and minority transport in the ferromagnetic La 2/3 A 1/3 MnO 3 system. The low-density minority carriers which lie in the band tail are localized by disorder, while the majority carriers retain long mean free paths reflected in the observed strongly metallic conductivity. In addition to obtaining transport parameters, we provide evidence that local distortions are due to nearby ionic charges rather than to ion size considerations. copyright 1997 The American Physical Society
Carbon materials for enhancing charge transport in the advancements of perovskite solar cells
Hu, Ruiyuan; Chu, Liang; Zhang, Jian; Li, Xing'ao; Huang, Wei
2017-09-01
Organic-inorganic halide perovskite solar cells (PSCs) have become a new favorite in the photovoltaic field, due to the boosted efficiency up to 22.1%. Despite a flow of achievements, there are certain challenges to simultaneously meet high efficiency, large scale, low cost and high stability. Due to the low cost, extensive sources, high electrical conductivity and chemical stability, carbon materials have made undeniable contributions to play positive roles in developing PSCs. Carbon materials not only have the favorable conductivity but also bipolar advantage, which can transfer both electrons and holes. In this review, we will discuss how the carbon materials transfer charge or accelerate charge transport by incorporation in PSCs. Carbon materials can replace transparent conductive oxide layers, and enhance electron transport in electron transport layers. Moreover, carbon materials with continuous structure, especially carbon nanotubes and graphene, can provide direct charge transport channel that make them suitable additives or even substitutes in hole transport layers. Especially, the successful application of carbon materials as counter electrodes makes the devices full-printable, low temperature and high stability. Finally, a brief outlook is provided on the future development of carbon materials for PSCs, which are expected to devote more contributions in the future photovoltaic market.
Effect of electric charge on the transperitoneal transport of plasma proteins during CAPD
Buis, B.; Koomen, G. C.; Imholz, A. L.; Struijk, D. G.; Reddingius, R. E.; Arisz, L.; Krediet, R. T.
1996-01-01
BACKGROUND: Controversy exists as to whether electric charges of plasma proteins influence their transport across the peritoneal membrane during CAPD. Fixed negative charges in the peritoneal membrane are diminished during peritonitis in rats. METHODS: Peritoneal clearances of 10 proteins and their
Mode-selective vibrational modulation of charge transport in organic electronic devices
Bakulin, Artem A.
2015-08-06
The soft character of organic materials leads to strong coupling between molecular, nuclear and electronic dynamics. This coupling opens the way to influence charge transport in organic electronic devices by exciting molecular vibrational motions. However, despite encouraging theoretical predictions, experimental realization of such approach has remained elusive. Here we demonstrate experimentally that photoconductivity in a model organic optoelectronic device can be modulated by the selective excitation of molecular vibrations. Using an ultrafast infrared laser source to create a coherent superposition of vibrational motions in a pentacene/C60 photoresistor, we observe that excitation of certain modes in the 1,500–1,700 cm−1 region leads to photocurrent enhancement. Excited vibrations affect predominantly trapped carriers. The effect depends on the nature of the vibration and its mode-specific character can be well described by the vibrational modulation of intermolecular electronic couplings. This presents a new tool for studying electron–phonon coupling and charge dynamics in (bio)molecular materials.
Mode-selective vibrational modulation of charge transport in organic electronic devices
Bakulin, Artem A.; Lovrincic, Robert; Yu, Xi; Selig, Oleg; Bakker, Huib J.; Rezus, Yves L. A.; Nayak, Pabitra K.; Fonari, Alexandr; Coropceanu, Veaceslav; Bredas, Jean-Luc; Cahen, David
2015-01-01
The soft character of organic materials leads to strong coupling between molecular, nuclear and electronic dynamics. This coupling opens the way to influence charge transport in organic electronic devices by exciting molecular vibrational motions. However, despite encouraging theoretical predictions, experimental realization of such approach has remained elusive. Here we demonstrate experimentally that photoconductivity in a model organic optoelectronic device can be modulated by the selective excitation of molecular vibrations. Using an ultrafast infrared laser source to create a coherent superposition of vibrational motions in a pentacene/C60 photoresistor, we observe that excitation of certain modes in the 1,500–1,700 cm−1 region leads to photocurrent enhancement. Excited vibrations affect predominantly trapped carriers. The effect depends on the nature of the vibration and its mode-specific character can be well described by the vibrational modulation of intermolecular electronic couplings. This presents a new tool for studying electron–phonon coupling and charge dynamics in (bio)molecular materials.
Neutral gas transport modeling with DEGAS 2
International Nuclear Information System (INIS)
Karney, C.; Stotler, D.
1993-01-01
The authors are currently re-writing the neutral gas transport code, DEGAS, with a view to making it both faster and easier to include new physics. They present model calculations including ionization and charge exchange illustrating the way that reactions are included into DEGAS 2 and its operation on a distributed network of workstations
Terahertz transport dynamics of graphene charge carriers
DEFF Research Database (Denmark)
Buron, Jonas Christian Due
The electronic transport dynamics of graphene charge carriers at femtosecond (10-15 s) to picosecond (10-12 s) time scales are investigated using terahertz (1012 Hz) time-domain spectroscopy (THz-TDS). The technique uses sub-picosecond pulses of electromagnetic radiation to gauge the electrodynamic...... response of thin conducting films at up to multi-terahertz frequencies. In this thesis THz-TDS is applied towards two main goals; (1) investigation of the fundamental carrier transport dynamics in graphene at femtosecond to picosecond timescales and (2) application of terahertz time-domain spectroscopy...... to rapid and non-contact electrical characterization of large-area graphene, relevant for industrial integration. We show that THz-TDS is an accurate and reliable probe of graphene sheet conductance, and that the technique provides insight into fundamental aspects of the nanoscopic nature of conduction...
Adiabatic and Nonadiabatic Charge Transport in Li-S Batteries
DEFF Research Database (Denmark)
Park, Haesun; Kumar, Nitin; Melander, Marko
2018-01-01
The insulating nature of the redox end members in Li-S batteries, -S and Li2S, has the potential to limit the capacity and efficiency of this emerging energy storage system. Nevertheless, the mechanisms responsible for ionic and electronic transport in these materials remain a matter of debate...... studies, we conclude that low equilibrium carrier concentrations are responsible for sluggish charge transport in -S and Li2S. Thus, a potential strategy for improving the performance of Li-S batteries is to increase the concentrations of holes in these redox end members....
Observation of quantum interference in molecular charge transport
DEFF Research Database (Denmark)
Guedon, Constant M.; Valkenier, Hennie; Markussen, Troels
2012-01-01
for such behaviour has been indirect. Here, we report the observation of destructive quantum interference in charge transport through two-terminal molecular junctions at room temperature. We studied five different rigid p-conjugated molecular wires, all of which form self-assembled monolayers on a gold surface......, and find that the degree of interference can be controlled by simple chemical modifications of the molecular wire....
Ionic charge transport in strongly structured molten salts
International Nuclear Information System (INIS)
Tatlipinar, H.; Amoruso, M.; Tosi, M.P.
1999-08-01
Data on the d.c. ionic conductivity for strongly structured molten halides of divalent and trivalent metals near freezing are interpreted as mainly reflecting charge transport by the halogen ions. On this assumption the Nernst-Einstein relation allows an estimate of the translational diffusion coefficient D tr of the halogen. In at least one case (molten ZnCl 2 ) D tr is much smaller than the measured diffusion coefficient, pointing to substantial diffusion via neutral units. The values of D tr estimated from the Nernst-Einstein relation are analyzed on the basis of a model involving two parameters, i.e. a bond-stretching frequency ω and an average waiting time τ. With the help of Raman scattering data for ω, the values of τ are evaluated and found to mostly lie in the range 0.02 - 0.3 ps for a vast class of materials. (author)
Charging stations location model based on spatiotemporal electromobility use patterns
Pagany, Raphaela; Marquardt, Anna; Zink, Roland
2016-04-01
One of the major challenges for mainstream adoption of electric vehicles is the provision of infrastructure for charging the batteries of the vehicles. The charging stations must not only be located dense enough to allow users to complete their journeys, but the electric energy must also be provided from renewable sources in order to truly offer a transportation with less CO2 emissions. The examination of potential locations for the charging of electric vehicles can facilitate the adaption of electromobility and the integration of electronic vehicles in everyday life. A geographic information system (GIS) based model for optimal location of charging stations in a small and regional scale is presented. This considers parameters such as the forecast of electric vehicle use penetration, the relevant weight of diverse point of interests and the distance between parking area and destination for different vehicle users. In addition to the spatial scale the temporal modelling of the energy demand at the different charging locations has to be considerate. Depending on different user profiles (commuters, short haul drivers etc.) the frequency of charging vary during the day, the week and the year. In consequence, the spatiotemporal variability is a challenge for a reliable energy supply inside a decentralized renewable energy system. The presented model delivers on the one side the most adequate identified locations for charging stations and on the other side the interaction between energy supply and demand for electromobility under the consideration of temporal aspects. Using ESRI ArcGIS Desktop, first results for the case study region of Lower Bavaria are generated. The aim of the concept is to keep the model transferable to other regions and also open to integrate further and more detailed user profiles, derived from social studies about i.e. the daily behavior and the perception of electromobility in a next step.
International Nuclear Information System (INIS)
Cranmer, Steven R.
2014-01-01
There have been several ideas proposed to explain how the Sun's corona is heated and how the solar wind is accelerated. Some models assume that open magnetic field lines are heated by Alfvén waves driven by photospheric motions and dissipated after undergoing a turbulent cascade. Other models posit that much of the solar wind's mass and energy is injected via magnetic reconnection from closed coronal loops. The latter idea is motivated by observations of reconnecting jets and also by similarities of ion composition between closed loops and the slow wind. Wave/turbulence models have also succeeded in reproducing observed trends in ion composition signatures versus wind speed. However, the absolute values of the charge-state ratios predicted by those models tended to be too low in comparison with observations. This Letter refines these predictions by taking better account of weak Coulomb collisions for coronal electrons, whose thermodynamic properties determine the ion charge states in the low corona. A perturbative description of nonlocal electron transport is applied to an existing set of wave/turbulence models. The resulting electron velocity distributions in the low corona exhibit mild suprathermal tails characterized by ''kappa'' exponents between 10 and 25. These suprathermal electrons are found to be sufficiently energetic to enhance the charge states of oxygen ions, while maintaining the same relative trend with wind speed that was found when the distribution was assumed to be Maxwellian. The updated wave/turbulence models are in excellent agreement with solar wind ion composition measurements
Time-dependent 2-D modeling of edge plasma transport with high intermittency due to blobs
International Nuclear Information System (INIS)
Pigarov, A. Yu.; Krasheninnikov, S. I.; Rognlien, T. D.
2012-01-01
The results on time-dependent 2-D fluid modeling of edge plasmas with non-diffusive intermittent transport across the magnetic field (termed cross-field) based on the novel macro-blob approach are presented. The capability of this approach to simulate the long temporal evolution (∼0.1 s) of the background plasma and simultaneously the fast spatiotemporal dynamics of blobs (∼10 −4 s) is demonstrated. An analysis of a periodic sequence of many macro-blobs (PSMB) is given showing that the resulting plasma attains a dynamic equilibrium. Plasma properties in the dynamic equilibrium are discussed. In PSMB modeling, the effect of macro-blob generation frequency on edge plasma parameters is studied. Comparison between PSMB modeling and experimental profile data is given. The calculations are performed for the same plasma discharge using two different models for anomalous cross-field transport: time-average convection and PSMB. Parametric analysis of edge plasma variation with transport coefficients in these models is presented. The capability of the models to accurately simulate enhanced transport due to blobs is compared. Impurity dynamics in edge plasma with macro-blobs is also studied showing strong impact of macro-blob on profiles of impurity charge states caused by enhanced outward transport of high-charge states and simultaneous inward transport of low-charge states towards the core. Macro-blobs cause enhancement of sputtering rates, increase radiation and impurity concentration in plasma, and change erosion/deposition patterns.
Directory of Open Access Journals (Sweden)
Andrés Arias
2018-09-01
Full Text Available Electric Vehicles (EVs represent a significant option that contributes to improve the mobility and reduce the pollution, leaving a future expectation in the merchandise transportation sector, which has been demonstrated with pilot projects of companies operating EVs for products delivering. In this work a new approach of EVs for merchandise transportation considering the location of Electric Vehicle Charging Stations (EVCSs and the impact on the Power Distribution System (PDS is addressed. This integrated planning is formulated through a mixed integer non-linear mathematical model. Test systems of different sizes are designed to evaluate the model performance, considering the transportation network and PDS. The results show a trade-off between EVs routing, PDS energy losses and EVCSs location.
Charge and Spin Transport in Spin-orbit Coupled and Topological Systems
Ndiaye, Papa Birame
2017-10-31
In the search for low power operation of microelectronic devices, spin-based solutions have attracted undeniable increasing interest due to their intrinsic magnetic nonvolatility. The ability to electrically manipulate the magnetic order using spin-orbit interaction, associated with the recent emergence of topological spintronics with its promise of highly efficient charge-to-spin conversion in solid state, offer alluring opportunities in terms of system design. Although the related technology is still at its infancy, this thesis intends to contribute to this engaging field by investigating the nature of the charge and spin transport in spin-orbit coupled and topological systems using quantum transport methods. We identified three promising building blocks for next-generation technology, three classes of systems that possibly enhance the spin and charge transport efficiency: (i)- topological insulators, (ii)- spin-orbit coupled magnonic systems, (iii)- topological magnetic textures (skyrmions and 3Q magnetic state). Chapter 2 reviews the basics and essential concepts used throughout the thesis: the spin-orbit coupling, the mathematical notion of topology and its importance in condensed matter physics, then topological magnetism and a zest of magnonics. In Chapter 3, we study the spin-orbit torques at the magnetized interfaces of 3D topological insulators. We demonstrated that their peculiar form, compared to other spin-orbit torques, have important repercussions in terms of magnetization reversal, charge pumping and anisotropic damping. In Chapter 4, we showed that the interplay between magnon current jm and magnetization m in homogeneous ferromagnets with Dzyaloshinskii-Moriya (DM) interaction, produces a field-like torque as well as a damping-like torque. These DM torques mediated by spin wave can tilt the imeaveraged magnetization direction and are similar to Rashba torques for electronic systems. Moreover, the DM torque is more efficient when magnons are
PATH: a lumped-element beam-transport simulation program with space charge
International Nuclear Information System (INIS)
Farrell, J.A.
1983-01-01
PATH is a group of computer programs for simulating charged-particle beam-transport systems. It was developed for evaluating the effects of some aberrations without a time-consuming integration of trajectories through the system. The beam-transport portion of PATH is derived from the well-known program, DECAY TURTLE. PATH contains all features available in DECAY TURTLE (including the input format) plus additional features such as a more flexible random-ray generator, longitudinal phase space, some additional beamline elements, and space-charge routines. One of the programs also provides a simulation of an Alvarez linear accelerator. The programs, originally written for a CDC 7600 computer system, also are available on a VAX-VMS system. All of the programs are interactive with input prompting for ease of use
Spiro-OMeTAD single crystals: Remarkably enhanced charge-carrier transport via mesoscale ordering
Shi, Dong
2016-04-15
We report the crystal structure and hole-transport mechanism in spiro-OMeTAD [2,2′,7,7′-tetrakis(N,N-di-p-methoxyphenyl-amine)9,9′-spirobifluorene], the dominant hole-transporting material in perovskite and solid-state dye-sensitized solar cells. Despite spiro-OMeTAD’s paramount role in such devices, its crystal structure was unknown because of highly disordered solution-processed films; the hole-transport pathways remained ill-defined and the charge carrier mobilities were low, posing a major bottleneck for advancing cell efficiencies. We devised an antisolvent crystallization strategy to grow single crystals of spiro-OMeTAD, which allowed us to experimentally elucidate its molecular packing and transport properties. Electronic structure calculations enabled us to map spiro-OMeTAD’s intermolecular charge-hopping pathways. Promisingly, single-crystal mobilities were found to exceed their thin-film counterparts by three orders of magnitude. Our findings underscore mesoscale ordering as a key strategy to achieving breakthroughs in hole-transport material engineering of solar cells.
Energy Technology Data Exchange (ETDEWEB)
Futtersack, R., E-mail: romain.futtersack@cea.fr [CEA, IRFM, F-13108 Saint-Paul-lez-Durance (France); Universite Paul Sabatier Toulouse, LAPLACE, 118 Route de Narbonne, F-31062 Toulouse Cedex 9 (France); Tamain, P. [CEA, IRFM, F-13108 Saint-Paul-lez-Durance (France); Hagelaar, G. [Universite Paul Sabatier Toulouse, LAPLACE, 118 Route de Narbonne, F-31062 Toulouse Cedex 9 (France); Ghendrih, Ph.; Simonin, A. [CEA, IRFM, F-13108 Saint-Paul-lez-Durance (France)
2013-07-15
We investigate the impact of both parallel and transverse boundary conditions on the current and charge transport in open field line systems using the TOKAM2D code, which solves a minimal model for interchange turbulence. Various limit test cases are discussed and analyzed. In the parallel direction, the sheath conductivity is found to play an essential role in the stabilization of large-scale potential structures, leading to the formation of transport channel or transport barrier respectively for an insulating end wall or a wall with an enhanced sheath conductivity. On another hand, the addition of transverse boundary conditions intrinsically changes the transport characteristics, influencing both radial profiles and probability density functions. It underlines that in some cases a detailed description of the plasma-wall interaction process is required to get a proper description of the current loop pattern that determines electrostatic turbulent transport.
DEFF Research Database (Denmark)
Muniruzzaman, Muhammad; Rolle, Massimo
2016-01-01
is coupled with the geochemical code PHREEQC-3 by utilizing the IPhreeqc module, thus enabling to perform the geochemical calculations included in the PHREEQC's reaction package. The multicomponent reactive transport code is benchmarked with different 1-D and 2-D transport problems. Successively...... the electrostatic interactions during transport of charged ions in physically and chemically heterogeneous porous media. The modeling approach is based on the local charge balance and on the description of compound-specific and spatially variable diffusive/dispersive fluxes. The multicomponent ionic transport code......, conservative and reactive transport examples are presented to demonstrate the capability of the proposed model to simulate transport of charged species in heterogeneous porous media with spatially variable physical and chemical properties. The results reveal that the Coulombic cross-coupling between dispersive...
Dynamic space charge behaviour in polymeric DC cables
DEFF Research Database (Denmark)
Rasmussen, Claus Nygaard; Holbøll, Joachim; Henriksen, Mogens
2002-01-01
The use of extruded insulation for DC cables involves a risk of local electric field enhancement, caused by a space charge build-up within the dielectric. In this work, the theory of charge generation and transport in polymers is applied in a numerical computer model in order to predict...... the formation and transport of space charges in a polymeric dielectric. The model incorporates the processes of field assisted electron-hole pair generation from impurity atoms, trapping and charge injection at the electrodes. Its aim has been to study the field- and temperature dependent dynamic behaviour...
Charge carrier transport and photogeneration in P3HT:PCBM photovoltaic blends.
Laquai, Frédéric; Andrienko, Denis; Mauer, Ralf; Blom, Paul W M
2015-06-01
This article reviews the charge transport and photogeneration in bulk-heterojunction solar cells made from blend films of regioregular poly(3-hexylthiophene) (RR-P3HT) and methano-fullerene (PCBM). The charge transport, specifically the hole mobility in the RR-P3HT phase of the polymer:fullerene photovoltaic blend, is dramatically affected by thermal annealing. The hole mobility increases more than three orders of magnitude and reaches a value of up to 2 × 10(-4) cm(2) V(-1) s(-1) after the thermal annealing process as a result of an improved semi-crystallinity of the film. This significant increase of the hole mobility balances the electron and hole mobilities in a photovoltaic blend in turn reducing space-charge formation, and this is the most important factor for the strong enhancement of the photovoltaic efficiency compared to an as cast, that is, non-annealed device. In fact, the balanced charge carrier mobility in RR-P3HT:PCBM blends in combination with a field- and temperature-independent charge carrier generation and greatly reduced non-geminate recombination explains the large quantum efficiencies mea-sured in P3HT:PCBM photovoltaic devices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
EBQ code: Transport of space-charge beams in axially symmetric devices
Paul, A. C.
1982-11-01
Such general-purpose space charge codes as EGUN, BATES, WODF, and TRANSPORT do not gracefully accommodate the simulation of relativistic space-charged beams propagating a long distance in axially symmetric devices where a high degree of cancellation has occurred between the self-magnetic and self-electric forces of the beam. The EBQ code was written specifically to follow high current beam particles where space charge is important in long distance flight in axially symmetric machines possessing external electric and magnetic field. EBQ simultaneously tracks all trajectories so as to allow procedures for charge deposition based on inter-ray separations. The orbits are treated in Cartesian geometry (position and momentum) with z as the independent variable. Poisson's equation is solved in cylindrical geometry on an orthogonal rectangular mesh. EBQ can also handle problems involving multiple ion species where the space charge from each must be included. Such problems arise in the design of ion sources where different charge and mass states are present.
EBQ code: transport of space-charge beams in axially symmetric devices
International Nuclear Information System (INIS)
Paul, A.C.
1982-11-01
Such general-purpose space charge codes as EGUN, BATES, WOLF, and TRANSPORT do not gracefully accommodate the simulation of relativistic space-charged beams propagating a long distance in axially symmetric devices where a high degree of cancellation has occurred between the self-magnetic and self-electric forces of the beam. The EBQ code was written specifically to follow high current beam particles where space charge is important in long distance flight in axially symmetric machines possessing external electric and magnetic field. EBQ simultaneously tracks all trajectories so as to allow procedures for charge deposition based on inter-ray separations. The orbits are treated in Cartesian geometry (position and momentum) with z as the independent variable. Poisson's equation is solved in cylindrical geometry on an orthogonal rectangular mesh. EBQ can also handle problems involving multiple ion species where the space charge from each must be included. Such problems arise in the design of ion sources where different charge and mass states are present
Determination of charge carrier mobility of hole transporting polytriarylamine-based diodes
Energy Technology Data Exchange (ETDEWEB)
Barea, Eva M. [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, 12071 Castello (Spain); Garcia-Belmonte, Germa, E-mail: garciag@uji.e [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, 12071 Castello (Spain); Sommer, Michael; Huettner, Sven [Applied Functional Polymers, Universitaet Bayreuth, 95440 Bayreuth (Germany); Bolink, Henk J. [Molecular Science Institute-Universitat de Valencia, Poligon La Coma s/n, 46980 Paterna, Valencia (Spain); Thelakkat, Mukundan, E-mail: mukundan.thelakkat@uni-bayreuth.d [Applied Functional Polymers, Universitaet Bayreuth, 95440 Bayreuth (Germany)
2010-04-02
Hole transport properties of three different side chain poly(triarylamines) have been determined by means of the analysis of steady-state current-voltage characteristics using co-planar diode structures. The interpretation is based on space-charge limited models with field-dependent mobility. Mobilities between {approx} 10{sup -8} and 10{sup -6} cm{sup 2} V{sup -1} s{sup -1} are obtained. The highest mobility is achieved for poly(tetraphenylbenzidine) devices and the lowest for poly(triphenylamine) devices. Electron-rich methoxy substituents increase the mobility of poly(triphenylamine)s. A comparison of the mobility values with those obtained using organic field-effect transistors is also given.
Routing and Scheduling Optimization Model of Sea Transportation
barus, Mika debora br; asyrafy, Habib; nababan, Esther; mawengkang, Herman
2018-01-01
This paper examines the routing and scheduling optimization model of sea transportation. One of the issues discussed is about the transportation of ships carrying crude oil (tankers) which is distributed to many islands. The consideration is the cost of transportation which consists of travel costs and the cost of layover at the port. Crude oil to be distributed consists of several types. This paper develops routing and scheduling model taking into consideration some objective functions and constraints. The formulation of the mathematical model analyzed is to minimize costs based on the total distance visited by the tanker and minimize the cost of the ports. In order for the model of the problem to be more realistic and the cost calculated to be more appropriate then added a parameter that states the multiplier factor of cost increases as the charge of crude oil is filled.
Plasma stream transport method (2) Use of charge exchange plasma source
International Nuclear Information System (INIS)
Tsuchimoto, T.
1978-01-01
The plasma stream transport method using a single plasma source has limitations for practical film deposition. Using a charge exchange phenomenon, a new plasma source is devised and tested by the plasma stream transport machine. Metals, silicon dioxide, and nitride films are deposited by this system. The mechanism of deposition under relatively high vacuum surrounding a silicon wafer is discussed as is the effect of radical atoms
Electrification Opportunities in the Transportation Sector and Impact of Residential Charging
Energy Technology Data Exchange (ETDEWEB)
Muratori, Matteo [National Renewable Energy Laboratory (NREL), Golden, CO (United States)
2018-04-04
This presentation provides an overview of electrification opportunities in the transportation sector and present results of a study assessing the impact of residential charging on residential power demand and electric power distribution infrastructure.
On the Structure of the Fixed Charge Transportation Problem
Kowalski, K.
2005-01-01
This work extends the theory of the fixed charge transportation problem (FCTP), currently based mostly on a forty-year-old publication by Hirsch and Danzig. This paper presents novel properties that need to be considered by those using existing, or those developing new methods for optimizing FCTP. It also defines the problem in an easier way,…
Charge transport in non-polar and semi-polar III-V nitride heterostructures
International Nuclear Information System (INIS)
Konar, Aniruddha; Verma, Amit; Fang, Tian; Zhao, Pei; Jana, Raj; Jena, Debdeep
2012-01-01
Compared to the intense research focus on the optical properties, the transport properties in non-polar and semi-polar III-nitride semiconductors remain relatively unexplored to date. The purpose of this paper is to discuss charge-transport properties in non-polar and semi-polar orientations of GaN in a comparative fashion to what is known for transport in polar orientations. A comprehensive approach is adopted, starting from an investigation of the differences in the electronic bandstructure along different polar orientations of GaN. The polarization fields along various orientations are then discussed, followed by the low-field electron and hole mobilities. A number of scattering mechanisms that are specific to non-polar and semi-polar GaN heterostructures are identified, and their effects are evaluated. Many of these scattering mechanisms originate due to the coupling of polarization with disorder and defects in various incarnations depending on the crystal orientation. The effect of polarization orientation on carrier injection into quantum-well light-emitting diodes is discussed. This paper ends with a discussion of orientation-dependent high-field charge-transport properties including velocity saturation, instabilities and tunneling transport. Possible open problems and opportunities are also discussed. (paper)
Effects of Te inclusions on charge-carrier transport properties in CdZnTe radiation detectors
International Nuclear Information System (INIS)
Gu, Yaxu; Rong, Caicai; Xu, Yadong; Shen, Hao; Zha, Gangqiang; Wang, Ning; Lv, Haoyan; Li, Xinyi; Wei, Dengke; Jie, Wanqi
2015-01-01
Highlights: • This work reveals the behaviors of Te inclusion in affecting charge-carrier transport properties in CdZnTe detectors for the first time and analysis the mechanism therein. • The results show that charge collection efficiencies in Te inclusion degraded regions experience fast ascent under low biases and slow descent at high applied biases, which deviates from the Hecht rule. • This phenomenon is attributed to the competitive influence of two mechanisms under different biases, namely charge carrier trapping due to uniformly distributed point defects and Te inclusion induced transient charge loss. • A modified Hecht equation is further proposed to explain the effects of high-density localized defects, say Te inclusions, on the charge collection efficiency. • We believe that this research has wide appeal to analyze the macroscopic defects and their influence on charge transport properties in semiconductor radiation detectors. - Abstract: The influence of tellurium (Te) inclusions on the charge collection efficiency in cadmium zinc telluride (CdZnTe or CZT) detectors has been investigated using ion beam induced charge (IBIC) technique. Combining the analysis of infrared transmittance image, most of the low charge collection areas in the IBIC images prove the existence of Te inclusions. To further clarify the role of Te inclusions on charge transport properties, bias dependent local IBIC scan was performed on Te inclusion related regions from 20 V to 500 V. The result shows that charge collection efficiencies in Te inclusion degraded regions experience fast ascent under low biases and slow descent at high applied biases, which deviates from Hecht rule. This behavior is attributed to the competitive influence of two mechanisms under different biases, namely charge carrier trapping due to uniformly distributed point defects and Te inclusion induced transient charge loss. A modified Hecht equation is further proposed to explain the effects of high
Electron-beam-charged dielectrics: Internal charge distribution
Beers, B. L.; Pine, V. W.
1981-01-01
Theoretical calculations of an electron transport model of the charging of dielectrics due to electron bombardment are compared to measurements of internal charge distributions. The emphasis is on the distribution of Teflon. The position of the charge centroid as a function of time is not monotonic. It first moves deeper into the material and then moves back near to the surface. In most time regimes of interest, the charge distribution is not unimodal, but instead has two peaks. The location of the centroid near saturation is a function of the incident current density. While the qualitative comparison of theory and experiment are reasonable, quantitative comparison shows discrepancies of as much as a factor of two.
Colloid transport in model fracture filling materials
Wold, S.; Garcia-Garcia, S.; Jonsson, M.
2010-12-01
Colloid transport in model fracture filling materials Susanna Wold*, Sandra García-García and Mats Jonsson KTH Chemical Science and Engineering Royal Institute of Technology, SE-100 44 Stockholm, Sweden *Corresponding author: E-mail: wold@kth.se Phone: +46 8 790 6295 In colloid transport in water-bearing fractures, the retardation depends on interactions with the fracture surface by sorption or filtration. These mechanisms are difficult to separate. A rougher surface will give a larger area available for sorption, and also when a particle is physically hindered, it approaches the surface and enables further sorption. Sorption can be explained by electrostatics were the strongest sorption on minerals always is observed at pH below pHpzc (Filby et al., 2008). The adhesion of colloids to mineral surfaces is related to the surface roughness according to a recent study (Darbha et al., 2010). There is a large variation in the characteristics of water-bearing fractures in bedrock in terms of aperture distribution, flow velocity, surface roughness, mineral distributions, presence of fracture filling material, and biological and organic material, which is hard to implement in modeling. The aim of this work was to study the transport of negatively charged colloids in model fracture filling material in relation to flow, porosity, mineral type, colloid size, and surface charge distribution. In addition, the impact on transport of colloids of mixing model fracture filling materials with different retention and immobilization capacities, determined by batch sorption experiments, was investigated. The transport of Na-montmorillonite colloids and well-defined negatively charged latex microspheres of 50, 100, and 200 nm diameter were studied in either columns containing quartz or quartz mixed with biotite. The ionic strength in the solution was exclusively 0.001 and pH 6 or 8.5. The flow rates used were 0.002, 0.03, and 0.6 mL min-1. Sorption of the colloids on the model fracture
Charge and Spin Transport in Spin-orbit Coupled and Topological Systems
Ndiaye, Papa Birame
2017-01-01
for next-generation technology, three classes of systems that possibly enhance the spin and charge transport efficiency: (i)- topological insulators, (ii)- spin-orbit coupled magnonic systems, (iii)- topological magnetic textures (skyrmions and 3Q magnetic
Jiang, Fangming; Peng, Peng
2016-01-01
Underutilization due to performance limitations imposed by species and charge transports is one of the key issues that persist with various lithium-ion batteries. To elucidate the relevant mechanisms, two groups of characteristic parameters were proposed. The first group contains three characteristic time parameters, namely: (1) te, which characterizes the Li-ion transport rate in the electrolyte phase, (2) ts, characterizing the lithium diffusion rate in the solid active materials, and (3) tc, describing the local Li-ion depletion rate in electrolyte phase at the electrolyte/electrode interface due to electrochemical reactions. The second group contains two electric resistance parameters: Re and Rs, which represent respectively, the equivalent ionic transport resistance and the effective electronic transport resistance in the electrode. Electrochemical modeling and simulations to the discharge process of LiCoO2 cells reveal that: (1) if te, ts and tc are on the same order of magnitude, the species transports may not cause any performance limitations to the battery; (2) the underlying mechanisms of performance limitations due to thick electrode, high-rate operation, and large-sized active material particles as well as effects of charge transports are revealed. The findings may be used as quantitative guidelines in the development and design of more advanced Li-ion batteries. PMID:27599870
Charge transport in silicon nanocrystal superlattices in the terahertz regime
Czech Academy of Sciences Publication Activity Database
Němec, Hynek; Zajac, Vít; Kužel, Petr; Malý, P.; Gutsch, S.; Hiller, D.; Zacharias, M.
2015-01-01
Roč. 91, č. 19 (2015), "195443-1"-"195443-10" ISSN 1098-0121 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : silicon nanocrystals * charge transport * terahertz spectroscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.736, year: 2014
Charge deposition model for investigating SE-microdose effect in trench power MOSFETs
Xin, Wan; Weisong, Zhou; Daoguang, Liu; Hanliang, Bo; Jun, Xu
2015-05-01
It was demonstrated that heavy ions can induce large current—voltage (I-V) characteristics shift in commercial trench power MOSFETs, named single event microdose effect (SE-microdose effect). A model is presented to describe this effect. This model calculates the charge deposition by a single heavy ion hitting oxide and the subsequent charge transport under an electric field. Holes deposited at the SiO2/Si interface by a Xe ion are calculated by using this model. The calculated results were then used in Sentaurus TCAD software to simulate a trench power MOSFET's I-V curve shift after a Xe ion has hit it. The simulation results are consistent with the related experiment's data. In the end, several factors which affect the SE-microdose effect in trench power MOSFETs are investigated by using this model.
International Nuclear Information System (INIS)
Teyssedre, G.; Laurent, C.; Vu, T. T. N.
2015-01-01
Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30–60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10 −14 –10 −13 m 2 V −1 s −1 for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets
Teyssedre, G.; Vu, T. T. N.; Laurent, C.
2015-12-01
Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30-60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10-14-10-13 m2 V-1 s-1 for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.
On the mechanism of charge transport in low density polyethylene
Upadhyay, Avnish K.; Reddy, C. C.
2017-08-01
Polyethylene based polymeric insulators, are being increasingly used in the power industry for their inherent advantages over conventional insulation materials. Specifically, modern power cables are almost made with these materials, replacing the mass-impregnated oil-paper cable technology. However, for ultra-high dc voltage applications, the use of these polymeric cables is hindered by ununderstood charge transport and accumulation. The conventional conduction mechanisms (Pool-Frenkel, Schottky, etc.) fail to track high-field charge transport in low density polyethylene, which is semi-crystalline in nature. Until now, attention was devoted mainly to the amorphous region of the material. In this paper, authors propose a novel mechanism for conduction in low density polyethylene, which could successfully track experimental results. As an implication, a novel, substantial relationship is established for electrical conductivity that could be effectively used for understanding conduction and breakdown in polyethylene, which is vital for successful development of ultra-high voltage dc cables.
Business Models for Solar Powered Charging Stations to Develop Infrastructure for Electric Vehicles
Directory of Open Access Journals (Sweden)
Jessica Robinson
2014-10-01
Full Text Available Electric power must become less dependent on fossil fuels and transportation must become more electric to decrease carbon emissions and mitigate climate change. Increasing availability and accessibility of charging stations is predicted to increase purchases of electric vehicles. In order to address the current inadequate charging infrastructure for electric vehicles, major entities must adopt business models for solar powered charging stations (SPCS. These SPCS should be located in parking lots to produce electricity for the grid and provide an integrated infrastructure for charging electric vehicles. Due to the lack of information related to SPCS business models, this manuscript designs several models for major entities including industry, the federal and state government, utilities, universities, and public parking. A literature review of the available relevant business models and case studies of constructed charging stations was completed to support the proposals. In addition, a survey of a university’s students, staff, and faculty was conducted to provide consumer research on people’s opinion of SPCS construction and preference of business model aspects. Results showed that 69% of respondents would be more willing to invest in an electric vehicle if there was sufficient charging station infrastructure at the university. Among many recommendations, the business models suggest installing level 1 charging for the majority of entities, and to match entities’ current pricing structures for station use. The manuscript discusses the impacts of fossil fuel use, and the benefits of electric car and SPCS use, accommodates for the present gap in available literature on SPCS business models, and provides current consumer data for SPCS and the models proposed.
Numerical design of electron guns and space charge limited transport systems
International Nuclear Information System (INIS)
Herrmannsfeldt, W.B.
1980-10-01
This paper describes the capabilities and limitations of computer programs used to design electron guns and similarly space-charge limited transport systems. Examples of computer generated plots from several different types of gun problems are included
Smieska, Louisa Marion
Organic semiconductors could have wide-ranging applications in lightweight, efficient electronic circuits. However, several fundamental questions regarding organic electronic device behavior have not yet been fully addressed, including the nature of chemical charge traps, and robust models for injection and transport. Many studies focus on engineering devices through bulk transport measurements, but it is not always possible to infer the microscopic behavior leading to the observed measurements. In this thesis, we present scanning-probe microscope studies of organic semiconductor devices in an effort to connect local properties with local device behavior. First, we study the chemistry of charge trapping in pentacene transistors. Working devices are doped with known pentacene impurities and the extent of charge trap formation is mapped across the transistor channel. Trap-clearing spectroscopy is employed to measure an excitation of the pentacene charge trap species, enabling identification of the degradationrelated chemical trap in pentacene. Second, we examine transport and trapping in peryelene diimide (PDI) transistors. Local mobilities are extracted from surface potential profiles across a transistor channel, and charge injection kinetics are found to be highly sensitive to electrode cleanliness. Trap-clearing spectra generally resemble PDI absorption spectra, but one derivative yields evidence indicating variation in trap-clearing mechanisms for different surface chemistries. Trap formation rates are measured and found to be independent of surface chemistry, contradicting a proposed silanol trapping mechanism. Finally, we develop a variation of scanning Kelvin probe microscopy that enables measurement of electric fields through a position modulation. This method avoids taking a numeric derivative of potential, which can introduce high-frequency noise into the electric field signal. Preliminary data is presented, and the theoretical basis for electric field
Model improvements to simulate charging in SEM
Arat, K. T.; Klimpel, T.; Hagen, C. W.
2018-03-01
Charging of insulators is a complex phenomenon to simulate since the accuracy of the simulations is very sensitive to the interaction of electrons with matter and electric fields. In this study, we report model improvements for a previously developed Monte-Carlo simulator to more accurately simulate samples that charge. The improvements include both modelling of low energy electron scattering and charging of insulators. The new first-principle scattering models provide a more realistic charge distribution cloud in the material, and a better match between non-charging simulations and experimental results. Improvements on charging models mainly focus on redistribution of the charge carriers in the material with an induced conductivity (EBIC) and a breakdown model, leading to a smoother distribution of the charges. Combined with a more accurate tracing of low energy electrons in the electric field, we managed to reproduce the dynamically changing charging contrast due to an induced positive surface potential.
Energy Technology Data Exchange (ETDEWEB)
Kaushal, Vikas; Margala, Martin [Department of Electrical and Computer Engineering, University of Massachusetts Lowell, MA, 01854 (United States); Yu Qiaoyan; Ampadu, Paul; Guarino, Gregg; Sobolewski, Roman, E-mail: vikas_kaushal@student.uml.ed [Department of Electrical and Computer Engineering, University of Rochester, NY, 14627 (United States)
2009-11-15
In this paper, two different theoretical models, Comsol Multiphysics{sup TM} (a Finite Element Analysis tool), and a field solver Atlas/Blaze from Silvaco, are compared qualitatively to study the effect of the deflector position, its size and electric field on the charge transport and its distribution along the channel, resulting in current outputs and leakages in ballistic deflection transistors (BDT). Silvaco simulations and experimental results were then used to study the lateral charge transport as a result of variation in electric field distribution, which controls the charge current along the channel in BDT. The electric field dependence of gain is also studied with experimental and theoretical results.
International Nuclear Information System (INIS)
Kaushal, Vikas; Margala, Martin; Yu Qiaoyan; Ampadu, Paul; Guarino, Gregg; Sobolewski, Roman
2009-01-01
In this paper, two different theoretical models, Comsol Multiphysics TM (a Finite Element Analysis tool), and a field solver Atlas/Blaze from Silvaco, are compared qualitatively to study the effect of the deflector position, its size and electric field on the charge transport and its distribution along the channel, resulting in current outputs and leakages in ballistic deflection transistors (BDT). Silvaco simulations and experimental results were then used to study the lateral charge transport as a result of variation in electric field distribution, which controls the charge current along the channel in BDT. The electric field dependence of gain is also studied with experimental and theoretical results.
Optimal Charging Schedule Planning and Economic Analysis for Electric Bus Charging Stations
Directory of Open Access Journals (Sweden)
Rong-Ceng Leou
2017-04-01
Full Text Available The battery capacity of electric buses (EB used for public transportation is greater than that of electric cars, and the charging power is also several times greater than that used in electric cars; this can result in high energy consumption and negatively impact power distribution networks. This paper proposes a framework to determine the optimal contracted power capacity and charging schedule of an EB charging station in such a way that energy costs can be reduced. A mathematical model of controlled charging, which includes the capacity and energy charges of the station, was developed to minimize costs. The constraints of the model include the charging characteristics of an EB and the operational guidelines of the bus company. A practical EB charging station was used to verify the proposed model. The financial viability of this EB charging station is also studied in this paper. The economic analysis model for this charging station considers investment and operational costs, and the operational revenue. Sensitivity analyses with respect to some key parameters are also performed in this paper. Based on actual operational routes and EB charging schemes, test results indicate that the EB charging station investment is feasible, and the planning model proposed can be used to determine optimal station power capacity and minimize energy costs.
Charge transportation in polyaniline/V2O5 composites
International Nuclear Information System (INIS)
Huguenin, Fritz; Torresi, Roberto M.
2004-01-01
In this work, composites formed from a mixture of V 2 O 5 and polyaniline (PANI) were investigated, for applications as cathode materials for secondary lithium batteries. Electrochemical quartz crystal microbalance (EQCM) data show that charge compensation in the [PANI] 0.3 V 2 O 5 nanocomposite is achieved predominantly by Li + migration. However, the charge compensation in the [PANI]V 2 O 5 microcomposite occurs by Li + and Cl O 4 - transport. Electrochemical Impedance Spectroscopy (EIS) measurements reveal several benefits of nanohybrid formation, including the achievement of shorter ionic diffusion pathways, the higher diffusion rate of the lithium ion and also the higher electronic conductivity, which are responsible for a synergetic effect of the energy storage properties. (author)
Position-dependent Effects of Polylysine on Sec Protein Transport*
Liang, Fu-Cheng; Bageshwar, Umesh K.; Musser, Siegfried M.
2012-01-01
The bacterial Sec protein translocation system catalyzes the transport of unfolded precursor proteins across the cytoplasmic membrane. Using a recently developed real time fluorescence-based transport assay, the effects of the number and distribution of positive charges on the transport time and transport efficiency of proOmpA were examined. As expected, an increase in the number of lysine residues generally increased transport time and decreased transport efficiency. However, the observed effects were highly dependent on the polylysine position in the mature domain. In addition, a string of consecutive positive charges generally had a more significant effect on transport time and efficiency than separating the charges into two or more charged segments. Thirty positive charges distributed throughout the mature domain resulted in effects similar to 10 consecutive charges near the N terminus of the mature domain. These data support a model in which the local effects of positive charge on the translocation kinetics dominate over total thermodynamic constraints. The rapid translocation kinetics of some highly charged proOmpA mutants suggest that the charge is partially shielded from the electric field gradient during transport, possibly by the co-migration of counter ions. The transport times of precursors with multiple positively charged sequences, or “pause sites,” were fairly well predicted by a local effect model. However, the kinetic profile predicted by this local effect model was not observed. Instead, the transport kinetics observed for precursors with multiple polylysine segments support a model in which translocation through the SecYEG pore is not the rate-limiting step of transport. PMID:22367204
Position-dependent effects of polylysine on Sec protein transport.
Liang, Fu-Cheng; Bageshwar, Umesh K; Musser, Siegfried M
2012-04-13
The bacterial Sec protein translocation system catalyzes the transport of unfolded precursor proteins across the cytoplasmic membrane. Using a recently developed real time fluorescence-based transport assay, the effects of the number and distribution of positive charges on the transport time and transport efficiency of proOmpA were examined. As expected, an increase in the number of lysine residues generally increased transport time and decreased transport efficiency. However, the observed effects were highly dependent on the polylysine position in the mature domain. In addition, a string of consecutive positive charges generally had a more significant effect on transport time and efficiency than separating the charges into two or more charged segments. Thirty positive charges distributed throughout the mature domain resulted in effects similar to 10 consecutive charges near the N terminus of the mature domain. These data support a model in which the local effects of positive charge on the translocation kinetics dominate over total thermodynamic constraints. The rapid translocation kinetics of some highly charged proOmpA mutants suggest that the charge is partially shielded from the electric field gradient during transport, possibly by the co-migration of counter ions. The transport times of precursors with multiple positively charged sequences, or "pause sites," were fairly well predicted by a local effect model. However, the kinetic profile predicted by this local effect model was not observed. Instead, the transport kinetics observed for precursors with multiple polylysine segments support a model in which translocation through the SecYEG pore is not the rate-limiting step of transport.
Energy Technology Data Exchange (ETDEWEB)
Allu, Srikanth [ORNL; Velamur Asokan, Badri [Exxon Mobil Research and Engineering; Shelton, William A [Louisiana State University; Philip, Bobby [ORNL; Pannala, Sreekanth [ORNL
2014-01-01
A generalized three dimensional computational model based on unied formulation of electrode- electrolyte-electrode system of a electric double layer supercapacitor has been developed. The model accounts for charge transport across the solid-liquid system. This formulation based on volume averaging process is a widely used concept for the multiphase ow equations ([28] [36]) and is analogous to porous media theory typically employed for electrochemical systems [22] [39] [12]. This formulation is extended to the electrochemical equations for a supercapacitor in a consistent fashion, which allows for a single-domain approach with no need for explicit interfacial boundary conditions as previously employed ([38]). In this model it is easy to introduce the spatio-temporal variations, anisotropies of physical properties and it is also conducive for introducing any upscaled parameters from lower length{scale simulations and experiments. Due to the irregular geometric congurations including porous electrode, the charge transport and subsequent performance characteristics of the super-capacitor can be easily captured in higher dimensions. A generalized model of this nature also provides insight into the applicability of 1D models ([38]) and where multidimensional eects need to be considered. In addition, simple sensitivity analysis on key input parameters is performed in order to ascertain the dependence of the charge and discharge processes on these parameters. Finally, we demonstarted how this new formulation can be applied to non-planar supercapacitors
Iterated local search and record-to-record travel applied to the fixed charge transportation problem
DEFF Research Database (Denmark)
Andersen, Jeanne; Klose, Andreas
The fixed charge transportation problem (FCTP) is a well-known and difficult optimization problem with lots of applications in logistics. It consists in finding a minimum cost network flow from a set of suppliers to a set of customers. Beside costs proportional to quantities transported......, transportation costs do, however, include a fixed charge. Iterated local search and record-to-record travel are both simple local search based meta-heuristics that, to our knowledge, not yet have been applied to the FCTP. In this paper, we apply both types of search strategies and combine them into a single...
Caban, Karolina; Lewera, Adam; Zukowska, Grazyna Z; Kulesza, Pawel J; Stojek, Zbigniew; Jeffrey, Kenneth R
2006-08-04
Two methods have been used for examination of transport of charge in gels soaked with DMF and containing dissolved polyoxometallates. The first method is based on the analysis of both Cottrellian and steady-state currents and therefore is capable of giving the concentration of the electroactive redox centres and their transport (diffusion-type) coefficient. The second method provides the real diffusion coefficients, i.e. transport coefficients free of migrational influence, for both the substrate and the product of the electrode reaction. Several gels based on poly(methyl methacrylate), with charged (addition of 1-acrylamido-2-methyl-2-propanesulphonic acid to the polymerization mixture) and uncharged chains, have been used in the investigation. The ratio obtained for the diffusion coefficient (second method) and transport coefficient (first method) was smaller for the gels containing charged polymer chains than for the gels with uncharged chains. In part these changes could be explained by the contribution of migration to the transport of polyoxomatallates in the gels. However, the impact of the changes in the polymer-channel capacity at the electrode surface while the electrode process proceeds was also considered. These structural changes should affect differently the methods based on different time domains.
Charge Pricing Optimization Model for Private Charging Piles in Beijing
Directory of Open Access Journals (Sweden)
Xingping Zhang
2017-11-01
Full Text Available This paper develops a charge pricing model for private charging piles (PCPs by considering the environmental and economic effects of private electric vehicle (PEV charging energy sources and the impact of PCP charging load on the total load. This model simulates users’ responses to different combinations of peak-valley prices based on the charging power of PCPs and user charging transfer rate. According to the regional power structure, it calculates the real-time coal consumption, carbon dioxide emissions reduction, and power generation costs of PEVs on the power generation side. The empirical results demonstrate that the proposed peak-valley time-of-use charging price can not only minimize the peak-valley difference of the total load but also improve the environmental effects of PEVs and the economic income of the power system. The sensitivity analysis shows that the load-shifting effect of PCPs will be more obvious when magnifying the number of PEVs by using the proposed charging price. The case study indicates that the proposed peak, average, and valley price in Beijing should be 1.8, 1, and 0.4 yuan/kWh, which can promote the large-scale adoption of PEVs.
Riccardi, E; Wang, J-C; Liapis, A I
2010-08-28
The transport of a charged adsorbate biomolecule in a porous polymeric adsorbent medium and its adsorption onto the covalently immobilized ligands have been modeled and investigated using molecular dynamics modeling and simulations as the third part of a novel fundamental methodology developed for studying ion-exchange chromatography based bioseparations. To overcome computational challenges, a novel simulation approach is devised where appropriate atomistic and coarse grain models are employed simultaneously and the transport of the adsorbate is characterized through a number of locations representative of the progress of the transport process. The adsorbate biomolecule for the system studied in this work changes shape, orientation, and lateral position in order to proceed toward the site where adsorption occurs and exhibits decreased mass transport coefficients as it approaches closer to the immobilized ligand. Furthermore, because the ligands are surrounded by counterions carrying the same type of charge as the adsorbate biomolecule, it takes the biomolecule repeated attempts to approach toward a ligand in order to displace the counterions in the proximity of the ligand and to finally become adsorbed. The formed adsorbate-ligand complex interacts with the counterions and polymeric molecules and is found to evolve slowly and continuously from one-site (monovalent) interaction to multisite (multivalent) interactions. Such a transition of the nature of adsorption reduces the overall adsorption capacity of the ligands in the adsorbent medium and results in a type of surface exclusion effect. Also, the adsorption of the biomolecule also presents certain volume exclusion effects by not only directly reducing the pore volume and the availability of the ligands in the adjacent regions, but also causing the polymeric molecules to change to more compact structures that could further shield certain ligands from being accessible to subsequent adsorbate molecules. These
A reduced-cost iterated local search heuristic for the fixed-charge transportation problem
Buson, Erika; Roberti, Roberto; Toth, Paolo
2014-01-01
The fixed-charge transportation problem (FCTP) is a generalization of the transportation problem where an additional fixed cost is paid for sending a flow from an origin to a destination. We propose an iterated local search heuristic based on the utilization of reduced costs for guiding the restart
Modeling of charge transport in ion bipolar junction transistors.
Volkov, Anton V; Tybrandt, Klas; Berggren, Magnus; Zozoulenko, Igor V
2014-06-17
Spatiotemporal control of the complex chemical microenvironment is of great importance to many fields within life science. One way to facilitate such control is to construct delivery circuits, comprising arrays of dispensing outlets, for ions and charged biomolecules based on ionic transistors. This allows for addressability of ionic signals, which opens up for spatiotemporally controlled delivery in a highly complex manner. One class of ionic transistors, the ion bipolar junction transistors (IBJTs), is especially attractive for these applications because these transistors are functional at physiological conditions and have been employed to modulate the delivery of neurotransmitters to regulate signaling in neuronal cells. Further, the first integrated complementary ionic circuits were recently developed on the basis of these ionic transistors. However, a detailed understanding of the device physics of these transistors is still lacking and hampers further development of components and circuits. Here, we report on the modeling of IBJTs using Poisson's and Nernst-Planck equations and the finite element method. A two-dimensional model of the device is employed that successfully reproduces the main characteristics of the measurement data. On the basis of the detailed concentration and potential profiles provided by the model, the different modes of operation of the transistor are analyzed as well as the transitions between the different modes. The model correctly predicts the measured threshold voltage, which is explained in terms of membrane potentials. All in all, the results provide the basis for a detailed understanding of IBJT operation. This new knowledge is employed to discuss potential improvements of ion bipolar junction transistors in terms of miniaturization and device parameters.
Mei, Yaochuan
2017-08-02
The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials, leading to better design of high-performance materials for consumer applications. Here, we present experimental results that suggest that the inhomogeneous strain induced in organic semiconductor layers by the mismatch between the coefficients of thermal expansion (CTE) of the consecutive device layers of field-effect transistors generates trapping states that localize charge carriers. We observe a universal scaling between the activation energy of the transistors and the interfacial thermal expansion mismatch, in which band-like transport is observed for similar CTEs, and activated transport otherwise. Our results provide evidence that a high-quality semiconductor layer is necessary, but not sufficient, to obtain efficient charge-carrier transport in devices, and underline the importance of holistic device design to achieve the intrinsic performance limits of a given organic semiconductor. We go on to show that insertion of an ultrathin CTE buffer layer mitigates this problem and can help achieve band-like transport on a wide range of substrate platforms.
Mei, Yaochuan; Diemer, Peter J; Niazi, Muhammad R; Hallani, Rawad K; Jarolimek, Karol; Day, Cynthia S; Risko, Chad; Anthony, John E; Amassian, Aram; Jurchescu, Oana D
2017-08-15
The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials, leading to better design of high-performance materials for consumer applications. Here, we present experimental results that suggest that the inhomogeneous strain induced in organic semiconductor layers by the mismatch between the coefficients of thermal expansion (CTE) of the consecutive device layers of field-effect transistors generates trapping states that localize charge carriers. We observe a universal scaling between the activation energy of the transistors and the interfacial thermal expansion mismatch, in which band-like transport is observed for similar CTEs, and activated transport otherwise. Our results provide evidence that a high-quality semiconductor layer is necessary, but not sufficient, to obtain efficient charge-carrier transport in devices, and underline the importance of holistic device design to achieve the intrinsic performance limits of a given organic semiconductor. We go on to show that insertion of an ultrathin CTE buffer layer mitigates this problem and can help achieve band-like transport on a wide range of substrate platforms.
Conformation sensitive charge transport in conjugated polymers
International Nuclear Information System (INIS)
Mattias Andersson, L.; Hedström, Svante; Persson, Petter
2013-01-01
Temperature dependent charge carrier mobility measurements using field effect transistors and density functional theory calculations are combined to show how the conformation dependent frontier orbital delocalization influences the hole- and electron mobilities in a donor-acceptor based polymer. A conformationally sensitive lowest unoccupied molecular orbital results in an electron mobility that decreases with increasing temperature above room temperature, while a conformationally stable highest occupied molecular orbital is consistent with a conventional hole mobility behavior and also proposed to be one of the reasons for why the material works well as a hole transporter in amorphous bulk heterojunction solar cells
International Nuclear Information System (INIS)
Song, Linze; Shi, Qiang
2015-01-01
We present a new non-perturbative method to calculate the charge carrier mobility using the imaginary time path integral approach, which is based on the Kubo formula for the conductivity, and a saddle point approximation to perform the analytic continuation. The new method is first tested using a benchmark calculation from the numerical exact hierarchical equations of motion method. Imaginary time path integral Monte Carlo simulations are then performed to explore the temperature dependence of charge carrier delocalization and mobility in organic molecular crystals (OMCs) within the Holstein and Holstein-Peierls models. The effects of nonlocal electron-phonon interaction on mobility in different charge transport regimes are also investigated
Carmona Benitez, R.B.; Lodewijiks, G.
2010-01-01
A mathematical model to estimate the average airlines operational costs and airports charges per route is important for airlines companies trying to open new routes and for data generation for other purpose such as transport modeling, simulation modeling, investment analyses for airlines and
International Nuclear Information System (INIS)
Cardia, R.; Malloci, G.; Bosin, A.; Serra, G.; Cappellini, G.
2016-01-01
We present a systematic computational study of the effects of perfluorination on the charge-transport properties of three homologous classes of polyaromatic hydrocarbons of interest for molecular electronics: acenes, pyrenes, and circumacenes. By means of Density Functional Theory calculations we first obtained the key molecular properties for transport of both holes and electrons. We then used these parameters in the framework of Marcus theory to compare charge-transfer rates in the high temperatures regime for both unsubstituted and perfluorinated molecules. We additionally estimated the relative charge-mobility of each unsubstituted (perfluorinated) molecule with respect to unsubstituted (perfluorinated) pentacene. We found in all cases that perfluorination reduces the charge-transfer rate in absolute terms. This is largely due to the higher values of the molecular reorganization energies predicted for perfluorinated compounds. Interestingly, however, the charge-transfer rates for both holes and electrons of perfluorinated species are remarkably similar, especially for the larger species. In addition, in the case of the larger circumacenes the charge-mobility values relative to pentacene values are found to increase upon perfluorination.
Energy Technology Data Exchange (ETDEWEB)
Cardia, R. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy); Malloci, G., E-mail: giuliano.malloci@dsf.unica.it [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Bosin, A.; Serra, G. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Cappellini, G., E-mail: giancarlo.cappellini@dsf.unica.it [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy)
2016-10-20
We present a systematic computational study of the effects of perfluorination on the charge-transport properties of three homologous classes of polyaromatic hydrocarbons of interest for molecular electronics: acenes, pyrenes, and circumacenes. By means of Density Functional Theory calculations we first obtained the key molecular properties for transport of both holes and electrons. We then used these parameters in the framework of Marcus theory to compare charge-transfer rates in the high temperatures regime for both unsubstituted and perfluorinated molecules. We additionally estimated the relative charge-mobility of each unsubstituted (perfluorinated) molecule with respect to unsubstituted (perfluorinated) pentacene. We found in all cases that perfluorination reduces the charge-transfer rate in absolute terms. This is largely due to the higher values of the molecular reorganization energies predicted for perfluorinated compounds. Interestingly, however, the charge-transfer rates for both holes and electrons of perfluorinated species are remarkably similar, especially for the larger species. In addition, in the case of the larger circumacenes the charge-mobility values relative to pentacene values are found to increase upon perfluorination.
Charge deposition model for investigating SE-microdose effect in trench power MOSFETs
International Nuclear Information System (INIS)
Wan Xin; Zhou Weisong; Liu Daoguang; Bo Hanliang; Xu Jun
2015-01-01
It was demonstrated that heavy ions can induce large current—voltage (I–V) characteristics shift in commercial trench power MOSFETs, named single event microdose effect (SE-microdose effect). A model is presented to describe this effect. This model calculates the charge deposition by a single heavy ion hitting oxide and the subsequent charge transport under an electric field. Holes deposited at the SiO 2 /Si interface by a Xe ion are calculated by using this model. The calculated results were then used in Sentaurus TCAD software to simulate a trench power MOSFET's I–V curve shift after a Xe ion has hit it. The simulation results are consistent with the related experiment's data. In the end, several factors which affect the SE-microdose effect in trench power MOSFETs are investigated by using this model. (paper)
Charge transport in single photochromic molecular junctions
Kim, Youngsang; Pietsch, T.; Scheer, Elke; Hellmuth, T.; Pauly, F.; Sysoiev, D.; Huhn, T.; Exner, T.; Groth, U.; Steiner, U.; Erbe, A.
2012-02-01
Recently, photoswitchable molecules, i.e. diarylethene, gained significant interest due to their applicability in data storage media, as optical switches, and in novel logic circuits [1]. Diarylethene-derivative molecules are the most promising candidates to design electronic functional elements, because of their excellent thermal stability, high fatigue resistance, and negligible change upon switching [1]. Here, we present the preferential conductance of specifically designed sulfur-free diarylethene molecules [2] bridging the mechanically controlled break-junctions at low temperatures [3]. The molecular energy levels and electrode couplings are obtained by evaluating the current-voltage characteristics using the single-level model [4]. The charge transport mechanism of different types of diarylethene molecules is investigated, and the results are discussed within the framework of novel theoretical predictions. [4pt] [1] M. Del Valle etal., Nat Nanotechnol 2, 176 (2007) S. J. van der Molen etal., Nano. Lett. 9, 76 (2009).[0pt] [2] D. Sysoiev etal., Chem. Eur. J. 17, 6663 (2011).[0pt] [3] Y. Kim etal., Phys. Rev. Lett. 106, 196804 (2011).[0pt] [4] Y. Kim etal., Nano Lett. 11, 3734 (2011). L. Zotti etal., Small 6, 1529 (2010).
Modeling Charge Collection in Detector Arrays
Hardage, Donna (Technical Monitor); Pickel, J. C.
2003-01-01
A detector array charge collection model has been developed for use as an engineering tool to aid in the design of optical sensor missions for operation in the space radiation environment. This model is an enhancement of the prototype array charge collection model that was developed for the Next Generation Space Telescope (NGST) program. The primary enhancements were accounting for drift-assisted diffusion by Monte Carlo modeling techniques and implementing the modeling approaches in a windows-based code. The modeling is concerned with integrated charge collection within discrete pixels in the focal plane array (FPA), with high fidelity spatial resolution. It is applicable to all detector geometries including monolithc charge coupled devices (CCDs), Active Pixel Sensors (APS) and hybrid FPA geometries based on a detector array bump-bonded to a readout integrated circuit (ROIC).
Study of charge transport in silicon detectors: Non-irradiated and irradiated
International Nuclear Information System (INIS)
Leroy, C.; Roy, P.; Casse, G.; Glaser, M.; Grigoriev, E.; Lemeilleur, F.
1999-01-01
The electrical characteristics of silicon detectors (standard planar float zone and MESA detectors) as a function of the particle fluence can be extracted by the application of a model describing the transport of charge carriers generated in the detectors by ionizing particles. The current pulse response induced by α and β particles in non-irradiated detectors and detectors irradiated up to fluences PHI ∼ 3 · 10 14 particles/cm 2 is reproduced via this model: i) by adding a small n-type region 15 μm deep on the p + side for the detectors at fluences beyond the n to p-type inversion and ii) for the MESA detectors, by considering one additional dead layer of 14 μm (observed experimentally) on each side of the detector, and introducing a second (delayed) component to the current pulse response. For both types of detectors, the model gives mobilities decreasing linearily up to fluences of about 5·10 13 particles/cm 2 and converging, beyond, to saturation values of about 1050 cm 2 /Vs and 450 cm 2 /Vs for electrons and holes, respectively. At a fluence PHI ∼ 10 14 particles/cm 2 (corresponding to about ten years of operation at the CERN-LHC), charge collection deficits of about 14% for β particles, 25% for α particles incident on the front and 35% for α particles incident on the back of the detector are found for both type of detectors
DEFF Research Database (Denmark)
Donley, C.L.; Zaumseil, J.; Andreasen, Jens Wenzel
2005-01-01
on the optoelectronic and charge transport properties of these films. A model based on quantum chemical calculations, wide-angle X-ray scattering, atomic force microscopy, Raman spectroscopy, photoluminescence, and electron mobility measurements was developed to describe the restructuring of the polymer film...
Energy Technology Data Exchange (ETDEWEB)
Teyssedre, G., E-mail: gilbert.teyssedre@laplace.univ-tlse.fr; Laurent, C. [Université de Toulouse, UPS, INPT, LAPLACE (Laboratoire Plasma et Conversion d' Energie), 118 route de Narbonne, F-31062 Toulouse cedex 9 (France); CNRS, LAPLACE, F-31062 Toulouse (France); Vu, T. T. N. [Université de Toulouse, UPS, INPT, LAPLACE (Laboratoire Plasma et Conversion d' Energie), 118 route de Narbonne, F-31062 Toulouse cedex 9 (France); Electric Power University, 235 Hoang Quoc Viet, 10000 Hanoi (Viet Nam)
2015-12-21
Among features observed in polyethylene materials under relatively high field, space charge packets, consisting in a pulse of net charge that remains in the form of a pulse as it crosses the insulation, are repeatedly observed but without complete theory explaining their formation and propagation. Positive charge packets are more often reported, and the models based on negative differential mobility(NDM) for the transport of holes could account for some charge packets phenomenology. Conversely, NDM for electrons transport has never been reported so far. The present contribution reports space charge measurements by pulsed electroacoustic method on miniature cables that are model of HVDC cables. The measurements were realized at room temperature or with a temperature gradient of 10 °C through the insulation under DC fields on the order 30–60 kV/mm. Space charge results reveal systematic occurrence of a negative front of charges generated at the inner electrode that moves toward the outer electrode at the beginning of the polarization step. It is observed that the transit time of the front of negative charge increases, and therefore the mobility decreases, with the applied voltage. Further, the estimated mobility, in the range 10{sup −14}–10{sup −13} m{sup 2} V{sup −1} s{sup −1} for the present results, increases when the temperature increases for the same condition of applied voltage. The features substantiate the hypothesis of negative differential mobility used for modelling space charge packets.
Energy Technology Data Exchange (ETDEWEB)
Rozhkov, A.V., E-mail: arozhkov@gmail.co [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Institute for Theoretical and Applied Electrodynamics, Russian Academy of Sciences, 125412, Moscow (Russian Federation); Giavaras, G. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Bliokh, Yury P. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Technion-Israel Institute of Technology, Haifa 32000 (Israel); Freilikher, Valentin [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Bar-Ilan University, Ramat-Gan 52900 (Israel); Nori, Franco [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, University of Michigan, Ann Arbor, MI 48109-1040 (United States)
2011-06-15
This brief review discusses electronic properties of mesoscopic graphene-based structures. These allow controlling the confinement and transport of charge and spin; thus, they are of interest not only for fundamental research, but also for applications. The graphene-related topics covered here are: edges, nanoribbons, quantum dots, pn-junctions, pnp-structures, and quantum barriers and waveguides. This review is partly intended as a short introduction to graphene mesoscopics.
International Nuclear Information System (INIS)
Tang Aiwei; Teng Feng; Liu Jie; Wang Yichao; Peng Hongshang; Hou Yanbing; Wang Yongsheng
2011-01-01
In this study, electrically bistable devices were fabricated by incorporating cuprous sulfide (Cu 2 S) nanospheres with mean size less than 10 nm into a poly(N-vinylcarbazole) (PVK) matrix. A remarkable electrical bistability was clearly observed in the current–voltage curves of the devices due to an electric-field-induced charge transfer between the dodecanethiol-capped Cu 2 S nanospheres and PVK. The maximum ON/OFF current ratio reached up to value as large as 10 4 , which was dependent on the mass ratios of Cu 2 S nanospheres to PVK, the amplitude of the scanning voltages, and the film thickness. The charge-transport mechanisms of the electrically bistable devices were described on the basis of the experimental results using different theoretical models of organic electronics.
Charge transport in poly(p-phenylene vinylene) at low temperature and high electric field
Katsouras, I.; Najafi, A.; Asadi, K.; Kronemeijer, A. J.; Oostra, A. J.; Koster, L. J. A.; de Leeuw, D. M.; Blom, P. W. M.
Charge transport in poly(2-methoxy, 5-(2'-ethyl-hexyloxy)-p-phenylene vinylene) (MEH-PPV)-based hole-only diodes is investigated at high electric fields and low temperatures using a novel diode architecture. Charge carrier densities that are in the range of those in a field-effect transistor are
Space charge compensation on the low energy beam transport of Linac4
AUTHOR|(SzGeCERN)733270; Scrivens, Richard; Jesus Castillo, Santos
Part of the upgrade program in the injector chains of the CERN accelerator complex is the replacement of the the proton accelerator Linac2 for the brand new Linac4 which will accelerate H$^-$ and its main goal is to increase the beam intensity in the next sections of the LHC accelerator chain. The Linac4 is now under commissioning and will use several ion sources to produce high intensity unbunched H$^-$ beams with different properties, and the low energy beam transport (LEBT) is the system in charge of match all these different beams to the Radio frequency quadrupole (RFQ). The space charge forces that spread the beam ions apart of each other and cause emittance growth limits the maximum intensity that can be transported in the LEBT, but the space charge of intense unbunched ion beams can be compensated by the generated ions by the impact ionization of the residual gas, which creates a source of secondary particles inside the beam pipe. For negative ion beams, the effect of the beam electric field is to ex...
Synthesis, characterization and charge transport mechanism of CdZnO nanorods
International Nuclear Information System (INIS)
Mahmoud, Waleed E.; Al-Ghamdi, A.A.; El-Tantawy, F.; Al-Heniti, S.
2009-01-01
ZnO and Cd-doped ZnO nanostructures were prepared by new facile method at 80 deg. C. XRD measurement indicated that both samples had typical hexagonal wurtzite structures. Transmission electron microscopy (TEM) measurement shows that rod-like crystals have been formed. EDX measurement confirms the incorporation of the cadmium ion into the crystalline lattice of ZnO and indicated that cadmium ions uniformly distributed on the surface of the rods. The doping with cadmium ions has a great influence on the optical properties of the ZnO. The electrical measurements of Cd-doped ZnO nanorod were measured. The current-voltage (I-V) characteristic curve revealed that the charge transport above 4 V is mainly non-linear due to grain boundary contribution. The complex impedance spectroscopy was confirmed that the grain boundary effect controls the charge transport mechanism through CdZnO ceramic material.
Charge and Spin Transport in Dilute Magnetic Semiconductors. Final report
International Nuclear Information System (INIS)
Ullrich, Carsten A.
2009-01-01
This proposal to the DOE outlines a three-year plan of research in theoretical and computational condensed-matter physics, with the aim of developing a microscopic theory for charge and spin dynamics in disordered materials with magnetic impurities. Important representatives of this class of materials are the dilute magnetic semiconductors (DMS), which have attracted great attention as a promising basis for spintronics devices. There is an intense experimental effort underway to study the transport properties of ferromagnetic DMS such as (Ga,Mn)As, and a number of interesting features have emerged: negative magnetoresistance, anomalous Hall effect, non-Drude dynamical conductivity, and resistivity maxima at the Curie temperature. Available theories have been able to account for some of these features, but at present we are still far away from a systematic microscopic understanding of transport in DMS. We propose to address this challenge by developing a theory of charge and spin dynamics based on a combination of the memory-function formalism and time-dependent density functional theory. This approach will be capable of dealing with two important issues: (a) the strong degree of correlated disorder in DMS, close to the localization transition (which invalidates the usual relaxation-time approximation to the Boltzmann equation), (b) the essentially unknown role of dynamical many-body effects such as spin Coulomb drag. We will calculate static and dynamical conductivities in DMS as functions of magnetic order and carrier density, which will advance our understanding of recent transport and infrared absorption measurements. Furthermore, we will study collective plasmon excitations in DMS (3D, 2D and quantum wells), whose linewidths could constitute a new experimental probe of the correlation of disorder, many-body effects and charge and spin dynamics in these materials.
Blue Light Emitting Polyphenylene Dendrimers with Bipolar Charge Transport Moieties
Directory of Open Access Journals (Sweden)
Guang Zhang
2016-10-01
Full Text Available Two light-emitting polyphenylene dendrimers with both hole and electron transporting moieties were synthesized and characterized. Both molecules exhibited pure blue emission solely from the pyrene core and efficient surface-to-core energy transfers when characterized in a nonpolar environment. In particular, the carbazole- and oxadiazole-functionalized dendrimer (D1 manifested a pure blue emission from the pyrene core without showing intramolecular charge transfer (ICT in environments with increasing polarity. On the other hand, the triphenylamine- and oxadiazole-functionalized one (D2 displayed notable ICT with dual emission from both the core and an ICT state in highly polar solvents. D1, in a three-layer organic light emitting diode (OLED by solution processing gave a pure blue emission with Commission Internationale de l’Éclairage 1931 CIE xy = (0.16, 0.12, a peak current efficiency of 0.21 cd/A and a peak luminance of 2700 cd/m2. This represents the first reported pure blue dendrimer emitter with bipolar charge transport and surface-to-core energy transfer in OLEDs.
Blue Light Emitting Polyphenylene Dendrimers with Bipolar Charge Transport Moieties.
Zhang, Guang; Auer-Berger, Manuel; Gehrig, Dominik W; Blom, Paul W M; Baumgarten, Martin; Schollmeyer, Dieter; List-Kratochvil, E J W; Müllen, Klaus
2016-10-20
Two light-emitting polyphenylene dendrimers with both hole and electron transporting moieties were synthesized and characterized. Both molecules exhibited pure blue emission solely from the pyrene core and efficient surface-to-core energy transfers when characterized in a nonpolar environment. In particular, the carbazole- and oxadiazole-functionalized dendrimer ( D1 ) manifested a pure blue emission from the pyrene core without showing intramolecular charge transfer (ICT) in environments with increasing polarity. On the other hand, the triphenylamine- and oxadiazole-functionalized one ( D2 ) displayed notable ICT with dual emission from both the core and an ICT state in highly polar solvents. D1 , in a three-layer organic light emitting diode (OLED) by solution processing gave a pure blue emission with Commission Internationale de l'Éclairage 1931 CIE xy = (0.16, 0.12), a peak current efficiency of 0.21 cd/A and a peak luminance of 2700 cd/m². This represents the first reported pure blue dendrimer emitter with bipolar charge transport and surface-to-core energy transfer in OLEDs.
Charge transport in micas: The kinetics of FeII/III electron transfer in the octahedral sheet
International Nuclear Information System (INIS)
Rosso, Kevin M.; Ilton, Eugene S.
2003-01-01
The two principal FeII/III electron exchange reactions underlying charge transport in the octahedral sheet of ideal end-member annite were modeled using a combination of ab initio calculations and Marcus electron transfer theory. A small polaron model was applied which yielded electron hopping activation energies that agree well with the limited available experimental data. A small ab initio cluster model successfully reproduced several important structural, energetic, and magnetic characteristics of the M1 and M2 Fe sites in the annite octahedral sheet. The cluster enabled calculation of the internal reorganization energy and electronic coupling matrix elements for the M2-M2 and M1-M2 electron transfer reactions. The M2-M2 electron transfer is symmetric with a predicted forward/reverse electron hopping rate of 106 s-1. The M1-M2 electron transfers are asymmetric due to the higher ionization potential by 0.46 eV of FeII in the M1 site. The electronic coupling matrix elements for these reactions are predicted to be small and of similar magnitude, suggesting the possibility that the coupling is essentially direction independent amongst hopping directions in the octahedral sheet. M1 Fe sites are predicted to be efficient electron traps and charge transport should occur by nearest-neighbor electron hops along the M2 Fe sublattice
Dharmapurikar, Satej S.; Chithiravel, Sundaresan; Mane, Manoj V.; Deshmukh, Gunvant; Krishnamoorthy, Kothandam
2018-03-01
Diketopyrrolopyrrole (DPP) and i-Indigo (i-Ind) are two monomers that are widely explored as active materials in organic field effect transistor and solar cells. These two molecules showed impressive charge carrier mobility due to better packing that are facilitated by quadrupoles. We hypothesized that the copolymers of these monomers would also exhibit high charge carrier mobility. However, we envisioned that the dihedral angle at the connecting point between the monomers will play a crucial role in packing as well as charge transport. To understand the impact of dihedral angle on charge transport, we synthesized three copolymers, wherein the DPP was sandwiched between benzenes, thiophenes and furans. The copolymer of i-Indigo and furan comprising DPP showed a band gap of 1.4 eV with a very high dihedral angle of 179°. The polymer was found to pack better and the coherence length was found to be 112 Å. The hole carrier mobility of these polymer was found to be highest among the synthesized polymer i.e. 0.01 cm2/vs. The copolymer comprising benzene did not transport hole and electrons. The dihedral angle at the connecting point between i and Indigo and benzene DPP was 143 Å, which the packing and consequently charge transport properties.
Verma, Upendra Kumar; Kumar, Brijesh
2017-10-01
We have modeled a multilayer quantum dot organic solar cell that explores the current-voltage characteristic of the solar cell whose characteristics can be tuned by varying the fabrication parameters of the quantum dots (QDs). The modeled device consists of a hole transport layer (HTL) which doubles up as photon absorbing layer, several quantum dot layers, and an electron transport layer (ETL). The conduction of charge carriers in HTL and ETL has been modeled by the drift-diffusion transport mechanism. The conduction and recombination in the quantum dot layers are described by a system of coupled rate equations incorporating tunneling and bimolecular recombination. Analysis of QD-solar cells shows improved device performance compared to the similar bilayer and trilayer device structures without QDs. Keeping other design parameters constant, solar cell characteristics can be controlled by the quantum dot layers. Bimolecular recombination coefficient of quantum dots is a prime factor which controls the open circuit voltage (VOC) without any significant reduction in short circuit current (JSC).
McClarty, P. A.; O'Brien, A.; Pollmann, F.
2014-05-01
We consider a classical model of charges ±q on a pyrochlore lattice in the presence of long-range Coulomb interactions. This model first appeared in the early literature on charge order in magnetite [P. W. Anderson, Phys. Rev. 102, 1008 (1956), 10.1103/PhysRev.102.1008]. In the limit where the interactions become short ranged, the model has a ground state with an extensive entropy and dipolar charge-charge correlations. When long-range interactions are introduced, the exact degeneracy is broken. We study the thermodynamics of the model and show the presence of a correlated charge liquid within a temperature window in which the physics is well described as a liquid of screened charged defects. The structure factor in this phase, which has smeared pinch points at the reciprocal lattice points, may be used to detect charge ice experimentally. In addition, the model exhibits fractionally charged excitations ±q/2 which are shown to interact via a 1/r potential. At lower temperatures, the model exhibits a transition to a long-range ordered phase. We are able to treat the Coulombic charge ice model and the dipolar spin ice model on an equal footing by mapping both to a constrained charge model on the diamond lattice. We find that states of the two ice models are related by a staggering field which is reflected in the energetics of these two models. From this perspective, we can understand the origin of the spin ice and charge ice ground states as coming from a dipolar model on a diamond lattice. We study the properties of charge ice in an external electric field, finding that the correlated liquid is robust to the presence of a field in contrast to the case of spin ice in a magnetic field. Finally, we comment on the transport properties of Coulombic charge ice in the correlated liquid phase.
Directory of Open Access Journals (Sweden)
Ahmad Irfan
2016-11-01
Full Text Available Imidazolidin derivatives gained significant attention in our daily life from better biological activity to the semiconducting materials. The present investigation deals with the in depth study of (Z-2-sulfanylidene-5-(thiophen-2-ylmethylideneimidazolidin-4-one (STMI with respect to their structural, electronic, optical and charge transport properties as semiconducting material. The ground and first excited state geometries were optimized by applying density functional theory (DFT and time dependent DFT, respectively. The light has been shed on the frontier molecular orbitals (FMOs and observed comprehensible intramolecular charge transfer (ICT from the highest occupied molecular orbitals (HOMOs to the lowest unoccupied molecular orbitals (LUMOs. The absorption, emission, ionization potentials (IP, electron affinities (EA, total and partial densities of states and structure-property relationship have been discussed. Finally, hole as well as electron reorganization energies, transfer integrals and intrinsic mobilities have been calculated then charge transport behavior of STMI was discussed, intensively.
Charge transport through molecular switches
International Nuclear Information System (INIS)
Jan van der Molen, Sense; Liljeroth, Peter
2010-01-01
We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)
Charge transport through molecular switches
Energy Technology Data Exchange (ETDEWEB)
Jan van der Molen, Sense [Kamerlingh Onnes Laboratorium, Leiden University, Niels Bohrweg 2, 2333 CA Leiden (Netherlands); Liljeroth, Peter, E-mail: molen@physics.leidenuniv.n [Condensed Matter and Interfaces, Debye Institute for Nanomaterials Science, University of Utrecht, PO Box 80000, 3508 TA Utrecht (Netherlands)
2010-04-07
We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)
Shi, Jiangjian; Li, Dongmei; Luo, Yanhong; Wu, Huijue; Meng, Qingbo
2016-12-01
An opto-electro-modulated transient photovoltage/photocurrent system has been developed to probe microscopic charge processes of a solar cell in its adjustable operating conditions. The reliability of this system is carefully determined by electric circuit simulations and experimental measurements. Using this system, the charge transport, recombination and storage properties of a conventional multicrystalline silicon solar cell under different steady-state bias voltages, and light illumination intensities are investigated. This system has also been applied to study the influence of the hole transport material layer on charge extraction and the microscopic charge processes behind the widely considered photoelectric hysteresis in perovskite solar cells.
International Nuclear Information System (INIS)
Astakhov, Oleksandr; Carius, Reinhard; Finger, Friedhelm; Petrusenko, Yuri; Borysenko, Valery; Barankov, Dmytro
2009-01-01
The influence of dangling-bond defects and the position of the Fermi level on the charge carrier transport properties in undoped and phosphorous doped thin-film silicon with structure compositions all the way from highly crystalline to amorphous is investigated. The dangling-bond density is varied reproducibly over several orders of magnitude by electron bombardment and subsequent annealing. The defects are investigated by electron-spin-resonance and photoconductivity spectroscopies. Comparing intrinsic amorphous and microcrystalline silicon, it is found that the relationship between defect density and photoconductivity is different in both undoped materials, while a similar strong influence of the position of the Fermi level on photoconductivity via the charge carrier lifetime is found in the doped materials. The latter allows a quantitative determination of the value of the transport gap energy in microcrystalline silicon. The photoconductivity in intrinsic microcrystalline silicon is, on one hand, considerably less affected by the bombardment but, on the other hand, does not generally recover with annealing of the defects and is independent from the spin density which itself can be annealed back to the as-deposited level. For amorphous silicon and material prepared close to the crystalline growth regime, the results for nonequilibrium transport fit perfectly to a recombination model based on direct capture into neutral dangling bonds over a wide range of defect densities. For the heterogeneous microcrystalline silicon, this model fails completely. The application of photoconductivity spectroscopy in the constant photocurrent mode (CPM) is explored for the entire structure composition range over a wide variation in defect densities. For amorphous silicon previously reported linear correlation between the spin density and the subgap absorption is confirmed for defect densities below 10 18 cm -3 . Beyond this defect level, a sublinear relation is found i.e., not
Ateshian, Gerard A; Nims, Robert J; Maas, Steve; Weiss, Jeffrey A
2014-10-01
Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio ( www.febio.org ). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the
Thickness dependent charge transport in ferroelectric BaTiO3 heterojunctions
Singh, Pooja; Rout, P. K.; Singh, Manju; Rakshit, R. K.; Dogra, Anjana
2015-09-01
We have investigated the effect of ferroelectric barium titanate (BaTiO3) film thickness on the charge transport mechanism in pulsed laser deposited epitaxial metal-ferroelectric semiconductor junctions. The current (I)-voltage (V) measurements across the junctions comprising of 20-500 nm thick BaTiO3 and conducting bottom electrode (Nb: SrTiO3 substrate or La2/3Ca1/3MnO3 buffer layer) demonstrate the space charge limited conduction. Further analysis indicates a reduction in the ratio of free to trapped carriers with increasing thickness in spite of decreasing trap density. Such behaviour arises the deepening of the shallow trap levels (I-V curves implies a bipolar resistive switching behaviour, which can be explained in terms of charge trapping and de-trapping process.
Stochastic approach and fluctuation theorem for charge transport in diodes
Gu, Jiayin; Gaspard, Pierre
2018-05-01
A stochastic approach for charge transport in diodes is developed in consistency with the laws of electricity, thermodynamics, and microreversibility. In this approach, the electron and hole densities are ruled by diffusion-reaction stochastic partial differential equations and the electric field generated by the charges is determined with the Poisson equation. These equations are discretized in space for the numerical simulations of the mean density profiles, the mean electric potential, and the current-voltage characteristics. Moreover, the full counting statistics of the carrier current and the measured total current including the contribution of the displacement current are investigated. On the basis of local detailed balance, the fluctuation theorem is shown to hold for both currents.
International Nuclear Information System (INIS)
Kotiluoto, P.
2007-05-01
A new deterministic three-dimensional neutral and charged particle transport code, MultiTrans, has been developed. In the novel approach, the adaptive tree multigrid technique is used in conjunction with simplified spherical harmonics approximation of the Boltzmann transport equation. The development of the new radiation transport code started in the framework of the Finnish boron neutron capture therapy (BNCT) project. Since the application of the MultiTrans code to BNCT dose planning problems, the testing and development of the MultiTrans code has continued in conventional radiotherapy and reactor physics applications. In this thesis, an overview of different numerical radiation transport methods is first given. Special features of the simplified spherical harmonics method and the adaptive tree multigrid technique are then reviewed. The usefulness of the new MultiTrans code has been indicated by verifying and validating the code performance for different types of neutral and charged particle transport problems, reported in separate publications. (orig.)
Mass and charge transport in micro and nanofluidic channels
DEFF Research Database (Denmark)
Mortensen, Niels Asger; Olesen, Laurits Højgaard; Okkels, Fridolin
2007-01-01
and charge transport coefficients that satisfy Onsager relations. In the limit of nonoverlapping Debye layers the transport coefficients are simply expressed in terms of parameters of the electrolyte as well as the hydraulic radiusR ¼ 2A=P with Aand P being the cross-sectional area and perimeter......, respectively. In particular, we consider the limits of thin nonoverlapping as well as strongly overlapping Debye layers, respectively, and calculate the corrections to the hydraulic resistance due to electrohydrodynamic interactions.......We consider laminar flow of incompressible electrolytes in long, straight channels driven by pressure and electroosmosis. We use aHilbert space eigenfunction expansion to address the general problem of an arbitrary cross section and obtain general results in linear-response theory for the mass...
Charge transport kinetics in a robust radical-substituted polymer/nanocarbon composite electrode
Sato, Kan; Oyaizu, Kenichi; Nishide, Hiroyuki
We have reported a series of organic radical-substituted polymers as new-type charge storage and transport materials which could be used for energy related devices such as batteries and solar cells. Redox-active radical moieties introduced to the non-conjugated polymer backbones enable the rapid electron transfer among the adjacent radical sites, and thus large diffusive flux of electrical charge at a bulk scale. Here we present the elucidated charge transport kinetics in a radical polymer/single-walled carbon nanotube (SWNT) composite electrode. The synergetic effect of electrical conduction by a three-dimensional SWNT network and electron self-exchange reaction by radical polymers contributed to the 105-fold (per 1 g of added SWNT) boosting of electrochemical reactions and exceptionally large current density (greater than 1 A/cm2) as a rechargeable electrode. A totally organic-based secondary battery with a submicron thickness was fabricated to demonstrate the splendid electrochemical performances. Grants-in-Aid for Scientific Research (No. 24225003, 15J00888) and the Leading Graduate Program in Science and Engineering, from the Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT).
Yimer, Y.Y.; Bobbert, P.A.; Coehoorn, R.
2008-01-01
We investigate charge transport in disordered organic host–guest systems with a bimodal Gaussian density of states (DOS). The energy difference between the two Gaussians defines the trap depth. By solving the Pauli master equation for the hopping of charge carriers on a regular lattice with site
Energy Technology Data Exchange (ETDEWEB)
Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)
2016-04-19
By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.
International Nuclear Information System (INIS)
Guo, Yuandong; Lin, Guiping; He, Jiang; Bai, Lizhan; Zhang, Hongxing; Miao, Jianyin
2017-01-01
Highlights: • A neon-charged CLHP integrated with a G-M cryocooler was designed and investigated. • The CLHP can realize the supercritical startup with an auxiliary heat load of 1.5 W. • Maximum heat transport capability of the CLHP was 4.5 W over a distance of 0.6 m. • There existed an optimum auxiliary heat load to expedite the supercritical startup. • There existed an optimum charged pressure to reach the largest heat transfer limit. - Abstract: Neon-charged cryogenic loop heat pipe (CLHP) can realize efficient cryogenic heat transport in the temperature range of 30–40 K, and promises great application potential in the thermal control of future space infrared exploration system. In this work, extensive experimental studies on the supercritical startup and heat transport capability of a neon-charged CLHP integrated with a G-M cryocooler were carried out, where the effects of the auxiliary heat load applied to the secondary evaporator and charged pressure of the working fluid were investigated. Experimental results showed that the CLHP could successfully realize the supercritical startup with an auxiliary heat load of 1.5 W, and there existed an optimum auxiliary heat load and charged pressure of the working fluid respectively, to achieve the maximum temperature drop rate of the primary evaporator during the supercritical startup. The CLHP could reach a maximum heat transport capability of 4.5 W over a distance of 0.6 m corresponding to the optimum charged pressure of the working fluid; however, the heat transport capability decreased with the increase of the auxiliary heat load. Furthermore, the inherent mechanisms responsible for the phenomena observed in the experiments were analyzed and discussed, to provide a better understanding from the theoretical view.
Symmetry properties of the transport coefficients of charged particles in disordered materials
International Nuclear Information System (INIS)
Baird, J.K.
1979-01-01
The transport coefficients of a charged particle in an isotropic material are shown to be even functions of the applied electric field. We discuss the limitation which this result and its consequences place upon formulae used to represent these coefficients
Pouran, Behdad; Arbabi, Vahid; Zadpoor, Amir A; Weinans, Harrie
2016-12-01
The metabolic function of cartilage primarily depends on transport of solutes through diffusion mechanism. In the current study, we use contrast enhanced micro-computed tomography to determine equilibrium concentration of solutes through different cartilage zones and solute flux in the cartilage, using osteochondral plugs from equine femoral condyles. Diffusion experiments were performed with two solutes of different charge and approximately equal molecular weight, namely iodixanol (neutral) and ioxaglate (charge=-1) in order to isolate the effects of solute's charge on diffusion. Furthermore, solute concentrations as well as bath osmolality were changed to isolate the effects of steric hindrance on diffusion. Bath concentration and bath osmolality only had minor effects on the diffusion of the neutral solute through cartilage at the surface, middle and deep zones, indicating that the diffusion of the neutral solute was mainly Fickian. The negatively charged solute diffused considerably slower through cartilage than the neutral solute, indicating a large non-Fickian contribution in the diffusion of charged molecules. The numerical models determined maximum solute flux in the superficial zone up to a factor of 2.5 lower for the negatively charged solutes (charge=-1) as compared to the neutral solutes confirming the importance of charge-matrix interaction in diffusion of molecules across cartilage. Copyright © 2016 IPEM. Published by Elsevier Ltd. All rights reserved.
Yimer, Y.Y.; Bobbert, P.A.; Coehoorn, R.
2009-01-01
We investigate charge transport in disordered organic host–guest systems with a bimodal Gaussian density of states. The energy difference between the peaks of the two Gaussians defines the trap depth. By solving the Pauli master equation for the hopping of charge carriers on a regular lattice we
Hutchison, Geoffrey Rogers
Theoretical studies on a variety of oligo- and polyheterocycles elucidate their optical and charge transport properties, suggesting new, improved transparent conductive polymers. First-principles calculations provide accurate methodologies for predicting both optical band gaps of neutral and cationic oligomers and intrinsic charge transfer rates. Multidimensional analysis reveals important motifs in chemical tailorability of oligoheterocycle optical and charge transport properties. The results suggest new directions for design of novel materials. Using both finite oligomer and infinite polymer calculations, the optical band gaps in polyheterocycles follow a modified particle-in-a-box formalism, scaling approximately as 1/N (where N is the number of monomer units) in short chains, saturating for long chains. Calculations demonstrate that band structure changes upon heteroatom substitution, (e.g., from polythiophene to polypyrrole) derive from heteroatom electron affinity. Further investigation of chemical variability in substituted oligoheterocycles using multidimensional statistics reveals the interplay between heteroatom and substituent in correlations between structure and redox/optical properties of neutral and cationic species. A linear correlation between band gaps of neutral and cationic species upon oxidation of conjugated oligomers, shows redshifts of optical absorption for most species and blueshifts for small band gap species. Interstrand charge-transport studies focus on two contributors to hopping-style charge transfer rates: internal reorganization energy and the electronic coupling matrix element. Statistical analysis of chemical variability of reorganization energies in oligoheterocycles proves the importance of reorganization energy in determining intrinsic charge transfer rates (e.g., charge mobility in unsubstituted oligothiophenes). Computed bandwidths across several oligothiophene crystal packing motifs show similar electron and hole bandwidths
Application of an entry-exit tariff model to the gas transport system in Spain
International Nuclear Information System (INIS)
Alonso, Alejandro; Serrano, Miguel; Olmos, Luis
2010-01-01
Under an entry-exit gas tariff system, reservation of capacity is split into entry capacity, to transport gas from the injection points to a virtual balancing point, and exit capacity, to transport gas from the balancing point to the exit points in the system. Entry-exit tariff for gas transport systems have been recommended by the 3rd EU Energy Package, since they are cost reflective, facilitate gas trade and can provide signals for the location of gas injections or off-takes. The advisability of applying an entry-exit tariff system is discussed in this paper. Apart from this, authors propose an entry-exit tariff model and apply it to compute charges for the Spanish gas transport system in 2009. Results produced by the model are presented as coefficients which should multiply the current postal transport tariff. The paper concludes that entry-exit tariffs would be useful location signals which would result in a better use of the gas transport system in Spain. In those cases where demand exceeds available capacity, as it occurs at the congested connection with France, entry-exit tariffs could be supplemented by capacity charges at entry points resulting from auctions. (author)
Himmelberger, Scott
2012-11-23
The film thickness of one of the most crystalline and highest performing polymer semiconductors, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b] thiophene) (PBTTT), is varied in order to determine the effects of interfaces and confinement on the microstructure and performance in organic field effect transistors (OFETs). Crystalline texture and overall film crystallinity are found to depend strongly on film thickness and thermal processing. The angular distribution of crystallites narrows upon both a decrease in film thickness and thermal annealing. These changes in the film microstructure are paired with thin-film transistor characterization and shown to be directly correlated with variations in charge carrier mobility. Charge transport is shown to be governed by film crystallinity in films below 20 nm and by crystalline orientation for thicker films. An optimal thickness is found for PBTTT at which the mobility is maximized in unannealed films and where mobility reaches a plateau at its highest value for annealed films. The effects of confinement on the morphology and charge transport properties of poly(2,5-bis(3-tetradecylthiophen-2-yl) thieno[3,2-b]thiophene) (PBTTT) are studied using quantitative X-ray diffraction and field-effect transistor measurements. Polymer crystallinity is found to limit charge transport in the thinnest films while crystalline texture and intergrain connectivity modulate carrier mobility in thicker films. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Himmelberger, Scott; Dacuñ a, Javier; Rivnay, Jonathan; Jimison, Leslie H.; McCarthy-Ward, Thomas; Heeney, Martin; McCulloch, Iain; Toney, Michael F.; Salleo, Alberto
2012-01-01
The film thickness of one of the most crystalline and highest performing polymer semiconductors, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b] thiophene) (PBTTT), is varied in order to determine the effects of interfaces and confinement on the microstructure and performance in organic field effect transistors (OFETs). Crystalline texture and overall film crystallinity are found to depend strongly on film thickness and thermal processing. The angular distribution of crystallites narrows upon both a decrease in film thickness and thermal annealing. These changes in the film microstructure are paired with thin-film transistor characterization and shown to be directly correlated with variations in charge carrier mobility. Charge transport is shown to be governed by film crystallinity in films below 20 nm and by crystalline orientation for thicker films. An optimal thickness is found for PBTTT at which the mobility is maximized in unannealed films and where mobility reaches a plateau at its highest value for annealed films. The effects of confinement on the morphology and charge transport properties of poly(2,5-bis(3-tetradecylthiophen-2-yl) thieno[3,2-b]thiophene) (PBTTT) are studied using quantitative X-ray diffraction and field-effect transistor measurements. Polymer crystallinity is found to limit charge transport in the thinnest films while crystalline texture and intergrain connectivity modulate carrier mobility in thicker films. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mei, Yaochuan; Diemer, Peter J.; Niazi, Muhammad Rizwan; Hallani, Rawad K.; Jarolimek, Karol; Day, Cynthia S.; Risko, Chad; Anthony, John E.; Amassian, Aram; Jurchescu, Oana D.
2017-01-01
The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials
Design study of low-energy beam transport for multi-charge beams at RAON
Bahng, Jungbae; Qiang, Ji; Kim, Eun-San
2015-12-01
The Rare isotope Accelerator Of Newness (RAON) at the Rare Isotope Science Project (RISP) is being designed to simultaneously accelerate beams with multiple charge states. It includes a driver superconducting (SC) linac for producing 200 MeV/u and 400 kW continuous wave (CW) heavy ion beams from protons to uranium. The RAON consists of a few electron cyclotron resonance ion sources, a low-energy beam transport (LEBT) system, a CW 81.25 MHz, 500 keV/u radio frequency quadrupole (RFQ) accelerator, a medium-energy beam transport system, the SC linac, and a charge-stripper system. The LEBT system for the RISP accelerator facility consists of a high-voltage platform, two 90° dipoles, a multi-harmonic buncher (MHB), solenoids, electrostatic quadrupoles, a velocity equalizer, and a diagnostic system. The ECR ion sources are located on a high-voltage platform to reach an initial beam energy of 10 keV/u. After extraction, the ion beam is transported through the LEBT system to the RFQ accelerator. The generated charge states are selected by an achromatic bending system and then bunched by the MHB in the LEBT system. The MHB is used to achieve a small longitudinal emittance in the RFQ by generating a sawtooth wave with three harmonics. In this paper, we present the results and issues of the beam dynamics of the LEBT system.
Design study of low-energy beam transport for multi-charge beams at RAON
Energy Technology Data Exchange (ETDEWEB)
Bahng, Jungbae [Department of Physics, Kyungpook National University, Daegu 41566 (Korea, Republic of); Qiang, Ji [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Kim, Eun-San, E-mail: eskim1@korea.ac.kr [Department of Accelerator Science, Graduate School, Korea University Sejong Campus, Sejong 30019 (Korea, Republic of)
2015-12-21
The Rare isotope Accelerator Of Newness (RAON) at the Rare Isotope Science Project (RISP) is being designed to simultaneously accelerate beams with multiple charge states. It includes a driver superconducting (SC) linac for producing 200 MeV/u and 400 kW continuous wave (CW) heavy ion beams from protons to uranium. The RAON consists of a few electron cyclotron resonance ion sources, a low-energy beam transport (LEBT) system, a CW 81.25 MHz, 500 keV/u radio frequency quadrupole (RFQ) accelerator, a medium-energy beam transport system, the SC linac, and a charge-stripper system. The LEBT system for the RISP accelerator facility consists of a high-voltage platform, two 90° dipoles, a multi-harmonic buncher (MHB), solenoids, electrostatic quadrupoles, a velocity equalizer, and a diagnostic system. The ECR ion sources are located on a high-voltage platform to reach an initial beam energy of 10 keV/u. After extraction, the ion beam is transported through the LEBT system to the RFQ accelerator. The generated charge states are selected by an achromatic bending system and then bunched by the MHB in the LEBT system. The MHB is used to achieve a small longitudinal emittance in the RFQ by generating a sawtooth wave with three harmonics. In this paper, we present the results and issues of the beam dynamics of the LEBT system.
Theory of thermal and charge transport in diffusive normal metal / superconductor junctions
Yokoyama, T.; Tanaka, Y.; Golubov, Alexandre Avraamovitch; Asano, Y.
2005-01-01
Thermal and charge transport in diffusive normal metal (DN)/insulator/s-, d-, and p-wave superconductor junctions are studied based on the Usadel equation with the Nazarov's generalized boundary condition. We derive a general expression of the thermal conductance in unconventional superconducting
Lavieville, Romain; Zhang, Yang; Casu, Alberto; Genovese, Alessandro; Manna, Liberato; Di Fabrizio, Enzo; Krahne, Roman
2012-04-24
Charge transport across metal-semiconductor interfaces at the nanoscale is a crucial issue in nanoelectronics. Chains of semiconductor nanorods linked by Au particles represent an ideal model system in this respect, because the metal-semiconductor interface is an intrinsic feature of the nanosystem and does not manifest solely as the contact to the macroscopic external electrodes. Here we investigate charge transport mechanisms in all-inorganic hybrid metal-semiconductor networks fabricated via self-assembly in solution, in which CdSe nanorods were linked to each other by Au nanoparticles. Thermal annealing of our devices changed the morphology of the networks and resulted in the removal of small Au domains that were present on the lateral nanorod facets, and in ripening of the Au nanoparticles in the nanorod junctions with more homogeneous metal-semiconductor interfaces. In such thermally annealed devices the voltage dependence of the current at room temperature can be well described by a Schottky barrier lowering at a metal semiconductor contact under reverse bias, if the spherical shape of the gold nanoparticles is considered. In this case the natural logarithm of the current does not follow the square-root dependence of the voltage as in the bulk, but that of V(2/3). From our fitting with this model we extract the effective permittivity that agrees well with theoretical predictions for the permittivity near the surface of CdSe nanorods. Furthermore, the annealing improved the network conductance at cryogenic temperatures, which could be related to the reduction of the number of trap states.
Energy Technology Data Exchange (ETDEWEB)
Cramer, Christopher J. [Univ. of Minnesota, Minneapolis, MN (United States)
2017-11-12
Charge transfer and charge transport in photoactivated systems are fundamental processes that underlie solar energy capture, solar energy conversion, and photoactivated catalysis, both organometallic and enzymatic. We developed methods, algorithms, and software tools needed for reliable treatment of the underlying physics for charge transfer and charge transport, an undertaking with broad applicability to the goals of the fundamental-interaction component of the Department of Energy Office of Basic Energy Sciences and the exascale initiative of the Office of Advanced Scientific Computing Research.
Directory of Open Access Journals (Sweden)
Fedros Galatopoulos
2017-07-01
Full Text Available The charge accumulation properties of p-i-n perovskite solar cells were investigated using three representative organic and inorganic hole transporting layer (HTL: (a Poly(3,4-ethylenedioxythiophene-poly(styrenesulfonate (PEDOT:PSS, Al 4083, (b copper-doped nickel oxide (Cu:NiOx, and (c Copper oxide (CuO. Through impedance spectroscopy analysis and modelling, it is shown that charge accumulation is decreased in the HTL/perovskite interface, between PEDOT:PSS to Cu:NiOx and CuO. This was indicative from the decrease in double layer capacitance (Cdl and interfacial charge accumulation capacitance (Cel, resulting in an increase to recombination resistance (Rrec, thus decreased charge recombination events between the three HTLs. Through AFM measurements, it is also shown that the reduced recombination events (followed by the increase in Rrec are also a result of increased grain size between the three HTLs, thus reduction in the grain boundary area. These charge accumulation properties of the three HTLs have resulted in an increase to the power conversion efficiency between the PEDOT:PSS (8.44%, Cu:NiOx (11.45%, and CuO (15.3%-based devices.
Noise And Charge Transport In Carbon Nanotube Devices
Reza, Shahed; Huynh, Quyen T.; Bosman, Gijs; Sippel, Jennifer; Rinzler, Andrew G.
2005-11-01
The charge transport and noise properties of three terminal, gated devices containing multiple, single wall, metallic and semiconductor carbon nanotubes have been measured as a function of gate and drain bias at 300K. Using pulsed bias the metallic tubes could be burned sequentially enabling the separation of measured conductance and low frequency excess noise into metallic and semiconductor contributions. The relative low frequency excess noise of the metallic tubes was about a factor 100 lower than that of the semiconductor tubes, whereas the conductance of the metallic tubes was significantly higher (10 to 50 times) than that of the semiconductor tubes.
Realistic modeling of chamber transport for heavy-ion fusion
International Nuclear Information System (INIS)
Sharp, W.M.; Grote, D.P.; Callahan, D.A.; Tabak, M.; Henestroza, E.; Yu, S.S.; Peterson, P.F.; Welch, D.R.; Rose, D.V.
2003-01-01
Transport of intense heavy-ion beams to an inertial-fusion target after final focus is simulated here using a realistic computer model. It is found that passing the beam through a rarefied plasma layer before it enters the fusion chamber can largely neutralize the beam space charge and lead to a usable focal spot for a range of ion species and input conditions
Understanding Non-Equilibrium Charge Transport and Rectification at Chromophore/Metal Interfaces
Darancet, Pierre
Understanding non-equilibrium charge and energy transport across nanoscale interfaces is central to developing an intuitive picture of fundamental processes in solar energy conversion applications. In this talk, I will discuss our theoretical studies of finite-bias transport at organic/metal interfaces. First, I will show how the finite-bias electronic structure of such systems can be quantitatively described using density functional theory in conjunction with simple models of non-local correlations and bias-induced Stark effects.. Using these methods, I will discuss the conditions of emergence of highly non-linear current-voltage characteristics in bilayers made of prototypical organic materials, and their implications in the context of hole- and electron-blocking layers in organic photovoltaic. In particular, I will show how the use of strongly-hybridized, fullerene-coated metallic surfaces as electrodes is a viable route to maximizing the diodic behavior and electrical functionality of molecular components. The submitted manuscript has been created by UChicago Argonne, LLC, Operator of Argonne National Laboratory (Argonne). Argonne, a U.S. Department of Energy Office of Science laboratory, is operated under Contract No. DE-AC02-06CH11357.
Hendrickson, Heidi Phillips
A fundamental understanding of charge separation in organic materials is necessary for the rational design of optoelectronic devices suited for renewable energy applications and requires a combination of theoretical, computational, and experimental methods. Density functional theory (DFT) and time-dependent (TD)DFT are cost effective ab-initio approaches for calculating fundamental properties of large molecular systems, however conventional DFT methods have been known to fail in accurately characterizing frontier orbital gaps and charge transfer states in molecular systems. In this dissertation, these shortcomings are addressed by implementing an optimally-tuned range-separated hybrid (OT-RSH) functional approach within DFT and TDDFT. The first part of this thesis presents the way in which RSH-DFT addresses the shortcomings in conventional DFT. Environmentally-corrected RSH-DFT frontier orbital energies are shown to correspond to thin film measurements for a set of organic semiconducting molecules. Likewise, the improved RSH-TDDFT description of charge transfer excitations is benchmarked using a model ethene dimer and silsesquioxane molecules. In the second part of this thesis, RSH-DFT is applied to chromophore-functionalized silsesquioxanes, which are currently investigated as candidates for building blocks in optoelectronic applications. RSH-DFT provides insight into the nature of absorptive and emissive states in silsesquioxanes. While absorption primarily involves transitions localized on one chromophore, charge transfer between chromophores and between chromophore and silsesquioxane cage have been identified. The RSH-DFT approach, including a protocol accounting for complex environmental effects on charge transfer energies, was tested and validated against experimental measurements. The third part of this thesis addresses quantum transport through nano-scale junctions. The ability to quantify a molecular junction via spectroscopic methods is crucial to their
Temperature-dependent charge injection and transport in pentacene thin-film transistors
International Nuclear Information System (INIS)
Kim, Dong Wook; Shin, Hyunji; Choi, Jong Sun; Park, Ji-Ho; Park, Jaehoon
2015-01-01
The electrical characteristics of p-channel pentacene thin-film transistors (TFTs) were analyzed at different operating temperatures ranging from 253 to 353 K. An improvement in the drain current and field-effect mobility of the pentacene TFTs is observed with increasing temperature. From the Arrhenius plots of field-effect mobility extracted at various temperatures, a lower activation energy of 99.34 meV was obtained when the device is operating in the saturation region. Such observation is ascribed to the thermally activated hole transport through the pentacene grain boundaries. On the other hand, it was found that the Au/pentacene contact significantly affects the TFTs electrical characteristics in the linear region, which resulted in a higher activation energy. The activation energy based on the linear field-effect mobility, which increased from 344.61 to 444.70 meV with decreasing temperature, implies the charge-injection-limited electrical behavior of pentacene TFTs at low temperatures. The thermally induced electrical characteristic variations in pentacene TFTs can thus be studied through the temperature dependence of the charge injection and transport processes. (paper)
Tavasszy, L.A.; Jong, G. de
2014-01-01
Freight Transport Modelling is a unique new reference book that provides insight into the state-of-the-art of freight modelling. Focusing on models used to support public transport policy analysis, Freight Transport Modelling systematically introduces the latest freight transport modelling
Directory of Open Access Journals (Sweden)
Martin Gregory T
2004-11-01
skin was solved by exploiting the mathematical analogy between local thermal models and local electrical (charge transport models, thereby allowing robust, circuit simulation software to obtain solutions to Kirchhoff's laws for the system model. Transport lattices allow systematic introduction of realistic geometry and spatially heterogeneous heat transport mechanisms. Local representations for both simple, passive functions and more complex local models can be easily and intuitively included into the system model of a tissue.
International Nuclear Information System (INIS)
Grosse, Veit
2011-01-01
In this thesis thin STO layers were epitactically deposited on YBCO for a subsequent electrical characterization. YBCO layers with a roughness of less than 2 nm (RMS), good out-of-plane orientation with a half-width in the rocking curve in the range (0.2..0.3) at only slightly diminished critical temperature could be reached. The STO layers exhibited also very good crystallographic properties. The charge-carrier transport in STO is mainly dominated by interface-limited processes. By means of an in thesis newly developed barrier model thereby the measured dependencies j(U,T) respectively σ(U,T) could be described very far-reachingly. At larger layer thicknesses and low temperatures the charge-carrier transport succeeds by hopping processes. So in the YBCO/STO/YBCO system the variable-range hopping could be identified as dominating transport process. Just above U>10 V a new behaviour is observed, which concerning its temperature dependence however is also tunnel-like. The STO layers exhibit here very large resistances, so that fields up to 10 7 ..10 8 V/m can be reached without flowing of significant leakage currents through the barrier. In the system YBCO/STO/Au the current transport can be principally in the same way as in the YBCO/STO/YBCO system. The special shape and above all the asymmetry of the barrier however work out very distinctly. It could be shown that at high temperatures according to the current direction a second barrier on the opposite electrode must be passed. So often observed breakdown effects can be well described. For STO layer-thicknesses in the range around 25 nm in the whole temperature range studied inelastic tunneling over chains of localized states was identified as dominating transport process. It could however for the first time be shown that at very low temperatures in the STO layers Coulomb blockades can be formed.
Photoinduced Charge Transport Spectra for Porphyrin and Naphthalene Derivative-based Dendrimers
Park, J. H.; Wu, Y.; Parquette, J. R.; Epstein, A. J.
2006-03-01
Dendrimers are important chemical structures for harvesting charge. We prepared model dendrimers using two porphyrin derivatives and a naphthalene derivative. Films of these porphyrin derivatives have a strong Soret band (˜430nm) and four significant Q-bands; the naphthalene derivative has strong absorption at 365 and 383nm. Two kinds of photovoltaic cell structures [ITO/BaytronP/(thick or thin) dendrimer/Al] are constructed to investigate the optical response spectra of dendrimers under electric potential(V) on the cell (range from -1V to 2V). To obtain pure optical responses, incident light is modulated with an optical chopper and a lock-in amplifier is used to measure current (IAC) and phase (θ). For the excitation of the Soret band, IAC and θ do not change substantially with change of sign and amplitude of V. For Q-bands and naphthalene absorption bands, θ nearly follows the polarity of V on the cells and IAC is linear with V. Hence, IAC is nearly ohmic for Q- band although there are shifts due to built-in-potential. IAC for Soret band is almost same for thick and thin active layer cells. In contrast, IAC increases with thickness increase for Q bands. Mechanisms of photogeneration and charge transport will be discussed.
Space charge compensation in the Linac4 low energy beam transport line with negative hydrogen ions
Energy Technology Data Exchange (ETDEWEB)
Valerio-Lizarraga, Cristhian A., E-mail: cristhian.alfonso.valerio.lizarraga@cern.ch [CERN, Geneva (Switzerland); Departamento de Investigación en Física, Universidad de Sonora, Hermosillo (Mexico); Lallement, Jean-Baptiste; Lettry, Jacques; Scrivens, Richard [CERN, Geneva (Switzerland); Leon-Monzon, Ildefonso [Facultad de Ciencias Fisico-Matematicas, Universidad Autónoma de Sinaloa, Culiacan (Mexico); Midttun, Øystein [CERN, Geneva (Switzerland); University of Oslo, Oslo (Norway)
2014-02-15
The space charge effect of low energy, unbunched ion beams can be compensated by the trapping of ions or electrons into the beam potential. This has been studied for the 45 keV negative hydrogen ion beam in the CERN Linac4 Low Energy Beam Transport using the package IBSimu [T. Kalvas et al., Rev. Sci. Instrum. 81, 02B703 (2010)], which allows the space charge calculation of the particle trajectories. The results of the beam simulations will be compared to emittance measurements of an H{sup −} beam at the CERN Linac4 3 MeV test stand, where the injection of hydrogen gas directly into the beam transport region has been used to modify the space charge compensation degree.
A numerical study on the charge transport in TPD/Alq3-based organic light emitting diodes.
Kim, K S; Hwang, Y W; Lee, H G; Won, T Y
2014-08-01
We report our simulation study on the charge transport characteristic of the multi-layer structure for organic light emitting diodes (OLEDs). We performed a numerical simulation on a multilayer structure comprising a hole transport layer (HTL), an emission layer (EML), and an electron transport layer (ETL) between both electrodes. The material of the HTL is TPD (N,N'-Bis (3-methylphenyl)-N,N'-bis(phenyl) benzidine), and the ETL includes Alq3 (Tris (8-hyroxyquinolinato) aluminium). Here, we investigated the parameters such as recombination rates which influence the efficiency of the charge transport between layers in bilayer OLEDs. We also analyzed a transient response during the turn on/off period and the carrier transport in accordance with the variation of the injection barrier and applied voltage. In addition, our numerical simulation revealed that the insertion of the EML affects the photonic characteristics in bilayer structure and also the efficiency due to the difference in the internal barrier height.
Charge and energy transports via poly-phenylacetylene based dendrimers
Shin, Yongwoo; Li, Minghai; Lin, Xi
2010-03-01
Poly-Phenylacetylene (PPA) is widely used in photoconductivity, photoluminescence, and light harvesting applications. In this work, we investigate the charge and exciton transport energetics and mechanisms in the PPA-based dendrimers using our recently developed adapted Su-Schrieffer-Heeger (SSH) model Hamiltonians and ab initio Hartree-Fock (HF) calculations. We found both doping and photo-excitation lead to the formation of optical phonon dressed pi electron states, namely the self-localized polarons, in the energy gap. Independent from their origins, these polarons can be self-trapped at multiple lattice locations along the PPA chain, and migrate from one to the next with an activation barrier of ˜0.006 eV, slightly higher than the corresponding barrier found in trans-polyacetylene. The PPA-based dendrimers can be constructed via the meta-positions of phenyl rings. In this case, we found the dendrimer junctions form attractive potential wells for both polarons and excitons, and the width and height of these junction potential wells can be controlled by the geometry of the dendrimers.
TTF/TCNQ-based thin films and microcrystals. Growth and charge transport phenomena
Energy Technology Data Exchange (ETDEWEB)
Solovyeva, Vita
2011-05-26
The thesis adresses several problems related to growth and charge transport phenomena in thin films of TTF-TCNQ and (BEDT-TTF)TCNQ. The following main new problems are addressed: - The influence of thin-film specific factors, such as the substrate material and growth-induced defects, on the Peierls transition temperature in TTF-TCNQ thin films was studied; - finite-size effects in TTF-TCNQ were investigated by considering transport properties in TTF-TCNQ microcrystals. The influence of the size of the crystal on the Peierls transition temperature was studied. In this context a new method of microcontact fabrication was employed to favor the measurements; - an analysis of radiation-induced defects in TTF-TCNQ thin films and microcrystals was performed. It was demonstrated than an electron beam can induce appreciable damage to the sample such that its electronic properties are strongly modified; - a bilayer growth method was established to fabricate (BEDT-TTF)TCNQ from the gas phase. This newly developed bilayer growth method was showed to be suitable for testing (BEDT-TTF)TCNQ charge-transfer phase formation; - the structure of the formed (BEDT-TTF)TCNQ charge-transfer compounds was analyzed by using a wide range of experimental techniques. An overview and the description of the basic physical principles underlying charge-transfer compounds is given in chapter 2. Experimental techniques used for the growth and characterization of thin films and microcrystals are presented in chapter 3. Chapter 4 gives an overview of the physical properties of the studied organic materials. Chapter 5 discussed the experimental study of TTF-TCNQ thin films. he Peierls transition in TTF-TCNQ is a consequence of the quasi-one-dimensional structure of the material and depends on different factors, studied in chapters 5 and 6. In contradistinction to TTF-TTCNQ, the (BEDT-TTF)TCNQ charge-transfer compound crystallizes in several different modifications with different physical properties
A hybrid charged-particle guide for studying (n, charged particle) reactions
International Nuclear Information System (INIS)
Haight, R.C.; White, R.M.; Zinkle, S.J.
1983-01-01
Charged-particle transport systems consisting of magnetic quadrupole lenses have been employed in recent years in the study of (n, charged particle) reactions. A new transport system was completed at the laboratory that is based both on magnetic lenses as well as electrostatic fields. The magnetic focusing of the charged-particle guide is provided by six magnetic quadrupole lenses arranged in a CDCCDC sequence (in the vertical plane). The electrostatic field is produced by a wire at high voltage which stretches the length of the guide and is physically at the centre of the magnetic axis. The magnetic lenses are used for charged particles above 5 MeV; the electrostatic guide is used for lower energies. This hybrid system possesses the excellent focusing and background rejection properties of other magnetic systems. For low energy charged-particles, the electrostatic transport avoids the narrow band-passes in charged-particle energy which are a problem with purely magnetic transport systems. This system is installed at the LLNL Cyclograaff facility for the study of (n, charged particle) reactions at neutron energies up to 35 MeV. (Auth.)
A transport model with color confinement
International Nuclear Information System (INIS)
Loh, S.
1997-01-01
First the mostly important properties of QCD are dealt with. It is made plausible, how the QCD vacuum generates a screening of color charges and is by this responsible for the quark confinement in color singlets. in the following the behaviour of classical color charges and color fields is studied and it is concluded that by this approximation, the neglection of quantum-mechanical fluctuation, the quark confinement cannot be explained, because the mean-field approximation leads to a screening of the color charges. Motivated by this result the Friedberg-Lee soliton model is presented, in which the the color confinement and all further nonperturbative QCD effects are phenomenologically modelled by means of a scalar field. Thereafter a derivation of the transport equations for quarks in the framework of the Wigner-function is presented. An extension of the equation to the Friedberg-Lee model is explained. As results the ground-state properties of the model are studied. Mesonic and baryonic ground-state solutions (soliton solutions) of the equations are constructed, whereby the constituents are both light quarks and heavy quarks. Furthermore the color coupling constant of QCD is fixed by means of the string tension by dynamical separation of the quarks of the meson. The flux tubes formed dynamically in this way are applied, in order to study the interaction of two strings and to calculate a string-string potential. Excited states of the meson (isovectorial modes) are presented as well as the influence of the color confinement on the quark motion. Finally the dynamical formation and the break-up of a string by the production of light and heavy quark pairs is described
Charge transport properties in microcrystalline KDyFe(China)6
International Nuclear Information System (INIS)
Aubert, P.H.; Goubard, F.; Chevrot, C.; Tabuteau, A.
2007-01-01
Microcrystalline solid dysprosium(III) hexacyanoferrate(II) was synthesized by co-precipitation in aqueous solution. The resulting solid has been studied by Fourier transform infrared spectroscopy, X-ray analysis and solid state electrochemistry. The use of a cavity microelectrode was necessary to explore a wide range of time scale and minimize the (undesired) capacitive currents. Cyclic voltametric experiments were very helpful to understand the kinetic of charge transfer in such microstructure. A structure-properties relationship has been established from the crystallographic and the electrochemical properties. A square-scheme is presented to explain the unique electrochemical behavior of hexacyanoferrate containing dysprosium since this compound exhibits a second redox system. The solid presents an open channel-like morphology in which the motion of charged species occurs during the redox processes. Precisely, the electronic transfer is accompanied by a cation diffusion inside the microcrystalline structure. The size of these channels strongly suggests that the kinetic of charge transfer is limited by the cation transport into these structures. - Graphical abstract: Dy and Fe polyhedra packing in the cell of KDyFe(China) 6 .3.5H 2 O shows occluded water molecules and potassium ions forming a pseudohexagonal 2D sub-lattice connected to each other by diffusion channels
Energy Technology Data Exchange (ETDEWEB)
Touzin, M.
2005-12-15
Dielectric breakdown constitutes an important limitation in the use of insulating materials under high-tension since it leads to the local fusion and the sublimation of material. The microstructure (average grain size, intergranular phase) has a great influence on the ability of material to resist this catastrophic phenomenon. Indeed, the interfaces between the various phases constitute potential sites of trapping for the charges. The optimization of the dielectric breakdown strength of a polycrystalline alumina sintered with a liquid phase passes necessarily through the control of the microstructural parameters. Thus, it is shown that by controlling the conditions of the process (rate of sintering aids, powder grain size and thermal cycle), it is possible to control the density (by the average grain size) but also the nature (by the crystallization or not of anorthite) of the grain boundaries. The study of the influence of these two parameters as well temperature on the properties of charge transport and storage was carried out by methods ICM and SEMME. The results, interpreted in light of the numerical simulation of the charge transport in bulk alumina sample during electron beam irradiation, allowed to highlight behaviors, and the corresponding microstructures, favourable to the dielectric breakdown resistance according to the considered temperature. Thus, at room temperature a high density of interfaces (low grain size and crystallized intergranular phase) makes it possible material to durably trap a great amount of charges, which leads to a high dielectric strength. On the other hand, at higher temperature, the presence of shallow traps (vitreous intergranular phase) supports the charge diffusion and makes it possible to delay breakdown. (author)
DNA Charge Transport: From Chemical Principles to the Cell
Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.
2016-01-01
The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744
Peculiarities of charge transport in a semiconductor gas discharge electronic devices
International Nuclear Information System (INIS)
Koch, E.; Chivi, M.; Salamov, B.G.; Salamov, B.G.
2009-01-01
The memory effect in planar semiconductor gas discharge system at different pressures (15-760) and interelectrode distance (60-445 μm) were experimentally studied. The study was performed on the bases of current-voltage characteristic (CVC) measurements with the time lag of several hours of afterglow periods. The influence of the active space-charge remaining from previous discharge on the breakdown voltage has been analyzed using the CVC method for different conductivity of semiconductor GaAs photocathode. On the other hand, the CVC data for subsequent dates present a correlation of memory effect and hysteresis behaviour. The explanation of such relation is based on the influence of long-lived active charges on the electronic transport mechanism of semiconductor material
May, Falk; Al-Helwi, Mustapha; Baumeier, Björn; Kowalsky, Wolfgang; Fuchs, Evelyn; Lennartz, Christian; Andrienko, Denis
2012-08-22
The use of blue phosphorescent emitters in organic light-emitting diodes (OLEDs) imposes demanding requirements on a host material. Among these are large triplet energies, the alignment of levels with respect to the emitter, the ability to form and sustain amorphous order, material processability, and an adequate charge carrier mobility. A possible design strategy is to choose a π-conjugated core with a high triplet level and to fulfill the other requirements by using suitable substituents. Bulky substituents, however, induce large spatial separations between conjugated cores, can substantially reduce intermolecular electronic couplings, and decrease the charge mobility of the host. In this work we analyze charge transport in amorphous 2,8-bis(triphenylsilyl)dibenzofuran, an electron-transporting material synthesized to serve as a host in deep-blue OLEDs. We show that mesomeric effects delocalize the frontier orbitals over the substituents recovering strong electronic couplings and lowering reorganization energies, especially for electrons, while keeping energetic disorder small. Admittance spectroscopy measurements reveal that the material has indeed a high electron mobility and a small Poole-Frenkel slope, supporting our conclusions. By linking electronic structure, molecular packing, and mobility, we provide a pathway to the rational design of hosts with high charge mobilities.
A Generalized Boltzmann Fokker-Planck Method for Coupled Charged Particle Transport
Energy Technology Data Exchange (ETDEWEB)
Prinja, Anil K
2012-01-09
The goal of this project was to develop and investigate the performance of reduced-physics formulations of high energy charged particle (electrons, protons and heavier ions) transport that are computationally more efficient than not only analog Monte Carlo methods but also the established condensed history Monte Carlo technique. Charged particles interact with matter by Coulomb collisions with target nuclei and electrons, by bremsstrahlung radiation loss and by nuclear reactions such as spallation and fission. Of these, inelastic electronic collisions and elastic nuclear collisions are the dominant cause of energy-loss straggling and angular deflection or range straggling of a primary particle. These collisions are characterized by extremely short mean free paths (sub-microns) and highly peaked, near-singular differential cross sections about forward directions and zero energy loss, with the situation for protons and heavier ions more extreme than for electrons. For this reason, analog or truephysics single-event Monte Carlo simulation, while possible in principle, is computationally prohibitive for routine calculation of charged particle interaction phenomena.
Zhu, Huayang; Ricote, Sandrine; Coors, W Grover; Kee, Robert J
2015-01-01
A model-based interpretation of measured equilibrium conductivity and conductivity relaxation is developed to establish thermodynamic, transport, and kinetics parameters for multiple charged defect conducting (MCDC) ceramic materials. The present study focuses on 10% yttrium-doped barium zirconate (BZY10). In principle, using the Nernst-Einstein relationship, equilibrium conductivity measurements are sufficient to establish thermodynamic and transport properties. However, in practice it is difficult to establish unique sets of properties using equilibrium conductivity alone. Combining equilibrium and conductivity-relaxation measurements serves to significantly improve the quantitative fidelity of the derived material properties. The models are developed using a Nernst-Planck-Poisson (NPP) formulation, which enables the quantitative representation of conductivity relaxations caused by very large changes in oxygen partial pressure.
Lee, Nien-En; Zhou, Jin-Jian; Agapito, Luis A.; Bernardi, Marco
2018-03-01
Predicting charge transport in organic molecular crystals is notoriously challenging. Carrier mobility calculations in organic semiconductors are dominated by quantum chemistry methods based on charge hopping, which are laborious and only moderately accurate. We compute from first principles the electron-phonon scattering and the phonon-limited hole mobility of naphthalene crystal in the framework of ab initio band theory. Our calculations combine GW electronic bandstructures, ab initio electron-phonon scattering, and the Boltzmann transport equation. The calculated hole mobility is in very good agreement with experiment between 100 -300 K , and we can predict its temperature dependence with high accuracy. We show that scattering between intermolecular phonons and holes regulates the mobility, though intramolecular phonons possess the strongest coupling with holes. We revisit the common belief that only rigid molecular motions affect carrier dynamics in organic molecular crystals. Our paper provides a quantitative and rigorous framework to compute charge transport in organic crystals and is a first step toward reconciling band theory and carrier hopping computational methods.
Mean electrostatic and Poisson-Boltzmann models for multicomponent transport through compacted clay
International Nuclear Information System (INIS)
Steefel, C.I.; Galindez, J.M.
2012-01-01
Document available in extended abstract form only. Electrical double layer effects in the pore space of clays become increasingly important as the level of compaction increases and intergrain and interlayer spacings shift towards the range of nano-meters. At such scales, solute transport can no longer be explained by concentration gradients alone and it becomes necessary to include the electrostatic effects on chemical potentials. In fact, the electrical double layer (EDL) that develops in the neighborhood of the negatively charged clay surfaces can extend well into the aqueous phase, effectively constraining the space available to anions (known as anion exclusion), thus distorting the spatial distribution of ionic species in solution. In this study, we make use of two approaches for addressing the accumulation and transport of charged ionic species in the electrical double layers of compacted bentonite: 1) a mean electrostatic approach based on the assumption of Donnan equilibrium, and 2) a 2D numerical approach based on the multicomponent Poisson-Nernst-Planck (NPP) set of equations. For the mean electrostatic or Donnan approach to the electrical double layer [1], two options are considered: 1) a model in which surface complexation in the Stern layer may partly balance the fixed charge of the montmorillonite making up the bentonite buffer, and 2) a model in which the fixed mineral charge is balanced completely by the diffuse layer. In the mean electrostatic approach, one additional equation that balances the charge between the Stern layer and the diffuse layer is added to the multicomponent reactive transport code CrunchFlow. The only additional unknown that is required is the mean electrostatic potential, although it may be necessary in certain cases to consider the volume (or width) of the electrical double layer as an additional implicit unknown. Both ions and neutral species may diffuse within the diffuse layer according to their gradients and species
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Jiang, J S; Pearson, J E; Bader, S D
2011-04-15
Using ballistic-electron-emission spectroscopy (BEES), we directly determined the energy barrier for electron injection at clean interfaces of Alq(3) with Al and Fe to be 2.1 and 2.2 eV, respectively. We quantitatively modeled the sub-barrier BEES spectra with an accumulated space charge layer, and found that the transport of nonballistic electrons is consistent with random hopping over the injection barrier.
Nikolka, Mark
2017-12-13
Over the past 25 years, various design motifs have emerged for the development of organic semiconductors for demanding applications in flexible organic light emitting diode display backplanes or even printed organic logic. Due to their large area uniformity paired with high charge carrier mobilities, conjugated polymers have attracted increasing attention in this respect. However, the performances delivered by current generation conjugated polymers still fall short of many industrial requirements demanding devices with ideal transistor characteristics and higher mobilities. The discovery of conjugated polymers with low energetic disorder, such as the indacenodithiophene-based polymer indacenodithiophene-co-benzothiadiazole, represent an exciting opportunity to breach this chasm if these materials can be further optimized while maintaining their low disorder. Here, it is shown how both the charge transport properties as well as the energetic disorder are affected by tuning the molecular structure of a large range of indacenodithiophene-based semiconducting polymer derivatives. This study allows to understand better the interplay between molecular design and structure of the polymer backbone and the degree of energetic disorder that governs the charge transport properties in thin polymer films.
Quantifying TEMPO Redox Polymer Charge Transport toward the Organic Radical Battery.
Karlsson, Christoffer; Suga, Takeo; Nishide, Hiroyuki
2017-03-29
To design new and better organic active battery materials in a rational fashion, fundamental parameters of the charge transport must be studied. Herein we report on the electronic conductivity by electron diffusion in a TEMPO-containing redox polymer, and the reorganization energy of the TEMPO self-exchange in an organic solvent is determined for the first time. The electronic conductivity was 8.5 μS/cm at E 0 and corresponded to a redox hopping mechanism. The apparent electron diffusion coefficient was 1.9 × 10 -9 cm 2 /s at room temperature, and at short times the ion diffusion was limiting with a diffusion coefficient of 6.5 × 10 -10 cm 2 /s. The reorganization energy was determined to be 1.01 eV, indicating a rather polar chemical environment for the TEMPO groups. The implications for the usage of this type of materials in organic energy storage are discussed. As conductivity through 10 μm was demonstrated, we show that, if sufficient swellability can be ensured, charge can be transported through several micrometer thick layers in a battery electrode without any conducting additive.
International Nuclear Information System (INIS)
Liu, Chunyu; Chang, Kaiwen; Guo, Wenbin; Li, Hao; Shen, Liang; Chen, Weiyou; Yan, Dawei
2014-01-01
Carbon quantum dots (Cdots) are synthesized by a simple method and introduced into active layer of polymer solar cells (PSCs). The performance of doped devices was apparently improved, and the highest power conversion efficiency of 7.05% was obtained, corresponding to a 28.2% enhancement compared with that of the contrast device. The charge transport properties, resistance, impedance, and transient absorption spectrum are systematically investigated to explore how the Cdots affect on PSCs performance. This study reveals the importance of Cdots in enhancing the efficiency of PSCs and gives insight into the mechanism of charge transport improvement.
A Monte Carlo modeling on charging effect for structures with arbitrary geometries
Li, C.; Mao, S. F.; Zou, Y. B.; Li, Yong Gang; Zhang, P.; Li, H. M.; Ding, Z. J.
2018-04-01
Insulating materials usually suffer charging effects when irradiated by charged particles. In this paper, we present a Monte Carlo study on the charging effect caused by electron beam irradiation for sample structures with any complex geometry. When transporting in an insulating solid, electrons encounter elastic and inelastic scattering events; the Mott cross section and a Lorentz-type dielectric function are respectively employed to describe such scatterings. In addition, the band gap and the electron–long optical phonon interaction are taken into account. The electronic excitation in inelastic scattering causes generation of electron–hole pairs; these negative and positive charges establish an inner electric field, which in turn induces the drift of charges to be trapped by impurities, defects, vacancies etc in the solid, where the distributions of trapping sites are assumed to have uniform density. Under charging conditions, the inner electric field distorts electron trajectories, and the surface electric potential dynamically alters secondary electron emission. We present, in this work, an iterative modeling method for a self-consistent calculation of electric potential; the method has advantages in treating any structure with arbitrary complex geometry, in comparison with the image charge method—which is limited to a quite simple boundary geometry. Our modeling is based on: the combination of the finite triangle mesh method for an arbitrary geometry construction; a self-consistent method for the spatial potential calculation; and a full dynamic description for the motion of deposited charges. Example calculations have been done to simulate secondary electron yield of SiO2 for a semi-infinite solid, the charging for a heterostructure of SiO2 film grown on an Au substrate, and SEM imaging of a SiO2 line structure with rough surfaces and SiO2 nanoparticles with irregular shapes. The simulations have explored interesting interlaced charge layer distribution
EDITORIAL: Charge transport in non-metallic solids
Youngs, Ian J.; Almond, Darryl P.
2009-03-01
Workers engaged in a wide range of investigations of charge transport in non-metallic solids came together at a meeting of the Institute of Physics Dielectric Group, held in London on 2 April 2008. Topics included both ionic and electronic conduction, investigations of the fundamental mechanisms of charge transport, percolation, modelling the conduction process in both natural and man-made composite electrical and electromagnetic materials, the design and development of solids with specified conduction properties and the ac characteristics of non-metallic solids. In the first session, the long-standing problem of the anomalous power law increase in ac conductivity with frequency was addressed by a set of four presentations. Jeppe Dyre, an invited speaker from Roskilde University, Denmark, introduced the problem and stressed the universality of the frequency dependence observed in the ac conductivities of disordered non-metallic materials. He showed that it could be obtained from a simple random barrier model, independent of the barrier distribution. Darryl Almond, University of Bath, showed that the electrical responses of large networks of randomly positioned resistors and capacitors, simulating the microstructures of disordered two-phase (conductor insulator) materials, exhibit the same frequency dependence. He demonstrated their robustness to component value and distribution and suggested that it was an emergent property of these networks and of two-phase materials. Klaus Funke, an invited speaker from the University of Munster, Germany, presented a detailed model of ion motion in disordered ionic materials. He stressed the need to account for the concerted many-particle processes that occur whilst ions hop from site to site in response to an applied electric field. The conductivity spectra obtained from this work reproduce the same frequency dispersion and have the additional feature of conductivity saturation at high frequencies. Tony West, University of
Poelking, Carl; Cho, Eunkyung; Malafeev, Alexander; Ivanov, Viktor; Kremer, Kurt; Risko, Chad; Bré das, Jean-Luc; Andrienko, Denis
2013-01-01
We establish a link between the microscopic ordering and the charge-transport parameters for a highly crystalline polymeric organic semiconductor, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b]thiophene) (PBTTT). We find that the nematic and dynamic order parameters of the conjugated backbones, as well as their separation, evolve linearly with temperature, while the side-chain dynamic order parameter and backbone paracrystallinity change abruptly upon the (also experimentally observed) melting of the side chains around 400 K. The distribution of site energies follows the behavior of the backbone paracrystallinity and can be treated as static on the time scale of a single-charge transfer reaction. On the contrary, the electronic couplings between adjacent backbones are insensitive to side-chain melting and vary on a much faster time scale. The hole mobility, calculated after time-averaging of the electronic couplings, reproduces well the value measured in a short-channel thin-film transistor. The results underline that to secure efficient charge transport in lamellar arrangements of conjugated polymers: (i) the electronic couplings should present high average values and fast dynamics, and (ii) the energetic disorder (paracrystallinity) should be small. © 2013 American Chemical Society.
Poelking, Carl
2013-01-31
We establish a link between the microscopic ordering and the charge-transport parameters for a highly crystalline polymeric organic semiconductor, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b]thiophene) (PBTTT). We find that the nematic and dynamic order parameters of the conjugated backbones, as well as their separation, evolve linearly with temperature, while the side-chain dynamic order parameter and backbone paracrystallinity change abruptly upon the (also experimentally observed) melting of the side chains around 400 K. The distribution of site energies follows the behavior of the backbone paracrystallinity and can be treated as static on the time scale of a single-charge transfer reaction. On the contrary, the electronic couplings between adjacent backbones are insensitive to side-chain melting and vary on a much faster time scale. The hole mobility, calculated after time-averaging of the electronic couplings, reproduces well the value measured in a short-channel thin-film transistor. The results underline that to secure efficient charge transport in lamellar arrangements of conjugated polymers: (i) the electronic couplings should present high average values and fast dynamics, and (ii) the energetic disorder (paracrystallinity) should be small. © 2013 American Chemical Society.
Modelling the effect of nonplanarity on charge transport along conjugated polymer chains
International Nuclear Information System (INIS)
Correia, Helena M.G.; Ramos, Marta M.D.
2007-01-01
Conjugated polymers show interesting properties that make them appropriated for nanoelectronics. Several studies of poly(p-phenylene vinylene) (PPV) have suggested that each polymer chain consists of several planar segments, with conjugation length of nanoscale dimension, linked by twists or kinks. A pronounced twist between two planar segments in a PPV chain not only causes loss of main-chain conjugation but it may also alter electron and hole mobility along the chain, which has further implications for the percolation of charge through the polymer film. We used self-consistent quantum molecular dynamics calculations to provide information on the electric field needed to move the injected charges (either electrons or holes) along the planar segments of PPV and to cross the twist between two planar segments perpendicular to each other. Field-dependent charge mobility was also estimated for conjugated segments of various lengths. Our results suggest that electrons can cross the twist between adjacent planar segments for lower applied electric fields than holes if there is no more than one electronic charge (electron or hole) on the PPV chain, otherwise similar fields are needed
Charge distribution in an two-chain dual model
International Nuclear Information System (INIS)
Fialkowski, K.; Kotanski, A.
1983-01-01
Charge distributions in the multiple production processes are analysed using the dual chain model. A parametrisation of charge distributions for single dual chains based on the νp and anti vp data is proposed. The rapidity charge distributions are then calculated for pp and anti pp collisions and compared with the previous calculations based on the recursive cascade model of single chains. The results differ at the SPS collider energies and in the energy dependence of the net forward charge supplying the useful tests of the dual chain model. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Gomez San Roman, Tomas [Instituto de Investigacion Tecnologica, Universidad Pontificia Comillas, Madrid (Spain); Momber, Ilan, E-mail: ilan.momber@iit.upcomillas.es [Instituto de Investigacion Tecnologica, Universidad Pontificia Comillas, Madrid (Spain); Rivier Abbad, Michel; Sanchez Miralles, Alvaro [Instituto de Investigacion Tecnologica, Universidad Pontificia Comillas, Madrid (Spain)
2011-10-15
Electric vehicles (EVs) present efficiency and environmental advantages over conventional transportation. It is expected that in the next decade this technology will progressively penetrate the market. The integration of plug-in electric vehicles in electric power systems poses new challenges in terms of regulation and business models. This paper proposes a conceptual regulatory framework for charging EVs. Two new electricity market agents, the EV charging manager and the EV aggregator, in charge of developing charging infrastructure and providing charging services are introduced. According to that, several charging modes such as EV home charging, public charging on streets, and dedicated charging stations are formulated. Involved market agents and their commercial relationships are analysed in detail. The paper elaborates the opportunities to formulate more sophisticated business models for vehicle-to-grid applications under which the storage capability of EV batteries is used for providing peak power or frequency regulation to support the power system operation. Finally penetration phase dependent policy and regulatory recommendations are given concerning time-of-use pricing, smart meter deployment, stable and simple regulation for reselling energy on private property, roll-out of public charging infrastructure as well as reviewing of grid codes and operational system procedures for interactions between network operators and vehicle aggregators. - Highlights: > A conceptual regulatory framework for charging EVs is proposed. > 2 new agents, EV charging point manager, EV aggregator and their functions are introduced. > Depending on private or public access of charging points, contractual relations change. > A classification of charging scenarios alludes implications on regulatory topics. > EV penetration phase dependent policy and regulatory recommendations are given.
Coherent Charge Transport in Ballistic InSb Nanowire Josephson Junctions
Li, S.; Kang, N.; Fan, D. X.; Wang, L. B.; Huang, Y. Q.; Caroff, P.; Xu, H. Q.
2016-01-01
Hybrid InSb nanowire-superconductor devices are promising for investigating Majorana modes and topological quantum computation in solid-state devices. An experimental realisation of ballistic, phase-coherent superconductor-nanowire hybrid devices is a necessary step towards engineering topological superconducting electronics. Here, we report on a low-temperature transport study of Josephson junction devices fabricated from InSb nanowires grown by molecular-beam epitaxy and provide a clear evidence for phase-coherent, ballistic charge transport through the nanowires in the junctions. We demonstrate that our devices show gate-tunable proximity-induced supercurrent and clear signatures of multiple Andreev reflections in the differential conductance, indicating phase-coherent transport within the junctions. We also observe periodic modulations of the critical current that can be associated with the Fabry-Pérot interference in the nanowires in the ballistic transport regime. Our work shows that the InSb nanowires grown by molecular-beam epitaxy are of excellent material quality and hybrid superconducting devices made from these nanowires are highly desirable for investigation of the novel physics in topological states of matter and for applications in topological quantum electronics. PMID:27102689
Modeling of charged anisotropic compact stars in general relativity
Energy Technology Data Exchange (ETDEWEB)
Dayanandan, Baiju; Maurya, S.K.; T, Smitha T. [University of Nizwa, Department of Mathematical and Physical Sciences, College of Arts and Science, Nizwa (Oman)
2017-06-15
A charged compact star model has been determined for anisotropic fluid distribution. We have solved the Einstein-Maxwell field equations to construct the charged compact star model by using the radial pressure, the metric function e{sup λ} and the electric charge function. The generic charged anisotropic solution is verified by exploring different physical conditions like causality condition, mass-radius relation and stability of the solution (via the adiabatic index, TOV equations and the Herrera cracking concept). It is observed that the present charged anisotropic compact star model is compatible with the star PSR 1937+21. Moreover, we also presented the EOS ρ = f(p) for the present charged compact star model. (orig.)
Czech Academy of Sciences Publication Activity Database
Masillamani, A. M.; Peřinka, N.; Hajná, Milena; Stejskal, Jaroslav; Tondelier, D.; Bonnassieux, Y.; Vanel, J.-C.; Geffroy, B.; Mencaraglia, D.
2016-01-01
Roč. 54, č. 17 (2016), s. 1710-1716 ISSN 0887-6266 R&D Projects: GA ČR(CZ) GA13-00270S Institutional support: RVO:61389013 Keywords : charge transport * colloidal dispersion * colloids Subject RIV: JI - Composite Materials Impact factor: 2.838, year: 2016
Charge-transport anisotropy in black phosphorus: critical dependence on the number of layers.
Banerjee, Swastika; Pati, Swapan K
2016-06-28
Phosphorene is a promising candidate for modern electronics because of the anisotropy associated with high electron-hole mobility. Additionally, superior mechanical flexibility allows the strain-engineering of various properties including the transport of charge carriers in phosphorene. In this work, we have shown the criticality of the number of layers to dictate the transport properties of black phosphorus. Trilayer black phosphorus (TBP) has been proposed as an excellent anisotropic material, based on the transport parameters using Boltzmann transport formalisms coupled with density functional theory. The mobilities of both the electron and the hole are found to be higher along the zigzag direction (∼10(4) cm(2) V(-1) s(-1) at 300 K) compared to the armchair direction (∼10(2) cm(2) V(-1) s(-1)), resulting in the intrinsic directional anisotropy. Application of strain leads to additional electron-hole anisotropy with 10(3) fold higher mobility for the electron compared to the hole. Critical strain for maximum anisotropic response has also been determined. Whether the transport anisotropy is due to the spatial or charge-carrier has been determined through analyses of the scattering process of electrons and holes, and their recombination as well as relaxation dynamics. In this context, we have derived two descriptors (S and F(k)), which are general enough for any 2D or quasi-2D systems. Information on the scattering involving purely the carrier states also helps to understand the layer-dependent photoluminescence and electron (hole) relaxation in black phosphorus. Finally, we justify trilayer black phosphorus (TBP) as the material of interest with excellent transport properties.
Directory of Open Access Journals (Sweden)
M. Mensik
2017-03-01
Full Text Available A quantum model solving the charge carrier mobility between polyacetylene-like polymer nanorods is presented. The model assumes: a Quantum mechanical calculation of hole on-chain delocalization involving electron-phonon coupling leading to the Peierls instability, b Hybridization coupling between the polymer backbone and side-groups (or environmental states, which act as hole traps, and c Semiclassical description of the inter-chain hole transfer in an applied voltage based on Marcus theory. We have found that mobility resonantly depends on the hybridization coupling between polymer and linked groups. We observed also non-trivial mobility dependences on the difference of energies of the highest occupied molecular orbitals localized on the polymer backbone and side-groups, respectively, and hole concentration. Those findings are important for optimization of hybrid opto-electronic devices.
Meng, Zhenyu; Kubar, Tomas; Mu, Yuguang; Shao, Fangwei
2018-05-08
Charge transport (CT) through biomolecules is of high significance in the research fields of biology, nanotechnology, and molecular devices. Inspired by our previous work that showed the binding of ionic liquid (IL) facilitated charge transport in duplex DNA, in silico simulation is a useful means to understand the microscopic mechanism of the facilitation phenomenon. Here molecular dynamics simulations (MD) of duplex DNA in water and hydrated ionic liquids were employed to explore the helical parameters. Principal component analysis was further applied to capture the subtle conformational changes of helical DNA upon different environmental impacts. Sequentially, CT rates were calculated by a QM/MM simulation of the flickering resonance model based upon MD trajectories. Herein, MD simulation illustrated that the binding of ionic liquids can restrain dynamic conformation and lower the on-site energy of the DNA base. Confined movement among the adjacent base pairs was highly related to the increase of electronic coupling among base pairs, which may lead DNA to a CT facilitated state. Sequentially combining MD and QM/MM analysis, the rational correlations among the binding modes, the conformational changes, and CT rates illustrated the facilitation effects from hydrated IL on DNA CT and supported a conformational-gating mechanism.
Yokoyama, T.; Tanaka, Y.; Golubov, Alexandre Avraamovitch; Inoue, J.; Asano, Y.
2005-01-01
Charge transport in the diffusive normal metal (DN)/insulator/s- and d-wave superconductor junctions is studied in the presence of magnetic impurities in DN in the framework of the quasiclassical Usadel equations with the generalized boundary conditions. The cases of s- and d-wave superconducting
Plausible carrier transport model in organic-inorganic hybrid perovskite resistive memory devices
Park, Nayoung; Kwon, Yongwoo; Choi, Jaeho; Jang, Ho Won; Cha, Pil-Ryung
2018-04-01
We demonstrate thermally assisted hopping (TAH) as an appropriate carrier transport model for CH3NH3PbI3 resistive memories. Organic semiconductors, including organic-inorganic hybrid perovskites, have been previously speculated to follow the space-charge-limited conduction (SCLC) model. However, the SCLC model cannot reproduce the temperature dependence of experimental current-voltage curves. Instead, the TAH model with temperature-dependent trap densities and a constant trap level are demonstrated to well reproduce the experimental results.
Disorder Effects in Charge Transport and Spin Response of Topological Insulators
Zhao, Lukas Zhonghua
Topological insulators are a class of solids in which the non-trivial inverted bulk band structure gives rise to metallic surface states that are robust against impurity backscattering. First principle calculations predicted Bi2Te3, Sb2Te3 and Bi2Se3 to be three-dimensional (3D) topological insulators with a single Dirac cone on the surface. The topological surface states were subsequently observed by angle-resolved photoemission (ARPES) and scanning tunneling microscopy (STM). The investigations of charge transport through topological surfaces of 3D topological insulators, however, have faced a major challenge due to large charge carrier densities in the bulk donated by randomly distributed defects such as vacancies and antisites. This bulk disorder intermixes surface and bulk conduction channels, thereby complicating access to the low-energy (Dirac point) charge transport or magnetic response and resulting in the relatively low measured carrier mobilities. Moreover, charge inhomogeneity arising from bulk disorder can result in pronounced nanoscale spatial fluctuations of energy on the surface, leading to the formation of surface `puddles' of different carrier types. Great efforts have been made to combat the undesirable effects of disorder in 3D topological insulators and to reduce bulk carriers through chemical doping, nanostructure fabrication, and electric gating. In this work we have developed a new way to reduce bulk carrier densities using high-energy electron irradiation, thereby allowing us access to the topological surface quantum channels. We also found that disorder in 3D topological insulators can be beneficial. It can play an important part in enabling detection of unusual magnetic response from Dirac fermions and in uncovering new excitations, namely surface superconductivity in Dirac `puddles'. In Chapter 3 we show how by using differential magnetometry we could probe spin rotation in the 3D topological material family (Bi2Se 3, Bi2Te3 and Sb2Te3
Kim, Myung-Hee Y.; Cucinotta, Francis A.; Zeitlin, Cary; Hassler, Donald M.; Ehresmann, Bent; Rafkin, Scot C. R.; Wimmer-Schweingruber, Robert F.; Boettcher, Stephan; Boehm, Eckart; Guo, Jingnan;
2014-01-01
Detailed measurements of the energetic particle radiation environment on the surface of Mars have been made by the Radiation Assessment Detector (RAD) on the Curiosity rover since August 2012. RAD is a particle detector that measures the energy spectrum of charged particles (10 to approx. 200 MeV/u) and high energy neutrons (approx 8 to 200 MeV). The data obtained on the surface of Mars for 300 sols are compared to the simulation results using the Badhwar-O'Neill galactic cosmic ray (GCR) environment model and the high-charge and energy transport (HZETRN) code. For the nuclear interactions of primary GCR through Mars atmosphere and Curiosity rover, the quantum multiple scattering theory of nuclear fragmentation (QMSFRG) is used. For describing the daily column depth of atmosphere, daily atmospheric pressure measurements at Gale Crater by the MSL Rover Environmental Monitoring Station (REMS) are implemented into transport calculations. Particle flux at RAD after traversing varying depths of atmosphere depends on the slant angles, and the model accounts for shielding of the RAD "E" dosimetry detector by the rest of the instrument. Detailed comparisons between model predictions and spectral data of various particle types provide the validation of radiation transport models, and suggest that future radiation environments on Mars can be predicted accurately. These contributions lend support to the understanding of radiation health risks to astronauts for the planning of various mission scenarios
International Nuclear Information System (INIS)
Nava, J.L.; Sosa, E.; Carreno, G.; Ponce-de-Leon, C.; Oropeza, M.T.
2006-01-01
A concentration versus time relationship model based on the isothermal diffusion-charge transfer mechanism was developed for a flow-by reactor with a three-dimensional (3D) reticulated vitreous carbon (RVC) electrode. The relationship was based on the effectiveness factor (η) which lead to the simulation of the concentration decay at different electrode polarisation conditions, i.e. -0.1, -0.3 and -0.59 V versus SCE; the charge transfer process was used for the former and mix and a mass transport control was used for the latter. Charge transfer and mass transport parameters were estimated from experimental data using Electrochemical Impedance Spectroscopy (EIS) and Linear Voltammetry (LV) techniques, respectively
Energy Technology Data Exchange (ETDEWEB)
Nava, J.L. [Universidad Autonoma Metropolitana-Iztapalapa, Departamento de Quimica, Av. San Rafael Atlixco 186, A.P. 55-534, C.P. 09340, Mexico D.F. (Mexico); Sosa, E. [Instituto Mexicano del Petroleo, Programa de Investigacion en Ingenieria Molecular, Eje Central 152, C.P. 07730, Mexico D.F. (Mexico); Carreno, G. [Universidad de Guanajuato, Facultad de Ingenieria en Geomatica e Hidraulica, Av. Juarez 77, C.P. 36000, Guanajuato, Gto. (Mexico); Ponce-de-Leon, C. [Electrochemical Engineering Group, School of Engineering Sciences, University of Southampton, Highfield, Southampton SO17 1BJ (United Kingdom)]. E-mail: capla@soton.ac.uk; Oropeza, M.T. [Centro de Graduados e Investigacion del Instituto Tecnologico de Tijuana, Blvd. Industrial, s/n, C.P. 22500, Tijuana B.C. (Mexico)
2006-05-25
A concentration versus time relationship model based on the isothermal diffusion-charge transfer mechanism was developed for a flow-by reactor with a three-dimensional (3D) reticulated vitreous carbon (RVC) electrode. The relationship was based on the effectiveness factor ({eta}) which lead to the simulation of the concentration decay at different electrode polarisation conditions, i.e. -0.1, -0.3 and -0.59 V versus SCE; the charge transfer process was used for the former and mix and a mass transport control was used for the latter. Charge transfer and mass transport parameters were estimated from experimental data using Electrochemical Impedance Spectroscopy (EIS) and Linear Voltammetry (LV) techniques, respectively.
Mass and charge transport in IPMC actuators with fractal interfaces
Chang, Longfei; Wu, Yucheng; Zhu, Zicai; Li, Heng
2016-04-01
Ionic Polymer-Metal Composite (IPMC) actuators have been attracting a growing interest in extensive applications, which consequently raises the demands on the accuracy of its theoretical modeling. For the last few years, rough landscape of the interface between the electrode and the ionic membrane of IPMC has been well-documented as one of the key elements to ensure a satisfied performance. However, in most of the available work, the interface morphology of IPMC was simplified with structural idealization, which lead to perplexity in the physical interpretation on its interface mechanism. In this paper, the quasi-random rough interface of IPMC was described with fractal dimension and scaling parameters. And the electro-chemical field was modeled by Poisson equation and a properly simplified Nernst-Planck equation set. Then, by simulation with Finite Element Method, a comprehensive analysis on he inner mass and charge transportation in IPMC actuators with different fractal interfaces was provided, which may be further adopted to instruct the performance-oriented interface design for ionic electro-active actuators. The results also verified that rough interface can impact the electrical and mechanical response of IPMC, not only from the respect of the real surface increase, but also from mass distribution difference caused by the complexity of the micro profile.
Duong, Duc T.
2014-04-09
In this work, crystallization kinetics and aggregate growth of poly(3-ethylhexylthiophene) (P3EHT) thin films are studied as a function of film thickness. X-ray diffraction and optical absorption show that individual aggregates and crystallites grow anisotropically and mostly along only two packing directions: the alkyl stacking and the polymer chain backbone direction. Further, it is also determined that crystallization kinetics is limited by the reorganization of polymer chains and depends strongly on the film thickness and average molecular weight. Time-dependent, field-effect hole mobilities in thin films reveal a percolation threshold for both low and high molecular weight P3EHT. Structural analysis reveals that charge percolation requires bridged aggregates separated by a distance of ≈2-3 nm, which is on the order of the polymer persistence length. These results thus highlight the importance of tie molecules and inter-aggregate distance in supporting charge percolation in semiconducting polymer thin films. The study as a whole also demonstrates that P3EHT is an ideal model system for polythiophenes and should prove to be useful for future investigations into crystallization kinetics. Recrystallization kinetics and its relationship to charge transport in poly(3-ethylhexylthiophene) (P3EHT) thin films are investigated using a combination of grazing incidence X-ray diffraction, optical absorption, and field-effect transistor measurements. These results show that thin film crystallization kinetics is limited by polymer chain reorganization and that charge percolation depends strongly on the edge-to-edge distance between aggregates. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Gomez San Roman, Tomas; Momber, Ilan; Rivier Abbad, Michel; Sanchez Miralles, Alvaro
2011-01-01
Electric vehicles (EVs) present efficiency and environmental advantages over conventional transportation. It is expected that in the next decade this technology will progressively penetrate the market. The integration of plug-in electric vehicles in electric power systems poses new challenges in terms of regulation and business models. This paper proposes a conceptual regulatory framework for charging EVs. Two new electricity market agents, the EV charging manager and the EV aggregator, in charge of developing charging infrastructure and providing charging services are introduced. According to that, several charging modes such as EV home charging, public charging on streets, and dedicated charging stations are formulated. Involved market agents and their commercial relationships are analysed in detail. The paper elaborates the opportunities to formulate more sophisticated business models for vehicle-to-grid applications under which the storage capability of EV batteries is used for providing peak power or frequency regulation to support the power system operation. Finally penetration phase dependent policy and regulatory recommendations are given concerning time-of-use pricing, smart meter deployment, stable and simple regulation for reselling energy on private property, roll-out of public charging infrastructure as well as reviewing of grid codes and operational system procedures for interactions between network operators and vehicle aggregators. - Highlights: → A conceptual regulatory framework for charging EVs is proposed. → 2 new agents, EV charging point manager, EV aggregator and their functions are introduced. → Depending on private or public access of charging points, contractual relations change. → A classification of charging scenarios alludes implications on regulatory topics. → EV penetration phase dependent policy and regulatory recommendations are given.
Solving the Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem by Dynamic Programming
DEFF Research Database (Denmark)
Christensen, Tue; Andersen, Kim Allan; Klose, Andreas
2013-01-01
This paper considers a minimum-cost network flow problem in a bipartite graph with a single sink. The transportation costs exhibit a staircase cost structure because such types of transportation cost functions are often found in practice. We present a dynamic programming algorithm for solving...... this so-called single-sink, fixed-charge, multiple-choice transportation problem exactly. The method exploits heuristics and lower bounds to peg binary variables, improve bounds on flow variables, and reduce the state-space variable. In this way, the dynamic programming method is able to solve large...... instances with up to 10,000 nodes and 10 different transportation modes in a few seconds, much less time than required by a widely used mixed-integer programming solver and other methods proposed in the literature for this problem....
Integral transport theory for charged particles in electric and magnetic fields
International Nuclear Information System (INIS)
Boffi, V.C.; Molinari, V.G.
1979-01-01
An integral transport theory for charged particles which, in the presence of electric and magnetic fields, diffuse by collisions against the atoms (or molecules) of a host medium is proposed. The combined effects of both the external fields and the mechanisms of scattering, removal and creation in building up the distribution function of the charged particles considered are investigated. The eigenvalue problem associated with the sourceless case of the given physical situation is also commented. Applications of the theory to a purely velocity-dependent problem and to a space-dependent problem, respectively, are illustrated for the case of a separable isotropic scattering kernel of synthetic type. Calculations of the distribution function, of the total current density and of relevant electrical conductivity are then carried out for different specializations of the external fields. (author)
Modeling transport pricing with multiple stakeholders. Working paper : Methodology and a case study
Smits, E.
2012-01-01
Pricing measures (e.g., a kilometre charge or cordon toll) are used to improve the external effects of transportation (e.g., congestion or emissions). This working paper presents a planning model for pricing while taking the preferences and interactions of multiple stakeholders (e.g., governments or
Geng, Hua; Peng, Qian; Wang, Linjun; Li, Haijiao; Liao, Yi; Ma, Zhiying; Shuai, Zhigang
2012-07-10
A tunneling-enabled hopping mechanism is proposed, providing a pratical tool to quantitatively assess charge mobility in organic semiconductors. The paradoxical phenomena in TIPS-pentacene is well explained in that the optical probe indicates localized charges while transport measurements show bands of charge. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Polarization of electron-beam irradiated LDPE films: contribution to charge generation and transport
Banda, M. E.; Griseri, V.; Teyssèdre, G.; Le Roy, S.
2018-04-01
Electron-beam irradiation is an alternative way to generate charges in insulating materials, at controlled position and quantity, in order to monitor their behaviour in regard to transport phenomena under the space charge induced electric field or external field applied. In this study, low density polyethylene (LDPE) films were irradiated by a 80 keV electron-beam with a flux of 1 nA cm‑2 during 10 min in an irradiation chamber under vacuum conditions, and were then characterized outside the chamber using three experimental methods. The electrical behaviour of the irradiated material was assessed by space charge measurements using the pulsed electro-acoustic (PEA) method under dc stress. The influence of the applied electric field polarity and amplitude has been tested in order to better understand the charge behaviour after electron-beam irradiation. Fourier transform infra-red spectroscopy (FTIR) and photoluminescence (PL) measurements were performed to evaluate the impact of the electron beam irradiation, i.e. deposited charges and energy, on the chemical structure of the irradiated samples. The present results show that the electrical behaviour in LDPE after irradiation is mostly driven by charges, i.e. by physical process functions of the electric field, and that changes in the chemical structure seems to be mild.
The Role of Shape on Electronic Structure and Charge Transport in Faceted PbSe Nanocrystals
Kaushik, Ananth P.
2014-03-25
We have determined the effect of shape on the charge transport characteristics of nanocrystals. Our study looked at the explicit determination of the electronic properties of faceted nanocrystals that essentially probe the limit of current computational reach, i.e., nanocrystals from 1.53 to 2.1 nm in diameter. These nanocrystals, which resemble PbSe systems, are either bare or covered in short ligands. They also differ in shape, octahedral vs cube-octahedral, and in superlattice symmetry (fcc vs bcc). We have provided insights on electron and hole coupling along different facets and overall charge mobility in bcc and fcc superlattices. We have determined that the relative areas of (100) to (111) facets, and facet atom types are important factors governing the optimization of charge transport. The calculated electronic density of states shows no role of -SCH3 - ligands on states near the band gap. Electron coupling between nanocrystals is significantly higher than that of hole coupling; thiol ligands lower the ratio between electron and hole couplings. Stronger coupling exists between smaller nanocrystals. © 2014 American Chemical Society.
Plausible carrier transport model in organic-inorganic hybrid perovskite resistive memory devices
Directory of Open Access Journals (Sweden)
Nayoung Park
2018-04-01
Full Text Available We demonstrate thermally assisted hopping (TAH as an appropriate carrier transport model for CH3NH3PbI3 resistive memories. Organic semiconductors, including organic-inorganic hybrid perovskites, have been previously speculated to follow the space-charge-limited conduction (SCLC model. However, the SCLC model cannot reproduce the temperature dependence of experimental current-voltage curves. Instead, the TAH model with temperature-dependent trap densities and a constant trap level are demonstrated to well reproduce the experimental results.
Charge-Spot Model for Electrostatic Forces in Simulation of Fine Particulates
Walton, Otis R.; Johnson, Scott M.
2010-01-01
The charge-spot technique for modeling the static electric forces acting between charged fine particles entails treating electric charges on individual particles as small sets of discrete point charges, located near their surfaces. This is in contrast to existing models, which assume a single charge per particle. The charge-spot technique more accurately describes the forces, torques, and moments that act on triboelectrically charged particles, especially image-charge forces acting near conducting surfaces. The discrete element method (DEM) simulation uses a truncation range to limit the number of near-neighbor charge spots via a shifted and truncated potential Coulomb interaction. The model can be readily adapted to account for induced dipoles in uncharged particles (and thus dielectrophoretic forces) by allowing two charge spots of opposite signs to be created in response to an external electric field. To account for virtual overlap during contacts, the model can be set to automatically scale down the effective charge in proportion to the amount of virtual overlap of the charge spots. This can be accomplished by mimicking the behavior of two real overlapping spherical charge clouds, or with other approximate forms. The charge-spot method much more closely resembles real non-uniform surface charge distributions that result from tribocharging than simpler approaches, which just assign a single total charge to a particle. With the charge-spot model, a single particle may have a zero net charge, but still have both positive and negative charge spots, which could produce substantial forces on the particle when it is close to other charges, when it is in an external electric field, or when near a conducting surface. Since the charge-spot model can contain any number of charges per particle, can be used with only one or two charge spots per particle for simulating charging from solar wind bombardment, or with several charge spots for simulating triboelectric charging
Solid charged-core model of ball lightning
Muldrew, D. B.
2010-01-01
In this study, ball lightning (BL) is assumed to have a solid, positively-charged core. According to this underlying assumption, the core is surrounded by a thin electron layer with a charge nearly equal in magnitude to that of the core. A vacuum exists between the core and the electron layer containing an intense electromagnetic (EM) field which is reflected and guided by the electron layer. The microwave EM field applies a ponderomotive force (radiation pressure) to the electrons preventing them from falling into the core. The energetic electrons ionize the air next to the electron layer forming a neutral plasma layer. The electric-field distributions and their associated frequencies in the ball are determined by applying boundary conditions to a differential equation given by Stratton (1941). It is then shown that the electron and plasma layers are sufficiently thick and dense to completely trap and guide the EM field. This model of BL is exceptional in that it can explain all or nearly all of the peculiar characteristics of BL. The ES energy associated with the core charge can be extremely large which can explain the observations that occasionally BL contains enormous energy. The mass of the core prevents the BL from rising like a helium-filled balloon - a problem with most plasma and burning-gas models. The positively charged core keeps the negatively charged electron layer from diffusing away, i.e. it holds the ball together; other models do not have a mechanism to do this. The high electrical charges on the core and in the electron layer explains why some people have been electrocuted by BL. Experiments indicate that BL radiates microwaves upon exploding and this is consistent with the model. The fact that this novel model of BL can explain these and other observations is strong evidence that the model should be taken seriously.
DEFF Research Database (Denmark)
Leitherer, Susanne; Jager, C. M.; Krause, A.
2017-01-01
In weakly interacting organic semiconductors, static disorder and dynamic disorder often have an important impact on transport properties. Describing charge transport in these systems requires an approach that correctly takes structural and electronic fluctuations into account. Here, we present...... are used in organic field-effect transistors....
Charge transport through superconductor/Anderson-insulator interfaces
International Nuclear Information System (INIS)
Frydman, A.; Ovadyahu, Z.
1997-01-01
We report on a study of charge transport through superconductor-insulator-superconductor and normal metal endash insulator endash superconductor structures (SIS and NIS junctions, respectively) where the insulator is of the Anderson type. Devices which are characterized by a junction resistance larger than 10 kΩ show behavior which is typical of Giaever tunnel junctions. In structures having smaller resistance, several peculiar features are observed. In the SIS junctions, Josephson coupling is detected over distances much larger then the typical insulator localization length. In addition, a series of resistance peaks appears at voltages of 2Δ/n, where Δ is the superconducting gap. The NIS Junctions exhibit a large resistance dip at subgap bias. We discuss possible interpretations of these findings and suggest that they may result from the presence of high transmission channels through the barrier region. copyright 1997 The American Physical Society
Gravitational instantons as models for charged particle systems
Franchetti, Guido; Manton, Nicholas S.
2013-03-01
In this paper we propose ALF gravitational instantons of types A k and D k as models for charged particle systems. We calculate the charges of the two families. These are -( k + 1) for A k , which is proposed as a model for k + 1 electrons, and 2 - k for D k , which is proposed as a model for either a particle of charge +2 and k electrons or a proton and k - 1 electrons. Making use of preferred topological and metrical structures of the manifolds, namely metrically preferred representatives of middle dimension homology classes, we construct two different energy functionals which reproduce the Coulomb interaction energy for a system of charged particles.
Space Charge Correction on Emittance Measurement of Low Energy Electron Beams
Energy Technology Data Exchange (ETDEWEB)
Treado, Colleen J.; /Massachusetts U., Amherst
2012-09-07
The goal of any particle accelerator is to optimize the transport of a charged particle beam along a set path by confining the beam to a small region close to the design trajectory and directing it accurately along the beamline. To do so in the simplest fashion, accelerators use a system of magnets that exert approximately linear electromagnetic forces on the charged beam. These electromagnets bend the beam along the desired path, in the case of bending magnets, and constrain the beam to the desired area through alternating focusing and defocusing effects, in the case of quadrupole magnets. We can model the transport of such a beam through transfer matrices representing the actions of the various beamline elements. However, space charge effects, produced from self electric fields within the beam, defocus the beam and must be accounted for in the calculation of beam emittance. We present below the preliminary results of a MATLAB code built to model the transport of a charged particle beam through an accelerator and measure the emittance under the influence of space charge effects. We demonstrate the method of correctly calculating the emittance of a beam under space charge effects using a least square fit to determine the initial properties of the beam given the beam size measured at a specific point after transport.
Adhikary, Prajwal; Venkatesan, Swaminathan; Adhikari, Nirmal; Maharjan, Purna P; Adebanjo, Olusegun; Chen, Jihua; Qiao, Qiquan
2013-10-21
In this work, the electron transport layer of PBDTTT-C-T/PC70BM polymer solar cells were subjected to UV-ozone treatment, leading to improved cell performances from 6.46% to 8.34%. The solar cell efficiency reached a maximum of 8.34% after an optimal 5 minute UV-ozone treatment, and then decreased if treated for a longer time. To the best of our knowledge, the mechanism behind the effects of UV-ozone treatment on the improvement of charge transport and cell performance is not fully understood. We have developed a fundamental understanding of the UV-ozone treatment mechanism, which explains both the enhancements in charge transport and photovoltaic performance at an optimal treatment time, and also the phenomenon whereby further treatment time leads to a drop in cell efficiency. Transient photocurrent measurements indicated that the cell charge transport times were 1370 ns, 770 ns, 832 ns, 867 ns, and 1150 ns for the 0 min, 5 min, 10 min, 15 min, and 20 min UV-ozone treatment times, respectively. Therefore the 5 min UV-ozone treatment time led to the shortest transport time and the most efficient charge transport in the cells. The 5 min UV-ozone treated sample exhibited the highest peak intensity (E2) in the Raman spectra of the treated films, at about 437 cm(-1), indicating that it possessed the best wurtzite phase crystallinity of the ZnO films. Further increasing the UV-ozone treatment time from 5 to 20 min induced the formation of p-type defects (e.g. interstitial oxygen atoms), pushing the ZnO Fermi-level further away from the vacuum level, and decreasing the wurtzite crystallinity.
Geant4-based simulations of charge collection in CMOS Active Pixel Sensors
International Nuclear Information System (INIS)
Esposito, M.; Allinson, N.M.; Price, T.; Anaxagoras, T.
2017-01-01
Geant4 is an object-oriented toolkit for the simulation of the interaction of particles and radiation with matter. It provides a snapshot of the state of a simulated particle in time, as it travels through a specified geometry. One important area of application is the modelling of radiation detector systems. Here, we extend the abilities of such modelling to include charge transport and sharing in pixelated CMOS Active Pixel Sensors (APSs); though similar effects occur in other pixel detectors. The CMOS APSs discussed were developed in the framework of the PRaVDA consortium to assist the design of custom sensors to be used in an energy-range detector for proton Computed Tomography (pCT). The development of ad-hoc classes, providing a charge transport model for a CMOS APS and its integration into the standard Geant4 toolkit, is described. The proposed charge transport model includes, charge generation, diffusion, collection, and sharing across adjacent pixels, as well as the full electronic chain for a CMOS APS. The proposed model is validated against experimental data acquired with protons in an energy range relevant for pCT.
Charge transport along luminescent oxide layers containing Si and SiC nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Jambois, O. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain)]. E-mail: ojambois@el.ub.es; Vila, A. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Pellegrino, P. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Carreras, J. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Perez-Rodriguez, A. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Garrido, B. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Bonafos, C. [Nanomaterials Group, CEMES-CNRS, 29 rue J. Marvig 31055, Toulouse (France); BenAssayag, G. [Nanomaterials Group, CEMES-CNRS, 29 rue J. Marvig 31055, Toulouse (France)
2006-12-15
The electrical conductivity of silicon oxides containing silicon and silicon-carbon nanoparticles has been investigated. By use of sequential Si{sup +} and C{sup +} ion implantations in silicon oxide followed by an annealing at 1100 deg. C, luminescent Si nanocrystals and SiC nanoparticles were precipitated. The characterization of the electrical transport has been carried out on two kinds of structures, allowing parallel or perpendicular transport, with respect to the substrate. The first type of samples were elaborated by means of a focus-ion-beam technique: electrical contacts to embedded nanoparticles were made by milling two nanotrenches on the sample surface until reaching the buried layer, then filling them with tungsten. The distance between the electrodes is about 100 nm. The second type of samples correspond to 40 nm thick typical MOS capacitors. The electron transport along the buried layer has shown a dramatic lowering of the electrical current, up to five orders of magnitude, when applying a sequence of voltages. It has been related to a progressive charge retention inside the nanoparticles, which, on its turn, suppresses the electrical conduction along the layer. On the other hand, the MOS capacitors show a reversible carrier charge and discharge effect that limits the current at low voltage, mostly due to the presence of C in the layers. A typical Fowler-Nordheim injection takes place at higher applied voltages, with a threshold voltage equal to 23 V.
The Role of Shape on Electronic Structure and Charge Transport in Faceted PbSe Nanocrystals
Kaushik, Ananth P.; Lukose, Binit; Clancy, Paulette
2014-01-01
We have determined the effect of shape on the charge transport characteristics of nanocrystals. Our study looked at the explicit determination of the electronic properties of faceted nanocrystals that essentially probe the limit of current
Burnett, Edmund K.
2018-02-26
Polymorphism, the ability for a given material to adopt multiple crystalline packing states, is a powerful approach for investigating how changes in molecular packing influence charge transport within organic semiconductors. In this study, a new
Burnett, Edmund K.; Ly, Jack; Niazi, Muhammad Rizwan; Zhang, Lei; McCuskey, Samantha R.; Amassian, Aram; Smilgies, Detlef-M.; Mannsfeld, Stefan C. B.; Briseno, Alejandro L.
2018-01-01
Polymorphism, the ability for a given material to adopt multiple crystalline packing states, is a powerful approach for investigating how changes in molecular packing influence charge transport within organic semiconductors. In this study, a new
Enhancement of charge-transport characteristics in polymeric films using polymer brushes
DEFF Research Database (Denmark)
Whiting, G.L.; Snaith, H.J.; Khodabakhsh, S.
2006-01-01
We show that charge-transporting polymer chains in the brush conformation can be synthesized from a variety of substrates of interest, displaying a high degree of stretching and showing up to a 3 orders of magnitude increase in current density normal to the substrate as compared with a spin......-coated film. These nanostructured polymeric films may prove to be suitable for electronic devices based on molecular semiconductors as current fabrication techniques often provide little control over film structure....
Finite Element in Angle Unit Sphere Meshing for Charged Particle Transport.
Energy Technology Data Exchange (ETDEWEB)
Ortega, Mario Ivan [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Drumm, Clifton R. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
2017-10-01
Finite element in angle formulations of the charged particle transport equation require the discretization of the unit sphere. In Sceptre, a three-dimensional surface mesh of a sphere is transformed into a two-dimensional mesh. Projection of a sphere onto a two-dimensional surface is well studied with map makers spending the last few centuries attempting to create maps that preserve proportion and area. Using these techniques, various meshing schemes for the unit sphere were investigated.
DEFF Research Database (Denmark)
Niedzialek, Dorota; Lemaur, Vincent; Dudenko, Dmytro
2013-01-01
Molecular modeling shows that longitudinal displacement of the backbones by a couple of ångströms has a profound impact on the electronic coupling mediating charge transport in a conjugated copolymer. These changes can be probed by monitoring the calculated X-ray scattering patterns and NMR chemi...... chemical shifts as a function of sliding of the polymer chains and comparing them to experiment....
Czech Academy of Sciences Publication Activity Database
Zajac, Vít; Němec, Hynek; Kužel, Petr
2016-01-01
Roč. 94, č. 11 (2016), 1-9, č. článku 115206. ISSN 1098-0121 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : terahertz spectroscopy * charge transport * TiO 2 * rutile * ultrafast spectroscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.736, year: 2014
Energy Technology Data Exchange (ETDEWEB)
Singha, R.K. [Department of Physics, Visva-Bharati, Santiniketan 731235 (India); Manna, S.; Bar, R.; Das, S. [Department of Physics, Indian Institute of Technology-Kharagpur, Kharagpur 721302 (India); Ray, S.K., E-mail: physkr@phy.iitkgp.ernet.in [Department of Physics, Indian Institute of Technology-Kharagpur, Kharagpur 721302 (India)
2017-06-15
Highlights: We have elaborately explained the individual Ge QD charging phenomena and current transport, which is very important to understand the Ge/Si nano devices. This paper will give a flavor to properly understand these phenomena linked together along with the photocurrent mechanism which is related to the Ge/Si valence band offset. • Both the CAFM and KPFM techniques point out the functionality of doping nature of the underneath Si substrate on the aforementioned characteristics of Ge QDs. • Analysis of the surface potential mapping using KPFM technique yields an approximate valence band offset measurement which is required to understand the intra-valence transition of holes for the realization of long wavelength infrared photodetector. • KPFM and CAFM can be utilized to explore the charging/discharging phenomena of dots and their composition variations. • Current-voltage (I–V) characteristics of the individual Ge QD strongly depends on the individual QD size. • Energy band diagrams for diamond tip and Ge QD shows the higher barrier for electrons and lower barrier for holes allowing the easy tunneling for holes to dominate the transport. - Abstract: It is fundamentally important to understand the nanoscale electronic properties of a single quantum dot (QD) contrary to an ensemble of QDs. Kelvin probe force microscopy (KPFM) and conductive atomic force microscopy (CAFM) are two important tools, which could be employed to probe surface potential, charging phenomena, and current transport mechanism of individual QD. We demonstrate the aforementioned characteristics of self-assembled Ge QDs, which was grown on Si substrates by solid source molecular beam epitaxy driven by the Stranski-Krastanov method. Study reveals that each Ge QD acts as charge storage node even at zero applied bias. The shape, size and density of QDs could be well probed by CAFM and KPFM, whereas QD facets could be better resolved by the conductive tip. The CAFM investigation
Monte Carlo modeling of transport in PbSe nanocrystal films
Energy Technology Data Exchange (ETDEWEB)
Carbone, I., E-mail: icarbone@ucsc.edu; Carter, S. A. [University of California, Santa Cruz, California 95060 (United States); Zimanyi, G. T. [University of California, Davis, California 95616 (United States)
2013-11-21
A Monte Carlo hopping model was developed to simulate electron and hole transport in nanocrystalline PbSe films. Transport is carried out as a series of thermally activated hopping events between neighboring sites on a cubic lattice. Each site, representing an individual nanocrystal, is assigned a size-dependent electronic structure, and the effects of particle size, charging, interparticle coupling, and energetic disorder on electron and hole mobilities were investigated. Results of simulated field-effect measurements confirm that electron mobilities and conductivities at constant carrier densities increase with particle diameter by an order of magnitude up to 5 nm and begin to decrease above 6 nm. We find that as particle size increases, fewer hops are required to traverse the same distance and that site energy disorder significantly inhibits transport in films composed of smaller nanoparticles. The dip in mobilities and conductivities at larger particle sizes can be explained by a decrease in tunneling amplitudes and by charging penalties that are incurred more frequently when carriers are confined to fewer, larger nanoparticles. Using a nearly identical set of parameter values as the electron simulations, hole mobility simulations confirm measurements that increase monotonically with particle size over two orders of magnitude.
Anisotropic charged generalized polytropic models
Nasim, A.; Azam, M.
2018-06-01
In this paper, we found some new anisotropic charged models admitting generalized polytropic equation of state with spherically symmetry. An analytic solution of the Einstein-Maxwell field equations is obtained through the transformation introduced by Durgapal and Banerji (Phys. Rev. D 27:328, 1983). The physical viability of solutions corresponding to polytropic index η =1/2, 2/3, 1, 2 is analyzed graphically. For this, we plot physical quantities such as radial and tangential pressure, anisotropy, speed of sound which demonstrated that these models achieve all the considerable physical conditions required for a relativistic star. Further, it is mentioned here that previous results for anisotropic charged matter with linear, quadratic and polytropic equation of state can be retrieved.
Charge carrier dynamics in thin film solar cells
Energy Technology Data Exchange (ETDEWEB)
Strothkaemper, Christian
2013-06-24
This work investigates the charge carrier dynamics in three different technological approaches within the class of thin film solar cells: radial heterojunctions, the dye solar cell, and microcrystalline CuInSe{sub 2}, focusing on charge transport and separation at the electrode, and the relaxation of photogenerated charge carriers due to recombination and energy dissipation to the phonon system. This work relies mostly on optical-pump terahertz-probe (OPTP) spectroscopy, followed by transient absorption (TA) and two-photon photoemission (2PPE). The charge separation in ZnO-electrode/In{sub 2}S{sub 3}-absorber core/shell nanorods, which represent a model system of a radial heterojunction, is analyzed by OPTP. It is concluded, that the dynamics in the absorber are determined by multiple trapping, which leads to a dispersive charge transport to the electrode that lasts over hundreds of picoseconds. The high trap density on the order of 10{sup 19}/cm{sup 3} is detrimental for the injection yield, which exhibits a decrease with increasing shell thickness. The heterogeneous electron transfer from a series of model dyes into ZnO proceeds on a time-scale of 200 fs. However, the photoconductivity builds up just on a 2-10 ps timescale, and 2PPE reveals that injected electrons are meanwhile localized spatially and energetically at the interface. It is concluded that the injection proceeds through adsorbate induced interface states. This is an important result because the back reaction from long lived interface states can be expected to be much faster than from bulk states. While the charge transport in stoichiometric CuInSe{sub 2} thin films is indicative of free charge carriers, CuInSe{sub 2} with a solar cell grade composition (Cu-poor) exhibits signs of carrier localization. This detrimental effect is attributed to a high density of charged defects and a high degree of compensation, which together create a spatially fluctuating potential that inhibits charge transport. On
Quantized charge transport in chiral Majorana edge modes
Rachel, Stephan; Mascot, Eric; Cocklin, Sagen; Vojta, Matthias; Morr, Dirk K.
2017-11-01
Majorana fermions can be realized as quasiparticles in topological superconductors, with potential applications in topological quantum computing. Recently, lattices of magnetic adatoms deposited on the surface of s -wave superconductors—Shiba lattices—have been proposed as a new platform for topological superconductivity. These systems possess the great advantage that they are accessible via scanning-probe techniques and thus enable the local manipulation and detection of Majorana modes. Using a nonequilibrium Green's function technique we demonstrate that the topological Majorana edge modes of nanoscopic Shiba islands display universal electronic and transport properties. Most remarkably, these Majorana modes possess a quantized charge conductance that is proportional to the topological Chern number, C , and carry a supercurrent whose chirality reflects the sign of C . These results establish nanoscopic Shiba islands as promising components in future topology-based devices.
Charge transport through DNA/DNA duplexes and DNA/RNA hybrids: complex mechanism study
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Irena; Vala, M.; Weiter, M.; Špérová, M.; Schneider, Bohdan; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír
2013-01-01
Roč. 20, č. 1 (2013), s. 9-9 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /11./. 14.03.2013-16.03.2013, Nové Hrady] Institutional support: RVO:61388963 ; RVO:68378271 ; RVO:86652036 Keywords : charge transport * fluorescence spectroscopy * DFT Subject RIV: CF - Physical ; Theoretical Chemistry
Electron beam charging of insulators: A self-consistent flight-drift model
International Nuclear Information System (INIS)
Touzin, M.; Goeuriot, D.; Guerret-Piecourt, C.; Juve, D.; Treheux, D.; Fitting, H.-J.
2006-01-01
Electron beam irradiation and the self-consistent charge transport in bulk insulating samples are described by means of a new flight-drift model and an iterative computer simulation. Ballistic secondary electron and hole transport is followed by electron and hole drifts, their possible recombination and/or trapping in shallow and deep traps. The trap capture cross sections are the Poole-Frenkel-type temperature and field dependent. As a main result the spatial distributions of currents j(x,t), charges ρ(x,t), the field F(x,t), and the potential slope V(x,t) are obtained in a self-consistent procedure as well as the time-dependent secondary electron emission rate σ(t) and the surface potential V 0 (t). For bulk insulating samples the time-dependent distributions approach the final stationary state with j(x,t)=const=0 and σ=1. Especially for low electron beam energies E 0 G of a vacuum grid in front of the target surface. For high beam energies E 0 =10, 20, and 30 keV high negative surface potentials V 0 =-4, -14, and -24 kV are obtained, respectively. Besides open nonconductive samples also positive ion-covered samples and targets with a conducting and grounded layer (metal or carbon) on the surface have been considered as used in environmental scanning electron microscopy and common SEM in order to prevent charging. Indeed, the potential distributions V(x) are considerably small in magnitude and do not affect the incident electron beam neither by retarding field effects in front of the surface nor within the bulk insulating sample. Thus the spatial scattering and excitation distributions are almost not affected
Energy Technology Data Exchange (ETDEWEB)
Randrup, J.
1979-07-01
This lecture discusses a theory for the transport of mass, charge, linear, and angular momentum and energy in damped nuclear collisions, as induced by multiple transfer of individual nucleons. 11 references.
Paterson, Alexandra F.
2017-12-27
Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.
Paterson, Alexandra F.; Lin, Yen-Hung; Mottram, Alexander D.; Fei, Zhuping; Niazi, Muhammad Rizwan; Kirmani, Ahmad R.; Amassian, Aram; Solomeshch, Olga; Tessler, Nir; Heeney, Martin; Anthopoulos, Thomas D.
2017-01-01
Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.
Feasibility Study of a Solar-Powered Electric Vehicle Charging Station Model
Directory of Open Access Journals (Sweden)
Bin Ye
2015-11-01
Full Text Available In China, the power sector is currently the largest carbon emitter and the transportation sector is the fastest-growing carbon emitter. This paper proposes a model of solar-powered charging stations for electric vehicles to mitigate problems encountered in China’s renewable energy utilization processes and to cope with the increasing power demand by electric vehicles for the near future. This study applies the proposed model to Shenzhen City to verify its technical and economic feasibility. Modeling results showed that the total net present value of a photovoltaic power charging station that meets the daily electricity demand of 4500 kWh is $3,579,236 and that the cost of energy of the combined energy system is $0.098/kWh. In addition, the photovoltaic powered electric vehicle model has pollutant reduction potentials of 99.8%, 99.7% and 100% for carbon dioxide, sulfur dioxide, and nitrogen oxides, respectively, compared with a traditional gasoline-fueled car. Sensitivity analysis results indicated that interest rate has a relatively strong influence on COE (Cost of Energy. An increase in the interest rate from 0% to 6% increases COE from $0.027/kWh to $0.097/kWh. This analysis also suggests that carbon pricing promotes renewable energy only when the price of carbon is above $20/t.
DEFF Research Database (Denmark)
Larsen, Erik Hviid; Sørensen, Jakob Balslev; Sørensen, Jens Nørkær
2000-01-01
those of tight junction and interspace basement membrane by convection-diffusion. With solute permeability of paracellular pathway large relative to paracellular water flow, the paracellular flux ratio of the solute (influx/outflux) is small (2-4) in agreement with experiments. The virtual solute......A mathematical model of an absorbing leaky epithelium is developed for analysis of solute coupled water transport. The non-charged driving solute diffuses into cells and is pumped from cells into the lateral intercellular space (lis). All membranes contain water channels with the solute passing...... increases with hydraulic conductance of the pathway carrying water from mucosal solution into lis. Uphill water transport is accomplished, but with high hydraulic conductance of cell membranes strength of transport is obscured by water flow through cells. Anomalous solvent drag occurs when back flux...
DEFF Research Database (Denmark)
Ryuzaki, Sou; Meyer, Jakob Abild Stengaard; Petersen, Søren Vermehren
2014-01-01
Charge transport properties of chemically reduced graphene oxide (RGO) sheets prepared by treatment with hydrazine were examined using conductive atomic force microscopy. The current-voltage (I-V) characteristics of monolayer RGO sheets prepared under atmospheric pressure followed an exponentially...
International Nuclear Information System (INIS)
Ghaznavi, Mahmoudreza; Chen, P.
2014-01-01
Highlights: • The discharge behavior of Li-S cells in wide range of exchange current densities of electrochemical reactions is studied. • Among all reduction reactions, 1/2 S 8(l) +e − ⇌1/2 S 8 2− and 1/2 S 2 2− +e − ⇌2S 2− play the most important role in capacity performance. • Low diffusion increases the precipitation of polysulfides in separator which may block the anode surface. • Large solubility of Li 2 S is needed for the model to be able to simulate the charging process. - Abstract: Sensitivity analysis of a mathematical model of a lithium-sulfur (Li-S) battery was performed by investigating the response of the model to variation of the exchange current densities, diffusion coefficients, and cathode thickness over a wide range; the results of the analysis were used to explain the some aspects of the behavior of the system which may be seen in experiments. In particular, among all the exchange current densities, the exchange current density of the elemental sulfur reduction has the most significant effect on the discharge capacity of the cell. The variation of the diffusion coefficients was also analyzed, providing information on the non-uniformity of precipitants in the cell after discharge. An optimum cathode thickness was presented to gain the highest capacity of the cell. Finally, the simulation of charging was studied, showing that the model needs a large solubility product of di-lithium sulfide to be able to simulate the charge process of a cell
International Nuclear Information System (INIS)
Luo, Yugong; Zhu, Tao; Wan, Shuang; Zhang, Shuwei; Li, Keqiang
2016-01-01
The widespread use of electric vehicles (EVs) is becoming an imminent trend. Research has been done on the scheduling of EVs from the perspective of the charging characteristic, improvement in the safety and economy of the power grid, or the traffic jams in the transport system caused by a large number of EVs driven to charging stations. There is a lack of systematic studies considering EVs, the power grid, and the transport system all together. In this paper, a novel optimal charging scheduling strategy for different types of EVs is proposed based on not only transport system information, such as road length, vehicle velocity and waiting time, but also grid system information, such as load deviation and node voltage. In addition, a charging scheduling simulation platform suitable for large-scale EV deployment is developed based on actual charging scenarios. The simulation results show that the improvements in both the transport system efficiency and the grid system operation can be obtained by using the optimal strategy, such as the node voltage drop is decreased, the power loss is reduced, and the load curve is optimized. - Highlights: • A novel optimal charging scheduling strategy is proposed for different electric vehicles (EVs). • A simulation platform suitable for large-scale EV deployment is established. • The traffic congestion near the charging and battery-switch stations is relieved. • The safety and economy problems of the distribution network are solved. • The peak-to-valley load of the distribution system is reduced.
Martelli, Fausto; Vuilleumier, Rodolphe; Simonin, Jean-Pierre; Spezia, Riccardo
2012-10-01
In this work, we show how increasing the charge of small cations affects the structural, thermodynamical, and dynamical properties of these ions in liquid water. We have studied the case of lanthanoid and actinoid ions, for which we have recently developed accurate polarizable force fields, and the ionic radius is in the 0.995-1.250 Å range, and explored the valency range from 0 to 4+. We found that the ion charge strongly structures the neighboring water molecules and that, in this range of charges, the hydration enthalpies exhibit a quadratic dependence with respect to the charge, in line with the Born model. The diffusion process follows two main regimes: a hydrodynamical regime for neutral or low charges, and a dielectric friction regime for high charges in which the contraction of the ionic radius along the series of elements causes a decrease of the diffusion coefficient. This latter behavior can be qualitatively described by theoretical models, such as the Zwanzig and the solvated ion models. However, these models need be modified in order to obtain agreement with the observed behavior in the full charge range. We have thus modified the solvated ion model by introducing a dependence of the bare ion radius as a function of the ionic charge. Besides agreement between theory and simulation this modification allows one to obtain an empirical unified model. Thus, by analyzing the contributions to the drag coefficient from the viscous and the dielectric terms, we are able to explain the transition from a regime in which the effect of viscosity dominates to one in which dielectric friction governs the motion of ions with radii of ca. 1 Å.
Charge transport in anodic TiO.sub.2./sub. nanotubes studied by terahertz spectroscopy
Czech Academy of Sciences Publication Activity Database
Krbal, M.; Kuchařík, Jiří; Sopha, H.; Němec, Hynek; Macák, J. M.
2016-01-01
Roč. 10, č. 9 (2016), s. 691-695 ISSN 1862-6254 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : terahertz spectroscopy * charge transport * TiO2 nanotubes Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.032, year: 2016
Simple standard model extension by heavy charged scalar
Boos, E.; Volobuev, I.
2018-05-01
We consider a Standard Model (SM) extension by a heavy charged scalar gauged only under the UY(1 ) weak hypercharge gauge group. Such an extension, being gauge invariant with respect to the SM gauge group, is a simple special case of the well-known Zee model. Since the interactions of the charged scalar with the Standard Model fermions turn out to be significantly suppressed compared to the Standard Model interactions, the charged scalar provides an example of a long-lived charged particle being interesting to search for at the LHC. We present the pair and single production cross sections of the charged scalar at different colliders and the possible decay widths for various boson masses. It is shown that the current ATLAS and CMS searches at 8 and 13 TeV collision energy lead to the bounds on the scalar boson mass of about 300-320 GeV. The limits are expected to be much larger for higher collision energies and, assuming 15 a b-1 integrated luminosity, reach about 2.7 TeV at future 27 TeV LHC thus covering the most interesting mass region.
Advanced transport modeling of toroidal plasmas with transport barriers
International Nuclear Information System (INIS)
Fukuyama, A.; Murakami, S.; Honda, M.; Izumi, Y.; Yagi, M.; Nakajima, N.; Nakamura, Y.; Ozeki, T.
2005-01-01
Transport modeling of toroidal plasmas is one of the most important issue to predict time evolution of burning plasmas and to develop control schemes in reactor plasmas. In order to describe the plasma rotation and rapid transition self-consistently, we have developed an advanced scheme of transport modeling based on dynamical transport equation and applied it to the analysis of transport barrier formation. First we propose a new transport model and examine its behavior by the use of conventional diffusive transport equation. This model includes the electrostatic toroidal ITG mode and the electromagnetic ballooning mode and successfully describes the formation of internal transport barriers. Then the dynamical transport equation is introduced to describe the plasma rotation and the radial electric field self-consistently. The formation of edge transport barriers is systematically studied and compared with experimental observations. The possibility of kinetic transport modeling in velocity space is also examined. Finally the modular structure of integrated modeling code for tokamaks and helical systems is discussed. (author)
Arbabi, Vahid; Pouran, Behdad; Zadpoor, Amir A; Weinans, Harrie
2017-04-23
Osteoarthritis (OA) is a debilitating disease that is associated with degeneration of articular cartilage and subchondral bone. Degeneration of articular cartilage impairs its load-bearing function substantially as it experiences tremendous chemical degradation, i.e. proteoglycan loss and collagen fibril disruption. One promising way to investigate chemical damage mechanisms during OA is to expose the cartilage specimens to an external solute and monitor the diffusion of the molecules. The degree of cartilage damage (i.e. concentration and configuration of essential macromolecules) is associated with collisional energy loss of external solutes while moving across articular cartilage creates different diffusion characteristics compared to healthy cartilage. In this study, we introduce a protocol, which consists of several steps and is based on previously developed experimental micro-Computed Tomography (micro-CT) and finite element modeling. The transport of charged and uncharged iodinated molecules is first recorded using micro-CT, which is followed by applying biphasic-solute and multiphasic finite element models to obtain diffusion coefficients and fixed charge densities across cartilage zones.
Numerical model for radial transport in the ELMO Bumpy Torus
International Nuclear Information System (INIS)
Jaeger, E.F.; Hedrick, C.L.
1977-11-01
Neutral and charged particle densities and temperatures are calculated as functions of radius for the toroidal plasma in the ELMO Bumpy Torus (EBT) experiment. Energy dependent ionization and charge-exchange rates, ambipolar diffusion, and self-consistent radial electric field profiles are included. Variation in magnetic field due to finite plasma pressure, effects of energetic electron rings, and transport due to drift waves and magnetic field errors are neglected. Diffusion is assumed to be neoclassical with enhanced losses at low collisionalities. The model reproduces many of the observed features of EBT operation in the quiescent toroidal (T) mode. The self-consistently calculated electric field is everywhere positive (not as in experiments) unless enhanced electron collisionality is included. Solutions for advanced EBT's are obtained and confinement parameters predicted
Directory of Open Access Journals (Sweden)
Hannes Michaels
2018-05-01
Full Text Available In dye-sensitized solar cells (DSCs, the redox mediator is responsible for the regeneration of the oxidized dye and for the hole transport towards the cathode. Here, we introduce new copper complexes with tetradentate 6,6′-bis(4-(S-isopropyl-2-oxazolinyl-2,2′-bipyridine ligands, Cu(oxabpy, as redox mediators. Copper coordination complexes with a square-planar geometry show low reorganization energies and thus introduce smaller losses in photovoltage. Slow recombination kinetics of excited electrons between the TiO2 and CuII(oxabpy species lead to an exceptionally long electron lifetime, a high Fermi level in the TiO2, and a high photovoltage of 920 mV with photocurrents of 10 mA∙cm−2 and 6.2% power conversion efficiency. Meanwhile, a large driving force remains for the dye regeneration of the Y123 dye with high efficiencies. The square-planar Cu(oxabpy complexes yield viscous gel-like solutions. The unique charge transport characteristics are attributed to a superposition of diffusion and electronic conduction. An enhancement in charge transport performance of 70% despite the higher viscosity is observed upon comparison of Cu(oxabpy to the previously reported Cu(tmby2 redox electrolyte.
Space-Charge-Limited Emission Models for Particle Simulation
Verboncoeur, J. P.; Cartwright, K. L.; Murphy, T.
2004-11-01
Space-charge-limited (SCL) emission of electrons from various materials is a common method of generating the high current beams required to drive high power microwave (HPM) sources. In the SCL emission process, sufficient space charge is extracted from a surface, often of complicated geometry, to drive the electric field normal to the surface close to zero. The emitted current is highly dominated by space charge effects as well as ambient fields near the surface. In this work, we consider computational models for the macroscopic SCL emission process including application of Gauss's law and the Child-Langmuir law for space-charge-limited emission. Models are described for ideal conductors, lossy conductors, and dielectrics. Also considered is the discretization of these models, and the implications for the emission physics. Previous work on primary and dual-cell emission models [Watrous et al., Phys. Plasmas 8, 289-296 (2001)] is reexamined, and aspects of the performance, including fidelity and noise properties, are improved. Models for one-dimensional diodes are considered, as well as multidimensional emitting surfaces, which include corners and transverse fields.
International Nuclear Information System (INIS)
Printz, Adam D.; Lipomi, Darren J.
2016-01-01
The primary goal of the field concerned with organic semiconductors is to produce devices with performance approaching that of silicon electronics, but with the deformability—flexibility and stretchability—of conventional plastics. However, an inherent competition between deformability and charge transport has long been observed in these materials, and achieving the extreme (or even moderate) deformability implied by the word “plastic” concurrently with high charge transport may be elusive. This competition arises because the properties needed for high carrier mobilities—e.g., rigid chains in π-conjugated polymers and high degrees of crystallinity in the solid state—are antithetical to deformability. On the device scale, this competition can lead to low-performance yet mechanically robust devices, or high-performance devices that fail catastrophically (e.g., cracking, cohesive failure, and delamination) under strain. There are, however, some observations that contradict the notion of the mutual exclusivity of electronic and mechanical performances. These observations suggest that this problem may not be a fundamental trade-off, but rather an inconvenience that may be negotiated by a logical selection of materials and processing conditions. For example, the selection of the poly(3-alkylthiophene) with a critical side-chain length—poly(3-heptylthiophene) (n = 7)—marries the high deformability of poly(3-octylthiophene) (n = 8) with the high electronic performance (as manifested in photovoltaic efficiency) of poly(3-hexylthiophene) (n = 6). This review explores the relationship between deformability and charge transport in organic semiconductors. The principal conclusions are that reducing the competition between these two parameters is in fact possible, with two demonstrated routes being: (1) incorporation of softer, insulating material into a stiffer, semiconducting material and (2) increasing disorder in a highly ordered film, but not
Energy Technology Data Exchange (ETDEWEB)
Printz, Adam D.; Lipomi, Darren J., E-mail: dlipomi@ucsd.edu [Department of NanoEngineering, University of California, San Diego, 9500 Gilman Drive, Mail Code 0448, La Jolla, California 92093-0448 (United States)
2016-06-15
The primary goal of the field concerned with organic semiconductors is to produce devices with performance approaching that of silicon electronics, but with the deformability—flexibility and stretchability—of conventional plastics. However, an inherent competition between deformability and charge transport has long been observed in these materials, and achieving the extreme (or even moderate) deformability implied by the word “plastic” concurrently with high charge transport may be elusive. This competition arises because the properties needed for high carrier mobilities—e.g., rigid chains in π-conjugated polymers and high degrees of crystallinity in the solid state—are antithetical to deformability. On the device scale, this competition can lead to low-performance yet mechanically robust devices, or high-performance devices that fail catastrophically (e.g., cracking, cohesive failure, and delamination) under strain. There are, however, some observations that contradict the notion of the mutual exclusivity of electronic and mechanical performances. These observations suggest that this problem may not be a fundamental trade-off, but rather an inconvenience that may be negotiated by a logical selection of materials and processing conditions. For example, the selection of the poly(3-alkylthiophene) with a critical side-chain length—poly(3-heptylthiophene) (n = 7)—marries the high deformability of poly(3-octylthiophene) (n = 8) with the high electronic performance (as manifested in photovoltaic efficiency) of poly(3-hexylthiophene) (n = 6). This review explores the relationship between deformability and charge transport in organic semiconductors. The principal conclusions are that reducing the competition between these two parameters is in fact possible, with two demonstrated routes being: (1) incorporation of softer, insulating material into a stiffer, semiconducting material and (2) increasing disorder in a highly ordered film, but not
Li, Yuan
2014-12-03
We present a multiscale modeling of the infrared optical properties of the rubrene crystal. The results are in very good agreement with the experimental data that point to nonmonotonic features in the optical conductivity spectrum and small optical effective masses. We find that, in the static-disorder approximation, the nonlocal electron-phonon interactions stemming from low-frequency lattice vibrations can decrease the optical effective masses and lead to lighter quasiparticles. On the other hand, the charge-transport and infrared optical properties of the rubrene crystal at room temperature are demonstrated to be governed by localized carriers driven by inherent thermal disorders. Our findings underline that the presence of apparently light carriers in high-mobility organic semiconductors does not necessarily imply bandlike transport.
Li, Yuan; Yi, Yuanping; Coropceanu, Veaceslav; Bredas, Jean-Luc
2014-01-01
We present a multiscale modeling of the infrared optical properties of the rubrene crystal. The results are in very good agreement with the experimental data that point to nonmonotonic features in the optical conductivity spectrum and small optical effective masses. We find that, in the static-disorder approximation, the nonlocal electron-phonon interactions stemming from low-frequency lattice vibrations can decrease the optical effective masses and lead to lighter quasiparticles. On the other hand, the charge-transport and infrared optical properties of the rubrene crystal at room temperature are demonstrated to be governed by localized carriers driven by inherent thermal disorders. Our findings underline that the presence of apparently light carriers in high-mobility organic semiconductors does not necessarily imply bandlike transport.
Yaffe, O.; Qi, Y.; Scheres, L.M.W.; Puniredd, S.R.; Segev, L.; Ely, T.; Haick, H.; Zuilhof, H.; Vilan, A.; Kronik, L.; Kahn, A.; Cahen, D.
2012-01-01
We compare the charge transport characteristics of heavy-doped p(++)- and n(++)-Si-alkyl chain/Hg junctions. Based on negative differential resistance in an analogous semiconductor-inorganic insulator/metal junction we suggest that for both p(++)- and n(++)-type junctions, the energy difference
A transport-based model of material trends in nonproportionality of scintillators
International Nuclear Information System (INIS)
Li Qi; Grim, Joel Q.; Williams, R. T.; Bizarri, G. A.; Moses, W. W.
2011-01-01
Electron-hole pairs created by the passage of a high-energy electron in a scintillator radiation detector find themselves in a very high radial concentration gradient of the primary electron track. Since nonlinear quenching that is generally regarded to be at the root of nonproportional response depends on the fourth or sixth power of the track radius in a cylindrical track model, radial diffusion of charge carriers and excitons on the ∼10 picosecond duration typical of nonlinear quenching can compete with and thereby modify that quenching. We use a numerical model of transport and nonlinear quenching to examine trends affecting local light yield versus excitation density as a function of charge carrier and exciton diffusion coefficients. Four trends are found: (1) nonlinear quenching associated with the universal 'roll-off' of local light yield versus dE/dx is a function of the lesser of mobilities μ e and μ h or of D EXC as appropriate, spanning a broad range of scintillators and semiconductor detectors; (2) when μ e ≅μ h , excitons dominate free carriers in transport, the corresponding reduction of scattering by charged defects and optical phonons increases diffusion out of the track in competition with nonlinear quenching, and a rise in proportionality is expected; (3) when μ h e as in halide scintillators with hole self-trapping, the branching between free carriers and excitons varies strongly along the track, leading to a 'hump' in local light yield versus dE/dx; (4) anisotropic mobility can promote charge separation along orthogonal axes and leads to a characteristic shift of the 'hump' in halide local light yield. Trends 1 and 2 have been combined in a quantitative model of nonlinear local light yield which is predictive of empirical nonproportionality for a wide range of oxide and semiconductor radiation detector materials where band mass or mobility data are the determinative material parameters.
The programme library for numerical simulation of charged particle dynamics in transportation lines
International Nuclear Information System (INIS)
Aleksandrov, V.S.; Shevtsov, V.F.; Shirkov, G.D.; Batygin, Yu.K.
1998-01-01
The description of a PC codes library to simulate the beam transportation of charged particles is presented. The codes are realized on IBM PC in Visual Basic common interface. It is destined for the simulation and optimization of beam dynamics and based on the successive and consistent use of two methods: the momentum method of distribution functions (RMS technique) and the particle-particle method (PP-Method). The library allows to calculate the RMS parameters of electron and ion beams, passing through a set of quadrupoles, solenoids, bends, accelerating sections. The RMS code is a fast code very suitable for the first test, design and optimization of the beam line parameters. The PP code requires more time for execution but provides a high accuracy of simulation taking into account the space charge effects, aberrations and beam losses. One of the main advantages of PP code presented here is an ability to simulate a real multicomponent beam of different masses and charged states of ions from ion sources
Problems in Modelling Charge Output Accelerometers
Directory of Open Access Journals (Sweden)
Tomczyk Krzysztof
2016-12-01
Full Text Available The paper presents major issues associated with the problem of modelling change output accelerometers. The presented solutions are based on the weighted least squares (WLS method using transformation of the complex frequency response of the sensors. The main assumptions of the WLS method and a mathematical model of charge output accelerometers are presented in first two sections of this paper. In the next sections applying the WLS method to estimation of the accelerometer model parameters is discussed and the associated uncertainties are determined. Finally, the results of modelling a PCB357B73 charge output accelerometer are analysed in the last section of this paper. All calculations were executed using the MathCad software program. The main stages of these calculations are presented in Appendices A−E.
Solution-grown organic single-crystalline p-n junctions with ambipolar charge transport.
Fan, Congcheng; Zoombelt, Arjan P; Jiang, Hao; Fu, Weifei; Wu, Jiake; Yuan, Wentao; Wang, Yong; Li, Hanying; Chen, Hongzheng; Bao, Zhenan
2013-10-25
Organic single-crystalline p-n junctions are grown from mixed solutions. First, C60 crystals (n-type) form and, subsequently, C8-BTBT crystals (p-type) nucleate heterogeneously on the C60 crystals. Both crystals continue to grow simultaneously into single-crystalline p-n junctions that exhibit ambipolar charge transport characteristics. This work provides a platform to study organic single-crystalline p-n junctions. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Numerical and experimental investigation on static electric charge model at stable cone-jet region
Hashemi, Ali Reza; Pishevar, Ahmad Reza; Valipouri, Afsaneh; Pǎrǎu, Emilian I.
2018-03-01
In a typical electro-spinning process, the steady stretching process of the jet beyond the Taylor cone has a significant effect on the dimensions of resulting nanofibers. Also, it sets up the conditions for the onset of the bending instability. The focus of this work is the modeling and simulation of the initial stable jet phase seen during the electro-spinning process. The perturbation method was applied to solve hydrodynamic equations, and the electrostatic equation was solved by a boundary integral method. These equations were coupled with the stress boundary conditions derived appropriate at the fluid-fluid interface. Perturbation equations were discretized by the second-order finite difference method, and the Newton method was implemented to solve the discretized nonlinear system. Also, the boundary element method was utilized to solve the electrostatic equation. In the theoretical study, the fluid is described as a leaky dielectric with charges only on the jet surface in dielectric air. In this study, electric charges were modeled as static. Comparison of numerical and experimental results shows that at low flow rates and high electric field, good agreement was achieved because of the superior importance of the charge transport by conduction rather than convection and charge concentration. In addition, the effect of unevenness of the electric field around the nozzle tip was experimentally studied through plate-plate geometry as well as point-plate geometry.
Directory of Open Access Journals (Sweden)
Ahmad Irfan
2016-05-01
Full Text Available We designed novel derivatives of 4,6-di(thiophen-2-ylpyrimidine (DTP. Two benchmark strategies including mesomerically deactivating group, as well as the extension of π-conjugation bridge (acene-fusion have been employed to enhance the electrical and charge transport properties. The density functional theory (DFT and time dependent DFT methods have been used to get optimized geometries in ground and first excited state, respectively. The structural properties (geometric parameters, electronic properties (frontier molecular orbitals; highest occupied and lowest unoccupied molecular orbitals, photophysical properties (absorption, fluorescence and phosphorescence, and important charge transport properties are discussed to establish a molecular level structure–property relationship among these derivatives. Our calculated electronic spectra i.e., absorption, fluorescence and phosphorescence have been found in good semi-quantitative agreement with available experimental data. All the newly designed derivatives displayed significantly improved electron injection ability than those of the parent molecule. The values of reorganization energy and transfer integral elucidate that DTP is a potential hole transport material. Based on our present investigation, it is expected that the naphtho and anthra derivatives of DTP are better hole transporters than those of some well-known charge transporter materials like naphthalene, anthracene, tetracene and pentacene.
Modeling and Analyzing Electric Vehicle Charging
DEFF Research Database (Denmark)
Andersen, Ove; Krogh, Benjamin Bjerre; Thomsen, Christian
2016-01-01
, such as wind turbines. To both enable a smart grid and the use of renewable energy, it is essential to know when and where an EV is plugged into the power grid and what battery capacity is available. In this paper, we present a generic spatio-temporal data-warehouse model for storing detailed information...... on all aspects of charging EVs, including integration with the electricity prices from a spot market. The proposed data warehouse is fully implemented and currently contains 2.5 years of charging data from 176 EVs. We describe the date warehouse model and the implementation including complex operations...
Space Charge Compensation in the Linac4 Low Energy Beam Transport Line with Negative Hydrogen Ions
Valerio-Lizarraga, C; Leon-Monzon, I; Lettry, J; Midttun, O; Scrivens, R
2014-01-01
The space charge effect of low energy, unbunched ion beams can be compensated by the trapping of ions or electrons into the beam potential. This has been studied for the 45 keV negative hydrogen ion beam in the CERN Linac4 Low Energy Beam Tranport (LEBT) using the package IBSimu1, which allows the space charge calculation of the particle trajectories. The results of the beam simulations will be compared to emittance measurements of an H- beam at the CERN Linac4 3 MeV test stand, where the injection of hydrogen gas directly into the beam transport region has been used to modify the space charge compensation degree.
Localized Models of Charged Particle Motion in Martian Crustal Magnetic Cusps
Brain, D. A.; Poppe, A. R.; Jarvinen, R.; Dong, Y.; Egan, H. L.; Fang, X.
2017-12-01
The induced magnetosphere of Mars is punctuated by localized but strong crustal magnetic fields that are observed to play host to a variety of phenomena typically associated with global magnetic fields, such as auroral processes and particle precipitation, field-aligned current systems, and ion outflow. Each of these phenomena occur on the night side, in small-scale magnetic `cusp' regions of vertically aligned field. Cusp regions are not yet capable of being spatially resolved in global scale models that include the ion kinetics necessary for simulating charged particle transport along cusps. Local models are therefore necessary if we are to understand how cusp processes operate at Mars. Here we present the first results of an effort to model the kinetic particle motion and electric fields in Martian cusps. We are adapting both a 1.5D Particle-in-Cell (PIC) model for lunar magnetic cusps regions to the Martian case and a hybrid model framework (used previously for the global Martian plasma interaction and for lunar magnetic anomaly regions) to cusps in 2D. By comparing the models we can asses the importance of electron kinetics in particle transport along cusp field lines. In this first stage of our study we model a moderately strong nightside cusp, with incident hot hydrogen plasma from above, and cold planetary (oxygen) plasma entering the simulation from below. We report on the spatial and temporal distribution of plasma along cusp field lines for this initial case.
International Nuclear Information System (INIS)
McGraw, M.
2000-01-01
The UZ Colloid Transport model development plan states that the objective of this Analysis/Model Report (AMR) is to document the development of a model for simulating unsaturated colloid transport. This objective includes the following: (1) use of a process level model to evaluate the potential mechanisms for colloid transport at Yucca Mountain; (2) Provide ranges of parameters for significant colloid transport processes to Performance Assessment (PA) for the unsaturated zone (UZ); (3) Provide a basis for development of an abstracted model for use in PA calculations
Droplet-model predictions of charge moments
International Nuclear Information System (INIS)
Myers, W.D.
1982-04-01
The Droplet Model expressions for calculating various moments of the nuclear charge distribution are given. There are contributions to the moments from the size and shape of the system, from the internal redistribution induced by the Coulomb repulsion, and from the diffuseness of the surface. A case is made for the use of diffuse charge distributions generated by convolution as an alternative to Fermi-functions
Watanabe, Takeshi; Koganezawa, Tomoyuki; Kikuchi, Mamoru; Muraoka, Hiroki; Ogawa, Satoshi; Yoshimoto, Noriyuki; Hirosawa, Ichiro
2018-03-01
We propose an in situ experimental method of investigating the correlations of the film coverage of the organic semiconductor layers and charge transport properties of organic thin film transistors during vacuum deposition. The coverage of each monolayer was estimated using the intensity of off-specular diffuse scattering and diffraction. Experimental data were obtained from the in situ measurements of two-dimensional grazing incidence X-ray scattering and charge transport. The source-drain current increased over the film coverage of the first monolayer (= 0.48). This is in agreement with the critical percolation coverage, indicating that the conductivities of the first and second monolayers are different.
Vertical Charge Transport and Negative Transconductance in Multilayer Molybdenum Disulfides.
Liu, Yuan; Guo, Jian; He, Qiyuan; Wu, Hao; Cheng, Hung-Chieh; Ding, Mengning; Shakir, Imran; Gambin, Vincent; Huang, Yu; Duan, Xiangfeng
2017-09-13
Negative transconductance (NTC) devices have been heavily investigated for their potential in low power logical circuit, memory, oscillating, and high-speed switching applications. Previous NTC devices are largely attributed to two working mechanisms: quantum mechanical tunneling, and mobility degradation at high electrical field. Herein we report a systematic investigation of charge transport in multilayer two-dimensional semiconductors (2DSCs) with optimized van der Waals contact and for the first time demonstrate NTC and antibipolar characteristics in multilayer 2DSCs (such as MoS 2 , WSe 2 ). By varying the measurement temperature, bias voltage, and body thickness, we found the NTC behavior can be attributed to a vertical potential barrier in the multilayer 2DSCs and the competing mechanisms between intralayer lateral transport and interlayer vertical transport, thus representing a new working mechanism for NTC operation. Importantly, this vertical potential barrier arises from inhomogeneous carrier distribution in 2DSC from the near-substrate region to the bulk region, which is in contrast to conventional semiconductors with homogeneous doping defined by bulk dopants. We further show that the unique NTC behavior can be explored for creating frequency doublers and phase shift keying circuits with only one transistor, greatly simplifying the circuit design compared to conventional technology.
Modeling and simulation of a proton beam space-charge neutralization
International Nuclear Information System (INIS)
Fleury, Xavier
2000-01-01
The aim of this work is to understand and to model the build-up of a plasma in the low-energy beam transport line of a proton accelerator. This plasma is generated by the beam, which ionizes the residual gas remaining in this low-energy section. By neutralizing the space-charge of the beam, the plasma modifies its transport, thus, to control the beam, it is necessary to study this phenomenon. In this work, we consider a continuous beam and we take interest in the stationary states of the plasma. We first restrict the description of the plasma to a plane perpendicular to the beam, by assuming that the beam and the plasma are longitudinally invariant. The build-up of the plasma is first described with a kinetic model where binary collisions are neglected, based on the Vlasov-Poisson system with source terms which take into account ionization. We prove mathematically that this system has no stationary solution, by using appropriate subsets of the phase-space that we call trapping-sets. Yet, measurements show that the plasma evolves towards a steady state. To account for this evolution, we modify the source terms of the model. The resulting model is solved by a particle-in-cell method, and the results are compared to the measurements. Then, we show that binary collisions between plasma electrons and beam ions or gas molecules help to maintain the equilibrium of the plasma. In the last part of the thesis, we use hydrodynamic models to investigate more easily the coupling between transversal and longitudinal effects. The preliminary study of a one-dimensional model enables to find the behaviour of the transverse potential of the plasma. Finally, a two-dimensional model of the transport of the beam when it is neutralized by the plasma is solved numerically, which shows that the longitudinal electric field should play an important role in the set-up of the equilibrium of the plasma. (author) [fr
Charge carrier transport properties in layer structured hexagonal boron nitride
Directory of Open Access Journals (Sweden)
T. C. Doan
2014-10-01
Full Text Available Due to its large in-plane thermal conductivity, high temperature and chemical stability, large energy band gap (˜ 6.4 eV, hexagonal boron nitride (hBN has emerged as an important material for applications in deep ultraviolet photonic devices. Among the members of the III-nitride material system, hBN is the least studied and understood. The study of the electrical transport properties of hBN is of utmost importance with a view to realizing practical device applications. Wafer-scale hBN epilayers have been successfully synthesized by metal organic chemical deposition and their electrical transport properties have been probed by variable temperature Hall effect measurements. The results demonstrate that undoped hBN is a semiconductor exhibiting weak p-type at high temperatures (> 700 °K. The measured acceptor energy level is about 0.68 eV above the valence band. In contrast to the electrical transport properties of traditional III-nitride wide bandgap semiconductors, the temperature dependence of the hole mobility in hBN can be described by the form of μ ∝ (T/T0−α with α = 3.02, satisfying the two-dimensional (2D carrier transport limit dominated by the polar optical phonon scattering. This behavior is a direct consequence of the fact that hBN is a layer structured material. The optical phonon energy deduced from the temperature dependence of the hole mobility is ħω = 192 meV (or 1546 cm-1, which is consistent with values previously obtained using other techniques. The present results extend our understanding of the charge carrier transport properties beyond the traditional III-nitride semiconductors.
Yu, Man; Wang, Yi; Wang, Hao-Yi; Han, Jun; Qin, Yujun; Zhang, Jian-Ping; Ai, Xi-Cheng
2016-10-01
The photovoltaic performance of planar perovskite solar cell is significantly influenced by the morphology of perovskite film. In this work, five kinds of devices with different perovskite film morphologies were prepared by varying the concentration of CH3NH3Cl in precursor solutions. We found that best morphology of perovskite film results in the excellent photovoltaic performance with an average efficiency of 15.52% and a champion efficiency of 16.38%. Transient photovoltage and photocurrent measurements are performed to elucidate the mechanism of photoelectric conversion processes, which shows that the charge recombination is effectively suppressed and the charge transport is obviously promoted by optimized morphology.
Das, Kalipada
2017-10-01
In our present study, we address in detail the magnetic and magneto-transport properties of ferromagnetic-charge ordered core-shell nanostructures. In these core-shell nanostructures, well-known half metallic La0.67Sr0.33MnO3 nanoparticles (average particle size, ˜20 nm) are wrapped by the charge ordered antiferromagnetic Pr0.67Ca0.33MnO3 (PCMO) matrix. The intrinsic properties of PCMO markedly modify it into such a core-shell form. The robustness of the PCMO matrix becomes fragile and melts at an external magnetic field (H) of ˜20 kOe. The analysis of magneto-transport data indicates the systematic reduction of the electron-electron and electron-magnon interactions in the presence of an external magnetic field in these nanostructures. The pronounced training effect appears in this phase separated compound, which was analyzed by considering the second order tunneling through the grain boundaries of the nanostructures. Additionally, the analysis of low field magnetoconductance data supports the second order tunneling and shows the close value of the universal limit (˜1.33).
Charge transport in DNA oligonucleotides with various base-pairing patterns
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Irena; Todorciuc, Tatiana; Král, Karel; Němec, Hynek; Bunček, M.; Šebera, Jakub; Záliš, Stanislav; Vokáčová, Zuzana; Sychrovský, Vladimír; Bednárová, Lucie; Mojzeš, P.; Schneider, Bohdan
2010-01-01
Roč. 114, č. 15 (2010), 5196–5205 ISSN 1520-6106 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA ČR GA202/07/0643; GA AV ČR IAA400550701; GA AV ČR KAN200100801; GA AV ČR KAN100400702; GA ČR GA202/09/0193 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z40400503; CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : DNA * charge transport * Scanning Tunneling Microscopy Subject RIV: CC - Organic Chemistry Impact factor: 3.603, year: 2010
Energy Technology Data Exchange (ETDEWEB)
Liu, Yuanyuan; Zhang, Changyong; Hu, Dehong; Kuhlenschmidt, Mark S.; Kuhlenschmidt, Theresa B.; Mylon, Steven E.; Kong, Rong; Bhargava, Rohit; Nguyen, Thanh H.
2013-02-04
The role of collector surface charge heterogeneity on transport of Cryptosporidium parvum oocyst and carboxylate microsphere in 2-dimensional micromodels was studied. The cylindrical silica collectors within the micromodels were coated with 0, 10, 20, 50 and 100% Fe2O3 patches. The experimental values of average single collector removal efficiencies (η) of the Fe2O3 patches and on the entire collectors were determined. In the presence of significant (>3500 kT) Derjaguin–Landau–Verwey–Overbeek (DLVO) energy barrier between the microspheres and the silica collectors at pH 5.8 and 8.1, the values of η determined for Fe2O3 patches were significantly less (p < 0.05, t-test) than that obtained for collectors coated entirely with Fe2O3. However, η on Fe2O3 patches for microspheres at pH 4.4 and for oocysts at pH 5.8 and 8.1, where the DLVO energy barrier was relatively small (ca. 200-360 kT), were significantly greater (p < 0.05, t-test) than that on the collectors coated entirely with Fe2O3. The dependence of η determined for Fe2O3 patches on the DLVO energy barrier indicated the importance of periodic favorable and unfavorable electrostatic interactions between colloids and collectors with alternating Fe2O3 and silica patches. Differences between experimentally determined η and that predicted by a patchwise geochemical heterogeneous model was observed, but can be explained by the model’s lack of consideration for the spatial distribution of charge heterogeneity on the collector surface and colloid migration on patchwise heterogeneous collectors.
A Process-Based Transport-Distance Model of Aeolian Transport
Naylor, A. K.; Okin, G.; Wainwright, J.; Parsons, A. J.
2017-12-01
We present a new approach to modeling aeolian transport based on transport distance. Particle fluxes are based on statistical probabilities of particle detachment and distributions of transport lengths, which are functions of particle size classes. A computational saltation model is used to simulate transport distances over a variety of sizes. These are fit to an exponential distribution, which has the advantages of computational economy, concordance with current field measurements, and a meaningful relationship to theoretical assumptions about mean and median particle transport distance. This novel approach includes particle-particle interactions, which are important for sustaining aeolian transport and dust emission. Results from this model are compared with results from both bulk- and particle-sized-specific transport equations as well as empirical wind tunnel studies. The transport-distance approach has been successfully used for hydraulic processes, and extending this methodology from hydraulic to aeolian transport opens up the possibility of modeling joint transport by wind and water using consistent physics. Particularly in nutrient-limited environments, modeling the joint action of aeolian and hydraulic transport is essential for understanding the spatial distribution of biomass across landscapes and how it responds to climatic variability and change.
Szymanski, Marek Z.; Kulszewicz-Bajer, Irena; Faure-Vincent, Jérôme; Djurado, David
2012-08-01
We have studied hole transport in triarylamine based dendrimer using space-charge-limited current transient technique. A mobility of 8 × 10-6 cm2/(V s) and a characteristic detrapping time of about 100 ms have been obtained. We found that quasi-ohmic contact is formed with gold. The obtained mobility differs from the apparent one given by the analysis of stationary current-voltage characteristics because of a limited contact efficiency. The comparison between transients obtained from fresh and aged samples reveals no change in mobility with aging. The deterioration of electrical properties is exclusively caused by trap formation and accumulation of ionic conducting impurities. Finally, repeated transient measurements have been applied to analyze the dynamics of charge trapping process.
International Nuclear Information System (INIS)
Wald, H.B.
1990-01-01
The 'PATH' codes are used to design magnetic optics subsystems for neutral particle beam systems. They include a 2-1/2D and three 3-D space charge models, two of which have recently been added. This paper describes the 3-D models and reports on preliminary benchmark studies in which these models are checked for stability as the cloud size is varied and for consistency with each other. Differences between the models are investigated and the computer time requirements for running these models are established
Magnetic fields for transporting charged beams
International Nuclear Information System (INIS)
Parzen, G.
1976-01-01
The transport of charged particle beams requires magnetic fields that must be shaped correctly and very accurately. During the last 20 years or so, many studies have been made, both analytically and through the use of computer programs, of various magnetic shapes that have proved to be useful. Many of the results for magnetic field shapes can be applied equally well to electric field shapes. A report is given which gathers together the results that have more general significance and would be useful in designing a configuration to produce a desired magnetic field shape. The field shapes studied include the fields in dipoles, quadrupoles, sextupoles, octupoles, septum magnets, combined-function magnets, and electrostatic septums. Where possible, empirical formulas are proposed, based on computer and analytical studies and on magnetic field measurements. These empirical formulas are often easier to use than analytical formulas and often include effects that are difficult to compute analytically. In addition, results given in the form of tables and graphs serve as illustrative examples. The field shapes studied include uniform fields produced by window-frame magnets, C-magnets, H-magnets, and cosine magnets; linear fields produced by various types of quadrupoles; quadratic and cubic fields produced by sextupoles and octupoles; combinations of uniform and linear fields; and septum fields with sharp boundaries
Energy Technology Data Exchange (ETDEWEB)
Nian, Qiong; Cheng, Gary J., E-mail: gjcheng@purdue.edu [Birck Nanotechnology Center, Purdue University, West Lafayette, Indiana 47906 (United States); School of Industrial Engineering, Purdue University, West Lafayette, Indiana 47906 (United States); Zhang, Martin Y. [School of Industrial Engineering, Purdue University, West Lafayette, Indiana 47906 (United States); Wang, Yuefeng [Birck Nanotechnology Center, Purdue University, West Lafayette, Indiana 47906 (United States); School of Materials Engineering, Purdue University, West Lafayette, Indiana 47906 (United States); Das, Suprem R.; Bhat, Venkataprasad S. [Birck Nanotechnology Center, Purdue University, West Lafayette, Indiana 47906 (United States); Huang, Fuqiang [Shanghai Institute of Ceramics, Chinese Academy of Science, Shanghai 200050 (China)
2014-09-15
There has been increasing needs for cost-effective and high performance thin film deposition techniques for photovoltaics. Among all deposition techniques, roll-to-roll printing of nanomaterials has been a promising method. However, the printed thin film contains many internal imperfections, which reduce the charge-collection performance. Here, direct pulse laser crystallization (DPLC) of photoactive nanoparticles-inks is studied to meet this challenge. In this study, copper indium selenite (CIS) nanoparticle-inks is applied as an example. Enhanced crystallinity, densified structure in the thin film is resulted after DLPC under optimal conditions. It is found that the decreased film internal imperfections after DPLC results in reducing scattering and multi-trapping effects. Both of them contribute to better charge-collection performance of CIS absorber material by increasing extended state mobility and carrier lifetime, when carrier transport and kinetics are coupled. Charge carrier transport was characterized after DPLC, showing mobility increased by 2 orders of magnitude. Photocurrent under AM1.5 illumination was measured and shown 10 times enhancement of integrated power density after DPLC, which may lead to higher efficiency in photo-electric energy conversion.
Goodman, Samuel M.; Noh, Hyunwoo; Singh, Vivek; Cha, Jennifer N.; Nagpal, Prashant
2015-02-01
Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers.
Energy Technology Data Exchange (ETDEWEB)
Goodman, Samuel M.; Singh, Vivek [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Noh, Hyunwoo [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering Program and Department of Nanoengineering, University of California, 9500 Gilman Drive, La Jolla, San Diego, California 92093 (United States); Cha, Jennifer N. [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering Program and Department of Nanoengineering, University of California, 9500 Gilman Drive, La Jolla, San Diego, California 92093 (United States); Materials Science and Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Nagpal, Prashant, E-mail: pnagpal@colorado.edu [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); BioFrontiers Institute, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Renewable and Sustainable Energy Institute, University of Colorado Boulder, 2445 Kittredge Loop, Boulder, Colorado 80309 (United States)
2015-02-23
Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers.
International Nuclear Information System (INIS)
Goodman, Samuel M.; Singh, Vivek; Noh, Hyunwoo; Cha, Jennifer N.; Nagpal, Prashant
2015-01-01
Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers
The Role of Electron Transport and Trapping in MOS Total-Dose Modeling
International Nuclear Information System (INIS)
Fleetwood, D.M.; Winokur, P.S.; Riewe, L.C.; Flament, O.; Paillet, P.; Leray, J.L.
1999-01-01
Radiation-induced hole and electron transport and trapping are fundamental to MOS total-dose models. Here we separate the effects of electron-hole annihilation and electron trapping on the neutralization of radiation-induced charge during switched-bias irradiation for hard and soft oxides, via combined thermally stimulated current (TSC) and capacitance-voltage measurements. We also show that present total-dose models cannot account for the thermal stability of deeply trapped electrons near the Si/SiO 2 interface, or the inability of electrons in deep or shallow traps to contribute to TSC at positive bias following (1) room-temperature, (2) high-temperature, or (3) switched-bias irradiation. These results require revisions of modeling parameters and boundary conditions for hole and electron transport in SiO 2 . The nature of deep and shallow electron traps in the near-interfacial SiO 2 is discussed
Modelling of an advanced charging system for electric vehicles
Hassan Jaafar, Abdul; Rahman, Ataur; Mohiuddin, A. K. M.; Rashid, Mahbubur
2017-03-01
Climate Change is recognized as one of the greatest environmental problem facing the World today and it has long been appreciated by governments that reducing the impact of the internal combustion (IC) engine powered motor vehicle has an important part to play in addressing this threat. In Malaysia, IC engine powered motor vehicle accounts almost 90% of the national greenhouse gas (GHG) emissions. The need to reduce the emission is paramount, as Malaysia has pledged to reduce 40% of CO2 intensity by 2020 from 2005 level by 25% of improvement in average fuel consumption. The introduction of electric vehicles (EVs) is one of the initiatives. However in terms of percentage, the electric vehicles have not been commonly used by people nowadays and one of the reasons is lack in charging infrastructure especially when cars are on the road. The aim of this study is to simulate and model an advanced charging system for the charging infrastructure of EVs/HEVs all over the nation with slow charging mode with charging current 25 A, medium charging mode with charging current 50 A and fast charging mode with charging current 100 A. The slow charging mode is proposed for residence, medium charging mode for office parking lots, and fast charging mode is called fast charging track for charging station on road. With three modes charger topology, consumers could choose a suitable mode for their car based on their need. The simulation and experiment of advanced charging system has been conducted on a scale down battery pack of nominal voltage of 3.75 V and capacity of 1020 mAh. Result shows that the battery could be charging less than 1 hour with fast charging mode. However, due to limitation of Tenaga Nasional Berhad (TNB) power grid, the maximum 50 A current is considered to be the optimized passive mode for the EV’s battery charging system. The developed advanced charger prototype performance has been compared with the simulation result and conventional charger performance, the
Energy Technology Data Exchange (ETDEWEB)
Reemts, J.
2006-05-18
During the last decades, zinc oxide has attracted a lot of attention as an important material in various electrical, chemical, and optical applications. In the present work results are discussed gained from investigations of highly porous electrochemically deposited zinc oxide, which is a promising electrode material both in the area of solar energy conversion and sensor technology. The films were prepared by adding detergents during the electrodeposition process. The detergents have a structure-directing influence during the film deposition and, therefore, on the morphology of the films. The obtained electrodes can easily be sensitized for light or different chemicals by a simple adsorption of different molecules. In the present work I discuss the fundamental charge transport properties of electrochemically deposited zinc oxide films. Temperature-dependent measurements of the current-voltage characteristics are carried out and the spectral response of the photoconductivity is investigated. In order to understand the charge transport properties of this highly porous material, it is necessary to get a deeper insight in the electrode morphology. Therefore, different optical and scanning probe microscopy methods are used to characterize the inner structure of the electrodes. The electrical conductivity of the zinc oxide films can be seen as a thermally activated process, which can be explained by electronic transitions from the valence band of the zinc oxide to two shallow impurity levels. The current-voltage characteristic unveils a nonlinear behavior which can be explained by a space-charge-limited current model with traps distributed in energy. Upon excitation with different wavelengths, the conductivity of the zinc oxide increases already under sub-band gap illumination due to widely distributed trap states within the band gap. The transients of the photoconductivity follow a stretched exponential law with time scales in the range of several hours, either if the
International Nuclear Information System (INIS)
Seamster, Pamela E; Loewenberg, Michael; Pascal, Jennifer; Chauviere, Arnaud; Gonzales, Aaron; Cristini, Vittorio; Bearer, Elaine L
2012-01-01
The kinesins have long been known to drive microtubule-based transport of sub-cellular components, yet the mechanisms of their attachment to cargo remain a mystery. Several different cargo-receptors have been proposed based on their in vitro binding affinities to kinesin-1. Only two of these—phosphatidyl inositol, a negatively charged lipid, and the carboxyl terminus of the amyloid precursor protein (APP-C), a trans-membrane protein—have been reported to mediate motility in living systems. A major question is how these many different cargo, receptors and motors interact to produce the complex choreography of vesicular transport within living cells. Here we describe an experimental assay that identifies cargo–motor receptors by their ability to recruit active motors and drive transport of exogenous cargo towards the synapse in living axons. Cargo is engineered by derivatizing the surface of polystyrene fluorescent nanospheres (100 nm diameter) with charged residues or with synthetic peptides derived from candidate motor receptor proteins, all designed to display a terminal COOH group. After injection into the squid giant axon, particle movements are imaged by laser-scanning confocal time-lapse microscopy. In this report we compare the motility of negatively charged beads with APP-C beads in the presence of glycine-conjugated non-motile beads using new strategies to measure bead movements. The ensuing quantitative analysis of time-lapse digital sequences reveals detailed information about bead movements: instantaneous and maximum velocities, run lengths, pause frequencies and pause durations. These measurements provide parameters for a mathematical model that predicts the spatiotemporal evolution of distribution of the two different types of bead cargo in the axon. The results reveal that negatively charged beads differ from APP-C beads in velocity and dispersion, and predict that at long time points APP-C will achieve greater progress towards the presynaptic
Alternate mutation based artificial immune algorithm for step fixed charge transportation problem
Directory of Open Access Journals (Sweden)
Mahmoud Moustafa El-Sherbiny
2012-07-01
Full Text Available Step fixed charge transportation problem (SFCTP is considered as a special version of the fixed-charge transportation problem (FCTP. In SFCTP, the fixed cost is incurred for every route that is used in the solution and is proportional to the amount shipped. This cost structure causes the value of the objective function to behave like a step function. Both FCTP and SFCTP are considered to be NP-hard problems. While a lot of research has been carried out concerning FCTP, not much has been done concerning SFCTP. This paper introduces an alternate Mutation based Artificial Immune (MAI algorithm for solving SFCTPs. The proposed MAI algorithm solves both balanced and unbalanced SFCTP without introducing a dummy supplier or a dummy customer. In MAI algorithm a coding schema is designed and procedures are developed for decoding such schema and shipping units. MAI algorithm guarantees the feasibility of all the generated solutions. Due to the significant role of mutation function on the MAI algorithm’s quality, 16 mutation functions are presented and their performances are compared to select the best one. For this purpose, forty problems with different sizes have been generated at random and then a robust calibration is applied using the relative percentage deviation (RPD method. Through two illustrative problems of different sizes the performance of the MAI algorithm has been compared with most recent methods.
Schmaltz, Thomas; Gothe, Bastian; Krause, Andreas; Leitherer, Susanne; Steinrück, Hans-Georg; Thoss, Michael; Clark, Timothy; Halik, Marcus
2017-09-26
Self-assembled monolayer field-effect transistors (SAMFETs) are not only a promising type of organic electronic device but also allow detailed analyses of structure-property correlations. The influence of the morphology on the charge transport is particularly pronounced, due to the confined monolayer of 2D-π-stacked organic semiconductor molecules. The morphology, in turn, is governed by relatively weak van-der-Waals interactions and is thus prone to dynamic structural fluctuations. Accordingly, combining electronic and physical characterization and time-averaged X-ray analyses with the dynamic information available at atomic resolution from simulations allows us to characterize self-assembled monolayer (SAM) based devices in great detail. For this purpose, we have constructed transistors based on SAMs of two molecules that consist of the organic p-type semiconductor benzothieno[3,2-b][1]benzothiophene (BTBT), linked to a C 11 or C 12 alkylphosphonic acid. Both molecules form ordered SAMs; however, our experiments show that the size of the crystalline domains and the charge-transport properties vary considerably in the two systems. These findings were confirmed by molecular dynamics (MD) simulations and semiempirical molecular-orbital electronic-structure calculations, performed on snapshots from the MD simulations at different times, revealing, in atomistic detail, how the charge transport in organic semiconductors is influenced and limited by dynamic disorder.
Membrane-traversing mechanism of thyroid hormone transport by monocarboxylate transporter 8.
Protze, Jonas; Braun, Doreen; Hinz, Katrin Manuela; Bayer-Kusch, Dorothea; Schweizer, Ulrich; Krause, Gerd
2017-06-01
Monocarboxylate transporter 8 (MCT8) mediates thyroid hormone (TH) transport across the plasma membrane in many cell types. In order to better understand its mechanism, we have generated three new MCT8 homology models based on sugar transporters XylE in the intracellular opened (PDB ID: 4aj4) and the extracellular partly occluded (PDB ID: 4gby) conformations as well as FucP (PDB ID: 3o7q) and GLUT3 (PDB ID: 4zwc) in the fully extracellular opened conformation. T 3 -docking studies from both sides revealed interactions with His192, His415, Arg445 and Asp498 as previously identified. Selected mutations revealed further transport-sensitive positions mainly at the discontinuous transmembrane helices TMH7 and 10. Lys418 is potentially involved in neutralising the charge of the TH substrate because it can be replaced by charged, but not by uncharged, amino acids. The side chain of Thr503 was hypothesised to stabilise a helix break at TMH10 that undergoes a prominent local shift during the transport cycle. A T503V mutation accordingly affected transport. The aromatic Tyr419, the polar Ser313 and Ser314 as well as the charged Glu422 and Glu423 lining the transport channel have been studied. Based on related sugar transporters, we suggest an alternating access mechanism for MCT8 involving a series of amino acid positions previously and newly identified as critical for transport.
Metal Oxides as Efficient Charge Transporters in Perovskite Solar Cells
Haque, Mohammed
2017-07-10
Over the past few years, hybrid halide perovskites have emerged as a highly promising class of materials for photovoltaic technology, and the power conversion efficiency of perovskite solar cells (PSCs) has accelerated at an unprecedented pace, reaching a record value of over 22%. In the context of PSC research, wide-bandgap semiconducting metal oxides have been extensively studied because of their exceptional performance for injection and extraction of photo-generated carriers. In this comprehensive review, we focus on the synthesis and applications of metal oxides as electron and hole transporters in efficient PSCs with both mesoporous and planar architectures. Metal oxides and their doped variants with proper energy band alignment with halide perovskites, in the form of nanostructured layers and compact thin films, can not only assist with charge transport but also improve the stability of PSCs under ambient conditions. Strategies for the implementation of metal oxides with tailored compositions and structures, and for the engineering of their interfaces with perovskites will be critical for the future development and commercialization of PSCs.
International Nuclear Information System (INIS)
Filippov, A.V.; Dyatko, N.A.; Pal', A.F.; Starostin, A.N.
2003-01-01
A model of dust grain charging is constructed using the method of moments. The dust grain charging process in a weakly ionized helium plasma produced by a 100-keV electron beam at atmospheric pressure is studied theoretically. In simulations, the beam current density was varied from 1 to 10 6 μA/cm 2 . It is shown that, in a He plasma, dust grains of radius 5 μm and larger perturb the electron temperature only slightly, although the reduced electric field near the grain reaches 8 Td, the beam current density being 10 6 μA/cm 2 . It is found that, at distances from the grain that are up to several tens or hundreds of times larger than its radius, the electron and ion densities are lower than their equilibrium values. Conditions are determined under which the charging process may be described by a model with constant electron transport coefficients. The dust grain charge is shown to be weakly affected by secondary electron emission. In a beam-produced helium plasma, the dust grain potential calculated in the drift-diffusion model is shown to be close to that calculated in the orbit motion limited model. It is found that, in the vicinity of a body perturbing the plasma, there may be no quasineutral plasma presheath with an ambipolar diffusion of charged particles. The conditions for the onset of this presheath in a beam-produced plasma are determined
A Temperature Dependent Lumped-charge Model for Trench FS-IGBT
DEFF Research Database (Denmark)
Duan, Yaoqiang; Kang, Yong; Iannuzzo, Francesco
2018-01-01
Abstract: This paper proposes a temperature dependent lumped-charge model for FS-IGBT. Due to the evolution of the IGBT structure, the existing lumped-charge IGBT model established for NPT-IGBT is not suitable for the simulation of FS-IGBT. This paper extends the lumped-charge IGBT model including...... the field-stop (FS) structure and temperature characteristics. The temperature characteristics of the model are considered for both the bipolar part and unipolar part. In addition, a new PN junction model which can distinguish the collector structure is presented and validated by TCAD simulation. Finally...
Adomian decomposition method for solving the telegraph equation in charged particle transport
International Nuclear Information System (INIS)
Abdou, M.A.
2005-01-01
In this paper, the analysis for the telegraph equation in case of isotropic small angle scattering from the Boltzmann transport equation for charged particle is presented. The Adomian decomposition is used to solve the telegraph equation. By means of MAPLE the Adomian polynomials of obtained series (ADM) solution have been calculated. The behaviour of the distribution function are shown graphically. The results reported in this article provide further evidence of the usefulness of Adomain decomposition for obtaining solution of linear and nonlinear problems
Space-charge limits on the transport of ion beams in a long alternating gradient system
International Nuclear Information System (INIS)
Tiefenback, M.G.
1986-11-01
We have experimentally studied the space-charge-dominated transport of ion beams in an alternating-gradient channel, without acceleration. We parameterize the focusing strength in terms of the zero-current ''betatron'' oscillation phase advance rate, σ 0 (degrees per focusing period). We have investigated the conditions for ''stability'', defined as the constancy of the total current and phase space area of the beam during transport. We find that the beam may be transported with neither loss of current nor growth in phase area if σ 0 0 . In this regime, the space-charge repulsive force can counter 98-99% of the externally applied focusing field, and the oscillation frequency of the beam particles can be depressed by self-forces to almost a factor of 10 below the zero-current value, limited only by the optical quality of our ion source. For σ 0 > 90 0 , we find that collective interactions bound the maintainable density of the beam, and we present a simple, semi-empirical characterization for stability, within our ability to distinguish the growth rate from zero in our apparatus. Our channel comprises 87 quadrupole lenses, 5 of which are used to prepare the beam for injection into the non-azimuthally-symmetric focusing channel
Methodology for assessing electric vehicle charging infrastructure business models
International Nuclear Information System (INIS)
Madina, Carlos; Zamora, Inmaculada; Zabala, Eduardo
2016-01-01
The analysis of economic implications of innovative business models in networked environments, as electro-mobility is, requires a global approach to ensure that all the involved actors obtain a benefit. Although electric vehicles (EVs) provide benefits for the society as a whole, there are a number of hurdles for their widespread adoption, mainly the high investment cost for the EV and for the infrastructure. Therefore, a sound business model must be built up for charging service operators, which allows them to recover their costs while, at the same time, offer EV users a charging price which makes electro-mobility comparable to internal combustion engine vehicles. For that purpose, three scenarios are defined, which present different EV charging alternatives, in terms of charging power and charging station ownership and accessibility. A case study is presented for each scenario and the required charging station usage to have a profitable business model is calculated. We demonstrate that private home charging is likely to be the preferred option for EV users who can charge at home, as it offers a lower total cost of ownership under certain conditions, even today. On the contrary, finding a profitable business case for fast charging requires more intensive infrastructure usage. - Highlights: • Ecosystem is a network of actors who collaborate to create a positive business case. • Electro-mobility (electricity-powered road vehicles and ICT) is a complex ecosystem. • Methodological analysis to ensure that all actors benefit from electro-mobility. • Economic analysis of charging infrastructure deployment linked to its usage. • Comparison of EV ownership cost vs. ICE for vehicle users.
STM and transport measurements of highly charged ion modified materials
International Nuclear Information System (INIS)
Pomeroy, J.M.; Grube, H.; Perrella, A.C.; Gillaspy, J.D.
2007-01-01
Careful measurements of highly charged ions (HCIs) colliding with gases and surfaces have provided glimpses of intense electronic interactions, but a comprehensive model for the interaction mechanisms, time scales, and resultant nano-features that bridges materials systems is yet to be realized. At the National Institute of Standards and Technology (NIST) electron beam ion trap (EBIT) facility, new apparatus is now connected to the HCI beamline to allow preparation of clean, atomically flat surfaces of single crystals, e.g. gold, tungsten and silicon, and deposition and patterning of thin films, e.g. high resistivity oxides, ferromagnetic metals, normal metals and superconductors. Experiments reported here focus on the electronic and morphological structure of HCI induced nano-features. Current activities are focused on using in situ scanning tunneling microscope (STM) on Au(1 1 1) and (separately) ex situ transport measurements to study electronic properties within HCI modified magnetic multilayer systems. Specifically, we are fabricating magnetic multilayers similar to magnetic tunnel junctions (MTJs) (important in advanced magnetic field sensors and superconducting Josephson junction devices) and using HCIs to adjust critical electronic properties. The electrical response of the tunnel junction to HCIs provides a novel approach to performing HCI-induced nanostructure ensemble measurements
Landkamer, Lee L.; Harvey, Ronald W.; Scheibe, Timothy D.; Ryan, Joseph N.
2013-01-01
A colloid transport model is introduced that is conceptually simple yet captures the essential features of colloid transport and retention in saturated porous media when colloid retention is dominated by the secondary minimum because an electrostatic barrier inhibits substantial deposition in the primary minimum. This model is based on conventional colloid filtration theory (CFT) but eliminates the empirical concept of attachment efficiency. The colloid deposition rate is computed directly from CFT by assuming all predicted interceptions of colloids by collectors result in at least temporary deposition in the secondary minimum. Also, a new paradigm for colloid re-entrainment based on colloid population heterogeneity is introduced. To accomplish this, the initial colloid population is divided into two fractions. One fraction, by virtue of physiochemical characteristics (e.g., size and charge), will always be re-entrained after capture in a secondary minimum. The remaining fraction of colloids, again as a result of physiochemical characteristics, will be retained “irreversibly” when captured by a secondary minimum. Assuming the dispersion coefficient can be estimated from tracer behavior, this model has only two fitting parameters: (1) the fraction of the initial colloid population that will be retained “irreversibly” upon interception by a secondary minimum, and (2) the rate at which reversibly retained colloids leave the secondary minimum. These two parameters were correlated to the depth of the Derjaguin-Landau-Verwey-Overbeek (DLVO) secondary energy minimum and pore-water velocity, two physical forces that influence colloid transport. Given this correlation, the model serves as a heuristic tool for exploring the influence of physical parameters such as surface potential and fluid velocity on colloid transport.
Meisel, K.D.; Pasveer, W.F.; Cottaar, J.; Tanase, C.; Coehoorn, R.; Bobbert, P.A.; Blom, P.W.M.; Leeuw, D.M. de; Michels, M.A.J.
2006-01-01
We model charge transport in disordered semiconducting polymers by hopping of charge carriers on a square lattice of sites with Gaussian on-site energy disorder, using Fermi-Dirac statistics. From numerically exact solutions of the Master equation, we study the dependence of the charge-carrier
Electrostatic charge bounds for ball lightning models
International Nuclear Information System (INIS)
Stephan, Karl D
2008-01-01
Several current theories concerning the nature of ball lightning predict a substantial electrostatic charge in order to account for its observed motion and shape (Turner 1998 Phys. Rep. 293 1; Abrahamson and Dinniss 2000 Nature 403 519). Using charged soap bubbles as a physical model for ball lightning, we show that the magnitude of charge predicted by some of these theories is too high to allow for the types of motion commonly observed in natural ball lightning, which includes horizontal motion above the ground and movement near grounded conductors. Experiments show that at charge levels of only 10-15 nC, 3-cm-diameter soap bubbles tend to be attracted by induced charges to the nearest grounded conductor and rupture. We conclude with a scaling rule that can be used to extrapolate these results to larger objects and surroundings
Quadrupole beam-transport experiment for heavy ions under extreme space charge conditions
International Nuclear Information System (INIS)
Chupp, W.; Faltens, A.; Hartwig, E.C.
1983-03-01
A Cs ion-beam-transport experiment is in progress to study beam behavior under extreme space-charge conditions. A five-lens section matches the beam into a periodic electrostatic quadrupole FODO channel and its behavior is found to agree with predictions. With the available parameters (less than or equal to 200 keV, less than or equal to 20 mA, πepsilon/sub n/ greater than or equal to 10 - 7 π rad-m, up to 41 periods) the transverse (betatron) occillation frequency (nu) can be depressed down to one-tenth of its zero current value (nu/sub 0/), where nu/sup 2/ = nu/sub 0//sup 2/ -#betta#/sub p/ 2 /2, and #betta#/sub p/ is the beam plasma frequency. The current can be controlled by adjustment of the gun and the emittance can be controlled independently by means of a set of charged grids
BEAMR: An interactive graphic computer program for design of charged particle beam transport systems
Leonard, R. F.; Giamati, C. C.
1973-01-01
A computer program for a PDP-15 is presented which calculates, to first order, the characteristics of charged-particle beam as it is transported through a sequence of focusing and bending magnets. The maximum dimensions of the beam envelope normal to the transport system axis are continuously plotted on an oscilloscope as a function of distance along the axis. Provision is made to iterate the calculation by changing the types of magnets, their positions, and their field strengths. The program is especially useful for transport system design studies because of the ease and rapidity of altering parameters from panel switches. A typical calculation for a system with eight elements is completed in less than 10 seconds. An IBM 7094 version containing more-detailed printed output but no oscilloscope display is also presented.
International Nuclear Information System (INIS)
Lehikoinen, J.
1997-01-01
This report describes the progress of the computer model for ionic transport in bentonite. The research is part of the project Microstructural and chemical parameters of bentonite as determinants of waste isolation efficiency within the Nuclear fission safety program organized by The Commission of the European Communities. The study was started by collecting a comprehensive body of available data on space-charge transport modelling and creating a conceptualization of the problem at hand. The numerical discretization of the governing equations by finite differences was also initiated. This report introduces the theoretical basis for the model, somewhat more elaborated than presented in Progress Report 1/1996, and rectifies a few mistakes appearing in that report. It also gives a brief introduction to the solution methodology of the disc retized governing equations. (orig.) (12 refs.)
A new computational method for simulation of charge transport in semiconductor radiation detectors
International Nuclear Information System (INIS)
Holban, I.
1993-01-01
An effective computational method for simulation of charge transport in semiconductor radiation detectors is the purpose of the present work. Basic equations for analysis include (1) Poisson's equations, (2) continuity equation for electrons and holes, (3) rate equations for deep levels, (4) current equation for electrons and holes and (5) boundary conditions. The system of equations is discretized and equidistant space and time grids is brought. The nonlinearity of the problem is overcome by using Newton-Raphson iteration scheme. Instead of solving a nonlinear boundary problem we resolve a linear matrix equation. Our computation procedure becomes very efficient using a sparse matrix. The computed program allows to calculate the charge collection efficiency and transient response for arbitrary electric fields when trapping and detrapping effects are present. The earlier literature results are reproduced. (Author)
Jana, Partha Sarathi; Katuri, Krishna; Kavanagh, Paul; Kumar, Amit Ravi Pradeep; Leech, Dó nal
2014-01-01
Harnessing, and understanding the mechanisms of growth and activity of, biofilms of electroactive bacteria (EAB) on solid electrodes is of increasing interest, for application to microbial fuel and electrolysis cells. Microbial electrochemical cell technology can be used to generate electricity, or higher value chemicals, from organic waste. The capability of biofilms of electroactive bacteria to transfer electrons to solid anodes is a key feature of this emerging technology, yet the electron transfer mechanism is not fully characterized as yet. Acetate oxidation current generated from biofilms of an EAB, Geobacter sulfurreducens, on graphite electrodes as a function of time does not correlate with film thickness. Values of film thickness, and the number and local concentration of electrically connected redox sites within Geobacter sulfurreducens biofilms as well as a charge transport diffusion co-efficient for the biofilm can be estimated from non-turnover voltammetry. The thicker biofilms, of 50 ± 9 μm, display higher charge transport diffusion co-efficient than that in thinner films, as increased film porosity of these films improves ion transport, required to maintain electro-neutrality upon electrolysis. This journal is © the Partner Organisations 2014.
Two-dimensional charge transport in self-organized, high-mobility conjugated polymers
DEFF Research Database (Denmark)
Sirringhaus, H.; Brown, P.J.; Friend, R.H.
1999-01-01
Self-organization in many solution-processed, semiconducting conjugated polymers results in complex microstructures, in which ordered microcrystalline domains are embedded in an amorphous matrix(I). This has important consequences for electrical properties of these materials: charge transport...... of the ordered microcrystalline domains in the conjugated polymer poly(3-hexylthiophene), P3HT, Self-organization in P3HT results in a lamella structure with two-dimensional conjugated sheets formed by interchain stacking. We find that, depending on processing conditions, the lamellae can adopt two different...... of polymer transistors in logic circuits(5) and active-matrix displays(4,6)....
Jia, Xu-Bo; Wei, Hui-Ling; Shi, Ya-Ting; Shi, Ya-Rui; Liu, Yu-Fang
2017-12-01
In this work, the charge transport properties of Isoindigo (II) and its derivatives which have the same hexyl chain were theoretically investigated by the Marcus-Hush theory combined with density functional theory (DFT). Here we demonstrate that the changes of benzene and thiophene groups in molecular structure have an important influence on the charge transport properties of organic semiconductor. The benzene rings of II are replaced by thiophenes to form the thienoisoindigo (TII), and the addition of benzene rings to the TII form the benzothienoisoindigo (BTII). The results show that benzene rings and thiophenes change the chemical structure of crystal molecules, which lead to different molecule stacking, thus, the length of hydrogen bond was changed. A shorter intermolecular hydrogen bond lead to tighter molecular stacking, which reduces the center-to-center distance and enhances the ability of charge transfer. At the same time, we theoretically demonstrated that II and BTII are the ambipolar organic semiconductor. BTII has better carrier mobility. The hole mobility far greater than electron mobility in TII, which is p-type organic semiconductor. Among all hopping path, we find that the distance of face-to-face stacking in II is the shortest and the electron-transport electronic coupling Ve is the largest, but II has not a largest anisotropic mobility, because the reorganization energy has a greater influence on the mobility than the electronic coupling. This work is helpful for designing ambipolar organic semiconductor materials with higher charge transport properties by introducing benzene ring and thiophene.
Kümmel, Stephan
Being able to visualize the dynamics of electrons in organic materials is a fascinating perspective. Simulations based on time-dependent density functional theory allow to realize this hope, as they visualize the flow of charge through molecular structures in real-space and real-time. We here present results on two fundamental processes: Photoemission from organic semiconductor molecules and charge transport through molecular structures. In the first part we demonstrate that angular resolved photoemission intensities - from both theory and experiment - can often be interpreted as a visualization of molecular orbitals. However, counter-intuitive quantum-mechanical electron dynamics such as emission perpendicular to the direction of the electrical field can substantially alter the picture, adding surprising features to the molecular orbital interpretation. In a second study we calculate the flow of charge through conjugated molecules. The calculations show in real time how breaks in the conjugation can lead to a local buildup of charge and the formation of local electrical dipoles. These can interact with neighboring molecular chains. As a consequence, collections of ''molecular electrical wires'' can show distinctly different characteristics than ''classical electrical wires''. German Science Foundation GRK 1640.
Charge sharing in silicon pixel detectors
Mathieson, K; Seller, P; Prydderch, M L; O'Shea, V; Bates, R L; Smith, K M; Rahman, M
2002-01-01
We used a pixellated hybrid silicon X-ray detector to study the effect of the sharing of generated charge between neighbouring pixels over a range of incident X-ray energies, 13-36 keV. The system is a room temperature, energy resolving detector with a Gaussian FWHM of 265 eV at 5.9 keV. Each pixel is 300 mu m square, 300 mu m deep and is bump bonded to matching read out electronics. The modelling packages MEDICI and MCNP were used to model the complete X-ray interaction and the subsequent charge transport. Using this software a model is developed which reproduces well the experimental results. The simulations are then altered to explore smaller pixel sizes and different X-ray energies. Charge sharing was observed experimentally to be 2% at 13 keV rising to 4.5% at 36 keV, for an energy threshold of 4 keV. The models predict that up to 50% of charge may be lost to the neighbouring pixels, for an X-ray energy of 36 keV, when the pixel size is reduced to 55 mu m.
Semi-empirical modelization of charge funneling in a NP diode
International Nuclear Information System (INIS)
Musseau, O.
1991-01-01
Heavy ion interaction with a semiconductor generates a high density of electrons and holes pairs along the trajectory and in a space charge zone the collected charge is considerably increased. The chronology of this charge funneling is described in a semi-empirical model. From initial conditions characterizing the incident ion and the studied structure, it is possible to evaluate directly the transient current, the collected charge and the length of funneling with a good agreement. The model can be extrapolated to more complex structures
OoTran, an object-oriented program for charged-particle beam transport design
International Nuclear Information System (INIS)
Ninane, A.; Ferte, J.M.; Mareschal, P.; Sibomana, M.; Somers, F.
1990-01-01
The OoTran program is a new object-oriented program for charged-particle beam transport computation. Using a simple menu interface, the user builds his beam line with magnetic and electric elements taken from a standard library. The program computes the beam transport using a well-known first-order matrix formalism and displays 'in real time' the computed beam envelope. The menu editor provides functions to interactively modify the beam line. Ootran is written in C++ and uses two object libraries: OOPS, the Object-Oriented Program Support Class Library, which is a collection of classes similar to those of Smalltalk-80; and InterViews, a C++ graphical-interface toolkit based on the X-Window system. OoTran is running on DECstation 3100, VAXstation 2000 and SUN 3, with the ULTRIX and SUN OS operating systems. (orig.)
Self-consistent study of space-charge-dominated beams in a misaligned transport system
International Nuclear Information System (INIS)
Sing Babu, P.; Goswami, A.; Pandit, V.S.
2013-01-01
A self-consistent particle-in-cell (PIC) simulation method is developed to investigate the dynamics of space-charge-dominated beams through a misaligned solenoid based transport system. Evolution of beam centroid, beam envelope and emittance is studied as a function of misalignment parameters for various types of beam distributions. Simulation results performed up to 40 mA of proton beam indicate that centroid oscillations induced by the displacement and rotational misalignments of solenoids do not depend of the beam distribution. It is shown that the beam envelope around the centroid is independent of the centroid motion for small centroid oscillation. In addition, we have estimated the loss of beam during the transport caused by the misalignment for various beam distributions
Numerical analysis of finite Debye-length effects in induced-charge electro-osmosis.
Gregersen, Misha Marie; Andersen, Mathias Baekbo; Soni, Gaurav; Meinhart, Carl; Bruus, Henrik
2009-06-01
For a microchamber filled with a binary electrolyte and containing a flat unbiased center electrode at one wall, we employ three numerical models to study the strength of the resulting induced-charge electro-osmotic (ICEO) flow rolls: (i) a full nonlinear continuum model resolving the double layer, (ii) a linear slip-velocity model not resolving the double layer and without tangential charge transport inside this layer, and (iii) a nonlinear slip-velocity model extending the linear model by including the tangential charge transport inside the double layer. We show that, compared to the full model, the slip-velocity models significantly overestimate the ICEO flow. This provides a partial explanation of the quantitative discrepancy between observed and calculated ICEO velocities reported in the literature. The discrepancy increases significantly for increasing Debye length relative to the electrode size, i.e., for nanofluidic systems. However, even for electrode dimensions in the micrometer range, the discrepancies in velocity due to the finite Debye length can be more than 10% for an electrode of zero height and more than 100% for electrode heights comparable to the Debye length.
Modeling, hybridization, and optimal charging of electrical energy storage systems
Parvini, Yasha
The rising rate of global energy demand alongside the dwindling fossil fuel resources has motivated research for alternative and sustainable solutions. Within this area of research, electrical energy storage systems are pivotal in applications including electrified vehicles, renewable power generation, and electronic devices. The approach of this dissertation is to elucidate the bottlenecks of integrating supercapacitors and batteries in energy systems and propose solutions by the means of modeling, control, and experimental techniques. In the first step, the supercapacitor cell is modeled in order to gain fundamental understanding of its electrical and thermal dynamics. The dependence of electrical parameters on state of charge (SOC), current direction and magnitude (20-200 A), and temperatures ranging from -40°C to 60°C was embedded in this computationally efficient model. The coupled electro-thermal model was parameterized using specifically designed temporal experiments and then validated by the application of real world duty cycles. Driving range is one of the major challenges of electric vehicles compared to combustion vehicles. In order to shed light on the benefits of hybridizing a lead-acid driven electric vehicle via supercapacitors, a model was parameterized for the lead-acid battery and combined with the model already developed for the supercapacitor, to build the hybrid battery-supercapacitor model. A hardware in the loop (HIL) setup consisting of a custom built DC/DC converter, micro-controller (muC) to implement the power management strategy, 12V lead-acid battery, and a 16.2V supercapacitor module was built to perform the validation experiments. Charging electrical energy storage systems in an efficient and quick manner, motivated to solve an optimal control problem with the objective of maximizing the charging efficiency for supercapacitors, lead-acid, and lithium ion batteries. Pontryagins minimum principle was used to solve the problems
Energy Technology Data Exchange (ETDEWEB)
Zhang, Xuning [HEEGER Beijing Research & Development Center; School of Chemistry; Beihang University; Beijing 100191; China; Zuo, Xiaobing [X-ray Science Division; Argonne National Laboratory; Argonne; USA; Xie, Shenkun [HEEGER Beijing Research & Development Center; School of Chemistry; Beihang University; Beijing 100191; China; Yuan, Jianyu [Jiangsu Key Laboratory for Carbon-Based Functional Materials & Devices; Institute of Functional Nano & Soft Materials (FUNSOM); Soochow University; Suzhou; P. R. China; Zhou, Huiqiong [CAS Key Laboratory of Nanosystem and Hierarchical Fabrication; CAS Center for Excellence in Nanoscience; National Center for Nanoscience and Technology; Beijing 100190; China; Zhang, Yuan [HEEGER Beijing Research & Development Center; School of Chemistry; Beihang University; Beijing 100191; China
2017-01-01
Photovoltaic characteristics, recombination and charge transport properties are investigated. The determined recombination reduction factor can reconcile the supreme device performance in organic solar cells using non-fullerene ITIC acceptor and severe carrier losses in all-polymer devices with P(NDI2OD-T2).
Evaluation and comparison of SN and Monte-Carlo charged particle transport calculations
International Nuclear Information System (INIS)
Hadad, K.
2000-01-01
A study was done to evaluate a 3-D S N charged particle transport code called SMARTEPANTS 1 and another 3-D Monte Carlo code called Integrated Tiger Series, ITS 2 . The evaluation study of SMARTEPANTS code was based on angular discretization and reflected boundary sensitivity whilst the evaluation of ITS was based on CPU time and variance reduction. The comparison of the two code was based on energy and charge deposition calculation in block of Gallium Arsenide with embedded gold cylinders. The result of evaluation tests shows that an S 8 calculation maintains both accuracy and speed and calculations with reflected boundaries geometry produces full symmetrical results. As expected for ITS evaluation, the CPU time and variance reduction are opposite to a point beyond which the history augmentation while increasing the CPU time do not result in variance reduction. The comparison test problem showed excellent agreement in total energy deposition calculations
Dennison, J. R.; Swaminathan, Prasanna; Jost, Randy; Brunson, Jerilyn; Green, Nelson; Frederickson, A. Robb
2005-01-01
A key parameter in modeling differential spacecraft charging is the resistivity of insulating materials. This determines how charge will accumulate and redistribute across the spacecraft, as well as the time scale for charge transport and dissipation. Existing spacecraft charging guidelines recommend use of tests and imported resistivity data from handbooks that are based principally upon ASTM methods that are more applicable to classical ground conditions and designed for problems associated with power loss through the dielectric, than for how long charge can be stored on an insulator. These data have been found to underestimate charging effects by one to four orders of magnitude for spacecraft charging applications. A review is presented of methods to measure the resistive of highly insulating materials, including the electrometer-resistance method, the electrometer-constant voltage method, the voltage rate-of-change method and the charge storage method. This is based on joint experimental studies conducted at NASA Jet Propulsion Laboratory and Utah State University to investigate the charge storage method and its relation to spacecraft charging. The different methods are found to be appropriate for different resistivity ranges and for different charging circumstances. A simple physics-based model of these methods allows separation of the polarization current and dark current components from long duration measurements of resistivity over day- to month-long time scales. Model parameters are directly related to the magnitude of charge transfer and storage and the rate of charge transport. The model largely explains the observed differences in resistivity found using the different methods and provides a framework for recommendations for the appropriate test method for spacecraft materials with different resistivities and applications. The proposed changes to the existing engineering guidelines are intended to provide design engineers more appropriate methods for
DETAILED MODELLING OF CHARGING BEHAVIOUR OF SMART SOLAR TANKS
DEFF Research Database (Denmark)
Fan, Jianhua; Andersen, Elsa; Furbo, Simon
2010-01-01
The charging behaviour of smart solar tanks for solar combisystems for one-family houses is investigated with detailed Computational Fluid Dynamics (CFD) modelling and Particle Image Velocimetry (PIV) measurements. The smart solar tank can be charged with a variable auxiliary volume fitted...... or by an electric heating element in a side-arm mounted on the side of the tank. Detailed CFD models of the smart tanks are built with different mesh densities in the tank and in the side-arm. The thermal conditions of the tank during charging are calculated with the CFD models. The fluid flow and temperature...... by the mesh densities, the distribution of computational cells, the physical model and time steps used in the simulations. The findings of the investigations will be used as guidance for creation of CFD models for optimal design of smart solar tanks....
Glynn, P.D.
2003-01-01
One-dimensional (1D) geochemical transport modeling is used to demonstrate the effects of speciation and sorption reactions on the ground-water transport of Np and Pu, two redox-sensitive elements. Earlier 1D simulations (Reardon, 1981) considered the kinetically limited dissolution of calcite and its effect on ion-exchange reactions (involving 90Sr, Ca, Na, Mg and K), and documented the spatial variation of a 90Sr partition coefficient under both transient and steady-state chemical conditions. In contrast, the simulations presented here assume local equilibrium for all reactions, and consider sorption on constant potential, rather than constant charge, surfaces. Reardon's (1981) seminal findings on the spatial and temporal variability of partitioning (of 90Sr) are reexamined and found partially caused by his assumption of a kinetically limited reaction. In the present work, sorption is assumed the predominant retardation process controlling Pu and Np transport, and is simulated using a diffuse-double-layer-surface-complexation (DDLSC) model. Transport simulations consider the infiltration of Np- and Pu-contaminated waters into an initially uncontaminated environment, followed by the cleanup of the resultant contamination with uncontaminated water. Simulations are conducted using different spatial distributions of sorption capacities (with the same total potential sorption capacity, but with different variances and spatial correlation structures). Results obtained differ markedly from those that would be obtained in transport simulations using constant Kd, Langmuir or Freundlich sorption models. When possible, simulation results (breakthrough curves) are fitted to a constant K d advection-dispersion transport model and compared. Functional differences often are great enough that they prevent a meaningful fit of the simulation results with a constant K d (or even a Langmuir or Freundlich) model, even in the case of Np, a weakly sorbed radionuclide under the
The effect of interfacial layers on charge transport in organic solar cell
Energy Technology Data Exchange (ETDEWEB)
Mbuyise, Xolani G.; Tonui, Patrick; Mola, Genene Tessema, E-mail: mola@ukzn.ac.za
2016-09-01
The effect of interfacial buffer layers in organic photovoltaic cell (OPV) whose active layer is composed of poly(3 hexylthiophene) (P3HT) and [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) blend was studied. The electrical properties of OPV devices produced with and without interfacial layers are compared and discussed in terms of measured parameters of the cells. The charge transport properties showed significant difference on the mobility and activation factor between the two types of device structures. The life time measurements in the unprotected conditions are also presented and discussed.
Analysis of some greedy algorithms for the single-sink fixed-charge transportation problem
DEFF Research Database (Denmark)
Görtz, Simon; Klose, Andreas
2009-01-01
-charge transportation problem. Nevertheless, just a few methods for solving this problem have been proposed in the literature. In this paper, some greedy heuristic solutions methods for the SSFCTP are investigated. It is shown that two greedy approaches for the SSFCTP known from the literature can be arbitrarily bad......, whereas an approximation algorithm proposed in the literature for the binary min-knapsack problem has a guaranteed worst case bound if adapted accordingly to the case of the SSFCTP....
International Nuclear Information System (INIS)
Nichterwitz, Melanie
2012-01-01
This work contributes to the understanding of generation dependent charge-carrier transport properties in Cu(In,Ga)Se 2 (CIGSe)/ CdS/ ZnO solar cells and a consistent model for the electronic band diagram of the heterojunction region of the device is developed. Cross section electron-beam induced current (EBIC) and temperature and illumination dependent current voltage (IV) measurements are performed on CIGSe solar cells with varying absorber layer compositions and CdS thickness. For a better understanding of possibilities and limitations of EBIC measurements applied on CIGSe solar cells, detailed numerical simulations of cross section EBIC profiles for varying electron beam and solar cell parameters are performed and compared to profiles obtained from an analytical description. Especially the effects of high injection conditions are considered. Even though the collection function of the solar cell is not independent of the generation function of the electron beam, the local electron diffusion length in CIGSe can still be extracted. Grain specific values ranging from (480±70) nm to (2.3±0.2) μm are determined for a CuInSe 2 absorber layer and a value of (2.8±0.3) μm for CIGSe with a Ga-content of 0.3. There are several models discussed in literature to explain generation dependent charge carrier transport, all assuming a high acceptor density either located in the CIGSe layer close to the CIGSe/CdS interface (p + layer), within the CdS layer or at the CdS/ZnO interface. In all models, a change in charge carrier collection properties is caused by a generation dependent occupation probability of the acceptor type defect state and the resulting potential distribution throughout the device. Numerical simulations of EBIC and IV data are performed with parameters according to these models. The model that explains the experimental data best is that of a p + layer at the CIGSe/CdS interface and acceptor type defect states at the CdS/ZnO interface. The p + layer leads
Interplanetary Radiation and Internal Charging Environment Models for Solar Sails
Minow, Joseph I.; Altstatt, Richard L.; NeegaardParker, Linda
2005-01-01
A Solar Sail Radiation Environment (SSRE) model has been developed for defining charged particle environments over an energy range from 0.01 keV to 1 MeV for hydrogen ions, helium ions, and electrons. The SSRE model provides the free field charged particle environment required for characterizing energy deposition per unit mass, charge deposition, and dose rate dependent conductivity processes required to evaluate radiation dose and internal (bulk) charging processes in the solar sail membrane in interplanetary space. Solar wind and energetic particle measurements from instruments aboard the Ulysses spacecraft in a solar, near-polar orbit provide the particle data over a range of heliospheric latitudes used to derive the environment that can be used for radiation and charging environments for both high inclination 0.5 AU Solar Polar Imager mission and the 1.0 AU L1 solar missions. This paper describes the techniques used to model comprehensive electron, proton, and helium spectra over the range of particle energies of significance to energy and charge deposition in thin (less than 25 micrometers) solar sail materials.
Sleutels, T.H.J.A.; Lodder, R.; Hamelers, H.V.M.; Buisman, C.J.N.
2009-01-01
To create an efficient MEC high current densities and high coulombic efficiencies are required. The aim of this study was to increase cur-rent densities and coulombic efficiencies by influencing mass and charge transport in porous electrodes by: (i) introduction of a forced flow through the anode to
Meisel, K.D.; Pasveer, W.F.; Cottaar, J.; Tanase, C.; Coehoorn, R.; Bobbert, P.A.; Blom, P.W.M.; Leeuw, de D.M.; Michels, M.A.J.
2006-01-01
We model charge transport in disordered semiconducting polymers by hopping of charge carriers on a square lattice of sites with Gaussian on-site energy disorder, using Fermi-Dirac statistics. From numerically exact solns. of the Master equation, we study the dependence of the charge-carrier mobility
Net charge fluctuations and local charge compensation
International Nuclear Information System (INIS)
Fu Jinghua
2006-01-01
We propose net charge fluctuation as a measure of local charge correlation length. It is demonstrated that, in terms of a schematic multiperipheral model, net charge fluctuation satisfies the same Quigg-Thomas relation as satisfied by charge transfer fluctuation. Net charge fluctuations measured in finite rapidity windows depend on both the local charge correlation length and the size of the observation window. When the observation window is larger than the local charge correlation length, the net charge fluctuation only depends on the local charge correlation length, while forward-backward charge fluctuations always have strong dependence on the observation window size. Net charge fluctuations and forward-backward charge fluctuations measured in the present heavy ion experiments show characteristic features similar to those from multiperipheral models. But the data cannot all be understood within this simple model
The effect of charge exchange with neutral deuterium on carbon emission in JET divertor plasmas
International Nuclear Information System (INIS)
Maggi, C.; Horton, L.; Summers, H.
1999-11-01
High density, low temperature divertor plasma operation in tokamaks results in large neutral deuterium concentrations in the divertor volume. In these conditions, low energy charge transfer reactions between neutral deuterium and the impurity ions can in principle enhance the impurity radiative losses and thus help to reduce the maximum heat load to the divertor target. A quantitative study of the effect of charge exchange on carbon emission is presented, applied to the JET divertor. Total and state selective effective charge exchange recombination rate coefficients were calculated in the collisional radiative picture. These coefficients were coupled to divertor and impurity transport models to study the effect of charge exchange on the measured carbon spectral emission in JET divertor discharges. The sensitivity of the effect of charge exchange to the assumptions in the impurity transport model was also investigated. A reassessment was made of fundamental charge exchange cross section data in support of this study. (author)
Quantum theory of space charge limited current in solids
Energy Technology Data Exchange (ETDEWEB)
González, Gabriel, E-mail: gabriel.gonzalez@uaslp.mx [Cátedras Conacyt, Universidad Autónoma de San Luis Potosí, San Luis Potosí 78000, Mexico and Coordinación para la Innovación y la Aplicación de la Ciencia y la Tecnología, Universidad Autónoma de San Luis Potosí, San Luis Potosí 78000 (Mexico)
2015-02-28
We present a quantum model of space charge limited current transport inside trap-free solids with planar geometry in the mean field approximation. We use a simple transformation which allows us to find the exact analytical solution for the steady state current case. We use our approach to find a Mott-Gurney like behavior and the mobility for single charge carriers in the quantum regime in solids.
Probabilistic transport models for fusion
International Nuclear Information System (INIS)
Milligen, B.Ph. van; Carreras, B.A.; Lynch, V.E.; Sanchez, R.
2005-01-01
A generalization of diffusive (Fickian) transport is considered, in which particle motion is described by probability distributions. We design a simple model that includes a critical mechanism to switch between two transport channels, and show that it exhibits various interesting characteristics, suggesting that the ideas of probabilistic transport might provide a framework for the description of a range of unusual transport phenomena observed in fusion plasmas. The model produces power degradation and profile consistency, as well as a scaling of the confinement time with system size reminiscent of the gyro-Bohm/Bohm scalings observed in fusion plasmas, and rapid propagation of disturbances. In the present work we show how this model may also produce on-axis peaking of the profiles with off-axis fuelling. It is important to note that the fluid limit of a simple model like this, characterized by two transport channels, does not correspond to the usual (Fickian) transport models commonly used for modelling transport in fusion plasmas, and behaves in a fundamentally different way. (author)
Modelling charge storage in Euclid CCD structures
International Nuclear Information System (INIS)
Clarke, A S; Holland, A; Hall, D J; Burt, D
2012-01-01
The primary aim of ESA's proposed Euclid mission is to observe the distribution of galaxies and galaxy clusters, enabling the mapping of the dark architecture of the universe [1]. This requires a high performance detector, designed to endure a harsh radiation environment. The e2v CCD204 image sensor was redesigned for use on the Euclid mission [2]. The resulting e2v CCD273 has a narrower serial register electrode and transfer channel compared to its predecessor, causing a reduction in the size of charge packets stored, thus reducing the number of traps encountered by the signal electrons during charge transfer and improving the serial Charge Transfer Efficiency (CTE) under irradiation [3]. The proposed Euclid CCD has been modelled using the Silvaco TCAD software [4], to test preliminary calculations for the Full Well Capacity (FWC) and the channel potential of the device and provide indications of the volume occupied by varying signals. These results are essential for the realisation of the mission objectives and for radiation damage studies, with the aim of producing empirically derived formulae to approximate signal-volume characteristics in the devices. These formulae will be used in the radiation damage (charge trapping) models. The Silvaco simulations have been tested against real devices to compare the experimental measurements to those predicted in the models. Using these results, the implications of this study on the Euclid mission can be investigated in more detail.
Planned studies of charge collection in non-uniformly irradiated Si and GaAs detectors
International Nuclear Information System (INIS)
Rosenfeld, A.; Reinhard, M.; Carolan, M.; Kaplan, G.; Lerch, M.; Alexiev, D.
1995-01-01
The aim of this project is to study the time and amplitude characteristics of silicon ion-implanted detectors non-uniformly irradiated with fast neutrons in order to predict their radiation behaviour in the LHC and space. It is expected in such detectors increases of the charge deficit due to trapping by large scale traps and transient time increases due to the reduction of the mobility. The theoretical model will be modified to describe the charge kinetics in the electrical field of the detector created by a non uniform space charge distribution. Experimental confirmation techniques are needed to develop non uniform predictable damage of silicon detectors using fast neutron sources (accelerators, reactors) and to study peculiarities of the charge transport in different parts of the detector. In parallel to experimental research will be started the theoretical development of the charge transport model for non-uniform distribution of space charge in the depletion layer (Neff). The model will include the linear distribution of Neff(y) along the detector as well as the change of sign of Neff (conversion from n to p type of silicon) inside the detector
Lin, XuXun; Yuan, PengCheng
2018-01-01
In this research we consider commuters' dynamic learning effect by modeling the trip mode choice behavior from a new perspective of dynamic evolutionary game theory. We explore the behavior pattern of different types of commuters and study the evolution path and equilibrium properties under different traffic conditions. We further establish a dynamic parking charge optimal control (referred to as DPCOC) model to alter commuters' trip mode choice while minimizing the total social cost. Numerical tests show. (1) Under fixed parking fee policy, the evolutionary results are completely decided by the travel time and the only method for public transit induction is to increase the parking charge price. (2) Compared with fixed parking fee policy, DPCOC policy proposed in this research has several advantages. Firstly, it can effectively turn the evolutionary path and evolutionary stable strategy to a better situation while minimizing the total social cost. Secondly, it can reduce the sensitivity of trip mode choice behavior to traffic congestion and improve the ability to resist interferences and emergencies. Thirdly, it is able to control the private car proportion to a stable state and make the trip behavior more predictable for the transportation management department. The research results can provide theoretical basis and decision-making references for commuters' mode choice prediction, dynamic setting of urban parking charge prices and public transit induction.
Theoretical proposal for a magnetic resonance study of charge transport in organic semiconductors
Mkhitaryan, Vagharsh
Charge transport in disordered organic semiconductors occurs via carrier incoherent hops in a band of localized states. In the framework of continuous-time random walk the carrier on-site waiting time distribution (WTD) is one of the basic characteristics of diffusion. Besides, WTD is fundamentally related to the density of states (DOS) of localized states, which is a key feature of a material determining the optoelectric properties. However, reliable first-principle calculations of DOS in organic materials are not yet available and experimental characterization of DOS and WTD is desirable. We theoretically study the spin dynamics of hopping carriers and propose measurement schemes directly probing WTD, based on the zero-field spin relaxation and the primary (Hahn) spin echo. The proposed schemes are possible because, as we demonstrate, the long-time behavior of the zero-field relaxation and the primary echo is determined by WTD, both for the hyperfine coupling dominated and the spin-orbit coupling dominated spin dynamics. We also examine the dispersive charge transport, which is a non-Markovian sub-diffusive process characterized by non-stationarity. We show that the proposed schemes unambiguously capture the effects of non-stationarity, e.g., the aging behavior of random walks. This work was supported by the Department of Energy-Basic Energy Sciences under Contract No. DE-AC02-07CH11358.
Model-Independent Characterization of Charge Diffusion in Thick Fully Depleted CCDs
International Nuclear Information System (INIS)
O'Connor, P.; Takacs, P.; Lawrence, D.; Frank, J.
2011-01-01
We present a new method to measure charge diffusion in charge-coupled devices (CCDs). The method is based on a statistical characterization of the shapes of charge clouds produced by low-energy X-rays using known properties of the two-dimensional Gaussian point-spread function (PSF). The algorithm produces reliable upper and lower bounds on the size of the PSF for photons converting near the entrance window of a device. It is optimally suited to the case of thick back-illuminated CCDs where the X-ray absorption length is smaller than the silicon thickness and the diffusion scale is of the same order as the pixel size. The only assumptions are that the charge cloud width is a monotonically increasing function of distance from the conversion point to the buried channel, and that the conversion probability is peaked at the surface. Otherwise, no physical models of carrier transport or knowledge of the electric field profile in the CCD are needed. In suboptimal conditions, the upper bound increases and the lower bound is unaffected, so confidence in the correctness of results is retained. The new method has been benchmarked against Monte Carlo simulations and tested on X-ray images measured on thick high-resistivity prototype CCDs for the Large Synoptic Survey Telescope. In Monte Carlo simulations of noiseless images having the optimal diffusion scale, the upper bound approximated the true PSF within 5%, increasing to 10% in simulations with added noise. Even with severely undersampled or truncated PSFs, the method brackets the true value to within 25%. Our method is accurate and computationally efficient and offers a fast and simple experimental setup.
Fabiano, Simone; Yoshida, Hiroyuki; Chen, Zhihua; Facchetti, Antonio; Loi, Maria Antonietta
2013-01-01
We investigated the role of metal/organic semiconductor interface morphology on the charge transport mechanisms and energy level alignment of the n-channel semiconductor poly{[N,N'-bis(2-octyldodecyl)-naphthalene-1,4,5,8-bis(dicarboximide)-2,6-diyl]-alt-5,5'-(2,2'-bithiophene)} (P-(NDI2ODT2)).
Charge transport in polyguanine-polycytosine DNA molecules
International Nuclear Information System (INIS)
Wei, J H; Chan, K S
2007-01-01
A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules
Sectional modeling of nanoparticle size and charge distributions in dusty plasmas
International Nuclear Information System (INIS)
Agarwal, Pulkit; Girshick, Steven L
2012-01-01
Sectional models of the dynamics of aerosol populations are well established in the aerosol literature but have received relatively less attention in numerical models of dusty plasmas, where most modeling studies have assumed the existence of monodisperse dust particles. In the case of plasmas in which nanoparticles nucleate and grow, significant polydispersity can exist in particle size distributions, and stochastic charging can cause particles of given size to have a broad distribution of charge states. Sectional models, while computationally expensive, are well suited to treating such distributions. This paper presents an overview of sectional modeling of nanodusty plasmas, and presents examples of simulation results that reveal important qualitative features of the spatiotemporal evolution of such plasmas, many of which could not be revealed by models that consider only monodisperse dust particles and average particle charge. These features include the emergence of bimodal particle populations consisting of very small neutral particles and larger negatively charged particles, the effects of size and charge distributions on coagulation, spreading and structure of the particle cloud, and the dynamics of dusty plasma afterglows. (paper)
Energy position of the transport path in disordered organic semiconductors
International Nuclear Information System (INIS)
Oelerich, J O; Jansson, F; Gebhard, F; Baranovskii, S D; Nenashev, A V
2014-01-01
The concept of transport energy is the most transparent theoretical approach to describe hopping transport in disordered systems with steeply energy dependent density of states (DOS), in particular in organic semiconductors with Gaussian DOS. This concept allows one to treat hopping transport in the framework of a simple multiple-trapping model, replacing the mobility edge by a particular energy level called the transport energy. However, there is no consensus among researchers on the position of this transport level. In this article, we suggest a numerical procedure to find out the energy level most significantly contributing to charge transport in organic semiconductors. The procedure is based on studying the effects of DOS modifications on the charge carrier mobility in straightforward computer simulations. We also show why the most frequently visited energy, computed in several numerical studies to determine the transport energy, is not representative for charge transport. (paper)
Ferrario, M.; Palumbo, L.
2014-12-19
The space charge forces are those generated directly by the charge distribution, with the inclusion of the image charges and currents due to the interaction of the beam with a perfectly conducting smooth pipe. Space charge forces are responsible for several unwanted phenomena related to beam dynamics, such as energy loss, shift of the synchronous phase and frequency , shift of the betatron frequencies, and instabilities. We will discuss in this lecture the main feature of space charge effects in high-energy storage rings as well as in low-energy linacs and transport lines.
Modeling charge polarization voltage for large lithium-ion batteries in electric vehicles
Directory of Open Access Journals (Sweden)
Yan Jiang
2013-06-01
Full Text Available Purpose: Polarization voltage of the lithium-ion battery is an important parameter that has direct influence on battery performance. The paper aims to analyze the impedance characteristics of the lithium-ion battery based on EIS data. Design/methodology/approach: The effects of currents, initial SOC of the battery on charge polarization voltage are investigated, which is approximately linear function of charge current. The change of charge polarization voltage is also analyzed with the gradient analytical method in the SOC domain. The charge polarization model with two RC networks is presented, and parts of model parameters like Ohmic resistance and charge transfer impedance are estimated by both EIS method and battery constant current testing method. Findings: This paper reveals that the Ohmic resistance accounts for much contribution to battery total polarization compared to charge transfer impedance. Practical implications: Experimental results demonstrate the efficacy of the model with the proposed identification method, which provides the foundation for battery charging optimization. Originality/value: The paper analyzed the impedance characteristics of the lithium-ion battery based on EIS data, presented a charge polarization model with two RC networks, and estimated parameters like Ohmic resistance and charge transfer impedance.
Santos, Joao
2017-10-01
Powerful laser-plasma processes are explored to generate discharge currents of a few 100 kA in coil targets, yielding magnetostatic fields (B-fields) in the kTesla range. The B-fields are measured by proton-deflectometry and high-frequency bandwidth B-dot probes. According to our modeling, the quasi-static currents are provided from hot electron ejection from the laser-irradiated surface, accounting for the space charge neutralization and the plasma magnetization. The major control parameter is the laser irradiance Iλ2 . The B-fields ns-scale is long enough to magnetize secondary targets through resistive diffusion. We applied it in experiments of laser-generated relativistic electron transport into solid dielectric targets, yielding an unprecedented enhancement of a factor 5 on the energy-density flux at 60 µm depth, compared to unmagnetized transport conditions. These studies pave the ground for magnetized high-energy density physics investigations, related to laser-generated secondary sources of radiation and/or high-energy particles and their transport, to high-gain fusion energy schemes and to laboratory astrophysics. We acknowledge funding from French National Agency for Research (ANR), Grant TERRE ANR-2011-BS04-014, and from EUROfusion Consortium, European Union's Horizon 2020 research and innovation programme, Grant 633053.
Study of Electron Transport and Amplification in Diamond
Energy Technology Data Exchange (ETDEWEB)
Ben-Zvi, Ilan [Stony Brook Univ., NY (United States); Muller, Erik [Stony Brook Univ., NY (United States)
2015-01-05
The development of the Diamond Amplified Photocathode (DAP) has produced significant results under our previous HEP funded efforts both on the fabrication of working devices and the understanding of the underlying physics governing its performance. The results presented here substantiate the use of diamond as both a secondary electron amplifier for high-brightness, high-average-current electron sources and as a photon and particle detector in harsh radiation environments. Very high average current densities (>10A/cm2) have been transported through diamond material. The transport has been measured as a function of incident photon energy and found to be in good agreement with theoretical models. Measurements of the charge transport for photon energies near the carbon K-edge (290 eV for sp3 bonded carbon) have provided insight into carrier loss due to diffusion; modeling of this aspect of charge transport is underway. The response of diamond to nanosecond x-ray pulses has been measured; in this regime the charge transport is as expected. Electron emission from hydrogenated diamond has been measured using both electron and x-ray generated carriers; a gain of 178 has been observed for electron-generated carriers. The energy spectrum of the emitted electrons has been measured, providing insight into the electron affinity and ultimately the thermal emittance. The origin of charge trapping in diamond has been investigated for both bulk and surface trapping