WorldWideScience

Sample records for charge pair escape

  1. Escape of charged particles from a neutron star

    International Nuclear Information System (INIS)

    Pelizzari, M.A.

    1976-01-01

    The theory of particle trajectories in an axisymmetric magnetic field, formulated by C. Stormer, can be extended to cover conservative force fields as well. As such, it is an ideal tool to study the escape of charged particles from a rapidly rotating neutron star, enabling one to determine the maximum range of their trajectories in space. With the aid of this theory, it is shown that a neutron star, rotating in a vacuum with rotation and magnetic axes aligned, will not evolve a perfectly conducting magnetosphere if the neutron star is the only source of charge. The sign of charge accelerated from the equatorial regions will be magnetically trapped to a toroidal region very near the star, and the opposite sign of charge, emerging from the polar regions, will escape from the magnetosphere until a critical stellar charge is reached, after which polar charges will be electrostatically bound to the magnetosphere. This selective magnetic trapping of one sign of charge, which prevents the formation of a stellar wind, is a consequence of the magnetic field's orientation relative to the internal charge density of the neutron star

  2. Charge Aspects of Composite Pair Superconductivity

    Science.gov (United States)

    Flint, Rebecca

    2014-03-01

    Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.

  3. Pair breaking and charge relaxation in superconductors

    International Nuclear Information System (INIS)

    Nielson, J.B.; Pethick, C.J.; Rammer, J.; Smith, H.

    1982-01-01

    We present a general formalism based on the quasiclassical Green's function for calculating charge imbalance in nonequilibrium superconductors. Our discussion is sufficiently general that it applies at arbitrary temperatures, and under conditions when the width of quasiparticle states are appreciable due to pair breaking processes, and when strong coupling effects are significant. As a first application we demonstrate in detail how in the limit of smallpair breaking and for a weak coupling superconductor the collision term in the formalism reduces to the one in the quasiparticle Boltzmann equation. We next treat the case of charge imbalance generated by tunnel injection, with pair breaking by phonons and magnetic impurities. Over the range of temperatures investigated exerimentally to date, the calculated charge imbalance is rather close to that evaluated using the Boltzmann equation, even if pair braeking is so strong as almost to destroy superconductivity. Finally we consider charge imbalance generated by the combined influence of a supercurrent and a temperature gradient. We give calculations for a dirty superconductor with scattering by phonons as the pair breaking mechanism, and the results give a reasonable account of the experimental data of Clarke, Fjordboge, and Lindelof. We carry out calculations for the case of impurity scattering along which are valid not only in the clean and dirty limits, but also for intermediate situations. These enable us to see how the large contribution to the charge imbalance found for energies close to the gap edge in the clean case is reduced with increasing impurity scattering

  4. Charged topological black hole pair creation

    International Nuclear Information System (INIS)

    Mann, R.B.

    1998-01-01

    I examine the pair creation of black holes in space-times with a cosmological constant of either sign. I consider cosmological C-metrics and show that the conical singularities in this metric vanish only for three distinct classes of black hole metric, two of which have compact event horizons on each spatial slice. One class is a generalization of the Reissner-Nordstroem (anti-)de Sitter black holes in which the event horizons are the direct product of a null line with a 2-surface with topology of genus g. The other class consists of neutral black holes whose event horizons are the direct product of a null conoid with a circle. In the presence of a domain wall, black hole pairs of all possible types will be pair created for a wide range of mass and charge, including even negative mass black holes. I determine the relevant instantons and Euclidean actions for each case. (orig.)

  5. Theoretical Evaluation of the Escape Rate of Charged Particles Trapped in a Potential Energy Well

    International Nuclear Information System (INIS)

    Chang Yongbin; Ordonez, C.A.

    2003-01-01

    In various types of charged particle sources and traps, charged particles are temporarily trapped within a potential energy well. In the work reported, a theoretical evaluation of the escape rate of trapped charged particles is carried out. As a specific example, the loss rate is evaluated for trapped plasma particles that are undergoing both collisions among themselves and collisions with particles of a different plasma species having a different temperature. Conditions are considered in which both species are confined within a nested Penning trap

  6. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  7. Models of charge pair generation in organic solar cells.

    Science.gov (United States)

    Few, Sheridan; Frost, Jarvist M; Nelson, Jenny

    2015-01-28

    Efficient charge pair generation is observed in many organic photovoltaic (OPV) heterojunctions, despite nominal electron-hole binding energies which greatly exceed the average thermal energy. Empirically, the efficiency of this process appears to be related to the choice of donor and acceptor materials, the resulting sequence of excited state energy levels and the structure of the interface. In order to establish a suitable physical model for the process, a range of different theoretical studies have addressed the nature and energies of the interfacial states, the energetic profile close to the heterojunction and the dynamics of excited state transitions. In this paper, we review recent developments underpinning the theory of charge pair generation and phenomena, focussing on electronic structure calculations, electrostatic models and approaches to excited state dynamics. We discuss the remaining challenges in achieving a predictive approach to charge generation efficiency.

  8. Pitch angle resolved measurements of escaping charged fusion products in TFTR

    International Nuclear Information System (INIS)

    Zweben, S.J.

    1989-01-01

    Measurements of the flux of charged fusion products escaping from the TFTR plasma have been made with a new type of detector which can resolve the particle flux vs. pitch angle, energy, and time. The design of this detector is described, and results from the 1987 TFTR run are presented. These results are roughly consistent with predictions from a simple first-orbit particle loss model with respect to the pitch angle, energy, time, and plasma current dependence of the signals. 11 refs., 9 figs

  9. Pitch angle resolved measurements of escaping charged fusion products in TFTR

    Energy Technology Data Exchange (ETDEWEB)

    Zweben, S.J.

    1989-01-01

    Measurements of the flux of charged fusion products escaping from the TFTR plasma have been made with a new type of detector which can resolve the particle flux vs. pitch angle, energy, and time. The design of this detector is described, and results from the 1987 TFTR run are presented. These results are roughly consistent with predictions from a simple first-orbit particle loss model with respect to the pitch angle, energy, time, and plasma current dependence of the signals. 11 refs., 9 figs.

  10. Germline progenitors escape the widespread phenomenon of homolog pairing during Drosophila development.

    Directory of Open Access Journals (Sweden)

    Eric F Joyce

    Full Text Available Homolog pairing, which plays a critical role in meiosis, poses a potential risk if it occurs in inappropriate tissues or between nonallelic sites, as it can lead to changes in gene expression, chromosome entanglements, and loss-of-heterozygosity due to mitotic recombination. This is particularly true in Drosophila, which supports organismal-wide pairing throughout development. Discovered over a century ago, such extensive pairing has led to the perception that germline pairing in the adult gonad is an extension of the pairing established during embryogenesis and, therefore, differs from the mechanism utilized in most species to initiate pairing specifically in the germline. Here, we show that, contrary to long-standing assumptions, Drosophila meiotic pairing in the gonad is not an extension of pairing established during embryogenesis. Instead, we find that homologous chromosomes are unpaired in primordial germ cells from the moment the germline can be distinguished from the soma in the embryo and remain unpaired even in the germline stem cells of the adult gonad. We further establish that pairing originates immediately after the stem cell stage. This pairing occurs well before the initiation of meiosis and, strikingly, continues through the several mitotic divisions preceding meiosis. These discoveries indicate that the spatial organization of the Drosophila genome differs between the germline and the soma from the earliest moments of development and thus argue that homolog pairing in the germline is an active process as versus a passive continuation of pairing established during embryogenesis.

  11. Charge exchange in a planetary corona - Its effect on the distribution and escape of hydrogen

    Science.gov (United States)

    Chamberlain, J. W.

    1977-01-01

    The theory for a spherical collisionless planetary corona is extended to include charge-exchange collisions between H(+) and H, which are assumed to constitute intermingled gases with different kinetic temperatures. The treatment is based on the conventional concept of a critical level (or exobase) above which the only collisions considered in the Boltzmann equation are those that resonantly exchange charge. Although the geometry treated is an oversimplification for a real planet, numerical examples are given for an idealized earth and Venus. For earth, an ion temperature of 4 times the neutral temperature, an ion density at the exobase of 14,000 per cu cm, and a plasmapause at 1.5 earth radii will raise the escape flux of H by a factor of 6. The total H above the exobase is changed by less than 1%. For Venus, conditions are examined that would account for the peculiar H distribution observed from Mariner 5. The plasma conditions required are not obviously outrageous by terrestrial standards, but the Mariner 5 ionosphere measurements did not show a high plasmapause at, say, 1.25 or 1.5 planetary radii, a fact that might argue against a charge-exchange model.

  12. On adiabatic pair potentials of highly charged colloid particles

    Science.gov (United States)

    Sogami, Ikuo S.

    2018-03-01

    Generalizing the Debye-Hückel formalism, we develop a new mean field theory for adiabatic pair potentials of highly charged particles in colloid dispersions. The unoccupied volume and the osmotic pressure are the key concepts to describe the chemical and thermodynamical equilibrium of the gas of small ions in the outside region of all of the colloid particles. To define the proper thermodynamic quantities, it is postulated to take an ensemble averaging with respect to the particle configurations in the integrals for their densities consisting of the electric potential satisfying a set of equations that are derived by linearizing the Poisson-Boltzmann equation. With the Fourier integral representation of the electric potential, we calculate first the internal electric energy of the system from which the Helmholtz free energy is obtained through the Legendre transformation. Then, the Gibbs free energy is calculated using both ways of the Legendre transformation with respect to the unoccupied volume and the summation of chemical potentials. The thermodynamic functions provide three types of pair potentials, all of which are inversely proportional to the fraction of the unoccupied volume. At the limit when the fraction factor reduces to unity, the Helmholtz pair potential turns exactly into the well known Derjaguin-Landau-Verwey-Overbeek repulsive potential. The Gibbs pair potential possessing a medium-range strong repulsive part and a long-range weak attractive tail can explain the Schulze-Hardy rule for coagulation in combination with the van der Waals-London potential and describes a rich variety of phenomena of phase transitions observed in the dilute dispersions of highly charged particles.

  13. Rydberg-state reionization of multiply charged ions escaping from solid surfaces

    International Nuclear Information System (INIS)

    Nedeljkovic, Lj.D.; Nedeljkovic, N.N.

    2003-01-01

    Reionization rates of Rydberg states (n>>1 and l=0, 1, and 2) of multiply charged ionic projectiles escaping solid surfaces are calculated. These rates are obtained in an analytic form as a function of the ion-surface distance R. A phenomenological model of the reionization process, based on two-state quantum dynamics, is adopted for the vicinity of the potential barrier top. The results of calculations show that ionization rates for different Rydberg states are strictly localized and relatively separated. Universality of the reionization rate as a function of the scaling parameter α, describing the turning point configurations, is demonstrated. The reionization is discussed within the framework of a nonresonant population-reionization process at intermediate ionic velocities (v∼1 a.u.). The influence of reionization on the population of ionic Rydberg states is expressed in terms of a renormalized neutralization rate. It is demonstrated that the reionization effect significantly changes the population curves for all Rydberg states. The population curves obtained correlate with beam-foil experimental data concerning the S VI, Cl VII, and Ar VIII ions

  14. Escape peak ratios in silicon X-ray charge coupled devices (CCDs)

    International Nuclear Information System (INIS)

    McCarthy, K.J.; Owens, A.; Keay, A.

    1997-01-01

    The intensity of the escape peak from the CCDs developed for the Joint European X-ray Telescope (JET-X) has been investigated over the energy range 2-10 keV. Both measured and calculated escape peak ratios (i.e., the ratio of counts in the escape peak to the sum of the counts in the escape and main peaks) are found to be in excellent agreement for all event sizes (i.e., single pixel events, 1 and 2 pixel events, etc.). Using a Monte Carlo simulation the escape peak ratio has been investigated as a function of pixel size and depletion depth. For completeness, we list the energy dependent parameterised forms for five CCDs used in three major astronomy missions. (orig.)

  15. Phonon Dispersion and the Competition between Pairing and Charge Order

    Science.gov (United States)

    Costa, N. C.; Blommel, T.; Chiu, W.-T.; Batrouni, G.; Scalettar, R. T.

    2018-05-01

    The Holstein model describes the interaction between fermions and a collection of local (dispersionless) phonon modes. In the dilute limit, the phonon degrees of freedom dress the fermions, giving rise to polaron and bipolaron formation. At higher densities, the phonons mediate collective superconducting (SC) and charge-density wave (CDW) phases. Quantum Monte Carlo (QMC) simulations have considered both these limits but have not yet focused on the physics of more general phonon spectra. Here we report QMC studies of the role of phonon dispersion on SC and CDW order in such models. We quantify the effect of finite phonon bandwidth and curvature on the critical temperature Tcdw for CDW order and also uncover several novel features of diagonal long-range order in the phase diagram, including a competition between charge patterns at momenta q =(π ,π ) and q =(0 ,π ) which lends insight into the relationship between Fermi surface nesting and the wave vector at which charge order occurs. We also demonstrate SC order at half filling in situations where a nonzero bandwidth sufficiently suppresses Tcdw.

  16. Direct search for pair production of heavy stable charged particles in Z decays

    International Nuclear Information System (INIS)

    Soderstrom, E.; McKenna, J.A.; Abrams, G.S.; Adolphsen, C.E.; Averill, D.; Ballam, J.; Barish, B.C.; Barklow, T.; Barnett, B.A.; Bartelt, J.; Bethke, S.; Blockus, D.; Bonvicini, G.; Boyarski, A.; Brabson, B.; Breakstone, A.; Bulos, F.; Burchat, P.R.; Burke, D.L.; Cence, R.J.; Chapman, J.; Chmeissani, M.; Cords, D.; Coupal, D.P.; Dauncey, P.; DeStaebler, H.C.; Dorfan, D.E.; Dorfan, J.M.; Drewer, D.C.; Elia, R.; Feldman, G.J.; Fernandes, D.; Field, R.C.; Ford, W.T.; Fordham, C.; Frey, R.; Fujino, D.; Gan, K.K.; Gero, E.; Gidal, G.; Glanzman, T.; Goldhaber, G.; Gomez Cadenas, J.J.; Gratta, G.; Grindhammer, G.; Grosse-Wiesmann, P.; Hanson, G.; Harr, R.; Harral, B.; Harris, F.A.; Hawkes, C.M.; Hayes, K.; Hearty, C.; Heusch, C.A.; Hildreth, M.D.; Himel, T.; Hinshaw, D.A.; Hong, S.J.; Hutchinson, D.; Hylen, J.; Innes, W.R.; Jacobsen, R.G.; Jaros, J.A.; Jung, C.K.; Kadyk, J.A.; Kent, J.; King, M.; Koetke, D.S.; Komamiya, S.; Koska, W.; Kowalski, L.A.; Kozanecki, W.; Kral, J.F.; Kuhlen, M.; Labarga, L.; Lankford, A.J.; Larsen, R.R.; Le Diberder, F.; Levi, M.E.; Litke, A.M.; Lou, X.C.; Lueth, V.; Matthews, J.A.J.; Mattison, T.; Milliken, B.D.; Moffeit, K.C.; Munger, C.T.; Murray, W.N.; Nash, J.; Ogren, H.; O'Shaughnessy, K.F.; Parker, S.I.; Peck, C.; Perl, M.L.; Petradza, M.; Pitthan, R.; Porter, F.C.; Rankin, P.; Riles, K.; Rouse, F.R.; Rust, D.R.; Sadrozinski, H.F.W.; Schaad, M.W.; Schumm, B.A.; Seiden, A.; Smith, J.G.; Snyder, A.; Stoker, D.P.; Stroynowski, R.; Swartz, M.; Thun, R.; Trilling, G.H.; Van Kooten, R.; Voruganti, P.; Wagner, S.R.; Watson, S.; Weber, P.; Weinstein, A.J.; Weir, A.J.; Wicklund, E.; Woods, M.; Wu, D.Y.; Yurko, M.; Zaccardelli, C.; von Zanthie, C.

    1990-01-01

    A search for pair production of stable charged particles from Z decay has been performed with the Mark II detector at the SLAC Linear Collider. Particle masses are determined from momentum, ionization energy loss, and time-of-flight measurements. A limit excluding pair production of stable fourth-generation charged leptons and stable mirror fermions with masses between the muon mass and 36.3 GeV/c 2 is set at the 95% confidence level. Pair production of stable supersymmetric scalar leptons with masses between the muon mass and 32.6 GeV/c 2 is also excluded

  17. First Measurement of the Charge Asymmetry in Beauty-Quark Pair Production

    NARCIS (Netherlands)

    Aaij, R.; Adeva, B.; Adinolfi, M.; Affolder, A.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Anderson, J.; Andreassen, R.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Gutierrez, O. Aquines; Archilli, F.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Bachmann, S.; Back, J. J.; Badalov, A.; Balagura, V.; Baldini, W.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Batozskaya, V.; Battista, V.; Bay, A.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Belogurov, S.; Belous, K.; Onderwater, G.; Pellegrino, A.

    2014-01-01

    The difference in the angular distributions between beauty quarks and antiquarks, referred to as the charge asymmetry, is measured for the first time in b (b) over bar pair production at a hadron collider. The data used correspond to an integrated luminosity of 1.0 fb(-1) collected at 7 TeV

  18. Modulation instability of ion thermal waves in a pair-ion plasma containing charged dust impurities

    International Nuclear Information System (INIS)

    Sabry, R.

    2008-01-01

    Modulation instability of ion thermal waves (ITWs) is investigated in a plasma composed of positive and negative ions as well as a fraction of stationary charged (positive or negative) dust impurities. For this purpose, a linear dispersion relation and a nonlinear Schroedinger equation are derived. The latter admits localized envelope solitary wave solutions of bright (pulses) and dark (holes, voids) type. The envelope soliton depends on the intrinsic plasma parameters. It is found that modulation instability of ITWs is significantly affected by the presence of positively/negatively charged dust grains. The findings of this investigation should be useful in understanding the stable electrostatic wave packet acceleration mechanisms in pair-ion plasma, and also enhances our knowledge on the occurrence of instability associated to the existence of charged dust impurities in pair-ion plasmas. Our results should be of relevance for laboratory plasmas.

  19. Calculation of the decay rate of tachyonic neutrinos against charged-lepton-pair and neutrino-pair Cerenkov radiation

    Science.gov (United States)

    Jentschura, Ulrich D.; Nándori, István; Ehrlich, Robert

    2017-10-01

    We consider in detail the calculation of the decay rate of high-energy superluminal neutrinos against (charged) lepton pair Cerenkov radiation, and neutrino pair Cerenkov radiation, i.e., against the decay channels ν \\to ν {e}+ {e}- and ν \\to ν \\overline{ν } ν . Under the hypothesis of a tachyonic nature of neutrinos, these decay channels put constraints on the lifetime of high-energy neutrinos for terrestrial experiments as well as on cosmic scales. For the oncoming neutrino, we use the Lorentz-covariant tachyonic relation {E}ν =\\sqrt{{p}2-{m}ν 2}, where m ν is the tachyonic mass parameter. We derive both threshold conditions as well as on decay and energy loss rates, using the plane-wave fundamental bispinor solutions of the tachyonic Dirac equation. Various intricacies of rest frame versus lab frame calculations are highlighted. The results are compared to the observations of high-energy IceCube neutrinos of cosmological origin.

  20. Top Quark Pair Properties - Spin Correlation, Charge Asymmetry, and Complex Final States - at ATLAS

    Directory of Open Access Journals (Sweden)

    Brost Elizabeth

    2014-04-01

    Full Text Available We present measurements of top quark pair properties performed with the ATLAS detector at the Large Hadron Collider in proton-proton collisions at a center-of-mass energy of √s = 7 TeV. The latest measurements of spin correlation and charge asymmetry in tt¯$t\\overline t $ events, as well as measurements of the cross section for tt¯$t\\overline t $ production in association with vector bosons, are presented.

  1. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  2. Pair production of charged Higgs scalars from electroweak gauge boson fusion

    CERN Document Server

    Moretti, S.

    2002-01-01

    We compute the contribution to charged Higgs boson pair production at the Large Hadron Collider (LHC) due to the scattering of two electroweak (EW) gauge bosons, these being in turn generated via bremsstrahlung off incoming quarks and antiquarks: $q\\bar q\\to q\\bar q V^*V^*\\to q\\bar q H^+H^-$ ($V=\\gamma,Z,W^\\pm$). We verify that the production cross section of this mode is $\\tan\\beta$ independent and show that it is smaller than that of $H^+H^-$ production via $q\\bar q$-initiated processes but generally larger than that of the loop-induced channel $gg\\to H^+H^-$.

  3. Search for pair-production of long-lived heavy charged particles in $e^+ e^-$ annihilation

    CERN Document Server

    Barate, R.; Decamp, D.; Ghez, Philippe; Goy, C.; Lees, J.P.; Lucotte, A.; Minard, M.N.; Nief, J.Y.; Pietrzyk, B.; Casado, M.P.; Chmeissani, M.; Comas, P.; Crespo, J.M.; Delfino, M.; Fernandez, E.; Fernandez-Bosman, M.; Garrido, L.; Juste, A.; Martinez, M.; Miquel, R.; Mir, L.M.; Orteu, S.; Padilla, C.; Park, I.C.; Pascual, A.; Perlas, J.A.; Riu, I.; Sanchez, F.; Teubert, F.; Colaleo, A.; Creanza, D.; De Palma, M.; Gelao, G.; Iaselli, G.; Maggi, G.; Maggi, M.; Marinelli, N.; Nuzzo, S.; Ranieri, A.; Raso, G.; Ruggieri, F.; Selvaggi, G.; Silvestris, L.; Tempesta, P.; Tricomi, A.; Zito, G.; Huang, X.; Lin, J.; Ouyang, Q.; Wang, T.; Xie, Y.; Xu, R.; Xue, S.; Zhang, J.; Zhang, L.; Zhao, W.; Abbaneo, D.; Alemany, R.; Bazarko, A.O.; Becker, U.; Bright-Thomas, P.; Cattaneo, M.; Cerutti, F.; Dissertori, G.; Drevermann, H.; Forty, R.W.; Frank, M.; Hagelberg, R.; Hansen, J.B.; Harvey, John; Janot, P.; Jost, B.; Kneringer, E.; Knobloch, J.; Lehraus, I.; Lutters, G.; Mato, P.; Minten, A.; Moneta, L.; Pacheco, A.; Pusztaszeri, J.F.; Ranjard, F.; Rizzo, G.; Rolandi, Gigi; Schlatter, D.; Schmitt, M.; Schneider, O.; Tejessy, W.; Tomalin, I.R.; Wachsmuth, H.; Wagner, A.; Ajaltouni, Z.; Barres, A.; Boyer, C.; Falvard, A.; Ferdi, C.; Gay, P.; Guicheney, C.; Henrard, P.; Jousset, J.; Michel, B.; Monteil, S.; Montret, J.C.; Pallin, D.; Perret, P.; Podlyski, F.; Proriol, J.; Rosnet, P.; Rossignol, J.M.; Fearnley, T.; Hansen, J.D.; Hansen, J.R.; Hansen, P.H.; Nilsson, B.S.; Rensch, B.; Waananen, A.; Daskalakis, G.; Kyriakis, A.; Markou, C.; Simopoulou, E.; Vayaki, A.; Blondel, A.; Brient, J.C.; Machefert, F.; Rouge, A.; Rumpf, M.; Valassi, A.; Videau, H.; Focardi, E.; Parrini, G.; Zachariadou, K.; Cavanaugh, R.; Corden, M.; Georgiopoulos, C.; Huehn, T.; Jaffe, D.E.; Antonelli, A.; Bencivenni, G.; Bologna, G.; Bossi, F.; Campana, P.; Capon, G.; Casper, D.; Chiarella, V.; Felici, G.; Laurelli, P.; Mannocchi, G.; Murtas, F.; Murtas, G.P.; Passalacqua, L.; Pepe-Altarelli, M.; Curtis, L.; Dorris, S.J.; Halley, A.W.; Knowles, I.G.; Lynch, J.G.; O'Shea, V.; Raine, C.; Scarr, J.M.; Smith, K.; Teixeira-Dias, P.; Thompson, A.S.; Thomson, Evelyn J.; Thomson, F.; Turnbull, R.M.; Geweniger, C.; Graefe, G.; Hanke, P.; Hansper, G.; Hepp, V.; Kluge, E.E.; Putzer, A.; Schmidt, M.; Sommer, J.; Tittel, K.; Werner, S.; Wunsch, M.; Beuselinck, R.; Binnie, D.M.; Cameron, W.; Dornan, P.J.; Girone, M.; Goodsir, S.; Martin, E.B.; Morawitz, P.; Moutoussi, A.; Nash, J.; Sedgbeer, J.K.; Stacey, A.M.; Williams, M.D.; Girtler, P.; Kuhn, D.; Rudolph, G.; Betteridge, A.P.; Bowdery, C.K.; Colrain, P.; Crawford, G.; Finch, A.J.; Foster, F.; Hughes, G.; Jones, R.W.; Sloan, T.; Whelan, E.P.; Williams, M.I.; Hoffmann, C.; Jakobs, K.; Kleinknecht, K.; Quast, G.; Renk, B.; Rohne, E.; Sander, H.G.; van Gemmeren, P.; Zeitnitz, C.; Aubert, J.J.; Benchouk, C.; Bonissent, A.; Bujosa, G.; Calvet, D.; Carr, J.; Coyle, P.; Diaconu, C.; Konstantinidis, N.; Leroy, O.; Motsch, F.; Payre, P.; Rousseau, D.; Talby, M.; Sadouki, A.; Thulasidas, M.; Tilquin, A.; Trabelsi, K.; Aleppo, M.; Ragusa, F.; Berlich, R.; Blum, W.; Buescher, Volker; Dietl, H.; Ganis, G.; Gotzhein, C.; Kroha, H.; Lutjens, G.; Lutz, G.; Manner, W.; Moser, H.G.; Richter, Robert, 1; Rosado-Schlosser, A.; Schael, S.; Settles, R.; Seywerd, H.; St. Denis, Richard Dante; Stenzel, H.; Wiedenmann, W.; Wolf, G.; Boucrot, J.; Callot, O.; Chen, S.; Cordier, A.; Davier, M.; Duflot, L.; Grivaz, J.F.; Heusse, P.; Hocker, Andreas; Jacholkowska, A.; Jacquet, M.; Kim, D.W.; Le Diberder, F.; Lefrancois, J.; Lutz, A.M.; Nikolic, Irina; Schune, M.H.; Simion, S.; Tournefier, E.; Veillet, J.J.; Videau, I.; Zerwas, D.; Azzurri, P.; Bagliesi, Giuseppe; Batignani, G.; Bettarini, S.; Bozzi, C.; Calderini, G.; Carpinelli, M.; Ciocci, M.A.; Ciulli, V.; Dell'Orso, R.; Fantechi, R.; Ferrante, I.; Giassi, A.; Gregorio, A.; Ligabue, F.; Lusiani, A.; Marrocchesi, P.S.; Messineo, A.; Palla, F.; Sanguinetti, G.; Sciaba, A.; Spagnolo, P.; Steinberger, J.; Tenchini, R.; Tonelli, G.; Vannini, C.; Venturi, A.; Verdini, P.G.; Blair, G.A.; Bryant, L.M.; Chambers, J.T.; Gao, Y.; Green, M.G.; Medcalf, T.; Perrodo, P.; Strong, J.A.; von Wimmersperg-Toeller, J.H.; Botterill, D.R.; Clifft, R.W.; Edgecock, T.R.; Haywood, S.; Maley, P.; Norton, P.R.; Thompson, J.C.; Wright, A.E.; Bloch-Devaux, Brigitte; Colas, P.; Fabbro, B.; Kozanecki, W.; Lancon, E.; Lemaire, M.C.; Locci, E.; Perez, P.; Rander, J.; Renardy, J.F.; Rosowsky, A.; Roussarie, A.; Schuller, J.P.; Schwindling, J.; Trabelsi, A.; Vallage, B.; Black, S.N.; Dann, J.H.; Kim, H.Y.; Litke, A.M.; McNeil, M.A.; Taylor, G.; Booth, C.N.; Boswell, R.; Brew, C.A.J.; Cartwright, S.; Combley, F.; Kelly, M.S.; Lehto, M.; Newton, W.M.; Reeve, J.; Thompson, L.F.; Affholderbach, K.; Boehrer, Armin; Brandt, S.; Cowan, G.; Foss, J.; Grupen, C.; Saraiva, P.; Smolik, L.; Stephan, F.; Apollonio, M.; Bosisio, L.; Della Marina, R.; Giannini, G.; Gobbo, B.; Musolino, G.; Putz, J.; Rothberg, J.; Wasserbaech, S.; Williams, R.W.; Armstrong, S.R.; Charles, E.; Elmer, P.; Ferguson, D.P.S.; Gonzalez, S.; Greening, T.C.; Hayes, O.J.; Hu, H.; Jin, S.; McNamara, P.A., III; Nachtman, J.M.; Nielsen, J.; Orejudos, W.; Pan, Y.B.; Saadi, Y.; Scott, I.J.; Walsh, J.; Wu, S.L.; Wu, X.; Yamartino, J.M.; Zobernig, G.

    1997-01-01

    A search for pair-production of long-lived, heavy, singly-charged particles has been performed with data collected by the ALEPH detector at a centre-of-mass energy of 172 GeV. Data at \\sqrt{s} = 161, 136, and 130 GeV are also included to improve the sensitivity to lower masses. No candidate is found in the data. A model-independent 95 % confidence level upper limit on the production cross section at 172 GeV of 0.2-0.4 pb is derived for masses between 45 and 86 GeV/c^2. This cross section limit implies, assuming the MSSM, a lower limit of 67 (69) GeV/c^2 on the mass of right- (left-) handed long-lived scalar taus or scalar muons and of 86 GeV/c^2 on the mass of long-lived charginos.

  4. Ionic pairing in binary liquids of charged hard spheres with non-additive diameters

    International Nuclear Information System (INIS)

    Pastore, G.; Giaquinta, P.V.; Thakur, J.S.; Tosi, M.P.

    1985-07-01

    We examine types of short range order that arise in binary liquids from a combination of Coulombic interactions and non-additivity of excluded volumes, the initial motivation being observations of complex formation by hydrated ions in concentrated aqueous solutions. The model is a fluid of charged hard spheres with contact distances σsub(+-)not=1/2(σsub(++)+σsub(--)), its structural functions being evaluated in the mean spherical approximation and in the hypernetted chain approximation. Cation-anion pairing is clearly seen in the calculated structural functions for negative deviations from additivity (σsub(+-) σsub(++)=σsub(--)) favour long-wavelength concentration fluctuations and demixing in a neutral mixture: these are suppressed by Coulombic interactions in favour of microscopic intermixing of the two species in the local liquid structure, up to like-ion pairing. Contact is made with diffraction from concentrated aqueous solutions of cadmium sulphate and other instances of possible applicability of the model are pointed out. (author)

  5. Iodide Ion Pairing with Highly Charged Ruthenium Polypyridyl Cations in CH3CN.

    Science.gov (United States)

    Swords, Wesley B; Li, Guocan; Meyer, Gerald J

    2015-05-04

    A series of three highly charged cationic ruthenium(II) polypyridyl complexes of the general formula [Ru(deeb)3-x(tmam)x](PF6)2x+2, where deeb is 4,4'-diethyl ester-2,2'-bipyridine and tmam is 4,4'-bis[(trimethylamino)methyl]-2,2'-bipyridine, were synthesized and characterized and are referred to as 1, 2, or 3 based on the number of tmam ligands. Crystals suitable for X-ray crystallography were obtained for the homoleptic complex 3, which was found to possess D3 symmetry over the entire ruthenium complex. The complexes displayed visible absorption spectra typical of metal-to-ligand charge-transfer (MLCT) transitions. In acetonitrile, quasi-reversible waves were assigned to Ru(III/II) electron transfer, with formal reduction potentials that shifted negative as the number of tmam ligands was increased. Room temperature photoluminescence was observed in acetonitrile with quantum yields of ϕ ∼ 0.1 and lifetimes of τ ∼ 2 μs. The spectroscopic and electrochemical data were most consistent with excited-state localization on the deeb ligand for 1 and 2 and on the tmam ligand for 3. The addition of tetrabutylammonium iodide to the complexes dissolved in a CH3CN solution led to changes in the UV-vis absorption spectra consistent with ion pairing. A Benesi-Hildebrand-type analysis of these data revealed equilibrium constants that increased with the cationic charge 1 10(8) s(-1). The possible relevance of this work to solar energy conversion and dye-sensitized solar cells is discussed.

  6. Measurement of Collins asymmetries in inclusive production of charged pion pairs in e(+)e(-) annihilation at BABAR

    NARCIS (Netherlands)

    Lees, J. P.; Poireau, V.; Tisserand, V.; Grauges, E.; Palano, A.; Eigen, G.; Stugu, B.; Brown, D. N.; Kerth, L. T.; Kolomensky, Yu. G.; Lynch, G.; Schroeder, T.; Hearty, C.; Mattison, T. S.; McKenna, J. A.; So, R. Y.; Khan, A.; Blinov, V. E.; Buzykaev, A. R.; Druzhinin, V. P.; Golubev, V. B.; Kravchenko, E. A.; Onuchin, A. P.; Serednyakov, S. I.; Skovpen, Yu. I.; Solodov, E. P.; Todyshev, K. Yu.; Yushkov, A. N.; Kirkby, D.; Lankford, A. J.; Mandelkern, M.; Dey, B.; Gary, J. W.; Long, O.; Vitug, G. M.; Campagnari, C.; Sevilla, M. Franco; Hong, T. M.; Kovalskyi, D.; Richman, J. D.; West, C. A.; Eisner, A. M.; Lockman, W. S.; Schumm, B. A.; Seiden, A.; Chao, D. S.; Echenard, B.; Flood, K. T.; Hitlin, D. G.; Ongmongkolkul, P.; Andreassen, R.; Huard, Z.; Meadows, B. T.; Pushpawela, B. G.; Sokoloff, M. D.; Sun, L.; Bloom, P. C.; Ford, W. T.; Gaz, A.; Nauenberg, U.; Smith, J. G.; Wagner, S. R.; Ayad, R.; Toki, W. H.; Spaan, B.; Schwierz, R.; Bernard, D.; Verderi, M.; Playfer, S.; Bettoni, D.; Bozzi, C.; Calabrese, R.; Cibinetto, G.; Fioravanti, E.; Garzia, I.; Luppi, E.; Piemontese, L.; Santoro, V.; Baldini-Ferroli, R.; Calcaterra, A.; de Sangro, R.; Finocchiaro, G.; Martellotti, S.; Patteri, P.; Peruzzi, I. M.; Piccolo, M.; Rama, M.; Zallo, A.; Contri, R.; Guido, E.; Lo Vetere, M.; Monge, M. R.; Passaggio, S.; Patrignani, C.; Robutti, E.; Bhuyan, B.; Prasad, V.; Morii, M.; Adametz, A.; Uwer, U.; Lacker, H. M.; Dauncey, P. D.; Mallik, U.; Cochran, J.; Meyer, W. T.; Prell, S.; Gritsan, A. V.; Arnaud, N.; Davier, M.; Derkach, D.; Grosdidier, G.; Le Diberder, F.; Lutz, A. M.; Malaescu, B.; Roudeau, P.; Stocchi, A.; Wormser, G.; Lange, D. J.; Wright, D. M.; Coleman, J. P.; Fry, J. R.; Gabathuler, E.; Hutchcroft, D. E.; Payne, D. J.; Touramanis, C.; Bevan, A. J.; Di Lodovico, F.; Sacco, R.; Cowan, G.; Bougher, J.; Brown, D. N.; Davis, C. L.; Denig, A. G.; Fritsch, M.; Gradl, W.; Griessinger, K.; Hafner, A.; Prencipe, E.; Schubert, K. R.; Barlow, R. J.; Lafferty, G. D.; Behn, E.; Cenci, R.; Hamilton, B.; Jawahery, A.; Roberts, D. A.; Cowan, R.; Dujmic, D.; Sciolla, G.; Cheaib, R.; Patel, P. M.; Robertson, S. H.; Biassoni, P.; Neri, N.; Palombo, F.; Cremaldi, L.; Godang, R.; Sonnek, P.; Summers, D. J.; Simard, M.; Taras, P.; De Nardo, G.; Monorchio, D.; Onorato, G.; Sciacca, C.; Martinelli, M.; Raven, G.; Jessop, C. P.; LoSecco, J. M.; Honscheid, K.; Kass, R.; Brau, J.; Frey, R.; Sinev, N. B.; Strom, D.; Torrence, E.; Feltresi, E.; Margoni, M.; Morandin, M.; Posocco, M.; Rotondo, M.; Simi, G.; Simonetto, F.; Stroili, R.; Akar, S.; Ben-Haim, E.; Bomben, M.; Bonneaud, G. R.; Briand, H.; Calderini, G.; Chauveau, J.; Leruste, Ph.; Marchiori, G.; Ocariz, J.; Sitt, S.; Biasini, M.; Manoni, E.; Pacetti, S.; Rossi, A.; Angelini, C.; Batignani, G.; Bettarini, S.; Carpinelli, M.; Casarosa, G.; Cervelli, A.; Forti, F.; Giorgi, M. A.; Lusiani, A.; Oberhof, B.; Paoloni, E.; Perez, A.; Rizzo, G.; Walsh, J. J.; Pegna, D. Lopes; Olsen, J.; Smith, A. J. S.; Faccini, R.; Ferrarotto, F.; Ferroni, F.; Gaspero, M.; Gioi, L. Li; Piredda, G.; Buenger, C.; Grueberg, O.; Leddig, T.; Voss, C.; Waldi, R.; Adye, T.; Olaiya, E. O.; Wilson, F. F.; Emery, S.; de Monchenault, G. Hamel; Vasseur, G.; Yeche, Ch.; Anulli, F.; Aston, D.; Bard, D. J.; Benitez, J. F.; Cartaro, C.; Convery, M. R.; Dorfan, J.; Dubois-Felsmann, G. P.; Dunwoodie, W.; Ebert, M.; Field, R. C.; Fulsom, B. G.; Gabareen, A. M.; Graham, M. T.; Hast, C.; Innes, W. R.; Kim, P.; Kocian, M. L.; Leith, D. W. G. S.; Lewis, P.; Lindemann, D.; Lindquist, B.; Luitz, S.; Luth, V.; Lynch, H. L.; MacFarlane, D. B.; Muller, D. R.; Neal, H.; Nelson, S.; Perl, M.; Pulliam, T.; Ratcliff, B. N.; Roodman, A.; Salnikov, A. A.; Schindler, R. H.; Snyder, A.; Su, D.; Sullivan, M. K.; Va'vra, J.; Wisniewski, W. J.; Wittgen, M.; Wright, D. H.; Wulsin, H. W.; Ziegler, V.; Park, W.; Purohit, M. V.; White, R. M.; Wilson, J. R.; Randle-Conde, A.; Sekula, S. J.; Bellis, M.; Burchat, P. R.; Miyashita, T. S.; Puccio, E. M. T.; Alam, M. S.; Ernst, J. A.; Gorodeisky, R.; Guttman, N.; Peimer, D. R.; Soffer, A.; Spanier, S. M.; Ritchie, J. L.; Ruland, A. M.; Schwitters, R. F.; Wray, B. C.; Izen, J. M.; Lou, X. C.; Bianchi, F.; De Mori, F.; Filippi, A.; Gamba, D.; Zambito, S.; Lanceri, L.; Vitale, L.; Martinez-Vidal, F.; Oyanguren, A.; Villanueva-Perez, P.; Ahmed, H.; Albert, J.; Banerjee, Sw.; Bernlochner, F. U.; Choi, H. H. F.; Kowalewski, R.; Lewczuk, M. J.; Lueck, T.; Nugent, I. M.; Roney, J. M.; Sobie, R. J.; Tasneem, N.; Gershon, T. J.; Harrison, P. F.; Latham, T. E.; Band, H. R.; Dasu, S.; Pan, Y.; Prepost, R.

    2014-01-01

    We present measurements of Collins asymmetries in the inclusive process e+e−→ππX, where π stands for charged pions, at a center-of-mass energy of 10.6 GeV. We use a data sample of 468  fb−1 collected by the BABAR experiment at the PEP-II B factory at SLAC, and consider pairs of charged pions

  7. One-to-one correspondence of charge-imbalance relaxing mechanisms with pair-breaking mechanisms in superconductors

    International Nuclear Information System (INIS)

    Lemberger, T.R.

    1984-01-01

    A one-to-one correspondence of charge-imbalance relaxing mechanisms with pair-breaking mechanisms in superconductors is demonstrated. The characteristic rates for these two effects are shown to be equal, within factors of order unity. These results are used to estimate the charge-imbalance relaxation rate associated with the proximity effect of a normal metal in metallic contact with a superconductor

  8. Pair-density waves, charge-density waves, and vortices in high-Tc cuprates

    Science.gov (United States)

    Dai, Zhehao; Zhang, Ya-Hui; Senthil, T.; Lee, Patrick A.

    2018-05-01

    A recent scanning tunneling microscopy (STM) experiment reports the observation of a charge-density wave (CDW) with a period of approximately 8a in the halo region surrounding the vortex core, in striking contrast to the approximately 4a period CDWs that are commonly observed in the cuprates. Inspired by this work, we study a model where a bidirectional pair-density wave (PDW) with period 8 is at play. This further divides into two classes: (1) where the PDW is a competing state of the d -wave superconductor and can exist only near the vortex core where the d -wave order is suppressed and (2) where the PDW is the primary order, the so-called "mother state" that persists with strong phase fluctuations to high temperature and high magnetic field and lies behind the pseudogap phenomenology. We study the charge-density wave structures near the vortex core in these models. We emphasize the importance of the phase winding of the d -wave order parameter. The PDW can be pinned by the vortex core due to this winding and become static. Furthermore, the period-8 CDW inherits the properties of this winding, which gives rise to a special feature of the Fourier transform peak, namely, it is split in certain directions. There is also a line of zeros in the inverse Fourier transform of filtered data. We propose that these are key experimental signatures that can distinguish between the PDW-driven scenario from the more mundane option that the period-8 CDW is primary. We discuss the pro's and con's of the options considered above. Finally, we attempt to place the STM experiment in the broader context of pseudogap physics of underdoped cuprates and relate this observation to the unusual properties of x-ray scattering data on CDW carried out to very high magnetic field.

  9. First measurement of the charge asymmetry in beauty-quark pair production

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreassen, Rolf; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Balagura, Vladislav; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Belogurov, Sergey; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Bird, Thomas; Bizzeti, Andrea; Bjørnstad, Pål Marius; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borgia, Alessandra; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Brambach, Tobias; van den Brand, Johannes; Bressieux, Joël; Brett, David; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Brown, Henry; Bursche, Albert; Busetto, Giovanni; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carranza-Mejia, Hector; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Ciba, Krzystof; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Counts, Ian; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dalseno, Jeremy; David, Pascal; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Silva, Weeraddana; De Simone, Patrizia; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Di Canto, Angelo; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garofoli, Justin; Garra Tico, Jordi; Garrido, Lluis; Gaspar, Clara; Gauld, Rhorry; Gavardi, Laura; Gavrilov, Gennadii; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Giani', Sebastiana; Gibson, Valerie; Giubega, Lavinia-Helena; Gligorov, Vladimir; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gordon, Hamish; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graziani, Giacomo; Grecu, Alexandru; Greening, Edward; Gregson, Sam; Griffith, Peter; Grillo, Lucia; Grünberg, Oliver; Gui, Bin; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Hampson, Thomas; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; He, Jibo; Head, Timothy; Heijne, Veerle; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hoballah, Mostafa; Hombach, Christoph; Hulsbergen, Wouter; Hunt, Philip; Hussain, Nazim; Hutchcroft, David; Hynds, Daniel; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jaton, Pierre; Jawahery, Abolhassan; Jing, Fanfan; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kaballo, Michael; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Karbach, Moritz; Karodia, Sarah; Kelsey, Matthew; Kenyon, Ian; Ketel, Tjeerd; Khanji, Basem; Khurewathanakul, Chitsanu; Klaver, Suzanne; Klimaszewski, Konrad; Kochebina, Olga; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Korolev, Mikhail; Kozlinskiy, Alexandr; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krocker, Georg; Krokovny, Pavel; Kruse, Florian; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kurek, Krzysztof; Kvaratskheliya, Tengiz; La Thi, Viet Nga; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lambert, Robert W; Lanciotti, Elisa; Lanfranchi, Gaia; Langenbruch, Christoph; Langhans, Benedikt; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Lefèvre, Regis; Leflat, Alexander; Lefrançois, Jacques; Leo, Sabato; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Liles, Myfanwy; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Liu, Guoming; Lohn, Stefan; Longstaff, Iain; Lopes, Jose; Lopez-March, Neus; Lowdon, Peter; Lu, Haiting; Lucchesi, Donatella; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Machefert, Frederic; Machikhiliyan, Irina V; Maciuc, Florin; Maev, Oleg; Malde, Sneha; Manca, Giulia; Mancinelli, Giampiero; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Märki, Raphael; Marks, Jörg; Martellotti, Giuseppe; Martens, Aurelien; Martín Sánchez, Alexandra; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massafferri, André; Matev, Rosen; Mathe, Zoltan; Matteuzzi, Clara; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; McSkelly, Ben; Meadows, Brian; Meier, Frank; Meissner, Marco; Merk, Marcel; Milanes, Diego Alejandro; Minard, Marie-Noelle; Moggi, Niccolò; Molina Rodriguez, Josue; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Müller, Katharina; Muresan, Raluca; Mussini, Manuel; Muster, Bastien; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi-Dung; Nguyen-Mau, Chung; Nicol, Michelle; Niess, Valentin; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Oggero, Serena; Ogilvy, Stephen; Okhrimenko, Oleksandr; Oldeman, Rudolf; Onderwater, Gerco; Orlandea, Marius; Otalora Goicochea, Juan Martin; Owen, Patrick; Oyanguren, Maria Arantza; Pal, Bilas Kanti; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Parkes, Christopher; Parkinson, Christopher John; Passaleva, Giovanni; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pazos Alvarez, Antonio; Pearce, Alex; Pellegrino, Antonio; Pepe Altarelli, Monica; Perazzini, Stefano; Perez Trigo, Eliseo; Perret, Pascal; Perrin-Terrin, Mathieu; Pescatore, Luca; Pesen, Erhan; Petridis, Konstantin; Petrolini, Alessandro; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pilař, Tomas; Pinci, Davide; Pistone, Alessandro; Playfer, Stephen; Plo Casasus, Maximo; Polci, Francesco; Poluektov, Anton; Polycarpo, Erica; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Potterat, Cédric; Price, Eugenia; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Rachwal, Bartolomiej; Rademacker, Jonas; Rakotomiaramanana, Barinjaka; Rama, Matteo; Rangel, Murilo; Raniuk, Iurii; Rauschmayr, Nathalie; Raven, Gerhard; Reichert, Stefanie; Reid, Matthew; dos Reis, Alberto; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vincente; Roa Romero, Diego; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Perez, Pablo; Roiser, Stefan; Romanovsky, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rouvinet, Julien; Ruf, Thomas; Ruffini, Fabrizio; Ruiz, Hugo; Ruiz Valls, Pablo; Sabatino, Giovanni; Saborido Silva, Juan Jose; Sagidova, Naylya; Sail, Paul; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santovetti, Emanuele; Sapunov, Matvey; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrie, Mauro; Savrina, Darya; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Seco, Marcos; Semennikov, Alexander; Sepp, Indrek; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Silva Coutinho, Rafael; Simi, Gabriele; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Anthony; Smith, Edmund; Smith, Eluned; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Soomro, Fatima; Souza, Daniel; Souza De Paula, Bruno; Spaan, Bernhard; Sparkes, Ailsa; Spradlin, Patrick; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Steinkamp, Olaf; Stenyakin, Oleg; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Stroili, Roberto; Subbiah, Vijay Kartik; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Swientek, Stefan; Syropoulos, Vasileios; Szczekowski, Marek; Szczypka, Paul; Szilard, Daniela; Szumlak, Tomasz; T'Jampens, Stephane; Teklishyn, Maksym; Tellarini, Giulia; Teubert, Frederic; Thomas, Christopher; Thomas, Eric; van Tilburg, Jeroen; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Topp-Joergensen, Stig; Torr, Nicholas; Tournefier, Edwige; Tourneur, Stephane; Tran, Minh Tâm; Tresch, Marco; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tuning, Niels; Ubeda Garcia, Mario; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vagnoni, Vincenzo; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vázquez Sierra, Carlos; Vecchi, Stefania; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Vollhardt, Achim; Volyanskyy, Dmytro; Voong, David; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; Voss, Helge; de Vries, Jacco; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wandernoth, Sebastian; Wang, Jianchun; Ward, David; Watson, Nigel; Websdale, David; Whitehead, Mark; Wicht, Jean; Wiedner, Dirk; Wilkinson, Guy; Williams, Matthew; Williams, Mike; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wright, Simon; Wu, Suzhi; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yuan, Xuhao; Yushchenko, Oleg; Zangoli, Maria; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Wen Chao; Zhang, Yanxi; Zhelezov, Alexey; Zhokhov, Anatoly; Zhong, Liang; Zvyagin, Alexander

    2014-01-01

    The difference in the angular distributions between beauty quarks and antiquarks, referred to as the charge asymmetry, is measured for the first time in $b\\bar{b}$ pair production at a hadron collider. The data used correspond to an integrated luminosity of 1.0fb$^{-1}$ collected at 7TeV center-of-mass energy in proton-proton collisions with the LHCb detector. The measurement is performed in three regions of the invariant mass of the $b\\bar{b}$ system. The results obtained are: \\begin{eqnarray} A_{C}^{b\\bar{b}}(40 105\\,\\rm{GeV/c^2}) &=&1.6 \\pm 1.7(\\rm{stat}) \\pm 0.6(\\rm{syst})\\% \\end{eqnarray} where $A_{C}^{b\\bar{b}}$ is defined as the asymmetry in the difference in rapidity between jets formed from the beauty quark and antiquark. The beauty jets are required to satisfy $2 20$GeV, and have an opening angle in the transverse plane $\\Delta\\phi>2.6$rad. These measurements are consistent with the predictions of the Standard Model.

  10. First measurement of the charge asymmetry in beauty-quark pair production.

    Science.gov (United States)

    Aaij, R; Adeva, B; Adinolfi, M; Affolder, A; Ajaltouni, Z; Akar, S; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amerio, S; Amhis, Y; An, L; Anderlini, L; Anderson, J; Andreassen, R; Andreotti, M; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Badalov, A; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Batozskaya, V; Battista, V; Bay, A; Beaucourt, L; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M-O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Borsato, M; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brodzicka, J; Brook, N H; Brown, H; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Calabrese, R; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Cassina, L; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chen, S; Cheung, S-F; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Corvo, M; Counts, I; Couturier, B; Cowan, G A; Craik, D C; Cruz Torres, M; Cunliffe, S; Currie, R; D'Ambrosio, C; Dalseno, J; David, P; David, P N Y; Davis, A; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Donleavy, S; Dordei, F; Dorigo, M; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dreimanis, K; Dujany, G; Dupertuis, F; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Ely, S; Esen, S; Evans, H-M; Evans, T; Falabella, A; Färber, C; Farinelli, C; Farley, N; Farry, S; Fay, Rf; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fiorini, M; Firlej, M; Fitzpatrick, C; Fiutowski, T; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Fu, J; Furfaro, E; Gallas Torreira, A; Galli, D; Gallorini, S; Gambetta, S; Gandelman, M; Gandini, P; Gao, Y; García Pardiñas, J; Garofoli, J; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gavardi, L; Gavrilov, G; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gianelle, A; Giani', S; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Gotti, C; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grillo, L; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Han, X; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Henry, L; Hernando Morata, J A; van Herwijnen, E; Heß, M; Hicheur, A; Hill, D; Hoballah, M; Hombach, C; Hulsbergen, W; Hunt, P; Hussain, N; Hutchcroft, D; Hynds, D; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jalocha, J; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Jurik, N; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Karodia, S; Kelsey, M; Kenyon, I R; Ketel, T; Khanji, B; Khurewathanakul, C; Klaver, S; Klimaszewski, K; Kochebina, O; Kolpin, M; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucewicz, W; Kucharczyk, M; Kudryavtsev, V; Kurek, K; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Langhans, B; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Liles, M; Lindner, R; Linn, C; Lionetto, F; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lowdon, P; Lu, H; Lucchesi, D; Luo, H; Lupato, A; Luppi, E; Lupton, O; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Maratas, J; Marchand, J F; Marconi, U; Marin Benito, C; Marino, P; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martinez Vidal, F; Martins Tostes, D; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Mazurov, A; McCann, M; McCarthy, J; McNab, A; McNulty, R; McSkelly, B; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M-N; Moggi, N; Molina Rodriguez, J; Monteil, S; Morandin, M; Morawski, P; Mordà, A; Morello, M J; Moron, J; Morris, A-B; Mountain, R; Muheim, F; Müller, K; Muresan, R; Mussini, M; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neri, N; Neubert, S; Neufeld, N; Neuner, M; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Novoselov, A; O'Hanlon, D P; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Onderwater, G; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palombo, F; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrignani, C; Pazos Alvarez, A; Pearce, A; Pellegrino, A; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Perret, P; Perrin-Terrin, M; Pescatore, L; Pesen, E; Petridis, K; Petrolini, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Pistone, A; Playfer, S; Plo Casasus, M; Polci, F; Poluektov, A; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Price, E; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rachwal, B; Rademacker, J H; Rakotomiaramanana, B; Rama, M; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Reichert, S; Reid, M M; Dos Reis, A C; Ricciardi, S; Richards, S; Rihl, M; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Rodrigues, A B; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rotondo, M; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Sanchez Mayordomo, C; Sanmartin Sedes, B; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Saunders, D M; Savrie, M; Savrina, D; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M-H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Sepp, I; Serra, N; Serrano, J; Sestini, L; Seyfert, P; Shapkin, M; Shapoval, I; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, V; Shires, A; Silva Coutinho, R; Simi, G; Sirendi, M; Skidmore, N; Skwarnicki, T; Smith, N A; Smith, E; Smith, E; Smith, J; Smith, M; Snoek, H; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, M; Stahl, S; Steinkamp, O; Stenyakin, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Stracka, S; Straticiuc, M; Straumann, U; Stroili, R; Subbiah, V K; Sun, L; Sutcliffe, W; Swientek, K; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szilard, D; Szumlak, T; T'Jampens, S; Teklishyn, M; Tellarini, G; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tomassetti, L; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vieites Diaz, M; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; de Vries, J A; Waldi, R; Wallace, C; Wallace, R; Walsh, J; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Websdale, D; Whitehead, M; Wicht, J; Wiedner, D; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wormser, G; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Xu, Z; Yang, Z; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

    2014-08-22

    The difference in the angular distributions between beauty quarks and antiquarks, referred to as the charge asymmetry, is measured for the first time in bb pair production at a hadron collider. The data used correspond to an integrated luminosity of 1.0 fb(-1) collected at 7 TeV center-of-mass energy in proton-proton collisions with the LHCb detector. The measurement is performed in three regions of the invariant mass of the bb system. The results obtained are A(C)(bb))(40 105 GeV/c(2)) = 1.6 ± 1.7 ± 0.6%, where A(C)(bb)) is defined as the asymmetry in the difference in rapidity between jets formed from the beauty quark and antiquark, where in each case the first uncertainty is statistical and the second systematic. The beauty jets are required to satisfy 2 20 GeV, and have an opening angle in the transverse plane Δ ϕ > 2.6 rad. These measurements are consistent with the predictions of the standard model.

  11. Direct electron-pair production by high energy heavy charged particles

    Science.gov (United States)

    Takahashi, Y.; Gregory, J. C.; Hayashi, T.; Dong, B. L.

    1989-01-01

    Direct electron pain production via virtual photons by moving charged particles is a unique electro-magnetic process having a substantial dependence on energy. Most electro-magnetic processes, including transition radiation, cease to be sensitive to the incident energy above 10 TeV/AMU. Thus, it is expected, that upon establishment of cross section and detection efficiency of this process, it may provide a new energy measuring technique above 10 TeV/AMU. Three accelerator exposures of emulsion chambers designed for measurements of direct electron-pains were performed. The objectives of the investigation were to provide the fundamental cross-section data in emulsion stacks to find the best-fit theoretical model, and to provide a calibration of measurements of direct electron-pairs in emulsion chamber configurations. This paper reports the design of the emulsion chambers, accelerator experiments, microscope measurements, and related considerations for future improvements of the measurements, and for possible applications to high energy cosmic ray experiments. Also discussed are the results from scanning 56m of emulsion tracks at 1200x magnification so that scanning efficiency is optimized. Measurements of the delta-ray range spectrum were also performed for much shorter track lengths, but with sufficiently large statistics in the number of measured delta-rays.

  12. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  13. Charged vector particle tunneling from a pair of accelerating and rotating and 5D gauged super-gravity black holes

    Energy Technology Data Exchange (ETDEWEB)

    Javed, Wajiha; Ali, Riasat [University of Education, Division of Science and Technology, Lahore (Pakistan); Abbas, G. [The Islamia University of Bahawalpur, Department of Mathematics, Bahawalpur (Pakistan)

    2017-05-15

    The aim of this paper is to study the quantum tunneling process for charged vector particles through the horizons of more generalized black holes by using the Proca equation. For this purpose, we consider a pair of charged accelerating and rotating black holes with Newman-Unti-Tamburino parameter and a black hole in 5D gauged super-gravity theory, respectively. Further, we study the tunneling probability and corresponding Hawking temperature for both black holes by using the WKB approximation. We find that our analysis is independent of the particles species whether or not the background black hole geometries are more generalized. (orig.)

  14. Charge and pairing dynamics in the attractive Hubbard model: Mode coupling and the validity of linear-response theory

    Science.gov (United States)

    Bünemann, Jörg; Seibold, Götz

    2017-12-01

    Pump-probe experiments have turned out as a powerful tool in order to study the dynamics of competing orders in a large variety of materials. The corresponding analysis of the data often relies on standard linear-response theory generalized to nonequilibrium situations. Here we examine the validity of such an approach for the charge and pairing response of systems with charge-density wave and (or) superconducting (SC) order. Our investigations are based on the attractive Hubbard model which we study within the time-dependent Hartree-Fock approximation. In particular, we calculate the quench and pump-probe dynamics for SC and charge order parameters in order to analyze the frequency spectra and the coupling of the probe field to the specific excitations. Our calculations reveal that the "linear-response assumption" is justified for small to moderate nonequilibrium situations (i.e., pump pulses) in the case of a purely charge-ordered ground state. However, the pump-probe dynamics on top of a superconducting ground state is determined by phase and amplitude modes which get coupled far from the equilibrium state indicating the failure of the linear-response assumption.

  15. Utility of Charge Transfer and Ion-Pair Complexation for Spectrophotometric Determination of Eletriptan Hydrobromide in Pure and Dosage Forms

    Directory of Open Access Journals (Sweden)

    Ayman A. Gouda

    2013-01-01

    Full Text Available Three simple, sensitive, and accurate spectrophotometric methods have been developed for the determination of eletriptan hydrobromide (ELT in pure and dosage forms. The first two methods are based on charge transfer complex formation between ELT and chromogenic reagents quinalizarin (Quinz and alizarin red S (ARS producing charge transfer complexes which showed an absorption maximum at 569 and 533 nm for Quinz and ARS, respectively. The third method is based on the formation of ion-pair complex between ELT with molybdenum(V-thiocyanate inorganic complex in hydrochloric acid medium followed by extraction of the colored ion-pair with dichloromethane and measured at 470 nm. Different variables affecting the reactions were studied and optimized. Beer's law is obeyed in the concentration ranges 2.0–18, 1.0–8.0, and 2.0–32 μg mL−1 for Quinz, ARS, and Mo(V-thiocyanate, respectively. The molar absorptivity, Sandell sensitivity, detection, and quantification limits are also calculated. The correlation coefficients were ≥0.9994 with a relative standard deviation (R.S.D%. of ≤0.925. The proposed methods were successfully applied for simultaneous determination of ELT in tablets with good accuracy and precision and without interferences from common additives, and the validity is assessed by applying the standard addition technique, which is compared with those obtained using the reported method.

  16. Measurement of the inclusive leptonic asymmetry in top-quark pairs that decay to two charged leptons at CDF.

    Science.gov (United States)

    Aaltonen, T; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Butti, P; Buzatu, A; Calamba, A; Camarda, S; Campanelli, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Cho, K; Chokheli, D; Clark, A; Clarke, C; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Cremonesi, M; Cruz, D; Cuevas, J; Culbertson, R; d'Ascenzo, N; Datta, M; de Barbaro, P; Demortier, L; Deninno, M; D'Errico, M; Devoto, F; Di Canto, A; Di Ruzza, B; Dittmann, J R; Donati, S; D'Onofrio, M; Dorigo, M; Driutti, A; Ebina, K; Edgar, R; Elagin, A; Erbacher, R; Errede, S; Esham, B; Farrington, S; Fernández Ramos, J P; Field, R; Flanagan, G; Forrest, R; Franklin, M; Freeman, J C; Frisch, H; Funakoshi, Y; Galloni, C; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González López, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gramellini, E; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Han, J Y; Happacher, F; Hara, K; Hare, M; Harr, R F; Harrington-Taber, T; Hatakeyama, K; Hays, C; Heinrich, J; Henry, S; Herndon, M; Hocker, A; Hong, Z; Hopkins, W; Hou, S; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kambeitz, M; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S H; Kim, S B; Kim, Y J; Kim, Y K; Kimura, N; Kirby, M; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Kruse, M; Kuhr, T; Kurata, M; Laasanen, A T; Lammel, S; Lancaster, M; Lannon, K; Latino, G; Lee, H S; Lee, J S; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lipeles, E; Lister, A; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lucà, A; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Marchese, L; Margaroli, F; Marino, P; Martínez, M; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M J; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Nigmanov, T; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagliarone, C; Palencia, E; Palni, P; Papadimitriou, V; Parker, W; Pauletta, G; Paulini, M; Paus, C; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Pranko, A; Prokoshin, F; Ptohos, F; Punzi, G; Ranjan, N; Redondo Fernández, I; Renton, P; Rescigno, M; Rimondi, F; Ristori, L; Robson, A; Rodriguez, T; Rolli, S; Ronzani, M; Roser, R; Rosner, J L; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schwarz, T; Scodellaro, L; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sliwa, K; Smith, J R; Snider, F D; Song, H; Sorin, V; St Denis, R; Stancari, M; Stentz, D; Strologas, J; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thomson, E; Thukral, V; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Vázquez, F; Velev, G; Vellidis, C; Vernieri, C; Vidal, M; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wallny, R; Wang, S M; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wilbur, S; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Zanetti, A M; Zeng, Y; Zhou, C; Zucchelli, S

    2014-07-25

    We measure the inclusive forward-backward asymmetry of the charged-lepton pseudorapidities from top-quark pairs produced in proton-antiproton collisions and decaying to final states that contain two charged leptons (electrons or muons). The data are collected with the Collider Detector at Fermilab and correspond to an integrated luminosity of 9.1 fb(-1). We measure the leptonic forward-backward asymmetry, A(FB)(ℓ), to be 0.072 ± 0.060 and the leptonic pair forward-backward asymmetry, A(FB)(ℓℓ), to be 0.076 ± 0.082. The measured values can be compared with the standard model predictions of A(FB)(ℓ) = 0.038 ± 0.003 and A(FB)(ℓℓ) = 0.048 ± 0.004, respectively. Additionally, we combine the A(FB)(ℓ) result with a previous determination from a final state with a single lepton and hadronic jets and obtain A(FB)(ℓ) = 0.090(-0.026)(+0.028).

  17. Measurement of charged current triple gauge boson couplings using W pairs at LEP

    CERN Document Server

    Abbiendi, G.; Akesson, P.F.; Alexander, G.; Allison, John; Amaral, P.; Anagnostou, G.; Anderson, K.J.; Arcelli, S.; Asai, S.; Axen, D.; Azuelos, G.; Bailey, I.; Barberio, E.; Barlow, R.J.; Batley, R.J.; Bechtle, P.; Behnke, T.; Bell, Kenneth Watson; Bell, P.J.; Bella, G.; Bellerive, A.; Benelli, G.; Bethke, S.; Biebel, O.; Boeriu, O.; Bock, P.; Boutemeur, M.; Braibant, S.; Brigliadori, L.; Brown, Robert M.; Buesser, K.; Burckhart, H.J.; Campana, S.; Carnegie, R.K.; Caron, B.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Csilling, A.; Cuffiani, M.; Dado, S.; De Roeck, A.; De Wolf, E.A.; Desch, K.; Dienes, B.; Donkers, M.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Etzion, E.; Fabbri, F.; Feld, L.; Ferrari, P.; Fiedler, F.; Fleck, I.; Ford, M.; Frey, A.; Furtjes, A.; Gagnon, P.; Gary, John William; Gaycken, G.; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Giunta, Marina; Goldberg, J.; Groll, M.; Gross, E.; Grunhaus, J.; Gruwe, M.; Gunther, P.O.; Gupta, A.; Hajdu, C.; Hamann, M.; Hanson, G.G.; Harder, K.; Harel, A.; Harin-Dirac, M.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Hensel, C.; Herten, G.; Heuer, R.D.; Hill, J.C.; Hoffman, Kara Dion; Horvath, D.; Igo-Kemenes, P.; Ishii, K.; Jeremie, H.; Jovanovic, P.; Junk, T.R.; Kanaya, N.; Kanzaki, J.; Karapetian, G.; Karlen, D.; Kawagoe, K.; Kawamoto, T.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Kim, D.H.; Klein, K.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Komamiya, S.; Kormos, Laura L.; Kramer, T.; Krieger, P.; von Krogh, J.; Kruger, K.; Kuhl, T.; Kupper, M.; Lafferty, G.D.; Landsman, H.; Lanske, D.; Layter, J.G.; Leins, A.; Lellouch, D.; Lettso, J.; Levinson, L.; Lillich, J.; Lloyd, S.L.; Loebinger, F.K.; Lu, J.; Ludwig, J.; Macpherson, A.; Mader, W.; Marcellini, S.; Martin, A.J.; Masetti, G.; Mashimo, T.; Mattig, Peter; McDonald, W.J.; McKenna, J.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menges, W.; Merritt, F.S.; Mes, H.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Moed, S.; Mohr, W.; Mori, T.; Mutter, A.; Nagai, K.; Nakamura, I.; Nanjo, H.; Neal, H.A.; Nisius, R.; O'Neale, S.W.; Oh, A.; Okpara, A.; Oreglia, M.J.; Orito, S.; Pahl, C.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poli, B.; Polok, J.; Pooth, O.; Przybycien, M.; Quadt, A.; Rabbertz, K.; Rembser, C.; Renkel, P.; Roney, J.M.; Rosati, S.; Rozen, Y.; Runge, K.; Sachs, K.; Saeki, T.; Sarkisyan, E.K.G.; Schaile, A.D.; Schaile, O.; Scharff-Hansen, P.; Schieck, J.; Schoerner-Sadenius, Thomas; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Sherwood, P.; Siroli, G.; Skuja, A.; Smith, A.M.; Sobie, R.; Soldner-Rembold, S.; Spano, F.; Stahl, A.; Stephens, K.; Strom, David M.; Strohmer, R.; Tarem, S.; Tasevsky, M.; Taylor, R.J.; Teuscher, R.; Thomson, M.A.; Torrence, E.; Toya, D.; Tran, P.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turner-Watson, M.F.; Ueda, I.; Ujvari, B.; Vollmer, C.F.; Vannerem, P.; Vertesi, R.; Verzocchi, M.; Voss, H.; Vossebeld, J.; Waller, D.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wengler, T.; Wermes, N.; Wetterling, G.W.; Wilson, D.; Wilson, J.A.; Wolf, G.; Wyatt, T.R.; Yamashita, S.; Zer-Zion, D.; Zivkovic, Lidija

    2004-01-01

    Triple gauge boson couplings are measured from W-pair and single photon events recorded by the OPAL detector at LEP at center-of-mass energies between 183 - 209 GeV with a total integrated luminosity of 680 inverse picobarns. Only CP-conserving couplings are considered and SU(2)xU(1) relations between the WWZ and the WWgamma couolings are used, resulting in four independent couplings. Each coupling is determined in a separate fit, assuming the other couplings to take their Standard Model values. Fits are also done allowing some of the couplings to vary simultaneously. The results are compared with the Standard Model predictions.

  18. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.).

    Science.gov (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan

    2016-03-15

    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Charge transport in DNA oligonucleotides with various base-pairing patterns

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Todorciuc, Tatiana; Král, Karel; Němec, Hynek; Bunček, M.; Šebera, Jakub; Záliš, Stanislav; Vokáčová, Zuzana; Sychrovský, Vladimír; Bednárová, Lucie; Mojzeš, P.; Schneider, Bohdan

    2010-01-01

    Roč. 114, č. 15 (2010), 5196–5205 ISSN 1520-6106 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA ČR GA202/07/0643; GA AV ČR IAA400550701; GA AV ČR KAN200100801; GA AV ČR KAN100400702; GA ČR GA202/09/0193 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z40400503; CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : DNA * charge transport * Scanning Tunneling Microscopy Subject RIV: CC - Organic Chemistry Impact factor: 3.603, year: 2010

  20. Forward-Backward Charge Asymmetry of Electron Pairs Above the Z0 Pole at CDF

    Science.gov (United States)

    CDF Collaboration

    1996-05-01

    We present a measurement of the forward-backward charge asymmetry of the process pbar p arrow Z0 / γ+X, Z0 / γ arrow e+e- at Q2 > MZ2, using pbar p collisions at √s = 1.8 TeV. The results are from 110 pb-1 of data collected at the Collider Detector at Fermilab during the 1992-1993 and 1994-1995 runs of the Fermilab Tevatron. We measure the asymmetry in a region above the Z0 pole for which Mee > 105 GeV/c2 and in a region near the Z0 pole for which 75 GeV/c2 Fisica Nucleare; the Ministry of Education, Science and Culture of Japan; the Natural Sciences and Engineering Research Council of Canada; the National Science Council of the Republic of China; and the A. P. Sloan Foundation. Supported by U.S. NSF PHY-9406402.

  1. Search for pair-production of long-lived heavy charged particles in e+e- annihilation

    Science.gov (United States)

    Barate, R.; Buskulic, D.; Decamp, D.; Ghez, P.; Goy, C.; Lees, J.-P.; Lucotte, A.; Minard, M.-N.; Nief, J.-Y.; Pietrzyk, B.; Casado, M. P.; Chmeissani, M.; Comas, P.; Crespo, J. M.; Delfino, M.; Fernandez, E.; Fernandez-Bosman, M.; Garrido, Ll.; Juste, A.; Martinez, M.; Miquel, R.; Mir, Ll. M.; Orteu, S.; Padilla, C.; Park, I. C.; Pascual, A.; Perlas, J. A.; Riu, I.; Sanchez, F.; Teubert, F.; Colaleo, A.; Creanza, D.; de Palma, M.; Gelao, G.; Iaselli, G.; Maggi, G.; Maggi, M.; Marinelli, N.; Nuzzo, S.; Ranieri, A.; Raso, G.; Ruggieri, F.; Selvaggi, G.; Silvestris, L.; Tempesta, P.; Tricomi, A.; Zito, G.; Huang, X.; Lin, J.; Ouyang, Q.; Wang, T.; Xie, Y.; Xu, R.; Xue, S.; Zhang, J.; Zhang, L.; Zhao, W.; Abbaneo, D.; Alemany, R.; Bazarko, A. O.; Becker, U.; Bright-Thomas, P.; Cattaneo, M.; Cerutti, F.; Dissertori, G.; Drevermann, H.; Forty, R. W.; Frank, M.; Hagelberg, R.; Hansen, J. B.; Harvey, J.; Janot, P.; Jost, B.; Kneringer, E.; Knobloch, J.; Lehraus, I.; Lutters, G.; Mato, P.; Minten, A.; Moneta, L.; Pacheco, A.; Pusztaszeri, J.-F.; Ranjard, F.; Rizzo, G.; Rolandi, L.; Schlatter, D.; Schmitt, M.; Schneider, O.; Tejessy, W.; Tomalin, I. R.; Wachsmuth, H.; Wagner, A.; Ajaltouni, Z.; Barrès, A.; Boyer, C.; Falvard, A.; Ferdi, C.; Gay, P.; Guicheney, C.; Henrard, P.; Jousset, J.; Michel, B.; Monteil, S.; Montret, J.-C.; Pallin, D.; Perret, P.; Podlyski, F.; Proriol, J.; Rosnet, P.; Rossignol, J.-M.; Fearnley, T.; Hansen, J. D.; Hansen, J. R.; Hansen, P. H.; Nilsson, B. S.; Rensch, B.; Wäänänen, A.; Daskalakis, G.; Kyriakis, A.; Markou, C.; Simopoulou, E.; Vayaki, A.; Blondel, A.; Brient, J. C.; Machefert, F.; Rougé, A.; Rumpf, M.; Valassi, A.; Videau, H.; Focardi, E.; Parrini, G.; Zachariadou, K.; Cavanaugh, R.; Corden, M.; Georgiopoulos, C.; Huehn, T.; Jaffe, D. E.; Antonelli, A.; Bencivenni, G.; Bologna, G.; Bossi, F.; Campana, P.; Capon, G.; Casper, D.; Chiarella, V.; Felici, G.; Laurelli, P.; Mannocchi, G.; Murtas, F.; Murtas, G. P.; Passalacqua, L.; Pepe-Altarelli, M.; Curtis, L.; Dorris, S. J.; Halley, A. W.; Knowles, I. G.; Lynch, J. G.; O'Shea, V.; Raine, C.; Scarr, J. M.; Smith, K.; Teixeira-Dias, P.; Thompson, A. S.; Thomson, E.; Thomson, F.; Turnbull, R. M.; Geweniger, C.; Graefe, G.; Hanke, P.; Hansper, G.; Hepp, V.; Kluge, E. E.; Putzer, A.; Schmidt, M.; Sommer, J.; Tittel, K.; Werner, S.; Wunsch, M.; Beuselinck, R.; Binnie, D. M.; Cameron, W.; Dornan, P. J.; Girone, M.; Goodsir, S.; Martin, E. B.; Morawitz, P.; Moutoussi, A.; Nash, J.; Sedgbeer, J. K.; Stacey, A. M.; Williams, M. D.; Girtler, P.; Kuhn, D.; Rudolph, G.; Betteridge, A. P.; Bowdery, C. K.; Colrain, P.; Crawford, G.; Finch, A. J.; Foster, F.; Hughes, G.; Jones, R. W.; Sloan, T.; Whelan, E. P.; Williams, M. I.; Hoffmann, C.; Jakobs, K.; Kleinknecht, K.; Quast, G.; Renk, B.; Rohne, E.; Sander, H.-G.; van Gemmeren, P.; Zeitnitz, C.; Aubert, J. J.; Benchouk, C.; Bonissent, A.; Bujosa, G.; Calvet, D.; Carr, J.; Coyle, P.; Diaconu, C.; Konstantinidis, N.; Leroy, O.; Motsch, F.; Payre, P.; Rousseau, D.; Talby, M.; Sadouki, A.; Thulasidas, M.; Tilquin, A.; Trabelsi, K.; Aleppo, M.; Ragusa, F.; Berlich, R.; Blum, W.; Büscher, V.; Dietl, H.; Ganis, G.; Gotzhein, C.; Kroha, H.; Lütjens, G.; Lutz, G.; Männer, W.; Moser, H.-G.; Richter, R.; Rosado-Schlosser, A.; Schael, S.; Settles, R.; Seywerd, H.; St. Denis, R.; Stenzel, H.; Wiedenmann, W.; Wolf, G.; Boucrot, J.; Callot, O.; Chen, S.; Cordier, A.; Davier, M.; Duflot, L.; Grivaz, J.-F.; Heusse, Ph.; Höcker, A.; Jacholkowska, A.; Jacquet, M.; Kim, D. W.; Le Diberder, F.; Lefrançois, J.; Lutz, A.-M.; Nikolic, I.; Schune, M.-H.; Simion, S.; Tournefier, E.; Veillet, J.-J.; Videau, I.; Zerwas, D.; Azzurri, P.; Bagliesi, G.; Batignani, G.; Bettarini, S.; Bozzi, C.; Calderini, G.; Carpinelli, M.; Ciocci, M. A.; Ciulli, V.; dell'Orso, R.; Fantechi, R.; Ferrante, I.; Giassi, A.; Gregorio, A.; Ligabue, F.; Lusiani, A.; Marrocchesi, P. S.; Messineo, A.; Palla, F.; Sanguinetti, G.; Sciabà, A.; Spagnolo, P.; Steinberger, J.; Tenchini, R.; Tonelli, G.; Vannini, C.; Venturi, A.; Verdini, P. G.; Blair, G. A.; Bryant, L. M.; Chambers, J. T.; Gao, Y.; Green, M. G.; Medcalf, T.; Perrodo, P.; Strong, J. A.; von Wimmersperg-Toeller, J. H.; Botterill, D. R.; Clifft, R. W.; Edgecock, T. R.; Haywood, S.; Maley, P.; Norton, P. R.; Thompson, J. C.; Wright, A. E.; Bloch-Devaux, B.; Colas, P.; Fabbro, B.; Kozanecki, W.; Lançon, E.; Lemaire, M. C.; Locci, E.; Perez, P.; Rander, J.; Renardy, J.-F.; Rosowsky, A.; Roussarie, A.; Schuller, J.-P.; Schwindling, J.; Trabelsi, A.; Vallage, B.; Black, S. N.; Dann, J. H.; Kim, H. Y.; Litke, A. M.; McNeil, M. A.; Taylor, G.; Booth, C. N.; Boswell, R.; Brew, C. A. J.; Cartwright, S.; Combley, F.; Kelly, M. S.; Lehto, M.; Newton, W. M.; Reeve, J.; Thompson, L. F.; Affholderbach, K.; Böhrer, A.; Brandt, S.; Cowan, G.; Foss, J.; Grupen, C.; Saraiva, P.; Smolik, L.; Stephan, F.; Apollonio, M.; Bosisio, L.; della Marina, R.; Giannini, G.; Gobbo, B.; Musolino, G.; Putz, J.; Rothberg, J.; Wasserbaech, S.; Williams, R. W.; Armstrong, S. R.; Charles, E.; Elmer, P.; Ferguson, D. P. S.; González, S.; Greening, T. C.; Hayes, O. J.; Hu, H.; Jin, S.; McNamara, P. A.; Nachtman, J. M.; Nielsen, J.; Orejudos, W.; Pan, Y. B.; Saadi, Y.; Scott, I. J.; Walsh, J.; Sau, Lan Wu; Wu, X.; Yamartino, J. M.; Zobernig, G.

    1997-02-01

    A search for pair-production of long-lived, heavy, singly-charged particles has been performed with data collected by the ALEPH detector at a centre-of-mass energy of 172 GeV. Data at √s = 161, 136, and 130 GeV are also included to improve the sensitivity to lower masses. No candidate is found in the data. A model-independent 95% confidence level upper limit on the production cross section at 172 GeV of 0.2-0.4 pb is derived for masses between 45 and 86 GeV/c2. This cross section limit implies, assuming the MSSM, a lower limit of 67 (69) GeV/c2 on the mass of might- (left-) handed long-lived scalar taus or scalar muons and of 86 GeV/c2 on the mass of long-lived charginos.

  2. A candidate for production of a top quark pair in CMS, where both top quarks decay into a W and a b quark, and both W particles decay into a muon and neutrino. This results in 2 muons (red tracks), 2 jets tagged as b-quark jets and missing energy (from the escaping neutrinos).

    CERN Multimedia

    CMS Collaboration

    2010-01-01

    A candidate for production of a top quark pair in CMS, where both top quarks decay into a W and a b quark, and both W particles decay into a muon and neutrino. This results in 2 muons (red tracks), 2 jets tagged as b-quark jets and missing energy (from the escaping neutrinos).

  3. Exciplexes versus Loose Ion Pairs: How Does the Driving Force Impact the Initial Product Ratio of Photoinduced Charge Separation Reactions?

    Science.gov (United States)

    2014-01-01

    Many donor–acceptor systems can undergo a photoinduced charge separation reaction, yielding loose ion pairs (LIPs). LIPs can be formed either directly via (distant) electron transfer (ET) or indirectly via the dissociation of an initially formed exciplex or tight ion pair. Establishing the prevalence of one of the reaction pathways is challenging because differentiating initially formed exciplexes from LIPs is difficult due to similar spectroscopic footprints. Hence, no comprehensive reaction model has been established for moderately polar solvents. Here, we employ an approach based on the time-resolved magnetic field effect (MFE) of the delayed exciplex luminescence to distinguish the two reaction channels. We focus on the effects of the driving force of ET and the solvent permittivity. We show that, surprisingly, the exciplex channel is significant even for an exergonic ET system with a free energy of ET of −0.58 eV and for the most polar solutions studied (butyronitrile). Our findings demonstrate that exciplexes play a crucial role even in polar solvents and at moderate driving forces, contrary to what is usually assumed. PMID:25243054

  4. Observation of Transverse Spin-Dependent Azimuthal Correlations of Charged Pion Pairs in p↑+p at √{s }=200 GeV

    Science.gov (United States)

    Adamczyk, L.; Adkins, J. K.; Agakishiev, G.; Aggarwal, M. M.; Ahammed, Z.; Alekseev, I.; Alford, J.; Aparin, A.; Arkhipkin, D.; Aschenauer, E. C.; Averichev, G. S.; Banerjee, A.; Bellwied, R.; Bhasin, A.; Bhati, A. K.; Bhattarai, P.; Bielcik, J.; Bielcikova, J.; Bland, L. C.; Bordyuzhin, I. G.; Bouchet, J.; Brandin, A. V.; Bunzarov, I.; Burton, T. P.; Butterworth, J.; Caines, H.; Calderón de la Barca Sánchez, M.; Campbell, J. M.; Cebra, D.; Cervantes, M. C.; Chakaberia, I.; Chaloupka, P.; Chang, Z.; Chattopadhyay, S.; Chen, J. H.; Chen, X.; Cheng, J.; Cherney, M.; Christie, W.; Contin, G.; Crawford, H. J.; Das, S.; De Silva, L. C.; Debbe, R. R.; Dedovich, T. G.; Deng, J.; Derevschikov, A. A.; di Ruzza, B.; Didenko, L.; Dilks, C.; Dong, X.; Drachenberg, J. L.; Draper, J. E.; Du, C. M.; Dunkelberger, L. E.; Dunlop, J. C.; Efimov, L. G.; Engelage, J.; Eppley, G.; Esha, R.; Evdokimov, O.; Eyser, O.; Fatemi, R.; Fazio, S.; Federic, P.; Fedorisin, J.; Feng, Z.; Filip, P.; Fisyak, Y.; Flores, C. E.; Fulek, L.; Gagliardi, C. A.; Garand, D.; Geurts, F.; Gibson, A.; Girard, M.; Greiner, L.; Grosnick, D.; Gunarathne, D. S.; Guo, Y.; Gupta, S.; Gupta, A.; Guryn, W.; Hamad, A.; Hamed, A.; Haque, R.; Harris, J. W.; He, L.; Heppelmann, S.; Heppelmann, S.; Hirsch, A.; Hoffmann, G. W.; Hofman, D. J.; Horvat, S.; Huang, B.; Huang, X.; Huang, H. Z.; Huck, P.; Humanic, T. J.; Igo, G.; Jacobs, W. W.; Jang, H.; Jiang, K.; Judd, E. G.; Kabana, S.; Kalinkin, D.; Kang, K.; Kauder, K.; Ke, H. W.; Keane, D.; Kechechyan, A.; Khan, Z. H.; Kikola, D. P.; Kisel, I.; Kisiel, A.; Kochenda, L.; Koetke, D. D.; Kollegger, T.; Kosarzewski, L. K.; Kraishan, A. F.; Kravtsov, P.; Krueger, K.; Kulakov, I.; Kumar, L.; Kycia, R. A.; Lamont, M. A. C.; Landgraf, J. M.; Landry, K. D.; Lauret, J.; Lebedev, A.; Lednicky, R.; Lee, J. H.; Li, X.; Li, C.; Li, W.; Li, Z. M.; Li, Y.; Li, X.; Lisa, M. A.; Liu, F.; Ljubicic, T.; Llope, W. J.; Lomnitz, M.; Longacre, R. S.; Luo, X.; Ma, Y. G.; Ma, G. L.; Ma, L.; Ma, R.; Magdy, N.; Majka, R.; Manion, A.; Margetis, S.; Markert, C.; Masui, H.; Matis, H. S.; McDonald, D.; Meehan, K.; Minaev, N. G.; Mioduszewski, S.; Mohanty, B.; Mondal, M. M.; Morozov, D.; Mustafa, M. K.; Nandi, B. K.; Nasim, Md.; Nayak, T. K.; Nigmatkulov, G.; Nogach, L. V.; Noh, S. Y.; Novak, J.; Nurushev, S. B.; Odyniec, G.; Ogawa, A.; Oh, K.; Okorokov, V.; Olvitt, D.; Page, B. S.; Pak, R.; Pan, Y. X.; Pandit, Y.; Panebratsev, Y.; Pawlik, B.; Pei, H.; Perkins, C.; Peterson, A.; Pile, P.; Planinic, M.; Pluta, J.; Poljak, N.; Poniatowska, K.; Porter, J.; Posik, M.; Poskanzer, A. M.; Pruthi, N. K.; Putschke, J.; Qiu, H.; Quintero, A.; Ramachandran, S.; Raniwala, R.; Raniwala, S.; Ray, R. L.; Ritter, H. G.; Roberts, J. B.; Rogachevskiy, O. V.; Romero, J. L.; Roy, A.; Ruan, L.; Rusnak, J.; Rusnakova, O.; Sahoo, N. R.; Sahu, P. K.; Sakrejda, I.; Salur, S.; Sandweiss, J.; Sarkar, A.; Schambach, J.; Scharenberg, R. P.; Schmah, A. M.; Schmidke, W. B.; Schmitz, N.; Seger, J.; Seyboth, P.; Shah, N.; Shahaliev, E.; Shanmuganathan, P. V.; Shao, M.; Sharma, M. K.; Sharma, B.; Shen, W. Q.; Shi, S. S.; Shou, Q. Y.; Sichtermann, E. P.; Sikora, R.; Simko, M.; Skoby, M. J.; Smirnov, D.; Smirnov, N.; Song, L.; Sorensen, P.; Spinka, H. M.; Srivastava, B.; Stanislaus, T. D. S.; Stepanov, M.; Stock, R.; Strikhanov, M.; Stringfellow, B.; Sumbera, M.; Summa, B.; Sun, X.; Sun, Z.; Sun, X. M.; Sun, Y.; Surrow, B.; Svirida, N.; Szelezniak, M. A.; Tang, A. H.; Tang, Z.; Tarnowsky, T.; Tawfik, A. N.; Thomas, J. H.; Timmins, A. R.; Tlusty, D.; Tokarev, M.; Trentalange, S.; Tribble, R. E.; Tribedy, P.; Tripathy, S. K.; Trzeciak, B. A.; Tsai, O. D.; Ullrich, T.; Underwood, D. G.; Upsal, I.; Van Buren, G.; van Nieuwenhuizen, G.; Vandenbroucke, M.; Varma, R.; Vasiliev, A. N.; Vertesi, R.; Videbæk, F.; Viyogi, Y. P.; Vokal, S.; Voloshin, S. A.; Vossen, A.; Wang, G.; Wang, Y.; Wang, F.; Wang, Y.; Wang, H.; Wang, J. S.; Webb, J. C.; Webb, G.; Wen, L.; Westfall, G. D.; Wieman, H.; Wissink, S. W.; Witt, R.; Wu, Y. F.; Xiao, Z. G.; Xie, W.; Xin, K.; Xu, Q. H.; Xu, Z.; Xu, H.; Xu, N.; Xu, Y. F.; Yang, Q.; Yang, Y.; Yang, S.; Yang, Y.; Yang, C.; Ye, Z.; Yepes, P.; Yi, L.; Yip, K.; Yoo, I.-K.; Yu, N.; Zbroszczyk, H.; Zha, W.; Zhang, X. P.; Zhang, J.; Zhang, Y.; Zhang, J.; Zhang, J. B.; Zhang, S.; Zhang, Z.; Zhao, J.; Zhong, C.; Zhou, L.; Zhu, X.; Zoulkarneeva, Y.; Zyzak, M.; STAR Collaboration

    2015-12-01

    We report the observation of transverse polarization-dependent azimuthal correlations in charged pion pair production with the STAR experiment in p↑+p collisions at RHIC. These correlations directly probe quark transversity distributions. We measure signals in excess of 5 standard deviations at high transverse momenta, at high pseudorapidities η >0.5 , and for pair masses around the mass of the ρ meson. This is the first direct transversity measurement in p +p collisions.

  5. Observation of Transverse Spin-Dependent Azimuthal Correlations of Charged Pion Pairs in p^{↑}+p at sqrt[s]=200  GeV.

    Science.gov (United States)

    Adamczyk, L; Adkins, J K; Agakishiev, G; Aggarwal, M M; Ahammed, Z; Alekseev, I; Alford, J; Aparin, A; Arkhipkin, D; Aschenauer, E C; Averichev, G S; Banerjee, A; Bellwied, R; Bhasin, A; Bhati, A K; Bhattarai, P; Bielcik, J; Bielcikova, J; Bland, L C; Bordyuzhin, I G; Bouchet, J; Brandin, A V; Bunzarov, I; Burton, T P; Butterworth, J; Caines, H; Calderón de la Barca Sánchez, M; Campbell, J M; Cebra, D; Cervantes, M C; Chakaberia, I; Chaloupka, P; Chang, Z; Chattopadhyay, S; Chen, J H; Chen, X; Cheng, J; Cherney, M; Christie, W; Contin, G; Crawford, H J; Das, S; De Silva, L C; Debbe, R R; Dedovich, T G; Deng, J; Derevschikov, A A; di Ruzza, B; Didenko, L; Dilks, C; Dong, X; Drachenberg, J L; Draper, J E; Du, C M; Dunkelberger, L E; Dunlop, J C; Efimov, L G; Engelage, J; Eppley, G; Esha, R; Evdokimov, O; Eyser, O; Fatemi, R; Fazio, S; Federic, P; Fedorisin, J; Feng, Z; Filip, P; Fisyak, Y; Flores, C E; Fulek, L; Gagliardi, C A; Garand, D; Geurts, F; Gibson, A; Girard, M; Greiner, L; Grosnick, D; Gunarathne, D S; Guo, Y; Gupta, S; Gupta, A; Guryn, W; Hamad, A; Hamed, A; Haque, R; Harris, J W; He, L; Heppelmann, S; Heppelmann, S; Hirsch, A; Hoffmann, G W; Hofman, D J; Horvat, S; Huang, B; Huang, X; Huang, H Z; Huck, P; Humanic, T J; Igo, G; Jacobs, W W; Jang, H; Jiang, K; Judd, E G; Kabana, S; Kalinkin, D; Kang, K; Kauder, K; Ke, H W; Keane, D; Kechechyan, A; Khan, Z H; Kikola, D P; Kisel, I; Kisiel, A; Kochenda, L; Koetke, D D; Kollegger, T; Kosarzewski, L K; Kraishan, A F; Kravtsov, P; Krueger, K; Kulakov, I; Kumar, L; Kycia, R A; Lamont, M A C; Landgraf, J M; Landry, K D; Lauret, J; Lebedev, A; Lednicky, R; Lee, J H; Li, X; Li, C; Li, W; Li, Z M; Li, Y; Li, X; Lisa, M A; Liu, F; Ljubicic, T; Llope, W J; Lomnitz, M; Longacre, R S; Luo, X; Ma, Y G; Ma, G L; Ma, L; Ma, R; Magdy, N; Majka, R; Manion, A; Margetis, S; Markert, C; Masui, H; Matis, H S; McDonald, D; Meehan, K; Minaev, N G; Mioduszewski, S; Mohanty, B; Mondal, M M; Morozov, D; Mustafa, M K; Nandi, B K; Nasim, Md; Nayak, T K; Nigmatkulov, G; Nogach, L V; Noh, S Y; Novak, J; Nurushev, S B; Odyniec, G; Ogawa, A; Oh, K; Okorokov, V; Olvitt, D; Page, B S; Pak, R; Pan, Y X; Pandit, Y; Panebratsev, Y; Pawlik, B; Pei, H; Perkins, C; Peterson, A; Pile, P; Planinic, M; Pluta, J; Poljak, N; Poniatowska, K; Porter, J; Posik, M; Poskanzer, A M; Pruthi, N K; Putschke, J; Qiu, H; Quintero, A; Ramachandran, S; Raniwala, R; Raniwala, S; Ray, R L; Ritter, H G; Roberts, J B; Rogachevskiy, O V; Romero, J L; Roy, A; Ruan, L; Rusnak, J; Rusnakova, O; Sahoo, N R; Sahu, P K; Sakrejda, I; Salur, S; Sandweiss, J; Sarkar, A; Schambach, J; Scharenberg, R P; Schmah, A M; Schmidke, W B; Schmitz, N; Seger, J; Seyboth, P; Shah, N; Shahaliev, E; Shanmuganathan, P V; Shao, M; Sharma, M K; Sharma, B; Shen, W Q; Shi, S S; Shou, Q Y; Sichtermann, E P; Sikora, R; Simko, M; Skoby, M J; Smirnov, D; Smirnov, N; Song, L; Sorensen, P; Spinka, H M; Srivastava, B; Stanislaus, T D S; Stepanov, M; Stock, R; Strikhanov, M; Stringfellow, B; Sumbera, M; Summa, B; Sun, X; Sun, Z; Sun, X M; Sun, Y; Surrow, B; Svirida, N; Szelezniak, M A; Tang, A H; Tang, Z; Tarnowsky, T; Tawfik, A N; Thomas, J H; Timmins, A R; Tlusty, D; Tokarev, M; Trentalange, S; Tribble, R E; Tribedy, P; Tripathy, S K; Trzeciak, B A; Tsai, O D; Ullrich, T; Underwood, D G; Upsal, I; Van Buren, G; van Nieuwenhuizen, G; Vandenbroucke, M; Varma, R; Vasiliev, A N; Vertesi, R; Videbæk, F; Viyogi, Y P; Vokal, S; Voloshin, S A; Vossen, A; Wang, G; Wang, Y; Wang, F; Wang, Y; Wang, H; Wang, J S; Webb, J C; Webb, G; Wen, L; Westfall, G D; Wieman, H; Wissink, S W; Witt, R; Wu, Y F; Xiao, Z G; Xie, W; Xin, K; Xu, Q H; Xu, Z; Xu, H; Xu, N; Xu, Y F; Yang, Q; Yang, Y; Yang, S; Yang, Y; Yang, C; Ye, Z; Yepes, P; Yi, L; Yip, K; Yoo, I-K; Yu, N; Zbroszczyk, H; Zha, W; Zhang, X P; Zhang, J; Zhang, Y; Zhang, J; Zhang, J B; Zhang, S; Zhang, Z; Zhao, J; Zhong, C; Zhou, L; Zhu, X; Zoulkarneeva, Y; Zyzak, M

    2015-12-11

    We report the observation of transverse polarization-dependent azimuthal correlations in charged pion pair production with the STAR experiment in p^{↑}+p collisions at RHIC. These correlations directly probe quark transversity distributions. We measure signals in excess of 5 standard deviations at high transverse momenta, at high pseudorapidities η>0.5, and for pair masses around the mass of the ρ meson. This is the first direct transversity measurement in p+p collisions.

  6. Dynamical mechanism of charge separation by photoexcited generation of proton–electron pairs in organic molecular systems. A nonadiabatic electron wavepacket dynamics study

    Energy Technology Data Exchange (ETDEWEB)

    Yamamoto, Kentaro, E-mail: kyamamoto@fukui.kyoto-u.ac.jp; Takatsuka, Kazuo, E-mail: kaztak@fukui.kyoto-u.ac.jp

    2016-08-22

    Graphical abstract: Asymptotic biradical state produced by the excited-state coupled proton–electron transfer (CPET), resulting in charge separation (proton–electron pair creation) on a proton–electron acceptor A, in a series of photochemical systems generally denoted as X–Mn–OH{sub 2}⋯A, where X = (OH, Ca(OH){sub 3}) and A = (N-methylformamidine, guanidine, imidazole, or ammonia clusters). - Abstract: In this perspective article, we review, along with presenting new results, a series of our theoretical analyses on the excited-state mechanism of charge separation (proton–electron pair creation) relevant to the photoinduced water-splitting reaction (2H{sub 2}O → 4H{sup +} + 4e{sup −} + O{sub 2}) in organic and biological systems, which quite often includes Mn clusters in various molecular configurations. The present mechanism is conceived to be universal in the triggering process of the photoexcited water splitting dynamics. In other words, any Mn-based catalytic charge separation is quite likely to be initiated according to this mechanism. As computationally tractable yet realistic models, we examine a series of systems generally expressed as X–Mn–OH{sub 2}⋯A, where X = (OH, Ca(OH){sub 3}) and A = (N-methylformamidine, guanidine, imidazole or ammonia cluster) in terms of the theory of nonadiabatic electron wavepacket dynamics. We first find both an electron and a proton are simultaneously transferred to the acceptors through conical intersections upon photoexcitation. In this mechanism, the electron takes different pathways from that of the proton and reaches the densely lying Rydberg-like states of the acceptors in the end, thereby inducing charge separation. Therefore the presence of the Rydberg-like diffused unoccupied states as an electron acceptor is critical for this reaction to proceed. We also have found another crucial nonadiabatic process that deteriorates the efficiency of charge separation by rendering the created pair of proton

  7. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    Energy Technology Data Exchange (ETDEWEB)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

    2016-04-19

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  8. Multiconfiguration Pair-Density Functional Theory Outperforms Kohn-Sham Density Functional Theory and Multireference Perturbation Theory for Ground-State and Excited-State Charge Transfer.

    Science.gov (United States)

    Ghosh, Soumen; Sonnenberger, Andrew L; Hoyer, Chad E; Truhlar, Donald G; Gagliardi, Laura

    2015-08-11

    The correct description of charge transfer in ground and excited states is very important for molecular interactions, photochemistry, electrochemistry, and charge transport, but it is very challenging for Kohn-Sham (KS) density functional theory (DFT). KS-DFT exchange-correlation functionals without nonlocal exchange fail to describe both ground- and excited-state charge transfer properly. We have recently proposed a theory called multiconfiguration pair-density functional theory (MC-PDFT), which is based on a combination of multiconfiguration wave function theory with a new type of density functional called an on-top density functional. Here we have used MC-PDFT to study challenging ground- and excited-state charge-transfer processes by using on-top density functionals obtained by translating KS exchange-correlation functionals. For ground-state charge transfer, MC-PDFT performs better than either the PBE exchange-correlation functional or CASPT2 wave function theory. For excited-state charge transfer, MC-PDFT (unlike KS-DFT) shows qualitatively correct behavior at long-range with great improvement in predicted excitation energies.

  9. Current flow and pair creation at low altitude in rotation-powered pulsars' force-free magnetospheres: space charge limited flow

    Science.gov (United States)

    Timokhin, A. N.; Arons, J.

    2013-02-01

    We report the results of an investigation of particle acceleration and electron-positron plasma generation at low altitude in the polar magnetic flux tubes of rotation-powered pulsars, when the stellar surface is free to emit whatever charges and currents are demanded by the force-free magnetosphere. We apply a new 1D hybrid plasma simulation code to the dynamical problem, using Particle-in-Cell methods for the dynamics of the charged particles, including a determination of the collective electrostatic fluctuations in the plasma, combined with a Monte Carlo treatment of the high-energy gamma-rays that mediate the formation of the electron-positron pairs. We assume the electric current flowing through the pair creation zone is fixed by the much higher inductance magnetosphere, and adopt the results of force-free magnetosphere models to provide the currents which must be carried by the accelerator. The models are spatially one dimensional, and designed to explore the physics, although of practical relevance to young, high-voltage pulsars. We observe novel behaviour (a) When the current density j is less than the Goldreich-Julian value (0 electrically trapped particles with the same sign of charge as the beam. The voltage drops are of the order of mc2/e, and pair creation is absent. (b) When the current density exceeds the Goldreich-Julian value (j/jGJ > 1), the system develops high voltage drops (TV or greater), causing emission of curvature gamma-rays and intense bursts of pair creation. The bursts exhibit limit cycle behaviour, with characteristic time-scales somewhat longer than the relativistic fly-by time over distances comparable to the polar cap diameter (microseconds). (c) In return current regions, where j/jGJ generated pairs allow the system to simultaneously carry the magnetospherically prescribed currents and adjust the charge density and average electric field to force-free conditions. We also elucidate the conditions for pair creating beam flow to be

  10. Charge transport of graphene ferromagnetic-insulator-superconductor junction with pairing state of broken time reversal symmetry

    Directory of Open Access Journals (Sweden)

    Yaser Hajati

    2015-04-01

    Full Text Available We investigate the charge transport through a graphene-based ferromagnetic-insulator-superconductor junction with a broken time reversal symmetry (BTRS of dx2−y2 + is and dx2−y2 + idxy superconductor using the extended Blonder-Tinkham-Klapwijk formalism. Our analysis have shown several charateristics in this junction, providing a useful probe to understand the role of the order parameter symmetry in the superconductivity. We find that the presence of the BTRS (X state in the superconductor region has a strong effect on the tunneling conductance curves which leads to a decrease in the height of the zero-bias conductance peak (ZBCP. In particular, we show that the magnitude of the superconducting proximity effect depends to a great extent on X and by increasing X, the zero-bias charge conductance oscillations with respect to the rotation angle β are suppressed. In addition, we find that at the maximum rotation angle β = π/4, introducing BTRS in the FIS junction causes oscillatory behavior of the zero-bias charge conductance with the barrier strength (χG by a period of π and by approaching the X to 1, the amplitude of charge conductance oscillations increases. This behavior is drastically different from none BTRS similar graphene junctions. At last, we suggest an experimental setup for verifying our predicted effects.

  11. Theoretical and experimental study of charge transfer through DNA: Impact of mercury mediated T-Hg-T base pair

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Vala, M.; Weiter, M.; Páv, Ondřej; Šebera, Jakub; Sychrovský, Vladimír

    2015-01-01

    Roč. 22, č. 1 (2015), s. 20 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /13./. 19.03.2015-21.03.2015, Nové Hrady] Institutional support: RVO:61388963 ; RVO:68378271 Keywords : charge transfer * T-Hg-T * steady-state fluorescence Subject RIV: CF - Physical ; Theoretical Chemistry

  12. Measurement of charge asymmetry of top quark-antiquark pairs in di-leptonic final states performed at D0 and ATLAS detectors

    International Nuclear Information System (INIS)

    Chapelain, Antoine

    2014-01-01

    Particle physics aims to give a coherent description of the nature and the behavior of elementary particles of matter. Particle accelerators (colliders) allow pushing back our knowledge in this domain producing particles that cannot be observed by other means. This thesis work contributes to this research field and focuses on the study of the top quark which is the latest brick of matter discovered and the heaviest known elementary particle. The property of the top quark studied here, the charge asymmetry of the top quark-antiquark pairs, has driven a lot of attention in 2011 because of measurements released by Tevatron experiments. These measurements showed deviations with the predictions made in the framework of the standard model of particle physics. New measurements of the charge asymmetry performed at the Tevatron (with the D0 detector) and at the LHC (with the ATLAS detector) are presented in this thesis. (author) [fr

  13. A measurement of forward-backward charge asymmetry of electron-positron pairs in proton-antiproton collision at 1.8 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Veramendi, Gregory Francisco [Univ. of California, Berkeley, CA (United States)

    2003-01-01

    The authors present a measurement of the mass dependence of the forward-backward charge asymmetry for e+e- pairs resulting from γ*/Z decays with mass Mee > 40 GeV/c2. The Run II data sample consists of 72 pb-1 of data, which was collected by the CDF detector in $\\bar{p}$p collisions at √s = 1.96 TeV at the Fermilab Tevatron. The measurement is compared with predictions from the Standard Model.

  14. Pair production of charged hadrons with large symmetric transverse momenta in pp collisions at 70 GeV

    International Nuclear Information System (INIS)

    Abramov, V.V.; Baldin, B.Y.; Buzulutskov, A.F.

    1985-01-01

    Cross sections have been measured for the pair production of hadrons (π, K, p) emitted with equal momenta in opposite directions in the c.m.s. in pp collisions in the transverse-momentum region from 0.45 to 1.99 GeV/c. Data are given on the correlation of particles as a function of the quantum numbers and transverse momentum. The results are analyzed in the framework of parton models

  15. Theoretical and experimental study of charge transfer through DNA: impact of mercury mediated T-Hg-T base pair

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Golan, Martin; Vala, M.; Špérová, M.; Weiter, M.; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír; Tanaka, Y.; Bickelhaupt, F.M.

    2014-01-01

    Roč. 118, č. 20 (2014), s. 5374-5381 ISSN 1520-6106 R&D Projects: GA TA ČR TA01011165; GA ČR(CZ) GA14-10279S; GA ČR GA13-26526S Institutional support: RVO:68378271 ; RVO:61388963 Keywords : charge transfer in DNA-Hg complexes * steady state fluorescence spectroscopy * density functional theory * electronic properties of biomolecules Subject RIV: BO - Biophysics Impact factor: 3.302, year: 2014

  16. Theoretical and experimental study of charge transfer through DNA: Impact of mercury attached to mismatched base pairs

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Golan, Martin; Vala, M.; Špérová, M.; Weiter, M.; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír

    2014-01-01

    Roč. 21, č. 1 (2014), s. 16 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /12./. 13.03.2014-15.03.2014, Nové Hrady] Institutional support: RVO:61388963 ; RVO:68378271 Keywords : metallo-DNA * T-Hg-T * steady-state fluorescence * charge transfer Subject RIV: CF - Physical ; Theoretical Chemistry

  17. Measurement of the charge asymmetry in highly boosted top-quark pair production in s=8 TeV pp collision data collected by the ATLAS experiment

    Directory of Open Access Journals (Sweden)

    G. Aad

    2016-05-01

    Full Text Available In the pp→tt¯ process the angular distributions of top and anti-top quarks are expected to present a subtle difference, which could be enhanced by processes not included in the Standard Model. This Letter presents a measurement of the charge asymmetry in events where the top-quark pair is produced with a large invariant mass. The analysis is performed on 20.3 fb−1 of pp collision data at s=8TeV collected by the ATLAS experiment at the LHC, using reconstruction techniques specifically designed for the decay topology of highly boosted top quarks. The charge asymmetry in a fiducial region with large invariant mass of the top-quark pair (mtt¯>0.75 TeV and an absolute rapidity difference of the top and anti-top quark candidates within −2<|yt|−|yt¯|<2 is measured to be 4.2±3.2%, in agreement with the Standard Model prediction at next-to-leading order. A differential measurement in three tt¯ mass bins is also presented.

  18. Measurement of top quark pair production cross section and charge asymmetry at the LHC with the ATLAS experiment.

    CERN Document Server

    Besana, Maria Ilaria

    In March 2010 the Large Hadron Collider (LHC) at CERN started its operation at a center of mass energy of 7 TeV. During this period, the ATLAS experiment has been collecting a large number of proton-proton collision events, resulting in an integrated luminosity of about 5.2 fb^(-1) up to now. My PhD research has been focused on top quark physics, which is one of the milestones of the ATLAS experiment physics program. The production of top quarks is indeed the dominant high p_T process in p-p collisions at multi-TeV energies, after QCD jets, W and Z bosons. Furthermore, top physics is a rich subject, in fact top quark events are used for detector commissioning and to provide a consistency test of the Standard Model (SM). Finally the top quark sector is considered a good channel for new physics discovery. In some Beyond Standard Model (BSM) theories top quark pairs can be produced by the exchange of undiscovered heavy particles. The first part of my PhD activity has been dedicated to the top quark pair producti...

  19. Titan's hydrodynamically escaping atmosphere

    Science.gov (United States)

    Strobel, Darrell F.

    2008-02-01

    The upper atmosphere of Titan is currently losing mass at a rate ˜(4-5)×10 amus, by hydrodynamic escape as a high density, slow outward expansion driven principally by solar UV heating by CH 4 absorption. The hydrodynamic mass loss is essentially CH 4 and H 2 escape. Their combined escape rates are restricted by power limitations from attaining their limiting rates (and limiting fluxes). Hence they must exhibit gravitational diffusive separation in the upper atmosphere with increasing mixing ratios to eventually become major constituents in the exosphere. A theoretical model with solar EUV heating by N 2 absorption balanced by HCN rotational line cooling in the upper thermosphere yields densities and temperatures consistent with the Huygens Atmospheric Science Investigation (HASI) data [Fulchignoni, M., and 42 colleagues, 2005. Nature 438, 785-791], with a peak temperature of ˜185-190 K between 3500-3550 km. This model implies hydrodynamic escape rates of ˜2×10 CHs and 5×10 Hs, or some other combination with a higher H 2 escape flux, much closer to its limiting value, at the expense of a slightly lower CH 4 escape rate. Nonthermal escape processes are not required to account for the loss rates of CH 4 and H 2, inferred by the Cassini Ion Neutral Mass Spectrometer (INMS) measurements [Yelle, R.V., Borggren, N., de la Haye, V., Kasprzak, W.T., Niemann, H.B., Müller-Wodarg, I., Waite Jr., J.H., 2006. Icarus 182, 567-576].

  20. Search for anomalous production of prompt same-sign lepton pairs and pair-produced doubly charged Higgs bosons with $\\sqrt{s}$ = 8 TeV $pp$ collisions using the ATLAS detector

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdel Khalek, Samah; Abdinov, Ovsat; Aben, Rosemarie; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alio, Lion; Alison, John; Allbrooke, Benedict; Allison, Lee John; Allport, Phillip; Almond, John; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Anduaga, Xabier; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Azuelos, Georges; Azuma, Yuya; Baak, Max; Baas, Alessandra; Bacci, Cesare; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Backus Mayes, John; Badescu, Elisabeta; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bain, Travis; Baines, John; Baker, Oliver Keith; Balek, Petr; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Bartsch, Valeria; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batley, Richard; Battaglia, Marco; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Sebastian; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Katharina; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Bernard, Clare; Bernat, Pauline; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertsche, Carolyn; Bertsche, David; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boddy, Christopher Richard; Boehler, Michael; Boek, Thorsten Tobias; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Bohm, Jan; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Borri, Marcello; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boutouil, Sara; Boveia, Antonio; Boyd, James; Boyko, Igor; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Brelier, Bertrand; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Richard; Bressler, Shikma; Bristow, Kieran; Bristow, Timothy Michael; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Bromberg, Carl; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Brown, Jonathan; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Buehrer, Felix; Bugge, Lars; Bugge, Magnar Kopangen; Bulekov, Oleg; Bundock, Aaron Colin; Burckhart, Helfried; Burdin, Sergey; Burghgrave, Blake; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Buszello, Claus-Peter; Butler, Bart; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Byszewski, Marcin; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarda, Stefano; Cameron, David; Caminada, Lea Michaela; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caughron, Seth; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Cerny, Karel; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chang, Philip; Chapleau, Bertrand; Chapman, John Derek; Charfeddine, Driss; Charlton, Dave; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Liming; Chen, Shenjian; Chen, Xin; Chen, Ye; Chen, Yujiao; Cheng, Hok Chuen; Cheng, Yangyang; Cheplakov, Alexander; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiefari, Giovanni; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Chouridou, Sofia; Chow, Bonnie Kar Bo; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciocio, Alessandra; Cirkovic, Predrag; Citron, Zvi Hirsh; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clemens, Jean-Claude; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Cogan, Joshua Godfrey; Coggeshall, James; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Colon, German; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Connell, Simon Henry; Connelly, Ian; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cooper-Smith, Neil; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Côté, David; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuciuc, Constantin-Mihai; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Daniells, Andrew Christopher; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davignon, Olivier; Davison, Adam; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dechenaux, Benjamin; Dedovich, Dmitri; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Barros do Vale, Maria Aline; Do Valle Wemans, André; Doan, Thi Kieu Oanh; Dobos, Daniel; Doglioni, Caterina; Doherty, Tom; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Dudziak, Fanny; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Dwuznik, Michal; Dyndal, Mateusz; Ebke, Johannes; Edson, William; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Engelmann, Roderich; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Favareto, Andrea; Fayard, Louis; Federic, Pavol; Fedin, Oleg; Fedorko, Wojciech; Fehling-Kaschek, Mirjam; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Fernandez Perez, Sonia; Ferrag, Samir; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Julia; Fisher, Wade Cameron; Fitzgerald, Eric Andrew; Flechl, Martin; Fleck, Ivor; Fleischmann, Philipp; Fleischmann, Sebastian; Fletcher, Gareth Thomas; Fletcher, Gregory; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Florez Bustos, Andres Carlos; Flowerdew, Michael; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Franchino, Silvia; Francis, David; Franconi, Laura; Franklin, Melissa; Franz, Sebastien; Fraternali, Marco; French, Sky; Friedrich, Conrad; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Stephen; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giugni, Danilo; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Glonti, George; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godfrey, Jennifer; Godlewski, Jan; Goeringer, Christian; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Grebenyuk, Oleg; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Groth-Jensen, Jacob; Grout, Zara Jane; Guan, Liang; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guicheney, Christophe; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Gunther, Jaroslav; Guo, Jun; Gupta, Shaun; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guttman, Nir; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Hall, David; Halladjian, Garabed; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Makoto; Hasegawa, Satoshi; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Lukas; Hejbal, Jiri; Helary, Louis; Helgadottir, Inga Run; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Hengler, Christopher; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Hensel, Carsten; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herrberg-Schubert, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hoffman, Julia; Hoffmann, Dirk; Hofmann, Julia Isabell; Hohlfeld, Marc; Holmes, Tova Ray; Hong, Tae Min; Hooft van Huysduynen, Loek; Horii, Yasuyuki; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Hurwitz, Martina; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Ilchenko, Iurii; Iliadis, Dimitrios; Ilic, Nikolina; Inamaru, Yuki; Ince, Tayfun; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivarsson, Jenny; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansen, Hendrik; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanty, Laura; Jejelava, Juansher; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Johansson, Erik; Johansson, Per; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jung, Christian; Jungst, Ralph Markus; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kajomovitz, Enrique; Kalderon, Charles William; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karastathis, Nikolaos; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Katre, Akshay; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Kehoe, Robert; Keil, Markus; Keller, John; Kempster, Jacob Julian; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Khodinov, Alexander; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hee Yeun; Kim, Hyeon Jin; Kim, Shinhong; Kimura, Naoki; Kind, Oliver; King, Barry; King, Matthew; King, Robert Steven Beaufoy; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kittelmann, Thomas; Kiuchi, Kenji; Kladiva, Eduard; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Klok, Peter; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Koletsou, Iro; Koll, James; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; König, Sebastian; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kurumida, Rie; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; La Rosa, Alessandro; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laier, Heiko; Lambourne, Luke; Lammers, Sabine; Lampen, Caleb; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmacher, Marc; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzen, Georg; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonhardt, Kathrin; Leonidopoulos, Christos; Leontsinis, Stefanos; Leroy, Claude; Lester, Christopher; Lester, Christopher Michael; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Bo; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Shu; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loddenkoetter, Thomas; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Lombardo, Vincenzo Paolo; Long, Brian Alexander; Long, Jonathan; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Feng; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lungwitz, Matthias; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Machado Miguens, Joana; Macina, Daniela; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeno, Mayuko; Maeno, Tadashi; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Mahmoud, Sara; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany Andreina; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marjanovic, Marija; Marques, Carlos; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Homero; Martinez, Mario; Martin-Haugh, Stewart; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazzaferro, Luca; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Meade, Andrew; Mechnich, Joerg; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Meric, Nicolas; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Merritt, Hayes; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Middleton, Robin; Migas, Sylwia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Mitsui, Shingo; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Mönig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Klemens; Mueller, Thibaut; Mueller, Timo; Muenstermann, Daniel; Munwes, Yonathan; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Nanava, Gizo; Narayan, Rohin; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Nef, Pascal Daniel; Negri, Andrea; Negri, Guido; Negrini, Matteo; Nektarijevic, Snezana; Nelson, Andrew; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Norberg, Scarlet; Nordberg, Markus; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nuti, Francesco; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olchevski, Alexander; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paganis, Efstathios; Pahl, Christoph; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panduro Vazquez, William; Pani, Priscilla; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pearce, James; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penwell, John; Perepelitsa, Dennis; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrino, Roberto; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Pettersson, Nora Emilia; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Pingel, Almut; Pinto, Belmiro; Pires, Sylvestre; Pitt, Michael; Pizio, Caterina; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Poddar, Sahill; Podlyski, Fabrice; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Pohl, Martin; Polesello, Giacomo; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Price, Darren; Price, Joe; Price, Lawrence; Prieur, Damien; Primavera, Margherita; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Przysiezniak, Helenka; Ptacek, Elizabeth; Puddu, Daniele; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quarrie, David; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Qureshi, Anum; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Randle-Conde, Aidan Sean; Rangel-Smith, Camila; Rao, Kanury; Rauscher, Felix; Rave, Tobias Christian; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reisin, Hernan; Relich, Matthew; Rembser, Christoph; Ren, Huan; Ren, Zhongliang; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Ridel, Melissa; Rieck, Patrick; Rieger, Julia; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Rodrigues, Luis; Roe, Shaun; Røhne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Matthew; Rose, Peyton; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sacerdoti, Sabrina; Saddique, Asif; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sartisohn, Georg; Sasaki, Osamu; Sasaki, Yuichi; Sauvage, Gilles; Sauvan, Emmanuel; Savard, Pierre; Savu, Dan Octavian; Sawyer, Craig; Sawyer, Lee; Saxon, David; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R~Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schroeder, Christian; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwegler, Philipp; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scott, Bill; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekula, Stephen; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellers, Graham; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simoniello, Rosa; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Song, Hong Ye; Soni, Nitesh; Sood, Alexander; Sopczak, Andre; Sopko, Bruno; Sopko, Vit; Sorin, Veronica; Sosebee, Mark; Soualah, Rachik; Soueid, Paul; Soukharev, Andrey; South, David; Spagnolo, Stefania; Spanò, Francesco; Spearman, William Robert; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Stavina, Pavel; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Struebig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Svatos, Michal; Swedish, Stephen; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanasijczuk, Andres Jorge; Tannenwald, Benjamin Bordy; Tannoury, Nancy; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Ray; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thong, Wai Meng; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Topilin, Nikolai; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Tran, Huong Lan; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; True, Patrick; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turk Cakir, Ilkay; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Uhlenbrock, Mathias; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urbaniec, Dustin; Urquijo, Phillip; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; Van Der Leeuw, Robin; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vankov, Peter; Vannucci, Francois; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloso, Filipe; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Virzi, Joseph; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Adrian; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Walsh, Brian; Wang, Chao; Wang, Chiho; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weigell, Philipp; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wendland, Dennis; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, Alan; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winter, Benedict Tobias; Wittgen, Matthias; Wittig, Tobias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wright, Michael; Wu, Mengqing; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yakabe, Ryota; Yamada, Miho; Yamaguchi, Hiroshi; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Un-Ki; Yang, Yi; Yanush, Serguei; Yao, Liwen; Yao, Weiming; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Lei; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Lei; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Zinonos, Zinonas; Ziolkowski, Michael; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zutshi, Vishnu; Zwalinski, Lukasz

    2015-03-09

    A low-background inclusive search for new physics in events with same-sign dileptons is presented. The search uses proton--proton collisions corresponding to 20.3 fb$^{-1}$ of integrated luminosity taken in 2012 at a centre-of-mass energy of 8 TeV with the ATLAS detector at the LHC. Pairs of isolated leptons with the same electric charge and large transverse momenta of the type $e^{\\pm}e^{\\pm}, e^{\\pm}\\mu^{\\pm}$, and $\\mu^{\\pm}\\mu^{\\pm}$ are selected and their invariant mass distribution is examined. No excess of events above the expected level of Standard Model background is found. The results are used to set upper limits on the cross sections for processes beyond the Standard Model. Limits are placed as a function of the dilepton invariant mass within a fiducial region corresponding to the signal event selection criteria. Exclusion limits are also derived for a specific model of doubly charged Higgs boson production.

  1. Search for new bottomlike quark pair decays QQ-->(tW(+)(-))(tW(+)(-)in same-charge dilepton events.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; González, B Alvarez; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Berge, D; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; d'Errico, M; Di Canto, A; di Giovanni, G P; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Dorigo, T; Dube, S; Ebina, K; Elagin, A; Erbacher, R; Errede, D; Errede, S; Ershaidat, N; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harr, R F; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Heuser, J; Hewamanage, S; Hickman, M; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Hughes, R E; Hurwitz, M; Husemann, U; Hussein, M; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leone, S; Lewis, J D; Lin, C-J; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Lovas, L; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Mastrandrea, P; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Mesropian, C; Miao, T; Mietlicki, D; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramanov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Peiffer, T; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Potamianos, K; Poukhov, O; Prokoshin, F; Pronko, A; Ptohos, F; Pueschel, E; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Renz, M; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Rutherford, B; Saarikko, H; Safonov, A; Sakumoto, W K; Santi, L; Sartori, L; Sato, K; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schmidt, M A; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sforza, F; Sfyrla, A; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shiraishi, S; Shochet, M; Shon, Y; Shreyber, I; Simonenko, A; Sinervo, P; Sisakyan, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S; Sorin, V; Squillacioti, P; Stanitzki, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Suh, J S; Sukhanov, A; Suslov, I; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thome, J; Thompson, G A; Thomson, E; Tipton, P; Ttito-Guzmán, P; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Tourneur, S; Trovato, M; Tsai, S-Y; Tu, Y; Turini, N; Ukegawa, F; Uozumi, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vila, I; Vilar, R; Vogel, M; Volobouev, I; Volpi, G; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wagner-Kuhr, J; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Weinelt, J; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Williams, G; Williams, H H; Wilson, M G; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wolfe, H; Wright, T; Wu, X; Würthwein, F; Yagil, A; Yamamoto, K; Yamaoka, J; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanetti, A; Zeng, Y; Zhang, X; Zheng, Y; Zucchelli, S

    2010-03-05

    We report the most restrictive direct limits on masses of fourth-generation down-type quarks b{'}, and quarklike composite fermions (B or T{5/3}), decaying promptly to tW{-/+}. We search for a significant excess of events with two same-charge leptons (e, mu), several hadronic jets, and missing transverse energy. An analysis of data from pp collisions with an integrated luminosity of 2.7 fb{-1} collected with the CDF II detector at Fermilab yields no evidence for such a signal, setting mass limits m{b{'}}, m{B}>338 GeV/c{2} and m{T{5/3}}>365 GeV/c{2} at 95% confidence level.

  2. Escape of magnetic toroids from the Sun

    International Nuclear Information System (INIS)

    Bieber, John W.; Rust, David M.

    1996-01-01

    Analysis of heliospheric magnetic fields at 1 AU shows that 10 24 Mx of net toroidal flux escapes from the Sun per solar cycle. This rate is compared with the apparent rate of flux emergence at the solar surface, and it is concluded that escaping toroids will remove at least 20% of the emerging flux, and may remove as much as 100% of emerging flux if multiple eruptions occur on the toroids. The data imply that flux escapes the Sun with an efficiency far exceeding Parker's upper limit estimate of 3%. Toroidal flux escape is almost certainly the source of the observed overwinding of the interplanetary magnetic field spiral. Two mechanisms to facilitate net flux escape are discussed: helicity charging to push open the fields and flux transport with reconnection to close them off. We estimate the Sun will shed ∼2x10 45 Mx 2 of magnetic helicity per solar cycle, leading to a mean helicity density of 100 Mx 2 cm -3 at 1 AU, which agrees well with observations

  3. Search for charge-asymmetric production of W' bosons in top pair + jet events from pp collisions at $\\sqrt{s}$ = 7 TeV

    CERN Document Server

    Chatrchyan, Serguei; Sirunyan, Albert M; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Erö, Janos; Fabjan, Christian; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hammer, Josef; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kiesenhofer, Wolfgang; Knünz, Valentin; Krammer, Manfred; Liko, Dietrich; Mikulec, Ivan; Pernicka, Manfred; Rahbaran, Babak; Rohringer, Christine; Rohringer, Herbert; Schöfbeck, Robert; Strauss, Josef; Taurok, Anton; Wagner, Philipp; Waltenberger, Wolfgang; Walzel, Gerhard; Widl, Edmund; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Bansal, Sunil; Cornelis, Tom; De Wolf, Eddi A; Janssen, Xavier; Luyckx, Sten; Maes, Thomas; Mucibello, Luca; Ochesanu, Silvia; Roland, Benoit; Rougny, Romain; Selvaggi, Michele; Staykova, Zlatka; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Van Spilbeeck, Alex; Blekman, Freya; Blyweert, Stijn; D'Hondt, Jorgen; Gonzalez Suarez, Rebeca; Kalogeropoulos, Alexis; Maes, Michael; Olbrechts, Annik; Van Doninck, Walter; Van Mulders, Petra; Van Onsem, Gerrit Patrick; Villella, Ilaria; Clerbaux, Barbara; De Lentdecker, Gilles; Dero, Vincent; Gay, Arnaud; Hreus, Tomas; Léonard, Alexandre; Marage, Pierre Edouard; Reis, Thomas; Thomas, Laurent; Vander Velde, Catherine; Vanlaer, Pascal; Wang, Jian; Adler, Volker; Beernaert, Kelly; Cimmino, Anna; Costantini, Silvia; Garcia, Guillaume; Grunewald, Martin; Klein, Benjamin; Lellouch, Jérémie; Marinov, Andrey; Mccartin, Joseph; Ocampo Rios, Alberto Andres; Ryckbosch, Dirk; Strobbe, Nadja; Thyssen, Filip; Tytgat, Michael; Verwilligen, Piet; Walsh, Sinead; Yazgan, Efe; Zaganidis, Nicolas; Basegmez, Suzan; Bruno, Giacomo; Castello, Roberto; Caudron, Adrien; Ceard, Ludivine; Delaere, Christophe; Du Pree, Tristan; Favart, Denis; Forthomme, Laurent; Giammanco, Andrea; Hollar, Jonathan; Lemaitre, Vincent; Liao, Junhui; Militaru, Otilia; Nuttens, Claude; Pagano, Davide; Perrini, Lucia; Pin, Arnaud; Piotrzkowski, Krzysztof; Schul, Nicolas; Vizan Garcia, Jesus Manuel; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Hammad, Gregory Habib; Alves, Gilvan; Correa Martins Junior, Marcos; De Jesus Damiao, Dilson; Martins, Thiago; Pol, Maria Elena; Henrique Gomes E Souza, Moacyr; Aldá Júnior, Walter Luiz; Carvalho, Wagner; Custódio, Analu; Melo Da Costa, Eliza; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Matos Figueiredo, Diego; Mundim, Luiz; Nogima, Helio; Oguri, Vitor; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Soares Jorge, Luana; Sznajder, Andre; Bernardes, Cesar Augusto; De Almeida Dias, Flavia; Tomei, Thiago; De Moraes Gregores, Eduardo; Lagana, Caio; Da Cunha Marinho, Franciole; Mercadante, Pedro G; Novaes, Sergio F; Padula, Sandra; Genchev, Vladimir; Iaydjiev, Plamen; Piperov, Stefan; Rodozov, Mircho; Stoykova, Stefka; Sultanov, Georgi; Tcholakov, Vanio; Trayanov, Rumen; Vutova, Mariana; Dimitrov, Anton; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leander; Pavlov, Borislav; Petkov, Peicho; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Meng, Xiangwei; Tao, Junquan; Wang, Jian; Wang, Xianyou; Wang, Zheng; Xiao, Hong; Xu, Ming; Zang, Jingjing; Zhang, Zhen; Asawatangtrakuldee, Chayanit; Ban, Yong; Guo, Shuang; Guo, Yifei; Li, Wenbo; Liu, Shuai; Mao, Yajun; Qian, Si-Jin; Teng, Haiyun; Wang, Siguang; Zhu, Bo; Zou, Wei; Avila, Carlos; Gomez, Juan Pablo; Gomez Moreno, Bernardo; Osorio Oliveros, Andres Felipe; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Plestina, Roko; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Kovac, Marko; Brigljevic, Vuko; Duric, Senka; Kadija, Kreso; Luetic, Jelena; Morovic, Srecko; Attikis, Alexandros; Galanti, Mario; Mavromanolakis, Georgios; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A; Finger, Miroslav; Finger Jr, Michael; Assran, Yasser; Elgammal, Sherif; Ellithi Kamel, Ali; Khalil, Shaaban; Mahmoud, Mohammed; Radi, Amr; Kadastik, Mario; Müntel, Mait; Raidal, Martti; Rebane, Liis; Tiko, Andres; Azzolini, Virginia; Eerola, Paula; Fedi, Giacomo; Voutilainen, Mikko; Härkönen, Jaakko; Heikkinen, Mika Aatos; Karimäki, Veikko; Kinnunen, Ritva; Kortelainen, Matti J; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Mäenpää, Teppo; Peltola, Timo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Ungaro, Donatella; Wendland, Lauri; Banzuzi, Kukka; Karjalainen, Ahti; Korpela, Arja; Tuuva, Tuure; Besancon, Marc; Choudhury, Somnath; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Millischer, Laurent; Nayak, Aruna; Rander, John; Rosowsky, André; Shreyber, Irina; Titov, Maksym; Baffioni, Stephanie; Beaudette, Florian; Benhabib, Lamia; Bianchini, Lorenzo; Bluj, Michal; Broutin, Clementine; Busson, Philippe; Charlot, Claude; Daci, Nadir; Dahms, Torsten; Dobrzynski, Ludwik; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Miné, Philippe; Mironov, Camelia; Nguyen, Matthew; Ochando, Christophe; Paganini, Pascal; Sabes, David; Salerno, Roberto; Sirois, Yves; Veelken, Christian; Zabi, Alexandre; Agram, Jean-Laurent; Andrea, Jeremy; Bloch, Daniel; Bodin, David; Brom, Jean-Marie; Cardaci, Marco; Chabert, Eric Christian; Collard, Caroline; Conte, Eric; Drouhin, Frédéric; Ferro, Cristina; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Juillot, Pierre; Le Bihan, Anne-Catherine; Van Hove, Pierre; Fassi, Farida; Mercier, Damien; Beauceron, Stephanie; Beaupere, Nicolas; Bondu, Olivier; Boudoul, Gaelle; Chasserat, Julien; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Fay, Jean; Gascon, Susan; Gouzevitch, Maxime; Ille, Bernard; Kurca, Tibor; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Sordini, Viola; Tosi, Silvano; Tschudi, Yohann; Verdier, Patrice; Viret, Sébastien; Tsamalaidze, Zviad; Anagnostou, Georgios; Beranek, Sarah; Edelhoff, Matthias; Feld, Lutz; Heracleous, Natalie; Hindrichs, Otto; Jussen, Ruediger; Klein, Katja; Merz, Jennifer; Ostapchuk, Andrey; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Wittmer, Bruno; Zhukov, Valery; Ata, Metin; Caudron, Julien; Dietz-Laursonn, Erik; Duchardt, Deborah; Erdmann, Martin; Fischer, Robert; Güth, Andreas; Hebbeker, Thomas; Heidemann, Carsten; Hoepfner, Kerstin; Klingebiel, Dennis; Kreuzer, Peter; Lingemann, Joschka; Magass, Carsten; Merschmeyer, Markus; Meyer, Arnd; Olschewski, Mark; Papacz, Paul; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sonnenschein, Lars; Steggemann, Jan; Teyssier, Daniel; Weber, Martin; Bontenackels, Michael; Cherepanov, Vladimir; Flügge, Günter; Geenen, Heiko; Geisler, Matthias; Haj Ahmad, Wael; Hoehle, Felix; Kargoll, Bastian; Kress, Thomas; Kuessel, Yvonne; Nowack, Andreas; Perchalla, Lars; Pooth, Oliver; Rennefeld, Jörg; Sauerland, Philip; Stahl, Achim; Aldaya Martin, Maria; Behr, Joerg; Behrenhoff, Wolf; Behrens, Ulf; Bergholz, Matthias; Bethani, Agni; Borras, Kerstin; Burgmeier, Armin; Cakir, Altan; Calligaris, Luigi; Campbell, Alan; Castro, Elena; Costanza, Francesco; Dammann, Dirk; Diez Pardos, Carmen; Eckerlin, Guenter; Eckstein, Doris; Flucke, Gero; Geiser, Achim; Glushkov, Ivan; Gunnellini, Paolo; Habib, Shiraz; Hauk, Johannes; Hellwig, Gregor; Jung, Hannes; Kasemann, Matthias; Katsas, Panagiotis; Kleinwort, Claus; Kluge, Hannelies; Knutsson, Albert; Krämer, Mira; Krücker, Dirk; Kuznetsova, Ekaterina; Lange, Wolfgang; Lohmann, Wolfgang; Lutz, Benjamin; Mankel, Rainer; Marfin, Ihar; Marienfeld, Markus; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mnich, Joachim; Mussgiller, Andreas; Naumann-Emme, Sebastian; Olzem, Jan; Perrey, Hanno; Petrukhin, Alexey; Pitzl, Daniel; Raspereza, Alexei; Ribeiro Cipriano, Pedro M; Riedl, Caroline; Ron, Elias; Rosin, Michele; Salfeld-Nebgen, Jakob; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Sen, Niladri; Spiridonov, Alexander; Stein, Matthias; Walsh, Roberval; Wissing, Christoph; Autermann, Christian; Blobel, Volker; Draeger, Jula; Enderle, Holger; Erfle, Joachim; Gebbert, Ulla; Görner, Martin; Hermanns, Thomas; Höing, Rebekka Sophie; Kaschube, Kolja; Kaussen, Gordon; Kirschenmann, Henning; Klanner, Robert; Lange, Jörn; Mura, Benedikt; Nowak, Friederike; Peiffer, Thomas; Pietsch, Niklas; Rathjens, Denis; Sander, Christian; Schettler, Hannes; Schleper, Peter; Schlieckau, Eike; Schmidt, Alexander; Schröder, Matthias; Schum, Torben; Seidel, Markus; Sola, Valentina; Stadie, Hartmut; Steinbrück, Georg; Thomsen, Jan; Vanelderen, Lukas; Barth, Christian; Berger, Joram; Böser, Christian; Chwalek, Thorsten; De Boer, Wim; Descroix, Alexis; Dierlamm, Alexander; Feindt, Michael; Guthoff, Moritz; Hackstein, Christoph; Hartmann, Frank; Hauth, Thomas; Heinrich, Michael; Held, Hauke; Hoffmann, Karl-Heinz; Honc, Simon; Katkov, Igor; Komaragiri, Jyothsna Rani; Lobelle Pardo, Patricia; Martschei, Daniel; Mueller, Steffen; Müller, Thomas; Niegel, Martin; Nürnberg, Andreas; Oberst, Oliver; Oehler, Andreas; Ott, Jochen; Quast, Gunter; Rabbertz, Klaus; Ratnikov, Fedor; Ratnikova, Natalia; Röcker, Steffen; Scheurer, Armin; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jürgen; Stober, Fred-Markus Helmut; Troendle, Daniel; Ulrich, Ralf; Wagner-Kuhr, Jeannine; Wayand, Stefan; Weiler, Thomas; Zeise, Manuel; Daskalakis, Georgios; Geralis, Theodoros; Kesisoglou, Stilianos; Kyriakis, Aristotelis; Loukas, Demetrios; Manolakos, Ioannis; Markou, Athanasios; Markou, Christos; Mavrommatis, Charalampos; Ntomari, Eleni; Gouskos, Loukas; Mertzimekis, Theodoros; Panagiotou, Apostolos; Saoulidou, Niki; Evangelou, Ioannis; Foudas, Costas; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Patras, Vaios; Bencze, Gyorgy; Hajdu, Csaba; Hidas, Pàl; Horvath, Dezso; Sikler, Ferenc; Veszpremi, Viktor; Vesztergombi, Gyorgy; Beni, Noemi; Czellar, Sandor; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Karancsi, János; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Beri, Suman Bala; Bhatnagar, Vipin; Dhingra, Nitish; Gupta, Ruchi; Bansal, Monika; Kaur, Manjit; Mehta, Manuk Zubin; Nishu, Nishu; Saini, Lovedeep Kaur; Sharma, Archana; Singh, Jasbir; Kumar, Ashok; Kumar, Arun; Ahuja, Sudha; Bhardwaj, Ashutosh; Choudhary, Brajesh C; Malhotra, Shivali; Naimuddin, Md; Ranjan, Kirti; Sharma, Varun; Shivpuri, Ram Krishen; Banerjee, Sunanda; Bhattacharya, Satyaki; Dutta, Suchandra; Gomber, Bhawna; Jain, Sandhya; Jain, Shilpi; Khurana, Raman; Sarkar, Subir; Sharan, Manoj; Abdulsalam, Abdulla; Choudhury, Rajani Kant; Dutta, Dipanwita; Kailas, Swaminathan; Kumar, Vineet; Mehta, Pourus; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Aziz, Tariq; Ganguly, Sanmay; Guchait, Monoranjan; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Parida, Bibhuti; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Etesami, Seyed Mohsen; Fahim, Ali; Hashemi, Majid; Hesari, Hoda; Jafari, Abideh; Khakzad, Mohsen; Mohammadi Najafabadi, Mojtaba; Paktinat Mehdiabadi, Saeid; Safarzadeh, Batool; Zeinali, Maryam; Abbrescia, Marcello; Barbone, Lucia; Calabria, Cesare; Chhibra, Simranjit Singh; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Fiore, Luigi; Iaselli, Giuseppe; Lusito, Letizia; Maggi, Giorgio; Maggi, Marcello; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pacifico, Nicola; Pompili, Alexis; Pugliese, Gabriella; Selvaggi, Giovanna; Silvestris, Lucia; Singh, Gurpreet; Venditti, Rosamaria; Zito, Giuseppe; Abbiendi, Giovanni; Benvenuti, Alberto; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Brigliadori, Luca; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Grandi, Claudio; Guiducci, Luigi; Marcellini, Stefano; Masetti, Gianni; Meneghelli, Marco; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Primavera, Federica; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gianni; Travaglini, Riccardo; Albergo, Sebastiano; Cappello, Gigi; Chiorboli, Massimiliano; Costa, Salvatore; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Frosali, Simone; Gallo, Elisabetta; Gonzi, Sandro; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Benussi, Luigi; Bianco, Stefano; Colafranceschi, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Musenich, Riccardo; Benaglia, Andrea; De Guio, Federico; Di Matteo, Leonardo; Fiorendi, Sara; Gennai, Simone; Ghezzi, Alessio; Malvezzi, Sandra; Manzoni, Riccardo Andrea; Martelli, Arabella; Massironi, Andrea; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Ragazzi, Stefano; Redaelli, Nicola; Sala, Silvano; Tabarelli de Fatis, Tommaso; Buontempo, Salvatore; Carrillo Montoya, Camilo Andres; Cavallo, Nicola; De Cosa, Annapaola; Dogangun, Oktay; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Meola, Sabino; Merola, Mario; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Branca, Antonio; Carlin, Roberto; Checchia, Paolo; Dorigo, Tommaso; Gasparini, Fabrizio; Gasparini, Ugo; Gozzelino, Andrea; Kanishchev, Konstantin; Lacaprara, Stefano; Lazzizzera, Ignazio; Margoni, Martino; Meneguzzo, Anna Teresa; Passaseo, Marina; Pazzini, Jacopo; Pegoraro, Matteo; Pozzobon, Nicola; Ronchese, Paolo; Simonetto, Franco; Torassa, Ezio; Tosi, Mia; Vanini, Sara; Ventura, Sandro; Zotto, Pierluigi; Zucchetta, Alberto; Gabusi, Michele; Ratti, Sergio P; Riccardi, Cristina; Torre, Paola; Vitulo, Paolo; Biasini, Maurizio; Bilei, Gian Mario; Fanò, Livio; Lariccia, Paolo; Lucaroni, Andrea; Mantovani, Giancarlo; Menichelli, Mauro; Nappi, Aniello; Romeo, Francesco; Saha, Anirban; Santocchia, Attilio; Taroni, Silvia; Azzurri, Paolo; Bagliesi, Giuseppe; Boccali, Tommaso; Broccolo, Giuseppe; Castaldi, Rino; D'Agnolo, Raffaele Tito; Dell'Orso, Roberto; Fiori, Francesco; Foà, Lorenzo; Giassi, Alessandro; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Rizzi, Andrea; Serban, Alin Titus; Spagnolo, Paolo; Squillacioti, Paola; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; Del Re, Daniele; Diemoz, Marcella; Grassi, Marco; Longo, Egidio; Meridiani, Paolo; Micheli, Francesco; Nourbakhsh, Shervin; Organtini, Giovanni; Paramatti, Riccardo; Rahatlou, Shahram; Sigamani, Michael; Soffi, Livia; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Biino, Cristina; Cartiglia, Nicolo; Costa, Marco; Demaria, Natale; Graziano, Alberto; Mariotti, Chiara; Maselli, Silvia; Migliore, Ernesto; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pastrone, Nadia; Pelliccioni, Mario; Potenza, Alberto; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Solano, Ada; Staiano, Amedeo; Vilela Pereira, Antonio; Belforte, Stefano; Candelise, Vieri; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; Marone, Matteo; Montanino, Damiana; Penzo, Aldo; Schizzi, Andrea; Heo, Seong Gu; Kim, Tae Yeon; Nam, Soon-Kwon; Chang, Sunghyun; Chung, Jin Hyuk; Kim, Dong Hee; Kim, Gui Nyun; Kong, Dae Jung; Park, Hyangkyu; Ro, Sang-Ryul; Son, Dong-Chul; Son, Taejin; Kim, Jae Yool; Kim, Zero Jaeho; Song, Sanghyeon; Choi, Suyong; Gyun, Dooyeon; Hong, Byung-Sik; Jo, Mihee; Kim, Hyunchul; Kim, Tae Jeong; Lee, Kyong Sei; Moon, Dong Ho; Park, Sung Keun; Choi, Minkyoo; Kim, Ji Hyun; Park, Chawon; Park, Inkyu; Park, Sangnam; Ryu, Geonmo; Cho, Yongjin; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Kim, Min Suk; Kwon, Eunhyang; Lee, Byounghoon; Lee, Jongseok; Lee, Sungeun; Seo, Hyunkwan; Yu, Intae; Bilinskas, Mykolas Jurgis; Grigelionis, Ignas; Janulis, Mindaugas; Juodagalvis, Andrius; Castilla-Valdez, Heriberto; De La Cruz-Burelo, Eduard; Heredia-de La Cruz, Ivan; Lopez-Fernandez, Ricardo; Magaña Villalba, Ricardo; Martínez-Ortega, Jorge; Sánchez-Hernández, Alberto; Villasenor-Cendejas, Luis Manuel; Carrillo Moreno, Salvador; Vazquez Valencia, Fabiola; Salazar Ibarguen, Humberto Antonio; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Reyes-Santos, Marco A; Krofcheck, David; Bell, Alan James; Butler, Philip H; Doesburg, Robert; Reucroft, Steve; Silverwood, Hamish; Ahmad, Muhammad; Asghar, Muhammad Irfan; Hoorani, Hafeez R; Khalid, Shoaib; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Shah, Mehar Ali; Shoaib, Muhammad; Brona, Grzegorz; Bunkowski, Karol; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Bialkowska, Helena; Boimska, Bozena; Frueboes, Tomasz; Gokieli, Ryszard; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Almeida, Nuno; Bargassa, Pedrame; David Tinoco Mendes, Andre; Faccioli, Pietro; Fernandes, Miguel; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Seixas, Joao; Varela, Joao; Vischia, Pietro; Belotelov, Ivan; Bunin, Pavel; Gavrilenko, Mikhail; Golutvin, Igor; Gorbunov, Ilya; Karjavin, Vladimir; Kozlov, Guennady; Lanev, Alexander; Malakhov, Alexander; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Savina, Maria; Shmatov, Sergey; Smirnov, Vitaly; Volodko, Anton; Zarubin, Anatoli; Evstyukhin, Sergey; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Murzin, Victor; Oreshkin, Vadim; Smirnov, Igor; Sulimov, Valentin; Uvarov, Lev; Vavilov, Sergey; Vorobyev, Alexey; Vorobyev, Andrey; Andreev, Yuri; Dermenev, Alexander; Gninenko, Sergei; Golubev, Nikolai; Kirsanov, Mikhail; Krasnikov, Nikolai; Matveev, Viktor; Pashenkov, Anatoli; Tlisov, Danila; Toropin, Alexander; Epshteyn, Vladimir; Erofeeva, Maria; Gavrilov, Vladimir; Kossov, Mikhail; Lychkovskaya, Natalia; Popov, Vladimir; Safronov, Grigory; Semenov, Sergey; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Belyaev, Andrey; Boos, Edouard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Klyukhin, Vyacheslav; Kodolova, Olga; Lokhtin, Igor; Markina, Anastasia; Obraztsov, Stepan; Perfilov, Maxim; Petrushanko, Sergey; Popov, Andrey; Sarycheva, Ludmila; Savrin, Viktor; Snigirev, Alexander; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Leonidov, Andrey; Mesyats, Gennady; Rusakov, Sergey V; Vinogradov, Alexey; Azhgirey, Igor; Bayshev, Igor; Bitioukov, Sergei; Grishin, Viatcheslav; Kachanov, Vassili; Konstantinov, Dmitri; Korablev, Andrey; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Sobol, Andrei; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Ekmedzic, Marko; Krpic, Dragomir; Milosevic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Arce, Pedro; Battilana, Carlo; Calvo, Enrique; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Delgado Peris, Antonio; Domínguez Vázquez, Daniel; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M; Josa, Maria Isabel; Merino, Gonzalo; Puerta Pelayo, Jesus; Quintario Olmeda, Adrián; Redondo, Ignacio; Romero, Luciano; Santaolalla, Javier; Senghi Soares, Mara; Willmott, Carlos; Albajar, Carmen; Codispoti, Giuseppe; de Trocóniz, Jorge F; Brun, Hugues; Cuevas, Javier; Fernandez Menendez, Javier; Folgueras, Santiago; Gonzalez Caballero, Isidro; Lloret Iglesias, Lara; Piedra Gomez, Jonatan; Brochero Cifuentes, Javier Andres; Cabrillo, Iban Jose; Calderon, Alicia; Chuang, Shan-Huei; Duarte Campderros, Jordi; Felcini, Marta; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Jorda, Clara; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Matorras, Francisco; Munoz Sanchez, Francisca Javiela; Rodrigo, Teresa; Rodríguez-Marrero, Ana Yaiza; Ruiz-Jimeno, Alberto; Scodellaro, Luca; Sobron Sanudo, Mar; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Baillon, Paul; Ball, Austin; Barney, David; Benitez, Jose F; Bernet, Colin; Bianchi, Giovanni; Bloch, Philippe; Bocci, Andrea; Bonato, Alessio; Botta, Cristina; Breuker, Horst; Camporesi, Tiziano; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; D'Enterria, David; Dabrowski, Anne; De Roeck, Albert; Di Guida, Salvatore; Dobson, Marc; Dupont-Sagorin, Niels; Elliott-Peisert, Anna; Frisch, Benjamin; Funk, Wolfgang; Georgiou, Georgios; Giffels, Manuel; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Giunta, Marina; Glege, Frank; Gomez-Reino Garrido, Robert; Govoni, Pietro; Gowdy, Stephen; Guida, Roberto; Hansen, Magnus; Harris, Philip; Hartl, Christian; Harvey, John; Hegner, Benedikt; Hinzmann, Andreas; Innocente, Vincenzo; Janot, Patrick; Kaadze, Ketino; Karavakis, Edward; Kousouris, Konstantinos; Lecoq, Paul; Lee, Yen-Jie; Lenzi, Piergiulio; Lourenco, Carlos; Maki, Tuula; Malberti, Martina; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Mersi, Stefano; Meschi, Emilio; Moser, Roland; Mozer, Matthias Ulrich; Mulders, Martijn; Musella, Pasquale; Nesvold, Erik; Orimoto, Toyoko; Orsini, Luciano; Palencia Cortezon, Enrique; Perez, Emmanuelle; Perrozzi, Luca; Petrilli, Achille; Pfeiffer, Andreas; Pierini, Maurizio; Pimiä, Martti; Piparo, Danilo; Polese, Giovanni; Quertenmont, Loic; Racz, Attila; Reece, William; Rodrigues Antunes, Joao; Rolandi, Gigi; Rommerskirchen, Tanja; Rovelli, Chiara; Rovere, Marco; Sakulin, Hannes; Santanastasio, Francesco; Schäfer, Christoph; Schwick, Christoph; Segoni, Ilaria; Sekmen, Sezen; Sharma, Archana; Siegrist, Patrice; Silva, Pedro; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Spiropulu, Maria; Tsirou, Andromachi; Veres, Gabor Istvan; Vlimant, Jean-Roch; Wöhri, Hermine Katharina; Worm, Steven; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; König, Stefan; Kotlinski, Danek; Langenegger, Urs; Meier, Frank; Renker, Dieter; Rohe, Tilman; Sibille, Jennifer; Bäni, Lukas; Bortignon, Pierluigi; Buchmann, Marco-Andrea; Casal, Bruno; Chanon, Nicolas; Deisher, Amanda; Dissertori, Günther; Dittmar, Michael; Dünser, Marc; Eugster, Jürg; Freudenreich, Klaus; Grab, Christoph; Hits, Dmitry; Lecomte, Pierre; Lustermann, Werner; Marini, Andrea Carlo; Martinez Ruiz del Arbol, Pablo; Mohr, Niklas; Moortgat, Filip; Nägeli, Christoph; Nef, Pascal; Nessi-Tedaldi, Francesca; Pandolfi, Francesco; Pape, Luc; Pauss, Felicitas; Peruzzi, Marco; Ronga, Frederic Jean; Rossini, Marco; Sala, Leonardo; Sanchez, Ann - Karin; Starodumov, Andrei; Stieger, Benjamin; Takahashi, Maiko; Tauscher, Ludwig; Thea, Alessandro; Theofilatos, Konstantinos; Treille, Daniel; Urscheler, Christina; Wallny, Rainer; Weber, Hannsjoerg Artur; Wehrli, Lukas; Aguilo, Ernest; Amsler, Claude; Chiochia, Vincenzo; De Visscher, Simon; Favaro, Carlotta; Ivova Rikova, Mirena; Millan Mejias, Barbara; Otiougova, Polina; Robmann, Peter; Snoek, Hella; Tupputi, Salvatore; Verzetti, Mauro; Chang, Yuan-Hann; Chen, Kuan-Hsin; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Liu, Zong-Kai; Lu, Yun-Ju; Mekterovic, Darko; Singh, Anil; Volpe, Roberta; Yu, Shin-Shan; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chang, Yu-Wei; Chao, Yuan; Chen, Kai-Feng; Dietz, Charles; Grundler, Ulysses; Hou, George Wei-Shu; Hsiung, Yee; Kao, Kai-Yi; Lei, Yeong-Jyi; Lu, Rong-Shyang; Majumder, Devdatta; Petrakou, Eleni; Shi, Xin; Shiu, Jing-Ge; Tzeng, Yeng-Ming; Wan, Xia; Wang, Minzu; Adiguzel, Aytul; Bakirci, Mustafa Numan; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gokbulut, Gul; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Karapinar, Guler; Kayis Topaksu, Aysel; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sogut, Kenan; Sunar Cerci, Deniz; Tali, Bayram; Topakli, Huseyin; Vergili, Latife Nukhet; Vergili, Mehmet; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilin, Bugra; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Ocalan, Kadir; Ozpineci, Altug; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Yalvac, Metin; Yildirim, Eda; Zeyrek, Mehmet; Gülmez, Erhan; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Ozkorucuklu, Suat; Sonmez, Nasuf; Cankocak, Kerem; Levchuk, Leonid; Bostock, Francis; Brooke, James John; Clement, Emyr; Cussans, David; Flacher, Henning; Frazier, Robert; Goldstein, Joel; Grimes, Mark; Heath, Greg P; Heath, Helen F; Kreczko, Lukasz; Metson, Simon; Newbold, Dave M; Nirunpong, Kachanon; Poll, Anthony; Senkin, Sergey; Smith, Vincent J; Williams, Thomas; Basso, Lorenzo; Bell, Ken W; Belyaev, Alexander; Brew, Christopher; Brown, Robert M; Cockerill, David JA; Coughlan, John A; Harder, Kristian; Harper, Sam; Jackson, James; Kennedy, Bruce W; Olaiya, Emmanuel; Petyt, David; Radburn-Smith, Benjamin Charles; Shepherd-Themistocleous, Claire; Tomalin, Ian R; Womersley, William John; Bainbridge, Robert; Ball, Gordon; Beuselinck, Raymond; Buchmuller, Oliver; Colling, David; Cripps, Nicholas; Cutajar, Michael; Dauncey, Paul; Davies, Gavin; Della Negra, Michel; Ferguson, William; Fulcher, Jonathan; Futyan, David; Gilbert, Andrew; Guneratne Bryer, Arlo; Hall, Geoffrey; Hatherell, Zoe; Hays, Jonathan; Iles, Gregory; Jarvis, Martyn; Karapostoli, Georgia; Lyons, Louis; Magnan, Anne-Marie; Marrouche, Jad; Mathias, Bryn; Nandi, Robin; Nash, Jordan; Nikitenko, Alexander; Papageorgiou, Anastasios; Pela, Joao; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rogerson, Samuel; Rose, Andrew; Ryan, Matthew John; Seez, Christopher; Sharp, Peter; Sparrow, Alex; Stoye, Markus; Tapper, Alexander; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardle, Nicholas; Whyntie, Tom; Chadwick, Matthew; Cole, Joanne; Hobson, Peter R; Khan, Akram; Kyberd, Paul; Leggat, Duncan; Leslie, Dawn; Martin, William; Reid, Ivan; Symonds, Philip; Teodorescu, Liliana; Turner, Mark; Hatakeyama, Kenichi; Liu, Hongxuan; Scarborough, Tara; Charaf, Otman; Henderson, Conor; Rumerio, Paolo; Avetisyan, Aram; Bose, Tulika; Fantasia, Cory; Heister, Arno; St John, Jason; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sperka, David; Sulak, Lawrence; Alimena, Juliette; Bhattacharya, Saptaparna; Cutts, David; Ferapontov, Alexey; Heintz, Ulrich; Jabeen, Shabnam; Kukartsev, Gennadiy; Laird, Edward; Landsberg, Greg; Luk, Michael; Narain, Meenakshi; Nguyen, Duong; Segala, Michael; Sinthuprasith, Tutanon; Speer, Thomas; Tsang, Ka Vang; Breedon, Richard; Breto, Guillermo; Calderon De La Barca Sanchez, Manuel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Conway, Rylan; Cox, Peter Timothy; Dolen, James; Erbacher, Robin; Gardner, Michael; Houtz, Rachel; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Miceli, Tia; Pellett, Dave; Rutherford, Britney; Searle, Matthew; Smith, John; Squires, Michael; Tripathi, Mani; Vasquez Sierra, Ricardo; Andreev, Valeri; Cline, David; Cousins, Robert; Duris, Joseph; Erhan, Samim; Everaerts, Pieter; Farrell, Chris; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Plager, Charles; Rakness, Gregory; Schlein, Peter; Tucker, Jordan; Valuev, Vyacheslav; Weber, Matthias; Babb, John; Clare, Robert; Dinardo, Mauro Emanuele; Ellison, John Anthony; Gary, J William; Giordano, Ferdinando; Hanson, Gail; Jeng, Geng-Yuan; Liu, Hongliang; Long, Owen Rosser; Luthra, Arun; Nguyen, Harold; Paramesvaran, Sudarshan; Sturdy, Jared; Sumowidagdo, Suharyo; Wilken, Rachel; Wimpenny, Stephen; Andrews, Warren; Branson, James G; Cerati, Giuseppe Benedetto; Cittolin, Sergio; Evans, David; Golf, Frank; Holzner, André; Kelley, Ryan; Lebourgeois, Matthew; Letts, James; Macneill, Ian; Mangano, Boris; Padhi, Sanjay; Palmer, Christopher; Petrucciani, Giovanni; Pieri, Marco; Sani, Matteo; Sharma, Vivek; Simon, Sean; Sudano, Elizabeth; Tadel, Matevz; Tu, Yanjun; Vartak, Adish; Wasserbaech, Steven; Würthwein, Frank; Yagil, Avraham; Yoo, Jaehyeok; Barge, Derek; Bellan, Riccardo; Campagnari, Claudio; D'Alfonso, Mariarosaria; Danielson, Thomas; Flowers, Kristen; Geffert, Paul; Incandela, Joe; Justus, Christopher; Kalavase, Puneeth; Koay, Sue Ann; Kovalskyi, Dmytro; Krutelyov, Vyacheslav; Lowette, Steven; Mccoll, Nickolas; Pavlunin, Viktor; Rebassoo, Finn; Ribnik, Jacob; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; West, Christopher; Apresyan, Artur; Bornheim, Adolf; Chen, Yi; Di Marco, Emanuele; Duarte, Javier; Gataullin, Marat; Ma, Yousi; Mott, Alexander; Newman, Harvey B; Rogan, Christopher; Timciuc, Vladlen; Traczyk, Piotr; Veverka, Jan; Wilkinson, Richard; Yang, Yong; Zhu, Ren-Yuan; Akgun, Bora; Carroll, Ryan; Ferguson, Thomas; Iiyama, Yutaro; Jang, Dong Wook; Liu, Yueh-Feng; Paulini, Manfred; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Drell, Brian Robert; Edelmaier, Christopher; Ford, William T; Gaz, Alessandro; Heyburn, Bernadette; Luiggi Lopez, Eduardo; Smith, James; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Alexander, James; Chatterjee, Avishek; Eggert, Nicholas; Gibbons, Lawrence Kent; Heltsley, Brian; Khukhunaishvili, Aleko; Kreis, Benjamin; Mirman, Nathan; Nicolas Kaufman, Gala; Patterson, Juliet Ritchie; Ryd, Anders; Salvati, Emmanuele; Sun, Werner; Teo, Wee Don; Thom, Julia; Thompson, Joshua; Vaughan, Jennifer; Weng, Yao; Winstrom, Lucas; Wittich, Peter; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Anderson, Jacob; Bauerdick, Lothar AT; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C; Bloch, Ingo; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gao, Yanyan; Green, Dan; Gutsche, Oliver; Hanlon, Jim; Harris, Robert M; Hirschauer, James; Hooberman, Benjamin; Jindariani, Sergo; Johnson, Marvin; Joshi, Umesh; Kilminster, Benjamin; Klima, Boaz; Kunori, Shuichi; Kwan, Simon; Leonidopoulos, Christos; Lincoln, Don; Lipton, Ron; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Maruyama, Sho; Mason, David; McBride, Patricia; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Newman-Holmes, Catherine; O'Dell, Vivian; Prokofyev, Oleg; Sexton-Kennedy, Elizabeth; Sharma, Seema; Spalding, William J; Spiegel, Leonard; Tan, Ping; Taylor, Lucas; Tkaczyk, Slawek; Tran, Nhan Viet; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yang, Fan; Yumiceva, Francisco; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Chen, Mingshui; Das, Souvik; De Gruttola, Michele; Di Giovanni, Gian Piero; Dobur, Didar; Drozdetskiy, Alexey; Field, Richard D; Fisher, Matthew; Fu, Yu; Furic, Ivan-Kresimir; Gartner, Joseph; Hugon, Justin; Kim, Bockjoo; Konigsberg, Jacobo; Korytov, Andrey; Kropivnitskaya, Anna; Kypreos, Theodore; Low, Jia Fu; Matchev, Konstantin; Milenovic, Predrag; Mitselmakher, Guenakh; Muniz, Lana; Remington, Ronald; Rinkevicius, Aurelijus; Sellers, Paul; Skhirtladze, Nikoloz; Snowball, Matthew; Yelton, John; Zakaria, Mohammed; Gaultney, Vanessa; Lebolo, Luis Miguel; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Adams, Jordon Rowe; Adams, Todd; Askew, Andrew; Bochenek, Joseph; Chen, Jie; Diamond, Brendan; Gleyzer, Sergei V; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Jenkins, Merrill; Johnson, Kurtis F; Prosper, Harrison; Veeraraghavan, Venkatesh; Weinberg, Marc; Baarmand, Marc M; Dorney, Brian; Hohlmann, Marcus; Kalakhety, Himali; Vodopiyanov, Igor; Adams, Mark Raymond; Anghel, Ioana Maria; Apanasevich, Leonard; Bai, Yuting; Bazterra, Victor Eduardo; Betts, Russell Richard; Bucinskaite, Inga; Callner, Jeremy; Cavanaugh, Richard; Dragoiu, Cosmin; Evdokimov, Olga; Gauthier, Lucie; Gerber, Cecilia Elena; Hofman, David Jonathan; Khalatyan, Samvel; Lacroix, Florent; Malek, Magdalena; O'Brien, Christine; Silkworth, Christopher; Strom, Derek; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Clarida, Warren; Duru, Firdevs; Griffiths, Scott; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Newsom, Charles Ray; Norbeck, Edwin; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Tiras, Emrah; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bolognesi, Sara; Fehling, David; Giurgiu, Gavril; Gritsan, Andrei; Guo, Zijin; Hu, Guofan; Maksimovic, Petar; Rappoccio, Salvatore; Swartz, Morris; Whitbeck, Andrew; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Grachov, Oleg; Kenny Iii, Raymond Patrick; Murray, Michael; Noonan, Daniel; Sanders, Stephen; Stringer, Robert; Tinti, Gemma; Wood, Jeffrey Scott; Zhukova, Victoria; Barfuss, Anne-Fleur; Bolton, Tim; Chakaberia, Irakli; Ivanov, Andrew; Khalil, Sadia; Makouski, Mikhail; Maravin, Yurii; Shrestha, Shruti; Svintradze, Irakli; Gronberg, Jeffrey; Lange, David; Wright, Douglas; Baden, Drew; Boutemeur, Madjid; Calvert, Brian; Eno, Sarah Catherine; Gomez, Jaime; Hadley, Nicholas John; Kellogg, Richard G; Kirn, Malina; Kolberg, Ted; Lu, Ying; Marionneau, Matthieu; Mignerey, Alice; Pedro, Kevin; Peterman, Alison; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C; Twedt, Elizabeth; Bauer, Gerry; Bendavid, Joshua; Busza, Wit; Butz, Erik; Cali, Ivan Amos; Chan, Matthew; Dutta, Valentina; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hahn, Kristan Allan; Kim, Yongsun; Klute, Markus; Krajczar, Krisztian; Li, Wei; Luckey, Paul David; Ma, Teng; Nahn, Steve; Paus, Christoph; Ralph, Duncan; Roland, Christof; Roland, Gunther; Rudolph, Matthew; Stephans, George; Stöckli, Fabian; Sumorok, Konstanty; Sung, Kevin; Velicanu, Dragos; Wenger, Edward Allen; Wolf, Roger; Wyslouch, Bolek; Xie, Si; Yang, Mingming; Yilmaz, Yetkin; Yoon, Sungho; Zanetti, Marco; Cooper, Seth; Dahmes, Bryan; De Benedetti, Abraham; Franzoni, Giovanni; Gude, Alexander; Kao, Shih-Chuan; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Pastika, Nathaniel; Rusack, Roger; Sasseville, Michael; Singovsky, Alexander; Tambe, Norbert; Turkewitz, Jared; Cremaldi, Lucien Marcus; Kroeger, Rob; Perera, Lalith; Rahmat, Rahmat; Sanders, David A; Avdeeva, Ekaterina; Bloom, Kenneth; Bose, Suvadeep; Butt, Jamila; Claes, Daniel R; Dominguez, Aaron; Eads, Michael; Keller, Jason; Kravchenko, Ilya; Lazo-Flores, Jose; Malbouisson, Helena; Malik, Sudhir; Snow, Gregory R; Baur, Ulrich; Godshalk, Andrew; Iashvili, Ia; Jain, Supriya; Kharchilava, Avto; Kumar, Ashish; Shipkowski, Simon Peter; Smith, Kenneth; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Chasco, Matthew; Haley, Joseph; Nash, David; Trocino, Daniele; Wood, Darien; Zhang, Jinzhong; Anastassov, Anton; Kubik, Andrew; Mucia, Nicholas; Odell, Nathaniel; Ofierzynski, Radoslaw Adrian; Pollack, Brian; Pozdnyakov, Andrey; Schmitt, Michael Henry; Stoynev, Stoyan; Velasco, Mayda; Won, Steven; Antonelli, Louis; Berry, Douglas; Brinkerhoff, Andrew; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Lannon, Kevin; Luo, Wuming; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Pearson, Tessa; Ruchti, Randy; Slaunwhite, Jason; Valls, Nil; Wayne, Mitchell; Wolf, Matthias; Bylsma, Ben; Durkin, Lloyd Stanley; Hart, Andrew; Hill, Christopher; Hughes, Richard; Kotov, Khristian; Ling, Ta-Yung; Puigh, Darren; Rodenburg, Marissa; Vuosalo, Carl; Williams, Grayson; Winer, Brian L; Adam, Nadia; Berry, Edmund; Elmer, Peter; Gerbaudo, Davide; Halyo, Valerie; Hebda, Philip; Hegeman, Jeroen; Hunt, Adam; Jindal, Pratima; Lopes Pegna, David; Lujan, Paul; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroué, Pierre; Quan, Xiaohang; Raval, Amita; Safdi, Ben; Saka, Halil; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zuranski, Andrzej; Acosta, Jhon Gabriel; Brownson, Eric; Huang, Xing Tao; Lopez, Angel; Mendez, Hector; Oliveros, Sandra; Ramirez Vargas, Juan Eduardo; Zatserklyaniy, Andriy; Alagoz, Enver; Barnes, Virgil E; Benedetti, Daniele; Bolla, Gino; Bortoletto, Daniela; De Mattia, Marco; Everett, Adam; Hu, Zhen; Jones, Matthew; Koybasi, Ozhan; Kress, Matthew; Laasanen, Alvin T; Leonardo, Nuno; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Shipsey, Ian; Silvers, David; Svyatkovskiy, Alexey; Vidal Marono, Miguel; Yoo, Hwi Dong; Zablocki, Jakub; Zheng, Yu; Guragain, Samir; Parashar, Neeti; Adair, Antony; Boulahouache, Chaouki; Ecklund, Karl Matthew; Geurts, Frank JM; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Zabel, James; Betchart, Burton; Bodek, Arie; Chung, Yeon Sei; Covarelli, Roberto; de Barbaro, Pawel; Demina, Regina; Eshaq, Yossof; Garcia-Bellido, Aran; Goldenzweig, Pablo; Han, Jiyeon; Harel, Amnon; Miner, Daniel Carl; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Ciesielski, Robert; Demortier, Luc; Goulianos, Konstantin; Lungu, Gheorghe; Malik, Sarah; Mesropian, Christina; Arora, Sanjay; Barker, Anthony; Chou, John Paul; Contreras-Campana, Christian; Contreras-Campana, Emmanuel; Duggan, Daniel; Ferencek, Dinko; Gershtein, Yuri; Gray, Richard; Halkiadakis, Eva; Hidas, Dean; Lath, Amitabh; Panwalkar, Shruti; Park, Michael; Patel, Rishi; Rekovic, Vladimir; Robles, Jorge; Rose, Keith; Salur, Sevil; Schnetzer, Steve; Seitz, Claudia; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Cerizza, Giordano; Hollingsworth, Matthew; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Eusebi, Ricardo; Flanagan, Will; Gilmore, Jason; Kamon, Teruki; Khotilovich, Vadim; Montalvo, Roy; Osipenkov, Ilya; Pakhotin, Yuriy; Perloff, Alexx; Roe, Jeffrey; Safonov, Alexei; Sakuma, Tai; Sengupta, Sinjini; Suarez, Indara; Tatarinov, Aysen; Toback, David; Akchurin, Nural; Damgov, Jordan; Dudero, Phillip Russell; Jeong, Chiyoung; Kovitanggoon, Kittikul; Lee, Sung Won; Libeiro, Terence; Roh, Youn; Volobouev, Igor; Appelt, Eric; Florez, Carlos; Greene, Senta; Gurrola, Alfredo; Johns, Willard; Johnston, Cody; Kurt, Pelin; Maguire, Charles; Melo, Andrew; Sheldon, Paul; Snook, Benjamin; Tuo, Shengquan; Velkovska, Julia; Arenton, Michael Wayne; Balazs, Michael; Boutle, Sarah; Cox, Bradley; Francis, Brian; Goodell, Joseph; Hirosky, Robert; Ledovskoy, Alexander; Lin, Chuanzhe; Neu, Christopher; Wood, John; Yohay, Rachel; Gollapinni, Sowjanya; Harr, Robert; Karchin, Paul Edmund; Kottachchi Kankanamge Don, Chamath; Lamichhane, Pramod; Sakharov, Alexandre; Anderson, Michael; Bachtis, Michail; Belknap, Donald; Borrello, Laura; Carlsmith, Duncan; Cepeda, Maria; Dasu, Sridhara; Gray, Lindsey; Grogg, Kira Suzanne; Grothe, Monika; Hall-Wilton, Richard; Herndon, Matthew; Hervé, Alain; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Lazaridis, Christos; Leonard, Jessica; Loveless, Richard; Mohapatra, Ajit; Ojalvo, Isabel; Palmonari, Francesco; Pierro, Giuseppe Antonio; Ross, Ian; Savin, Alexander; Smith, Wesley H; Swanson, Joshua

    2013-07-16

    A search is presented for charge-asymmetric production of a W' boson that has been proposed to accommodate the forward-backward asymmetry observed in the production of top-antitop quark pairs at the Tevatron. The new heavy W' boson would be produced in association with a top quark and would decay into top and down quarks. The data correspond to an integrated luminosity of 5.0 inverse femtobarns in pp collisions at a center-of-mass energy of 7 TeV, recorded by the CMS detector at the LHC. No significant excess above the standard model expectations is observed, and, from a combination of the electron-plus-jets and muon-plus-jets channels, a lower limit of 840 GeV/c$^2$ is set on the W' boson mass at the 95% confidence level.

  4. Restricting wolves risks escape

    Science.gov (United States)

    Mech, L. David; Ballard, Warren; Bangs, Ed; Ream, Bob

    2010-01-01

    Implementing the proposal set forth by Licht and colleagues (BioScience 60: 147–153) requires restricting wolves to tiny "islands," areas that are magnitudes smaller than the ranges of most wolf populations. Wolves naturally have large ranges; restricting their spatial needs increases the risk of wolves escaping, exacerbating public relations and political and legal problems.

  5. Measurement of the charge asymmetry in top-quark pair production in proton-proton collisions at sqrt(s) = 7 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Chatrchyan, Serguei; Khachatryan, Vardan; Sirunyan, Albert M.; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Erö, Janos; Fabjan, Christian; Friedl, Markus; Fruehwirth, Rudolf; /Yerevan Phys. Inst. /Vienna, OAW /Minsk, High Energy Phys. Ctr. /Antwerp U., WISINF /Vrije U., Brussels /Brussels U. /Gent U. /Louvain U. /UMH, Mons /Rio de Janeiro, CBPF /Rio de Janeiro State U.

    2011-12-01

    The difference in angular distributions between top quarks and antiquarks, commonly referred to as the charge asymmetry, is measured in pp collisions at the LHC with the CMS experiment. The data sample corresponds to an integrated luminosity of 1.09 fb{sup -1} at a centre-of-mass energy of 7 TeV. Top-quark pairs are selected in the final state with an electron or muon and four or more jets. At least one jet is identified as originating from b-quark hadronization. The charge asymmetry is measured in two variables, one based on the pseudorapidities ({eta}) of the top quarks and the other on their rapidities (y). The results A{sub C}{sup {eta}} = -0.017 {+-} 0.032(stat.){sub -0.036}{sup +0.025}(syst.) and A{sub C}{sup y} = -0.013 {+-} 0.028(stat.){sub -0.031}{sup +0.029}(syst.) are consistent within uncertainties with the standard-model predictions.

  6. Radiative corrections to the charged pion-pair production process {pi}{sup -}{gamma} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup -} at low energies

    Energy Technology Data Exchange (ETDEWEB)

    Kaiser, N.; Petschauer, S. [Technische Universitaet Muenchen, Physik-Department T39, Garching (Germany)

    2013-12-15

    We calculate the one-photon loop radiative corrections to the charged pion-pair production process {pi}{sup -}{gamma} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup -}. In the low-energy region this reaction is governed by the chiral pion-pion interaction. The pertinent set of 42 irreducible photon-loop diagrams is calculated by using the package FeynCalc. Electromagnetic counterterms with two independent low-energy constants k{sub 1} and k{sub 2} are included in order to remove the ultraviolet divergences generated by the photon loops. Infrared finiteness of the virtual radiative corrections is achieved by including soft photon radiation below an energy cut-off {Lambda}. The purely electromagnetic interaction of the charged pions mediated by one-photon exchange is also taken into account. The radiative corrections to the total cross section (in the isospin limit) vary between +10% close to threshold and about -1% at a center-of-mass energy of 7m{sub {pi}}. The largest contribution comes from the simple one-photon exchange. Radiative corrections to the {pi}{sup +}{pi}{sup -} and {pi}{sup -}{pi}{sup -} mass spectra are studied as well. The Coulomb singularity of the final-state interaction produces a kink in the dipion mass spectra. The virtual radiative corrections to elastic {pi}{sup -}{pi}{sup -} scattering are derived additionally. (orig.)

  7. Measurement of the top quark pair production charge asymmetry in proton–proton collisions at √ s = 7 TeV using the ATLAS detector

    CERN Document Server

    Aad, Georges; Abbott, Brad; Abdallah, Jalal; Abdel Khalek, Samah; Abdinov, Ovsat; Aben, Rosemarie; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Addy, Tetteh; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Aefsky, Scott; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Ahlen, Steven; Ahmad, Ashfaq; Ahmadov, Faig; Aielli, Giulio; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alam, Muhammad Aftab; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alessandria, Franco; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Aliev, Malik; Alimonti, Gianluca; Alio, Lion; Alison, John; Allbrooke, Benedict; Allison, Lee John; Allport, Phillip; Allwood-Spiers, Sarah; Almond, John; Aloisio, Alberto; Alon, Raz; Alonso, Alejandro; Alonso, Francisco; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Ammosov, Vladimir; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Anduaga, Xabier; Angelidakis, Stylianos; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Arce, Ayana; Arfaoui, Samir; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Engin; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ask, Stefan; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Astbury, Alan; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Auge, Etienne; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Azuelos, Georges; Azuma, Yuya; Baak, Max; Bacci, Cesare; Bach, Andre; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Backus Mayes, John; Badescu, Elisabeta; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bailey, David; Bain, Travis; Baines, John; Baker, Oliver Keith; Baker, Sarah; Balek, Petr; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Banfi, Danilo; Bangert, Andrea Michelle; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barber, Tom; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Bardin, Dmitri; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartsch, Valeria; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batkova, Lucia; Batley, Richard; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Sebastian; Beckingham, Matthew; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Katharina; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belloni, Alberto; Beloborodova, Olga; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Berglund, Elina; Beringer, Jürg; Bernard, Clare; Bernat, Pauline; Bernhard, Ralf; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertolucci, Federico; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia, Olga; Besson, Nathalie; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Bittner, Bernhard; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blocki, Jacek; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Boddy, Christopher Richard; Boehler, Michael; Boek, Jennifer; Boek, Thorsten Tobias; Boelaert, Nele; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Bohm, Jan; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bolnet, Nayanka Myriam; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Bordoni, Stefania; Borer, Claudia; Borisov, Anatoly; Borissov, Guennadi; Borri, Marcello; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Bouchami, Jihene; Boudreau, Joseph; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boutouil, Sara; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozovic-Jelisavcic, Ivanka; Bracinik, Juraj; Branchini, Paolo; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Brelier, Bertrand; Brendlinger, Kurt; Brenner, Richard; Bressler, Shikma; Bristow, Timothy Michael; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Broggi, Francesco; Bromberg, Carl; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Brown, Gareth; Brown, Jonathan; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchanan, James; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Budick, Burton; Buehrer, Felix; Bugge, Lars; Bulekov, Oleg; Bundock, Aaron Colin; Bunse, Moritz; Burckhart, Helfried; Burdin, Sergey; Burgess, Thomas; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Volker; Bussey, Peter; Buszello, Claus-Peter; Butler, Bart; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Buttinger, William; Buzatu, Adrian; Byszewski, Marcin; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Caloi, Rita; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarri, Paolo; Cameron, David; Caminada, Lea Michaela; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Canale, Vincenzo; Canelli, Florencia; Canepa, Anadi; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Antony; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Caso, Carlo; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caughron, Seth; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chan, Kevin; Chang, Philip; Chapleau, Bertrand; Chapman, John Derek; Charfeddine, Driss; Charlton, Dave; Chavda, Vikash; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Shenjian; Chen, Xin; Chen, Yujiao; Cheng, Yangyang; Cheplakov, Alexander; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiefari, Giovanni; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Choudalakis, Georgios; Chouridou, Sofia; Chow, Bonnie Kar Bo; Christidi, Ilektra-Athanasia; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Ciapetti, Guido; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciocio, Alessandra; Cirilli, Manuela; Cirkovic, Predrag; Citron, Zvi Hirsh; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clemens, Jean-Claude; Clement, Benoit; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coelli, Simone; Coffey, Laurel; Cogan, Joshua Godfrey; Coggeshall, James; Colas, Jacques; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collins-Tooth, Christopher; Collot, Johann; Colombo, Tommaso; Colon, German; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cooper-Smith, Neil; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Côté, David; Cottin, Giovanna; Courneyea, Lorraine; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Crispin Ortuzar, Mireia; Cristinziani, Markus; Crosetti, Giovanni; Cuciuc, Constantin-Mihai; Cuenca Almenar, Cristóbal; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; D'Orazio, Alessia; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Damiani, Daniel; Daniells, Andrew Christopher; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darlea, Georgiana Lavinia; Darmora, Smita; Dassoulas, James; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davignon, Olivier; Davison, Adam; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; de Graat, Julien; De Groot, Nicolo; de Jong, Paul; De La Taille, Christophe; De la Torre, Hector; De Lorenzi, Francesco; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; De Zorzi, Guido; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dechenaux, Benjamin; Dedovich, Dmitri; Degenhardt, James; Del Peso, Jose; Del Prete, Tarcisio; Delemontex, Thomas; Deliot, Frederic; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Demirkoz, Bilge; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deviveiros, Pier-Olivier; Dewhurst, Alastair; DeWilde, Burton; Dhaliwal, Saminder; Dhullipudi, Ramasudhakar; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dindar Yagci, Kamile; Dingfelder, Jochen; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Barros do Vale, Maria Aline; Do Valle Wemans, André; Doan, Thi Kieu Oanh; Dobos, Daniel; Dobson, Ellie; Dodd, Jeremy; Doglioni, Caterina; Doherty, Tom; Dohmae, Takeshi; Doi, Yoshikuni; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dos Anjos, Andre; Dotti, Andrea; Dova, Maria-Teresa; Doyle, Tony; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Dudziak, Fanny; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Dwuznik, Michal; Ebke, Johannes; Edson, William; Edwards, Clive; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Eisenhandler, Eric; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Katherine; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Engelmann, Roderich; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Espinal Curull, Xavier; Esposito, Bellisario; Etienne, Francois; Etienvre, Anne-Isabelle; Etzion, Erez; Evangelakou, Despoina; Evans, Hal; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Fatholahzadeh, Baharak; Favareto, Andrea; Fayard, Louis; Federic, Pavol; Fedin, Oleg; Fedorko, Wojciech; Fehling-Kaschek, Mirjam; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Fernando, Waruna; Ferrag, Samir; Ferrando, James; Ferrara, Valentina; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Julia; Fisher, Matthew; Fitzgerald, Eric Andrew; Flechl, Martin; Fleck, Ivor; Fleischmann, Philipp; Fleischmann, Sebastian; Fletcher, Gareth Thomas; Fletcher, Gregory; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Florez Bustos, Andres Carlos; Flowerdew, Michael; Fonseca Martin, Teresa; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Fournier, Daniel; Fox, Harald; Francavilla, Paolo; Franchini, Matteo; Franchino, Silvia; Francis, David; Franklin, Melissa; Franz, Sebastien; Fraternali, Marco; Fratina, Sasa; French, Sky; Friedrich, Conrad; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gadatsch, Stefan; Gadfort, Thomas; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gandrajula, Reddy Pratap; Gao, Jun; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Stephen; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gillman, Tony; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Francesco Michelangelo; Giovannini, Paola; Giraud, Pierre-Francois; Giugni, Danilo; Giuliani, Claudia; Giunta, Michele; Gjelsten, Børge Kile; Gkialas, Ioannis; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glazov, Alexandre; Glonti, George; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godfrey, Jennifer; Godlewski, Jan; Goeringer, Christian; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez Silva, Laura; Gonzalez-Sevilla, Sergio; Goodson, Jeremiah Jet; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorfine, Grant; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Gough Eschrich, Ivo; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Francesco; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Gray, Heather; Gray, Julia Ann; Graziani, Enrico; Grebenyuk, Oleg; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grigalashvili, Nugzar; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Groth-Jensen, Jacob; Grout, Zara Jane; Grybel, Kai; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guicheney, Christophe; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Gunther, Jaroslav; Guo, Jun; Gupta, Shaun; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guttman, Nir; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haefner, Petra; Hageboeck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Hall, David; Halladjian, Garabed; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Handel, Carsten; Hanke, Paul; Hansen, John Renner; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hansson, Per; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Paul Fraser; Hartjes, Fred; Harvey, Alex; Hasegawa, Satoshi; Hasegawa, Yoji; Hassani, Samira; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heinemann, Beate; Heisterkamp, Simon; Hejbal, Jiri; Helary, Louis; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Hensel, Carsten; Herbert, Geoffrey Henry; Medina Hernandez, Carlos; Hernández Jiménez, Yesenia; Herrberg-Schubert, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, John; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoffman, Julia; Hoffmann, Dirk; Hofmann, Julia Isabell; Hohlfeld, Marc; Holmgren, Sven-Olof; Hong, Tae Min; Hooft van Huysduynen, Loek; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huettmann, Antje; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Hurwitz, Martina; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Idarraga, John; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Iliadis, Dimitrios; Ilic, Nikolina; Inamaru, Yuki; Ince, Tayfun; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Ivashin, Anton; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, John; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansen, Hendrik; Janssen, Jens; Janus, Michel; Jared, Richard; Jarlskog, Göran; Jeanty, Laura; Jeng, Geng-yuan; Jen-La Plante, Imai; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Jha, Manoj Kumar; Ji, Haoshuang; Ji, Weina; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Joffe, David; Johansson, Erik; Johansson, Per; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jung, Christian; Jungst, Ralph Markus; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kadlecik, Peter; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kajomovitz, Enrique; Kalinin, Sergey; Kama, Sami; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kanno, Takayuki; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karastathis, Nikolaos; Karnevskiy, Mikhail; Karpov, Sergey; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Katre, Akshay; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Keener, Paul; Kehoe, Robert; Keil, Markus; Keller, John; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharchenko, Dmitri; Khodinov, Alexander; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hyeon Jin; Kim, Shinhong; Kimura, Naoki; Kind, Oliver; King, Barry; King, Matthew; King, Robert Steven Beaufoy; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kitamura, Takumi; Kittelmann, Thomas; Kiuchi, Kenji; Kladiva, Eduard; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klinkby, Esben; Klioutchnikova, Tatiana; Klok, Peter; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Ko, Byeong Rok; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koenig, Sebastian; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Koletsou, Iro; Koll, James; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Köneke, Karsten; König, Adriaan; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotov, Sergey; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Nina; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuhl, Thorsten; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurata, Masakazu; Kurochkin, Yurii; Kurumida, Rie; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwee, Regina; La Rosa, Alessandro; La Rotonda, Laura; Labarga, Luis; Lablak, Said; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laier, Heiko; Laisne, Emmanuel; Lambourne, Luke; Lampen, Caleb; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lange, Clemens; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Lanza, Agostino; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Larner, Aimee; Lassnig, Mario; Laurelli, Paolo; Lavorini, Vincenzo; Lavrijsen, Wim; Laycock, Paul; Le, Bao Tran; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legendre, Marie; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmacher, Marc; Lehmann Miotto, Giovanna; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Lendermann, Victor; Leney, Katharine; Lenz, Tatiana; Lenzen, Georg; Lenzi, Bruno; Leone, Robert; Leonhardt, Kathrin; Leontsinis, Stefanos; Leroy, Claude; Lessard, Jean-Raphael; Lester, Christopher; Lester, Christopher Michael; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Bo; Li, Haifeng; Li, Ho Ling; Li, Shu; Li, Xuefei; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Limper, Maaike; Lin, Simon; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loddenkoetter, Thomas; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loginov, Andrey; Loh, Chang Wei; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Lombardo, Vincenzo Paolo; Long, Jonathan; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Losty, Michael; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Feng; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Ludwig, Dörthe; Ludwig, Inga; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lund, Esben; Lundberg, Johan; Lundberg, Olof; Lund-Jensen, Bengt; Lungwitz, Matthias; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Maček, Boštjan; Machado Miguens, Joana; Macina, Daniela; Mackeprang, Rasmus; Madar, Romain; Madaras, Ronald; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeno, Mayuko; Maeno, Tadashi; Magnoni, Luca; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Mahmoud, Sara; Mahout, Gilles; Maiani, Camilla; Maidantchik, Carmen; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany Andreina; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchese, Fabrizio; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marques, Carlos; Marroquim, Fernando; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian; Martin, Brian Thomas; Martin, Jean-Pierre; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Homero; Martinez, Mario; Martin-Haugh, Stewart; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Matsunaga, Hiroyuki; Matsushita, Takashi; Mättig, Peter; Mättig, Stefan; Mattmann, Johannes; Mattravers, Carly; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazzaferro, Luca; Mazzanti, Marcello; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; Mclaughlan, Tom; McMahon, Steve; McPherson, Robert; Meade, Andrew; Mechnich, Joerg; Mechtel, Markus; Medinnis, Mike; Meehan, Samuel; Meera-Lebbai, Razzak; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mendoza Navas, Luis; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Meric, Nicolas; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Merritt, Hayes; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Meyer, Joerg; Michal, Sebastien; Middleton, Robin; Migas, Sylwia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Miller, David; Mills, Bill; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Miñano Moya, Mercedes; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Mitsui, Shingo; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Moeller, Victoria; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Molfetas, Angelos; Mönig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Mora Herrera, Clemencia; Moraes, Arthur; Morange, Nicolas; Morel, Julien; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Klemens; Mueller, Thibaut; Mueller, Timo; Muenstermann, Daniel; Munwes, Yonathan; Murillo Quijada, Javier Alberto; Murray, Bill; Mussche, Ido; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Nanava, Gizo; Napier, Austin; Narayan, Rohin; Nash, Michael; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Negri, Andrea; Negri, Guido; Negrini, Matteo; Nektarijevic, Snezana; Nelson, Andrew; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neusiedl, Andrea; Neves, Ricardo; Nevski, Pavel; Newcomer, Mitchel; Newman, Paul; Nguyen, Duong Hai; Nguyen Thi Hong, Van; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Norberg, Scarlet; Nordberg, Markus; Novakova, Jana; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nuncio-Quiroz, Adriana-Elizabeth; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakes, Louise Beth; Oakham, Gerald; Oberlack, Horst; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohshima, Takayoshi; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olchevski, Alexander; Olivares Pino, Sebastian Andres; Oliveira, Miguel Alfonso; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olivito, Dominick; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ottersbach, John; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Owen, Simon; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagan Griso, Simone; Paganis, Efstathios; Pahl, Christoph; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panduro Vazquez, William; Pani, Priscilla; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pashapour, Shabnaz; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pearce, James; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedraza Morales, Maria Isabel; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penson, Alexander; Penwell, John; Perepelitsa, Dennis; Perez Cavalcanti, Tiago; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrino, Roberto; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Jorgen; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Petteni, Michele; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Piec, Sebastian Marcin; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Pingel, Almut; Pinto, Belmiro; Pizio, Caterina; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Poddar, Sahill; Podlyski, Fabrice; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Pohl, Martin; Polesello, Giacomo; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pomeroy, Daniel; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Pospelov, Guennady; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Prabhu, Robindra; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Price, Darren; Price, Joe; Price, Lawrence; Prieur, Damien; Primavera, Margherita; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Prudent, Xavier; Przybycien, Mariusz; Przysiezniak, Helenka; Psoroulas, Serena; Ptacek, Elizabeth; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Pylypchenko, Yuriy; Qian, Jianming; Quadt, Arnulf; Quarrie, David; Quayle, William; Quilty, Donnchadha; Radeka, Veljko; Radescu, Voica; Radloff, Peter; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Rammes, Marcus; Randle-Conde, Aidan Sean; Rangel-Smith, Camila; Rao, Kanury; Rauscher, Felix; Rave, Tobias Christian; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Reinsch, Andreas; Reisinger, Ingo; Relich, Matthew; Rembser, Christoph; Ren, Zhongliang; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Resende, Bernardo; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Ridel, Melissa; Rieck, Patrick; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Rios, Ryan Randy; Ritsch, Elmar; Riu, Imma; Rivoltella, Giancesare; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Rocha de Lima, Jose Guilherme; Roda, Chiara; Roda Dos Santos, Denis; Rodrigues, Luis; Roe, Adam; Roe, Shaun; Røhne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romeo, Gaston; Romero Adam, Elena; Rompotis, Nikolaos; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Anthony; Rose, Matthew; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rumyantsev, Leonid; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Rutherfoord, John; Ruthmann, Nils; Ruzicka, Pavel; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Saddique, Asif; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvachua Ferrando, Belén; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarkisyan-Grinbaum, Edward; Sarrazin, Bjorn; Sartisohn, Georg; Sasaki, Osamu; Sasaki, Yuichi; Sasao, Noboru; Satsounkevitch, Igor; Sauvage, Gilles; Sauvan, Emmanuel; Sauvan, Jean-Baptiste; Savard, Pierre; Savinov, Vladimir; Savu, Dan Octavian; Sawyer, Craig; Sawyer, Lee; Saxon, David; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaelicke, Andreas; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R. Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Christopher; Schmitt, Sebastian; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schram, Malachi; Schramm, Steven; Schreyer, Manuel; Schroeder, Christian; Schroer, Nicolai; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwartzman, Ariel; Schwegler, Philipp; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scott, Bill; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekula, Stephen; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellers, Graham; Seman, Michal; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Seuster, Rolf; Severini, Horst; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shank, James; Shao, Qi Tao; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Sherwood, Peter; Shimizu, Shima; Shimojima, Makoto; Shin, Taeksu; Shiyakova, Mariya; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silbert, Ohad; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simoniello, Rosa; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skinnari, Louise Anastasia; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snow, Joel; Snyder, Scott; Sobie, Randall; Socher, Felix; Sodomka, Jaromir; Soffer, Abner; Soh, Dart-yin; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solfaroli Camillocci, Elena; Solodkov, Alexander; Solovyanov, Oleg; Solovyev, Victor; Soni, Nitesh; Sood, Alexander; Sopko, Vit; Sopko, Bruno; Sosebee, Mark; Soualah, Rachik; Soueid, Paul; Soukharev, Andrey; South, David; Spagnolo, Stefania; Spanò, Francesco; Spearman, William Robert; Spighi, Roberto; Spigo, Giancarlo; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Stahlman, Jonathan; Stamen, Rainer; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Stavina, Pavel; Steele, Genevieve; Steinbach, Peter; Steinberg, Peter; Stekl, Ivan; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoerig, Kathrin; Stoicea, Gabriel; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Stucci, Stefania Antonia; Stugu, Bjarne; Stumer, Iuliu; Stupak, John; Sturm, Philipp; Styles, Nicholas Adam; Su, Dong; Subramania, Halasya Siva; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Svatos, Michal; Swedish, Stephen; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takahashi, Yuta; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tamsett, Matthew; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanasijczuk, Andres Jorge; Tani, Kazutoshi; Tannoury, Nancy; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Christopher; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thoma, Sascha; Thomas, Juergen; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thong, Wai Meng; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tic, Tomáš; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Tonoyan, Arshak; Topilin, Nikolai; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Tran, Huong Lan; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Triplett, Nathan; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; True, Patrick; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsung, Jieh-Wen; Tsuno, Soshi; Tsybychev, Dmitri; Tua, Alan; Tudorache, Alexandra; Tudorache, Valentina; Tuggle, Joseph; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turk Cakir, Ilkay; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Uhlenbrock, Mathias; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Urbaniec, Dustin; Urquijo, Phillip; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Vahsen, Sven; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Berg, Richard; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; Van Der Leeuw, Robin; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; Vanadia, Marco; Vandelli, Wainer; Vaniachine, Alexandre; Vankov, Peter; Vannucci, Francois; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vassilakopoulos, Vassilios; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloso, Filipe; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Virzi, Joseph; Vitells, Ofer; Viti, Michele; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Adrian; Vokac, Petr; Volpi, Guido; Volpi, Matteo; Volpini, Giovanni; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Wolfgang; Wagner, Peter; Wahrmund, Sebastian; Wakabayashi, Jun; Walch, Shannon; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Walsh, Brian; Wang, Chiho; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Xiaoxiao; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watanabe, Ippei; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Anthony; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weigell, Philipp; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wendland, Dennis; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Werth, Michael; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Whittington, Denver; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilhelm, Ivan; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Eric; Williams, Hugh; Williams, Sarah; Willis, William; Willocq, Stephane; Wilson, John; Wilson, Alan; Wingerter-Seez, Isabelle; Winkelmann, Stefan; Winklmeier, Frank; Wittgen, Matthias; Wittig, Tobias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wong, Wei-Cheng; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wraight, Kenneth; Wright, Michael; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xu, Chao; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yamada, Miho; Yamaguchi, Hiroshi; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Un-Ki; Yang, Yi; Yang, Zhaoyu; Yanush, Serguei; Yao, Liwen; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yen, Andy L; Yildirim, Eda; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zaytsev, Alexander; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhang, Dongliang; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Lei; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Lei; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zibell, Andre; Zieminska, Daria; Zimin, Nikolai; Zimmermann, Christoph; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Zinonos, Zinonas; Ziolkowski, Michael; Zitoun, Robert; Živković, Lidija; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zutshi, Vishnu; Zwalinski, Lukasz

    2014-01-01

    This paper presents a measurement of the top quark pair ($t\\bar{t}$) production charge asymmetry $A_C$ using 4.7 fb−1 of proton-proton collisions at a centre-of-mass energy √s = 7 TeV collected by the ATLAS detector at the LHC. A $t\\bar{t}$ enriched sample of events with a single lepton (electron or muon), missing transverse momentum and at least four high transverse momentum jets, of which at least one is tagged as coming from a b–quark, is selected. A likelihood fit is used to reconstruct the $t\\bar{t}$ event kinematics. A Bayesian unfolding procedure is employed to estimate $A_C$ at the parton–level. The measured value of the $t\\bar{t}$ production charge asymmetry is $A_C$ = 0.006± 0.010, where the uncertainty includes both the statistical and the systematic components. Differential $A_C$ measurements as a function of the invariant mass, the rapidity and the transverse momentum of the $t\\bar{t}$-system are also presented. In addition, $A_C$ is measured for a subset of events with large $t\\bar{t}$...

  8. Charge imbalance

    International Nuclear Information System (INIS)

    Clarke, J.

    1981-01-01

    This article provides a long theoretical development of the main ideas of charge imbalance in superconductors. Concepts of charge imbalance and quasiparticle charge are introduced, especially in regards to the use of tunnel injection in producing and detecting charge imbalance. Various mechanisms of charge relaxation are discussed, including inelastic scattering processes, elastic scattering in the presence of energy-gap anisotropy, and various pair-breaking mechanisms. In each case, present theories are reviewed in comparison with experimental data

  9. The atmospheric escape at Mars: complementing the scenario

    Science.gov (United States)

    Lilensten, Jean; Simon, Cyril; Barthélémy, Mathieu; Thissen, Roland; Ehrenreich, David; Gronoff, Guillaume; Witasse, Olivier

    2013-04-01

    In the recent years, the presence of dications in the atmospheres of Mars, Venus, Earth and Titan has been modeled and assessed. These studies also suggested that these ions could participate to the escape of the planetary atmospheres because a large fraction of them is unstable and highly ener- getic. When they dissociate, their internal energy is transformed into kinetic energy which may be larger than the escape energy. This study assesses the impact of the doubly-charged ions in the escape of CO2-dominated planetary atmospheres and to compare it to the escape of thermal photo-ions.We solve a Boltzmann transport equation at daytime taking into account the dissociative states of CO++ for a simplified single constituent atmosphere of a 2 case-study planet. We compute the escape of fast ions using a Beer-Lambert approach. We study three test-cases. On a Mars-analog planet in today's conditions, we retrieve the measured electron escape flux. When comparing the two mechanisms (i.e. excluding solar wind effects, sputtering ...), the escape due to the fast ions issuing from the dissociation of dications may account for up to 6% of the total and the escape of thermal ions for the remaining. We show that these two mechanisms cannot explain the escape of the atmosphere since the magnetic field vanished but complement the other processes and allow writing the scenario of the Mars escape. We show that the atmosphere of a Mars analog planet would empty in another giga years and a half. At Venus orbit, the contribution of the dications in the escape rate is negligible.When simulating the hot Jupiter HD209458b, the two processes cannot explain the measured escape flux of C+.

  10. Top pair production cross-section measurement in the lepton+tau+jets+met channel in the D0 experiment and interpretation in terms of charged Higgs boson

    International Nuclear Information System (INIS)

    Lacroix, F.

    2008-12-01

    The standard model of particle physics describes the matter as elementary particles interacting via strong and electroweak interactions. The top quark is the heaviest quark described by this model and has been discovered in 1995 by CDF and D0 collaborations in proton-antiproton collisions at the Tevatron. This thesis is devoted to the measurement of the top pair production cross-section via the strong interaction, in a final state composed of one lepton, one hadronic tau, two b-jets and missing transverse energy. This analysis uses the 1,2 fb -1 of Run-IIb data collected between July 2006 and August 2007, combined with the Run-IIa data to obtain a 2,2 fb -1 analysis. One part of the work described here is devoted to the trigger system, which is the first part of any analysis, and in particular to the tau identification at the level 3 and the 'jets+met' triggers. The problematic of the jet energy resolution is also addressed with the η-intercalibration of the hadronic calorimeter and with the use of the central pre-shower detector in the jet energy definition. The top pair production cross-section obtained is: l + τ: σ(tt-bar) = (7.32 -1.24 +1.34 (stat) -1.06 +1.20 (syst) ± 0.45 (lumi)) pb. This measurement is in good agreement with the standard model predictions and can be used to restrain the possibilities of new physics, such as the existence of a charged Higgs boson lighter than the top quark. An exclusion limit has been obtained in the (tan(β), m H ± ) plan and is presented in the last part of this manuscript. (author)

  11. Measurement of the charge asymmetry in top quark pair production in $pp$ collisions at $\\sqrt{s}$ = 7 TeV using the ATLAS detector

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdelalim, Ahmed Ali; Abdesselam, Abdelouahab; Abdinov, Ovsat; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Acerbi, Emilio; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Addy, Tetteh; Adelman, Jahred; Aderholz, Michael; Adomeit, Stefanie; Adragna, Paolo; Adye, Tim; Aefsky, Scott; Aguilar-Saavedra, Juan Antonio; Aharrouche, Mohamed; Ahlen, Steven; Ahles, Florian; Ahmad, Ashfaq; Ahsan, Mahsana; Aielli, Giulio; Akdogan, Taylan; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Akiyama, Kunihiro; Alam, Mohammad; Alam, Muhammad Aftab; Albert, Justin; Albrand, Solveig; Aleksa, Martin; Aleksandrov, Igor; Alessandria, Franco; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Aliev, Malik; Alimonti, Gianluca; Alison, John; Aliyev, Magsud; Allport, Phillip; Allwood-Spiers, Sarah; Almond, John; Aloisio, Alberto; Alon, Raz; Alonso, Alejandro; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral, Pedro; Amelung, Christoph; Ammosov, Vladimir; Amorim, Antonio; Amorós, Gabriel; Amram, Nir; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Andrieux, Marie-Laure; Anduaga, Xabier; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoun, Sahar; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Arce, Ayana; Archambault, John-Paul; Arfaoui, Samir; Arguin, Jean-Francois; Arik, Engin; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnault, Christian; Artamonov, Andrei; Artoni, Giacomo; Arutinov, David; Asai, Shoji; Asfandiyarov, Ruslan; Ask, Stefan; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astbury, Alan; Astvatsatourov, Anatoli; Aubert, Bernard; Auge, Etienne; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Avramidou, Rachel Maria; Axen, David; Ay, Cano; Azuelos, Georges; Azuma, Yuya; Baak, Max; Baccaglioni, Giuseppe; Bacci, Cesare; Bach, Andre; Bachacou, Henri; Bachas, Konstantinos; Bachy, Gerard; Backes, Moritz; Backhaus, Malte; Badescu, Elisabeta; Bagnaia, Paolo; Bahinipati, Seema; Bai, Yu; Bailey, David; Bain, Travis; Baines, John; Baker, Oliver Keith; Baker, Mark; Baker, Sarah; Banas, Elzbieta; Banerjee, Piyali; Banerjee, Swagato; Banfi, Danilo; Bangert, Andrea Michelle; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barashkou, Andrei; Barbaro Galtieri, Angela; Barber, Tom; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Bardin, Dmitri; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Barrillon, Pierre; Bartoldus, Rainer; Barton, Adam Edward; Bartsch, Valeria; Bates, Richard; Batkova, Lucia; Batley, Richard; Battaglia, Andreas; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beale, Steven; Beare, Brian; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Sebastian; Beckingham, Matthew; Becks, Karl-Heinz; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Begel, Michael; Behar Harpaz, Silvia; Behera, Prafulla; Beimforde, Michael; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellina, Francesco; Bellomo, Massimiliano; Belloni, Alberto; Beloborodova, Olga; Belotskiy, Konstantin; Beltramello, Olga; Ben Ami, Sagi; Benary, Odette; Benchekroun, Driss; Benchouk, Chafik; Bendel, Markus; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Benoit, Mathieu; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Berglund, Elina; Beringer, Jürg; Bernat, Pauline; Bernhard, Ralf; Bernius, Catrin; Berry, Tracey; Bertella, Claudia; Bertin, Antonio; Bertinelli, Francesco; Bertolucci, Federico; Besana, Maria Ilaria; Besson, Nathalie; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Biscarat, Catherine; Bitenc, Urban; Black, Kevin; Blair, Robert; Blanchard, Jean-Baptiste; Blanchot, Georges; Blazek, Tomas; Blocker, Craig; Blocki, Jacek; Blondel, Alain; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Boddy, Christopher Richard; Boehler, Michael; Boek, Jennifer; Boelaert, Nele; Böser, Sebastian; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Bolnet, Nayanka Myriam; Bona, Marcella; Bondarenko, Valery; Bondioli, Mario; Boonekamp, Maarten; Boorman, Gary; Booth, Chris; Bordoni, Stefania; Borer, Claudia; Borisov, Anatoly; Borissov, Guennadi; Borjanovic, Iris; Borri, Marcello; Borroni, Sara; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Botterill, David; Bouchami, Jihene; Boudreau, Joseph; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozhko, Nikolay; Bozovic-Jelisavcic, Ivanka; Bracinik, Juraj; Braem, André; Branchini, Paolo; Brandenburg, George; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brelier, Bertrand; Bremer, Johan; Brenner, Richard; Bressler, Shikma; Breton, Dominique; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Brodbeck, Timothy; Brodet, Eyal; Broggi, Francesco; Bromberg, Carl; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, William; Brown, Gareth; Brown, Heather; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchanan, James; Buchanan, Norman; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Budick, Burton; Büscher, Volker; Bugge, Lars; Bulekov, Oleg; Bunse, Moritz; Buran, Torleiv; Burckhart, Helfried; Burdin, Sergey; Burgess, Thomas; Burke, Stephen; Busato, Emmanuel; Bussey, Peter; Buszello, Claus-Peter; Butin, François; Butler, Bart; Butler, John; Buttar, Craig; Butterworth, Jonathan; Buttinger, William; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Caloi, Rita; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarri, Paolo; Cambiaghi, Mario; Cameron, David; Caminada, Lea Michaela; Campana, Simone; Campanelli, Mario; Canale, Vincenzo; Canelli, Florencia; Canepa, Anadi; Cantero, Josu; Capasso, Luciano; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capriotti, Daniele; Capua, Marcella; Caputo, Regina; Caramarcu, Costin; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Bryan; Caron, Sascha; Carrillo Montoya, German D; Carter, Antony; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Cascella, Michele; Caso, Carlo; Castaneda Hernandez, Alfredo Martin; Castaneda-Miranda, Elizabeth; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Cataldi, Gabriella; Cataneo, Fernando; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caughron, Seth; Cauz, Diego; Cavalleri, Pietro; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cetin, Serkant Ali; Cevenini, Francesco; Chafaq, Aziz; Chakraborty, Dhiman; Chan, Kevin; Chapleau, Bertrand; Chapman, John Derek; Chapman, John Wehrley; Chareyre, Eve; Charlton, Dave; Chavda, Vikash; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Shenjian; Chen, Tingyang; Chen, Xin; Cheng, Shaochen; Cheplakov, Alexander; Chepurnov, Vladimir; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Cheung, Sing-Leung; Chevalier, Laurent; Chiefari, Giovanni; Chikovani, Leila; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chizhov, Mihail; Choudalakis, Georgios; Chouridou, Sofia; Christidi, Illectra-Athanasia; Christov, Asen; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Ciapetti, Guido; Ciba, Krzysztof; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciobotaru, Matei Dan; Ciocca, Claudia; Ciocio, Alessandra; Cirilli, Manuela; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Cleland, Bill; Clemens, Jean-Claude; Clement, Benoit; Clement, Christophe; Clifft, Roger; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coe, Paul; Cogan, Joshua Godfrey; Coggeshall, James; Cogneras, Eric; Colas, Jacques; Colijn, Auke-Pieter; Collins, Neil; Collins-Tooth, Christopher; Collot, Johann; Colon, German; Conde Muiño, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Consonni, Michele; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conventi, Francesco; Cook, James; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Costin, Tudor; Côté, David; Coura Torres, Rodrigo; Courneyea, Lorraine; Cowan, Glen; Cowden, Christopher; Cox, Brian; Cranmer, Kyle; Crescioli, Francesco; Cristinziani, Markus; Crosetti, Giovanni; Crupi, Roberto; Crépé-Renaudin, Sabine; Cuciuc, Constantin-Mihai; Cuenca Almenar, Cristóbal; Cuhadar Donszelmann, Tulay; Curatolo, Maria; Curtis, Chris; Cuthbert, Cameron; Cwetanski, Peter; Czirr, Hendrik; Czodrowski, Patrick; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; D'Orazio, Alessia; Da Silva, Paulo Vitor; Da Via, Cinzia; Dabrowski, Wladyslaw; Dai, Tiesheng; Dallapiccola, Carlo; Dam, Mogens; Dameri, Mauro; Damiani, Daniel; Danielsson, Hans Olof; Dannheim, Dominik; Dao, Valerio; Darbo, Giovanni; Darlea, Georgiana Lavinia; Daum, Cornelis; Davey, Will; Davidek, Tomas; Davidson, Nadia; Davidson, Ruth; Davies, Eleanor; Davies, Merlin; Davison, Adam; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Dawson, John; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Castro Faria Salgado, Pedro; De Cecco, Sandro; de Graat, Julien; De Groot, Nicolo; de Jong, Paul; De La Taille, Christophe; De la Torre, Hector; De Lotto, Barbara; de Mora, Lee; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dean, Simon; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dedovich, Dmitri; Degenhardt, James; Dehchar, Mohamed; Del Papa, Carlo; Del Peso, Jose; Del Prete, Tarcisio; Delemontex, Thomas; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delruelle, Nicolas; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demirkoz, Bilge; Deng, Jianrong; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Devetak, Erik; Deviveiros, Pier-Olivier; Dewhurst, Alastair; DeWilde, Burton; Dhaliwal, Saminder; Dhullipudi, Ramasudhakar; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Luise, Silvestro; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Diaz, Marco Aurelio; Diblen, Faruk; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dindar Yagci, Kamile; Dingfelder, Jochen; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Barros do Vale, Maria Aline; Do Valle Wemans, André; Doan, Thi Kieu Oanh; Dobbs, Matt; Dobinson, Robert; Dobos, Daniel; Dobson, Ellie; Dodd, Jeremy; Doglioni, Caterina; Doherty, Tom; Doi, Yoshikuni; Dolejsi, Jiri; Dolenc, Irena; Dolezal, Zdenek; Dolgoshein, Boris; Dohmae, Takeshi; Donadelli, Marisilvia; Donega, Mauro; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dos Anjos, Andre; Dosil, Mireia; Dotti, Andrea; Dova, Maria-Teresa; Dowell, John; Doxiadis, Alexander; Doyle, Tony; Drasal, Zbynek; Drees, Jürgen; Dressnandt, Nandor; Drevermann, Hans; Driouichi, Chafik; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Duchovni, Ehud; Duckeck, Guenter; Dudarev, Alexey; Dudziak, Fanny; Dührssen, Michael; Duerdoth, Ian; Duflot, Laurent; Dufour, Marc-Andre; Dunford, Monica; Duran Yildiz, Hatice; Duxfield, Robert; Dwuznik, Michal; Dydak, Friedrich; Düren, Michael; Ebenstein, William; Ebke, Johannes; Eckweiler, Sebastian; Edmonds, Keith; Edwards, Clive; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Ehrich, Thies; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Eisenhandler, Eric; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Katherine; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Engelmann, Roderich; Engl, Albert; Epp, Brigitte; Eppig, Andrew; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Escobar, Carlos; Espinal Curull, Xavier; Esposito, Bellisario; Etienne, Francois; Etienvre, Anne-Isabelle; Etzion, Erez; Evangelakou, Despoina; Evans, Hal; Fabbri, Laura; Fabre, Caroline; Fakhrutdinov, Rinat; Falciano, Speranza; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farley, Jason; Farooque, Trisha; Farrington, Sinead; Farthouat, Philippe; Fassnacht, Patrick; Fassouliotis, Dimitrios; Fatholahzadeh, Baharak; Favareto, Andrea; Fayard, Louis; Fazio, Salvatore; Febbraro, Renato; Federic, Pavol; Fedin, Oleg; Fedorko, Woiciech; Fehling-Kaschek, Mirjam; Feligioni, Lorenzo; Fellmann, Denis; Feng, Cunfeng; Feng, Eric; Fenyuk, Alexander; Ferencei, Jozef; Ferland, Jonathan; Fernando, Waruna; Ferrag, Samir; Ferrando, James; Ferrara, Valentina; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferrer, Antonio; Ferrer, Maria Lorenza; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filippas, Anastasios; Filthaut, Frank; Fincke-Keeler, Margret; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Gordon; Fischer, Peter; Fisher, Matthew; Flechl, Martin; Fleck, Ivor; Fleckner, Johanna; Fleischmann, Philipp; Fleischmann, Sebastian; Flick, Tobias; Flores Castillo, Luis; Flowerdew, Michael; Fokitis, Manolis; Fonseca Martin, Teresa; Forbush, David Alan; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Foster, Joe; Fournier, Daniel; Foussat, Arnaud; Fowler, Andrew; Fowler, Ken; Fox, Harald; Francavilla, Paolo; Franchino, Silvia; Francis, David; Frank, Tal; Franklin, Melissa; Franz, Sebastien; Fraternali, Marco; Fratina, Sasa; French, Sky; Friedrich, Felix; Froeschl, Robert; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gadfort, Thomas; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Gan, KK; Gao, Yongsheng; Gapienko, Vladimir; Gaponenko, Andrei; Garberson, Ford; Garcia-Sciveres, Maurice; García, Carmen; García Navarro, José Enrique; Gardner, Robert; Garelli, Nicoletta; Garitaonandia, Hegoi; Garonne, Vincent; Garvey, John; Gatti, Claudio; Gaudio, Gabriella; Gaumer, Olivier; Gaur, Bakul; Gauthier, Lea; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gayde, Jean-Christophe; Gazis, Evangelos; Ge, Peng; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerlach, Peter; Gershon, Avi; Geweniger, Christoph; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giakoumopoulou, Victoria; Giangiobbe, Vincent; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Adam; Gibson, Stephen; Gilbert, Laura; Gilewsky, Valentin; Gillberg, Dag; Gillman, Tony; Gingrich, Douglas; Ginzburg, Jonatan; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Francesco Michelangelo; Giovannini, Paola; Giraud, Pierre-Francois; Giugni, Danilo; Giunta, Michele; Giusti, Paolo; Gjelsten, Børge Kile; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glazov, Alexandre; Glitza, Karl-Walter; Glonti, George; Goddard, Jack Robert; Godfrey, Jennifer; Godlewski, Jan; Goebel, Martin; Göpfert, Thomas; Goeringer, Christian; Gössling, Claus; Göttfert, Tobias; Goldfarb, Steven; Golling, Tobias; Golovnia, Serguei; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; Gonidec, Allain; Gonzalez, Saul; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez Silva, Laura; Gonzalez-Sevilla, Sergio; Goodson, Jeremiah Jet; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorfine, Grant; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Gorokhov, Serguei; Goryachev, Vladimir; Gosdzik, Bjoern; Gosselink, Martijn; Gostkin, Mikhail Ivanovitch; Gough Eschrich, Ivo; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Grancagnolo, Francesco; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Grau, Nathan; Gray, Heather; Gray, Julia Ann; Graziani, Enrico; Grebenyuk, Oleg; Greenshaw, Timothy; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grigalashvili, Nugzar; Grillo, Alexander; Grinstein, Sebastian; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Groh, Manfred; Gross, Eilam; Grosse-Knetter, Joern; Groth-Jensen, Jacob; Grybel, Kai; Guarino, Victor; Guest, Daniel; Guicheney, Christophe; Guida, Angelo; Guindon, Stefan; Guler, Hulya; Gunther, Jaroslav; Guo, Bin; Guo, Jun; Gupta, Ambreesh; Gusakov, Yury; Gushchin, Vladimir; Gutierrez, Andrea; Gutierrez, Phillip; Guttman, Nir; Gutzwiller, Olivier; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haas, Stefan; Haber, Carl; Hadavand, Haleh Khani; Hadley, David; Haefner, Petra; Hahn, Ferdinand; Haider, Stefan; Hajduk, Zbigniew; Hakobyan, Hrachya; Hall, David; Haller, Johannes; Hamacher, Klaus; Hamal, Petr; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Han, Hongguang; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Handel, Carsten; Hanke, Paul; Hansen, John Renner; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hansson, Per; Hara, Kazuhiko; Hare, Gabriel; Harenberg, Torsten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Karl; Hartert, Jochen; Hartjes, Fred; Haruyama, Tomiyoshi; Harvey, Alex; Hasegawa, Satoshi; Hasegawa, Yoji; Hassani, Samira; Hatch, Mark; Hauff, Dieter; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawes, Brian; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hawkins, Donovan; Hayakawa, Takashi; Hayashi, Takayasu; Hayden, Daniel; Hayward, Helen; Haywood, Stephen; Hazen, Eric; He, Mao; Head, Simon; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heinemann, Beate; Heisterkamp, Simon; Helary, Louis; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, Robert; Henke, Michael; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Henry-Couannier, Frédéric; Hensel, Carsten; Henß, Tobias; Medina Hernandez, Carlos; Hernández Jiménez, Yesenia; Herrberg, Ruth; Hershenhorn, Alon David; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hessey, Nigel; Higón-Rodriguez, Emilio; Hill, Daniel; Hill, John; Hill, Norman; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirsch, Florian; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoffman, Julia; Hoffmann, Dirk; Hohlfeld, Marc; Holder, Martin; Holmgren, Sven-Olof; Holy, Tomas; Holzbauer, Jenny; Homma, Yasuhiro; Hong, Tae Min; Hooft van Huysduynen, Loek; Horazdovsky, Tomas; Horn, Claus; Horner, Stephan; Hostachy, Jean-Yves; Hou, Suen; Houlden, Michael; Hoummada, Abdeslam; Howarth, James; Howell, David; Hristova, Ivana; Hrivnac, Julius; Hruska, Ivan; Hryn'ova, Tetiana; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Huang, Guang Shun; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huettmann, Antje; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Hughes-Jones, Richard; Huhtinen, Mika; Hurst, Peter; Hurwitz, Martina; Husemann, Ulrich; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibbotson, Michael; Ibragimov, Iskander; Ichimiya, Ryo; Iconomidou-Fayard, Lydia; Idarraga, John; Iengo, Paolo; Igonkina, Olga; Ikegami, Yoichi; Ikeno, Masahiro; Ilchenko, Yuri; Iliadis, Dimitrios; Ilic, Nikolina; Imbault, Didier; Imori, Masatoshi; Ince, Tayfun; Inigo-Golfin, Joaquin; Ioannou, Pavlos; Iodice, Mauro; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishikawa, Akimasa; Ishino, Masaya; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Ivashin, Anton; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, John; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakubek, Jan; Jana, Dilip; Jankowski, Ernest; Jansen, Eric; Jansen, Hendrik; Jantsch, Andreas; Janus, Michel; Jarlskog, Göran; Jeanty, Laura; Jelen, Kazimierz; Jen-La Plante, Imai; Jenni, Peter; Jeremie, Andrea; Jež, Pavel; Jézéquel, Stéphane; Jha, Manoj Kumar; Ji, Haoshuang; Ji, Weina; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Ge; Jin, Shan; Jinnouchi, Osamu; Joergensen, Morten Dam; Joffe, David; Johansen, Lars; Johansen, Marianne; Johansson, Erik; Johansson, Per; Johnert, Sebastian; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tegid; Jones, Tim; Jonsson, Ove; Joram, Christian; Jorge, Pedro; Joseph, John; Jovin, Tatjana; Ju, Xiangyang; Jung, Christian; Jungst, Ralph Markus; Juranek, Vojtech; Jussel, Patrick; Juste Rozas, Aurelio; Kabachenko, Vasily; Kabana, Sonja; Kaci, Mohammed; Kaczmarska, Anna; Kadlecik, Peter; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kaiser, Steffen; Kajomovitz, Enrique; Kalinin, Sergey; Kalinovskaya, Lidia; Kama, Sami; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kanno, Takayuki; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kaplon, Jan; Kar, Deepak; Karagounis, Michael; Karagoz, Muge; Karnevskiy, Mikhail; Karr, Kristo; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Mayuko; Kataoka, Yousuke; Katsoufis, Elias; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kayl, Manuel; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Kehoe, Robert; Keil, Markus; Kekelidze, George; Kennedy, John; Kenney, Christopher John; Kenyon, Mike; Kepka, Oldrich; Kerschen, Nicolas; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharchenko, Dmitri; Khodinov, Alexander; Kholodenko, Anatoli; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Nikolai; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hyeon Jin; Kim, Min Suk; Kim, Peter; Kim, Shinhong; Kimura, Naoki; Kind, Oliver; King, Barry; King, Matthew; King, Robert Steven Beaufoy; Kirk, Julie; Kirsch, Lawrence; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kittelmann, Thomas; Kiver, Andrey; Kladiva, Eduard; Klaiber-Lodewigs, Jonas; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klemetti, Miika; Klier, Amit; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klinkby, Esben; Klioutchnikova, Tatiana; Klok, Peter; Klous, Sander; Kluge, Eike-Erik; Kluge, Thomas; Kluit, Peter; Kluth, Stefan; Knecht, Neil; Kneringer, Emmerich; Knobloch, Juergen; Knoops, Edith; Knue, Andrea; Ko, Byeong Rok; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Köneke, Karsten; König, Adriaan; Koenig, Sebastian; Köpke, Lutz; Koetsveld, Folkert; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohn, Fabian; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kokott, Thomas; Kolachev, Guennady; Kolanoski, Hermann; Kolesnikov, Vladimir; Koletsou, Iro; Koll, James; Kollar, Daniel; Kollefrath, Michael; Kolya, Scott; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kono, Takanori; Kononov, Anatoly; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kootz, Andreas; Koperny, Stefan; Korcyl, Krzysztof; Kordas, Kostantinos; Koreshev, Victor; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotamäki, Miikka Juhani; Kotov, Sergey; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, James; Kraus, Jana; Kreisel, Arik; Krejci, Frantisek; Kretzschmar, Jan; Krieger, Nina; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruth, Andre; Kubota, Takashi; Kuehn, Susanne; Kugel, Andreas; Kuhl, Thorsten; Kuhn, Dietmar; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kummer, Christian; Kuna, Marine; Kundu, Nikhil; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurata, Masakazu; Kurochkin, Yurii; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwee, Regina; La Rosa, Alessandro; La Rotonda, Laura; Labarga, Luis; Labbe, Julien; Lablak, Said; Lacasta, Carlos; Lacava, Francesco; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laisne, Emmanuel; Lamanna, Massimo; Lampen, Caleb; Lampl, Walter; Lancon, Eric; Landgraf, Ulrich; Landon, Murrough; Landsman, Hagar; Lane, Jenna; Lange, Clemens; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Larionov, Anatoly; Larner, Aimee; Lasseur, Christian; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Laycock, Paul; Lazarev, Alexandre; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Maner, Christophe; Le Menedeu, Eve; Lebel, Céline; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Michel; Legendre, Marie; Leger, Annie; LeGeyt, Benjamin; Legger, Federica; Leggett, Charles; Lehmacher, Marc; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Leltchouk, Mikhail; Lemmer, Boris; Lendermann, Victor; Leney, Katharine; Lenz, Tatiana; Lenzen, Georg; Lenzi, Bruno; Leonhardt, Kathrin; Leontsinis, Stefanos; Leroy, Claude; Lessard, Jean-Raphael; Lesser, Jonas; Lester, Christopher; Leung Fook Cheong, Annabelle; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levitski, Mikhail; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bo; Li, Haifeng; Li, Shu; Li, Xuefei; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lichtnecker, Markus; Lie, Ki; Liebig, Wolfgang; Lifshitz, Ronen; Limbach, Christian; Limosani, Antonio; Limper, Maaike; Lin, Simon; Linde, Frank; Linnemann, James; Lipeles, Elliot; Lipinsky, Lukas; Lipniacka, Anna; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Chuanlei; Liu, Dong; Liu, Hao; Liu, Jianbei; Liu, Minghui; Liu, Shengli; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loddenkoetter, Thomas; Loebinger, Fred; Loginov, Andrey; Loh, Chang Wei; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Loken, James; Lombardo, Vincenzo Paolo; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lorenz, Jeanette; Losada, Marta; Loscutoff, Peter; Lo Sterzo, Francesco; Losty, Michael; Lou, Xinchou; Lounis, Abdenour; Loureiro, Karina; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Feng; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Ludwig, Andreas; Ludwig, Dörthe; Ludwig, Inga; Ludwig, Jens; Luehring, Frederick; Luijckx, Guy; Lumb, Debra; Luminari, Lamberto; Lund, Esben; Lund-Jensen, Bengt; Lundberg, Björn; Lundberg, Johan; Lundquist, Johan; Lungwitz, Matthias; Lutz, Gerhard; Lynn, David; Lys, Jeremy; Lytken, Else; Ma, Hong; Ma, Lian Liang; Macana Goia, Jorge Andres; Maccarrone, Giovanni; Macchiolo, Anna; Maček, Boštjan; Machado Miguens, Joana; Mackeprang, Rasmus; Madaras, Ronald; Mader, Wolfgang; Maenner, Reinhard; Maeno, Tadashi; Mättig, Peter; Mättig, Stefan; Magnoni, Luca; Magradze, Erekle; Mahalalel, Yair; Mahboubi, Kambiz; Mahout, Gilles; Maiani, Camilla; Maidantchik, Carmen; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Malecki, Piotr; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mameghani, Raphael; Mamuzic, Judita; Manabe, Atsushi; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Mangeard, Pierre-Simon; Manhaes de Andrade Filho, Luciano; Manjavidze, Ioseb; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Manz, Andreas; Mapelli, Alessandro; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchese, Fabrizio; Marchiori, Giovanni; Marcisovsky, Michal; Marin, Alexandru; Marino, Christopher; Marroquim, Fernando; Marshall, Robin; Marshall, Zach; Martens, Kalen; Marti-Garcia, Salvador; Martin, Andrew; Martin, Brian; Martin, Brian Thomas; Martin, Franck Francois; Martin, Jean-Pierre; Martin, Philippe; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martin-Haugh, Stewart; Martinez, Mario; Martinez Outschoorn, Verena; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massaro, Graziano; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mathes, Markus; Matricon, Pierre; Matsumoto, Hiroshi; Matsunaga, Hiroyuki; Matsushita, Takashi; Mattravers, Carly; Maugain, Jean-Marie; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; May, Edward; Mayne, Anna; Mazini, Rachid; Mazur, Michael; Mazzanti, Marcello; Mazzoni, Enrico; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; McGlone, Helen; Mchedlidze, Gvantsa; McLaren, Robert Andrew; Mclaughlan, Tom; McMahon, Steve; McPherson, Robert; Meade, Andrew; Mechnich, Joerg; Mechtel, Markus; Medinnis, Mike; Meera-Lebbai, Razzak; Meguro, Tatsuma; Mehdiyev, Rashid; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Mendoza Navas, Luis; Meng, Zhaoxia; Mengarelli, Alberto; Menke, Sven; Menot, Claude; Meoni, Evelin; Mercurio, Kevin Michael; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Meyer, Joerg; Meyer, Thomas Christian; Meyer, W Thomas; Miao, Jiayuan; Michal, Sebastien; Micu, Liliana; Middleton, Robin; Migas, Sylwia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Miller, David; Miller, Robert; Mills, Bill; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Miñano Moya, Mercedes; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Miralles Verge, Lluis; Misiejuk, Andrzej; Mitrevski, Jovan; Mitrofanov, Gennady; Mitsou, Vasiliki A; Mitsui, Shingo; Miyagawa, Paul; Miyazaki, Kazuki; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mockett, Paul; Moed, Shulamit; Moeller, Victoria; Mönig, Klaus; Möser, Nicolas; Mohapatra, Soumya; Mohr, Wolfgang; Mohrdieck-Möck, Susanne; Moisseev, Artemy; Moles-Valls, Regina; Molina-Perez, Jorge; Monk, James; Monnier, Emmanuel; Montesano, Simone; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Moorhead, Gareth; Mora Herrera, Clemencia; Moraes, Arthur; Morange, Nicolas; Morel, Julien; Morello, Gianfranco; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morii, Masahiro; Morin, Jerome; Morley, Anthony Keith; Mornacchi, Giuseppe; Morozov, Sergey; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Mudrinic, Mihajlo; Mueller, Felix; Mueller, James; Mueller, Klemens; Müller, Thomas; Mueller, Timo; Muenstermann, Daniel; Muir, Alex; Munwes, Yonathan; Murray, Bill; Mussche, Ido; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nadal, Jordi; Nagai, Koichi; Nagano, Kunihiro; Nagasaka, Yasushi; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Nanava, Gizo; Napier, Austin; Narayan, Rohin; Nash, Michael; Nation, Nigel; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Neal, Homer; Nebot, Eduardo; Nechaeva, Polina; Neep, Thomas James; Negri, Andrea; Negri, Guido; Nektarijevic, Snezana; Nelson, Andrew; Nelson, Silke; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neusiedl, Andrea; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen Thi Hong, Van; Nickerson, Richard; Nicolaidou, Rosy; Nicolas, Ludovic; Nicquevert, Bertrand; Niedercorn, Francois; Nielsen, Jason; Niinikoski, Tapio; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolaev, Kirill; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsen, Henrik; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nishiyama, Tomonori; Nisius, Richard; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Nordberg, Markus; Nordkvist, Bjoern; Norton, Peter; Novakova, Jana; Nozaki, Mitsuaki; Nozka, Libor; Nugent, Ian Michael; Nuncio-Quiroz, Adriana-Elizabeth; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nyman, Tommi; O'Brien, Brendan Joseph; O'Neale, Steve; O'Neil, Dugan; O'Shea, Val; Oakes, Louise Beth; Oakham, Gerald; Oberlack, Horst; Ocariz, Jose; Ochi, Atsuhiko; Oda, Susumu; Odaka, Shigeru; Odier, Jerome; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohshima, Takayoshi; Ohshita, Hidetoshi; Ohsugi, Takashi; Okada, Shogo; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olcese, Marco; Olchevski, Alexander; Oliveira, Miguel Alfonso; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olivito, Dominick; Olszewski, Andrzej; Olszowska, Jolanta; Omachi, Chihiro; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlov, Iliya; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Osuna, Carlos; Otero y Garzon, Gustavo; Ottersbach, John; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Owen, Simon; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagan Griso, Simone; Paganis, Efstathios; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Paleari, Chiara; Palestini, Sandro; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panes, Boris; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Panuskova, Monika; Paolone, Vittorio; Papadelis, Aras; Papadopoulou, Theodora; Paramonov, Alexander; Park, Woochun; Parker, Andy; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pecsy, Martin; Pedraza Morales, Maria Isabel; Peleganchuk, Sergey; Peng, Haiping; Pengo, Ruggero; Penson, Alexander; Penwell, John; Perantoni, Marcelo; Perez, Kerstin; Perez Cavalcanti, Tiago; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrino, Roberto; Perrodo, Pascal; Persembe, Seda; Perus, Antoine; Peshekhonov, Vladimir; Peters, Krisztian; Petersen, Brian; Petersen, Jorgen; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Petschull, Dennis; Petteni, Michele; Pezoa, Raquel; Phan, Anna; Phillips, Peter William; Piacquadio, Giacinto; Piccaro, Elisa; Piccinini, Maurizio; Piec, Sebastian Marcin; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Ping, Jialun; Pinto, Belmiro; Pirotte, Olivier; Pizio, Caterina; Plamondon, Mathieu; Pleier, Marc-Andre; Pleskach, Anatoly; Poblaguev, Andrei; Poddar, Sahill; Podlyski, Fabrice; Poggioli, Luc; Poghosyan, Tatevik; Pohl, Martin; Polci, Francesco; Polesello, Giacomo; Policicchio, Antonio; Polini, Alessandro; Poll, James; Polychronakos, Venetios; Pomarede, Daniel Marc; Pomeroy, Daniel; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Posch, Christoph; Pospelov, Guennady; Pospisil, Stanislav; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Prabhu, Robindra; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Pretzl, Klaus Peter; Pribyl, Lukas; Price, Darren; Price, Joe; Price, Lawrence; Price, Michael John; Prieur, Damien; Primavera, Margherita; Prokofiev, Kirill; Prokoshin, Fedor; Protopopescu, Serban; Proudfoot, James; Prudent, Xavier; Przybycien, Mariusz; Przysiezniak, Helenka; Psoroulas, Serena; Ptacek, Elizabeth; Pueschel, Elisa; Purdham, John; Purohit, Milind; Puzo, Patrick; Pylypchenko, Yuriy; Qian, Jianming; Qian, Zuxuan; Qin, Zhonghua; Quadt, Arnulf; Quarrie, David; Quayle, William; Quinonez, Fernando; Raas, Marcel; Radescu, Voica; Radics, Balint; Radloff, Peter; Rador, Tonguc; Ragusa, Francesco; Rahal, Ghita; Rahimi, Amir; Rahm, David; Rajagopalan, Srinivasan; Rammensee, Michael; Rammes, Marcus; Randle-Conde, Aidan Sean; Randrianarivony, Koloina; Ratoff, Peter; Rauscher, Felix; Raymond, Michel; Read, Alexander Lincoln; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Reichold, Armin; Reinherz-Aronis, Erez; Reinsch, Andreas; Reisinger, Ingo; Reljic, Dusan; Rembser, Christoph; Ren, Zhongliang; Renaud, Adrien; Renkel, Peter; Rescigno, Marco; Resconi, Silvia; Resende, Bernardo; Reznicek, Pavel; Rezvani, Reyhaneh; Richards, Alexander; Richter, Robert; Richter-Was, Elzbieta; Ridel, Melissa; Rijpstra, Manouk; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Rios, Ryan Randy; Riu, Imma; Rivoltella, Giancesare; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robinson, Mary; Robson, Aidan; Rocha de Lima, Jose Guilherme; Roda, Chiara; Roda Dos Santos, Denis; Rodriguez, Diego; Roe, Adam; Roe, Shaun; Røhne, Ole; Rojo, Victoria; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romanov, Victor; Romeo, Gaston; Romero Adam, Elena; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Anthony; Rose, Matthew; Rosenbaum, Gabriel; Rosenberg, Eli; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rosselet, Laurent; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexander; Rozen, Yoram; Ruan, Xifeng; Rubinskiy, Igor; Ruckert, Benjamin; Ruckstuhl, Nicole; Rud, Viacheslav; Rudolph, Christian; Rudolph, Gerald; Rühr, Frederik; Ruggieri, Federico; Ruiz-Martinez, Aranzazu; Rumiantsev, Viktor; Rumyantsev, Leonid; Runge, Kay; Rurikova, Zuzana; Rusakovich, Nikolai; Rust, Dave; Rutherfoord, John; Ruwiedel, Christoph; Ruzicka, Pavel; Ryabov, Yury; Ryadovikov, Vasily; Ryan, Patrick; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Rzaeva, Sevda; Saavedra, Aldo; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvachua Ferrando, Belén; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Samset, Björn Hallvard; Sanchez, Arturo; Sandaker, Heidi; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sandvoss, Stephan; Sankey, Dave; Sansoni, Andrea; Santamarina Rios, Cibran; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Saraiva, João; Sarangi, Tapas; Sarkisyan-Grinbaum, Edward; Sarri, Francesca; Sartisohn, Georg; Sasaki, Osamu; Sasao, Noboru; Satsounkevitch, Igor; Sauvage, Gilles; Sauvan, Emmanuel; Sauvan, Jean-Baptiste; Savard, Pierre; Savinov, Vladimir; Savu, Dan Octavian; Sawyer, Lee; Saxon, David; Says, Louis-Pierre; Sbarra, Carla; Sbrizzi, Antonio; Scallon, Olivia; Scannicchio, Diana; Scarcella, Mark; Schaarschmidt, Jana; Schacht, Peter; Schäfer, Uli; Schaepe, Steffen; Schaetzel, Sebastian; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R. Dean; Schamov, Andrey; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schioppa, Marco; Schlenker, Stefan; Schlereth, James; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schmitz, Martin; Schöning, André; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schram, Malachi; Schroeder, Christian; Schroer, Nicolai; Schuh, Silvia; Schuler, Georges; Schultes, Joachim; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Jan; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwemling, Philippe; Schwienhorst, Reinhard; Schwierz, Rainer; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Scott, Bill; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Segura, Ester; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellden, Bjoern; Sellers, Graham; Seman, Michal; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Seuster, Rolf; Severini, Horst; Sevior, Martin; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shank, James; Shao, Qi Tao; Shapiro, Marjorie; Shatalov, Pavel; Shaver, Leif; Shaw, Kate; Sherman, Daniel; Sherwood, Peter; Shibata, Akira; Shichi, Hideharu; Shimizu, Shima; Shimojima, Makoto; Shin, Taeksu; Shiyakova, Maria; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shupe, Michael; Sicho, Petr; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silbert, Ohad; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simmons, Brinick; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skinnari, Louise Anastasia; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Skvorodnev, Nikolai; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Sloper, John erik; Smakhtin, Vladimir; Smirnov, Sergei; Smirnova, Lidia; Smirnova, Oxana; Smith, Ben Campbell; Smith, Douglas; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snow, Steve; Snow, Joel; Snuverink, Jochem; Snyder, Scott; Soares, Mara; Sobie, Randall; Sodomka, Jaromir; Soffer, Abner; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solfaroli Camillocci, Elena; Solodkov, Alexander; Solovyanov, Oleg; Soni, Nitesh; Sopko, Vit; Sopko, Bruno; Sosebee, Mark; Soualah, Rachik; Soukharev, Andrey; Spagnolo, Stefania; Spanò, Francesco; Spighi, Roberto; Spigo, Giancarlo; Spila, Federico; Spiwoks, Ralf; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Stahl, Thorsten; Stahlman, Jonathan; Stamen, Rainer; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staude, Arnold; Stavina, Pavel; Stavropoulos, Georgios; Steele, Genevieve; Steinbach, Peter; Steinberg, Peter; Stekl, Ivan; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stevenson, Kyle; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoerig, Kathrin; Stoicea, Gabriel; Stonjek, Stefan; Strachota, Pavel; Stradling, Alden; Straessner, Arno; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strang, Michael; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Strong, John; Stroynowski, Ryszard; Strube, Jan; Stugu, Bjarne; Stumer, Iuliu; Stupak, John; Sturm, Philipp; Styles, Nicholas Adam; Soh, Dart-yin; Su, Dong; Subramania, Halasya Siva; Succurro, Antonella; Sugaya, Yorihito; Sugimoto, Takuya; Suhr, Chad; Suita, Koichi; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Sushkov, Serge; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Suzuki, Yuta; Svatos, Michal; Sviridov, Yuri; Swedish, Stephen; Sykora, Ivan; Sykora, Tomas; Szeless, Balazs; Sánchez, Javier; Ta, Duc; Tackmann, Kerstin; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takahashi, Yuta; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tamsett, Matthew; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanaka, Yoshito; Tanasijczuk, Andres Jorge; Tani, Kazutoshi; Tannoury, Nancy; Tappern, Geoffrey; Tapprogge, Stefan; Tardif, Dominique; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tassi, Enrico; Tatarkhanov, Mous; Tayalati, Yahya; Taylor, Christopher; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teinturier, Marthe; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Terada, Susumu; Terashi, Koji; Terron, Juan; Testa, Marianna; Teuscher, Richard; Thadome, Jocelyn; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thioye, Moustapha; Thoma, Sascha; Thomas, Juergen; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Stan; Thomson, Evelyn; Thomson, Mark; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tic, Tomáš; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tipton, Paul; Tique Aires Viegas, Florbela De Jes; Tisserant, Sylvain; Toczek, Barbara; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tokár, Stanislav; Tokunaga, Kaoru; Tokushuku, Katsuo; Tollefson, Kirsten; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Tong, Guoliang; Tonoyan, Arshak; Topfel, Cyril; Topilin, Nikolai; Torchiani, Ingo; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alesandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Trinh, Thi Nguyet; Tripiana, Martin; Trischuk, William; Trivedi, Arjun; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiakiris, Menelaos; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsung, Jieh-Wen; Tsuno, Soshi; Tsybychev, Dmitri; Tua, Alan; Tudorache, Alexandra; Tudorache, Valentina; Tuggle, Joseph; Turala, Michal; Turecek, Daniel; Turk Cakir, Ilkay; Turlay, Emmanuel; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Tzanakos, George; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ugland, Maren; Uhlenbrock, Mathias; Uhrmacher, Michael; Ukegawa, Fumihiko; Unal, Guillaume; Underwood, David; Undrus, Alexander; Unel, Gokhan; Unno, Yoshinobu; Urbaniec, Dustin; Usai, Giulio; Uslenghi, Massimiliano; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Vahsen, Sven; Valenta, Jan; Valente, Paolo; Valentinetti, Sara; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; van der Graaf, Harry; van der Kraaij, Erik; Van Der Leeuw, Robin; van der Poel, Egge; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; van Kesteren, Zdenko; van Vulpen, Ivo; Vanadia, Marco; Vandelli, Wainer; Vandoni, Giovanna; Vaniachine, Alexandre; Vankov, Peter; Vannucci, Francois; Varela Rodriguez, Fernando; Vari, Riccardo; Varnes, Erich; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vassilakopoulos, Vassilios; Vazeille, Francois; Vegni, Guido; Veillet, Jean-Jacques; Vellidis, Constantine; Veloso, Filipe; Veness, Raymond; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinek, Elisabeth; Vinogradov, Vladimir; Virchaux, Marc; Virzi, Joseph; Vitells, Ofer; Viti, Michele; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vlasov, Nikolai; Vogel, Adrian; Vokac, Petr; Volpi, Guido; Volpi, Matteo; Volpini, Giovanni; von der Schmitt, Hans; von Loeben, Joerg; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobiev, Alexander; Vorwerk, Volker; Vos, Marcel; Voss, Rudiger; Voss, Thorsten Tobias; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Wagner, Wolfgang; Wagner, Peter; Wahlen, Helmut; Wakabayashi, Jun; Walbersloh, Jorg; Walch, Shannon; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Wang, Chiho; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Joshua C; Wang, Rui; Wang, Song-Ming; Warburton, Andreas; Ward, Patricia; Warsinsky, Markus; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Anthony; Waugh, Ben; Weber, Marc; Weber, Michele; Weber, Pavel; Weidberg, Anthony; Weigell, Philipp; Weingarten, Jens; Weiser, Christian; Wellenstein, Hermann; Wells, Phillippa; Wen, Mei; Wenaus, Torre; Wendler, Shanti; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Werth, Michael; Wessels, Martin; Weydert, Carole; Whalen, Kathleen; Wheeler-Ellis, Sarah Jane; Whitaker, Scott; White, Andrew; White, Martin; Whitehead, Samuel Robert; Whiteson, Daniel; Whittington, Denver; Wicek, Francois; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilhelm, Ivan; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Eric; Williams, Hugh; Willis, William; Willocq, Stephane; Wilson, John; Wilson, Michael Galante; Wilson, Alan; Wingerter-Seez, Isabelle; Winkelmann, Stefan; Winklmeier, Frank; Wittgen, Matthias; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wong, Wei-Cheng; Wooden, Gemma; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wraight, Kenneth; Wright, Catherine; Wright, Michael; Wrona, Bozydar; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wunstorf, Renate; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xie, Song; Xie, Yigang; Xu, Chao; Xu, Da; Xu, Guofa; Yabsley, Bruce; Yacoob, Sahal; Yamada, Miho; Yamaguchi, Hiroshi; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamaoka, Jared; Yamazaki, Takayuki; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Un-Ki; Yang, Yi; Yang, Yi; Yang, Zhaoyu; Yanush, Serguei; Yao, Yushu; Yasu, Yoshiji; Ybeles Smit, Gabriel Valentijn; Ye, Jingbo; Ye, Shuwei; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Riktura; Young, Charles; Youssef, Saul; Yu, Dantong; Yu, Jaehoon; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Zabinski, Bartlomiej; Zaets, Vassilli; Zaidan, Remi; Zaitsev, Alexander; Zajacova, Zuzana; Zanello, Lucia; Zarzhitsky, Pavel; Zaytsev, Alexander; Zeitnitz, Christian; Zeller, Michael; Zeman, Martin; Zemla, Andrzej; Zendler, Carolin; Zenin, Oleg; Ženiš, Tibor; Zinonos, Zinonas; Zenz, Seth; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhan, Zhichao; Zhang, Dongliang; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Long; Zhao, Tianchi; Zhao, Zhengguo; Zhemchugov, Alexey; Zheng, Shuchen; Zhong, Jiahang; Zhou, Bing; Zhou, Ning; Zhou, Yue; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhuravlov, Vadym; Zieminska, Daria; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Ziolkowski, Michael; Zitoun, Robert; Živković, Lidija; Zmouchko, Viatcheslav; Zobernig, Georg; Zoccoli, Antonio; Zolnierowski, Yves; Zsenei, Andras; zur Nedden, Martin; Zutshi, Vishnu; Zwalinski, Lukasz

    2012-06-15

    A measurement of the top-antitop production charge asymmetry $A_C$ is presented using data corresponding to an integrated luminosity of 1.04 fb$^{-1}$ of $pp$ collisions at $\\sqrt{s}$ = 7 TeV collected by the ATLAS detector at the LHC. Events are selected with a single lepton (electron or muon), missing transverse momentum and at least four jets of which at least one jet is identified as coming from a b-quark. A kinematic fit is used to reconstruct the $t\\overline{t}$ event topology. After background subtraction, a Bayesian unfolding procedure is performed to correct for acceptance and detector effects. The measured value of $A_C$ is $A_C = -0.018 \\pm 0.028 (stat.) \\pm 0.023 (syst.)$, consistent with the prediction from the MC@NLO Monte Carlo generator of $A_C = 0.006 \\pm 0.002$. Measurements of $A_C$ in two ranges of invariant mass of the top-antitop pair is also shown.

  12. Enhanced sunlight-driven photocatalytic performance of Bi-doped CdMoO4 benefited from efficient separation of photogenerated charge pairs

    Science.gov (United States)

    Huang, Jiao; Liu, Huanhuan; Zhong, Junbo; Yang, Qi; Chen, Jiufu; Li, Jianzhang; Ma, Dongmei; duan, Ran

    2018-06-01

    In this paper, to further boost the photocatalytic performance of CdMoO4, Bi3+ was successfully doped into CdMoO4 by a facile microwave hydrothermal method. The Bi-doped CdMoO4 photocatalysts prepared were characterized by Brunauer-Emmett-Teller (BET) method, X-ray diffraction (XRD), UV-Vis diffuse reflectance spectroscopy (DRS), scanning electron microscopy (SEM), energy dispersive spectrometer (EDS), high-resolution transmission electron microscopy (HRTEM), X-ray photoelectron spectroscopy (XPS), electron spin-resonance (ESR) and surface photovoltage spectroscopy (SPS). The results exhibit that doping Bi3+ into CdMoO4 remarkably boosts the separation rate of photoinduced charge pairs and the specific surface area, decrease the crystal size, narrows the band gap of the CdMoO4 and induces the binding energy shift of Cd, all these advantageous factors result in the promoted photocatalytic performance of CdMoO4. Using rhodamine B (RhB) as model toxic pollutant, the photocatalytic activities of the photocatalysts were evaluated under a 500 W Xe lamp irradiation. When the molar ratio of Bi/Cd is 0.2%, Bi-CdMoO4 prepared displays the best photocatalytic performance, the photocatalytic performance of the 0.2% sample is more than twice of that of the reference CdMoO4.

  13. Search for maximal flavor violating scalars in same-charge lepton pairs in pp collisions at sqrt[s]=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bar-Shalom, S; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'orso, M; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopolou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R-S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Osterberg, K; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Rajaraman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Safonov, A; Sakumoto, W K; Salamanna, G; Saltó, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M A; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyria, A; Shalhout, S Z; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thompson, G A; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tu, Y; Turini, N; Ukegawa, F; Uozumi, S; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Veszpremi, V; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Volobouev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner-Kuhr, J; Wagner, W; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, F; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zheng, Y; Zucchelli, S

    2009-01-30

    Models of maximal flavor violation (MxFV) in elementary particle physics may contain at least one new scalar SU(2) doublet field Phi(FV)=(eta(0),eta(+)) that couples the first and third generation quarks (q_(1), q_(3)) via a Lagrangian term L(FV)=xi(13)Phi(FV)q(1)q(3). These models have a distinctive signature of same-charge top-quark pairs and evade flavor-changing limits from meson mixing measurements. Data corresponding to 2 fb(-1) collected by the Collider Dectector at Fermilab II detector in pp[over ] collisions at sqrt[s]=1.96 TeV are analyzed for evidence of the MxFV signature. For a neutral scalar eta(0) with m_(eta;(0))=200 GeV/c(2) and coupling xi(13)=1, approximately 11 signal events are expected over a background of 2.1+/-1.8 events. Three events are observed in the data, consistent with background expectations, and limits are set on the coupling xi(13) for m(eta(0)=180-300 GeV/c(2).

  14. Measurements of the charge asymmetry in top-quark pair production in the dilepton final state at $\\sqrt{s}=8$ TeV with the ATLAS detector

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdinov, Ovsat; Abeloos, Baptiste; Aben, Rosemarie; Abolins, Maris; AbouZeid, Ossama; Abraham, Nicola; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Affolder, Tony; Agatonovic-Jovin, Tatjana; Agricola, Johannes; Aguilar-Saavedra, Juan Antonio; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexopoulos, Theodoros; Alhroob, Muhammad; Aliev, Malik; Alimonti, Gianluca; Alison, John; Alkire, Steven Patrick; Allbrooke, Benedict; Allen, Benjamin William; Allport, Phillip; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Alvarez Gonzalez, Barbara; Άlvarez Piqueras, Damián; Alviggi, Mariagrazia; Amadio, Brian Thomas; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anders, John Kenneth; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Arabidze, Giorgi; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arduh, Francisco Anuar; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Armitage, Lewis James; Arnaez, Olivier; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Artz, Sebastian; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Augsten, Kamil; Avolio, Giuseppe; Axen, Bradley; Ayoub, Mohamad Kassem; Azuelos, Georges; Baak, Max; Baas, Alessandra; Baca, Matthew John; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Baines, John; Baker, Oliver Keith; Baldin, Evgenii; Balek, Petr; Balestri, Thomas; Balli, Fabrice; Balunas, William Keaton; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Barak, Liron; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barklow, Timothy; Barlow, Nick; Barnes, Sarah Louise; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barranco Navarro, Laura; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Basalaev, Artem; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batista, Santiago Juan; Batley, Richard; Battaglia, Marco; Bauce, Matteo; Bauer, Florian; Bawa, Harinder Singh; Beacham, James; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Bechtle, Philip; Beck, Hans~Peter; Becker, Kathrin; Becker, Maurice; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bednyakov, Vadim; Bedognetti, Matteo; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Janna Katharina; Belanger-Champagne, Camille; Bell, Andrew Stuart; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Belyaev, Nikita; Benary, Odette; Benchekroun, Driss; Bender, Michael; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez, Jose; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Bentvelsen, Stan; Beresford, Lydia; Beretta, Matteo; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Berlendis, Simon; Bernard, Nathan Rogers; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertram, Iain Alexander; Bertsche, Carolyn; Bertsche, David; Besjes, Geert-Jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bevan, Adrian John; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Biedermann, Dustin; Bielski, Rafal; Biesuz, Nicolo Vladi; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Biondi, Silvia; Bjergaard, David Martin; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blanco, Jacobo Ezequiel; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Blunier, Sylvain; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boehler, Michael; Boerner, Daniela; Bogaerts, Joannes Andreas; Bogavac, Danijela; Bogdanchikov, Alexander; Bohm, Christian; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Bortfeldt, Jonathan; Bortoletto, Daniela; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Bossio Sola, Jonathan David; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Boutle, Sarah Kate; Boveia, Antonio; Boyd, James; Boyko, Igor; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Breaden Madden, William Dmitri; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Lydia; Brenner, Richard; Bressler, Shikma; Bristow, Timothy Michael; Britton, Dave; Britzger, Daniel; Brochu, Frederic; Brock, Ian; Brock, Raymond; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Broughton, James; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Bruni, Alessia; Bruni, Graziano; Brunt, Benjamin; Bruschi, Marco; Bruscino, Nello; Bryant, Patrick; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Buchholz, Peter; Buckley, Andrew; Budagov, Ioulian; Buehrer, Felix; Bugge, Magnar Kopangen; Bulekov, Oleg; Bullock, Daniel; Burckhart, Helfried; Burdin, Sergey; Burgard, Carsten Daniel; Burghgrave, Blake; Burka, Klaudia; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Buzykaev, Aleksey; Cabrera Urbán, Susana; Caforio, Davide; Cairo, Valentina; Cakir, Orhan; Calace, Noemi; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Caloba, Luiz; Calvet, David; Calvet, Samuel; Calvet, Thomas Philippe; Camacho Toro, Reina; Camarda, Stefano; Camarri, Paolo; Cameron, David; Caminal Armadans, Roger; Camincher, Clement; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Carbone, Ryne Michael; Cardarelli, Roberto; Cardillo, Fabio; Carli, Ina; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Casper, David William; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Caudron, Julien; Cavaliere, Viviana; Cavallaro, Emanuele; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerda Alberich, Leonor; Cerio, Benjamin; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chan, Stephen Kam-wah; Chan, Yat Long; Chang, Philip; Chapman, John Derek; Charlton, Dave; Chatterjee, Avishek; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Che, Siinn; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Shenjian; Chen, Shion; Chen, Xin; Chen, Ye; Cheng, Hok Chuen; Cheng, Huajie; Cheng, Yangyang; Cheplakov, Alexander; Cheremushkina, Evgenia; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiarelli, Giorgio; Chiodini, Gabriele; Chisholm, Andrew; Chitan, Adrian; Chizhov, Mihail; Choi, Kyungeon; Chomont, Arthur Rene; Chouridou, Sofia; Chow, Bonnie Kar Bo; Christodoulou, Valentinos; Chromek-Burckhart, Doris; Chudoba, Jiri; Chuinard, Annabelle Julia; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Cinca, Diane; Cindro, Vladimir; Cioara, Irina Antonela; Ciocio, Alessandra; Cirotto, Francesco; Citron, Zvi Hirsh; Ciubancan, Mihai; Clark, Allan G; Clark, Brian Lee; Clark, Michael; Clark, Philip James; Clarke, Robert; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Colasurdo, Luca; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Connell, Simon Henry; Connelly, Ian; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Crawley, Samuel Joseph; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cúth, Jakub; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Dandoy, Jeffrey Rogers; Dang, Nguyen Phuong; Daniells, Andrew Christopher; Dann, Nicholas Stuart; Danninger, Matthias; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Merlin; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Benedetti, Abraham; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dedovich, Dmitri; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Delgove, David; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; DeMarco, David; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Denysiuk, Denys; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Dette, Karola; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Clemente, William Kennedy; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Diaconu, Cristinel; Diamond, Miriam; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Dobos, Daniel; Dobre, Monica; Doglioni, Caterina; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Drechsler, Eric; Dris, Manolis; Du, Yanyan; Duarte-Campderros, Jorge; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Duschinger, Dirk; Dutta, Baishali; Dyndal, Mateusz; Eckardt, Christoph; Ecker, Katharina Maria; Edgar, Ryan Christopher; Edson, William; Edwards, Nicholas Charles; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellajosyula, Venugopal; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Elliot, Alison; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Ennis, Joseph Stanford; Erdmann, Johannes; Ereditato, Antonio; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Federica; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farina, Christian; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Faucci Giannelli, Michele; Favareto, Andrea; Fawcett, William James; Fayard, Louis; Fedin, Oleg; Fedorko, Wojciech; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Feremenga, Last; Fernandez Martinez, Patricia; Fernandez Perez, Sonia; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Cora; Fischer, Julia; Fisher, Wade Cameron; Flaschel, Nils; Fleck, Ivor; Fleischmann, Philipp; Fletcher, Gareth Thomas; Fletcher, Gregory; Fletcher, Rob Roy MacGregor; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Flowerdew, Michael; Forcolin, Giulio Tiziano; Formica, Andrea; Forti, Alessandra; Foster, Andrew Geoffrey; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Francis, David; Franconi, Laura; Franklin, Melissa; Frate, Meghan; Fraternali, Marco; Freeborn, David; Fressard-Batraneanu, Silvia; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fusayasu, Takahiro; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gach, Grzegorz; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Louis Guillaume; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yanyan; Gao, Yongsheng; Garay Walls, Francisca; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gascon Bravo, Alberto; Gatti, Claudio; Gaudiello, Andrea; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Gecse, Zoltan; Gee, Norman; Geich-Gimbel, Christoph; Geisler, Manuel Patrice; Gemme, Claudia; Genest, Marie-Hélène; Geng, Cong; Gentile, Simonetta; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghasemi, Sara; Ghazlane, Hamid; Ghneimat, Mazuza; Giacobbe, Benedetto; Giagu, Stefano; Giannetti, Paola; Gibbard, Bruce; Gibson, Stephen; Gignac, Matthew; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giromini, Paolo; Giugni, Danilo; Giuli, Francesco; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gkougkousis, Evangelos Leonidas; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Goblirsch-Kolb, Maximilian; Godlewski, Jan; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; Gongadze, Alexi; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Goudet, Christophe Raymond; Goujdami, Driss; Goussiou, Anna; Govender, Nicolin; Gozani, Eitan; Graber, Lars; Grabowska-Bold, Iwona; Gradin, Per Olov Joakim; Grafström, Per; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Greenwood, Zeno Dixon; Grefe, Christian; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Grevtsov, Kirill; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grivaz, Jean-Francois; Groh, Sabrina; Grohs, Johannes Philipp; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Grout, Zara Jane; Guan, Liang; Guan, Wen; Guenther, Jaroslav; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Guo, Yicheng; Gupta, Shaun; Gustavino, Giuliano; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Hadef, Asma; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Haley, Joseph; Hall, David; Halladjian, Garabed; Hallewell, Gregory David; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamilton, Andrew; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Haney, Bijan; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Maike Christina; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harrington, Robert; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Makoto; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauser, Reiner; Hauswald, Lorenz; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayden, Daniel; Hays, Chris; Hays, Jonathan Michael; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Jochen Jens; Heinrich, Lukas; Heinz, Christian; Hejbal, Jiri; Helary, Louis; Hellman, Sten; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Henkelmann, Steffen; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hetherly, Jeffrey Wayne; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hinman, Rachel Reisner; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hohlfeld, Marc; Hohn, David; Holmes, Tova Ray; Homann, Michael; Hong, Tae Min; Hooberman, Benjamin Henry; Hopkins, Walter; Horii, Yasuyuki; Horton, Arthur James; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hrynevich, Aliaksei; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Qipeng; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Idrissi, Zineb; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikeno, Masahiro; Ilchenko, Iurii; Iliadis, Dimitrios; Ilic, Nikolina; Ince, Tayfun; Introzzi, Gianluca; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Ito, Fumiaki; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivarsson, Jenny; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jabbar, Samina; Jackson, Brett; Jackson, Matthew; Jackson, Paul; Jain, Vivek; Jakobi, Katharina Bianca; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansky, Roland; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanneau, Fabien; Jeanty, Laura; Jejelava, Juansher; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Hai; Jiang, Yi; Jiggins, Stephen; Jimenez Pena, Javier; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Johansson, Per; Johns, Kenneth; Johnson, William Joseph; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Sarah; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Jovicevic, Jelena; Ju, Xiangyang; Juste Rozas, Aurelio; Köhler, Markus Konrad; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kahn, Sebastien Jonathan; Kajomovitz, Enrique; Kalderon, Charles William; Kaluza, Adam; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneti, Steven; Kanjir, Luka; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kaplan, Laser Seymour; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karamaoun, Andrew; Karastathis, Nikolaos; Kareem, Mohammad Jawad; Karentzos, Efstathios; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kasahara, Kota; Kashif, Lashkar; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Kato, Chikuma; Katre, Akshay; Katzy, Judith; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Keeler, Richard; Kehoe, Robert; Keller, John; Kempster, Jacob Julian; Kentaro, Kawade; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Keyes, Robert; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharlamov, Alexey; Khoo, Teng Jian; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kido, Shogo; Kim, Hee Yeun; Kim, Shinhong; Kim, Young-Kee; Kimura, Naoki; Kind, Oliver Maria; King, Barry; King, Matthew; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kiuchi, Kenji; Kivernyk, Oleh; Kladiva, Eduard; Klein, Matthew Henry; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Knapik, Joanna; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Aine; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Koi, Tatsumi; Kolanoski, Hermann; Kolb, Mathis; Koletsou, Iro; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Kortner, Oliver; Kortner, Sandra; Kosek, Tomas; Kostyukhin, Vadim; Kotwal, Ashutosh; Kourkoumeli-Charalampidi, Athina; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewska, Anna Bozena; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Krizka, Karol; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Krumnack, Nils; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kucuk, Hilal; Kuday, Sinan; Kuechler, Jan Thomas; Kuehn, Susanne; Kugel, Andreas; Kuger, Fabian; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kukla, Romain; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunigo, Takuto; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwan, Tony; Kyriazopoulos, Dimitrios; La Rosa, Alessandro; La Rosa Navarro, Jose Luis; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Lammers, Sabine; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lange, J örn Christian; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Lanza, Agostino; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Lazovich, Tomo; Lazzaroni, Massimo; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; Le Quilleuc, Eloi; LeBlanc, Matthew Edgar; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Leontsinis, Stefanos; Lerner, Giuseppe; Leroy, Claude; Lesage, Arthur; Lester, Christopher; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Qi; Li, Shu; Li, Xingguo; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Liblong, Aaron; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Lindquist, Brian Edward; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Hao; Liu, Hongbin; Liu, Jian; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanlin; Liu, Yanwen; Livan, Michele; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loew, Kevin Michael; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Long, Brian Alexander; Long, Jonathan David; Long, Robin Eamonn; Longo, Luigi; Looper, Kristina Anne; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lopez Solis, Alvaro; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Lösel, Philipp Jonathan; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lu, Haonan; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luedtke, Christian; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lynn, David; Lysak, Roman; Lytken, Else; Lyubushkin, Vladimir; Ma, Hong; Ma, Lian Liang; Ma, Yanhui; Maccarrone, Giovanni; Macchiolo, Anna; Macdonald, Calum Michael; Maček, Boštjan; Machado Miguens, Joana; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeda, Junpei; Maeland, Steffen; Maeno, Tadashi; Maevskiy, Artem; Magradze, Erekle; Mahlstedt, Joern; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maier, Thomas; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyukov, Sergei; Mamuzic, Judita; Mancini, Giada; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Maneira, José; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany; Mann, Alexander; Mansoulie, Bruno; Mantifel, Rodger; Mantoani, Matteo; Manzoni, Stefano; Mapelli, Livio; Marceca, Gino; March, Luis; Marchiori, Giovanni; Marcisovsky, Michal; Marjanovic, Marija; Marley, Daniel; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Mario; Martin-Haugh, Stewart; Martoiu, Victor Sorin; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazza, Simone Michele; Mc Fadden, Neil Christopher; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McClymont, Laurie; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Meyer Zu Theenhausen, Hanno; Middleton, Robin; Miglioranzi, Silvia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milesi, Marco; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Minaenko, Andrey; Minami, Yuto; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mistry, Khilesh; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Monden, Ryutaro; Mondragon, Matthew Craig; Mönig, Klaus; Monk, James; Monnier, Emmanuel; Montalbano, Alyssa; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Mori, Daniel; Mori, Tatsuya; Morii, Masahiro; Morinaga, Masahiro; Morisbak, Vanja; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Mortensen, Simon Stark; Morvaj, Ljiljana; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Ralph Soeren Peter; Mueller, Thibaut; Muenstermann, Daniel; Mullen, Paul; Mullier, Geoffrey; Munoz Sanchez, Francisca Javiela; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Muškinja, Miha; Myagkov, Alexey; Myska, Miroslav; Nachman, Benjamin Philip; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagano, Kunihiro; Nagasaka, Yasushi; Nagata, Kazuki; Nagel, Martin; Nagy, Elemer; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Naranjo Garcia, Roger Felipe; Narayan, Rohin; Narrias Villar, Daniel Isaac; Naryshkin, Iouri; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Nef, Pascal Daniel; Negri, Andrea; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Andrew; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolopoulos, Konstantinos; Nilsen, Jon Kerr; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Nooney, Tamsin; Norberg, Scarlet; Nordberg, Markus; Norjoharuddeen, Nurfikri; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nurse, Emily; Nuti, Francesco; O'grady, Fionnbarr; O'Neil, Dugan; O'Rourke, Abigail Alexandra; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Ochoa-Ricoux, Juan Pedro; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Oide, Hideyuki; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Oleiro Seabra, Luis Filipe; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onogi, Kouta; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Owen, Mark; Owen, Rhys Edward; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Palma, Alberto; Panagiotopoulou, Evgenia; Pandini, Carlo Enrico; Panduro Vazquez, William; Pani, Priscilla; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Adam Jackson; Parker, Michael Andrew; Parker, Kerry Ann; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pascuzzi, Vincent; Pasqualucci, Enrico; Passaggio, Stefano; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Pauly, Thilo; Pearce, James; Pearson, Benjamin; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Penc, Ondrej; Peng, Cong; Peng, Haiping; Penwell, John; Peralva, Bernardo; Perego, Marta Maria; Perepelitsa, Dennis; Perez Codina, Estel; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petroff, Pierre; Petrolo, Emilio; Petrov, Mariyan; Petrucci, Fabrizio; Pettersson, Nora Emilia; Peyaud, Alan; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Pickering, Mark Andrew; Piegaia, Ricardo; Pilcher, James; Pilkington, Andrew; Pin, Arnaud Willy J; Pina, João Antonio; Pinamonti, Michele; Pinfold, James; Pingel, Almut; Pires, Sylvestre; Pirumov, Hayk; Pitt, Michael; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Pluth, Daniel; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Polesello, Giacomo; Poley, Anne-luise; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pozo Astigarraga, Mikel Eukeni; Pralavorio, Pascal; Pranko, Aliaksandr; Prell, Soeren; Price, Darren; Price, Lawrence; Primavera, Margherita; Prince, Sebastien; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Puddu, Daniele; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Raddum, Silje; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Raine, John Andrew; Rajagopalan, Srinivasan; Rammensee, Michael; Rangel-Smith, Camila; Ratti, Maria Giulia; Rauscher, Felix; Rave, Stefan; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reichert, Joseph; Reisin, Hernan; Rembser, Christoph; Ren, Huan; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Richter, Stefan; Richter-Was, Elzbieta; Ricken, Oliver; Ridel, Melissa; Rieck, Patrick; Riegel, Christian Johann; Rieger, Julia; Rifki, Othmane; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ristić, Branislav; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Rizzi, Chiara; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Rodina, Yulia; Rodriguez Perez, Andrea; Rodriguez Rodriguez, Daniel; Roe, Shaun; Rogan, Christopher Sean; Røhne, Ole; Romaniouk, Anatoli; Romano, Marino; Romano Saez, Silvestre Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Peyton; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Jonatan; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Russell, Heather; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryu, Soo; Ryzhov, Andrey; Saavedra, Aldo; Sabato, Gabriele; Sacerdoti, Sabrina; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Saha, Puja; Sahinsoy, Merve; Saimpert, Matthias; Saito, Tomoyuki; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Salazar Loyola, Javier Esteban; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sammel, Dirk; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sannino, Mario; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sasaki, Osamu; Sasaki, Yuichi; Sato, Koji; Sauvage, Gilles; Sauvan, Emmanuel; Savage, Graham; Savard, Pierre; Sawyer, Craig; Sawyer, Lee; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaeffer, Jan; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Schiavi, Carlo; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmieden, Kristof; Schmitt, Christian; Schmitt, Stefan; Schmitz, Simon; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schopf, Elisabeth; Schorlemmer, Andre Lukas; Schott, Matthias; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schwegler, Philipp; Schweiger, Hansdieter; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Sciolla, Gabriella; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Seema, Pienpen; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekhon, Karishma; Sekula, Stephen; Seliverstov, Dmitry; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Sessa, Marco; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shaikh, Nabila Wahab; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shaw, Savanna Marie; Shcherbakova, Anna; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shoaleh Saadi, Diane; Shochet, Mel; Shojaii, Seyedruhollah; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Sicho, Petr; Sidebo, Per Edvin; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simon, Dorian; Simon, Manuel; Sinervo, Pekka; Sinev, Nikolai; Sioli, Maximiliano; Siragusa, Giovanni; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skinner, Malcolm Bruce; Skottowe, Hugh Philip; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Slawinska, Magdalena; Sliwa, Krzysztof; Slovak, Radim; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Matthew; Smith, Russell; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Sokhrannyi, Grygorii; Solans Sanchez, Carlos; Solar, Michael; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Son, Hyungsuk; Song, Hong Ye; Sood, Alexander; Sopczak, Andre; Sopko, Vit; Sorin, Veronica; Sosa, David; Sotiropoulou, Calliope Louisa; Soualah, Rachik; Soukharev, Andrey; South, David; Sowden, Benjamin; Spagnolo, Stefania; Spalla, Margherita; Spangenberg, Martin; Spanò, Francesco; Sperlich, Dennis; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; St Denis, Richard Dante; Stabile, Alberto; Stahlman, Jonathan; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Giordon; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Stärz, Steffen; Staszewski, Rafal; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Strubig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramaniam, Rajivalochan; Suchek, Stanislav; Sugaya, Yorihito; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Shota; Svatos, Michal; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Shuji; Tannenwald, Benjamin Bordy; Tapia Araya, Sebastian; Tapprogge, Stefan; Tarem, Shlomit; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Aaron; Taylor, Geoffrey; Taylor, Pierre Thor Elliot; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira-Dias, Pedro; Temming, Kim Katrin; Temple, Darren; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Tepel, Fabian-Phillipp; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Ray; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Tibbetts, Mark James; Ticse Torres, Royer Edson; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tipton, Paul; Tisserant, Sylvain; Todome, Kazuki; Todorov, Theodore; Todorova-Nova, Sharka; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tolley, Emma; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Tong, Baojia(Tony); Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Trefzger, Thomas; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Trofymov, Artur; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; Truong, Loan; Trzebinski, Maciej; Trzupek, Adam; Tseng, Jeffrey; Tsiareshka, Pavel; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsui, Ka Ming; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turgeman, Daniel; Turra, Ruggero; Turvey, Andrew John; Tuts, Michael; Tyndel, Mike; Ucchielli, Giulia; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urban, Jozef; Urquijo, Phillip; Urrejola, Pedro; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valderanis, Chrysostomos; Valdes Santurio, Eduardo; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vankov, Peter; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vasquez, Jared Gregory; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloce, Laurelle Maria; Veloso, Filipe; Veneziano, Stefano; Ventura, Andrea; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigani, Luigi; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Vittori, Camilla; Vivarelli, Iacopo; Vlachos, Sotirios; Vlasak, Michal; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wallangen, Veronica; Wang, Chao; Wang, Chao; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Tingting; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Washbrook, Andrew; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; Whallon, Nikola Lazar; Wharton, Andrew Mark; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wildauer, Andreas; Wilk, Fabian; Wilkens, Henric George; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winston, Oliver James; Winter, Benedict Tobias; Wittgen, Matthias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wu, Mengqing; Wu, Miles; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yakabe, Ryota; Yamaguchi, Daiki; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Shimpei; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Yi; Yang, Zongchang; Yao, Weiming; Yap, Yee Chinn; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yuen, Stephanie P; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zakharchuk, Nataliia; Zalieckas, Justas; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zeng, Jian Cong; Zeng, Qi; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Guangyi; Zhang, Huijun; Zhang, Jinlong; Zhang, Lei; Zhang, Rui; Zhang, Ruiqi; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Xiandong; Zhao, Yongke; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Chen; Zhou, Lei; Zhou, Li; Zhou, Mingliang; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Stephanie; Zinonos, Zinonas; Zinser, Markus; Ziolkowski, Michael; Živković, Lidija; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zwalinski, Lukasz

    2016-08-22

    Measurements of the top--antitop quark pair production charge asymmetry in the dilepton channel are presented using data corresponding to an integrated luminosity of $20.3$ fb$^{-1}$ from $pp$ collisions at a center-of-mass energy of $\\sqrt{s} = 8$ TeV collected with the ATLAS detector at the Large Hadron Collider at CERN. Inclusive and differential measurements as a function of the invariant mass, transverse momentum, and longitudinal boost of the $t\\bar{t}$ system are performed both in the full phase space and in a fiducial phase space closely matching the detector acceptance. Two observables are studied: $A^{\\ell\\ell}_{\\textrm{C}}$ based on the selected leptons and $A^{t\\bar{t}}_{\\textrm{C}}$ based on the reconstructed $t\\bar{t}$ final state. The inclusive asymmetries are measured in the full phase space to be $A^{\\ell\\ell}_{\\textrm{C}} = 0.008 \\pm 0.006$ and $A^{t\\bar{t}}_{\\textrm{C}} = 0.021 \\pm 0.016$, which are in agreement with the Standard Model predictions of $A^{\\ell\\ell}_{\\textrm{C}} = 0.0064 \\pm ...

  15. Measurement of the charge asymmetry in top quark pair production in pp collisions at √(s)=7 TeV using the ATLAS detector

    International Nuclear Information System (INIS)

    Aad, G.

    2012-01-01

    A measurement of the top-antitop production charge asymmetry A C is presented using data corresponding to an integrated luminosity of 1.04 fb -1 of pp collisions at √(s) = 7 TeV collected by the ATLAS detector at the LHC. Events are selected with a single lepton (electron or muon), missing transverse momentum and at least four jets of which at least one jet is identified as coming from a b-quark. A kinematic fit is used to reconstruct the t anti t event topology. After background subtraction, a Bayesian unfolding procedure is performed to correct for acceptance and detector effects. The measured value of A C is A C = -0.019 ±0.028 (stat.) ±0.024 (syst.), consistent with the prediction from the MC rate at NLO Monte Carlo generator of A C =0.006 ±0.002. Measurements of A C in two ranges of invariant mass of the top-antitop pair are also shown. (orig.)

  16. Measurement of the charge asymmetry in top quark pair production in pp collisions at √s = 7 TeV using the ATLAS detector

    International Nuclear Information System (INIS)

    2012-01-01

    A measurement of the top-antitop production charge asymmetry A C is presented using data corresponding to an integrated luminosity of 1.04 fb -1 of pp collisions at √s = 7 TeV collected by the ATLAS detector at the LHC. Events are selected with a single lepton (electron or muon), missing transverse momentum and at least four jets of which at least one jet is identified as coming from a b-quark. A kinematic fit is used to reconstruct the t(bar t) event topology. After background subtraction, a Bayesian unfolding procedure is performed to correct for acceptance and detector effects. The measured value of A C is A C = -0.019 ± 0.028 (stat.) ± 0.024 (syst.), consistent with the prediction from the MC(at)NLO Monte Carlo generator of A C = 0.006 ± 0.002. Measurements of A C in two ranges of invariant mass of the top-antitop pair are also shown.

  17. Differential top-quark-pair cross sections in pp collisions at √(s)=7 TeV with CMS and charge multiplication in highly irradiated silicon sensors

    International Nuclear Information System (INIS)

    Lange, Joern

    2013-09-01

    Modern particle-physics experiments like the ones at the Large Hadron Collider (LHC) are global and interdisciplinary endeavours comprising a variety of different fields. In this work, two different aspects are dealt with: on the one hand a top-quark physics analysis and on the other hand research and development towards radiation-hard silicon tracking detectors. The high centre-of-mass energy and luminosity at the LHC allow for a detailed investigation of top-quark-pair (t anti t) pro duction properties. Normalised differential t anti t cross sections (1)/(σ) (dσ t anti t )/(dX) are measured as a function of nine different kinematic variables X of the t anti t system, the top quarks and their decay products (b jets and leptons). The analysis is performed using data of proton-proton collisions at √(s) = 7 TeV recorded by the CMS experiment in 2011, corresponding to an integrated luminosity of 5 fb -1 . A high-purity sample of t anti t events is selected according to the topology of the lepton+jets decay channel. Lepton-selection and trigger efficiencies are determined with data-driven methods. The top-quark four-vectors are reconstructed using a constrained kinematic fit. The reconstructed distributions are corrected for background and detector effects using a regularised unfolding technique. By normalising the differential cross sections with the in-situ measured total cross section, correlated systematic uncertainties are reduced, achieving a precision of typically 4-11%. The results are compared to standard-model predictions from Monte-Carlo event generators and approximate next-to-next-to-leading-order (NNLO) perturbative QCD calculations. A good agreement is observed. A high-luminosity upgrade of the LHC (HL-LHC) is envisaged for 2022, which implies increased radiation levels for the silicon tracking detectors. The innermost pixel layer is expected to be exposed to a 1-MeV-neutron-equivalent fluence in the order of 10 16 cm -2 . The novel effect of

  18. Differential top-quark-pair cross sections in pp collisions at {radical}(s)=7 TeV with CMS and charge multiplication in highly irradiated silicon sensors

    Energy Technology Data Exchange (ETDEWEB)

    Lange, Joern

    2013-09-15

    Modern particle-physics experiments like the ones at the Large Hadron Collider (LHC) are global and interdisciplinary endeavours comprising a variety of different fields. In this work, two different aspects are dealt with: on the one hand a top-quark physics analysis and on the other hand research and development towards radiation-hard silicon tracking detectors. The high centre-of-mass energy and luminosity at the LHC allow for a detailed investigation of top-quark-pair (t anti t) pro duction properties. Normalised differential t anti t cross sections (1)/({sigma}) (d{sigma}{sub t} {sub anti} {sub t})/(dX) are measured as a function of nine different kinematic variables X of the t anti t system, the top quarks and their decay products (b jets and leptons). The analysis is performed using data of proton-proton collisions at {radical}(s) = 7 TeV recorded by the CMS experiment in 2011, corresponding to an integrated luminosity of 5 fb{sup -1}. A high-purity sample of t anti t events is selected according to the topology of the lepton+jets decay channel. Lepton-selection and trigger efficiencies are determined with data-driven methods. The top-quark four-vectors are reconstructed using a constrained kinematic fit. The reconstructed distributions are corrected for background and detector effects using a regularised unfolding technique. By normalising the differential cross sections with the in-situ measured total cross section, correlated systematic uncertainties are reduced, achieving a precision of typically 4-11%. The results are compared to standard-model predictions from Monte-Carlo event generators and approximate next-to-next-to-leading-order (NNLO) perturbative QCD calculations. A good agreement is observed. A high-luminosity upgrade of the LHC (HL-LHC) is envisaged for 2022, which implies increased radiation levels for the silicon tracking detectors. The innermost pixel layer is expected to be exposed to a 1-MeV-neutron-equivalent fluence in the order of 10

  19. Escape from the Alternative

    Directory of Open Access Journals (Sweden)

    Marin Dinu

    2006-12-01

    Full Text Available This paper sets out to elaborate on Romania’s specific agenda regarding the approach to the integration process in the EU as a project of modernization. The focus is on the functional aspects, the type of strategic solutions destined to consolidate the specific transformations belonging to post-communist transition seen as an internal transition, on the one hand and on the other hand to push convergence as the essence of integration, marked by the vision of EU integration as a continuation of change, which is the stage of external transition. Identifying the prominent factors and the pragmatic priorities of the escape from the peripheries of development by engaging in evolution by way of the second modernization constitutes as well a target for analysis. One particularity of the method of analysis is the review if the value-set of the bobsled effect of path dependency – the path of the peripheries – as well as of the set of values of the escape from the peripheries.

  20. THERMALLY DRIVEN ATMOSPHERIC ESCAPE: TRANSITION FROM HYDRODYNAMIC TO JEANS ESCAPE

    International Nuclear Information System (INIS)

    Volkov, Alexey N.; Johnson, Robert E.; Tucker, Orenthal J.; Erwin, Justin T.

    2011-01-01

    Thermally driven escape from planetary atmospheres changes in nature from an organized outflow (hydrodynamic escape) to escape on a molecule-by-molecule basis (Jeans escape) with increasing Jeans parameter, λ, the ratio of the gravitational to thermal energy of the atmospheric molecules. This change is described here for the first time using the direct simulation Monte Carlo method. When heating is predominantly below the lower boundary of the simulation region, R 0 , and well below the exobase of a single-component atmosphere, the nature of the escape process changes over a surprisingly narrow range of Jeans parameters, λ 0 , evaluated at R 0 . For an atomic gas, the transition occurs over λ 0 ∼ 2-3, where the lower bound, λ 0 ∼ 2.1, corresponds to the upper limit for isentropic, supersonic outflow. For λ 0 > 3 escape occurs on a molecule-by-molecule basis and we show that, contrary to earlier suggestions, for λ 0 > ∼6 the escape rate does not deviate significantly from the familiar Jeans rate. In a gas composed of diatomic molecules, the transition shifts to λ 0 ∼ 2.4-3.6 and at λ 0 > ∼4 the escape rate increases a few tens of percent over that for the monatomic gas. Scaling by the Jeans parameter and the Knudsen number, these results can be applied to thermally induced escape of the major species from solar and extrasolar planets.

  1. Escape of atmospheres and loss of water

    International Nuclear Information System (INIS)

    Hunten, D.M.; Donahue, T.M.; Walker, J.C.G.; Kasting, J.F.

    1989-01-01

    The properties and limitations of several loss processes for atmospheric gases are presented and discussed. They include thermal loss (Jeans and hydrodynamic); nonthermal loss (all processes involve charged particles); and impact erosion, including thermal escape from a molten body heated by rapid accretion. Hydrodynamic escape, or blowoff, is of particular interest because it offers the prospect of processing large quantities of gas and enriching the remainder in heavy elements and isotopes. In a second part, the water budgets and likely evolutionary histories of Venus, Earth and Mars are assessed. Although it is tempting to associate the great D/H enrichment on Venus with loss of a large initial endowment, a steady state with juvenile water (perhaps from comets) is equally probable

  2. Hydrodynamic escape from planetary atmospheres

    Science.gov (United States)

    Tian, Feng

    Hydrodynamic escape is an important process in the formation and evolution of planetary atmospheres. Due to the existence of a singularity point near the transonic point, it is difficult to find transonic steady state solutions by solving the time-independent hydrodynamic equations. In addition to that, most previous works assume that all energy driving the escape flow is deposited in one narrow layer. This assumption not only results in less accurate solutions to the hydrodynamic escape problem, but also makes it difficult to include other chemical and physical processes in the hydrodynamic escape models. In this work, a numerical model describing the transonic hydrodynamic escape from planetary atmospheres is developed. A robust solution technique is used to solve the time dependent hydrodynamic equations. The method has been validated in an isothermal atmosphere where an analytical solution is available. The hydrodynamic model is applied to 3 cases: hydrogen escape from small orbit extrasolar planets, hydrogen escape from a hydrogen rich early Earth's atmosphere, and nitrogen/methane escape from Pluto's atmosphere. Results of simulations on extrasolar planets are in good agreement with the observations of the transiting extrasolar planet HD209458b. Hydrodynamic escape of hydrogen from other hypothetical close-in extrasolar planets are simulated and the influence of hydrogen escape on the long-term evolution of these extrasolar planets are discussed. Simulations on early Earth suggest that hydrodynamic escape of hydrogen from a hydrogen rich early Earth's atmosphere is about two orders magnitude slower than the diffusion limited escape rate. A hydrogen rich early Earth's atmosphere could have been maintained by the balance between the hydrogen escape and the supply of hydrogen into the atmosphere by volcanic outgassing. Origin of life may have occurred in the organic soup ocean created by the efficient formation of prebiotic molecules in the hydrogen rich early

  3. Gamma-ray escape peak characteristics of radiation-damaged reverse-electrode germanium coaxial detectors

    International Nuclear Information System (INIS)

    Pehl, R.H.; Hull, E.L.; Madden, N.W.; Xing Jingshu; Friesel, D.L.

    1996-01-01

    A comparison of the characteristics of full-energy gamma-ray peaks and their corresponding escape peaks when high energy photons interact in radiation damaged reverse-electrode (n-type) germanium coaxial detectors is presented. Coaxial detector geometry is the dominant factor, causing charge collection to be dramatically better for interactions occurring near the outer periphery of the detector as well as increasing of the probability of escape events occurring in this region. It follows that the resolution of escape peaks is better than that of ordinary gamma-ray peaks. This is experimentally verified. A nearly identical but undamaged detector exhibited significant Doppler broadening of single escape peaks. Because double escape events preferentially occur at outer radii, energy shifts of double escape reflect extremely small amounts of charge trapping in undamaged detectors. (orig.)

  4. Dications and thermal ions in planetary atmospheric escape

    Science.gov (United States)

    Lilensten, J.; Simon Wedlund, C.; Barthélémy, M.; Thissen, R.; Ehrenreich, D.; Gronoff, G.; Witasse, O.

    2013-01-01

    In the recent years, the presence of dications in the atmospheres of Mars, Venus, Earth and Titan has been modeled and assessed. These studies also suggested that these ions could participate to the escape of the planetary atmospheres because a large fraction of them is unstable and highly energetic. When they dissociate, their internal energy is transformed into kinetic energy which may be larger than the escape energy. The goal of this study is to assess the impact of the doubly-charged ions in the escape of CO2-dominated planetary atmospheres and to compare it to the escape of thermal photo-ions. We solve a Boltzmann transport equation at daytime taking into account the dissociative states of CO2++ for a simplified single constituent atmosphere of a case-study planet. We compute the escape of fast ions using a Beer-Lambert approach. We study three test-cases. On a Mars-analog planet in today's conditions, we retrieve the measured electron escape flux. When comparing the two mechanisms (i.e. excluding solar wind effects, sputtering, etc.), the escape due to the fast ions issuing from the dissociation of dications may account for up to 6% of the total and the escape of thermal ions for the remaining. We show that these two mechanisms cannot explain the escape of the atmosphere since the magnetic field vanished and even contribute only marginally to this loss. We show that with these two mechanisms, the atmosphere of a Mars analog planet would empty in another giga years and a half. At Venus orbit, the contribution of the dications in the escape rate is negligible. When simulating the hot Jupiter HD 209458 b, the two processes cannot explain the measured escape flux of C+. This study shows that the dications may constitute a source of the escape of planetary atmospheres which had not been taken into account until now. This source, although marginal, is not negligible. The influence of the photoionization is of course large, but cannot explain alone the loss of Mars

  5. Dressed ion theory of size-asymmetric electrolytes: effective ionic charges and the decay length of screened Coulomb potential and pair correlations.

    Science.gov (United States)

    Forsberg, Björn; Ulander, Johan; Kjellander, Roland

    2005-02-08

    The effects of ionic size asymmetry on long-range electrostatic interactions in electrolyte solutions are investigated within the primitive model. Using the formalism of dressed ion theory we analyze correlation functions from Monte Carlo simulations and the hypernetted chain approximation for size asymmetric 1:1 electrolytes. We obtain decay lengths of the screened Coulomb potential, effective charges of ions, and effective permittivity of the solution. It is found that the variation of these quantities with the degree of size asymmetry depends in a quite intricate manner on the interplay between the electrostatic coupling and excluded volume effects. In most cases the magnitude of the effective charge of the small ion species is larger than that of the large species; the difference increases with increasing size asymmetry. The effective charges of both species are larger (in absolute value) than the bare ionic charge, except for high asymmetry where the effective charge of the large ions can become smaller than the bare charge.

  6. Molecular Dications in Planetary Atmospheric Escape

    Directory of Open Access Journals (Sweden)

    Stefano Falcinelli

    2016-08-01

    Full Text Available Fundamental properties of multiply charged molecular ions, such as energetics, structure, stability, lifetime and fragmentation dynamics, are relevant to understand and model the behavior of gaseous plasmas as well as ionosphere and astrophysical environments. Experimental determinations of the Kinetic Energy Released (KER for ions originating from dissociations reactions, induced by Coulomb explosion of doubly charged molecular ions (molecular dications produced by double photoionization of CO2, N2O and C2H2 molecules of interest in planetary atmospheres, are reported. The KER measurement as a function of the ultraviolet (UV photon energy in the range of 28–65 eV was extracted from the electron-ion-ion coincidence spectra obtained by using tunable synchrotron radiation coupled with ion imaging techniques at the ELETTRA Synchrotron Light Laboratory Trieste, Italy. These experiments, coupled with a computational analysis based on a Monte Carlo trajectory simulation, allow assessing the probability of escape for simple ionic species in the upper atmosphere of Mars, Venus and Titan. The measured KER in the case of H+, C+, CH+, CH2+, N+, O+, CO+, N2+ and NO+ fragment ions range between 1.0 and 5.5 eV, being large enough to allow these ionic species to participate in the atmospheric escape from such planets into space. In the case of Mars, we suggest a possible explanation for the observed behavior of the O+ and CO22+ ion density profiles.

  7. Using the Pairs of Lines Broadened by Collisions with Neutral and Charged Particles for Gas Temperature Determination of Argon Non-Thermal Plasmas at Atmospheric Pressure

    Directory of Open Access Journals (Sweden)

    Cristina Yubero

    2017-10-01

    Full Text Available The spectroscopic method for gas temperature determination in argon non-thermal plasmas sustained at atmospheric pressure proposed recently by Spectrochimica Acta Part B 129 14 (2017—based on collisional broadening measurements of selected pairs of argon atomic lines, has been applied to other pairs of argon atomic lines, and the discrepancies found in some of these results have been analyzed. For validation purposes, the values of the gas temperature obtained using the different pairs of lines have been compared with the rotational temperatures derived from the OH ro-vibrational bands, using the Boltzmann-plot technique.

  8. Search for the production of ZW and ZZ boson pairs decaying into charged leptons and jets in proton-antiproton collisions at sqrt[s]=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, Timo Antero; et al,

    2013-11-01

    We present a measurement of the production cross section for ZW and ZZ boson pairs in final states with a pair of charged leptons, from the decay of a Z boson, and at least two jets, from the decay of a W or Z boson, using the full sample of proton-antiproton collisions recorded with the CDF II detector at the Tevatron, corresponding to 8.9 fb^(-1) of integrated luminosity. We increase the sensitivity to vector boson decays into pairs of quarks using a neural network discriminant that exploits the differences between the spatial spread of energy depositions and charged-particle momenta contained within the jet of particles originating from quarks and gluons. Additionally, we employ new jet energy corrections to Monte Carlo simulations that account for differences in the observed energy scales for quark and gluon jets. The number of signal events is extracted through a simultaneous fit to the dijet mass spectrum in three classes of events: events likely to contain jets with a heavy-quark decay, events likely to contain jets originating from light quarks, and events that fail these identification criteria. We determine the production cross section to be 2.5 +2.0 -1.0 pb (< 6.1 pb at the 95% confidence level), consistent with the standard model prediction of 5.1 pb.

  9. Creating Engaging Escape Rooms for the Classroom

    Science.gov (United States)

    Nicholson, Scott

    2018-01-01

    Escape rooms are "live-action team-based games where players discover clues, solve puzzles, and accomplish tasks in one or more rooms in order to accomplish a specific goal (usually escaping from the room) in a limited amount of time." Escape Rooms are one type of Escape Game, which are narrative-based challenges that use puzzles, tasks,…

  10. Analysis of events with $b$-jets and a pair of leptons of the same charge in $pp$ collisions at $\\sqrt{s}=8$ TeV with the ATLAS detector

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdinov, Ovsat; Aben, Rosemarie; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Affolder, Tony; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alio, Lion; Alison, John; Alkire, Steven Patrick; Allbrooke, Benedict; Allport, Phillip; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Άlvarez Piqueras, Damián; Alviggi, Mariagrazia; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Arabidze, Giorgi; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arduh, Francisco Anuar; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Axen, Bradley; Ayoub, Mohamad Kassem; Azuelos, Georges; Baak, Max; Baas, Alessandra; Bacci, Cesare; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Badescu, Elisabeta; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bain, Travis; Baines, John; Baker, Oliver Keith; Balek, Petr; Balestri, Thomas; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnes, Sarah Louise; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batista, Santiago Juan; Batley, Richard; Battaglia, Marco; Bauce, Matteo; Bauer, Florian; Bawa, Harinder Singh; Beacham, James Baker; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Maurice; Becker, Sebastian; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Janna Katharina; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bender, Michael; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Bentvelsen, Stan; Beresford, Lydia; Beretta, Matteo; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Bernard, Clare; Bernard, Nathan Rogers; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertsche, Carolyn; Bertsche, David; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bevan, Adrian John; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blanco, Jacobo Ezequiel; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boehler, Michael; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bohm, Christian; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boutouil, Sara; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozic, Ivan; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Lydia; Brenner, Richard; Bressler, Shikma; Bristow, Kieran; Bristow, Timothy Michael; Britton, Dave; Britzger, Daniel; Brochu, Frederic; Brock, Ian; Brock, Raymond; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Brown, Jonathan; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Buchholz, Peter; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Buehrer, Felix; Bugge, Lars; Bugge, Magnar Kopangen; Bulekov, Oleg; Burckhart, Helfried; Burdin, Sergey; Burghgrave, Blake; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Buszello, Claus-Peter; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Buzykaev, Aleksey; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Caloba, Luiz; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarda, Stefano; Cameron, David; Caminada, Lea Michaela; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Caudron, Julien; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Cerny, Karel; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chang, Philip; Chapleau, Bertrand; Chapman, John Derek; Charlton, Dave; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Liming; Chen, Shenjian; Chen, Xin; Chen, Ye; Cheng, Hok Chuen; Cheng, Yangyang; Cheplakov, Alexander; Cheremushkina, Evgenia; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Childers, John Taylor; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Choi, Kyungeon; Chouridou, Sofia; Chow, Bonnie Kar Bo; Christodoulou, Valentinos; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Chuinard, Annabelle Julia; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Cinca, Diane; Cindro, Vladimir; Cioara, Irina Antonela; Ciocio, Alessandra; Citron, Zvi Hirsh; Ciubancan, Mihai; Clark, Allan G; Clark, Brian Lee; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Cogan, Joshua Godfrey; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Connell, Simon Henry; Connelly, Ian; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Côté, David; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Dandoy, Jeffrey Rogers; Daniells, Andrew Christopher; Danninger, Matthias; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dedovich, Dmitri; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Delgove, David; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; DeMarco, David; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Diaconu, Cristinel; Diamond, Miriam; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Dobos, Daniel; Dobre, Monica; Doglioni, Caterina; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Drechsler, Eric; Dris, Manolis; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Duschinger, Dirk; Dwuznik, Michal; Dyndal, Mateusz; Eckardt, Christoph; Ecker, Katharina Maria; Edson, William; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Elliot, Alison; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Engelmann, Roderich; Erdmann, Johannes; Ereditato, Antonio; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Favareto, Andrea; Fayard, Louis; Federic, Pavol; Fedin, Oleg; Fedorko, Wojciech; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Fernandez Martinez, Patricia; Fernandez Perez, Sonia; Ferrag, Samir; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Cora; Fischer, Julia; Fisher, Wade Cameron; Fitzgerald, Eric Andrew; Flechl, Martin; Fleck, Ivor; Fleischmann, Philipp; Fleischmann, Sebastian; Fletcher, Gareth Thomas; Fletcher, Gregory; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Flowerdew, Michael; Formica, Andrea; Forti, Alessandra; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Francis, David; Franconi, Laura; Franklin, Melissa; Fraternali, Marco; Freeborn, David; French, Sky; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yanyan; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudiello, Andrea; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Geisler, Manuel Patrice; Gemme, Claudia; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gibbard, Bruce; Gibson, Stephen; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giromini, Paolo; Giugni, Danilo; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gkougkousis, Evangelos Leonidas; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godlewski, Jan; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Goujdami, Driss; Goussiou, Anna; Govender, Nicolin; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Grout, Zara Jane; Guan, Liang; Guenther, Jaroslav; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Gupta, Shaun; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Haley, Joseph; Hall, David; Halladjian, Garabed; Hallewell, Gregory David; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Maike Christina; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harrington, Robert; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Makoto; Hasegawa, Satoshi; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauser, Reiner; Hauswald, Lorenz; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hays, Jonathan Michael; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Lukas; Hejbal, Jiri; Helary, Louis; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Hengler, Christopher; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herrberg-Schubert, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hetherly, Jeffrey Wayne; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hinman, Rachel Reisner; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hohlfeld, Marc; Hohn, David; Holmes, Tova Ray; Hong, Tae Min; Hooft van Huysduynen, Loek; Hopkins, Walter; Horii, Yasuyuki; Horton, Arthur James; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hrynevich, Aliaksei; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Qipeng; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Idrissi, Zineb; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Ilchenko, Iurii; Iliadis, Dimitrios; Ilic, Nikolina; Inamaru, Yuki; Ince, Tayfun; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivarsson, Jenny; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jabbar, Samina; Jackson, Brett; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansky, Roland; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanty, Laura; Jejelava, Juansher; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Yi; Jiggins, Stephen; Jimenez Pena, Javier; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Johansson, Per; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jung, Christian; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kahn, Sebastien Jonathan; Kajomovitz, Enrique; Kalderon, Charles William; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karamaoun, Andrew; Karastathis, Nikolaos; Kareem, Mohammad Jawad; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Katre, Akshay; Katzy, Judith; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Kehoe, Robert; Keller, John; Kempster, Jacob Julian; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Keyes, Robert; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharlamov, Alexey; Khoo, Teng Jian; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hee Yeun; Kim, Hyeon Jin; Kim, Shinhong; Kim, Young-Kee; Kimura, Naoki; Kind, Oliver Maria; King, Barry; King, Matthew; King, Robert Steven Beaufoy; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kiuchi, Kenji; Kivernyk, Oleh; Kladiva, Eduard; Klein, Matthew Henry; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Klok, Peter; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Koletsou, Iro; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; König, Sebastian; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Kortner, Oliver; Kortner, Sandra; Kosek, Tomas; Kostyukhin, Vadim; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumeli-Charalampidi, Athina; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Krizka, Karol; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Krumnack, Nils; Krumshteyn, Zinovii; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kucuk, Hilal; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuger, Fabian; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kukla, Romain; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunigo, Takuto; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kurumida, Rie; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwan, Tony; Kyriazopoulos, Dimitrios; La Rosa, Alessandro; La Rosa Navarro, Jose Luis; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Lambourne, Luke; Lammers, Sabine; Lampen, Caleb; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lange, J örn Christian; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeBlanc, Matthew Edgar; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Leontsinis, Stefanos; Leroy, Claude; Lester, Christopher; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Lewis, Adrian; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Shu; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Liblong, Aaron; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Jian; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Long, Brian Alexander; Long, Jonathan; Long, Robin Eamonn; Looper, Kristina Anne; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Lösel, Philipp Jonathan; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lungwitz, Matthias; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Macdonald, Calum Michael; Machado Miguens, Joana; Macina, Daniela; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeland, Steffen; Maeno, Tadashi; Maevskiy, Artem; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maier, Thomas; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mancini, Giada; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mantoani, Matteo; Mapelli, Livio; March, Luis; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marjanovic, Marija; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Mario; Martin-Haugh, Stewart; Martoiu, Victor Sorin; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazza, Simone Michele; Mazzaferro, Luca; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Middleton, Robin; Miglioranzi, Silvia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milesi, Marco; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Minaenko, Andrey; Minami, Yuto; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Mönig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Morisbak, Vanja; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Mortensen, Simon Stark; Morton, Alexander; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Klemens; Mueller, Ralph Soeren Peter; Mueller, Thibaut; Muenstermann, Daniel; Mullen, Paul; Munwes, Yonathan; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagata, Kazuki; Nagel, Martin; Nagy, Elemer; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Naranjo Garcia, Roger Felipe; Narayan, Rohin; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Nef, Pascal Daniel; Negri, Andrea; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Andrew; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolopoulos, Konstantinos; Nilsen, Jon Kerr; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nomachi, Masaharu; Nomidis, Ioannis; Nooney, Tamsin; Norberg, Scarlet; Nordberg, Markus; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nuti, Francesco; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Oide, Hideyuki; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Owen, Rhys Edward; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paganis, Efstathios; Pahl, Christoph; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Palma, Alberto; Pan, Yibin; Panagiotopoulou, Evgenia; Pandini, Carlo Enrico; Panduro Vazquez, William; Pani, Priscilla; Panitkin, Sergey; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parker, Kerry Ann; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Pauly, Thilo; Pearce, James; Pearson, Benjamin; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penwell, John; Perepelitsa, Dennis; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Pettersson, Nora Emilia; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Pickering, Mark Andrew; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinfold, James; Pingel, Almut; Pinto, Belmiro; Pires, Sylvestre; Pitt, Michael; Pizio, Caterina; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Pluth, Daniel; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Polesello, Giacomo; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Prell, Soeren; Price, Darren; Price, Joe; Price, Lawrence; Primavera, Margherita; Prince, Sebastien; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Ptacek, Elizabeth; Puddu, Daniele; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quarrie, David; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Raddum, Silje; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Rangel-Smith, Camila; Rauscher, Felix; Rave, Stefan; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reisin, Hernan; Relich, Matthew; Rembser, Christoph; Ren, Huan; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Richter, Stefan; Richter-Was, Elzbieta; Ricken, Oliver; Ridel, Melissa; Rieck, Patrick; Riegel, Christian Johann; Rieger, Julia; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ristić, Branislav; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Roe, Shaun; Røhne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romano Saez, Silvestre Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Peyton; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Russell, Heather; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sabato, Gabriele; Sacerdoti, Sabrina; Saddique, Asif; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Saimpert, Matthias; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sannino, Mario; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sasaki, Osamu; Sasaki, Yuichi; Sato, Koji; Sauvage, Gilles; Sauvan, Emmanuel; Savage, Graham; Savard, Pierre; Sawyer, Craig; Sawyer, Lee; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaeffer, Jan; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Schiavi, Carlo; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schmitt, Stefan; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schopf, Elisabeth; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schroeder, Christian; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schwegler, Philipp; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seema, Pienpen; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekula, Stephen; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shaw, Savanna Marie; Shcherbakova, Anna; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shoaleh Saadi, Diane; Shochet, Mel; Shojaii, Seyedruhollah; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silver, Yiftah; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simon, Dorian; Simoniello, Rosa; Sinervo, Pekka; Sinev, Nikolai; Siragusa, Giovanni; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skinner, Malcolm Bruce; Skottowe, Hugh Philip; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Slawinska, Magdalena; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Matthew; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Song, Hong Ye; Soni, Nitesh; Sood, Alexander; Sopczak, Andre; Sopko, Bruno; Sopko, Vit; Sorin, Veronica; Sosa, David; Sosebee, Mark; Sotiropoulou, Calliope Louisa; Soualah, Rachik; Soueid, Paul; Soukharev, Andrey; South, David; Spagnolo, Stefania; Spalla, Margherita; Spanò, Francesco; Spearman, William Robert; Sperlich, Dennis; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; Spreitzer, Teresa; St Denis, Richard Dante; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Stavina, Pavel; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Strubig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Shota; Suzuki, Yu; Svatos, Michal; Swedish, Stephen; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tannenwald, Benjamin Bordy; Tannoury, Nancy; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Tepel, Fabian-Phillipp; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Ray; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thun, Rudolf; Tibbetts, Mark James; Ticse Torres, Royer Edson; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tolley, Emma; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; True, Patrick; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turra, Ruggero; Turvey, Andrew John; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Uhlenbrock, Mathias; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urban, Jozef; Urquijo, Phillip; Urrejola, Pedro; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valderanis, Chrysostomos; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; Van Der Leeuw, Robin; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vannucci, Francois; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloso, Filipe; Velz, Thomas; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wang, Chao; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; Wharton, Andrew Mark; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wildauer, Andreas; Wilkens, Henric George; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, Alan; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winter, Benedict Tobias; Wittgen, Matthias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wu, Mengqing; Wu, Miles; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yakabe, Ryota; Yamada, Miho; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Shimpei; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Yi; Yao, Liwen; Yao, Weiming; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zalieckas, Justas; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Jinlong; Zhang, Lei; Zhang, Ruiqi; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Xiandong; Zhao, Yongke; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Chen; Zhou, Lei; Zhou, Li; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Robert; Zimmermann, Stephanie; Zinonos, Zinonas; Zinser, Markus; Ziolkowski, Michael; Živković, Lidija; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zwalinski, Lukasz

    2015-10-22

    An analysis is presented of events containing jets including at least one $b$-tagged jet, sizeable missing transverse momentum, and at least two leptons including a pair of the same electric charge, with the scalar sum of the jet and lepton transverse momenta being large. A data sample with an integrated luminosity of 20.3 fb$^{-1}$ of $pp$ collisions at $\\sqrt{s} = 8$ TeV recorded by the ATLAS detector at the Large Hadron Collider is used. Standard Model processes rarely produce these final states, but there are several models of physics beyond the Standard Model that predict an enhanced rate of production of such events; the ones considered here are production of vector-like quarks, enhanced four-top-quark production, pair production of chiral $b^\\prime$-quarks, and production of two positively charged top quarks. Eleven signal regions are defined; subsets of these regions are combined when searching for each class of models. In the three signal regions primarily sensitive to positively charged top quark pa...

  11. Prosthetic Mitral Valve Leaflet Escape

    Science.gov (United States)

    Kim, Darae; Hun, Sin Sang; Cho, In-Jeong; Shim, Chi-Young; Ha, Jong-Won; Chung, Namsik; Ju, Hyun Chul; Sohn, Jang Won

    2013-01-01

    Leaflet escape of prosthetic valve is rare but potentially life threatening. It is essential to make timely diagnosis in order to avoid mortality. Transesophageal echocardiography and cinefluoroscopy is usually diagnostic and the location of the missing leaflet can be identified by computed tomography (CT). Emergent surgical correction is mandatory. We report a case of fractured escape of Edward-Duromedics mitral valve 27 years after the surgery. The patient presented with symptoms of acute decompensated heart failure and cardiogenic shock. She was instantly intubated and mechanically ventilated. After prompt evaluation including transthoracic echocardiography and CT, the escape of the leaflet was confirmed. The patient underwent emergent surgery for replacement of the damaged prosthetic valves immediately. Eleven days after the surgery, the dislodged leaflet in iliac artery was removed safely and the patient recovered well. PMID:23837121

  12. Mesure de l'asymétrie de charge des paires de quarks top-antitop dans les états nals dileptoniques auprès des détecteurs D0 et ATLAS.

    CERN Document Server

    Chapelain, Antoine

    2014-01-01

    Particle physics aims to give a coherent description of the nature and the behavior of elementary particles of matter. Particle accelerators (colliders) allow pushing back our knowledge in this domain producing particles that cannot be observed by other means. This thesis work contributes to this research field and focuses on the study of the top quark which is the latest brick of matter discovered and the heaviest known elementary particle. The property of the top quark studied here, the charge asymmetry of the top quark-antiquark pairs, has driven a lot of attention in 2011 because of measurements released by Tevatron experiments. These measurements showed deviations with the predictions made in the framework of the standard model of particle physics. New measurements of the charge asymmetry performed at the Tevatron (with the D0 detector) and at the LHC (with the ATLAS detector) are presented in this thesis.

  13. Search for doubly charged Higgs boson pair production in the decay to mu(+)mu(+)mu(-)mu(-) in p(p)over-bar collisions at root s=1.96 TeV

    OpenAIRE

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, D. L.; Adams, M.; Adams, T.; Agelou, M.; Agram, J. L.; Ahmed, S. N.; Ahn, S. H.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.

    2004-01-01

    A search for pair production of doubly charged Higgs bosons in the process p (p) over bar -->H++H---->mu(+)mu(+)mu(-)mu(-) is performed with the D0 run II detector at the Fermilab Tevatron. The analysis is based on a sample of inclusive dimuon data collected at an energy of roots=1.96 TeV, corresponding to an integrated luminosity of 113 pb(-1). In the absence of a signal, 95% confidence level mass limits of M(H-L(+/-+/-))>118.4 GeV/c(2) and M(H-R(+/-+/-))>98.2 GeV/c(2) are set for left-hande...

  14. Automated Escape Guidance Algorithms for An Escape Vehicle

    Science.gov (United States)

    Flanary, Ronald; Hammen, David; Ito, Daigoro; Rabalais, Bruce; Rishikof, Brian; Siebold, Karl

    2002-01-01

    An escape vehicle was designed to provide an emergency evacuation for crew members living on a space station. For maximum escape capability, the escape vehicle needs to have the ability to safely evacuate a station in a contingency scenario such as an uncontrolled (e.g., tumbling) station. This emergency escape sequence will typically be divided into three events: The fust separation event (SEP1), the navigation reconstruction event, and the second separation event (SEP2). SEP1 is responsible for taking the spacecraft from its docking port to a distance greater than the maximum radius of the rotating station. The navigation reconstruction event takes place prior to the SEP2 event and establishes the orbital state to within the tolerance limits necessary for SEP2. The SEP2 event calculates and performs an avoidance burn to prevent station recontact during the next several orbits. This paper presents the tools and results for the whole separation sequence with an emphasis on the two separation events. The fust challenge includes collision avoidance during the escape sequence while the station is in an uncontrolled rotational state, with rotation rates of up to 2 degrees per second. The task of avoiding a collision may require the use of the Vehicle's de-orbit propulsion system for maximum thrust and minimum dwell time within the vicinity of the station vicinity. The thrust of the propulsion system is in a single direction, and can be controlled only by the attitude of the spacecraft. Escape algorithms based on a look-up table or analytical guidance can be implemented since the rotation rate and the angular momentum vector can be sensed onboard and a-priori knowledge of the position and relative orientation are available. In addition, crew intervention has been provided for in the event of unforeseen obstacles in the escape path. The purpose of the SEP2 burn is to avoid re-contact with the station over an extended period of time. Performing this maneuver properly

  15. Search for the standard model Higgs boson decaying to a bb pair in events with two oppositely charged leptons using the full CDF data set.

    Science.gov (United States)

    Aaltonen, T; Álvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M E; Bisello, D; Bizjak, I; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Calamba, A; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chung, W H; Chung, Y S; Ciocci, M A; Clark, A; Clarke, C; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuevas, J; Culbertson, R; Dagenhart, D; d'Ascenzo, N; Datta, M; de Barbaro, P; Dell'Orso, M; Demortier, L; Deninno, M; Devoto, F; d'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Dorigo, M; Dorigo, T; Ebina, K; Elagin, A; Eppig, A; Erbacher, R; Errede, S; Ershaidat, N; Eusebi, R; Farrington, S; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Funakoshi, Y; Furic, I; Gallinaro, M; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Halkiadakis, E; Hamaguchi, A; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harr, R F; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Hewamanage, S; Hocker, A; Hopkins, W; Horn, D; Hou, S; Hughes, R E; Hurwitz, M; Husemann, U; Hussain, N; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeans, D T; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kim, Y J; Kimura, N; Kirby, M; Klimenko, S; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Kruse, M; Krutelyov, V; Kuhr, T; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; LeCompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lin, C-J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maeshima, K; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Martínez, M; Mastrandrea, P; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Prokoshin, F; Pranko, A; Ptohos, F; Punzi, G; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Rescigno, M; Riddick, T; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sinervo, P; Sliwa, K; Smith, J R; Snider, F D; Soha, A; Sorin, V; Song, H; Squillacioti, P; Stancari, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thome, J; Thompson, G A; Thomson, E; Tipton, P; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Varganov, A; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vila, I; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wagner, R L; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Wick, F; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanetti, A; Zeng, Y; Zhou, C; Zucchelli, S

    2012-09-14

    We present a search for the standard model Higgs boson produced in association with a Z boson in data collected with the CDF II detector at the Tevatron, corresponding to an integrated luminosity of 9.45  fb(-1). In events consistent with the decay of the Higgs boson to a bottom-quark pair and the Z boson to electron or muon pairs, we set 95% credibility level upper limits on the ZH production cross section times the H→bb branching ratio as a function of Higgs boson mass. At a Higgs boson mass of 125  GeV/c(2), we observe (expect) a limit of 7.1 (3.9) times the standard model value.

  16. New insights on the collisional escape of light neutrals from Mars

    Science.gov (United States)

    Gacesa, Marko; Zahnle, Kevin

    2017-04-01

    Photodissociative recombination (PDR) of atmospheric molecules on Mars is a major mechanism of production of hot (suprathermal) atoms with sufficient kinetic energy to either directly escape to space or to eject other atmospheric species. This collisional ejection mechanism is important for evaluating the escape rates of all light neutrals that are too heavy to escape via Jeans escape. In particular, it plays a role in estimating the total volume of escaped water constituents (i.e., O and H) from Mars, as well as influences evolution of the atmospheric [D]/[H] ratio1. We present revised estimates of total collisional escape rates of neutral light elements including H, He, and H2, based on recent (years 2015-2016) atmospheric density profiles obtained from the NASA Mars Atmosphere and Volatile Evolution (MAVEN) mission. We also estimate the contribution to the collisional escape from Energetic Neutral Atoms (ENAs) produced in charge-exchange of solar wind H+ and He+ ions with atmospheric gases2,3. Scattering of hot oxygen and atmospheric species of interest is modeled using fully-quantum reactive scattering formalism1,3. The escape rates are evaluated using a 1D model of the atmosphere supplemented with MAVEN measurements of the neutrals. Finally, new estimates of contributions of these non-thermal mechanisms to the estimated PDR escape rates from young Mars4 are presented. [1] M. Gacesa and V. Kharchenko, "Non-thermal escape of molecular hydrogen from Mars", Geophys. Res. Lett., 39, L10203 (2012). [2] N. Lewkow and V. Kharchenko, "Precipitation of Energetic Neutral Atoms and Escape Fluxes induced from the Mars Atmosphere", Astroph. J., 790, 98 (2014). [3] M. Gacesa, N. Lewkow, and V. Kharchenko, "Non-thermal production and escape of OH from the upper atmosphere of Mars", Icarus 284, 90 (2017). [4] J. Zhao, F. Tian, Y. Ni, and X. Huang, "DR-induced escape of O and C from early Mars", Icarus 284, 305 (2017).

  17. Cnidoscolus (Euphorbiaceae) escaped in Malesia?

    NARCIS (Netherlands)

    Welzen, van P.C.; Fernández-Casas, F.J.

    2017-01-01

    The genus Cnidoscolus, a species rich genus in the Americas, has been introduced in the Philippines. A cultivar of Cnidoscolus aconitifolius is used as vegetable and has been collected from gardens in Manila and Pasay City and two times near Cebu City. It cannot be excluded that it has escaped

  18. Cu-O network dependence of optical charge-transfer gaps and spin-pair excitations in single-CuO2-layer compounds

    International Nuclear Information System (INIS)

    Tokura, Y.; Koshihara, S.; Arima, T.; Takagi, H.; Ishibashi, S.; Ido, T.; Uchida, S.

    1990-01-01

    Spectra of optical conductivity and magnon Raman scattering have been investigated in single crystals of a parent family of cuprate superconductors with various types of Cu-O single-layer networks. The analysis of the spectra shows the systematic dependence of the charge-transfer gaps and covalent character of Cu-O bonds on the pattern of the Cu-O network, while the spin-exchange energy is rather convergent for all the single-CuO 2 -sheet compounds

  19. Measurement of the charge asymmetry in dileptonic decays of top quark pairs in $pp$ collisions at $\\sqrt{s}=7$ TeV using the ATLAS detector

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdel Khalek, Samah; Abdinov, Ovsat; Aben, Rosemarie; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alio, Lion; Alison, John; Allbrooke, Benedict; Allison, Lee John; Allport, Phillip; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Anduaga, Xabier; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arduh, Francisco Anuar; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Axen, Bradley; Azuelos, Georges; Azuma, Yuya; Baak, Max; Baas, Alessandra; Bacci, Cesare; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Backus Mayes, John; Badescu, Elisabeta; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bain, Travis; Baines, John; Baker, Oliver Keith; Balek, Petr; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnes, Sarah Louise; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Bartsch, Valeria; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batista, Santiago Juan; Batley, Richard; Battaglia, Marco; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Sebastian; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Katharina; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Bernard, Clare; Bernat, Pauline; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertsche, Carolyn; Bertsche, David; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boddy, Christopher Richard; Boehler, Michael; Boek, Thorsten Tobias; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Borri, Marcello; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boutouil, Sara; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozic, Ivan; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Brelier, Bertrand; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Richard; Bressler, Shikma; Bristow, Kieran; Bristow, Timothy Michael; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Brown, Jonathan; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchholz, Peter; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Buehrer, Felix; Bugge, Lars; Bugge, Magnar Kopangen; Bulekov, Oleg; Bundock, Aaron Colin; Burckhart, Helfried; Burdin, Sergey; Burghgrave, Blake; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Buszello, Claus-Peter; Butler, Bart; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Byszewski, Marcin; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarda, Stefano; Cameron, David; Caminada, Lea Michaela; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caudron, Julien; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Cerny, Karel; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chang, Philip; Chapleau, Bertrand; Chapman, John Derek; Charfeddine, Driss; Charlton, Dave; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Liming; Chen, Shenjian; Chen, Xin; Chen, Ye; Cheng, Hok Chuen; Cheng, Yangyang; Cheplakov, Alexander; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiefari, Giovanni; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Chouridou, Sofia; Chow, Bonnie Kar Bo; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciocio, Alessandra; Citron, Zvi Hirsh; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clemens, Jean-Claude; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Cogan, Joshua Godfrey; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Connell, Simon Henry; Connelly, Ian; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cooper-Smith, Neil; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Côté, David; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Daniells, Andrew Christopher; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davignon, Olivier; Davison, Adam; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dechenaux, Benjamin; Dedovich, Dmitri; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; DeMarco, David; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Dobos, Daniel; Doglioni, Caterina; Doherty, Tom; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Dudziak, Fanny; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Duschinger, Dirk; Dwuznik, Michal; Dyndal, Mateusz; Ebke, Johannes; Edson, William; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Engelmann, Roderich; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Favareto, Andrea; Fayard, Louis; Federic, Pavol; Fedin, Oleg; Fedorko, Wojciech; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Fernandez Perez, Sonia; Ferrag, Samir; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Julia; Fisher, Wade Cameron; Fitzgerald, Eric Andrew; Flechl, Martin; Fleck, Ivor; Fleischmann, Philipp; Fleischmann, Sebastian; Fletcher, Gareth Thomas; Fletcher, Gregory; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Flowerdew, Michael; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Franchino, Silvia; Francis, David; Franconi, Laura; Franklin, Melissa; Fraternali, Marco; French, Sky; Friedrich, Conrad; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Stephen; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giugni, Danilo; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gkougkousis, Evangelos Leonidas; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Glonti, George; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godlewski, Jan; Goeringer, Christian; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Grebenyuk, Oleg; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Grout, Zara Jane; Guan, Liang; Guenther, Jaroslav; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guicheney, Christophe; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Gupta, Shaun; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guttman, Nir; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Hall, David; Halladjian, Garabed; Hallewell, Gregory David; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Makoto; Hasegawa, Satoshi; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hays, Jonathan Michael; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Lukas; Hejbal, Jiri; Helary, Louis; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Hengler, Christopher; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herrberg-Schubert, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hoffmann, Dirk; Hohlfeld, Marc; Holmes, Tova Ray; Hong, Tae Min; Hooft van Huysduynen, Loek; Hopkins, Walter; Horii, Yasuyuki; Horton, Arthur James; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hrynevich, Aliaksei; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Hurwitz, Martina; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Idrissi, Zineb; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Ilchenko, Iurii; Iliadis, Dimitrios; Ilic, Nikolina; Inamaru, Yuki; Ince, Tayfun; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivarsson, Jenny; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansen, Hendrik; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanty, Laura; Jejelava, Juansher; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Johansson, Erik; Johansson, Per; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jung, Christian; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kajomovitz, Enrique; Kalderon, Charles William; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karastathis, Nikolaos; Kareem, Mohammad Jawad; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Katre, Akshay; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Kehoe, Robert; Keil, Markus; Keller, John; Kempster, Jacob Julian; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Keyes, Robert; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharlamov, Alexey; Khodinov, Alexander; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hee Yeun; Kim, Hyeon Jin; Kim, Shinhong; Kimura, Naoki; Kind, Oliver; King, Barry; King, Matthew; King, Robert Steven Beaufoy; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kiuchi, Kenji; Kladiva, Eduard; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Klok, Peter; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Koletsou, Iro; Koll, James; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; König, Sebastian; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumeli-Charalampidi, Athina; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kucuk, Hilal; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunigo, Takuto; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kurumida, Rie; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kyriazopoulos, Dimitrios; La Rosa, Alessandro; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laier, Heiko; Lambourne, Luke; Lammers, Sabine; Lampen, Caleb; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Hurng-Chun; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzen, Georg; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Leontsinis, Stefanos; Leroy, Claude; Lester, Christopher; Lester, Christopher Michael; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Bo; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Shu; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Lombardo, Vincenzo Paolo; Long, Brian Alexander; Long, Jonathan; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Feng; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lungwitz, Matthias; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Machado Miguens, Joana; Macina, Daniela; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeno, Mayuko; Maeno, Tadashi; Maevskiy, Artem; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Mahmoud, Sara; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany Andreina; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marjanovic, Marija; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Homero; Martinez, Mario; Martin-Haugh, Stewart; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazzaferro, Luca; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Mechnich, Joerg; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Meric, Nicolas; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Merritt, Hayes; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Middleton, Robin; Migas, Sylwia; Miglioranzi, Silvia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Minaenko, Andrey; Minami, Yuto; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Mönig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Morisbak, Vanja; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Morton, Alexander; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Klemens; Mueller, Thibaut; Mueller, Timo; Muenstermann, Daniel; Munwes, Yonathan; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagata, Kazuki; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Nanava, Gizo; Naranjo Garcia, Roger Felipe; Narayan, Rohin; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Nef, Pascal Daniel; Negri, Andrea; Negri, Guido; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Andrew; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Norberg, Scarlet; Nordberg, Markus; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nuti, Francesco; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Oide, Hideyuki; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olchevski, Alexander; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paganis, Efstathios; Pahl, Christoph; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panduro Vazquez, William; Pani, Priscilla; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pearce, James; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penwell, John; Perepelitsa, Dennis; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Perrino, Roberto; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Pettersson, Nora Emilia; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Pingel, Almut; Pinto, Belmiro; Pires, Sylvestre; Pitt, Michael; Pizio, Caterina; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Pluth, Daniel; Poddar, Sahill; Podlyski, Fabrice; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Pohl, Martin; Polesello, Giacomo; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Price, Darren; Price, Joe; Price, Lawrence; Prieur, Damien; Primavera, Margherita; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Przysiezniak, Helenka; Ptacek, Elizabeth; Puddu, Daniele; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quarrie, David; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Qureshi, Anum; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Rangel-Smith, Camila; Rao, Kanury; Rauscher, Felix; Rave, Tobias Christian; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reisin, Hernan; Relich, Matthew; Rembser, Christoph; Ren, Huan; Ren, Zhongliang; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Ridel, Melissa; Rieck, Patrick; Rieger, Julia; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Rodrigues, Luis; Roe, Shaun; Røhne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Matthew; Rose, Peyton; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Russell, Heather; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sabato, Gabriele; Sacerdoti, Sabrina; Saddique, Asif; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sartisohn, Georg; Sasaki, Osamu; Sasaki, Yuichi; Sauvage, Gilles; Sauvan, Emmanuel; Savard, Pierre; Savu, Dan Octavian; Sawyer, Craig; Sawyer, Lee; Saxon, David; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R~Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schroeder, Christian; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schwegler, Philipp; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seema, Pienpen; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekula, Stephen; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellers, Graham; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shoaleh Saadi, Diane; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simon, Dorian; Simoniello, Rosa; Sinervo, Pekka; Sinev, Nikolai; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skottowe, Hugh Philip; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Slawinska, Magdalena; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Song, Hong Ye; Soni, Nitesh; Sood, Alexander; Sopczak, Andre; Sopko, Bruno; Sopko, Vit; Sorin, Veronica; Sosebee, Mark; Soualah, Rachik; Soueid, Paul; Soukharev, Andrey; South, David; Spagnolo, Stefania; Spanò, Francesco; Spearman, William Robert; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; Spreitzer, Teresa; St Denis, Richard Dante; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Stavina, Pavel; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Strubig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Svatos, Michal; Swedish, Stephen; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanasijczuk, Andres Jorge; Tannenwald, Benjamin Bordy; Tannoury, Nancy; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Ray; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thong, Wai Meng; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tolley, Emma; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Topilin, Nikolai; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Tran, Huong Lan; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; True, Patrick; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turk Cakir, Ilkay; Turra, Ruggero; Turvey, Andrew John; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Uhlenbrock, Mathias; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urban, Jozef; Urbaniec, Dustin; Urquijo, Phillip; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; Van Der Leeuw, Robin; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vankov, Peter; Vannucci, Francois; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloso, Filipe; Velz, Thomas; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Virzi, Joseph; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Adrian; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Walsh, Brian; Wang, Chao; Wang, Chiho; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wendland, Dennis; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilkens, Henric George; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, Alan; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winter, Benedict Tobias; Wittgen, Matthias; Wittig, Tobias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wright, Michael; Wu, Mengqing; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yakabe, Ryota; Yamada, Miho; Yamaguchi, Hiroshi; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Yi; Yanush, Serguei; Yao, Liwen; Yao, Weiming; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Lei; Zhang, Ruiqi; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Yongke; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Lei; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Zinonos, Zinonas; Ziolkowski, Michael; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zutshi, Vishnu; Zwalinski, Lukasz

    2015-05-12

    A measurement of the top--antitop ($t\\bar{t}$) charge asymmetry is presented using data corresponding to an integrated luminosity of 4.6 fb$^{-1}$ of LHC $pp$ collisions at a centre-of-mass energy of 7 TeV collected by the ATLAS detector. Events with two charged leptons, at least two jets and large missing transverse momentum are selected. Two observables are studied: $A^{\\ell\\ell}_{\\textrm{C}}$ based on the identified charged leptons, and $A^{t\\bar{t}}_{\\textrm{C}}$, based on the reconstructed $t\\bar{t}$ final state. The asymmetries are measured to be \\begin{eqnarray*} A^{\\ell\\ell}_{\\textrm{C}} & = & 0.024 \\pm 0.015 ~\\textrm{(stat.)} \\pm 0.009 ~\\textrm{(syst.)}, \\end{eqnarray*} \\begin{eqnarray*} A^{t\\bar{t}}_{\\textrm{C}} & = & 0.021 \\pm 0.025 ~\\textrm{(stat.)} \\pm 0.017 ~\\textrm{(syst.)}. \\end{eqnarray*} The measured values are in agreement with the Standard Model predictions.

  20. Solvent-shared pairs of densely charged ions induce intense but short-range supra-additive slowdown of water rotation.

    Science.gov (United States)

    Vila Verde, Ana; Santer, Mark; Lipowsky, Reinhard

    2016-01-21

    The question "Can ions exert supra-additive effects on water dynamics?" has had several opposing answers from both simulation and experiment. We address this ongoing controversy by investigating water reorientation in aqueous solutions of two salts with large (magnesium sulfate) and small (cesium chloride) effects on water dynamics using molecular dynamics simulations and classical, polarizable models. The salt models are reparameterized to reproduce properties of both dilute and concentrated solutions. We demonstrate that water rotation in concentrated MgSO4 solutions is unexpectedly slow, in agreement with experiment, and that the slowdown is supra-additive: the observed slowdown is larger than that predicted by assuming that the resultant of the extra forces induced by the ions on the rotating water molecules tilts the free energy landscape associated with water rotation. Supra-additive slow down is very intense but short-range, and is strongly ion-specific: in contrast to the long-range picture initially proposed based on experiment, we find that intense supra-additivity is limited to water molecules directly bridging two ions in solvent-shared ion pair configuration; in contrast to a non-ion-specific origin to supra-additive effects proposed from simulations, we find that the magnitude of supra-additive slowdown strongly depends on the identity of the cations and anions. Supra-additive slowdown of water dynamics requires long-lived solvent-shared ion pairs; long-lived ion pairs should be typical for salts of multivalent ions. We discuss the origin of the apparent disagreement between the various studies on this topic and show that the short-range cooperative slowdown scenario proposed here resolves the existing controversy.

  1. New calculations of cross-sections and charge asymmetries for lepton pair production and wide angle Bhabha scattering in e+e- collisions near the Z-peak

    Science.gov (United States)

    Field, J. H.

    1994-03-01

    A new event generator for lepton pair production and wide angle Bhabha scattering, BHAGENE3, is presented. Both electroweak and higher order (beyond O(α) QED corrections are included. Comparisons are made with results from the programs, based on the structure function formalism, ALIBABA, TOPAZ0 and ZFITTER. For the case of the final states l+l-γγ ( l = e, μ, τ) BHAGENE3 results are compared with those of Monte Carlo generators that use the exact O( α2) amplitudes.

  2. Flavor changing effects on single charged Higgs boson production associated with a bottom-charm pair at CERN Large Hadron Collider

    International Nuclear Information System (INIS)

    Hao Sun; Ma Wengan; Zhang Renyou; Guo Lei; Han Liang; Jiang Yi

    2007-01-01

    We study flavor changing effects on the pp→bcH ± +X process at the Large Hadron Collider, which are inspired by the left-handed up-type squark mixings in the minimal supersymmetric standard model (MSSM). We find that the SUSY QCD radiative corrections to bcH ± coupling can significantly enhance the cross sections at the tree level by a factor about 1.5∼5 with our choice of parameters. We conclude that the squark-mixing mechanism in the MSSM makes the pp→bcH ± +X process a new channel for discovering a charged Higgs boson and investigating flavor changing effects

  3. Escaping carbon lock-in

    International Nuclear Information System (INIS)

    Unruh, G.C.

    2002-01-01

    This article explores the climate policy implications of the arguments made in ''Understanding carbon lock-in'' (Unruh, 2000), which posited that industrial countries have become locked-into fossil fuel-based energy systems through path dependent processes driven by increasing returns to scale. Carbon lock-in arises through technological, organizational, social and institutional co-evolution, ''culminating'' in what was termed as techno-institutional complex (TIC). In order to resolve the climate problem, an escape from the lock-in condition is required. However, due to the self-referential nature of TIC, escape conditions are unlikely to be generated internally and it is argued here that erogenous forces are probably required. (author)

  4. Measurement of the production cross-section of top quark pairs in the lepton+jets channel at D0 and ATLAS, and interpretation in terms of charged Higgs boson in ATLAS

    International Nuclear Information System (INIS)

    Chevallier, F.

    2007-05-01

    One of the main challenges of the current and future colliders TeVatron and LHC is the discovery of physics beyond the Standard Model. This goal may be accessible through precision measurements in the top quark sector. Deviations from theoretical predictions may bring to light the first indirect signs of new physics. The work exposed in this thesis deals with the production cross-section of top quark pairs via the strong interaction, within both D0 and ATLAS collaborations. Firstly, I have worked at D0 on the improvement of the reconstruction of soft electrons, in order to tag b-jets produced in top-anti top quarks events. Then I focused myself on the measurement of the top quark pair production cross-section with 420 pb -1 of D0 data. The measured cross-section is in agreement with the Standard Model expectations. In the ATLAS experiment, I tried to develop a procedure in order to select top quark pair events, using the knowledge and the techniques from the D0 experiment. This work also high-lighted the main systematic sources that can affect the sensitivity of the measurement. After one year of data taking at low luminosity, this preliminary analysis obtains a sensitivity at a few percent level, leading to a good discovery potential of new physic signs, like charged Higgs bosons. These new particles appear in non minimal standard models, and modify the phenomenology of top pair events. This new analysis has shown a good sensitivity for some regions of the parameter space. (author)

  5. EscapED: A Framework for Creating Educational Escape Rooms and Interactive Games to For Higher/Further Education.

    Directory of Open Access Journals (Sweden)

    Samantha Jane Clarke

    2017-09-01

    Full Text Available Game-based learning (GBL is often found to be technologically driven and more often than not, serious games for instance, are conceptualised and designed solely for digital platforms and state of the art technologies. To encourage a greater discussion on the potential benefits and challenges of a more holistic approach to developing GBL that promote human centered interactions and play for learning, the authors present the escapED programme. The escapED programme was conceived following the recent entertainment trend of escape rooms and is used for developing non-digital GBL approaches within education. escapED aids the design and creation of educational Escape Rooms and Interactive Gaming Experiences for staff and students in further/higher education settings. The paper first presents a pilot study that was used to assess the feasibility and acceptance of University teaching staff of embedding interactive GBL into a higher education environment. The authors then present the escapED theoretical framework that was used to create the prototype game for the pilot study as a tool to aid future design and development of on-site interactive experiences. The paper also presents an external developer report of using the escapED framework to develop a prototype game for teaching research methods to Southampton University students. Finally, the authors present a discussion on the use of the escapED framework so far and plans for future work and evaluation in order to provide engaging alternatives for learning and soft skills development amongst higher education staff andstudents.

  6. Measurement of the production cross-section of top quark pairs in the lepton+jets channel at D0 and ATLAS, and interpretation in terms of charged Higgs boson in ATLAS; Mesure de la section efficace de production de quarks top en paires dans le canal lepton+jets a D0 et a ATLAS et interpretation en terme de boson de Higgs charge dans ATLAS

    Energy Technology Data Exchange (ETDEWEB)

    Chevallier, F

    2007-05-15

    One of the main challenges of the current and future colliders TeVatron and LHC is the discovery of physics beyond the Standard Model. This goal may be accessible through precision measurements in the top quark sector. Deviations from theoretical predictions may bring to light the first indirect signs of new physics. The work exposed in this thesis deals with the production cross-section of top quark pairs via the strong interaction, within both D0 and ATLAS collaborations. Firstly, I have worked at D0 on the improvement of the reconstruction of soft electrons, in order to tag b-jets produced in top-anti top quarks events. Then I focused myself on the measurement of the top quark pair production cross-section with 420 pb{sup -1} of D0 data. The measured cross-section is in agreement with the Standard Model expectations. In the ATLAS experiment, I tried to develop a procedure in order to select top quark pair events, using the knowledge and the techniques from the D0 experiment. This work also high-lighted the main systematic sources that can affect the sensitivity of the measurement. After one year of data taking at low luminosity, this preliminary analysis obtains a sensitivity at a few percent level, leading to a good discovery potential of new physic signs, like charged Higgs bosons. These new particles appear in non minimal standard models, and modify the phenomenology of top pair events. This new analysis has shown a good sensitivity for some regions of the parameter space. (author)

  7. Phased charging and discharging in capacitive desalinatio

    Science.gov (United States)

    Stadermann, Michael; Qu, Yatian; Santiago, Juan G.; Hemmatifar, Ali

    2017-09-12

    A system combines complete, ultra-thin cells into a monolithic and robust framework necessary for desalination applications which yields orders of magnitude faster desalination. The electrode pairs are located so that a flow of feed water flows through or around the electrode pairs with the flow perpendicular to sequentially applied electric potentials. The system is controlled to charge the series of electrode pairs sequentially or phased. That means the charging of the second electrode pair is delayed with regard to the charging of the first electrode pair and the charging of a third electrode pair is delayed with respect to the charging of the second electrode pair.

  8. Mahonian pairs

    OpenAIRE

    Sagan, Bruce E.; Savage, Carla D.

    2012-01-01

    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  9. Charge disproportionation of mixed-valent Cr triggered by Bi lone-pair effect in the A -site-ordered perovskite BiC u3C r4O12

    Science.gov (United States)

    Etter, Martin; Isobe, Masahiko; Sakurai, Hiroya; Yaresko, Alexander; Dinnebier, Robert E.; Takagi, Hidenori

    2018-05-01

    A new A -site-ordered perovskite BiC u3C r4O12 is synthesized under a high pressure of 7.7 GPa. A phase transition from a paramagnetic metal to a ferrimagnetic metal is observed at Tc=190 K accompanied with a structural change from cubic to monoclinic. Structural analysis of the low-temperature monoclinic phase reveals that this transition represents a charge disproportionation of C r3.75 + into C r4 + and C r3.5 + . We argue that the asymmetric displacement of Bi caused by a lone-pair effect triggers the formation of a dimeric Cr4+2O5 unit and leads to an ordering of C r4 + and C r3.5 + below the transition.

  10. Malaria parasites: the great escape

    Directory of Open Access Journals (Sweden)

    Laurent Rénia

    2016-11-01

    Full Text Available Parasites of the genus Plasmodium have a complex life cycle. They alternate between their final mosquito host and their intermediate hosts. The parasite can be either extra- or intracellular, depending on the stage of development. By modifying their shape, motility, and metabolic requirements, the parasite adapts to the different environments in their different hosts. The parasite has evolved to escape the multiple immune mechanisms in the host that try to block parasite development at the different stages of their development. In this article, we describe the mechanisms reported thus far that allow the Plasmodium parasite to evade innate and adaptive immune responses.

  11. Search for pair-produced vector-like quarks of charge -1/3 decaying to bH using boosted Higgs jet-tagging in pp collisions at sqrt(s) = 8 TeV

    CERN Document Server

    CMS Collaboration

    2014-01-01

    A search is performed for the pair-production of a heavy vector-like quark ${\\rm b'}$ of charge $-1/3$ and its anti-particle, using data collected by the CMS experiment, from the LHC pp collisions at centre-of-mass energy of 8 TeV and corresponding to an integrated luminosity of 19.7 fb$^{-1}$. We search for the ${\\rm b'}$ quark decaying to a Higgs-boson and a b quark, assuming a branching ratio of 100$\\%$, in a final state containing a fat jet to reconstruct the boosted Higgs boson and one or more b-tagged jets. The multijets background is evaluated entirely from the data while the t$\\overline{\\rm t}$+jets background is obtained from simulations. In the absence of a signal excess significantly above the estimated background, we place a limit on the ${\\rm b'}$ quark-antiquark pair-production cross section and hence on the ${\\rm b'}$ quark mass. We exclude ${\\rm b'}$ quarks for masses below 846 GeV at 95$\\%$ confidence level, while the expected limit is 811 GeV.

  12. Measurement of the charge asymmetry in top-quark pair production in the lepton-plus-jets final state in $pp$ collision data at $\\sqrt{s}=8$ TeV with the ATLAS detector

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdinov, Ovsat; Aben, Rosemarie; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Affolder, Tony; Agatonovic-Jovin, Tatjana; Agricola, Johannes; Aguilar-Saavedra, Juan Antonio; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alio, Lion; Alison, John; Alkire, Steven Patrick; Allbrooke, Benedict; Allport, Phillip; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Άlvarez Piqueras, Damián; Alviggi, Mariagrazia; Amadio, Brian Thomas; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anders, John Kenneth; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Arabidze, Giorgi; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arduh, Francisco Anuar; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Axen, Bradley; Ayoub, Mohamad Kassem; Azuelos, Georges; Baak, Max; Baas, Alessandra; Baca, Matthew John; Bacci, Cesare; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bain, Travis; Baines, John; Baker, Oliver Keith; Baldin, Evgenii; Balek, Petr; Balestri, Thomas; Balli, Fabrice; Balunas, William Keaton; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Barak, Liron; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnes, Sarah Louise; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Basalaev, Artem; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batista, Santiago Juan; Batley, Richard; Battaglia, Marco; Bauce, Matteo; Bauer, Florian; Bawa, Harinder Singh; Beacham, James Baker; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Kathrin; Becker, Maurice; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Janna Katharina; Belanger-Champagne, Camille; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bender, Michael; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Bentvelsen, Stan; Beresford, Lydia; Beretta, Matteo; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Bernard, Clare; Bernard, Nathan Rogers; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertsche, Carolyn; Bertsche, David; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bevan, Adrian John; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Biedermann, Dustin; Bieniek, Stephen Paul; Biesuz, Nicolo Vladi; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Biondi, Silvia; Bjergaard, David Martin; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blanco, Jacobo Ezequiel; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Blunier, Sylvain; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boehler, Michael; Bogaerts, Joannes Andreas; Bogavac, Danijela; Bogdanchikov, Alexander; Bohm, Christian; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boutle, Sarah Kate; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozic, Ivan; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Breaden Madden, William Dmitri; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Lydia; Brenner, Richard; Bressler, Shikma; Bristow, Timothy Michael; Britton, Dave; Britzger, Daniel; Brochu, Frederic; Brock, Ian; Brock, Raymond; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bruscino, Nello; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Buchholz, Peter; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Buehrer, Felix; Bugge, Lars; Bugge, Magnar Kopangen; Bulekov, Oleg; Bullock, Daniel; Burckhart, Helfried; Burdin, Sergey; Burgard, Carsten Daniel; Burghgrave, Blake; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Buzykaev, Aleksey; Cabrera Urbán, Susana; Caforio, Davide; Cairo, Valentina; Cakir, Orhan; Calace, Noemi; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Caloba, Luiz; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarda, Stefano; Camarri, Paolo; Cameron, David; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Carbone, Ryne Michael; Cardarelli, Roberto; Cardillo, Fabio; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Caudron, Julien; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Cerny, Karel; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chan, Yat Long; Chang, Philip; Chapman, John Derek; Charlton, Dave; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Liming; Chen, Shenjian; Chen, Shion; Chen, Xin; Chen, Ye; Cheng, Hok Chuen; Cheng, Yangyang; Cheplakov, Alexander; Cheremushkina, Evgenia; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiarelli, Giorgio; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Choi, Kyungeon; Chouridou, Sofia; Chow, Bonnie Kar Bo; Christodoulou, Valentinos; Chromek-Burckhart, Doris; Chudoba, Jiri; Chuinard, Annabelle Julia; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Cinca, Diane; Cindro, Vladimir; Cioara, Irina Antonela; Ciocio, Alessandra; Cirotto, Francesco; Citron, Zvi Hirsh; Ciubancan, Mihai; Clark, Allan G; Clark, Brian Lee; Clark, Philip James; Clarke, Robert; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Cogan, Joshua Godfrey; Colasurdo, Luca; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Connell, Simon Henry; Connelly, Ian; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Côté, David; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cúth, Jakub; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Dandoy, Jeffrey Rogers; Dang, Nguyen Phuong; Daniells, Andrew Christopher; Danninger, Matthias; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Benedetti, Abraham; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dedovich, Dmitri; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Delgove, David; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; DeMarco, David; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Dette, Karola; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Diaconu, Cristinel; Diamond, Miriam; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Dobos, Daniel; Dobre, Monica; Doglioni, Caterina; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Drechsler, Eric; Dris, Manolis; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Duschinger, Dirk; Dutta, Baishali; Dyndal, Mateusz; Eckardt, Christoph; Ecker, Katharina Maria; Edgar, Ryan Christopher; Edson, William; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Elliot, Alison; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Erdmann, Johannes; Ereditato, Antonio; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Faucci Giannelli, Michele; Favareto, Andrea; Fayard, Louis; Fedin, Oleg; Fedorko, Wojciech; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Feremenga, Last; Fernandez Martinez, Patricia; Fernandez Perez, Sonia; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Cora; Fischer, Julia; Fisher, Wade Cameron; Flaschel, Nils; Fleck, Ivor; Fleischmann, Philipp; Fletcher, Gareth Thomas; Fletcher, Gregory; Fletcher, Rob Roy MacGregor; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Flowerdew, Michael; Formica, Andrea; Forti, Alessandra; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Francis, David; Franconi, Laura; Franklin, Melissa; Frate, Meghan; Fraternali, Marco; Freeborn, David; French, Sky; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fusayasu, Takahiro; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gach, Grzegorz; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yanyan; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudiello, Andrea; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geich-Gimbel, Christoph; Geisler, Manuel Patrice; Gemme, Claudia; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghasemi, Sara; Ghazlane, Hamid; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gibbard, Bruce; Gibson, Stephen; Gignac, Matthew; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giromini, Paolo; Giugni, Danilo; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gkougkousis, Evangelos Leonidas; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godlewski, Jan; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Goujdami, Driss; Goussiou, Anna; Govender, Nicolin; Gozani, Eitan; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Gradin, Per Olov Joakim; Grafström, Per; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Greenwood, Zeno Dixon; Grefe, Christian; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Grout, Zara Jane; Guan, Liang; Guenther, Jaroslav; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Guo, Yicheng; Gupta, Shaun; Gustavino, Giuliano; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Haley, Joseph; Hall, David; Halladjian, Garabed; Hallewell, Gregory David; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamilton, Andrew; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Haney, Bijan; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Maike Christina; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harrington, Robert; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Makoto; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauser, Reiner; Hauswald, Lorenz; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hays, Jonathan Michael; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Lukas; Hejbal, Jiri; Helary, Louis; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Hengler, Christopher; Henkelmann, Steffen; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hetherly, Jeffrey Wayne; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hinman, Rachel Reisner; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hohlfeld, Marc; Hohn, David; Holmes, Tova Ray; Homann, Michael; Hong, Tae Min; Hopkins, Walter; Horii, Yasuyuki; Horton, Arthur James; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hrynevich, Aliaksei; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Qipeng; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Idrissi, Zineb; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Ilchenko, Iurii; Iliadis, Dimitrios; Ilic, Nikolina; Ince, Tayfun; Introzzi, Gianluca; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivarsson, Jenny; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jabbar, Samina; Jackson, Brett; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansky, Roland; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanty, Laura; Jejelava, Juansher; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Yi; Jiggins, Stephen; Jimenez Pena, Javier; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Johansson, Per; Johns, Kenneth; Johnson, William Joseph; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kahn, Sebastien Jonathan; Kajomovitz, Enrique; Kalderon, Charles William; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneti, Steven; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kaplan, Laser Seymour; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karamaoun, Andrew; Karastathis, Nikolaos; Kareem, Mohammad Jawad; Karentzos, Efstathios; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kasahara, Kota; Kashif, Lashkar; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Kato, Chikuma; Katre, Akshay; Katzy, Judith; Kawade, Kentaro; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Keeler, Richard; Kehoe, Robert; Keller, John; Kempster, Jacob Julian; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Keyes, Robert; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharlamov, Alexey; Khoo, Teng Jian; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kido, Shogo; Kim, Hee Yeun; Kim, Shinhong; Kim, Young-Kee; Kimura, Naoki; Kind, Oliver Maria; King, Barry; King, Matthew; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kiuchi, Kenji; Kivernyk, Oleh; Kladiva, Eduard; Klein, Matthew Henry; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Knapik, Joanna; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Aine; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Kolb, Mathis; Koletsou, Iro; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Kortner, Oliver; Kortner, Sandra; Kosek, Tomas; Kostyukhin, Vadim; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumeli-Charalampidi, Athina; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Krizka, Karol; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Krumnack, Nils; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kucuk, Hilal; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuger, Fabian; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kukla, Romain; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunigo, Takuto; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwan, Tony; Kyriazopoulos, Dimitrios; La Rosa, Alessandro; La Rosa Navarro, Jose Luis; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Lambourne, Luke; Lammers, Sabine; Lampen, Caleb; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lange, J örn Christian; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Lanza, Agostino; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Lazovich, Tomo; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeBlanc, Matthew Edgar; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Leontsinis, Stefanos; Leroy, Claude; Lester, Christopher; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Lewis, Adrian; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Shu; Li, Xingguo; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Liblong, Aaron; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Hao; Liu, Jian; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loew, Kevin Michael; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Long, Brian Alexander; Long, Jonathan David; Long, Robin Eamonn; Looper, Kristina Anne; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Lösel, Philipp Jonathan; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lu, Haonan; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luedtke, Christian; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Macdonald, Calum Michael; Maček, Boštjan; Machado Miguens, Joana; Macina, Daniela; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeda, Junpei; Maeland, Steffen; Maeno, Tadashi; Maevskiy, Artem; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maier, Thomas; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mancini, Giada; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany; Mann, Alexander; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mantoani, Matteo; Mapelli, Livio; March, Luis; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marjanovic, Marija; Marley, Daniel; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Mario; Martin-Haugh, Stewart; Martoiu, Victor Sorin; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazza, Simone Michele; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Meyer Zu Theenhausen, Hanno; Middleton, Robin; Miglioranzi, Silvia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milesi, Marco; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Minaenko, Andrey; Minami, Yuto; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mistry, Khilesh; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Monden, Ryutaro; Mönig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montalbano, Alyssa; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Mori, Daniel; Mori, Tatsuya; Morii, Masahiro; Morinaga, Masahiro; Morisbak, Vanja; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Mortensen, Simon Stark; Morton, Alexander; Morvaj, Ljiljana; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Ralph Soeren Peter; Mueller, Thibaut; Muenstermann, Daniel; Mullen, Paul; Mullier, Geoffrey; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nachman, Benjamin Philip; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagata, Kazuki; Nagel, Martin; Nagy, Elemer; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Naranjo Garcia, Roger Felipe; Narayan, Rohin; Narrias Villar, Daniel Isaac; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Nef, Pascal Daniel; Negri, Andrea; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Andrew; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolopoulos, Konstantinos; Nilsen, Jon Kerr; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nomachi, Masaharu; Nomidis, Ioannis; Nooney, Tamsin; Norberg, Scarlet; Nordberg, Markus; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nuti, Francesco; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Ochoa-Ricoux, Juan Pedro; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Oide, Hideyuki; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onogi, Kouta; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Owen, Rhys Edward; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paganis, Efstathios; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Palma, Alberto; Pan, Yibin; Panagiotopoulou, Evgenia; Pandini, Carlo Enrico; Panduro Vazquez, William; Pani, Priscilla; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parker, Kerry Ann; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Pauly, Thilo; Pearce, James; Pearson, Benjamin; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Penc, Ondrej; Peng, Cong; Peng, Haiping; Penning, Bjoern; Penwell, John; Perepelitsa, Dennis; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petroff, Pierre; Petrolo, Emilio; Petrucci, Fabrizio; Pettersson, Nora Emilia; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Pickering, Mark Andrew; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pin, Arnaud Willy J; Pina, João Antonio; Pinamonti, Michele; Pinfold, James; Pingel, Almut; Pires, Sylvestre; Pirumov, Hayk; Pitt, Michael; Pizio, Caterina; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Pluth, Daniel; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Polesello, Giacomo; Poley, Anne-luise; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Prell, Soeren; Price, Darren; Price, Lawrence; Primavera, Margherita; Prince, Sebastien; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Ptacek, Elizabeth; Puddu, Daniele; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quarrie, David; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Raddum, Silje; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Rangel-Smith, Camila; Rauscher, Felix; Rave, Stefan; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reichert, Joseph; Reisin, Hernan; Rembser, Christoph; Ren, Huan; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Richter, Stefan; Richter-Was, Elzbieta; Ricken, Oliver; Ridel, Melissa; Rieck, Patrick; Riegel, Christian Johann; Rieger, Julia; Rifki, Othmane; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ristić, Branislav; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Roe, Shaun; Røhne, Ole; Romaniouk, Anatoli; Romano, Marino; Romano Saez, Silvestre Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Peyton; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Jonatan; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Russell, Heather; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sabato, Gabriele; Sacerdoti, Sabrina; Saddique, Asif; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Saha, Puja; Sahinsoy, Merve; Saimpert, Matthias; Saito, Tomoyuki; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Salazar Loyola, Javier Esteban; Saleem, Muhammad; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sammel, Dirk; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sannino, Mario; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sasaki, Osamu; Sasaki, Yuichi; Sato, Koji; Sauvage, Gilles; Sauvan, Emmanuel; Savage, Graham; Savard, Pierre; Sawyer, Craig; Sawyer, Lee; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaeffer, Jan; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Schiavi, Carlo; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schmitt, Stefan; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schopf, Elisabeth; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schwegler, Philipp; Schweiger, Hansdieter; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seema, Pienpen; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekhon, Karishma; Sekula, Stephen; Seliverstov, Dmitry; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Sessa, Marco; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shaw, Savanna Marie; Shcherbakova, Anna; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shoaleh Saadi, Diane; Shochet, Mel; Shojaii, Seyedruhollah; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidebo, Per Edvin; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silver, Yiftah; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simon, Dorian; Sinervo, Pekka; Sinev, Nikolai; Sioli, Maximiliano; Siragusa, Giovanni; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skinner, Malcolm Bruce; Skottowe, Hugh Philip; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Slawinska, Magdalena; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Matthew; Smith, Russell; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Sokhrannyi, Grygorii; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Song, Hong Ye; Soni, Nitesh; Sood, Alexander; Sopczak, Andre; Sopko, Bruno; Sopko, Vit; Sorin, Veronica; Sosa, David; Sosebee, Mark; Sotiropoulou, Calliope Louisa; Soualah, Rachik; Soukharev, Andrey; South, David; Sowden, Benjamin; Spagnolo, Stefania; Spalla, Margherita; Spangenberg, Martin; Spanò, Francesco; Spearman, William Robert; Sperlich, Dennis; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; St Denis, Richard Dante; Stabile, Alberto; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Strubig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Shota; Svatos, Michal; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Shuji; Tannenwald, Benjamin Bordy; Tannoury, Nancy; Tapia Araya, Sebastian; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Frank; Taylor, Geoffrey; Taylor, Pierre Thor Elliot; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Temple, Darren; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Tepel, Fabian-Phillipp; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Ray; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thun, Rudolf; Tibbetts, Mark James; Ticse Torres, Royer Edson; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todome, Kazuki; Todorov, Theodore; Todorova-Nova, Sharka; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tolley, Emma; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; Truong, Loan; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsui, Ka Ming; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turra, Ruggero; Turvey, Andrew John; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urban, Jozef; Urquijo, Phillip; Urrejola, Pedro; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valderanis, Chrysostomos; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vannucci, Francois; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloce, Laurelle Maria; Veloso, Filipe; Velz, Thomas; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wang, Chao; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Tingting; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Washbrook, Andrew; Wasicki, Christoph; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; Wharton, Andrew Mark; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wildauer, Andreas; Wilkens, Henric George; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, Alan; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winter, Benedict Tobias; Wittgen, Matthias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wu, Mengqing; Wu, Miles; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yakabe, Ryota; Yamada, Miho; Yamaguchi, Daiki; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Shimpei; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Yi; Yao, Weiming; Yap, Yee Chinn; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yuen, Stephanie P; Yurkewicz, Adam; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zalieckas, Justas; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zeng, Qi; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Guangyi; Zhang, Huijun; Zhang, Jinlong; Zhang, Lei; Zhang, Ruiqi; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Xiandong; Zhao, Yongke; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Chen; Zhou, Lei; Zhou, Li; Zhou, Mingliang; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Stephanie; Zinonos, Zinonas; Zinser, Markus; Ziolkowski, Michael; Živković, Lidija; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zwalinski, Lukasz

    2016-02-19

    This paper reports inclusive and differential measurements of the $t\\bar{t}$ charge asymmetry $A_{\\text{C}}$ in 20.3 fb$^{-1}$ of $\\sqrt{s} = 8$ TeV $pp$ collisions recorded by the ATLAS experiment at the Large Hadron Collider at CERN. Three differential measurements are performed as a function of the invariant mass, transverse momentum and longitudinal boost of the $t\\bar{t}$ system. The $t\\bar{t}$ pairs are selected in the single-lepton channels ($e$ or $\\mu$) with at least four jets, and a likelihood fit is used to reconstruct the $t\\bar{t}$ event kinematics. A Bayesian unfolding procedure is performed to infer the asymmetry at parton level from the observed data distribution. The inclusive $t\\bar{t}$ charge asymmetry is measured to be $A_{\\text{C}} = 0.009 \\pm 0.005$ (stat.$+$syst.). The inclusive and differential measurements are compatible with the values predicted by the Standard Model.

  13. Two examples of escaping harmonic maps

    International Nuclear Information System (INIS)

    Pereira do Valle, A.; Verjovsky, A.

    1988-12-01

    This paper is part of a study on the existence of special harmonic maps on complete non-compact Riemannian manifolds. We generalize the notion of escaping geodesic and prove some results on the existence of escaping harmonic maps. 11 refs, 6 figs

  14. Physics escape room as an educational tool

    Science.gov (United States)

    Vörös, Alpár István Vita; Sárközi, Zsuzsa

    2017-12-01

    Escape rooms have flourished in the last decade. These are adventure games in which players work together to solve puzzles using hints, clues and a strategy to escape from a locked room. In many cases they use different phenomena related to physics. Hence the idea of using escape rooms in science centers or even in classroom activities. Escape rooms are designed for one single team of players, the method is more suitable for activities in a science centre. In our paper, we show that escape rooms' puzzle solving methods could be used in physics classroom activities as well, taking into account that several teams have to work together in the same room/place. We have developed an educational escape game for physics of fluids, as this topic is left out from the Romanian high-school curriculum. We have tried out our game during the project week called "Şcoala altfel" ("school in a different way") and in a physics camp for gifted students. We present the designed physics escape game and the results.

  15. A Model for SEP Escape

    Science.gov (United States)

    Antiochos, S. K.; Masson, S.; DeVore, C. R.

    2012-01-01

    Magnetic reconnection in the solar atmosphere is believed to be the driver of most solar explosive phenomena. Therefore, the topology of the coronal magnetic field is central to understanding the solar drivers of space weather. Of particular importance to space weather are the impulsive Solar Energetic particles that are associated with some CME/eruptive flare events. Observationally, the magnetic configuration of active regions where solar eruptions originate appears to agree with the standard eruptive flare model. According to this model, particles accelerated at the flare reconnection site should remain trapped in the corona and the ejected plasmoid. However, flare-accelerated particles frequently reach the Earth long before the CME does. We present a model that may account for the injection of energetic particles onto open magnetic flux tubes connecting to the Earth. Our model is based on the well-known 2.5D breakout topology, which has a coronal null point (null line) and a four-flux system. A key new addition, however, is that we include an isothermal solar wind with open-flux regions. Depending on the location of the open flux with respect to the null point, we find that the flare reconnection can consist of two distinct phases. At first, the flare reconnection involves only closed field, but if the eruption occurs close to the open field, we find a second phase involving interchange reconnection between open and closed. We argue that this second reconnection episode is responsible for the injection of flare-accelerated particles into the interplanetary medium. We will report on our recent work toward understanding how flare particles escape to the heliosphere. This work uses high-resolution 2.5D MHD numerical simulations performed with the Adaptively Refined MHD Solver (ARMS).

  16. Narrow Escape of Interacting Diffusing Particles

    Science.gov (United States)

    Agranov, Tal; Meerson, Baruch

    2018-03-01

    The narrow escape problem deals with the calculation of the mean escape time (MET) of a Brownian particle from a bounded domain through a small hole on the domain's boundary. Here we develop a formalism which allows us to evaluate the nonescape probability of a gas of diffusing particles that may interact with each other. In some cases the nonescape probability allows us to evaluate the MET of the first particle. The formalism is based on the fluctuating hydrodynamics and the recently developed macroscopic fluctuation theory. We also uncover an unexpected connection between the narrow escape of interacting particles and thermal runaway in chemical reactors.

  17. Guanidinium Pairing Facilitates Membrane Translocation

    Czech Academy of Sciences Publication Activity Database

    Allolio, Christoph; Baxová, Katarína; Vazdar, M.; Jungwirth, Pavel

    2016-01-01

    Roč. 120, č. 1 (2016), s. 143-153 ISSN 1520-6106 R&D Projects: GA ČR GA13-06181S Institutional support: RVO:61388963 Keywords : ab initio molecular dynamics * guanidinium * like charge pairing * membrane Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.177, year: 2016

  18. Dynamic Escape Routes for Naval Ships

    National Research Council Canada - National Science Library

    Villalonga, Francisco J

    2005-01-01

    This thesis addresses the problem of optimal evacuation of a naval ship. We propose the use of a dynamic escape-route system which employs a signaling system to adapt the emergency egress process to the instigating contingency...

  19. St.Petersburg Escape Experience Tour

    OpenAIRE

    Palagina, Mariia; Zhak, Svetlana

    2017-01-01

    The growing popularity of Russia as a tourist destination and the high interest towards escape rooms and quests opens new business opportunities and market niches. The aim of this thesis is to develop a tourist product based on the new escape room tourism concept combining the historical, cultural and game experiences. The choice of the theme and destination was determined by the authors’ personal backgrounds and the destination proximity to Finland. The theoretical research was implement...

  20. Cerebrospinal Fluid HIV Escape from Antiretroviral Therapy.

    Science.gov (United States)

    Ferretti, Francesca; Gisslen, Magnus; Cinque, Paola; Price, Richard W

    2015-06-01

    CNS infection is a nearly constant facet of systemic CNS infection and is generally well controlled by suppressive systemic antiretroviral therapy (ART). However, there are instances when HIV can be detected in the cerebrospinal fluid (CSF) despite suppression of plasma viruses below the clinical limits of measurement. We review three types of CSF viral escape: asymptomatic, neuro-symptomatic, and secondary. The first, asymptomatic CSF escape, is seemingly benign and characterized by lack of discernable neurological deterioration or subsequent CNS disease progression. Neuro-symptomatic CSF escape is an uncommon, but important, entity characterized by new or progressive CNS disease that is critical to recognize clinically because of its management implications. Finally, secondary CSF escape, which may be even more uncommon, is defined by an increase of CSF HIV replication in association with a concomitant non-HIV infection, as a consequence of the local inflammatory response. Understanding these CSF escape settings not only is important for clinical diagnosis and management but also may provide insight into the CNS HIV reservoir.

  1. Thermal escape from extrasolar giant planets.

    Science.gov (United States)

    Koskinen, Tommi T; Lavvas, Panayotis; Harris, Matthew J; Yelle, Roger V

    2014-04-28

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres.

  2. Black holes escaping from domain walls

    International Nuclear Information System (INIS)

    Flachi, Antonino; Sasaki, Misao; Pujolas, Oriol; Tanaka, Takahiro

    2006-01-01

    Previous studies concerning the interaction of branes and black holes suggested that a small black hole intersecting a brane may escape via a mechanism of reconnection. Here we consider this problem by studying the interaction of a small black hole and a domain wall composed of a scalar field and simulate the evolution of this system when the black hole acquires an initial recoil velocity. We test and confirm previous results, however, unlike the cases previously studied, in the more general set-up considered here, we are able to follow the evolution of the system also during the separation, and completely illustrate how the escape of the black hole takes place

  3. Martian Atmospheric and Ionospheric plasma Escape

    Science.gov (United States)

    Lundin, Rickard

    2016-04-01

    Solar forcing is responsible for the heating, ionization, photochemistry, and erosion processes in the upper atmosphere throughout the lifetime of the terrestrial planets. Of the four terrestrial planets, the Earth is the only one with a fully developed biosphere, while our kin Venus and Mars have evolved into arid inhabitable planets. As for Mars, there are ample evidences for an early Noachian, water rich period on Mars. The question is, what made Mars evolve so differently compared to the Earth? Various hydrosphere and atmospheric evolution scenarios for Mars have been forwarded based on surface morphology, chemical composition, simulations, semi-empiric (in-situ data) models, and the long-term evolution of the Sun. Progress has been made, but the case is still open regarding the changes that led to the present arid surface and tenuous atmosphere at Mars. This presentation addresses the long-term variability of the Sun, the solar forcing impact on the Martian atmosphere, and its interaction with the space environment - an electromagnetic wave and particle interaction with the upper atmosphere that has implications for its photochemistry, composition, and energization that governs thermal and non-thermal escape. Non-thermal escape implies an electromagnetic upward energization of planetary ions and molecules to velocities above escape velocity, a process governed by a combination of solar EUV radiation (ionization), and energy and momentum transfer by the solar wind. The ion escape issue dates back to the early Soviet and US-missions to Mars, but the first more accurate estimates of escape rates came with the Phobos-2 mission in 1989. Better-quality ion composition measurement results of atmospheric/ionospheric ion escape from Mars, obtained from ESA Mars Express (MEX) instruments, have improved our understanding of the ion escape mechanism. With the NASA MAVEN spacecraft orbiting Mars since Sept. 2014, dual in-situ measurement with plasma instruments are now

  4. Do the visual conditions at the point of escape affect European sea bass escape behavior?

    Directory of Open Access Journals (Sweden)

    I.E. PAPADAKIS

    2013-03-01

    Full Text Available European sea bass (Dicentrarchus labrax, an important species for the Mediterranean aquaculture industry, has been reported to escape from sea cage installations. Fish escapes are caused mainly by operational and technical failures that eventually result into a creation of a tear. Escapees may interact with wild stocks through interbreeding, transfer of pathogens and competition for food. The aim of this study was to examine at which extent the presence of a visible obstacle close to a tear on the net have an influence on sea bass propensity to escape. Fish were initially confined into small sea cages, with a tear at one side. The escape behavior was tested under experimental conditions. It is clearly demonstrated that sea bass was able to locate a tear on the net pen, immediately after its appearance. Crossings occurred in all cages, in singles or in a series of up to seven individuals. The presence of an obstacle close to the net tear altered the escape behavior of D. labrax resulting in a delay that eventually reduced the escape rate. Concluding, it is highly recommended that sea bass cages should be kept internally the culture array. Furthermore, the placement of artificial obstacles close to the sea cages could be an efficient practice that mitigates the escape risk after severe environmental conditions.

  5. Escape rate for nonequilibrium processes dominated by strong non-detailed balance force

    Science.gov (United States)

    Tang, Ying; Xu, Song; Ao, Ping

    2018-02-01

    Quantifying the escape rate from a meta-stable state is essential to understand a wide range of dynamical processes. Kramers' classical rate formula is the product of an exponential function of the potential barrier height and a pre-factor related to the friction coefficient. Although many applications of the rate formula focused on the exponential term, the prefactor can have a significant effect on the escape rate in certain parameter regions, such as the overdamped limit and the underdamped limit. There have been continuous interests to understand the effect of non-detailed balance on the escape rate; however, how the prefactor behaves under strong non-detailed balance force remains elusive. In this work, we find that the escape rate formula has a vanishing prefactor with decreasing friction strength under the strong non-detailed balance limit. We both obtain analytical solutions in specific examples and provide a derivation for more general cases. We further verify the result by simulations and propose a testable experimental system of a charged Brownian particle in electromagnetic field. Our study demonstrates that a special care is required to estimate the effect of prefactor on the escape rate when non-detailed balance force dominates.

  6. Learning from escaped prescribed fire reviews

    Science.gov (United States)

    Anne E. Black; Dave Thomas; James Saveland; Jennifer D. Ziegler

    2011-01-01

    The U.S. wildland fire community has developed a number of innovative methods for conducting a review following escape of a prescribed fire (expanding on the typical regional or local reviews, to include more of a learning focus - expanded After Action Reviews, reviews that incorporate High Reliability Organizing, Facilitated Learning Analyses, etc). The stated purpose...

  7. Genomics of Stress Escape in Arabidopsis Thaliana

    NARCIS (Netherlands)

    Das, D.

    2016-01-01

    In nature, two highly diverse environmental signals, flooding and shade, sensed through their own unique receptor systems, share physiological and molecular similarities in the context of accelerated shoot elongation in plants (a conserved stress-escape strategy), suggesting a possible cross-talk

  8. Centrifugally Stimulated Exospheric Ion Escape at Mercury

    Science.gov (United States)

    Delcourt, Dominique; Seki, K.; Terada, N.; Moore, Thomas E.

    2012-01-01

    We investigate the transport of ions in the low-altitude magnetosphere magnetosphere of Mercury. We show that, because of small spatial scales, the centrifugal effect due to curvature of the E B drift paths can lead to significant particle energization in the parallel direction. We demonstrate that because of this effect, ions with initial speed smaller than the escape speed such as those produced via thermal desorption can overcome gravity and escape into the magnetosphere. The escape route of this low-energy exosphere originating material is largely controlled by the magnetospheric convection rate. This escape route spreads over a narrower range of altitudes when the convection rate increases. Bulk transport of low-energy planetary material thus occurs within a limited region of space once moderate magnetospheric convection is established. These results suggest that, via release of material otherwise gravitationally trapped, the E B related centrifugal acceleration is an important mechanism for the net supply of plasma to the magnetosphere of Mercury.

  9. Pade approximant calculations for neutron escape probability

    International Nuclear Information System (INIS)

    El Wakil, S.A.; Saad, E.A.; Hendi, A.A.

    1984-07-01

    The neutron escape probability from a non-multiplying slab containing internal source is defined in terms of a functional relation for the scattering function for the diffuse reflection problem. The Pade approximant technique is used to get numerical results which compare with exact results. (author)

  10. Net escapement of Antartic krill in trawls

    DEFF Research Database (Denmark)

    Krafft, B.A.; Krag, Ludvig Ahm; Herrmann, Bent

    This document describes the aims and methodology of a three year project (commenced in 2012) entitled Net Escapement of Antarctic krill in Trawls (NEAT). The study will include a morphology based mathematical modeling (FISHSELECT) of different sex and maturity groups of Antarctic krill (Euphausia...

  11. Life events and escape in conversion disorder.

    Science.gov (United States)

    Nicholson, T R; Aybek, S; Craig, T; Harris, T; Wojcik, W; David, A S; Kanaan, R A

    2016-09-01

    Psychological models of conversion disorder (CD) traditionally assume that psychosocial stressors are identifiable around symptom onset. In the face of limited supportive evidence such models are being challenged. Forty-three motor CD patients, 28 depression patients and 28 healthy controls were assessed using the Life Events and Difficulties Schedule in the year before symptom onset. A novel 'escape' rating for events was developed to test the Freudian theory that physical symptoms of CD could provide escape from stressors, a form of 'secondary gain'. CD patients had significantly more severe life events and 'escape' events than controls. In the month before symptom onset at least one severe event was identified in 56% of CD patients - significantly more than 21% of depression patients [odds ratio (OR) 4.63, 95% confidence interval (CI) 1.56-13.70] and healthy controls (OR 5.81, 95% CI 1.86-18.2). In the same time period 53% of CD patients had at least one 'high escape' event - again significantly higher than 14% in depression patients (OR 6.90, 95% CI 2.05-23.6) and 0% in healthy controls. Previous sexual abuse was more commonly reported in CD than controls, and in one third of female patients was contextually relevant to life events at symptom onset. The majority (88%) of life events of potential aetiological relevance were not identified by routine clinical assessments. Nine per cent of CD patients had no identifiable severe life events. Evidence was found supporting the psychological model of CD, the Freudian notion of escape and the potential aetiological relevance of childhood traumas in some patients. Uncovering stressors of potential aetiological relevance requires thorough psychosocial evaluation.

  12. Pairing mechanism in oxide superconductors

    International Nuclear Information System (INIS)

    Hirsch, J.E.

    1988-01-01

    A useful way to learn about the pairing mechanism that is responsible for high T c superconductivity is to study properties of model Hamiltonians on small systems. The goal is to find the simplest model that can describe the essential physics of high T c superconductivity. The authors have used Monte Carlo simulation and exact diagonalization techniques to study properties of systems of up to 64 sites. Their results show that spin fluctuations and other spin related mechanisms induced by a Hubbard on-site repulsion U are not likely to give rise to pairing, neither in one nor in multiple band models. In contrast, charge fluctuations in a model with both strong U and V (repulsion between Cu and O) are shown to give rise to pairing and it is suggested that this model provides a plausible mechanism for high T c superconductivity

  13. Monte-Carlo simulations of geminate electron-hole pair dissociation in a molecular heterojunction: a two-step dissociation mechanism

    International Nuclear Information System (INIS)

    Offermans, Ton; Meskers, Stefan C.J.; Janssen, Rene A.J.

    2005-01-01

    The Monte-Carlo simulations are used to investigate the dissociation of a Coulomb correlated charge pair at an idealized interface between an electron accepting and an electron donating molecular material. In the simulations the materials are represented by cubic lattices of sites, with site the energies spread according to Gaussian distributions. The influence of temperature, applied external fields, and the width of the Gaussian densities of states distribution for both the electron and the hole transporting material are investigated. The results show that the dissociation of geminate charge pairs is assisted by disorder and the results can be understood in terms of a two-step model. In the first step, the slow carrier in the most disordered material jumps away from the interface. In the following, second step, the reduced Coulombic attraction allows the faster carrier in the less disordered material to escape from the interface by thermally activated hopping. When the rate for geminate recombination at the interface is very low ( -1 ) the simulations predict a high yield for carrier collection, as observed experimentally. Comparison of the simulated and experimentally observed temperature dependence of the collection efficiency indicates that at low temperature dissociation of the geminate charge pairs may be one of the factors limiting the device performance

  14. Ion pairing in ionic liquids

    International Nuclear Information System (INIS)

    Kirchner, Barbara; Malberg, Friedrich; Firaha, Dzmitry S; Hollóczki, Oldamur

    2015-01-01

    In the present article we briefly review the extensive discussion in literature about the presence or absence of ion pair-like aggregates in ionic liquids. While some experimental studies point towards the presence of neutral subunits in ionic liquids, many other experiments cannot confirm or even contradict their existence. Ion pairs can be detected directly in the gas phase, but no direct method is available to observe such association behavior in the liquid, and the corresponding indirect experimental proofs are based on such assumptions as unity charges at the ions. However, we have shown by calculating ionic liquid clusters of different sizes that assuming unity charges for ILs is erroneous, because a substantial charge transfer is taking place between the ionic liquid ions that reduce their total charge. Considering these effects might establish a bridge between the contradicting experimental results on this matter. Beside these results, according to molecular dynamics simulations the lifetimes of ion–ion contacts and their joint motions are far too short to verify the existence of neutral units in these materials. (topical review)

  15. Launch Pad Escape System Design (Human Spaceflight)

    Science.gov (United States)

    Maloney, Kelli

    2011-01-01

    A launch pad escape system for human spaceflight is one of those things that everyone hopes they will never need but is critical for every manned space program. Since men were first put into space in the early 1960s, the need for such an Emergency Escape System (EES) has become apparent. The National Aeronautics and Space Administration (NASA) has made use of various types of these EESs over the past 50 years. Early programs, like Mercury and Gemini, did not have an official launch pad escape system. Rather, they relied on a Launch Escape System (LES) of a separate solid rocket motor attached to the manned capsule that could pull the astronauts to safety in the event of an emergency. This could only occur after hatch closure at the launch pad or during the first stage of flight. A version of a LES, now called a Launch Abort System (LAS) is still used today for all manned capsule type launch vehicles. However, this system is very limited in that it can only be used after hatch closure and it is for flight crew only. In addition, the forces necessary for the LES/LAS to get the capsule away from a rocket during the first stage of flight are quite high and can cause injury to the crew. These shortcomings led to the development of a ground based EES for the flight crew and ground support personnel as well. This way, a much less dangerous mode of egress is available for any flight or ground personnel up to a few seconds before launch. The early EESs were fairly simple, gravity-powered systems to use when thing's go bad. And things can go bad very quickly and catastrophically when dealing with a flight vehicle fueled with millions of pounds of hazardous propellant. With this in mind, early EES designers saw such a passive/unpowered system as a must for last minute escapes. This and other design requirements had to be derived for an EES, and this section will take a look at the safety design requirements had to be derived for an EES, and this section will take a look at

  16. Non-thermal escape rates of atmospheric H and D from Mars using MAVEN data

    Science.gov (United States)

    Gacesa, M.; Zahnle, K. J.

    2017-12-01

    Geological evidence suggests that an ocean of liquid water existed on Mars until at least middle to late Noachian era (4.1 to 3.8 Ga) and possibly, at least episodically, as late as Hesperian. Between 67% and 87% of the total primordial amount of water, equal to about 70 to 110 meters equivalent (spread over the entire Mars' surface), is believed to have escape to space, while about 35 meters remains on or beneath the surface as water ice. Establishing better constraints on these numbers and identifying the responsible atmospheric loss processes remains the major objective of NASA's Mars Atmosphere and Volatile EvolutioN (MAVEN) mission. The ratio of atmospheric Deuterium and Hydrogen (D/H) on Mars is one of the best indicators of water loss to space. While majority of H and D escape through thermal Jeans escape, up to 10% of D can escape to space via non-thermal mechanisms, such as collisions with superthermal neutral atoms. In this study, we present new estimates of non-thermal escape rates of light molecules of interest to the water evolution, including H2, HD, OH, and OD, based on recent measurements of atmospheric density and temperature profiles by MAVEN. The escape mechanisms considered include photochemical sources of hot O, as well as collisions with energetic neutral atoms produced in charge-exchange of solar wind ions with atmospheric gases1,2. Energy transport and escape rates are modeled using quantum reactive scattering formalism3 and seasonal variations are illustrated. Finally, a simple estimate of the role of the non-thermal escape mechanisms in previous eras is given. We conclude that D escape rates can be affected by the non-thermal processes with consequences on the estimates of primordial water inventory based on the D/H ratio. [1] N. Lewkow and V. Kharchenko, Astroph. J., 790, 98 (2014) [2] M. Gacesa, N. Lewkow, V. Kharchenko, Icarus 284, 90 (2017) [3] M. Gacesa and V. Kharchenko, Geophys. Res. Lett., 39, L10203 (2012)

  17. Biomechanics of Tetrahymena escaping from dead ends

    Science.gov (United States)

    Ishikawa, Takuji; Kikuchi, Kenji

    2017-11-01

    Behaviors of swimming microorganisms in complex environments are important in understanding cells' distribution in nature and in industries. Although cell's swimming and spreading in an infinite fluid has been intensively investigated, that in a narrow region bounded by walls is still unclear. Thus, in this study, we used Tetrahymena thermophila as a model microorganism, and experimentally investigated its behavior between flat plates with an angle. The results showed that the cells tended to escape from the narrow region, and the swimming velocity and the radius of curvature of the trajectories decreased as they swam narrower region. We then developed a computational model of swimming Tetrahymena. The results showed that the escaping behavior could be well explained by fluid mechanics. The obtained knowledge is useful in understanding cells' behaviors in complex environments, such as in porous media and in a granular matter. This research was supported by JSPS KAKENHI Grants, numbers 25000008 and 17H00853.

  18. Constraining Lyman continuum escape using Machine Learning

    Science.gov (United States)

    Giri, Sambit K.; Zackrisson, Erik; Binggeli, Christian; Pelckmans, Kristiaan; Cubo, Rubén; Mellema, Garrelt

    2018-05-01

    The James Webb Space Telescope (JWST) will observe the rest-frame ultraviolet/optical spectra of galaxies from the epoch of reionization (EoR) in unprecedented detail. While escaping into the intergalactic medium, hydrogen-ionizing (Lyman continuum; LyC) photons from the galaxies will contribute to the bluer end of the UV slope and make nebular emission lines less prominent. We present a method to constrain leakage of the LyC photons using the spectra of high redshift (z >~ 6) galaxies. We simulate JWST/NIRSpec observations of galaxies at z =6-9 by matching the fluxes of galaxies observed in the Frontier Fields observations of galaxy cluster MACS-J0416. Our method predicts the escape fraction fesc with a mean absolute error Δfesc ~ 0.14. The method also predicts the redshifts of the galaxies with an error .

  19. Measurement of the resonance escape probability

    International Nuclear Information System (INIS)

    Anthony, J.P.; Bacher, P.; Lheureux, L.; Moreau, J.; Schmitt, A.P.

    1957-01-01

    The average cadmium ratio in natural uranium rods has been measured, using equal diameter natural uranium disks. These values correlated with independent measurements of the lattice buckling, enabled us to calculate values of the resonance escape probability for the G1 reactor with one or the other of two definitions. Measurements were performed on 26 mm and 32 mm rods, giving the following values for the resonance escape probability p: 0.8976 ± 0.005 and 0.912 ± 0.006 (d. 26 mm), 0.8627 ± 0.009 and 0.884 ± 0.01 (d. 32 mm). The influence of either definition on the lattice parameters is discussed, leading to values of the effective integral. Similar experiments have been performed with thorium rods. (author) [fr

  20. Asymmetric Effects on Escape Rates of Bistable System

    International Nuclear Information System (INIS)

    Wang Canjun; Mei Dongcheng; Dai Zucheng

    2011-01-01

    The asymmetric effects on the escape rates from the stable states x ± in the bistable system are analyzed. The results indicate that the multiplicative noise and the additive noise always enhance the particle escape from stable states x ± of bistable. However, the asymmetric parameter r enhances the particle escape from stable state x + , and holds back the particle escape from stable state x - . (general)

  1. Escape and transmission probabilities in cylindrical geometry

    International Nuclear Information System (INIS)

    Bjerke, M.A.

    1980-01-01

    An improved technique for the generation of escape and transmission probabilities in cylindrical geometry was applied to the existing resonance cross section processing code ROLAIDS. The algorithm of Hwang and Toppel, [ANL-FRA-TM-118] (with modifications) was employed. The probabilities generated were found to be as accurate as those given by the method previously applied in ROLAIDS, while requiring much less computer core storage and CPU time

  2. Search for charged Higgs bosons produced via vector boson fusion and decaying into a pair of W and Z bosons using proton-proton collisions at $\\sqrt{s} = $ 13 TeV

    CERN Document Server

    Sirunyan, Albert M; CMS Collaboration; Adam, Wolfgang; Asilar, Ece; Bergauer, Thomas; Brandstetter, Johannes; Brondolin, Erica; Dragicevic, Marko; Erö, Janos; Flechl, Martin; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hartl, Christian; Krammer, Natascha; Hrubec, Josef; Jeitler, Manfred; König, Axel; Krätschmer, Ilse; Liko, Dietrich; Matsushita, Takashi; Mikulec, Ivan; Rabady, Dinyar; Rad, Navid; Rahbaran, Babak; Rohringer, Herbert; Schieck, Jochen; Strauss, Josef; Waltenberger, Wolfgang; Wulz, Claudia-Elisabeth; Dvornikov, Oleg; Makarenko, Vladimir; Mossolov, Vladimir; Suarez Gonzalez, Juan; Zykunov, Vladimir; Shumeiko, Nikolai; Alderweireldt, Sara; De Wolf, Eddi A; Janssen, Xavier; Lauwers, Jasper; Van De Klundert, Merijn; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Van Spilbeeck, Alex; Abu Zeid, Shimaa; Blekman, Freya; D'Hondt, Jorgen; Daci, Nadir; De Bruyn, Isabelle; Deroover, Kevin; Lowette, Steven; Moortgat, Seth; Moreels, Lieselotte; Olbrechts, Annik; Python, Quentin; Skovpen, Kirill; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Parijs, Isis; Brun, Hugues; Clerbaux, Barbara; De Lentdecker, Gilles; Delannoy, Hugo; Fasanella, Giuseppe; Favart, Laurent; Goldouzian, Reza; Grebenyuk, Anastasia; Karapostoli, Georgia; Lenzi, Thomas; Léonard, Alexandre; Luetic, Jelena; Maerschalk, Thierry; Marinov, Andrey; Randle-conde, Aidan; Seva, Tomislav; Vander Velde, Catherine; Vanlaer, Pascal; Vannerom, David; Yonamine, Ryo; Zenoni, Florian; Zhang, Fengwangdong; Cornelis, Tom; Dobur, Didar; Fagot, Alexis; Gul, Muhammad; Khvastunov, Illia; Poyraz, Deniz; Salva Diblen, Sinem; Schöfbeck, Robert; Tytgat, Michael; Van Driessche, Ward; Verbeke, Willem; Zaganidis, Nicolas; Bakhshiansohi, Hamed; Bondu, Olivier; Brochet, Sébastien; Bruno, Giacomo; Caudron, Adrien; De Visscher, Simon; Delaere, Christophe; Delcourt, Martin; Francois, Brieuc; Giammanco, Andrea; Jafari, Abideh; Komm, Matthias; Krintiras, Georgios; Lemaitre, Vincent; Magitteri, Alessio; Mertens, Alexandre; Musich, Marco; Piotrzkowski, Krzysztof; Quertenmont, Loic; Vidal Marono, Miguel; Wertz, Sébastien; Beliy, Nikita; Aldá Júnior, Walter Luiz; Alves, Fábio Lúcio; Alves, Gilvan; Brito, Lucas; Hensel, Carsten; Moraes, Arthur; Pol, Maria Elena; Rebello Teles, Patricia; Belchior Batista Das Chagas, Ewerton; Carvalho, Wagner; Chinellato, Jose; Custódio, Analu; Melo Da Costa, Eliza; Da Silveira, Gustavo Gil; De Jesus Damiao, Dilson; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Huertas Guativa, Lina Milena; Malbouisson, Helena; Matos Figueiredo, Diego; Mora Herrera, Clemencia; Mundim, Luiz; Nogima, Helio; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Sznajder, Andre; Tonelli Manganote, Edmilson José; Torres Da Silva De Araujo, Felipe; Vilela Pereira, Antonio; Ahuja, Sudha; Bernardes, Cesar Augusto; Dogra, Sunil; Tomei, Thiago; De Moraes Gregores, Eduardo; Mercadante, Pedro G; Moon, Chang-Seong; Novaes, Sergio F; Padula, Sandra; Romero Abad, David; Ruiz Vargas, José Cupertino; Aleksandrov, Aleksandar; Hadjiiska, Roumyana; Iaydjiev, Plamen; Rodozov, Mircho; Stoykova, Stefka; Sultanov, Georgi; Shopova, Mariana; Dimitrov, Anton; Glushkov, Ivan; Litov, Leander; Pavlov, Borislav; Petkov, Peicho; Fang, Wenxing; Gao, Xuyang; Ahmad, Muhammad; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Chen, Mingshui; Chen, Ye; Cheng, Tongguang; Jiang, Chun-Hua; Leggat, Duncan; Liu, Zhenan; Romeo, Francesco; Ruan, Manqi; Shaheen, Sarmad Masood; Spiezia, Aniello; Tao, Junquan; Wang, Chunjie; Wang, Zheng; Yazgan, Efe; Zhang, Huaqiao; Zhao, Jingzhou; Ban, Yong; Chen, Geng; Li, Qiang; Liu, Shuai; Mao, Yajun; Qian, Si-Jin; Wang, Dayong; Xu, Zijun; Avila, Carlos; Cabrera, Andrés; Chaparro Sierra, Luisa Fernanda; Florez, Carlos; Gomez, Juan Pablo; González Hernández, Carlos Felipe; Ruiz Alvarez, José David; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Puljak, Ivica; Ribeiro Cipriano, Pedro M; Sculac, Toni; Antunovic, Zeljko; Kovac, Marko; Brigljevic, Vuko; Ferencek, Dinko; Kadija, Kreso; Mesic, Benjamin; Susa, Tatjana; Ather, Mohsan Waseem; Attikis, Alexandros; Mavromanolakis, Georgios; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A; Rykaczewski, Hans; Finger, Miroslav; Finger Jr, Michael; Carrera Jarrin, Edgar; Abdelalim, Ahmed Ali; Mohammed, Yasser; Salama, Elsayed; Kadastik, Mario; Perrini, Lucia; Raidal, Martti; Tiko, Andres; Veelken, Christian; Eerola, Paula; Pekkanen, Juska; Voutilainen, Mikko; Härkönen, Jaakko; Jarvinen, Terhi; Karimäki, Veikko; Kinnunen, Ritva; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Tuominiemi, Jorma; Tuovinen, Esa; Wendland, Lauri; Talvitie, Joonas; Tuuva, Tuure; Besancon, Marc; Couderc, Fabrice; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Favaro, Carlotta; Ferri, Federico; Ganjour, Serguei; Ghosh, Saranya; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Kucher, Inna; Locci, Elizabeth; Machet, Martina; Malcles, Julie; Rander, John; Rosowsky, André; Titov, Maksym; Abdulsalam, Abdulla; Antropov, Iurii; Baffioni, Stephanie; Beaudette, Florian; Busson, Philippe; Cadamuro, Luca; Chapon, Emilien; Charlot, Claude; Davignon, Olivier; Granier de Cassagnac, Raphael; Jo, Mihee; Lisniak, Stanislav; Lobanov, Artur; Miné, Philippe; Nguyen, Matthew; Ochando, Christophe; Ortona, Giacomo; Paganini, Pascal; Pigard, Philipp; Regnard, Simon; Salerno, Roberto; Sirois, Yves; Stahl Leiton, Andre Govinda; Strebler, Thomas; Yilmaz, Yetkin; Zabi, Alexandre; Zghiche, Amina; Agram, Jean-Laurent; Andrea, Jeremy; Bloch, Daniel; Brom, Jean-Marie; Buttignol, Michael; Chabert, Eric Christian; Chanon, Nicolas; Collard, Caroline; Conte, Eric; Coubez, Xavier; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Le Bihan, Anne-Catherine; Van Hove, Pierre; Gadrat, Sébastien; Beauceron, Stephanie; Bernet, Colin; Boudoul, Gaelle; Carrillo Montoya, Camilo Andres; Chierici, Roberto; Contardo, Didier; Courbon, Benoit; Depasse, Pierre; El Mamouni, Houmani; Fay, Jean; Finco, Linda; Gascon, Susan; Gouzevitch, Maxime; Grenier, Gérald; Ille, Bernard; Lagarde, Francois; Laktineh, Imad Baptiste; Lethuillier, Morgan; Mirabito, Laurent; Pequegnot, Anne-Laure; Perries, Stephane; Popov, Andrey; Sordini, Viola; Vander Donckt, Muriel; Verdier, Patrice; Viret, Sébastien; Khvedelidze, Arsen; Tsamalaidze, Zviad; Autermann, Christian; Beranek, Sarah; Feld, Lutz; Kiesel, Maximilian Knut; Klein, Katja; Lipinski, Martin; Preuten, Marius; Schomakers, Christian; Schulz, Johannes; Verlage, Tobias; Albert, Andreas; Brodski, Michael; Dietz-Laursonn, Erik; Duchardt, Deborah; Endres, Matthias; Erdmann, Martin; Erdweg, Sören; Esch, Thomas; Fischer, Robert; Güth, Andreas; Hamer, Matthias; Hebbeker, Thomas; Heidemann, Carsten; Hoepfner, Kerstin; Knutzen, Simon; Merschmeyer, Markus; Meyer, Arnd; Millet, Philipp; Mukherjee, Swagata; Olschewski, Mark; Padeken, Klaas; Pook, Tobias; Radziej, Markus; Reithler, Hans; Rieger, Marcel; Scheuch, Florian; Sonnenschein, Lars; Teyssier, Daniel; Thüer, Sebastian; Cherepanov, Vladimir; Flügge, Günter; Kargoll, Bastian; Kress, Thomas; Künsken, Andreas; Lingemann, Joschka; Müller, Thomas; Nehrkorn, Alexander; Nowack, Andreas; Pistone, Claudia; Pooth, Oliver; Stahl, Achim; Aldaya Martin, Maria; Arndt, Till; Asawatangtrakuldee, Chayanit; Beernaert, Kelly; Behnke, Olaf; Behrens, Ulf; Bin Anuar, Afiq Aizuddin; Borras, Kerstin; Campbell, Alan; Connor, Patrick; Contreras-Campana, Christian; Costanza, Francesco; Diez Pardos, Carmen; Dolinska, Ganna; Eckerlin, Guenter; Eckstein, Doris; Eichhorn, Thomas; Eren, Engin; Gallo, Elisabetta; Garay Garcia, Jasone; Geiser, Achim; Gizhko, Andrii; Grados Luyando, Juan Manuel; Grohsjean, Alexander; Gunnellini, Paolo; Harb, Ali; Hauk, Johannes; Hempel, Maria; Jung, Hannes; Kalogeropoulos, Alexis; Karacheban, Olena; Kasemann, Matthias; Keaveney, James; Kleinwort, Claus; Korol, Ievgen; Krücker, Dirk; Lange, Wolfgang; Lelek, Aleksandra; Lenz, Teresa; Leonard, Jessica; Lipka, Katerina; Lohmann, Wolfgang; Mankel, Rainer; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mittag, Gregor; Mnich, Joachim; Mussgiller, Andreas; Ntomari, Eleni; Pitzl, Daniel; Placakyte, Ringaile; Raspereza, Alexei; Roland, Benoit; Sahin, Mehmet Özgür; Saxena, Pooja; Schoerner-Sadenius, Thomas; Spannagel, Simon; Stefaniuk, Nazar; Van Onsem, Gerrit Patrick; Walsh, Roberval; Wissing, Christoph; Blobel, Volker; Centis Vignali, Matteo; Draeger, Arne-Rasmus; Dreyer, Torben; Garutti, Erika; Gonzalez, Daniel; Haller, Johannes; Hoffmann, Malte; Junkes, Alexandra; Klanner, Robert; Kogler, Roman; Kovalchuk, Nataliia; Kurz, Simon; Lapsien, Tobias; Marchesini, Ivan; Marconi, Daniele; Meyer, Mareike; Niedziela, Marek; Nowatschin, Dominik; Pantaleo, Felice; Peiffer, Thomas; Perieanu, Adrian; Scharf, Christian; Schleper, Peter; Schmidt, Alexander; Schumann, Svenja; Schwandt, Joern; Sonneveld, Jory; Stadie, Hartmut; Steinbrück, Georg; Stober, Fred-Markus Helmut; Stöver, Marc; Tholen, Heiner; Troendle, Daniel; Usai, Emanuele; Vanelderen, Lukas; Vanhoefer, Annika; Vormwald, Benedikt; Akbiyik, Melike; Barth, Christian; Baur, Sebastian; Baus, Colin; Berger, Joram; Butz, Erik; Caspart, René; Chwalek, Thorsten; Colombo, Fabio; De Boer, Wim; Dierlamm, Alexander; Fink, Simon; Freund, Benedikt; Friese, Raphael; Giffels, Manuel; Gilbert, Andrew; Goldenzweig, Pablo; Haitz, Dominik; Hartmann, Frank; Heindl, Stefan Michael; Husemann, Ulrich; Kassel, Florian; Katkov, Igor; Kudella, Simon; Mildner, Hannes; Mozer, Matthias Ulrich; Müller, Thomas; Plagge, Michael; Quast, Gunter; Rabbertz, Klaus; Röcker, Steffen; Roscher, Frank; Schröder, Matthias; Shvetsov, Ivan; Sieber, Georg; Simonis, Hans-Jürgen; Ulrich, Ralf; Wayand, Stefan; Weber, Marc; Weiler, Thomas; Williamson, Shawn; Wöhrmann, Clemens; Wolf, Roger; Anagnostou, Georgios; Daskalakis, Georgios; Geralis, Theodoros; Giakoumopoulou, Viktoria Athina; Kyriakis, Aristotelis; Loukas, Demetrios; Topsis-Giotis, Iasonas; Kesisoglou, Stilianos; Panagiotou, Apostolos; Saoulidou, Niki; Tziaferi, Eirini; Kousouris, Konstantinos; Evangelou, Ioannis; Flouris, Giannis; Foudas, Costas; Kokkas, Panagiotis; Loukas, Nikitas; Manthos, Nikolaos; Papadopoulos, Ioannis; Paradas, Evangelos; Triantis, Frixos A; Filipovic, Nicolas; Pasztor, Gabriella; Bencze, Gyorgy; Hajdu, Csaba; Horvath, Dezso; Sikler, Ferenc; Veszpremi, Viktor; Vesztergombi, Gyorgy; Zsigmond, Anna Julia; Beni, Noemi; Czellar, Sandor; Karancsi, János; Makovec, Alajos; Molnar, Jozsef; Szillasi, Zoltan; Bartók, Márton; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Choudhury, Somnath; Komaragiri, Jyothsna Rani; Bahinipati, Seema; Bhowmik, Sandeep; Mal, Prolay; Mandal, Koushik; Nayak, Aruna; Sahoo, Deepak Kumar; Sahoo, Niladribihari; Swain, Sanjay Kumar; Bansal, Sunil; Beri, Suman Bala; Bhatnagar, Vipin; Chawla, Ridhi; Bhawandeep, Bhawandeep; Kalsi, Amandeep Kaur; Kaur, Anterpreet; Kaur, Manjit; Kumar, Ramandeep; Kumari, Priyanka; Mehta, Ankita; Mittal, Monika; Singh, Jasbir; Walia, Genius; Kumar, Ashok; Bhardwaj, Ashutosh; Choudhary, Brajesh C; Garg, Rocky Bala; Keshri, Sumit; Kumar, Ajay; Malhotra, Shivali; Naimuddin, Md; Ranjan, Kirti; Sharma, Ramkrishna; Sharma, Varun; Bhattacharya, Rajarshi; Bhattacharya, Satyaki; Chatterjee, Kalyanmoy; Dey, Sourav; Dutt, Suneel; Dutta, Suchandra; Ghosh, Shamik; Majumdar, Nayana; Modak, Atanu; Mondal, Kuntal; Mukhopadhyay, Supratik; Nandan, Saswati; Purohit, Arnab; Roy, Ashim; Roy, Debarati; Roy Chowdhury, Suvankar; Sarkar, Subir; Sharan, Manoj; Thakur, Shalini; Behera, Prafulla Kumar; Chudasama, Ruchi; Dutta, Dipanwita; Jha, Vishwajeet; Kumar, Vineet; Mohanty, Ajit Kumar; Netrakanti, Pawan Kumar; Pant, Lalit Mohan; Shukla, Prashant; Topkar, Anita; Aziz, Tariq; Dugad, Shashikant; Kole, Gouranga; Mahakud, Bibhuprasad; Mitra, Soureek; Mohanty, Gagan Bihari; Parida, Bibhuti; Sur, Nairit; Sutar, Bajrang; Banerjee, Sudeshna; Dewanjee, Ram Krishna; Ganguly, Sanmay; Guchait, Monoranjan; Jain, Sandhya; Kumar, Sanjeev; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Sarkar, Tanmay; Wickramage, Nadeesha; Chauhan, Shubhanshu; Dube, Sourabh; Hegde, Vinay; Kapoor, Anshul; Kothekar, Kunal; Pandey, Shubham; Rane, Aditee; Sharma, Seema; Chenarani, Shirin; Eskandari Tadavani, Esmaeel; Etesami, Seyed Mohsen; Khakzad, Mohsen; Mohammadi Najafabadi, Mojtaba; Naseri, Mohsen; Paktinat Mehdiabadi, Saeid; Rezaei Hosseinabadi, Ferdos; Safarzadeh, Batool; Zeinali, Maryam; Felcini, Marta; Grunewald, Martin; Abbrescia, Marcello; Calabria, Cesare; Caputo, Claudio; Colaleo, Anna; Creanza, Donato; Cristella, Leonardo; De Filippis, Nicola; De Palma, Mauro; Fiore, Luigi; Iaselli, Giuseppe; Maggi, Giorgio; Maggi, Marcello; Miniello, Giorgia; My, Salvatore; Nuzzo, Salvatore; Pompili, Alexis; Pugliese, Gabriella; Radogna, Raffaella; Ranieri, Antonio; Selvaggi, Giovanna; Sharma, Archana; Silvestris, Lucia; Venditti, Rosamaria; Verwilligen, Piet; Abbiendi, Giovanni; Battilana, Carlo; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Brigliadori, Luca; Campanini, Renato; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Chhibra, Simranjit Singh; Codispoti, Giuseppe; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Grandi, Claudio; Guiducci, Luigi; Marcellini, Stefano; Masetti, Gianni; Montanari, Alessandro; Navarria, Francesco; Perrotta, Andrea; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gian Piero; Tosi, Nicolò; Albergo, Sebastiano; Costa, Salvatore; Di Mattia, Alessandro; Giordano, Ferdinando; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Russo, Lorenzo; Sguazzoni, Giacomo; Strom, Derek; Viliani, Lorenzo; Benussi, Luigi; Bianco, Stefano; Fabbri, Franco; Piccolo, Davide; Primavera, Federica; Calvelli, Valerio; Ferro, Fabrizio; Monge, Maria Roberta; Robutti, Enrico; Tosi, Silvano; Brianza, Luca; Brivio, Francesco; Ciriolo, Vincenzo; Dinardo, Mauro Emanuele; Fiorendi, Sara; Gennai, Simone; Ghezzi, Alessio; Govoni, Pietro; Malberti, Martina; Malvezzi, Sandra; Manzoni, Riccardo Andrea; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Pigazzini, Simone; Ragazzi, Stefano; Tabarelli de Fatis, Tommaso; Buontempo, Salvatore; Cavallo, Nicola; De Nardo, Guglielmo; Di Guida, Salvatore; Fabozzi, Francesco; Fienga, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Meola, Sabino; Paolucci, Pierluigi; Sciacca, Crisostomo; Thyssen, Filip; Azzi, Patrizia; Bacchetta, Nicola; Benato, Lisa; Bisello, Dario; Boletti, Alessio; Carlin, Roberto; Carvalho Antunes De Oliveira, Alexandra; Checchia, Paolo; Dall'Osso, Martino; De Castro Manzano, Pablo; Dorigo, Tommaso; Gasparini, Fabrizio; Gasparini, Ugo; Gozzelino, Andrea; Lacaprara, Stefano; Margoni, Martino; Meneguzzo, Anna Teresa; Pazzini, Jacopo; Pozzobon, Nicola; Ronchese, Paolo; Rossin, Roberto; Simonetto, Franco; Torassa, Ezio; Zanetti, Marco; Zotto, Pierluigi; Zumerle, Gianni; Braghieri, Alessandro; Fallavollita, Francesco; Magnani, Alice; Montagna, Paolo; Ratti, Sergio P; Re, Valerio; Ressegotti, Martina; Riccardi, Cristina; Salvini, Paola; Vai, Ilaria; Vitulo, Paolo; Alunni Solestizi, Luisa; Bilei, Gian Mario; Ciangottini, Diego; Fanò, Livio; Lariccia, Paolo; Leonardi, Roberto; Mantovani, Giancarlo; Mariani, Valentina; Menichelli, Mauro; Saha, Anirban; Santocchia, Attilio; Androsov, Konstantin; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Castaldi, Rino; Ciocci, Maria Agnese; Dell'Orso, Roberto; Fedi, Giacomo; Giassi, Alessandro; Grippo, Maria Teresa; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Rizzi, Andrea; Savoy-Navarro, Aurore; Spagnolo, Paolo; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; Cipriani, Marco; Del Re, Daniele; Diemoz, Marcella; Gelli, Simone; Longo, Egidio; Margaroli, Fabrizio; Marzocchi, Badder; Meridiani, Paolo; Organtini, Giovanni; Paramatti, Riccardo; Preiato, Federico; Rahatlou, Shahram; Rovelli, Chiara; Santanastasio, Francesco; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Bartosik, Nazar; Bellan, Riccardo; Biino, Cristina; Cartiglia, Nicolo; Cenna, Francesca; Costa, Marco; Covarelli, Roberto; Degano, Alessandro; Demaria, Natale; Kiani, Bilal; Mariotti, Chiara; Maselli, Silvia; Migliore, Ernesto; Monaco, Vincenzo; Monteil, Ennio; Monteno, Marco; Obertino, Maria Margherita; Pacher, Luca; Pastrone, Nadia; Pelliccioni, Mario; Pinna Angioni, Gian Luca; Ravera, Fabio; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Shchelina, Ksenia; Sola, Valentina; Solano, Ada; Staiano, Amedeo; Traczyk, Piotr; Belforte, Stefano; Casarsa, Massimo; Cossutti, Fabio; Della Ricca, Giuseppe; Zanetti, Anna; Kim, Dong Hee; Kim, Gui Nyun; Kim, Min Suk; Lee, Jeongeun; Lee, Sangeun; Lee, Seh Wook; Oh, Young Do; Sekmen, Sezen; Son, Dong-Chul; Yang, Yu Chul; Lee, Ari; Kim, Hyunchul; Brochero Cifuentes, Javier Andres; Goh, Junghwan; Kim, Tae Jeong; Cho, Sungwoong; Choi, Suyong; Go, Yeonju; Gyun, Dooyeon; Ha, Seungkyu; Hong, Byung-Sik; Jo, Youngkwon; Kim, Yongsun; Lee, Kisoo; Lee, Kyong Sei; Lee, Songkyo; Lim, Jaehoon; Park, Sung Keun; Roh, Youn; Almond, John; Kim, Junho; Lee, Haneol; Oh, Sung Bin; Radburn-Smith, Benjamin Charles; Seo, Seon-hee; Yang, Unki; Yoo, Hwi Dong; Yu, Geum Bong; Choi, Minkyoo; Kim, Hyunyong; Kim, Ji Hyun; Lee, Jason Sang Hun; Park, Inkyu; Ryu, Geonmo; Ryu, Min Sang; Choi, Young-Il; Hwang, Chanwook; Lee, Jongseok; Yu, Intae; Dudenas, Vytautas; Juodagalvis, Andrius; Vaitkus, Juozas; Ahmed, Ijaz; Ibrahim, Zainol Abidin; Md Ali, Mohd Adli Bin; Mohamad Idris, Faridah; Wan Abdullah, Wan Ahmad Tajuddin; Yusli, Mohd Nizam; Zolkapli, Zukhaimira; Castilla-Valdez, Heriberto; De La Cruz-Burelo, Eduard; Heredia-De La Cruz, Ivan; Lopez-Fernandez, Ricardo; Magaña Villalba, Ricardo; Mejia Guisao, Jhovanny; Sánchez Hernández, Alberto; Carrillo Moreno, Salvador; Oropeza Barrera, Cristina; Vazquez Valencia, Fabiola; Carpinteyro, Severiano; Pedraza, Isabel; Salazar Ibarguen, Humberto Antonio; Uribe Estrada, Cecilia; Morelos Pineda, Antonio; Krofcheck, David; Butler, Philip H; Ahmad, Ashfaq; Ahmad, Muhammad; Hassan, Qamar; Hoorani, Hafeez R; Khan, Wajid Ali; Saddique, Asif; Shah, Mehar Ali; Shoaib, Muhammad; Waqas, Muhammad; Bialkowska, Helena; Bluj, Michal; Boimska, Bozena; Frueboes, Tomasz; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Zalewski, Piotr; Bunkowski, Karol; Byszuk, Adrian; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Misiura, Maciej; Olszewski, Michal; Pyskir, Andrzej; Walczak, Marek; Bargassa, Pedrame; Beirão Da Cruz E Silva, Cristóvão; Calpas, Betty; Di Francesco, Agostino; Faccioli, Pietro; Gallinaro, Michele; Hollar, Jonathan; Leonardo, Nuno; Lloret Iglesias, Lara; Nemallapudi, Mythra Varun; Seixas, Joao; Toldaiev, Oleksii; Vadruccio, Daniele; Varela, Joao; Afanasiev, Serguei; Bunin, Pavel; Gavrilenko, Mikhail; Golutvin, Igor; Gorbunov, Ilya; Kamenev, Alexey; Karjavin, Vladimir; Lanev, Alexander; Malakhov, Alexander; Matveev, Viktor; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Shulha, Siarhei; Skatchkov, Nikolai; Smirnov, Vitaly; Voytishin, Nikolay; Zarubin, Anatoli; Chtchipounov, Leonid; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Kuznetsova, Ekaterina; Murzin, Victor; Oreshkin, Vadim; Sulimov, Valentin; Vorobyev, Alexey; Andreev, Yuri; Dermenev, Alexander; Gninenko, Sergei; Golubev, Nikolai; Karneyeu, Anton; Kirsanov, Mikhail; Krasnikov, Nikolai; Pashenkov, Anatoli; Tlisov, Danila; Toropin, Alexander; Epshteyn, Vladimir; Gavrilov, Vladimir; Lychkovskaya, Natalia; Popov, Vladimir; Pozdnyakov, Ivan; Safronov, Grigory; Spiridonov, Alexander; Toms, Maria; Vlasov, Evgueni; Zhokin, Alexander; Aushev, Tagir; Bylinkin, Alexander; Chistov, Ruslan; Danilov, Mikhail; Polikarpov, Sergey; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Leonidov, Andrey; Terkulov, Adel; Baskakov, Alexey; Belyaev, Andrey; Boos, Edouard; Bunichev, Viacheslav; Dubinin, Mikhail; Dudko, Lev; Gribushin, Andrey; Klyukhin, Vyacheslav; Kodolova, Olga; Lokhtin, Igor; Miagkov, Igor; Obraztsov, Stepan; Perfilov, Maxim; Petrushanko, Sergey; Savrin, Viktor; Blinov, Vladimir; Skovpen, Yuri; Shtol, Dmitry; Azhgirey, Igor; Bayshev, Igor; Bitioukov, Sergei; Elumakhov, Dmitry; Kachanov, Vassili; Kalinin, Alexey; Konstantinov, Dmitri; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Sobol, Andrei; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Cirkovic, Predrag; Devetak, Damir; Dordevic, Milos; Milosevic, Jovan; Rekovic, Vladimir; Alcaraz Maestre, Juan; Barrio Luna, Mar; Calvo, Enrique; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Delgado Peris, Antonio; Escalante Del Valle, Alberto; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M; Josa, Maria Isabel; Navarro De Martino, Eduardo; Pérez-Calero Yzquierdo, Antonio María; Puerta Pelayo, Jesus; Quintario Olmeda, Adrián; Redondo, Ignacio; Romero, Luciano; Senghi Soares, Mara; de Trocóniz, Jorge F; Missiroli, Marino; Moran, Dermot; Cuevas, Javier; Erice, Carlos; Fernandez Menendez, Javier; Gonzalez Caballero, Isidro; González Fernández, Juan Rodrigo; Palencia Cortezon, Enrique; Sanchez Cruz, Sergio; Suárez Andrés, Ignacio; Vischia, Pietro; Vizan Garcia, Jesus Manuel; Cabrillo, Iban Jose; Calderon, Alicia; Curras, Esteban; Fernandez, Marcos; Garcia-Ferrero, Juan; Gomez, Gervasio; Lopez Virto, Amparo; Marco, Jesus; Martinez Rivero, Celso; Matorras, Francisco; Piedra Gomez, Jonatan; Rodrigo, Teresa; Ruiz-Jimeno, Alberto; Scodellaro, Luca; Trevisani, Nicolò; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Baillon, Paul; Ball, Austin; Barney, David; Bloch, Philippe; Bocci, Andrea; Botta, Cristina; Camporesi, Tiziano; Castello, Roberto; Cepeda, Maria; Cerminara, Gianluca; Chen, Yi; Cimmino, Anna; D'Enterria, David; Dabrowski, Anne; Daponte, Vincenzo; David Tinoco Mendes, Andre; De Gruttola, Michele; De Roeck, Albert; Di Marco, Emanuele; Dobson, Marc; Dorney, Brian; Du Pree, Tristan; Dünser, Marc; Dupont, Niels; Elliott-Peisert, Anna; Everaerts, Pieter; Fartoukh, Stephane; Franzoni, Giovanni; Fulcher, Jonathan; Funk, Wolfgang; Gigi, Dominique; Gill, Karl; Girone, Maria; Glege, Frank; Gulhan, Doga; Gundacker, Stefan; Guthoff, Moritz; Harris, Philip; Hegeman, Jeroen; Innocente, Vincenzo; Janot, Patrick; Kieseler, Jan; Kirschenmann, Henning; Knünz, Valentin; Kornmayer, Andreas; Kortelainen, Matti J; Krammer, Manfred; Lange, Clemens; Lecoq, Paul; Lourenco, Carlos; Lucchini, Marco Toliman; Malgeri, Luca; Mannelli, Marcello; Martelli, Arabella; Meijers, Frans; Merlin, Jeremie Alexandre; Mersi, Stefano; Meschi, Emilio; Milenovic, Predrag; Moortgat, Filip; Morovic, Srecko; Mulders, Martijn; Neugebauer, Hannes; Orfanelli, Styliani; Orsini, Luciano; Pape, Luc; Perez, Emmanuel; Peruzzi, Marco; Petrilli, Achille; Petrucciani, Giovanni; Pfeiffer, Andreas; Pierini, Maurizio; Racz, Attila; Reis, Thomas; Rolandi, Gigi; Rovere, Marco; Sakulin, Hannes; Sauvan, Jean-Baptiste; Schäfer, Christoph; Schwick, Christoph; Seidel, Markus; Selvaggi, Michele; Sharma, Archana; Silva, Pedro; Sphicas, Paraskevas; Steggemann, Jan; Stoye, Markus; Takahashi, Yuta; Tosi, Mia; Treille, Daniel; Triossi, Andrea; Tsirou, Andromachi; Veckalns, Viesturs; Veres, Gabor Istvan; Verweij, Marta; Wardle, Nicholas; Wöhri, Hermine Katharina; Zagozdzinska, Agnieszka; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; Kotlinski, Danek; Langenegger, Urs; Rohe, Tilman; Wiederkehr, Stephan Albert; Bachmair, Felix; Bäni, Lukas; Bianchini, Lorenzo; Casal, Bruno; Dissertori, Günther; Dittmar, Michael; Donegà, Mauro; Grab, Christoph; Heidegger, Constantin; Hits, Dmitry; Hoss, Jan; Kasieczka, Gregor; Lustermann, Werner; Mangano, Boris; Marionneau, Matthieu; Martinez Ruiz del Arbol, Pablo; Masciovecchio, Mario; Meinhard, Maren Tabea; Meister, Daniel; Micheli, Francesco; Musella, Pasquale; Nessi-Tedaldi, Francesca; Pandolfi, Francesco; Pata, Joosep; Pauss, Felicitas; Perrin, Gaël; Perrozzi, Luca; Quittnat, Milena; Rossini, Marco; Schönenberger, Myriam; Starodumov, Andrei; Tavolaro, Vittorio Raoul; Theofilatos, Konstantinos; Wallny, Rainer; Aarrestad, Thea Klaeboe; Amsler, Claude; Caminada, Lea; Canelli, Maria Florencia; De Cosa, Annapaola; Donato, Silvio; Galloni, Camilla; Hinzmann, Andreas; Hreus, Tomas; Kilminster, Benjamin; Ngadiuba, Jennifer; Pinna, Deborah; Rauco, Giorgia; Robmann, Peter; Salerno, Daniel; Seitz, Claudia; Yang, Yong; Zucchetta, Alberto; Candelise, Vieri; Doan, Thi Hien; Jain, Shilpi; Khurana, Raman; Konyushikhin, Maxim; Kuo, Chia-Ming; Lin, Willis; Pozdnyakov, Andrey; Yu, Shin-Shan; Kumar, Arun; Chang, Paoti; Chang, You-Hao; Chao, Yuan; Chen, Kai-Feng; Chen, Po-Hsun; Fiori, Francesco; Hou, George Wei-Shu; Hsiung, Yee; Liu, Yueh-Feng; Lu, Rong-Shyang; Miñano Moya, Mercedes; Paganis, Efstathios; Psallidas, Andreas; Tsai, Jui-fa; Asavapibhop, Burin; Singh, Gurpreet; Srimanobhas, Norraphat; Suwonjandee, Narumon; Adiguzel, Aytul; Boran, Fatma; Cerci, Salim; Damarseckin, Serdal; Demiroglu, Zuhal Seyma; Dozen, Candan; Dumanoglu, Isa; Girgis, Semiray; Gokbulut, Gul; Guler, Yalcin; Hos, Ilknur; Kangal, Evrim Ersin; Kara, Ozgun; Kayis Topaksu, Aysel; Kiminsu, Ugur; Oglakci, Mehmet; Onengut, Gulsen; Ozdemir, Kadri; Sunar Cerci, Deniz; Topakli, Huseyin; Turkcapar, Semra; Zorbakir, Ibrahim Soner; Zorbilmez, Caglar; Bilin, Bugra; Isildak, Bora; Karapinar, Guler; Yalvac, Metin; Zeyrek, Mehmet; Gülmez, Erhan; Kaya, Mithat; Kaya, Ozlem; Yetkin, Elif Asli; Yetkin, Taylan; Cakir, Altan; Cankocak, Kerem; Sen, Sercan; Grynyov, Boris; Levchuk, Leonid; Sorokin, Pavel; Aggleton, Robin; Ball, Fionn; Beck, Lana; Brooke, James John; Burns, Douglas; Clement, Emyr; Cussans, David; Flacher, Henning; Goldstein, Joel; Grimes, Mark; Heath, Greg P; Heath, Helen F; Jacob, Jeson; Kreczko, Lukasz; Lucas, Chris; Newbold, Dave M; Paramesvaran, Sudarshan; Poll, Anthony; Sakuma, Tai; Seif El Nasr-storey, Sarah; Smith, Dominic; Smith, Vincent J; Bell, Ken W; Belyaev, Alexander; Brew, Christopher; Brown, Robert M; Calligaris, Luigi; Cieri, Davide; Cockerill, David JA; Coughlan, John A; Harder, Kristian; Harper, Sam; Olaiya, Emmanuel; Petyt, David; Shepherd-Themistocleous, Claire; Thea, Alessandro; Tomalin, Ian R; Williams, Thomas; Baber, Mark; Bainbridge, Robert; Buchmuller, Oliver; Bundock, Aaron; Casasso, Stefano; Citron, Matthew; Colling, David; Corpe, Louie; Dauncey, Paul; Davies, Gavin; De Wit, Adinda; Della Negra, Michel; Di Maria, Riccardo; Dunne, Patrick; Elwood, Adam; Futyan, David; Haddad, Yacine; Hall, Geoffrey; Iles, Gregory; James, Thomas; Lane, Rebecca; Laner, Christian; Lyons, Louis; Magnan, Anne-Marie; Malik, Sarah; Mastrolorenzo, Luca; Nash, Jordan; Nikitenko, Alexander; Pela, Joao; Penning, Bjoern; Pesaresi, Mark; Raymond, David Mark; Richards, Alexander; Rose, Andrew; Scott, Edward; Seez, Christopher; Summers, Sioni; Tapper, Alexander; Uchida, Kirika; Vazquez Acosta, Monica; Virdee, Tejinder; Wright, Jack; Zenz, Seth Conrad; Cole, Joanne; Hobson, Peter R; Khan, Akram; Kyberd, Paul; Reid, Ivan; Symonds, Philip; Teodorescu, Liliana; Turner, Mark; Borzou, Ahmad; Call, Kenneth; Dittmann, Jay; Hatakeyama, Kenichi; Liu, Hongxuan; Pastika, Nathaniel; Bartek, Rachel; Dominguez, Aaron; Buccilli, Andrew; Cooper, Seth; Henderson, Conor; Rumerio, Paolo; West, Christopher; Arcaro, Daniel; Avetisyan, Aram; Bose, Tulika; Gastler, Daniel; Rankin, Dylan; Richardson, Clint; Rohlf, James; Sulak, Lawrence; Zou, David; Benelli, Gabriele; Cutts, David; Garabedian, Alex; Hakala, John; Heintz, Ulrich; Hogan, Julie Managan; Jesus, Orduna; Kwok, Ka Hei Martin; Laird, Edward; Landsberg, Greg; Mao, Zaixing; Narain, Meenakshi; Piperov, Stefan; Sagir, Sinan; Spencer, Eric; Syarif, Rizki; Breedon, Richard; Burns, Dustin; Calderon De La Barca Sanchez, Manuel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Conway, Rylan; Cox, Peter Timothy; Erbacher, Robin; Flores, Chad; Funk, Garrett; Gardner, Michael; Ko, Winston; Lander, Richard; Mclean, Christine; Mulhearn, Michael; Pellett, Dave; Pilot, Justin; Shalhout, Shalhout; Shi, Mengyao; Smith, John; Squires, Michael; Stolp, Dustin; Tos, Kyle; Tripathi, Mani; Bachtis, Michail; Bravo, Cameron; Cousins, Robert; Dasgupta, Abhigyan; Florent, Alice; Hauser, Jay; Ignatenko, Mikhail; Mccoll, Nickolas; Saltzberg, David; Schnaible, Christian; Valuev, Vyacheslav; Weber, Matthias; Bouvier, Elvire; Burt, Kira; Clare, Robert; Ellison, John Anthony; Gary, J William; Ghiasi Shirazi, Seyyed Mohammad Amin; Hanson, Gail; Heilman, Jesse; Jandir, Pawandeep; Kennedy, Elizabeth; Lacroix, Florent; Long, Owen Rosser; Olmedo Negrete, Manuel; Paneva, Mirena Ivova; Shrinivas, Amithabh; Si, Weinan; Wei, Hua; Wimpenny, Stephen; Yates, Brent; Branson, James G; Cerati, Giuseppe Benedetto; Cittolin, Sergio; Derdzinski, Mark; Gerosa, Raffaele; Holzner, André; Klein, Daniel; Krutelyov, Vyacheslav; Letts, James; Macneill, Ian; Olivito, Dominick; Padhi, Sanjay; Pieri, Marco; Sani, Matteo; Sharma, Vivek; Simon, Sean; Tadel, Matevz; Vartak, Adish; Wasserbaech, Steven; Welke, Charles; Wood, John; Würthwein, Frank; Yagil, Avraham; Zevi Della Porta, Giovanni; Amin, Nick; Bhandari, Rohan; Bradmiller-Feld, John; Campagnari, Claudio; Dishaw, Adam; Dutta, Valentina; Franco Sevilla, Manuel; George, Christopher; Golf, Frank; Gouskos, Loukas; Gran, Jason; Heller, Ryan; Incandela, Joe; Mullin, Sam Daniel; Ovcharova, Ana; Qu, Huilin; Richman, Jeffrey; Stuart, David; Suarez, Indara; Yoo, Jaehyeok; Anderson, Dustin; Bendavid, Joshua; Bornheim, Adolf; Bunn, Julian; Lawhorn, Jay Mathew; Mott, Alexander; Newman, Harvey B; Pena, Cristian; Spiropulu, Maria; Vlimant, Jean-Roch; Xie, Si; Zhu, Ren-Yuan; Andrews, Michael Benjamin; Ferguson, Thomas; Paulini, Manfred; Russ, James; Sun, Menglei; Vogel, Helmut; Vorobiev, Igor; Weinberg, Marc; Cumalat, John Perry; Ford, William T; Jensen, Frank; Johnson, Andrew; Krohn, Michael; Leontsinis, Stefanos; Mulholland, Troy; Stenson, Kevin; Wagner, Stephen Robert; Alexander, James; Chaves, Jorge; Chu, Jennifer; Dittmer, Susan; Mcdermott, Kevin; Mirman, Nathan; Patterson, Juliet Ritchie; Rinkevicius, Aurelijus; Ryd, Anders; Skinnari, Louise; Soffi, Livia; Tan, Shao Min; Tao, Zhengcheng; Thom, Julia; Tucker, Jordan; Wittich, Peter; Zientek, Margaret; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Apollinari, Giorgio; Apresyan, Artur; Banerjee, Sunanda; Bauerdick, Lothar AT; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C; Bolla, Gino; Burkett, Kevin; Butler, Joel Nathan; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Cremonesi, Matteo; Duarte, Javier; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gottschalk, Erik; Gray, Lindsey; Green, Dan; Grünendahl, Stefan; Gutsche, Oliver; Harris, Robert M; Hasegawa, Satoshi; Hirschauer, James; Hu, Zhen; Jayatilaka, Bodhitha; Jindariani, Sergo; Johnson, Marvin; Joshi, Umesh; Klima, Boaz; Kreis, Benjamin; Lammel, Stephan; Linacre, Jacob; Lincoln, Don; Lipton, Ron; Liu, Miaoyuan; Liu, Tiehui; Lopes De Sá, Rafael; Lykken, Joseph; Maeshima, Kaori; Magini, Nicolo; Marraffino, John Michael; Maruyama, Sho; Mason, David; McBride, Patricia; Merkel, Petra; Mrenna, Stephen; Nahn, Steve; O'Dell, Vivian; Pedro, Kevin; Prokofyev, Oleg; Rakness, Gregory; Ristori, Luciano; Sexton-Kennedy, Elizabeth; Soha, Aron; Spalding, William J; Spiegel, Leonard; Stoynev, Stoyan; Strait, James; Strobbe, Nadja; Taylor, Lucas; Tkaczyk, Slawek; Tran, Nhan Viet; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vernieri, Caterina; Verzocchi, Marco; Vidal, Richard; Wang, Michael; Weber, Hannsjoerg Artur; Whitbeck, Andrew; Wu, Yujun; Acosta, Darin; Avery, Paul; Bortignon, Pierluigi; Bourilkov, Dimitri; Brinkerhoff, Andrew; Carnes, Andrew; Carver, Matthew; Curry, David; Das, Souvik; Field, Richard D; Furic, Ivan-Kresimir; Konigsberg, Jacobo; Korytov, Andrey; Low, Jia Fu; Ma, Peisen; Matchev, Konstantin; Mei, Hualin; Mitselmakher, Guenakh; Rank, Douglas; Shchutska, Lesya; Sperka, David; Thomas, Laurent; Wang, Jian; Wang, Sean-Jiun; Yelton, John; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Ackert, Andrew; Adams, Todd; Askew, Andrew; Bein, Samuel; Hagopian, Sharon; Hagopian, Vasken; Johnson, Kurtis F; Kolberg, Ted; Perry, Thomas; Prosper, Harrison; Santra, Arka; Yohay, Rachel; Baarmand, Marc M; Bhopatkar, Vallary; Colafranceschi, Stefano; Hohlmann, Marcus; Noonan, Daniel; Roy, Titas; Yumiceva, Francisco; Adams, Mark Raymond; Apanasevich, Leonard; Berry, Douglas; Betts, Russell Richard; Cavanaugh, Richard; Chen, Xuan; Evdokimov, Olga; Gerber, Cecilia Elena; Hangal, Dhanush Anil; Hofman, David Jonathan; Jung, Kurt; Kamin, Jason; Sandoval Gonzalez, Irving Daniel; Trauger, Hallie; Varelas, Nikos; Wang, Hui; Wu, Zhenbin; Zhang, Jingyu; Bilki, Burak; Clarida, Warren; Dilsiz, Kamuran; Durgut, Süleyman; Gandrajula, Reddy Pratap; Haytmyradov, Maksat; Khristenko, Viktor; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Ogul, Hasan; Onel, Yasar; Ozok, Ferhat; Penzo, Aldo; Snyder, Christina; Tiras, Emrah; Wetzel, James; Yi, Kai; Blumenfeld, Barry; Cocoros, Alice; Eminizer, Nicholas; Fehling, David; Feng, Lei; Gritsan, Andrei; Maksimovic, Petar; Roskes, Jeffrey; Sarica, Ulascan; Swartz, Morris; Xiao, Meng; You, Can; Al-bataineh, Ayman; Baringer, Philip; Bean, Alice; Boren, Samuel; Bowen, James; Castle, James; Forthomme, Laurent; Khalil, Sadia; Kropivnitskaya, Anna; Majumder, Devdatta; Mcbrayer, William; Murray, Michael; Sanders, Stephen; Stringer, Robert; Tapia Takaki, Daniel; Wang, Quan; Ivanov, Andrew; Kaadze, Ketino; Maravin, Yurii; Mohammadi, Abdollah; Saini, Lovedeep Kaur; Skhirtladze, Nikoloz; Toda, Sachiko; Rebassoo, Finn; Wright, Douglas; Anelli, Christopher; Baden, Drew; Baron, Owen; Belloni, Alberto; Calvert, Brian; Eno, Sarah Catherine; Ferraioli, Charles; Hadley, Nicholas John; Jabeen, Shabnam; Jeng, Geng-Yuan; Kellogg, Richard G; Kunkle, Joshua; Mignerey, Alice; Ricci-Tam, Francesca; Shin, Young Ho; Skuja, Andris; Tonjes, Marguerite; Tonwar, Suresh C; Abercrombie, Daniel; Allen, Brandon; Apyan, Aram; Azzolini, Virginia; Barbieri, Richard; Baty, Austin; Bi, Ran; Bierwagen, Katharina; Brandt, Stephanie; Busza, Wit; Cali, Ivan Amos; D'Alfonso, Mariarosaria; Demiragli, Zeynep; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hsu, Dylan; Iiyama, Yutaro; Innocenti, Gian Michele; Klute, Markus; Kovalskyi, Dmytro; Krajczar, Krisztian; Lai, Yue Shi; Lee, Yen-Jie; Levin, Andrew; Luckey, Paul David; Maier, Benedikt; Marini, Andrea Carlo; Mcginn, Christopher; Mironov, Camelia; Narayanan, Siddharth; Niu, Xinmei; Paus, Christoph; Roland, Christof; Roland, Gunther; Salfeld-Nebgen, Jakob; Stephans, George; Tatar, Kaya; Velicanu, Dragos; Wang, Jing; Wang, Ta-Wei; Wyslouch, Bolek; Benvenuti, Alberto; Chatterjee, Rajdeep Mohan; Evans, Andrew; Hansen, Peter; Kalafut, Sean; Kao, Shih-Chuan; Kubota, Yuichi; Lesko, Zachary; Mans, Jeremy; Nourbakhsh, Shervin; Ruckstuhl, Nicole; Rusack, Roger; Tambe, Norbert; Turkewitz, Jared; Acosta, John Gabriel; Oliveros, Sandra; Avdeeva, Ekaterina; Bloom, Kenneth; Claes, Daniel R; Fangmeier, Caleb; Gonzalez Suarez, Rebeca; Kamalieddin, Rami; Kravchenko, Ilya; Malta Rodrigues, Alan; Monroy, Jose; Siado, Joaquin Emilo; Snow, Gregory R; Stieger, Benjamin; Alyari, Maral; Dolen, James; Godshalk, Andrew; Harrington, Charles; Iashvili, Ia; Nguyen, Duong; Parker, Ashley; Rappoccio, Salvatore; Roozbahani, Bahareh; Alverson, George; Barberis, Emanuela; Hortiangtham, Apichart; Massironi, Andrea; Morse, David Michael; Nash, David; Orimoto, Toyoko; Teixeira De Lima, Rafael; Trocino, Daniele; Wang, Ren-Jie; Wood, Darien; Bhattacharya, Saptaparna; Charaf, Otman; Hahn, Kristan Allan; Mucia, Nicholas; Odell, Nathaniel; Pollack, Brian; Schmitt, Michael Henry; Sung, Kevin; Trovato, Marco; Velasco, Mayda; Dev, Nabarun; Hildreth, Michael; Hurtado Anampa, Kenyi; Jessop, Colin; Karmgard, Daniel John; Kellams, Nathan; Lannon, Kevin; Marinelli, Nancy; Meng, Fanbo; Mueller, Charles; Musienko, Yuri; Planer, Michael; Reinsvold, Allison; Ruchti, Randy; Rupprecht, Nathaniel; Smith, Geoffrey; Taroni, Silvia; Wayne, Mitchell; Wolf, Matthias; Woodard, Anna; Alimena, Juliette; Antonelli, Louis; Bylsma, Ben; Durkin, Lloyd Stanley; Flowers, Sean; Francis, Brian; Hart, Andrew; Hill, Christopher; Ji, Weifeng; Liu, Bingxuan; Luo, Wuming; Puigh, Darren; Winer, Brian L; Wulsin, Howard Wells; Cooperstein, Stephane; Driga, Olga; Elmer, Peter; Hardenbrook, Joshua; Hebda, Philip; Lange, David; Luo, Jingyu; Marlow, Daniel; Medvedeva, Tatiana; Mei, Kelvin; Ojalvo, Isabel; Olsen, James; Palmer, Christopher; Piroué, Pierre; Stickland, David; Svyatkovskiy, Alexey; Tully, Christopher; Malik, Sudhir; Barker, Anthony; Barnes, Virgil E; Folgueras, Santiago; Gutay, Laszlo; Jha, Manoj; Jones, Matthew; Jung, Andreas Werner; Khatiwada, Ajeeta; Miller, David Harry; Neumeister, Norbert; Schulte, Jan-Frederik; Sun, Jian; Wang, Fuqiang; Xie, Wei; Parashar, Neeti; Stupak, John; Adair, Antony; Akgun, Bora; Chen, Zhenyu; Ecklund, Karl Matthew; Geurts, Frank JM; Guilbaud, Maxime; Li, Wei; Michlin, Benjamin; Northup, Michael; Padley, Brian Paul; Roberts, Jay; Rorie, Jamal; Tu, Zhoudunming; Zabel, James; Betchart, Burton; Bodek, Arie; de Barbaro, Pawel; Demina, Regina; Duh, Yi-ting; Ferbel, Thomas; Galanti, Mario; Garcia-Bellido, Aran; Han, Jiyeon; Hindrichs, Otto; Khukhunaishvili, Aleko; Lo, Kin Ho; Tan, Ping; Verzetti, Mauro; Agapitos, Antonis; Chou, John Paul; Gershtein, Yuri; Gómez Espinosa, Tirso Alejandro; Halkiadakis, Eva; Heindl, Maximilian; Hughes, Elliot; Kaplan, Steven; Kunnawalkam Elayavalli, Raghav; Kyriacou, Savvas; Lath, Amitabh; Montalvo, Roy; Nash, Kevin; Osherson, Marc; Saka, Halil; Salur, Sevil; Schnetzer, Steve; Sheffield, David; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Thomassen, Peter; Walker, Matthew; Delannoy, Andrés G; Foerster, Mark; Heideman, Joseph; Riley, Grant; Rose, Keith; Spanier, Stefan; Thapa, Krishna; Bouhali, Othmane; Celik, Ali; Dalchenko, Mykhailo; De Mattia, Marco; Delgado, Andrea; Dildick, Sven; Eusebi, Ricardo; Gilmore, Jason; Huang, Tao; Juska, Evaldas; Kamon, Teruki; Mueller, Ryan; Pakhotin, Yuriy; Patel, Rishi; Perloff, Alexx; Perniè, Luca; Rathjens, Denis; Safonov, Alexei; Tatarinov, Aysen; Ulmer, Keith; Akchurin, Nural; Damgov, Jordan; De Guio, Federico; Dragoiu, Cosmin; Dudero, Phillip Russell; Faulkner, James; Gurpinar, Emine; Kunori, Shuichi; Lamichhane, Kamal; Lee, Sung Won; Libeiro, Terence; Peltola, Timo; Undleeb, Sonaina; Volobouev, Igor; Wang, Zhixing; Greene, Senta; Gurrola, Alfredo; Janjam, Ravi; Johns, Willard; Maguire, Charles; Melo, Andrew; Ni, Hong; Sheldon, Paul; Tuo, Shengquan; Velkovska, Julia; Xu, Qiao; Arenton, Michael Wayne; Barria, Patrizia; Cox, Bradley; Hirosky, Robert; Ledovskoy, Alexander; Li, Hengne; Neu, Christopher; Sinthuprasith, Tutanon; Sun, Xin; Wang, Yanchu; Wolfe, Evan; Xia, Fan; Clarke, Christopher; Harr, Robert; Karchin, Paul Edmund; Sturdy, Jared; Zaleski, Shawn; Belknap, Donald; Buchanan, James; Caillol, Cécile; Dasu, Sridhara; Dodd, Laura; Duric, Senka; Gomber, Bhawna; Grothe, Monika; Herndon, Matthew; Hervé, Alain; Hussain, Usama; Klabbers, Pamela; Lanaro, Armando; Levine, Aaron; Long, Kenneth; Loveless, Richard; Pierro, Giuseppe Antonio; Polese, Giovanni; Ruggles, Tyler; Savin, Alexander; Smith, Nicholas; Smith, Wesley H; Taylor, Devin; Woods, Nathaniel

    2017-10-04

    A search for charged Higgs bosons produced in vector boson fusion processes and decaying into W and Z A search for charged Higgs bosons produced via vector boson fusion and decaying into W and Z bosons using proton-proton collisions at $\\sqrt{s}= $ 13 TeV is presented. The data sample corresponds to an integrated luminosity of 15.2 fb$^{-1}$ collected with the CMS detector in 2015 and 2016. The event selection requires three leptons (electrons or muons), two jets with large pseudorapidity separation and high dijet mass, and missing transverse momentum. The observation agrees with the standard model prediction. Limits on the vector boson fusion production cross section times branching fraction for new charged physical states are reported as a function of mass from 200 to 2000 GeV and interpreted in the context of Higgs triplet models.

  3. Xenon Fractionation and Archean Hydrogen Escape

    Science.gov (United States)

    Zahnle, K. J.

    2015-01-01

    Xenon is the heaviest gas found in significant quantities in natural planetary atmospheres. It would seem the least likely to escape. Yet there is more evidence for xenon escape from Earth than for any element other than helium and perhaps neon. The most straightforward evidence is that most of the radiogenic Xe from the decay of (129)I (half-life 15.7 Myr) and (244)Pu (half-life 81 Myr) that is Earth's birthright is missing. The missing xenon is often attributed to the impact erosion of early atmospheres of Earth and its ancestors. It is obvious that if most of the radiogenic xenon were driven off by impacts, most of the rest of the atmophiles fared the same fate. The other line of evidence is in the nonradiogenic isotopes of xenon and its silent partner, krypton. Atmospheric xenon is strongly mass fractionated (at about 4% per amu) compared to any known solar system source (Figure 1). This is in stark contrast to krypton, which may not be fractionated at all: atmospheric Kr is slightly heavier than solar Kr (at about 0.5% per amu), but it is the same as in carbonaceous chondrites. Nonradiogenic xenon is also under abundant relative to krypton (the so-called "missing xenon" problem). Together these observations imply that xenon has been subject to fractionating escape and krypton not.

  4. Escape probabilities for fluorescent x-rays

    International Nuclear Information System (INIS)

    Dance, D.R.; Day, G.J.

    1985-01-01

    Computation of the energy absorption efficiency of an x-ray photon detector involves consideration of the histories of the secondary particles produced in any initial or secondary interaction which may occur within the detector. In particular, the K or higher shell fluorescent x-rays which may be emitted following a photoelectric interaction can carry away a large fraction of the energy of the incident photon, especially if this energy is just above an absorption edge. The effects of such photons cannot be ignored and a correction term, depending upon the probability that the fluorescent x-rays will escape from the detector, must be applied to the energy absorption efficiency. For detectors such as x-ray intensifying screens, it has been usual to calculate this probability by numerical integration. In this note analytic expressions are derived for the escape probability of fluorescent photons from planar detectors in terms of exponential integral functions. Rational approximations for these functions are readily available and these analytic expressions therefore facilitate the computation of photon absorption efficiencies. A table is presented which should obviate the need for calculating the escape probability for most cases of interest. (author)

  5. Paired Hall states

    International Nuclear Information System (INIS)

    Greiter, M.

    1992-01-01

    This dissertation contains a collection of individual articles on various topics. Their significance in the corresponding field as well as connections between them are emphasized in a general and comprehensive introduction. In the first article, the author explores the consequences for macroscopic effective Lagrangians of assuming that the momentum density is proportional to the flow of conserved current. The universal corrections obtained for the macroscopic Lagrangian of a superconductor describe the London Hall effect, and provide a fully consistent derivation of it. In the second article, a heuristic principle is proposed for quantized Hall states: the existence and incompressibility of fractionally quantized Hall states is explained by an argument based on an adiabatic localization of magnetic flux, the process of trading uniform flux for an equal amount of fictitious flux attached to the particles. This principle is exactly implemented in the third article. For a certain class of model Hamiltonians, the author obtains Laughlin's Jastrow type wave functions explicitly from a filled Landau level, by smooth extrapolation in quantum statistics. The generalization of this analysis to the torus geometry shows that theorems restricting the possibilities of quantum statistics on closed surfaces are circumvented in the presence of a magnetic field. In the last article, the existence is proposed of a novel incompressible quantum liquid, a paired Hall state, at a half filled Landau level. This state arises adiabatically from free fermions in zero magnetic field, and reduces to a state previously proposed by Halperin in the limit of tightly bound pairs. It supports unusual excitations, including neutral fermions and charge e/4 anyons with statistical parameter θ = π/8

  6. Risks incurred by hydrogen escaping from containers and conduits

    Energy Technology Data Exchange (ETDEWEB)

    Swain, M.R.; Grilliot, E.S. [Univ. of Miami, Coral Gables, FL (United States); Swain, M.N. [Analytical Technologies, Inc., Miami, FL (United States)

    1998-08-01

    This paper is a discussion of a method for hydrogen leak classification. Leaks are classified as; gas escapes into enclosed spaces, gas escapes into partially enclosed spaces (vented), and gas escapes into unenclosed spaces. Each of the three enclosure classifications is further divided into two subclasses; total volume of hydrogen escaped and flow rate of escaping hydrogen. A method to aid in risk assessment determination in partially enclosed spaces is proposed and verified for several enclosure geometries. Examples are discussed for additional enclosure geometries.

  7. The cost of the sword: escape performance in male swordtails.

    Directory of Open Access Journals (Sweden)

    Alex Baumgartner

    2011-01-01

    Full Text Available The handicap theory of sexual selection posits that male display traits that are favored in mate choice come at a significant cost to performance. We tested one facet of this hypothesis in the green swordtail (Xiphophorus helleri. In this species, the lower ray of male caudal fin is extended into a 'sword', which serves to attract potential mates. However, bearing a long sword may increase drag and thus compromise a male's ability to swim effectively. We tested escape performance in this species by eliciting C-start escape responses, an instinctive escape behavior, in males with various sword lengths. We then removed males' swords and retested escape performance. We found no relationship between escape performance and sword length and no effect of sword removal on escape performance. While having a large sword may attract a predator's attention, our results suggest that sword size does not compromise a male's escape performance.

  8. Search for Charged Higgs Bosons Produced via Vector Boson Fusion and Decaying into a Pair of W and Z Bosons Using pp Collisions at sqrt[s]=13  TeV.

    Science.gov (United States)

    Sirunyan, A M; Tumasyan, A; Adam, W; Asilar, E; Bergauer, T; Brandstetter, J; Brondolin, E; Dragicevic, M; Erö, J; Flechl, M; Friedl, M; Frühwirth, R; Ghete, V M; Hartl, C; Hörmann, N; Hrubec, J; Jeitler, M; König, A; Krätschmer, I; Liko, D; Matsushita, T; Mikulec, I; Rabady, D; Rad, N; Rahbaran, B; Rohringer, H; Schieck, J; Strauss, J; Waltenberger, W; Wulz, C-E; Dvornikov, O; Makarenko, V; Mossolov, V; Suarez Gonzalez, J; Zykunov, V; Shumeiko, N; Alderweireldt, S; De Wolf, E A; Janssen, X; Lauwers, J; Van De Klundert, M; Van Haevermaet, H; Van Mechelen, P; Van Remortel, N; Van Spilbeeck, A; Abu Zeid, S; Blekman, F; D'Hondt, J; Daci, N; De Bruyn, I; Deroover, K; Lowette, S; Moortgat, S; Moreels, L; Olbrechts, A; Python, Q; Skovpen, K; Tavernier, S; Van Doninck, W; Van Mulders, P; Van Parijs, I; Brun, H; Clerbaux, B; De Lentdecker, G; Delannoy, H; Fasanella, G; Favart, L; Goldouzian, R; Grebenyuk, A; Karapostoli, G; Lenzi, T; Léonard, A; Luetic, J; Maerschalk, T; Marinov, A; Randle-Conde, A; Seva, T; Vander Velde, C; Vanlaer, P; Vannerom, D; Yonamine, R; Zenoni, F; Zhang, F; Cornelis, T; Dobur, D; Fagot, A; Gul, M; Khvastunov, I; Poyraz, D; Salva, S; Schöfbeck, R; Tytgat, M; Van Driessche, W; Verbeke, W; Zaganidis, N; Bakhshiansohi, H; Bondu, O; Brochet, S; Bruno, G; Caudron, A; De Visscher, S; Delaere, C; Delcourt, M; Francois, B; Giammanco, A; Jafari, A; Komm, M; Krintiras, G; Lemaitre, V; Magitteri, A; Mertens, A; Musich, M; Piotrzkowski, K; Quertenmont, L; Vidal Marono, M; Wertz, S; Beliy, N; Aldá Júnior, W L; Alves, F L; Alves, G A; Brito, L; Hensel, C; Moraes, A; Pol, M E; Rebello Teles, P; Belchior Batista Das Chagas, E; Carvalho, W; Chinellato, J; Custódio, A; Da Costa, E M; Da Silveira, G G; De Jesus Damiao, D; De Oliveira Martins, C; Fonseca De Souza, S; Huertas Guativa, L M; Malbouisson, H; Matos Figueiredo, D; Mora Herrera, C; Mundim, L; Nogima, H; Prado Da Silva, W L; Santoro, A; Sznajder, A; Tonelli Manganote, E J; Torres Da Silva De Araujo, F; Vilela Pereira, A; Ahuja, S; Bernardes, C A; Dogra, S; Fernandez Perez Tomei, T R; Gregores, E M; Mercadante, P G; Moon, C S; Novaes, S F; Padula, Sandra S; Romero Abad, D; Ruiz Vargas, J C; Aleksandrov, A; Hadjiiska, R; Iaydjiev, P; Rodozov, M; Stoykova, S; Sultanov, G; Vutova, M; Dimitrov, A; Glushkov, I; Litov, L; Pavlov, B; Petkov, P; Fang, W; Gao, X; Ahmad, M; Bian, J G; Chen, G M; Chen, H S; Chen, M; Chen, Y; Cheng, T; Jiang, C H; Leggat, D; Liu, Z; Romeo, F; Ruan, M; Shaheen, S M; Spiezia, A; Tao, J; Wang, C; Wang, Z; Yazgan, E; Zhang, H; Zhao, J; Ban, Y; Chen, G; Li, Q; Liu, S; Mao, Y; Qian, S J; Wang, D; Xu, Z; Avila, C; Cabrera, A; Chaparro Sierra, L F; Florez, C; Gomez, J P; González Hernández, C F; Ruiz Alvarez, J D; Sanabria, J C; Godinovic, N; Lelas, D; Puljak, I; Ribeiro Cipriano, P M; Sculac, T; Antunovic, Z; Kovac, M; Brigljevic, V; Ferencek, D; Kadija, K; Mesic, B; Susa, T; Ather, M W; Attikis, A; Mavromanolakis, G; Mousa, J; Nicolaou, C; Ptochos, F; Razis, P A; Rykaczewski, H; Finger, M; Finger, M; Carrera Jarrin, E; Abdelalim, A A; Mohammed, Y; Salama, E; Kadastik, M; Perrini, L; Raidal, M; Tiko, A; Veelken, C; Eerola, P; Pekkanen, J; Voutilainen, M; Härkönen, J; Järvinen, T; Karimäki, V; Kinnunen, R; Lampén, T; Lassila-Perini, K; Lehti, S; Lindén, T; Luukka, P; Tuominiemi, J; Tuovinen, E; Wendland, L; Talvitie, J; Tuuva, T; Besancon, M; Couderc, F; Dejardin, M; Denegri, D; Fabbro, B; Faure, J L; Favaro, C; Ferri, F; Ganjour, S; Ghosh, S; Givernaud, A; Gras, P; Hamel de Monchenault, G; Jarry, P; Kucher, I; Locci, E; Machet, M; Malcles, J; Rander, J; Rosowsky, A; Titov, M; Abdulsalam, A; Antropov, I; Baffioni, S; Beaudette, F; Busson, P; Cadamuro, L; Chapon, E; Charlot, C; Davignon, O; Granier de Cassagnac, R; Jo, M; Lisniak, S; Lobanov, A; Miné, P; Nguyen, M; Ochando, C; Ortona, G; Paganini, P; Pigard, P; Regnard, S; Salerno, R; Sirois, Y; Stahl Leiton, A G; Strebler, T; Yilmaz, Y; Zabi, A; Zghiche, A; Agram, J-L; Andrea, J; Bloch, D; Brom, J-M; Buttignol, M; Chabert, E C; Chanon, N; Collard, C; Conte, E; Coubez, X; Fontaine, J-C; Gelé, D; Goerlach, U; Le Bihan, A-C; Van Hove, P; Gadrat, S; Beauceron, S; Bernet, C; Boudoul, G; Carrillo Montoya, C A; Chierici, R; Contardo, D; Courbon, B; Depasse, P; El Mamouni, H; Fay, J; Finco, L; Gascon, S; Gouzevitch, M; Grenier, G; Ille, B; Lagarde, F; Laktineh, I B; Lethuillier, M; Mirabito, L; Pequegnot, A L; Perries, S; Popov, A; Sordini, V; Vander Donckt, M; Verdier, P; Viret, S; Khvedelidze, A; Tsamalaidze, Z; Autermann, C; Beranek, S; Feld, L; Kiesel, M K; Klein, K; Lipinski, M; Preuten, M; Schomakers, C; Schulz, J; Verlage, T; Albert, A; Brodski, M; Dietz-Laursonn, E; Duchardt, D; Endres, M; Erdmann, M; Erdweg, S; Esch, T; Fischer, R; Güth, A; Hamer, M; Hebbeker, T; Heidemann, C; Hoepfner, K; Knutzen, S; Merschmeyer, M; Meyer, A; Millet, P; Mukherjee, S; Olschewski, M; Padeken, K; Pook, T; Radziej, M; Reithler, H; Rieger, M; Scheuch, F; Sonnenschein, L; Teyssier, D; Thüer, S; Cherepanov, V; Flügge, G; Kargoll, B; Kress, T; Künsken, A; Lingemann, J; Müller, T; Nehrkorn, A; Nowack, A; Pistone, C; Pooth, O; Stahl, A; Aldaya Martin, M; Arndt, T; Asawatangtrakuldee, C; Beernaert, K; Behnke, O; Behrens, U; Bin Anuar, A A; Borras, K; Campbell, A; Connor, P; Contreras-Campana, C; Costanza, F; Diez Pardos, C; Dolinska, G; Eckerlin, G; Eckstein, D; Eichhorn, T; Eren, E; Gallo, E; Garay Garcia, J; Geiser, A; Gizhko, A; Grados Luyando, J M; Grohsjean, A; Gunnellini, P; Harb, A; Hauk, J; Hempel, M; Jung, H; Kalogeropoulos, A; Karacheban, O; Kasemann, M; Keaveney, J; Kleinwort, C; Korol, I; Krücker, D; Lange, W; Lelek, A; Lenz, T; Leonard, J; Lipka, K; Lohmann, W; Mankel, R; Melzer-Pellmann, I-A; Meyer, A B; Mittag, G; Mnich, J; Mussgiller, A; Ntomari, E; Pitzl, D; Placakyte, R; Raspereza, A; Roland, B; Sahin, M Ö; Saxena, P; Schoerner-Sadenius, T; Spannagel, S; Stefaniuk, N; Van Onsem, G P; Walsh, R; Wissing, C; Blobel, V; Centis Vignali, M; Draeger, A R; Dreyer, T; Garutti, E; Gonzalez, D; Haller, J; Hoffmann, M; Junkes, A; Klanner, R; Kogler, R; Kovalchuk, N; Kurz, S; Lapsien, T; Marchesini, I; Marconi, D; Meyer, M; Niedziela, M; Nowatschin, D; Pantaleo, F; Peiffer, T; Perieanu, A; Scharf, C; Schleper, P; Schmidt, A; Schumann, S; Schwandt, J; Sonneveld, J; Stadie, H; Steinbrück, G; Stober, F M; Stöver, M; Tholen, H; Troendle, D; Usai, E; Vanelderen, L; Vanhoefer, A; Vormwald, B; Akbiyik, M; Barth, C; Baur, S; Baus, C; Berger, J; Butz, E; Caspart, R; Chwalek, T; Colombo, F; De Boer, W; Dierlamm, A; Fink, S; Freund, B; Friese, R; Giffels, M; Gilbert, A; Goldenzweig, P; Haitz, D; Hartmann, F; Heindl, S M; Husemann, U; Kassel, F; Katkov, I; Kudella, S; Mildner, H; Mozer, M U; Müller, Th; Plagge, M; Quast, G; Rabbertz, K; Röcker, S; Roscher, F; Schröder, M; Shvetsov, I; Sieber, G; Simonis, H J; Ulrich, R; Wayand, S; Weber, M; Weiler, T; Williamson, S; Wöhrmann, C; Wolf, R; Anagnostou, G; Daskalakis, G; Geralis, T; Giakoumopoulou, V A; Kyriakis, A; Loukas, D; Topsis-Giotis, I; Kesisoglou, S; Panagiotou, A; Saoulidou, N; Tziaferi, E; Kousouris, K; Evangelou, I; Flouris, G; Foudas, C; Kokkas, P; Loukas, N; Manthos, N; Papadopoulos, I; Paradas, E; Triantis, F A; Filipovic, N; Pasztor, G; Bencze, G; Hajdu, C; Horvath, D; Sikler, F; Veszpremi, V; Vesztergombi, G; Zsigmond, A J; Beni, N; Czellar, S; Karancsi, J; Makovec, A; Molnar, J; Szillasi, Z; Bartók, M; Raics, P; Trocsanyi, Z L; Ujvari, B; Choudhury, S; Komaragiri, J R; Bahinipati, S; Bhowmik, S; Mal, P; Mandal, K; Nayak, A; Sahoo, D K; Sahoo, N; Swain, S K; Bansal, S; Beri, S B; Bhatnagar, V; Chawla, R; Bhawandeep, U; Kalsi, A K; Kaur, A; Kaur, M; Kumar, R; Kumari, P; Mehta, A; Mittal, M; Singh, J B; Walia, G; Kumar, Ashok; Bhardwaj, A; Choudhary, B C; Garg, R B; Keshri, S; Kumar, A; Malhotra, S; Naimuddin, M; Ranjan, K; Sharma, R; Sharma, V; Bhattacharya, R; Bhattacharya, S; Chatterjee, K; Dey, S; Dutt, S; Dutta, S; Ghosh, S; Majumdar, N; Modak, A; Mondal, K; Mukhopadhyay, S; Nandan, S; Purohit, A; Roy, A; Roy, D; Roy Chowdhury, S; Sarkar, S; Sharan, M; Thakur, S; Behera, P K; Chudasama, R; Dutta, D; Jha, V; Kumar, V; Mohanty, A K; Netrakanti, P K; Pant, L M; Shukla, P; Topkar, A; Aziz, T; Dugad, S; Kole, G; Mahakud, B; Mitra, S; Mohanty, G B; Parida, B; Sur, N; Sutar, B; Banerjee, S; Dewanjee, R K; Ganguly, S; Guchait, M; Jain, Sa; Kumar, S; Maity, M; Majumder, G; Mazumdar, K; Sarkar, T; Wickramage, N; Chauhan, S; Dube, S; Hegde, V; Kapoor, A; Kothekar, K; Pandey, S; Rane, A; Sharma, S; Chenarani, S; Eskandari Tadavani, E; Etesami, S M; Khakzad, M; Mohammadi Najafabadi, M; Naseri, M; Paktinat Mehdiabadi, S; Rezaei Hosseinabadi, F; Safarzadeh, B; Zeinali, M; Felcini, M; Grunewald, M; Abbrescia, M; Calabria, C; Caputo, C; Colaleo, A; Creanza, D; Cristella, L; De Filippis, N; De Palma, M; Fiore, L; Iaselli, G; Maggi, G; Maggi, M; Miniello, G; My, S; Nuzzo, S; Pompili, A; Pugliese, G; Radogna, R; Ranieri, A; Selvaggi, G; Sharma, A; Silvestris, L; Venditti, R; Verwilligen, P; Abbiendi, G; Battilana, C; Bonacorsi, D; Braibant-Giacomelli, S; Brigliadori, L; Campanini, R; Capiluppi, P; Castro, A; Cavallo, F R; Chhibra, S S; Codispoti, G; Cuffiani, M; Dallavalle, G M; Fabbri, F; Fanfani, A; Fasanella, D; Giacomelli, P; Grandi, C; Guiducci, L; Marcellini, S; Masetti, G; Montanari, A; Navarria, F L; Perrotta, A; Rossi, A M; Rovelli, T; Siroli, G P; Tosi, N; Albergo, S; Costa, S; Di Mattia, A; Giordano, F; Potenza, R; Tricomi, A; Tuve, C; Barbagli, G; Ciulli, V; Civinini, C; D'Alessandro, R; Focardi, E; Lenzi, P; Meschini, M; Paoletti, S; Russo, L; Sguazzoni, G; Strom, D; Viliani, L; Benussi, L; Bianco, S; Fabbri, F; Piccolo, D; Primavera, F; Calvelli, V; Ferro, F; Monge, M R; Robutti, E; Tosi, S; Brianza, L; Brivio, F; Ciriolo, V; Dinardo, M E; Fiorendi, S; Gennai, S; Ghezzi, A; Govoni, P; Malberti, M; Malvezzi, S; Manzoni, R A; Menasce, D; Moroni, L; Paganoni, M; Pedrini, D; Pigazzini, S; Ragazzi, S; Tabarelli de Fatis, T; Buontempo, S; Cavallo, N; De Nardo, G; Di Guida, S; Fabozzi, F; Fienga, F; Iorio, A O M; Lista, L; Meola, S; Paolucci, P; Sciacca, C; Thyssen, F; Azzi, P; Bacchetta, N; Benato, L; Bisello, D; Boletti, A; Carlin, R; Carvalho Antunes De Oliveira, A; Checchia, P; Dall'Osso, M; De Castro Manzano, P; Dorigo, T; Gasparini, F; Gasparini, U; Gozzelino, A; Lacaprara, S; Margoni, M; Meneguzzo, A T; Pazzini, J; Pozzobon, N; Ronchese, P; Rossin, R; Simonetto, F; Torassa, E; Zanetti, M; Zotto, P; Zumerle, G; Braghieri, A; Fallavollita, F; Magnani, A; Montagna, P; Ratti, S P; Re, V; Ressegotti, M; Riccardi, C; Salvini, P; Vai, I; Vitulo, P; Alunni Solestizi, L; Bilei, G M; Ciangottini, D; Fanò, L; Lariccia, P; Leonardi, R; Mantovani, G; Mariani, V; Menichelli, M; Saha, A; Santocchia, A; Androsov, K; Azzurri, P; Bagliesi, G; Bernardini, J; Boccali, T; Castaldi, R; Ciocci, M A; Dell'Orso, R; Fedi, G; Giassi, A; Grippo, M T; Ligabue, F; Lomtadze, T; Martini, L; Messineo, A; Palla, F; Rizzi, A; Savoy-Navarro, A; Spagnolo, P; Tenchini, R; Tonelli, G; Venturi, A; Verdini, P G; Barone, L; Cavallari, F; Cipriani, M; Del Re, D; Diemoz, M; Gelli, S; Longo, E; Margaroli, F; Marzocchi, B; Meridiani, P; Organtini, G; Paramatti, R; Preiato, F; Rahatlou, S; Rovelli, C; Santanastasio, F; Amapane, N; Arcidiacono, R; Argiro, S; Arneodo, M; Bartosik, N; Bellan, R; Biino, C; Cartiglia, N; Cenna, F; Costa, M; Covarelli, R; Degano, A; Demaria, N; Kiani, B; Mariotti, C; Maselli, S; Migliore, E; Monaco, V; Monteil, E; Monteno, M; Obertino, M M; Pacher, L; Pastrone, N; Pelliccioni, M; Pinna Angioni, G L; Ravera, F; Romero, A; Ruspa, M; Sacchi, R; Shchelina, K; Sola, V; Solano, A; Staiano, A; Traczyk, P; Belforte, S; Casarsa, M; Cossutti, F; Della Ricca, G; Zanetti, A; Kim, D H; Kim, G N; Kim, M S; Lee, J; Lee, S; Lee, S W; Oh, Y D; Sekmen, S; Son, D C; Yang, Y C; Lee, A; Kim, H; Brochero Cifuentes, J A; Goh, J; Kim, T J; Cho, S; Choi, S; Go, Y; Gyun, D; Ha, S; Hong, B; Jo, Y; Kim, Y; Lee, K; Lee, K S; Lee, S; Lim, J; Park, S K; Roh, Y; Almond, J; Kim, J; Lee, H; Oh, S B; Radburn-Smith, B C; Seo, S H; Yang, U K; Yoo, H D; Yu, G B; Choi, M; Kim, H; Kim, J H; Lee, J S H; Park, I C; Ryu, G; Ryu, M S; Choi, Y; Hwang, C; Lee, J; Yu, I; Dudenas, V; Juodagalvis, A; Vaitkus, J; Ahmed, I; Ibrahim, Z A; Md Ali, M A B; Mohamad Idris, F; Wan Abdullah, W A T; Yusli, M N; Zolkapli, Z; Castilla-Valdez, H; De La Cruz-Burelo, E; Heredia-De La Cruz, I; Lopez-Fernandez, R; Magaña Villalba, R; Mejia Guisao, J; Sanchez-Hernandez, A; Carrillo Moreno, S; Oropeza Barrera, C; Vazquez Valencia, F; Carpinteyro, S; Pedraza, I; Salazar Ibarguen, H A; Uribe Estrada, C; Morelos Pineda, A; Krofcheck, D; Butler, P H; Ahmad, A; Ahmad, M; Hassan, Q; Hoorani, H R; Khan, W A; Saddique, A; Shah, M A; Shoaib, M; Waqas, M; Bialkowska, H; Bluj, M; Boimska, B; Frueboes, T; Górski, M; Kazana, M; Nawrocki, K; Romanowska-Rybinska, K; Szleper, M; Zalewski, P; Bunkowski, K; Byszuk, A; Doroba, K; Kalinowski, A; Konecki, M; Krolikowski, J; Misiura, M; Olszewski, M; Pyskir, A; Walczak, M; Bargassa, P; Beirão Da Cruz E Silva, C; Calpas, B; Di Francesco, A; Faccioli, P; Gallinaro, M; Hollar, J; Leonardo, N; Lloret Iglesias, L; Nemallapudi, M V; Seixas, J; Toldaiev, O; Vadruccio, D; Varela, J; Afanasiev, S; Bunin, P; Gavrilenko, M; Golutvin, I; Gorbunov, I; Kamenev, A; Karjavin, V; Lanev, A; Malakhov, A; Matveev, V; Palichik, V; Perelygin, V; Shmatov, S; Shulha, S; Skatchkov, N; Smirnov, V; Voytishin, N; Zarubin, A; Chtchipounov, L; Golovtsov, V; Ivanov, Y; Kim, V; Kuznetsova, E; Murzin, V; Oreshkin, V; Sulimov, V; Vorobyev, A; Andreev, Yu; Dermenev, A; Gninenko, S; Golubev, N; Karneyeu, A; Kirsanov, M; Krasnikov, N; Pashenkov, A; Tlisov, D; Toropin, A; Epshteyn, V; Gavrilov, V; Lychkovskaya, N; Popov, V; Pozdnyakov, I; Safronov, G; Spiridonov, A; Toms, M; Vlasov, E; Zhokin, A; Aushev, T; Bylinkin, A; Chistov, R; Danilov, M; Polikarpov, S; Andreev, V; Azarkin, M; Dremin, I; Kirakosyan, M; Leonidov, A; Terkulov, A; Baskakov, A; Belyaev, A; Boos, E; Bunichev, V; Dubinin, M; Dudko, L; Gribushin, A; Klyukhin, V; Kodolova, O; Lokhtin, I; Miagkov, I; Obraztsov, S; Perfilov, M; Petrushanko, S; Savrin, V; Blinov, V; Skovpen, Y; Shtol, D; Azhgirey, I; Bayshev, I; Bitioukov, S; Elumakhov, D; Kachanov, V; Kalinin, A; Konstantinov, D; Krychkine, V; Petrov, V; Ryutin, R; Sobol, A; Troshin, S; Tyurin, N; Uzunian, A; Volkov, A; Adzic, P; Cirkovic, P; Devetak, D; Dordevic, M; Milosevic, J; Rekovic, V; Alcaraz Maestre, J; Barrio Luna, M; Calvo, E; Cerrada, M; Chamizo Llatas, M; Colino, N; De La Cruz, B; Delgado Peris, A; Escalante Del Valle, A; Fernandez Bedoya, C; Fernández Ramos, J P; Flix, J; Fouz, M C; Garcia-Abia, P; Gonzalez Lopez, O; Goy Lopez, S; Hernandez, J M; Josa, M I; Navarro De Martino, E; Pérez-Calero Yzquierdo, A; Puerta Pelayo, J; Quintario Olmeda, A; Redondo, I; Romero, L; Soares, M S; de Trocóniz, J F; Missiroli, M; Moran, D; Cuevas, J; Erice, C; Fernandez Menendez, J; Gonzalez Caballero, I; González Fernández, J R; Palencia Cortezon, E; Sanchez Cruz, S; Suárez Andrés, I; Vischia, P; Vizan Garcia, J M; Cabrillo, I J; Calderon, A; Curras, E; Fernandez, M; Garcia-Ferrero, J; Gomez, G; Lopez Virto, A; Marco, J; Martinez Rivero, C; Matorras, F; Piedra Gomez, J; Rodrigo, T; Ruiz-Jimeno, A; Scodellaro, L; Trevisani, N; Vila, I; Vilar Cortabitarte, R; Abbaneo, D; Auffray, E; Auzinger, G; Baillon, P; Ball, A H; Barney, D; Bloch, P; Bocci, A; Botta, C; Camporesi, T; Castello, R; Cepeda, M; Cerminara, G; Chen, Y; Cimmino, A; d'Enterria, D; Dabrowski, A; Daponte, V; David, A; De Gruttola, M; De Roeck, A; Di Marco, E; Dobson, M; Dorney, B; du Pree, T; Dünser, M; Dupont, N; Elliott-Peisert, A; Everaerts, P; Fartoukh, S; Franzoni, G; Fulcher, J; Funk, W; Gigi, D; Gill, K; Girone, M; Glege, F; Gulhan, D; Gundacker, S; Guthoff, M; Harris, P; Hegeman, J; Innocente, V; Janot, P; Kieseler, J; Kirschenmann, H; Knünz, V; Kornmayer, A; Kortelainen, M J; Krammer, M; Lange, C; Lecoq, P; Lourenço, C; Lucchini, M T; Malgeri, L; Mannelli, M; Martelli, A; Meijers, F; Merlin, J A; Mersi, S; Meschi, E; Milenovic, P; Moortgat, F; Morovic, S; Mulders, M; Neugebauer, H; Orfanelli, S; Orsini, L; Pape, L; Perez, E; Peruzzi, M; Petrilli, A; Petrucciani, G; Pfeiffer, A; Pierini, M; Racz, A; Reis, T; Rolandi, G; Rovere, M; Sakulin, H; Sauvan, J B; Schäfer, C; Schwick, C; Seidel, M; Selvaggi, M; Sharma, A; Silva, P; Sphicas, P; Steggemann, J; Stoye, M; Takahashi, Y; Tosi, M; Treille, D; Triossi, A; Tsirou, A; Veckalns, V; Veres, G I; Verweij, M; Wardle, N; Wöhri, H K; Zagozdzinska, A; Zeuner, W D; Bertl, W; Deiters, K; Erdmann, W; Horisberger, R; Ingram, Q; Kaestli, H C; Kotlinski, D; Langenegger, U; Rohe, T; Wiederkehr, S A; Bachmair, F; Bäni, L; Bianchini, L; Casal, B; Dissertori, G; Dittmar, M; Donegà, M; Grab, C; Heidegger, C; Hits, D; Hoss, J; Kasieczka, G; Lustermann, W; Mangano, B; Marionneau, M; Martinez Ruiz Del Arbol, P; Masciovecchio, M; Meinhard, M T; Meister, D; Micheli, F; Musella, P; Nessi-Tedaldi, F; Pandolfi, F; Pata, J; Pauss, F; Perrin, G; Perrozzi, L; Quittnat, M; Rossini, M; Schönenberger, M; Starodumov, A; Tavolaro, V R; Theofilatos, K; Wallny, R; Aarrestad, T K; Amsler, C; Caminada, L; Canelli, M F; De Cosa, A; Donato, S; Galloni, C; Hinzmann, A; Hreus, T; Kilminster, B; Ngadiuba, J; Pinna, D; Rauco, G; Robmann, P; Salerno, D; Seitz, C; Yang, Y; Zucchetta, A; Candelise, V; Doan, T H; Jain, Sh; Khurana, R; Konyushikhin, M; Kuo, C M; Lin, W; Pozdnyakov, A; Yu, S S; Kumar, Arun; Chang, P; Chang, Y H; Chao, Y; Chen, K F; Chen, P H; Fiori, F; Hou, W-S; Hsiung, Y; Liu, Y F; Lu, R-S; Miñano Moya, M; Paganis, E; Psallidas, A; Tsai, J F; Asavapibhop, B; Singh, G; Srimanobhas, N; Suwonjandee, N; Adiguzel, A; Boran, F; Cerci, S; Damarseckin, S; Demiroglu, Z S; Dozen, C; Dumanoglu, I; Girgis, S; Gokbulut, G; Guler, Y; Hos, I; Kangal, E E; Kara, O; Kayis Topaksu, A; Kiminsu, U; Oglakci, M; Onengut, G; Ozdemir, K; Sunar Cerci, D; Topakli, H; Turkcapar, S; Zorbakir, I S; Zorbilmez, C; Bilin, B; Isildak, B; Karapinar, G; Yalvac, M; Zeyrek, M; Gülmez, E; Kaya, M; Kaya, O; Yetkin, E A; Yetkin, T; Cakir, A; Cankocak, K; Sen, S; Grynyov, B; Levchuk, L; Sorokin, P; Aggleton, R; Ball, F; Beck, L; Brooke, J J; Burns, D; Clement, E; Cussans, D; Flacher, H; Goldstein, J; Grimes, M; Heath, G P; Heath, H F; Jacob, J; Kreczko, L; Lucas, C; Newbold, D M; Paramesvaran, S; Poll, A; Sakuma, T; Seif El Nasr-Storey, S; Smith, D; Smith, V J; Bell, K W; Belyaev, A; Brew, C; Brown, R M; Calligaris, L; Cieri, D; Cockerill, D J A; Coughlan, J A; Harder, K; Harper, S; Olaiya, E; Petyt, D; Shepherd-Themistocleous, C H; Thea, A; Tomalin, I R; Williams, T; Baber, M; Bainbridge, R; Buchmuller, O; Bundock, A; Casasso, S; Citron, M; Colling, D; Corpe, L; Dauncey, P; Davies, G; De Wit, A; Della Negra, M; Di Maria, R; Dunne, P; Elwood, A; Futyan, D; Haddad, Y; Hall, G; Iles, G; James, T; Lane, R; Laner, C; Lyons, L; Magnan, A-M; Malik, S; Mastrolorenzo, L; Nash, J; Nikitenko, A; Pela, J; Penning, B; Pesaresi, M; Raymond, D M; Richards, A; Rose, A; Scott, E; Seez, C; Summers, S; Tapper, A; Uchida, K; Vazquez Acosta, M; Virdee, T; Wright, J; Zenz, S C; Cole, J E; Hobson, P R; Khan, A; Kyberd, P; Reid, I D; Symonds, P; Teodorescu, L; Turner, M; Borzou, A; Call, K; Dittmann, J; Hatakeyama, K; Liu, H; Pastika, N; Bartek, R; Dominguez, A; Buccilli, A; Cooper, S I; Henderson, C; Rumerio, P; West, C; Arcaro, D; Avetisyan, A; Bose, T; Gastler, D; Rankin, D; Richardson, C; Rohlf, J; Sulak, L; Zou, D; Benelli, G; Cutts, D; Garabedian, A; Hakala, J; Heintz, U; Hogan, J M; Jesus, O; Kwok, K H M; Laird, E; Landsberg, G; Mao, Z; Narain, M; Piperov, S; Sagir, S; Spencer, E; Syarif, R; Breedon, R; Burns, D; Calderon De La Barca Sanchez, M; Chauhan, S; Chertok, M; Conway, J; Conway, R; Cox, P T; Erbacher, R; Flores, C; Funk, G; Gardner, M; Ko, W; Lander, R; Mclean, C; Mulhearn, M; Pellett, D; Pilot, J; Shalhout, S; Shi, M; Smith, J; Squires, M; Stolp, D; Tos, K; Tripathi, M; Bachtis, M; Bravo, C; Cousins, R; Dasgupta, A; Florent, A; Hauser, J; Ignatenko, M; Mccoll, N; Saltzberg, D; Schnaible, C; Valuev, V; Weber, M; Bouvier, E; Burt, K; Clare, R; Ellison, J; Gary, J W; Ghiasi Shirazi, S M A; Hanson, G; Heilman, J; Jandir, P; Kennedy, E; Lacroix, F; Long, O R; Olmedo Negrete, M; Paneva, M I; Shrinivas, A; Si, W; Wei, H; Wimpenny, S; Yates, B R; Branson, J G; Cerati, G B; Cittolin, S; Derdzinski, M; Gerosa, R; Holzner, A; Klein, D; Krutelyov, V; Letts, J; Macneill, I; Olivito, D; Padhi, S; Pieri, M; Sani, M; Sharma, V; Simon, S; Tadel, M; Vartak, A; Wasserbaech, S; Welke, C; Wood, J; Würthwein, F; Yagil, A; Zevi Della Porta, G; Amin, N; Bhandari, R; Bradmiller-Feld, J; Campagnari, C; Dishaw, A; Dutta, V; Franco Sevilla, M; George, C; Golf, F; Gouskos, L; Gran, J; Heller, R; Incandela, J; Mullin, S D; Ovcharova, A; Qu, H; Richman, J; Stuart, D; Suarez, I; Yoo, J; Anderson, D; Bendavid, J; Bornheim, A; Bunn, J; Lawhorn, J M; Mott, A; Newman, H B; Pena, C; Spiropulu, M; Vlimant, J R; Xie, S; Zhu, R Y; Andrews, M B; Ferguson, T; Paulini, M; Russ, J; Sun, M; Vogel, H; Vorobiev, I; Weinberg, M; Cumalat, J P; Ford, W T; Jensen, F; Johnson, A; Krohn, M; Leontsinis, S; Mulholland, T; Stenson, K; Wagner, S R; Alexander, J; Chaves, J; Chu, J; Dittmer, S; Mcdermott, K; Mirman, N; Patterson, J R; Rinkevicius, A; Ryd, A; Skinnari, L; Soffi, L; Tan, S M; Tao, Z; Thom, J; Tucker, J; Wittich, P; Zientek, M; Winn, D; Abdullin, S; Albrow, M; Apollinari, G; Apresyan, A; Banerjee, S; Bauerdick, L A T; Beretvas, A; Berryhill, J; Bhat, P C; Bolla, G; Burkett, K; Butler, J N; Cheung, H W K; Chlebana, F; Cihangir, S; Cremonesi, M; Duarte, J; Elvira, V D; Fisk, I; Freeman, J; Gottschalk, E; Gray, L; Green, D; Grünendahl, S; Gutsche, O; Harris, R M; Hasegawa, S; Hirschauer, J; Hu, Z; Jayatilaka, B; Jindariani, S; Johnson, M; Joshi, U; Klima, B; Kreis, B; Lammel, S; Linacre, J; Lincoln, D; Lipton, R; Liu, M; Liu, T; Lopes De Sá, R; Lykken, J; Maeshima, K; Magini, N; Marraffino, J M; Maruyama, S; Mason, D; McBride, P; Merkel, P; Mrenna, S; Nahn, S; O'Dell, V; Pedro, K; Prokofyev, O; Rakness, G; Ristori, L; Sexton-Kennedy, E; Soha, A; Spalding, W J; Spiegel, L; Stoynev, S; Strait, J; Strobbe, N; Taylor, L; Tkaczyk, S; Tran, N V; Uplegger, L; Vaandering, E W; Vernieri, C; Verzocchi, M; Vidal, R; Wang, M; Weber, H A; Whitbeck, A; Wu, Y; Acosta, D; Avery, P; Bortignon, P; Bourilkov, D; Brinkerhoff, A; Carnes, A; Carver, M; Curry, D; Das, S; Field, R D; Furic, I K; Konigsberg, J; Korytov, A; Low, J F; Ma, P; Matchev, K; Mei, H; Mitselmakher, G; Rank, D; Shchutska, L; Sperka, D; Thomas, L; Wang, J; Wang, S; Yelton, J; Linn, S; Markowitz, P; Martinez, G; Rodriguez, J L; Ackert, A; Adams, T; Askew, A; Bein, S; Hagopian, S; Hagopian, V; Johnson, K F; Kolberg, T; Perry, T; Prosper, H; Santra, A; Yohay, R; Baarmand, M M; Bhopatkar, V; Colafranceschi, S; Hohlmann, M; Noonan, D; Roy, T; Yumiceva, F; Adams, M R; Apanasevich, L; Berry, D; Betts, R R; Cavanaugh, R; Chen, X; Evdokimov, O; Gerber, C E; Hangal, D A; Hofman, D J; Jung, K; Kamin, J; Sandoval Gonzalez, I D; Trauger, H; Varelas, N; Wang, H; Wu, Z; Zhang, J; Bilki, B; Clarida, W; Dilsiz, K; Durgut, S; Gandrajula, R P; Haytmyradov, M; Khristenko, V; Merlo, J-P; Mermerkaya, H; Mestvirishvili, A; Moeller, A; Nachtman, J; Ogul, H; Onel, Y; Ozok, F; Penzo, A; Snyder, C; Tiras, E; Wetzel, J; Yi, K; Blumenfeld, B; Cocoros, A; Eminizer, N; Fehling, D; Feng, L; Gritsan, A V; Maksimovic, P; Roskes, J; Sarica, U; Swartz, M; Xiao, M; You, C; Al-Bataineh, A; Baringer, P; Bean, A; Boren, S; Bowen, J; Castle, J; Forthomme, L; Khalil, S; Kropivnitskaya, A; Majumder, D; Mcbrayer, W; Murray, M; Sanders, S; Stringer, R; Tapia Takaki, J D; Wang, Q; Ivanov, A; Kaadze, K; Maravin, Y; Mohammadi, A; Saini, L K; Skhirtladze, N; Toda, S; Rebassoo, F; Wright, D; Anelli, C; Baden, A; Baron, O; Belloni, A; Calvert, B; Eno, S C; Ferraioli, C; Hadley, N J; Jabeen, S; Jeng, G Y; Kellogg, R G; Kunkle, J; Mignerey, A C; Ricci-Tam, F; Shin, Y H; Skuja, A; Tonjes, M B; Tonwar, S C; Abercrombie, D; Allen, B; Apyan, A; Azzolini, V; Barbieri, R; Baty, A; Bi, R; Bierwagen, K; Brandt, S; Busza, W; Cali, I A; D'Alfonso, M; Demiragli, Z; Gomez Ceballos, G; Goncharov, M; Hsu, D; Iiyama, Y; Innocenti, G M; Klute, M; Kovalskyi, D; Krajczar, K; Lai, Y S; Lee, Y-J; Levin, A; Luckey, P D; Maier, B; Marini, A C; Mcginn, C; Mironov, C; Narayanan, S; Niu, X; Paus, C; Roland, C; Roland, G; Salfeld-Nebgen, J; Stephans, G S F; Tatar, K; Velicanu, D; Wang, J; Wang, T W; Wyslouch, B; Benvenuti, A C; Chatterjee, R M; Evans, A; Hansen, P; Kalafut, S; Kao, S C; Kubota, Y; Lesko, Z; Mans, J; Nourbakhsh, S; Ruckstuhl, N; Rusack, R; Tambe, N; Turkewitz, J; Acosta, J G; Oliveros, S; Avdeeva, E; Bloom, K; Claes, D R; Fangmeier, C; Gonzalez Suarez, R; Kamalieddin, R; Kravchenko, I; Malta Rodrigues, A; Monroy, J; Siado, J E; Snow, G R; Stieger, B; Alyari, M; Dolen, J; Godshalk, A; Harrington, C; Iashvili, I; Nguyen, D; Parker, A; Rappoccio, S; Roozbahani, B; Alverson, G; Barberis, E; Hortiangtham, A; Massironi, A; Morse, D M; Nash, D; Orimoto, T; Teixeira De Lima, R; Trocino, D; Wang, R-J; Wood, D; Bhattacharya, S; Charaf, O; Hahn, K A; Mucia, N; Odell, N; Pollack, B; Schmitt, M H; Sung, K; Trovato, M; Velasco, M; Dev, N; Hildreth, M; Hurtado Anampa, K; Jessop, C; Karmgard, D J; Kellams, N; Lannon, K; Marinelli, N; Meng, F; Mueller, C; Musienko, Y; Planer, M; Reinsvold, A; Ruchti, R; Rupprecht, N; Smith, G; Taroni, S; Wayne, M; Wolf, M; Woodard, A; Alimena, J; Antonelli, L; Bylsma, B; Durkin, L S; Flowers, S; Francis, B; Hart, A; Hill, C; Ji, W; Liu, B; Luo, W; Puigh, D; Winer, B L; Wulsin, H W; Cooperstein, S; Driga, O; Elmer, P; Hardenbrook, J; Hebda, P; Lange, D; Luo, J; Marlow, D; Medvedeva, T; Mei, K; Ojalvo, I; Olsen, J; Palmer, C; Piroué, P; Stickland, D; Svyatkovskiy, A; Tully, C; Malik, S; Barker, A; Barnes, V E; Folgueras, S; Gutay, L; Jha, M K; Jones, M; Jung, A W; Khatiwada, A; Miller, D H; Neumeister, N; Schulte, J F; Sun, J; Wang, F; Xie, W; Parashar, N; Stupak, J; Adair, A; Akgun, B; Chen, Z; Ecklund, K M; Geurts, F J M; Guilbaud, M; Li, W; Michlin, B; Northup, M; Padley, B P; Roberts, J; Rorie, J; Tu, Z; Zabel, J; Betchart, B; Bodek, A; de Barbaro, P; Demina, R; Duh, Y T; Ferbel, T; Galanti, M; Garcia-Bellido, A; Han, J; Hindrichs, O; Khukhunaishvili, A; Lo, K H; Tan, P; Verzetti, M; Agapitos, A; Chou, J P; Gershtein, Y; Gómez Espinosa, T A; Halkiadakis, E; Heindl, M; Hughes, E; Kaplan, S; Kunnawalkam Elayavalli, R; Kyriacou, S; Lath, A; Montalvo, R; Nash, K; Osherson, M; Saka, H; Salur, S; Schnetzer, S; Sheffield, D; Somalwar, S; Stone, R; Thomas, S; Thomassen, P; Walker, M; Delannoy, A G; Foerster, M; Heideman, J; Riley, G; Rose, K; Spanier, S; Thapa, K; Bouhali, O; Celik, A; Dalchenko, M; De Mattia, M; Delgado, A; Dildick, S; Eusebi, R; Gilmore, J; Huang, T; Juska, E; Kamon, T; Mueller, R; Pakhotin, Y; Patel, R; Perloff, A; Perniè, L; Rathjens, D; Safonov, A; Tatarinov, A; Ulmer, K A; Akchurin, N; Damgov, J; De Guio, F; Dragoiu, C; Dudero, P R; Faulkner, J; Gurpinar, E; Kunori, S; Lamichhane, K; Lee, S W; Libeiro, T; Peltola, T; Undleeb, S; Volobouev, I; Wang, Z; Greene, S; Gurrola, A; Janjam, R; Johns, W; Maguire, C; Melo, A; Ni, H; Sheldon, P; Tuo, S; Velkovska, J; Xu, Q; Arenton, M W; Barria, P; Cox, B; Hirosky, R; Ledovskoy, A; Li, H; Neu, C; Sinthuprasith, T; Sun, X; Wang, Y; Wolfe, E; Xia, F; Clarke, C; Harr, R; Karchin, P E; Sturdy, J; Zaleski, S; Belknap, D A; Buchanan, J; Caillol, C; Dasu, S; Dodd, L; Duric, S; Gomber, B; Grothe, M; Herndon, M; Hervé, A; Hussain, U; Klabbers, P; Lanaro, A; Levine, A; Long, K; Loveless, R; Pierro, G A; Polese, G; Ruggles, T; Savin, A; Smith, N; Smith, W H; Taylor, D; Woods, N

    2017-10-06

    A search for charged Higgs bosons produced via vector boson fusion and decaying into W and Z bosons using proton-proton collisions at sqrt[s]=13  TeV is presented. The data sample corresponds to an integrated luminosity of 15.2  fb^{-1} collected with the CMS detector in 2015 and 2016. The event selection requires three leptons (electrons or muons), two jets with large pseudorapidity separation and high dijet mass, and missing transverse momentum. The observation agrees with the standard model prediction. Limits on the vector boson fusion production cross section times branching fraction for new charged physical states are reported as a function of mass from 200 to 2000 GeV and interpreted in the context of Higgs triplet models.

  9. Strange culinary encounters::stranger fetichism in "Jamie's Italian escape" and "Gordon's great escape"

    OpenAIRE

    Leer, Jonatan; Kjær, Katrine Meldgaard

    2015-01-01

    In this article, we examine the ways in which the encountering of 'other' food cultures is played out in the two travelogue cooking shows Gordon's Great Escape and Jamie's Italian Escape. We investigate how the two protagonist chefs Jamie Oliver and Gordon Ramsay imagine, meet and evaluate the ‘other’ food cultures in these programs, paying special attention to how the encounter with the local Indian and Italian is imagined to be a gateway to an authentic and/or primitive experience. Our main...

  10. Room escape at class: Escape games activities to facilitate the motivation and learning in computer science

    Directory of Open Access Journals (Sweden)

    Carlos Borrego

    2017-06-01

    Full Text Available Real-life room-escape games are ludic activities in which participants enter a room in order to get out of it only after solving some riddles. In this paper, we explain a Room Escape teaching experience developed in the Engineering School at Universitat Autònoma de Barcelona. The goal of this activity is to increase student’s motivation and to improve their learning on two courses of the second year in the Computer Engineering degree: Computer Networksand Information and Security.

  11. Room escape at class: escape games activities to facilitate the motivation and learning in computer science

    OpenAIRE

    Borrego, Carlos; Fernández, Cristina; Blanes, Ian; Robles, Sergi

    2017-01-01

    Real-life room-escape games are ludic activities in which participants enter a room in order to get out of it only after solving some riddles. In this paper, we explain a Room Escape teaching experience developed in the Engineering School at Universitat Autònoma de Barcelona. The goal of this activity is to increase student’s motivation and to improve their learning on two courses of the second year in the Computer Engineering degree: Computer Networksand Information and Security Peer Revi...

  12. W+- pairs and neutral currents at ISABELLE

    International Nuclear Information System (INIS)

    Mikaelian, K.O.

    1975-01-01

    A report is presented on two different types of processes which may form part of the weak interactions program. The first is the production of pairs of charged weak bosons in the process pp → W + W - X; the second involves searching for neutral current effects in the rate for ordinary lepton production, without measuring any charge asymmetry or helicities using the reaction pp → l + l - X

  13. Arduino adventures escape from Gemini station

    CERN Document Server

    Kelly, James Floyd

    2013-01-01

    Arduino Adventures: Escape from Gemini Station provides a fun introduction to the Arduino microcontroller by putting you (the reader) into the action of a science fiction adventure story.  You'll find yourself following along as Cade and Elle explore Gemini Station-an orbiting museum dedicated to preserving and sharing technology throughout the centuries. Trouble ensues. The station is evacuated, including Cade and Elle's class that was visiting the station on a field trip. Cade and Elle don't make it aboard their shuttle and are trapped on the station along with a friendly artificial intellig

  14. A supplemental device to return escaping particles to a magnetic mirror reactor

    Energy Technology Data Exchange (ETDEWEB)

    Nagata, Mitsuaki [Nippon Electronic Engineering College, Noboribetsu-shi, Hokkaido (Japan); Sawada, Keiichi [Soft Creator Company, Kyoto (Japan)

    2018-12-15

    Cyclotron resonance is now applied as one of the important means for heating plasma in a fusion reactor. We examined this phenomenon from the viewpoint of electron gyration orbits through a solution of the linearized relativistic equation of motion. We found a powerful term that accelerates a relativistic charged particle largely at a resonance point when a magnetic field strength is very large. In this study, aiming an effect of this term, we consider applying a resonance phenomenon to reducing the number of charged particles that escape from a magnetic mirror reactor. We install a long supplemental device at the exit of a main magnetic bottle and make a cyclotron resonance space within the device, as shown in Fig. 7. If velocities (perpendicular to a magnetic field) of charged particles are accelerated largely within the cyclotron resonance space, the reflection efficiency of a magnetic mirror behind the resonance space ought to be improved. Based on this idea, we discuss such a supplemental device for recovering the maximum number of escaping charged particles. (orig.)

  15. Mesure de la section efficace de production de paires de quarks top dans le canal lepton+tau+jets+MET dans l'experience D0 et interpretation en termes de boson de Higgs charge

    Energy Technology Data Exchange (ETDEWEB)

    Lacroix, Florent [Clermont-Ferrand U.

    2008-12-01

    The standard model of particle physics describes the matter as elementary particles interacting via strong and electroweak interactions. The top quark is the heaviest quark described by this model and has been discovered in 1995 by CDF and D collaborations in proton-antiproton collisions at the Tevatron. This thesis is devoted to the measurement of the top pair production cross-section via the strong interaction, in a final state composed of one lepton, one hadronic tau, two b-jets and missing transverse energy. This analysis uses the 1,2 fb

  16. Mars atmospheric escape and evolution; interaction with the solar wind

    Science.gov (United States)

    Chassefière, Eric; Leblanc, François

    2004-09-01

    This tutorial deals with the question of atmospheric escape on Mars. After a brief introduction describing the general context of Mars escape studies, we will present in Section 2 a simplified theory of thermal escape, of both Jeans and hydrodynamic types. The phenomenon of hydrodynamic escape, still hypothetical and not proved to have ever existed on terrestrial planets, will be treated with the help of two well known examples: (i) the isotopic fractionation of xenon in Mars and Earth atmospheres, (ii) the paradox of missing oxygen in Venus atmosphere. In Section 3, a simplified approach of non-thermal escape will be developed, treating in a specific way the different kinds of escape (photochemical escape, ion sputtering, ion escape and ionospheric outflow). As a matter of illustration, some calculations of the relative contributions of these mechanisms, and of their time evolutions, will be given, and the magnitude of the total amount of atmosphere lost by non-thermal escape will be estimated. Section 4 will present the state of knowledge concerning the constraints derived from Mars isotopic geochemistry in terms of past escape and evolution. Finally, a few conclusions, which are more interrogations, will be proposed.

  17. Escape from viscosity : the kinematics and hydrodynamics of copepod foraging and escape swimming

    NARCIS (Netherlands)

    van Duren, LA; Videler, JJ

    Feeding and escape swimming in adult females of the calanoid copepod. Temora lopgicornis Muller were investigated and compared. Swimming velocities were calculated using a 3-D filming setup., Foraging velocities ranged between 2 and 6 min s(-1), while maximum velocities of up to 80 mm s(-1) were

  18. Titan's hydrodynamically escaping atmosphere: Escape rates and the structure of the exobase region

    Science.gov (United States)

    Strobel, Darrell F.

    2009-08-01

    In Strobel [Strobel, D.F., 2008. Icarus, 193, 588-594] a mass loss rate from Titan's upper atmosphere, ˜4.5×10 amus, was calculated for a single constituent, N 2 atmosphere by hydrodynamic escape as a high density, slow outward expansion driven principally by solar UV heating due to CH 4 absorption. It was estimated, but not proven, that the hydrodynamic mass loss is essentially CH 4 and H 2 escape. Here the individual conservation of momentum equations for the three major components of the upper atmosphere (N 2, CH 4, H 2) are solved in the low Mach number limit and compared with Cassini Ion Neutral Mass Spectrometer (INMS) measurements to demonstrate that light gases (CH 4, H 2) preferentially escape over the heavy gas (N 2). The lightest gas (H 2) escapes with a flux 99% of its limiting flux, whereas CH 4 is restricted to ⩾75% of its limiting flux because there is insufficient solar power to support escape at the limiting rate. The respective calculated H 2 and CH 4 escape rates are 9.2×10 and 1.7×10 s, for a total of ˜4.6×10 amus. From the calculated densities, mean free paths of N 2, CH 4, H 2, and macroscopic length scales, an extended region above the classic exobase is inferred where frequent collisions are still occurring and thermal heat conduction can deliver power to lift the escaping gas out of the gravitational potential well. In this region rapid acceleration of CH 4 outflow occurs. With the thermal structure of Titan's thermosphere inferred from INMS data by Müller-Wodarg et al. [Müller-Wodarg, I.C.F., Yelle, R.V., Cui, J., Waite Jr., J.H., 2008. J. Geophys. Res. 113, doi:10.1029/2007JE003033. E10005], in combination with calculated temperature profiles that include sputter induced plasma heating at the exobase, it is concluded that on average that the integrated, globally average, orbit-averaged, plasma heating rate during the Cassini epoch does not exceed ˜5×10 eVcms ( ˜0.0008 ergcms).

  19. Thermal and quantum escape of fractional Josephson vortices

    Energy Technology Data Exchange (ETDEWEB)

    Poehler, Hanna; Kienzle, Uta; Buckenmaier, Kai; Gaber, Tobias; Koelle, Dieter; Kleiner, Reinhold; Goldobin, Edward [Physikalisches Institut, Center for Collective Quantum Phenomena, Universitaet Tuebingen (Germany); Siegel, Michael [Institut fuer Mikro- und Nanoelektronische Systeme, Universitaet Karlsruhe (Germany)

    2009-07-01

    By using a pair of tiny current injectors one can create an arbitrary {kappa} discontinuity of the phase in a long Josephson junction (LJJ) and a fractional Josephson vortex (FJV), carrying a fraction {phi}/{phi}{sub 0}={kappa}/2{pi}{<=}1 of the magnetic flux quantum {phi}{sub 0}{approx}2.07 .10{sup -15} Wb, which is pinned at the discontinuity. If a bias current I, exceeds the critical value I{sub c}({kappa}), an integer fluxon is torn off the discontinuity and the LJJ switches to the voltage state. Due to thermal or quantum fluctuations this escape event may occur at I

  20. Some Possible Cases of Escape Mimicry in Neotropical Butterflies.

    Science.gov (United States)

    Pinheiro, C E G; Freitas, A V L

    2014-10-01

    The possibility that escape or evasive mimicry evolved in butterflies and other prey insects in a similar fashion to classical Batesian and Müllerian mimicry has long been advanced in the literature. However, there is a general disagreement among lepidopterists and evolutionary biologists on whether or not escape mimicry exists, as well as in which mimicry rings this form of mimicry has evolved. Here, we review some purported cases of escape mimicry in Neotropical butterflies and suggest new mimicry rings involving several species of Archaeoprepona, Prepona, and Doxocopa (the "bright blue bands" ring) and species of Colobura and Hypna (the "creamy bands" ring) where the palatability of butterflies, their ability to escape predator attacks, geographic distribution, relative abundance, and co-occurrence in the same habitats strongly suggest that escape mimicry is involved. In addition, we also indicate other butterfly taxa whose similarities of coloration patterns could be due to escape mimicry and would constitute important case studies for future investigation.

  1. Energy conversion through mass loading of escaping ionospheric ions for different Kp values

    Science.gov (United States)

    Yamauchi, Masatoshi; Slapak, Rikard

    2018-01-01

    By conserving momentum during the mixing of fast solar wind flow and slow planetary ion flow in an inelastic way, mass loading converts kinetic energy to other forms - e.g. first to electrical energy through charge separation and then to thermal energy (randomness) through gyromotion of the newly born cold ions for the comet and Mars cases. Here, we consider the Earth's exterior cusp and plasma mantle, where the ionospheric origin escaping ions with finite temperatures are loaded into the decelerated solar wind flow. Due to direct connectivity to the ionosphere through the geomagnetic field, a large part of this electrical energy is consumed to maintain field-aligned currents (FACs) toward the ionosphere, in a similar manner as the solar wind-driven ionospheric convection in the open geomagnetic field region. We show that the energy extraction rate by the mass loading of escaping ions (ΔK) is sufficient to explain the cusp FACs, and that ΔK depends only on the solar wind velocity accessing the mass-loading region (usw) and the total mass flux of the escaping ions into this region (mloadFload), as ΔK ˜ -mloadFloadu2sw/4. The expected distribution of the separated charges by this process also predicts the observed flowing directions of the cusp FACs for different interplanetary magnetic field (IMF) orientations if we include the deflection of the solar wind flow directions in the exterior cusp. Using empirical relations of u0 ∝ Kp + 1.2 and Fload ∝ exp(0.45Kp) for Kp = 1-7, where u0 is the solar wind velocity upstream of the bow shock, ΔK becomes a simple function of Kp as log10(ΔK) = 0.2 ṡ Kp + 2 ṡ log10(Kp + 1.2) + constant. The major contribution of this nearly linear increase is the Fload term, i.e. positive feedback between the increase of ion escaping rate Fload through the increased energy consumption in the ionosphere for high Kp, and subsequent extraction of more kinetic energy ΔK from the solar wind to the current system by the increased

  2. Search for the standard model Higgs boson decaying to a bb pair in events with one charged lepton and large missing transverse energy using the full CDF data set.

    Science.gov (United States)

    Aaltonen, T; Álvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M E; Bisello, D; Bizjak, I; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Calamba, A; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chung, W H; Chung, Y S; Ciocci, M A; Clark, A; Clarke, C; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuevas, J; Culbertson, R; Dagenhart, D; d'Ascenzo, N; Datta, M; de Barbaro, P; Dell'Orso, M; Demortier, L; Deninno, M; Devoto, F; d'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Dorigo, M; Dorigo, T; Ebina, K; Elagin, A; Eppig, A; Erbacher, R; Errede, S; Ershaidat, N; Eusebi, R; Farrington, S; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Funakoshi, Y; Furic, I; Gallinaro, M; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Halkiadakis, E; Hamaguchi, A; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harr, R F; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Hewamanage, S; Hocker, A; Hopkins, W; Horn, D; Hou, S; Hughes, R E; Hurwitz, M; Husemann, U; Hussain, N; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeans, D T; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kim, Y J; Kimura, N; Kirby, M; Klimenko, S; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Kruse, M; Krutelyov, V; Kuhr, T; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; LeCompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lin, C-J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maeshima, K; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Martínez, M; Mastrandrea, P; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Prokoshin, F; Pranko, A; Ptohos, F; Punzi, G; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Rescigno, M; Riddick, T; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sinervo, P; Sliwa, K; Smith, J R; Snider, F D; Soha, A; Sorin, V; Song, H; Squillacioti, P; Stancari, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thome, J; Thompson, G A; Thomson, E; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Varganov, A; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vila, I; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wagner, R L; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Wick, F; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanetti, A; Zeng, Y; Zhou, C; Zucchelli, S

    2012-09-14

    We present a search for the standard model Higgs boson produced in association with a W boson in sqrt[s]=1.96  TeV pp collision data collected with the CDF II detector at the Tevatron corresponding to an integrated luminosity of 9.45  fb(-1). In events consistent with the decay of the Higgs boson to a bottom-quark pair and the W boson to an electron or muon and a neutrino, we set 95% credibility level upper limits on the WH production cross section times the H→bb branching ratio as a function of Higgs boson mass. At a Higgs boson mass of 125  GeV/c(2), we observe (expect) a limit of 4.9 (2.8) times the standard model value.

  3. Drift wave in pair-ion plasma

    Indian Academy of Sciences (India)

    of charged particles in electromagnetic fields. The linear and nonlinear collective modes in electron-positron plasma have been investigated theoretically [3–6]. Recently, Oohara and Hatakeyama [7] have developed a novel method for generating a pair plasma con- sisting of only negative and positive ions with equal mass ...

  4. Angular assymetries in a shielded pair line

    International Nuclear Information System (INIS)

    Fanchiotti, H.; Garcia Canal, C.A.; Vucetich, H.

    1979-01-01

    The capacitance matrix and surface charge density distribution of an unbalanced pair line with both longitudinal and balanced excitations is presented. In particular the case in which the axes of the inner wires are not restricted to lie on a line through the axis of the shield is discussed

  5. Estimating Collisionally-Induced Escape Rates of Light Neutrals from Early Mars

    Science.gov (United States)

    Gacesa, M.; Zahnle, K. J.

    2016-12-01

    Collisions of atmospheric gases with hot oxygen atoms constitute an important non-thermal mechanism of escape of light atomic and molecular species at Mars. In this study, we present revised theoretical estimates of non-thermal escape rates of neutral O, H, He, and H2 based on recent atmospheric density profiles obtained from the NASA Mars Atmosphere and Volatile Evolution (MAVEN) mission and related theoretical models. As primary sources of hot oxygen, we consider dissociative recombination of O2+ and CO2+ molecular ions. We also consider hot oxygen atoms energized in primary and secondary collisions with energetic neutral atoms (ENAs) produced in charge-exchange of solar wind H+ and He+ ions with atmospheric gases1,2. Scattering of hot oxygen and atmospheric species of interest is modeled using fully-quantum reactive scattering formalism3. This approach allows us to construct distributions of vibrationally and rotationally excited states and predict the products' emission spectra. In addition, we estimate formation rates of excited, translationally hot hydroxyl molecules in the upper atmosphere of Mars. The escape rates are calculated from the kinetic energy distributions of the reaction products using an enhanced 1D model of the atmosphere for a range of orbital and solar parameters. Finally, by considering different scenarios, we estimate the influence of these escape mechanisms on the evolution of Mars's atmosphere throughout previous epochs and their impact on the atmospheric D/H ratio. M.G.'s research was supported by an appointment to the NASA Postdoctoral Program at the NASA Ames Research Center, administered by Universities Space Research Association under contract with NASA. 1N. Lewkow and V. Kharchenko, "Precipitation of Energetic Neutral Atoms and Escape Fluxes induced from the Mars Atmosphere", Astroph. J., 790, 98 (2014) 2M. Gacesa, N. Lewkow, and V. Kharchenko, "Non-thermal production and escape of OH from the upper atmosphere of Mars", arXiv:1607

  6. Non-thermal escape of molecular hydrogen from Mars

    Science.gov (United States)

    Gacesa, M.; Zhang, P.; Kharchenko, V.

    2012-05-01

    We present a detailed theoretical analysis of non-thermal escape of molecular hydrogen from Mars induced by collisions with hot atomic oxygen from the Martian corona. To accurately describe the energy transfer in O + H2(v, j) collisions, we performed extensive quantum-mechanical calculations of state-to-state elastic, inelastic, and reactive cross sections. The escape flux of H2 molecules was evaluated using a simplified 1D column model of the Martian atmosphere with realistic densities of atmospheric gases and hot oxygen production rates for low solar activity conditions. An average intensity of the non-thermal escape flux of H2 of 1.9 × 105 cm-2s-1 was obtained considering energetic O atoms produced in dissociative recombinations of O2+ ions. Predicted ro-vibrational distribution of the escaping H2 was found to contain a significant fraction of higher rotational states. While the non-thermal escape rate was found to be lower than Jeans rate for H2 molecules, the non-thermal escape rates of HD and D2 are significantly higher than their respective Jeans rates. The accurate evaluation of the collisional escape flux of H2 and its isotopes is important for understanding non-thermal escape of molecules from Mars, as well as for the formation of hot H2 Martian corona. The described molecular ejection mechanism is general and expected to contribute to atmospheric escape of H2 and other light molecules from planets, satellites, and exoplanetary bodies.

  7. Search for the standard model Higgs boson decaying to a bb pair in events with no charged leptons and large missing transverse energy using the full CDF data set.

    Science.gov (United States)

    Aaltonen, T; Álvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M E; Bisello, D; Bizjak, I; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Calamba, A; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chung, W H; Chung, Y S; Ciocci, M A; Clark, A; Clarke, C; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuevas, J; Culbertson, R; Dagenhart, D; d'Ascenzo, N; Datta, M; de Barbaro, P; Dell'Orso, M; Demortier, L; Deninno, M; Devoto, F; d'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Dorigo, M; Dorigo, T; Ebina, K; Elagin, A; Eppig, A; Erbacher, R; Errede, S; Ershaidat, N; Eusebi, R; Farrington, S; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Funakoshi, Y; Furic, I; Gallinaro, M; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Halkiadakis, E; Hamaguchi, A; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harr, R F; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Hewamanage, S; Hocker, A; Hopkins, W; Horn, D; Hou, S; Hughes, R E; Hurwitz, M; Husemann, U; Hussain, N; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kim, Y J; Kimura, N; Kirby, M; Klimenko, S; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Kruse, M; Krutelyov, V; Kuhr, T; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; LeCompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lin, C-J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maeshima, K; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Martínez, M; Mastrandrea, P; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Prokoshin, F; Pranko, A; Ptohos, F; Punzi, G; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Rescigno, M; Riddick, T; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sinervo, P; Sliwa, K; Smith, J R; Snider, F D; Soha, A; Sorin, V; Song, H; Squillacioti, P; Stancari, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thome, J; Thompson, G A; Thomson, E; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Varganov, A; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vila, I; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wagner, R L; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Wick, F; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanetti, A; Zeng, Y; Zhou, C; Zucchelli, S

    2012-09-14

    We report on a search for the standard model Higgs boson produced in association with a vector boson in the full data set of proton-antiproton collisions at sqrt[s]=1.96  TeV recorded by the CDF II detector at the Tevatron, corresponding to an integrated luminosity of 9.45  fb(-1). We consider events having no identified charged lepton, a transverse energy imbalance, and two or three jets, of which at least one is consistent with originating from the decay of a b quark. We place 95% credibility level upper limits on the production cross section times standard model branching fraction for several mass hypotheses between 90 and 150  GeV/c(2). For a Higgs boson mass of 125  GeV/c(2), the observed (expected) limit is 6.7 (3.6) times the standard model prediction.

  8. Effects of mesh size and escape gaps on discarding in an Australian giant mud crab (Scylla serrata trap fishery.

    Directory of Open Access Journals (Sweden)

    Matt K Broadhurst

    Full Text Available In response to concerns over excessive discarding from Australian recreational round traps (with four funnel entrances used to target giant mud crabs, Scylla serrata, an experiment was done to assess the independent and cumulative utility of paired, bottom-located horizontal escape gaps (46×120 mm and increasing mesh size (from 51 to 101 mm. Compared to conventional traps comprising 51-mm mesh throughout, those with the same mesh size and escape gaps caught significantly fewer (by 95% undersize (<85 mm carapace length--CL crabs while maintaining legal catches. Traps made from 101-mm mesh (but with the same funnel entrances as conventional designs and with and without escape gaps similarly retained fewer undersize crabs and also yellowfin bream Acanthopagrus australis (the key bycatch species by up to 94%, but there were concomitant reductions in fishing power for legal sizes of S. serrata. Although there were no immediate mortalities among any discarded crabs, there was a greater bias towards wounding among post molts than late inter-molts and less damage to individuals in the 101-mm conventional than 51-mm conventional traps (without escape gaps. The results support retrospectively fitting escape gaps in conventional S. serrata traps as a means for reducing discarding, but additional work is required to determine appropriate mesh sizes/configurations that maximize species and size selectivity.

  9. HCP track calculations in Lif:Mg,Ti: 3D modeling of the ''track – escape'' parameter

    International Nuclear Information System (INIS)

    Sattinger, D.; Sharon, A.; Horowitz, Y.S.

    2011-01-01

    The conceptual framework of the track interaction model (TIM) was conceived in the 1970s and mathematically formulated in the 1980s to describe heavy charged particle TL fluence response supralinearity. The extended track interaction model (ETIM) was developed to include saturation effects due to overlapping tracks and has been applied to both proton and alpha particle TL fluence response. One of the parameters of major importance in the TIM is the ''track – escape'' parameter, defined by N e /N w , where N e represents the number of electrons which escape the parent track during heating, and N w is the number of electrons which recombine within the parent track to produce a TL photon. Recently a first attempt was carried out to theoretically model escape parameters calculated in 2D geometry as a function of particle type and energy using trapping center (TC), luminescent center (LC) and competitive center (CC) occupation probabilities calculated from track segment radial dose distributions and optical absorption (OA) dose response. In this study, the calculations are extended to 3D geometry using a Monte Carlo approach which samples the point of creation of the charge carriers according to the TC occupation probabilities and then estimates N w by sampling the chord length to the track exterior. Charge carriers which escape the irradiated track volume contribute to N e . This more sophisticated 3D calculation of N e /N w is expected to increase the reliability of the modeling of heavy charged particle TL fluence response in the framework of the ETIM and enhance our understanding of “track effects” in Heavy Charged Particle (HCP) induced TL.

  10. Differential Top-Quark-Pair Cross Sections in pp Collisions at $\\sqrt{s} = 7$~TeV with CMS and Charge Multiplication in Highly-Irradiated Silicon Sensors

    CERN Document Server

    Lange, Jörn Christian; Klanner, Robert

    2013-01-01

    Modern particle-physics exp eriments like the ones at the Large Hadron Collider (LHC) are global and interdisciplinary endeavours comprising a variety of dierent elds. In this work, two dierent asp ects are dealt with: on the one hand a top-quark physics analysis and on the other hand research and development towards radiation- hard silicon tracking detectors. The high centre-of-mass energy and luminosity at the LHC allow for a detailed investigation of top-quark-pair ( t t ) pro duction prop erties. Normalised dierential t t cross sections 1 d t t dX are measured as a function of nine dierent kinematic variables X of the t t system, the top quarks and their decay pro ducts (b jets and leptons). The analysis is p erformed using data of proton-proton collisions at p s = 7 TeV recorded by the CMS exp eriment in 2011, corresp onding to an integrated luminosity of 5 fb 1 . A high-purity sample of t t events is selected according to the top ology of the lep- ton+jets decay channel. Lepton-selection and trigger eci...

  11. X-chromosome inactivation and escape

    Indian Academy of Sciences (India)

    2015-11-06

    Nov 6, 2015 ... tion and cancer in mice after a long period of time (Yildirim et al. 2013). ... chromosome of man has a short pairing seg- ment, that is not normally ..... Lyon M. F. 1988 The William Allan memorial award address: X-chromosome ...

  12. Pairing correlations in nuclei

    International Nuclear Information System (INIS)

    Baba, C.V.K.

    1988-01-01

    There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs

  13. 30 CFR 75.382 - Mechanical escape facilities.

    Science.gov (United States)

    2010-07-01

    ... with brakes that can stop the fully loaded platform, cage, or other device. (c) Mechanical escape facilities, including automatic elevators, shall be examined weekly. The weekly examination of this equipment... cages, platforms, or elevators. (e) Mechanical escape facilities shall have rated capacities consistent...

  14. Buying to blunt negative feelings : Materialistic escape from the self

    NARCIS (Netherlands)

    Donnelly, Grant E.; Ksendzova, Masha; Howell, Ryan T.; Vohs, Kathleen D.; Baumeister, Roy F.

    2016-01-01

    We propose that escape theory, which describes how individuals seek to free themselves from aversive states of self-awareness, helps explain key patterns of materialistic people's behavior. As predicted by escape theory, materialistic individuals may feel dissatisfied with their standard of living,

  15. Teachers Offering Healthy Escape Options for Teenagers in Pain

    Science.gov (United States)

    Kaywell, Joan F.

    2005-01-01

    "[T]wenty-five percent of today's teenagers have inordinate emotional baggage beyond the normal angst of adolescence." This burden can lead to unhealthy escapes, including substance abuse, sexual activity, violence, eating disorders, and suicide. One healthy escape, however, lies in books, where students can read about teenagers living in painful…

  16. Escape of protists in predator-generated feeding currents

    DEFF Research Database (Denmark)

    Jakobsen, Hans Henrik

    2002-01-01

    The ciliate Strobilidium sp. and 2 flagellates, Chrysochromulina simplex and Gymnodinium sp., were exposed to predator-generated feeding currents, and their escape responses were quantified using 2- and 3-dimensional video techniques. All 3 studied organisms responded by escaping at a defined dis...

  17. Statistical mechanics of magnetized pair Fermi gas

    International Nuclear Information System (INIS)

    Daicic, J.; Frankel, N.E.; Kowalenko, V.

    1993-01-01

    Following previous work on the magnetized pair Bose gas this contribution presents the statistical mechanics of the charged relativistic Fermi gas with pair creation in d spatial dimensions. Initially, the gas in no external fields is studied. As a result, expansions for the various thermodynamic functions are obtained in both the μ/m→0 (neutrino) limit, and about the point μ/m =1, where μ is the chemical potential. The thermodynamics of a gas of quantum-number conserving massless fermions is also discussed. Then a complete study of the pair Fermi gas in a homogeneous magnetic field, is presented investigating the behavior of the magnetization over a wide range of field strengths. The inclusion of pairs leads to new results for the net magnetization due to the paramagnetic moment of the spins and the diamagnetic Landau orbits. 20 refs

  18. Fractional charges

    International Nuclear Information System (INIS)

    Saminadayar, L.

    2001-01-01

    20 years ago fractional charges were imagined to explain values of conductivity in some materials. Recent experiments have proved the existence of charges whose value is the third of the electron charge. This article presents the experimental facts that have led theorists to predict the existence of fractional charges from the motion of quasi-particles in a linear chain of poly-acetylene to the quantum Hall effect. According to the latest theories, fractional charges are neither bosons nor fermions but anyons, they are submitted to an exclusive principle that is less stringent than that for fermions. (A.C.)

  19. Schwinger pair creation of Kaluza-Klein particles: Pair creation without tunneling

    International Nuclear Information System (INIS)

    Friedmann, Tamar; Verlinde, Herman

    2005-01-01

    We study Schwinger pair creation of charged Kaluza-Klein (KK) particles from a static KK electric field. We find that the gravitational backreaction of the electric field on the geometry--which is incorporated via the electric KK-Melvin solution--prevents the electrostatic potential from overcoming the rest mass of the KK particles, thus impeding the tunneling mechanism which is often thought of as responsible for the pair creation. However, we find that pair creation still occurs with a finite rate formally similar to the classic Schwinger result, but via an apparently different mechanism, involving a combination of the Unruh effect and vacuum polarization due to the E-field

  20. Secure pairing with biometrics

    NARCIS (Netherlands)

    Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.

    Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a

  1. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.

    2011-01-01

    Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and

  2. Solutions of nuclear pairing

    International Nuclear Information System (INIS)

    Balantekin, A. B.; Pehlivan, Y.

    2007-01-01

    We give the exact solution of orbit dependent nuclear pairing problem between two nondegenerate energy levels using the Bethe ansatz technique. Our solution reduces to previously solved cases in the appropriate limits including Richardson's treatment of reduced pairing in terms of rational Gaudin algebra operators

  3. Pair correlations in nuclei

    International Nuclear Information System (INIS)

    Shimizu, Yoshifumi

    2009-01-01

    Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

  4. Immune escape strategies of malaria parasites

    Directory of Open Access Journals (Sweden)

    Pollyanna Stephanie Gomes

    2016-10-01

    Full Text Available Malaria is one of the most life-threatening infectious diseases worldwide. Immunity to malaria is slow and short-lived despite the repeated parasite exposure in endemic areas. Malaria parasites have evolved refined machinery to evade the immune system based on a range of genetic changes that include allelic variation, biomolecular exposure of proteins and intracellular replication. All of these features increase the probability of survival in both mosquitoes and the vertebrate host. Plasmodium species escape from the first immunological trap in its invertebrate vector host, the Anopheles mosquitoes. The parasites have to pass through various immunological barriers within the mosquito such as anti-microbial molecules and the mosquito microbiota in order to achieve successful transmission to the vertebrate host. Within these hosts, Plasmodium species employ various immune evasion strategies during different life cycle stages. Parasite persistence against the vertebrate immune response depends on the balance among virulence factors, pathology, metabolic cost of the host immune response, and the parasites ability to evade the immune response. In this review we discuss the strategies that Plasmodium parasites use to avoid the vertebrate host immune system and how they promote successful infection and transmission.

  5. Nonthermal atmospheric escape from Mars and Titan

    International Nuclear Information System (INIS)

    Lammer, H.; Bauer, S.J.

    1991-01-01

    Energy flux spectra and particle concentrations of the hot O and N coronae from Mars and Titan, respectively, resulting primarily from dissociative recombination of molecular ions, have been calculated by means of a Monte Carlo method. The calculated energy flux spectra lead to an escape flux null esc ∼ 6 x 10 6 cm -2 s -1 for Mars and null esc ∼ 2 x 10 6 cm -2 s -1 for Titan, corresponding to a mass loss of about 0.14 kg/s for Mars and about 0.3 kg/s for Titan. (The contribution of electron impact ionization on N 2 amounts to only about 25% of Titan's mass loss.) Mass loss via solar and magnetospheric wind is also estimated using newly calculated mass loading limits. The mass loss via ion pickup from the extended hot atom corona for Mars amounts to about 0.25 kg/s (O + ) and for Titan to about 50 g/s (N 2 + or H 2 CN + ). Thus, the total mass loss rate from Mars and Titan is about the same, i.e., 0.4 kg/s

  6. Leishmania Hijacks Myeloid Cells for Immune Escape

    Directory of Open Access Journals (Sweden)

    María Martínez-López

    2018-05-01

    Full Text Available Protozoan parasites of the Leishmania genus are the causative agents of leishmaniasis, a group of neglected tropical diseases whose clinical manifestations vary depending on the infectious Leishmania species but also on host factors. Recognition of the parasite by host myeloid immune cells is a key to trigger an effective Leishmania-specific immunity. However, the parasite is able to persist in host myeloid cells by evading, delaying and manipulating host immunity in order to escape host resistance and ensure its transmission. Neutrophils are first in infiltrating infection sites and could act either favoring or protecting against infection, depending on factors such as the genetic background of the host or the parasite species. Macrophages are the main host cells where the parasites grow and divide. However, macrophages are also the main effector population involved in parasite clearance. Parasite elimination by macrophages requires the priming and development of an effector Th1 adaptive immunity driven by specific subtypes of dendritic cells. Herein, we will provide a comprehensive outline of how myeloid cells regulate innate and adaptive immunity against Leishmania, and the mechanisms used by the parasites to promote their evasion and sabotage. Understanding the interactions between Leishmania and the host myeloid cells may lead to the development of new therapeutic approaches and improved vaccination to leishmaniases, an important worldwide health problem in which current therapeutic or preventive approaches are limited.

  7. Escape route simulator utilizing augmented reality

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Karen Salazar Ribeiro de; Mó, Antônio Carlos de A.; Santo, André Cotelli do E.; Silva, Marcio Henrique, E-mail: karensalazar.1190@gmail.com [Instituto de Engenharia Nuclear (IEN/CNEN-RJ), Rio de Janeiro, RJ (Brazil); Centro Universitário Carioca (UniCarioca), Rio de Janeiro, RJ (Brazil)

    2017-07-01

    Due to increasing demand and interest in the interaction of technology platforms and integration of different types of systems and technologies, some tools are already providing practical ways to develop integrated applications. The tools explored by this article are Unity, a platform for game development, and Vuforia, an SDK, software development kit, for augmented reality creation. The coalition proposal of these resources is to create an intuitive escape route that can be used for the evacuation of buildings or open spaces in view of imminent danger, such as radiation leakage, and that can be accessed from a target available at the institution. It has also the intention of simulating situations that involve training of personnel in order to obtain methods that allow to save financial resources, and even to avoid that those who are involved are exposed to risks unnecessarily. The simulator is expected to help design, test, and improve ways to maintain the physical integrity of the facility and provide end users with a better sense of immersion and attractiveness. (author)

  8. Escape route simulator utilizing augmented reality

    International Nuclear Information System (INIS)

    Mattos, Karen Salazar Ribeiro de; Mó, Antônio Carlos de A.; Santo, André Cotelli do E.; Silva, Marcio Henrique

    2017-01-01

    Due to increasing demand and interest in the interaction of technology platforms and integration of different types of systems and technologies, some tools are already providing practical ways to develop integrated applications. The tools explored by this article are Unity, a platform for game development, and Vuforia, an SDK, software development kit, for augmented reality creation. The coalition proposal of these resources is to create an intuitive escape route that can be used for the evacuation of buildings or open spaces in view of imminent danger, such as radiation leakage, and that can be accessed from a target available at the institution. It has also the intention of simulating situations that involve training of personnel in order to obtain methods that allow to save financial resources, and even to avoid that those who are involved are exposed to risks unnecessarily. The simulator is expected to help design, test, and improve ways to maintain the physical integrity of the facility and provide end users with a better sense of immersion and attractiveness. (author)

  9. High-energy X-ray powder diffraction and atomic-pair distribution-function studies of charged/discharged structures in carbon-hybridized Li2MnSiO4 nanoparticles as a cathode material for lithium-ion batteries

    Science.gov (United States)

    Moriya, Maki; Miyahara, Masahiko; Hokazono, Mana; Sasaki, Hirokazu; Nemoto, Atsushi; Katayama, Shingo; Akimoto, Yuji; Hirano, Shin-ichi; Ren, Yang

    2014-10-01

    The stable cycling performance with a high discharge capacity of ∼190 mAh g-1 in a carbon-hybridized Li2MnSiO4 nanostructured powder has prompted an experimental investigation of the charged/discharged structures using synchrotron-based and laboratory-based X-rays and atomic-pair distribution-function (PDF) analyses. A novel method of in-situ spray pyrolysis of a precursor solution with glucose as a carbon source enabled the successful synthesis of the carbon-hybridized Li2MnSiO4 nanoparticles. The XRD patters of the discharged (lithiated) samples exhibit a long-range ordered structure characteristic of the (β) Li2MnSiO4 crystalline phase (space group Pmn21) which dissipates in the charged (delithiated) samples. However, upon discharging the long-range ordered structure recovers in each cycle. The disordered structure, according to the PDF analysis, is mainly due to local distortions of the MnO4 tetrahedra which show a mean Mn-O nearest neighbor distance shorter than that of the long-range ordered phase. These results corroborate the notion of the smaller Mn3+/Mn4+ ionic radii in the Li extracted phase versus the larger Mn2+ ionic radius in Li inserted phase. Thus Li extraction/insertion drives the fluctuation between the disordered and the long-range ordered structures.

  10. Cooper Pairs in Insulators?

    International Nuclear Information System (INIS)

    Valles, James

    2008-01-01

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

  11. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

  12. A New Paradigm for Evaluating Avoidance/Escape Motivation.

    Science.gov (United States)

    Tsutsui-Kimura, Iku; Bouchekioua, Youcef; Mimura, Masaru; Tanaka, Kenji F

    2017-07-01

    Organisms have evolved to approach pleasurable opportunities and to avoid or escape from aversive experiences. These 2 distinct motivations are referred to as approach and avoidance/escape motivations and are both considered vital for survival. Despite several recent advances in understanding the neurobiology of motivation, most studies addressed approach but not avoidance/escape motivation. Here we develop a new experimental paradigm to quantify avoidance/escape motivation and examine the pharmacological validity. We set up an avoidance variable ratio 5 task in which mice were required to press a lever for variable times to avoid an upcoming aversive stimulus (foot shock) or to escape the ongoing aversive event if they failed to avoid it. We i.p. injected ketamine (0, 1, or 5 mg/kg) or buspirone (0, 5, or 10 mg/kg) 20 or 30 minutes before the behavioral task to see if ketamine enhanced avoidance/escape behavior and buspirone diminished it as previously reported. We found that the performance on the avoidance variable ratio 5 task was sensitive to the intensity of the aversive stimulus. Treatment with ketamine increased while that with buspirone decreased the probability of avoidance from an aversive stimulus in the variable ratio 5 task, being consistent with previous reports. Our new paradigm will prove useful for quantifying avoidance/escape motivation and will contribute to a more comprehensive understanding of motivation. © The Author 2017. Published by Oxford University Press on behalf of CINP.

  13. Internal Charging

    Science.gov (United States)

    Minow, Joseph I.

    2014-01-01

    (1) High energy (>100keV) electrons penetrate spacecraft walls and accumulate in dielectrics or isolated conductors; (2) Threat environment is energetic electrons with sufficient flux to charge circuit boards, cable insulation, and ungrounded metal faster than charge can dissipate; (3) Accumulating charge density generates electric fields in excess of material breakdown strenght resulting in electrostatic discharge; and (4) System impact is material damage, discharge currents inside of spacecraft Faraday cage on or near critical circuitry, and RF noise.

  14. MAVEN Pickup Ion Constraints on Mars Neutral Escape

    Science.gov (United States)

    Rahmati, A.; Larson, D. E.; Cravens, T.; Lillis, R. J.; Dunn, P.; Halekas, J. S.; McFadden, J. P.; Mitchell, D. L.; Thiemann, E.; Connerney, J. E. P.; DiBraccio, G. A.; Espley, J. R.; Eparvier, F. G.

    2017-12-01

    Mars is currently losing its atmosphere mainly due to the escape of neutral hydrogen and oxygen. Directly measuring the rate of escaping neutrals is difficult, because the neutral density in the Mars exosphere is dominated, up to several Martian radii, by atoms that are gravitationally bound to the planet. Neutral atoms in the Martian exosphere, however, can get ionized, picked up, and accelerated by the solar wind motional electric field and energized to energies high enough for particle detectors to measure them. The MAVEN SEP instrument detects O+ pickup ions that are created at altitudes where the escaping part of the exosphere is dominant. Fluxes of these ions reflect neutral densities in the distant exosphere of Mars, allowing us to constrain neutral oxygen escape rates. The MAVEN SWIA and STATIC instruments measure pickup H+ and O+ created closer to Mars; comparisons of these data with models can be used to constrain exospheric hot O and thermal H densities and escape rates. In this work, pickup ion measurements from SEP, SWIA, and STATIC, taken during the first 3 Earth years of the MAVEN mission, are compared to the outputs of a pickup ion model to constrain the variability of neutral escape at Mars. The model is based on data from six MAVEN instruments, namely, MAG providing magnetic field used in calculating pickup ion trajectories, SWIA providing solar wind velocity as well as 3D pickup H+ and O+ spectra, SWEA providing solar wind electron spectrum used in electron impact ionization rate calculations, SEP providing pickup O+ spectra, STATIC providing mass resolved 3D pickup H+ and O+ spectra, and EUVM providing solar EUV spectra used in photoionization rate calculations. A variability of less than a factor of two is observed in hot oxygen escape rates, whereas thermal escape of hydrogen varies by an order of magnitude with Mars season. This hydrogen escape variability challenges our understanding of the H cycle at Mars, but is consistent with other

  15. Effect of the source charge on charged-boson interferometry

    International Nuclear Information System (INIS)

    Shoppa, T. D.; Koonin, S. E.; Seki, R.

    2000-01-01

    We investigate quantal perturbations of the interferometric correlations of charged bosons by the Coulomb field of an instantaneous, charged source. The source charge increases the apparent source size by weakening the correlation at nonzero relative momenta. The effect is strongest for pairs with a small total momentum and is stronger for kaons than for pions of the same momenta. The low-energy data currently available are well described by this effect. A simple expression is proposed to account for the effect. (c) 2000 The American Physical Society

  16. Mesoscopic pairing without superconductivity

    Science.gov (United States)

    Hofmann, Johannes

    2017-12-01

    We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.

  17. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.

    2006-01-01

    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  18. Performance of the clover detector considering the effects of pair production

    International Nuclear Information System (INIS)

    Kshetri, Ritesh

    2015-01-01

    Gamma rays having sufficient energy to produce positron-electron pairs in a detector generate three peaks in the energy spectrum, corresponding to the full gamma-ray energy, and this gamma-ray energy minus 511 and 1022 keV because of the single and double escape of the 511 keV annihilation quanta. The escape peaks are frequently used to extend the precision of energy calibration, simply by providing additional spectral peaks at well-known energies. At energies around 6 MeV, the pair production process dominates over other gamma interaction processes in germanium. It has been observed that the intensity of the single and double escape peaks (SEP and DEP) for gamma-rays around these energies increases rapidly. This results in a difficulty to correctly identify new gamma-rays, which is crucial for precision gamma-ray spectroscopy that involves mostly the use of tapered cylindrical germanium detectors

  19. Charge preamplifier

    International Nuclear Information System (INIS)

    Chaminade, R.; Passerieux, J.P.

    1961-01-01

    We describe a charge preamplifier having the following properties: - large open loop gain giving both stable gain and large input charge transfer; - stable input grid current with aging and without any adjustment; - fairly fast rise; - nearly optimum noise performance; - industrial material. (authors)

  20. Charge Meter

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 4. Charge Meter: Easy Way to Measure Charge and Capacitance: Some Interesting Electrostatic Experiments. M K Raghavendra V Venkataraman. Classroom Volume 19 Issue 4 April 2014 pp 376-390 ...

  1. Charging machine

    International Nuclear Information System (INIS)

    Medlin, J.B.

    1976-01-01

    A charging machine for loading fuel slugs into the process tubes of a nuclear reactor includes a tubular housing connected to the process tube, a charging trough connected to the other end of the tubular housing, a device for loading the charging trough with a group of fuel slugs, means for equalizing the coolant pressure in the charging trough with the pressure in the process tubes, means for pushing the group of fuel slugs into the process tube and a latch and a seal engaging the last object in the group of fuel slugs to prevent the fuel slugs from being ejected from the process tube when the pusher is removed and to prevent pressure liquid from entering the charging machine. 3 claims, 11 drawing figures

  2. Escape/Aggression Incidence in Sexually Abused Juvenile Delinquents.

    Science.gov (United States)

    Reich, John W.; Gutierres, Sara E.

    1979-01-01

    Reports a continuation of prior research testing a theoretical model which predicts that juveniles subjected to abuse will not become aggressive but will engage in escape and social avoidance behaviors. Analysis supported the hypothesis. (Author)

  3. 30 CFR 57.11053 - Escape and evacuation plans.

    Science.gov (United States)

    2010-07-01

    ... of principal air flow, location of escape routes and locations of existing telephones, primary fans... maps or diagrams shall be posted at all shaft stations and in underground shops, lunchrooms, and...

  4. Amplitude modulation control of escape from a potential well

    International Nuclear Information System (INIS)

    Chacón, R.; Martínez García-Hoz, A.; Miralles, J.J.; Martínez, P.J.

    2014-01-01

    We demonstrate the effectiveness of periodic amplitude modulations in controlling (suppressing and enhancing) escape from a potential well through the universal model of a damped Helmholtz oscillator subjected to an external periodic excitation (the escape-inducing excitation) whose amplitude is periodically modulated (the escape-controlling excitation). Analytical and numerical results show that this multiplicative control works reliably for different subharmonic resonances between the two periodic excitations involved, and that its effectiveness is comparable to those of different methods of additive control. Additionally, we demonstrate the robustness of the multiplicative control against the presence of low-intensity Gaussian noise. -- Highlights: •Multiplicative control of escape from a potential well has been demonstrated. •Theoretical predictions are obtained from a Melnikov analysis. •It has been shown the robustness of the multiplicative control against noise.

  5. Escape panels in trawls – a consistent management tool?

    DEFF Research Database (Denmark)

    Krag, Ludvig Ahm; Herrmann, Bent; Feekings, Jordan P.

    2016-01-01

    ), saithe (Pollachius virens), haddock (Melanogrammus aeglefinus), plaice (Pleuronectes platessa) and Norway lobster (Nephrops norvegicus). Thus the modification by fishers of certain gear properties not specified in the legislation can significantly influence the efficiency of an escape panel. We discuss...

  6. Topological Nodal Cooper Pairing in Doped Weyl Metals

    Science.gov (United States)

    Li, Yi; Haldane, F. D. M.

    2018-02-01

    We generalize the concept of Berry connection of the single-electron band structure to that of a two-particle Cooper pairing state between two Fermi surfaces with opposite Chern numbers. Because of underlying Fermi surface topology, the pairing Berry phase acquires nontrivial monopole structure. Consequently, pairing gap functions have topologically protected nodal structure as vortices in the momentum space with the total vorticity solely determined by the pair monopole charge qp. The nodes of gap function behave as the Weyl-Majorana points of the Bogoliubov-de Gennes pairing Hamiltonian. Their relation with the connection patterns of the surface modes from the Weyl band structure and the Majorana surface modes inside the pairing gap is also discussed. Under the approximation of spherical Fermi surfaces, the pairing symmetry are represented by monopole harmonic functions. The lowest possible pairing channel carries angular momentum number j =|qp|, and the corresponding gap functions are holomorphic or antiholomorphic functions on Fermi surfaces. After projected on the Fermi surfaces with nontrivial topology, all the partial-wave channels of pairing interactions acquire the monopole charge qp independent of concrete pairing mechanism.

  7. GREEN PEA GALAXIES REVEAL SECRETS OF Lyα ESCAPE

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Huan; Wang, Junxian [CAS Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China (China); Malhotra, Sangeeta; Rhoads, James E. [Arizona State University, School of Earth and Space Exploration (United States); Gronke, Max; Dijkstra, Mark [Institute of Theoretical Astrophysics, University of Oslo (Norway); Jaskot, Anne [Smith College, Northampton, MA (United States); Zheng, Zhenya, E-mail: yanghuan@mail.ustc.edu.cn, E-mail: huan.y@asu.edu, E-mail: Sangeeta.Malhotra@asu.edu, E-mail: James.Rhoads@asu.edu [Pontificia Universidad Católica de Chile, Santiago (Chile)

    2016-04-01

    We analyze archival Lyα spectra of 12 “Green Pea” galaxies observed with the Hubble Space Telescope, model their Lyα profiles with radiative transfer models, and explore the dependence of the Lyα escape fraction on various properties. Green Pea galaxies are nearby compact starburst galaxies with [O iii] λ5007 equivalent widths (EWs) of hundreds of Å. All 12 Green Pea galaxies in our sample show Lyα lines in emission, with an Lyα EW distribution similar to high-redshift Lyα emitters. Combining the optical and UV spectra of Green Pea galaxies, we estimate their Lyα escape fractions and find correlations between Lyα escape fraction and kinematic features of Lyα profiles. The escape fraction of Lyα in these galaxies ranges from 1.4% to 67%. We also find that the Lyα escape fraction depends strongly on metallicity and moderately on dust extinction. We compare their high-quality Lyα profiles with single H i shell radiative transfer models and find that the Lyα escape fraction anticorrelates with the derived H i column densities. Single-shell models fit most Lyα profiles well, but not the ones with the highest escape fractions of Lyα. Our results suggest that low H i column density and low metallicity are essential for Lyα escape and make a galaxy an Lyα emitter.

  8. The influence of panic on the efficiency of escape

    Science.gov (United States)

    Shen, Jia-Quan; Wang, Xu-Wen; Jiang, Luo-Luo

    2018-02-01

    Whenever we (such as pedestrians) perceive a high density or imminent danger in a confined space, we tend to be panic, which can lead to severe injuries even in the absence of real dangers. Although it is difficult to measure panics in real conditions, we introduced a simple model to study the collective behaviors in condition of fire with dense smoke. Owing to blocking the sight with dense smoke, pedestrians in this condition have two strategies to escape: random-walking or walking along the wall. When the pedestrians are in moderate panic that mean the two types of behaviors are mixed(random-walking and walking along the wall). Our simulation results show that moderate panic, meaning that two escape strategies are mixed, reduces the escape time. In addition, the results indicate that moderate panic can improve the efficiency of escape, this theory also can be useful in a real escape situation. We hope that our research provides the theoretical understanding of underlying mechanisms of panic escape in the condition of poor sight.

  9. An automatic recording system for the study of escape from fear in rats.

    Science.gov (United States)

    Li, Ming; He, Wei

    2013-11-01

    Escape from fear (EFF) is an active response to a conditioned stimulus (CS) previously paired with an unconditioned fearful stimulus (US), which typically leads to the termination of the CS. In this paradigm, animals acquire two distinct associations: S-S [CS-US] and R-O [response-outcome] through Pavlovian and instrumental conditioning, respectively. The present study describes a computer controlled automatic recording system that captures the development of EFF and allows the determination of the respective roles of S-S and R-O associations in this process. We validated this system by showing that only rats subjected to a simultaneous CS-US conditioning (i.e., CS and US occur together at the beginning of each trial) acquired EFF, not those subjected to an unpaired CS-US conditioning. Paired rats had a progressively increased number of EFF and significantly shorter escape latencies than unpaired rats across the 5-trial blocks on the test day. However, during the conditioning phase, the unpaired rats emitted more 22kHz ultrasonic vocalizations, a validated measure of conditioned reactive fear responses. Our results demonstrate that the acquisition of EFF is contingent upon pairing of the CS with the US, not simply the consequence of a high level of generalized fear. Because this commercially available system is capable of examining both conditioned active and reactive fear responses in a single setup, it could be used to determine the relative roles of S-S and R-O associations in EFF, the neurobiology of conditioned active fear response and neuropharmacology of psychotherapeutic drugs. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Pair production by a deep potential well

    International Nuclear Information System (INIS)

    Nikishov, A.I.

    1987-01-01

    Solutions are obtained for the Dirac and Klein-Gordon equations with a one-dimensional symmetric potential well, having a flat bottom and arbitrary depth, width and field strengths at the walls. Quasi-stationary solutions describing a pair production by the well and the inverse process are obtained. It is shown that if the pair production probability is small, it is expressed in terms of the pair production probability on one wall and the particle oscillation frequency in the well. If the well has a supercritical depth, the lower continuum contains positron resonance scattering states at energies close to the real part of the quasi-stationary level energy (Zeldovich's effect). The qualitative dependence of the positron penetration coefficient through the wall on its energy and the well depth is an evidence that the solution of the so called one-particle Dirac equation describes in fact a many-particle system with a charge of 0 or 1

  11. Theory of antiferromagnetic pairing in cuprate superconductors

    International Nuclear Information System (INIS)

    Plakida, N.M.

    2006-01-01

    A review of the antiferromagnetic exchange and spin-fluctuation pairing theory in the cuprate superconductors is given. We briefly discuss a phenomenological approach and a theory in the limit of weak Coulomb correlations. A microscopic theory in the strong correlation limit is presented in more detail. In particular, results of our recently developed theory for the effective p-d Hubbard model and the reduced t-J model are given. We have proved that retardation effects for the antiferromagnetic exchange interaction are unimportant that results in pairing of all charge carriers in the conduction band and high Tc proportional to the Fermi energy. The spin-fluctuation interaction caused by kinematic interaction gives an additional contribution to the d-wave pairing. Dependence of Tc on the hole concentration and the lattice constant (or pressure) and an oxygen isotope shift are discussed

  12. Charged Higgs signals in t t ¯ searches

    Science.gov (United States)

    Alves, Daniele S. M.; Hedri, Sonia El; Taki, Anna Maria; Weiner, Neal

    2017-10-01

    New scalars from an extended Higgs sector could have weak scale masses and still have escaped detection. In a type I two Higgs doublet model, for instance, even the charged Higgs can be lighter than the top quark. Because electroweak production of these scalars is modest, the greatest opportunity for their detection might come from rare top decays. For mass hierarchies of the type mt>mH+>mA0,H0, the natural signal can arise from top quark pair production, followed by the decay chain t →b H+, H+→W+(*)ϕ0, ϕ0→b b ¯,τ+τ-, where ϕ0=A0,H0. These final states largely overlap with those of the Standard Model t t ¯ HSM process, and therefore can potentially contaminate t t ¯ HSM searches. We demonstrate that existing t t ¯HSM analyses can already probe light extended Higgs sectors, and we derive new constraints from their results. Furthermore, we note that existing excesses in t t ¯HSM searches can be naturally explained by the contamination of rare top decays to new light Higgses. We discuss how to distinguish this signal from the Standard Model process.

  13. Charge independence and charge symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Miller, G A [Washington Univ., Seattle, WA (United States). Dept. of Physics; van Oers, W T.H. [Manitoba Univ., Winnipeg, MB (Canada). Dept. of Physics; [TRIUMF, Vancouver, BC (Canada)

    1994-09-01

    Charge independence and charge symmetry are approximate symmetries of nature, violated by the perturbing effects of the mass difference between up and down quarks and by electromagnetic interactions. The observations of the symmetry breaking effects in nuclear and particle physics and the implications of those effects are reviewed. (author). 145 refs., 3 tabs., 11 figs.

  14. Charge independence and charge symmetry

    International Nuclear Information System (INIS)

    Miller, G.A.

    1994-09-01

    Charge independence and charge symmetry are approximate symmetries of nature, violated by the perturbing effects of the mass difference between up and down quarks and by electromagnetic interactions. The observations of the symmetry breaking effects in nuclear and particle physics and the implications of those effects are reviewed. (author). 145 refs., 3 tabs., 11 figs

  15. [Paired kidneys in transplant].

    Science.gov (United States)

    Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús

    2009-02-01

    Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.

  16. Determination of the pairing-strength constants in the isovector plus isoscalar pairing case

    Science.gov (United States)

    Mokhtari, D.; Fellah, M.; Allal, N. H.

    2016-05-01

    A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.

  17. Junctionless Cooper pair transistor

    Energy Technology Data Exchange (ETDEWEB)

    Arutyunov, K. Yu., E-mail: konstantin.yu.arutyunov@jyu.fi [National Research University Higher School of Economics , Moscow Institute of Electronics and Mathematics, 101000 Moscow (Russian Federation); P.L. Kapitza Institute for Physical Problems RAS , Moscow 119334 (Russian Federation); Lehtinen, J.S. [VTT Technical Research Centre of Finland Ltd., Centre for Metrology MIKES, P.O. Box 1000, FI-02044 VTT (Finland)

    2017-02-15

    Highlights: • Junctionless Cooper pair box. • Quantum phase slips. • Coulomb blockade and gate modulation of the Coulomb gap. - Abstract: Quantum phase slip (QPS) is the topological singularity of the complex order parameter of a quasi-one-dimensional superconductor: momentary zeroing of the modulus and simultaneous 'slip' of the phase by ±2π. The QPS event(s) are the dynamic equivalent of tunneling through a conventional Josephson junction containing static in space and time weak link(s). Here we demonstrate the operation of a superconducting single electron transistor (Cooper pair transistor) without any tunnel junctions. Instead a pair of thin superconducting titanium wires in QPS regime was used. The current–voltage characteristics demonstrate the clear Coulomb blockade with magnitude of the Coulomb gap modulated by the gate potential. The Coulomb blockade disappears above the critical temperature, and at low temperatures can be suppressed by strong magnetic field.

  18. Charge Separation in Intermixed Polymer:PC70BM Photovoltaic Blends: Correlating Structural and Photophysical Length Scales as a Function of Blend Composition

    KAUST Repository

    Utzat, Hendrik

    2017-04-24

    A key challenge in achieving control over photocurrent generation by bulk-heterojunction organic solar cells is understanding how the morphology of the active layer impacts charge separation and in particular the separation dynamics within molecularly intermixed donor-acceptor domains versus the dynamics between phase-segregated domains. This paper addresses this issue by studying blends and devices of the amorphous silicon-indacenodithiophene polymer SiIDT-DTBT and the acceptor PCBM. By changing the blend composition, we modulate the size and density of the pure and intermixed domains on the nanometer length scale. Laser spectroscopic studies show that these changes in morphology correlate quantitatively with the changes in charge separation dynamics on the nanosecond time scale and with device photocurrent densities. At low fullerene compositions, where only a single, molecularly intermixed polymer-fullerene phase is observed, photoexcitation results in a ∼ 30% charge loss from geminate polaron pair recombination, which is further studied via light intensity experiments showing that the radius of the polaron pairs in the intermixed phase is 3-5 nm. At high fullerene compositions (≥67%), where the intermixed domains are 1-3 nm and the pure fullerene phases reach ∼4 nm, the geminate recombination is suppressed by the reduction of the intermixed phase, making the fullerene domains accessible for electron escape.

  19. Ion escape fluxes from the terrestrial high-latitude ionosphere

    International Nuclear Information System (INIS)

    Barakat, A.R.; Schunk, R.W.; Moore, T.E.; Waite, J.H. Jr.

    1987-01-01

    The coupled continuity and momentum equations for H + , O + , and electrons were solved for the terrestrial ionosphere in order to determine the limiting ion escape fluxes at high latitudes. The effects of solar cycle, season, geomagnetic activity, and the altitude of the acceleration region on the ion escape fluxes were studied for average conditions. In addition, a systematic parameter study was conducted to determine the extent to which variations in ionospheric conditions (for example, electron temperature, ion temperature, induced vertical ion drifts, etc.) can affect the results. The main conclusions of the study are as follows: (1) as solar activity increases, the general trend is for an increase in the limiting O + escape flux and a decrease in the limiting H + escape flux; (2) in winter the limiting escape fluxes of both O + and H + are larger than those in summer, particularly for low geomagnetic activity; (3) the O + content of the ion outflow increases with increasing ''demand'' imposed on the ionosphere by a high-altitude acceleration process, with increasing solar activity, with increasing geomagnetic activity, with increasing solar elevation from winter to summer, and with a lowering of the altitude of the acceleration region; (4) when H + is in a near-diffusive equilibrium state and a selective mechanism accelerates O + , the limiting O + escape flux is significantly reduced compared to that obtained when an H + outflow also occurs; and (5) at a given time or location the general trends described above can be significantly modified or even reversed owing to natural variations of the ionospheric ion and electron temperatures, induced vertical ion drifts, etc. The general trends obtained for average conditions appear to mimic the qualitative behavior determined from statistically averaged data for comparable absolute escape flux magnitudes

  20. Enhanced pairing susceptibility in a photodoped two-orbital Hubbard model

    Science.gov (United States)

    Werner, Philipp; Strand, Hugo U. R.; Hoshino, Shintaro; Murakami, Yuta; Eckstein, Martin

    2018-04-01

    Local spin fluctuations provide the glue for orbital-singlet spin-triplet pairing in the doped Mott insulating regime of multiorbital Hubbard models. At large Hubbard repulsion U , the pairing susceptibility is nevertheless tiny because the pairing interaction cannot overcome the suppression of charge fluctuations. Using nonequilibrium dynamical mean field simulations of the two-orbital Hubbard model, we show that out of equilibrium the pairing susceptibility in this large-U regime can be strongly enhanced by creating a photoinduced population of the relevant charge states. This enhancement is supported by the long lifetime of photodoped charge carriers and a built-in cooling mechanism in multiorbital Hubbard systems.

  1. Importance of polaron effects for charge carrier mobility above and ...

    Indian Academy of Sciences (India)

    It is shown that the scattering of polaronic charge carriers and bosonic Cooper pairs at acoustic and optical phonons are responsible for the charge carrier mobility above and below the PG temperature. We show that the energy scales of the binding energies of large polarons and polaronic Cooper pairs can be identified by ...

  2. Measurements of the charge asymmetry in top-quark pair production in the dilepton final state at s=8TeV with the ATLAS detector

    Energy Technology Data Exchange (ETDEWEB)

    Aad, G.; Abbott, B.; Abdallah, J.; Abdinov, O.; Abeloos, B.; Aben, R.; Abolins, M.; AbouZeid, O. S.; Abraham, N. L.; Abramowicz, H.; Abreu, H.; Abreu, R.; Abulaiti, Y.; Acharya, B. S.; Adamczyk, L.; Adams, D. L.; Adelman, J.; Adomeit, S.; Adye, T.; Affolder, A. A.; Agatonovic-Jovin, T.; Agricola, J.; Aguilar-Saavedra, J. A.; Ahlen, S. P.; Ahmadov, F.; Aielli, G.; Akerstedt, H.; Åkesson, T. P. A.; Akimov, A. V.; Alberghi, G. L.; Albert, J.; Albrand, S.; Alconada Verzini, M. J.; Aleksa, M.; Aleksandrov, I. N.; Alexa, C.; Alexander, G.; Alexopoulos, T.; Alhroob, M.; Aliev, M.; Alimonti, G.; Alison, J.; Alkire, S. P.; Allbrooke, B. M. M.; Allen, B. W.; Allport, P. P.; Aloisio, A.; Alonso, A.; Alonso, F.; Alpigiani, C.; Alvarez Gonzalez, B.; Álvarez Piqueras, D.; Alviggi, M. G.; Amadio, B. T.; Amako, K.; Amaral Coutinho, Y.; Amelung, C.; Amidei, D.; Amor Dos Santos, S. P.; Amorim, A.; Amoroso, S.; Amram, N.; Amundsen, G.; Anastopoulos, C.; Ancu, L. S.; Andari, N.; Andeen, T.; Anders, C. F.; Anders, G.; Anders, J. K.; Anderson, K. J.; Andreazza, A.; Andrei, V.; Angelidakis, S.; Angelozzi, I.; Anger, P.; Angerami, A.; Anghinolfi, F.; Anisenkov, A. V.; Anjos, N.; Annovi, A.; Antonelli, M.; Antonov, A.; Antos, J.; Anulli, F.; Aoki, M.; Aperio Bella, L.; Arabidze, G.; Arai, Y.; Araque, J. P.; Arce, A. T. H.; Arduh, F. A.; Arguin, J-F.; Argyropoulos, S.; Arik, M.; Armbruster, A. J.; Armitage, L. J.; Arnaez, O.; Arnold, H.; Arratia, M.; Arslan, O.; Artamonov, A.; Artoni, G.; Artz, S.; Asai, S.; Asbah, N.; Ashkenazi, A.; Åsman, B.; Asquith, L.; Assamagan, K.; Astalos, R.; Atkinson, M.; Atlay, N. B.; Augsten, K.; Avolio, G.; Axen, B.; Ayoub, M. K.; Azuelos, G.; Baak, M. A.; Baas, A. E.; Baca, M. J.; Bachacou, H.; Bachas, K.; Backes, M.; Backhaus, M.; Bagiacchi, P.; Bagnaia, P.; Bai, Y.; Baines, J. T.; Baker, O. K.; Baldin, E. M.; Balek, P.; Balestri, T.; Balli, F.; Balunas, W. K.; Banas, E.; Banerjee, Sw.; Bannoura, A. A. E.; Barak, L.; Barberio, E. L.; Barberis, D.; Barbero, M.; Barillari, T.; Barklow, T.; Barlow, N.; Barnes, S. L.; Barnett, B. M.; Barnett, R. M.; Barnovska, Z.; Baroncelli, A.; Barone, G.; Barr, A. J.; Barranco Navarro, L.; Barreiro, F.; Barreiro Guimarães da Costa, J.; Bartoldus, R.; Barton, A. E.; Bartos, P.; Basalaev, A.; Bassalat, A.; Basye, A.; Bates, R. L.; Batista, S. J.; Batley, J. R.; Battaglia, M.; Bauce, M.; Bauer, F.; Bawa, H. S.; Beacham, J. B.; Beattie, M. D.; Beau, T.; Beauchemin, P. H.; Bechtle, P.; Beck, H. P.; Becker, K.; Becker, M.; Beckingham, M.; Becot, C.; Beddall, A. J.; Beddall, A.; Bednyakov, V. A.; Bedognetti, M.; Bee, C. P.; Beemster, L. J.; Beermann, T. A.; Begel, M.; Behr, J. K.; Belanger-Champagne, C.; Bell, A. S.; Bella, G.; Bellagamba, L.; Bellerive, A.; Bellomo, M.; Belotskiy, K.; Beltramello, O.; Belyaev, N. L.; Benary, O.; Benchekroun, D.; Bender, M.; Bendtz, K.; Benekos, N.; Benhammou, Y.; Benhar Noccioli, E.; Benitez, J.; Benitez Garcia, J. A.; Benjamin, D. P.; Bensinger, J. R.; Bentvelsen, S.; Beresford, L.; Beretta, M.; Berge, D.; Bergeaas Kuutmann, E.; Berger, N.; Berghaus, F.; Beringer, J.; Berlendis, S.; Bernard, N. R.; Bernius, C.; Bernlochner, F. U.; Berry, T.; Berta, P.; Bertella, C.; Bertoli, G.; Bertolucci, F.; Bertram, I. A.; Bertsche, C.; Bertsche, D.; Besjes, G. J.; Bessidskaia Bylund, O.; Bessner, M.; Besson, N.; Betancourt, C.; Bethke, S.; Bevan, A. J.; Bhimji, W.; Bianchi, R. M.; Bianchini, L.; Bianco, M.; Biebel, O.; Biedermann, D.; Bielski, R.; Biesuz, N. V.; Biglietti, M.; Bilbao De Mendizabal, J.; Bilokon, H.; Bindi, M.; Binet, S.; Bingul, A.; Bini, C.; Biondi, S.; Bjergaard, D. M.; Black, C. W.; Black, J. E.; Black, K. M.; Blackburn, D.; Blair, R. E.; Blanchard, J. -B.; Blanco, J. E.; Blazek, T.; Bloch, I.; Blocker, C.; Blum, W.; Blumenschein, U.; Blunier, S.; Bobbink, G. J.; Bobrovnikov, V. S.; Bocchetta, S. S.; Bocci, A.; Bock, C.; Boehler, M.; Boerner, D.; Bogaerts, J. A.; Bogavac, D.; Bogdanchikov, A. G.; Bohm, C.; Boisvert, V.; Bold, T.; Boldea, V.; Boldyrev, A. S.; Bomben, M.; Bona, M.; Boonekamp, M.; Borisov, A.; Borissov, G.; Bortfeldt, J.; Bortoletto, D.; Bortolotto, V.; Bos, K.; Boscherini, D.; Bosman, M.; Bossio Sola, J. D.; Boudreau, J.; Bouffard, J.; Bouhova-Thacker, E. V.; Boumediene, D.; Bourdarios, C.; Boutle, S. K.; Boveia, A.; Boyd, J.; Boyko, I. R.; Bracinik, J.; Brandt, A.; Brandt, G.; Brandt, O.; Bratzler, U.; Brau, B.; Brau, J. E.; Braun, H. M.; Breaden Madden, W. D.; Brendlinger, K.; Brennan, A. J.; Brenner, L.; Brenner, R.; Bressler, S.; Bristow, T. M.; Britton, D.; Britzger, D.; Brochu, F. M.; Brock, I.; Brock, R.; Brooijmans, G.; Brooks, T.; Brooks, W. K.; Brosamer, J.; Brost, E.; Broughton, J. H.; Bruckman de Renstrom, P. A.; Bruncko, D.; Bruneliere, R.; Bruni, A.; Bruni, G.; Brunt, BH; Bruschi, M.; Bruscino, N.; Bryant, P.; Bryngemark, L.; Buanes, T.; Buat, Q.; Buchholz, P.; Buckley, A. G.; Budagov, I. A.; Buehrer, F.; Bugge, M. K.; Bulekov, O.; Bullock, D.; Burckhart, H.; Burdin, S.; Burgard, C. D.; Burghgrave, B.; Burka, K.; Burke, S.; Burmeister, I.; Busato, E.; Büscher, D.; Büscher, V.; Bussey, P.; Butler, J. M.; Butt, A. I.; Buttar, C. M.; Butterworth, J. M.; Butti, P.; Buttinger, W.; Buzatu, A.; Buzykaev, A. R.; Cabrera Urbán, S.; Caforio, D.; Cairo, V. M.; Cakir, O.; Calace, N.; Calafiura, P.; Calandri, A.; Calderini, G.; Calfayan, P.; Caloba, L. P.; Calvet, D.; Calvet, S.; Calvet, T. P.; Camacho Toro, R.; Camarda, S.; Camarri, P.; Cameron, D.; Caminal Armadans, R.; Camincher, C.; Campana, S.; Campanelli, M.; Campoverde, A.; Canale, V.; Canepa, A.; Cano Bret, M.; Cantero, J.; Cantrill, R.; Cao, T.; Capeans Garrido, M. D. M.; Caprini, I.; Caprini, M.; Capua, M.; Caputo, R.; Carbone, R. M.; Cardarelli, R.; Cardillo, F.; Carli, I.; Carli, T.; Carlino, G.; Carminati, L.; Caron, S.; Carquin, E.; Carrillo-Montoya, G. D.; Carter, J. R.; Carvalho, J.; Casadei, D.; Casado, M. P.; Casolino, M.; Casper, D. W.; Castaneda-Miranda, E.; Castelli, A.; Castillo Gimenez, V.; Castro, N. F.; Catinaccio, A.; Catmore, J. R.; Cattai, A.; Caudron, J.; Cavaliere, V.; Cavallaro, E.; Cavalli, D.; Cavalli-Sforza, M.; Cavasinni, V.; Ceradini, F.; Cerda Alberich, L.; Cerio, B. C.; Cerqueira, A. S.; Cerri, A.; Cerrito, L.; Cerutti, F.; Cerv, M.; Cervelli, A.; Cetin, S. A.; Chafaq, A.; Chakraborty, D.; Chan, S. K.; Chan, Y. L.; Chang, P.; Chapman, J. D.; Charlton, D. G.; Chatterjee, A.; Chau, C. C.; Chavez Barajas, C. A.; Che, S.; Cheatham, S.; Chegwidden, A.; Chekanov, S.; Chekulaev, S. V.; Chelkov, G. A.; Chelstowska, M. A.; Chen, C.; Chen, H.; Chen, K.; Chen, S.; Chen, S.; Chen, X.; Chen, Y.; Cheng, H. C.; Cheng, H. J.; Cheng, Y.; Cheplakov, A.; Cheremushkina, E.; Cherkaoui El Moursli, R.; Chernyatin, V.; Cheu, E.; Chevalier, L.; Chiarella, V.; Chiarelli, G.; Chiodini, G.; Chisholm, A. S.; Chitan, A.; Chizhov, M. V.; Choi, K.; Chomont, A. R.; Chouridou, S.; Chow, B. K. B.; Christodoulou, V.; Chromek-Burckhart, D.; Chudoba, J.; Chuinard, A. J.; Chwastowski, J. J.; Chytka, L.; Ciapetti, G.; Ciftci, A. K.; Cinca, D.; Cindro, V.; Cioara, I. A.; Ciocio, A.; Cirotto, F.; Citron, Z. H.; Ciubancan, M.; Clark, A.; Clark, B. L.; Clark, M. R.; Clark, P. J.; Clarke, R. N.; Clement, C.; Coadou, Y.; Cobal, M.; Coccaro, A.; Cochran, J.; Coffey, L.; Colasurdo, L.; Cole, B.; Cole, S.; Colijn, A. P.; Collot, J.; Colombo, T.; Compostella, G.; Conde Muiño, P.; Coniavitis, E.; Connell, S. H.; Connelly, I. A.; Consorti, V.; Constantinescu, S.; Conta, C.; Conti, G.; Conventi, F.; Cooke, M.; Cooper, B. D.; Cooper-Sarkar, A. M.; Cornelissen, T.; Corradi, M.; Corriveau, F.; Corso-Radu, A.; Cortes-Gonzalez, A.; Cortiana, G.; Costa, G.; Costa, M. J.; Costanzo, D.; Cottin, G.; Cowan, G.; Cox, B. E.; Cranmer, K.; Crawley, S. J.; Cree, G.; Crépé-Renaudin, S.; Crescioli, F.; Cribbs, W. A.; Crispin Ortuzar, M.; Cristinziani, M.; Croft, V.; Crosetti, G.; Cuhadar Donszelmann, T.; Cummings, J.; Curatolo, M.; Cúth, J.; Cuthbert, C.; Czirr, H.; Czodrowski, P.; D’Auria, S.; D’Onofrio, M.; Da Cunha Sargedas De Sousa, M. J.; Da Via, C.; Dabrowski, W.; Dai, T.; Dale, O.; Dallaire, F.; Dallapiccola, C.; Dam, M.; Dandoy, J. R.; Dang, N. P.; Daniells, A. C.; Dann, N. S.; Danninger, M.; Dano Hoffmann, M.; Dao, V.; Darbo, G.; Darmora, S.; Dassoulas, J.; Dattagupta, A.; Davey, W.; David, C.; Davidek, T.; Davies, M.; Davison, P.; Davygora, Y.; Dawe, E.; Dawson, I.; Daya-Ishmukhametova, R. K.; De, K.; de Asmundis, R.; De Benedetti, A.; De Castro, S.; De Cecco, S.; De Groot, N.; de Jong, P.; De la Torre, H.; De Lorenzi, F.; De Pedis, D.; De Salvo, A.; De Sanctis, U.; De Santo, A.; De Vivie De Regie, J. B.; Dearnaley, W. J.; Debbe, R.; Debenedetti, C.; Dedovich, D. V.; Deigaard, I.; Del Peso, J.; Del Prete, T.; Delgove, D.; Deliot, F.; Delitzsch, C. M.; Deliyergiyev, M.; Dell’Acqua, A.; Dell’Asta, L.; Dell’Orso, M.; Della Pietra, M.; della Volpe, D.; Delmastro, M.; Delsart, P. A.; Deluca, C.; DeMarco, D. A.; Demers, S.; Demichev, M.; Demilly, A.; Denisov, S. P.; Denysiuk, D.; Derendarz, D.; Derkaoui, J. E.; Derue, F.; Dervan, P.; Desch, K.; Deterre, C.; Dette, K.; Deviveiros, P. O.; Dewhurst, A.; Dhaliwal, S.; Di Ciaccio, A.; Di Ciaccio, L.; Di Clemente, W. K.; Di Donato, C.; Di Girolamo, A.; Di Girolamo, B.; Di Micco, B.; Di Nardo, R.; Di Simone, A.; Di Sipio, R.; Di Valentino, D.; Diaconu, C.; Diamond, M.; Dias, F. A.; Diaz, M. A.; Diehl, E. B.; Dietrich, J.; Diglio, S.; Dimitrievska, A.; Dingfelder, J.; Dita, P.; Dita, S.; Dittus, F.; Djama, F.; Djobava, T.; Djuvsland, J. I.; do Vale, M. A. B.; Dobos, D.; Dobre, M.; Doglioni, C.; Dohmae, T.; Dolejsi, J.; Dolezal, Z.; Dolgoshein, B. A.; Donadelli, M.; Donati, S.; Dondero, P.; Donini, J.; Dopke, J.; Doria, A.; Dova, M. T.; Doyle, A. T.; Drechsler, E.; Dris, M.; Du, Y.; Duarte-Campderros, J.; Duchovni, E.; Duckeck, G.; Ducu, O. A.; Duda, D.; Dudarev, A.; Duflot, L.; Duguid, L.; Dührssen, M.; Dunford, M.; Duran Yildiz, H.; Düren, M.; Durglishvili, A.; Duschinger, D.; Dutta, B.; Dyndal, M.; Eckardt, C.; Ecker, K. M.; Edgar, R. C.; Edson, W.; Edwards, N. C.; Eifert, T.; Eigen, G.; Einsweiler, K.; Ekelof, T.; El Kacimi, M.; Ellajosyula, V.; Ellert, M.; Elles, S.; Ellinghaus, F.; Elliot, A. A.; Ellis, N.; Elmsheuser, J.; Elsing, M.; Emeliyanov, D.; Enari, Y.; Endner, O. C.; Endo, M.; Ennis, J. S.; Erdmann, J.; Ereditato, A.; Ernis, G.; Ernst, J.; Ernst, M.; Errede, S.; Ertel, E.; Escalier, M.; Esch, H.; Escobar, C.; Esposito, B.; Etienvre, A. I.; Etzion, E.; Evans, H.; Ezhilov, A.; Fabbri, F.; Fabbri, L.; Facini, G.; Fakhrutdinov, R. M.; Falciano, S.; Falla, R. J.; Faltova, J.; Fang, Y.; Fanti, M.; Farbin, A.; Farilla, A.; Farina, C.; Farooque, T.; Farrell, S.; Farrington, S. M.; Farthouat, P.; Fassi, F.; Fassnacht, P.; Fassouliotis, D.; Faucci Giannelli, M.; Favareto, A.; Fawcett, W. J.; Fayard, L.; Fedin, O. L.; Fedorko, W.; Feigl, S.; Feligioni, L.; Feng, C.; Feng, E. J.; Feng, H.; Fenyuk, A. B.; Feremenga, L.; Fernandez Martinez, P.; Fernandez Perez, S.; Ferrando, J.; Ferrari, A.; Ferrari, P.; Ferrari, R.; Ferreira de Lima, D. E.; Ferrer, A.; Ferrere, D.; Ferretti, C.; Ferretto Parodi, A.; Fiedler, F.; Filipčič, A.; Filipuzzi, M.; Filthaut, F.; Fincke-Keeler, M.; Finelli, K. D.; Fiolhais, M. C. N.; Fiorini, L.; Firan, A.; Fischer, A.; Fischer, C.; Fischer, J.; Fisher, W. C.; Flaschel, N.; Fleck, I.; Fleischmann, P.; Fletcher, G. T.; Fletcher, G.; Fletcher, R. R. M.; Flick, T.; Floderus, A.; Flores Castillo, L. R.; Flowerdew, M. J.; Forcolin, G. T.; Formica, A.; Forti, A.; Foster, A. G.; Fournier, D.; Fox, H.; Fracchia, S.; Francavilla, P.; Franchini, M.; Francis, D.; Franconi, L.; Franklin, M.; Frate, M.; Fraternali, M.; Freeborn, D.; Fressard-Batraneanu, S. M.; Friedrich, F.; Froidevaux, D.; Frost, J. A.; Fukunaga, C.; Fullana Torregrosa, E.; Fusayasu, T.; Fuster, J.; Gabaldon, C.; Gabizon, O.; Gabrielli, A.; Gabrielli, A.; Gach, G. P.; Gadatsch, S.; Gadomski, S.; Gagliardi, G.; Gagnon, L. G.; Gagnon, P.; Galea, C.; Galhardo, B.; Gallas, E. J.; Gallop, B. J.; Gallus, P.; Galster, G.; Gan, K. K.; Gao, J.; Gao, Y.; Gao, Y. S.; Garay Walls, F. M.; García, C.; García Navarro, J. E.; Garcia-Sciveres, M.; Gardner, R. W.; Garelli, N.; Garonne, V.; Gascon Bravo, A.; Gatti, C.; Gaudiello, A.; Gaudio, G.; Gaur, B.; Gauthier, L.; Gavrilenko, I. L.; Gay, C.; Gaycken, G.; Gazis, E. N.; Gecse, Z.; Gee, C. N. P.; Geich-Gimbel, Ch.; Geisler, M. P.; Gemme, C.; Genest, M. H.; Geng, C.; Gentile, S.; George, S.; Gerbaudo, D.; Gershon, A.; Ghasemi, S.; Ghazlane, H.; Ghneimat, M.; Giacobbe, B.; Giagu, S.; Giannetti, P.; Gibbard, B.; Gibson, S. M.; Gignac, M.; Gilchriese, M.; Gillam, T. P. S.; Gillberg, D.; Gilles, G.; Gingrich, D. M.; Giokaris, N.; Giordani, M. P.; Giorgi, F. M.; Giorgi, F. M.; Giraud, P. F.; Giromini, P.; Giugni, D.; Giuli, F.; Giuliani, C.; Giulini, M.; Gjelsten, B. K.; Gkaitatzis, S.; Gkialas, I.; Gkougkousis, E. L.; Gladilin, L. K.; Glasman, C.; Glatzer, J.; Glaysher, P. C. F.; Glazov, A.; Goblirsch-Kolb, M.; Godlewski, J.; Goldfarb, S.; Golling, T.; Golubkov, D.; Gomes, A.; Gonçalo, R.; Goncalves Pinto Firmino Da Costa, J.; Gonella, L.; Gongadze, A.; González de la Hoz, S.; Gonzalez Parra, G.; Gonzalez-Sevilla, S.; Goossens, L.; Gorbounov, P. A.; Gordon, H. A.; Gorelov, I.; Gorini, B.; Gorini, E.; Gorišek, A.; Gornicki, E.; Goshaw, A. T.; Gössling, C.; Gostkin, M. I.; Goudet, C. R.; Goujdami, D.; Goussiou, A. G.; Govender, N.; Gozani, E.; Graber, L.; Grabowska-Bold, I.; Gradin, P. O. J.; Grafström, P.; Gramling, J.; Gramstad, E.; Grancagnolo, S.; Gratchev, V.; Gray, H. M.; Graziani, E.; Greenwood, Z. D.; Grefe, C.; Gregersen, K.; Gregor, I. M.; Grenier, P.; Grevtsov, K.; Griffiths, J.; Grillo, A. A.; Grimm, K.; Grinstein, S.; Gris, Ph.; Grivaz, J. -F.; Groh, S.; Grohs, J. P.; Gross, E.; Grosse-Knetter, J.; Grossi, G. C.; Grout, Z. J.; Guan, L.; Guan, W.; Guenther, J.; Guescini, F.; Guest, D.; Gueta, O.; Guido, E.; Guillemin, T.; Guindon, S.; Gul, U.; Gumpert, C.; Guo, J.; Guo, Y.; Gupta, S.; Gustavino, G.; Gutierrez, P.; Gutierrez Ortiz, N. G.; Gutschow, C.; Guyot, C.; Gwenlan, C.; Gwilliam, C. B.; Haas, A.; Haber, C.; Hadavand, H. K.; Haddad, N.; Hadef, A.; Haefner, P.; Hageböck, S.; Hajduk, Z.; Hakobyan, H.; Haleem, M.; Haley, J.; Hall, D.; Halladjian, G.; Hallewell, G. D.; Hamacher, K.; Hamal, P.; Hamano, K.; Hamilton, A.; Hamity, G. N.; Hamnett, P. G.; Han, L.; Hanagaki, K.; Hanawa, K.; Hance, M.; Haney, B.; Hanke, P.; Hanna, R.; Hansen, J. B.; Hansen, J. D.; Hansen, M. C.; Hansen, P. H.; Hara, K.; Hard, A. S.; Harenberg, T.; Hariri, F.; Harkusha, S.; Harrington, R. D.; Harrison, P. F.; Hartjes, F.; Hasegawa, M.; Hasegawa, Y.; Hasib, A.; Hassani, S.; Haug, S.; Hauser, R.; Hauswald, L.; Havranek, M.; Hawkes, C. M.; Hawkings, R. J.; Hawkins, A. D.; Hayden, D.; Hays, C. P.; Hays, J. M.; Hayward, H. S.; Haywood, S. J.; Head, S. J.; Heck, T.; Hedberg, V.; Heelan, L.; Heim, S.; Heim, T.; Heinemann, B.; Heinrich, J. J.; Heinrich, L.; Heinz, C.; Hejbal, J.; Helary, L.; Hellman, S.; Helsens, C.; Henderson, J.; Henderson, R. C. W.; Heng, Y.; Henkelmann, S.; Henriques Correia, A. M.; Henrot-Versille, S.; Herbert, G. H.; Hernández Jiménez, Y.; Herten, G.; Hertenberger, R.; Hervas, L.; Hesketh, G. G.; Hessey, N. P.; Hetherly, J. W.; Hickling, R.; Higón-Rodriguez, E.; Hill, E.; Hill, J. C.; Hiller, K. H.; Hillier, S. J.; Hinchliffe, I.; Hines, E.; Hinman, R. R.; Hirose, M.; Hirschbuehl, D.; Hobbs, J.; Hod, N.; Hodgkinson, M. C.; Hodgson, P.; Hoecker, A.; Hoeferkamp, M. R.; Hoenig, F.; Hohlfeld, M.; Hohn, D.; Holmes, T. R.; Homann, M.; Hong, T. M.; Hooberman, B. H.; Hopkins, W. H.; Horii, Y.; Horton, A. J.; Hostachy, J-Y.; Hou, S.; Hoummada, A.; Howard, J.; Howarth, J.; Hrabovsky, M.; Hristova, I.; Hrivnac, J.; Hryn’ova, T.; Hrynevich, A.; Hsu, C.; Hsu, P. J.; Hsu, S. -C.; Hu, D.; Hu, Q.; Huang, Y.; Hubacek, Z.; Hubaut, F.; Huegging, F.; Huffman, T. B.; Hughes, E. W.; Hughes, G.; Huhtinen, M.; Hülsing, T. A.; Huseynov, N.; Huston, J.; Huth, J.; Iacobucci, G.; Iakovidis, G.; Ibragimov, I.; Iconomidou-Fayard, L.; Ideal, E.; Idrissi, Z.; Iengo, P.; Igonkina, O.; Iizawa, T.; Ikegami, Y.; Ikeno, M.; Ilchenko, Y.; Iliadis, D.; Ilic, N.; Ince, T.; Introzzi, G.; Ioannou, P.; Iodice, M.; Iordanidou, K.; Ippolito, V.; Irles Quiles, A.; Isaksson, C.; Ishino, M.; Ishitsuka, M.; Ishmukhametov, R.; Issever, C.; Istin, S.; Ito, F.; Iturbe Ponce, J. M.; Iuppa, R.; Ivarsson, J.; Iwanski, W.; Iwasaki, H.; Izen, J. M.; Izzo, V.; Jabbar, S.; Jackson, B.; Jackson, M.; Jackson, P.; Jain, V.; Jakobi, K. B.; Jakobs, K.; Jakobsen, S.; Jakoubek, T.; Jamin, D. O.; Jana, D. K.; Jansen, E.; Jansky, R.; Janssen, J.; Janus, M.; Jarlskog, G.; Javadov, N.; Javůrek, T.; Jeanneau, F.; Jeanty, L.; Jejelava, J.; Jeng, G. -Y.; Jennens, D.; Jenni, P.; Jentzsch, J.; Jeske, C.; Jézéquel, S.; Ji, H.; Jia, J.; Jiang, H.; Jiang, Y.; Jiggins, S.; Jimenez Pena, J.; Jin, S.; Jinaru, A.; Jinnouchi, O.; Johansson, P.; Johns, K. A.; Johnson, W. J.; Jon-And, K.; Jones, G.; Jones, R. W. L.; Jones, S.; Jones, T. J.; Jongmanns, J.; Jorge, P. M.; Jovicevic, J.; Ju, X.; Juste Rozas, A.; Köhler, M. K.; Kaczmarska, A.; Kado, M.; Kagan, H.; Kagan, M.; Kahn, S. J.; Kajomovitz, E.; Kalderon, C. W.; Kaluza, A.; Kama, S.; Kamenshchikov, A.; Kanaya, N.; Kaneti, S.; Kanjir, L.; Kantserov, V. A.; Kanzaki, J.; Kaplan, B.; Kaplan, L. S.; Kapliy, A.; Kar, D.; Karakostas, K.; Karamaoun, A.; Karastathis, N.; Kareem, M. J.; Karentzos, E.; Karnevskiy, M.; Karpov, S. N.; Karpova, Z. M.; Karthik, K.; Kartvelishvili, V.; Karyukhin, A. N.; Kasahara, K.; Kashif, L.; Kass, R. D.; Kastanas, A.; Kataoka, Y.; Kato, C.; Katre, A.; Katzy, J.; Kawagoe, K.; Kawamoto, T.; Kawamura, G.; Kazama, S.; Kazanin, V. F.; Keeler, R.; Kehoe, R.; Keller, J. S.; Kempster, J. J.; Kentaro, K.; Keoshkerian, H.; Kepka, O.; Kerševan, B. P.; Kersten, S.; Keyes, R. A.; Khalil-zada, F.; Khandanyan, H.; Khanov, A.; Kharlamov, A. G.; Khoo, T. J.; Khovanskiy, V.; Khramov, E.; Khubua, J.; Kido, S.; Kim, H. Y.; Kim, S. H.; Kim, Y. K.; Kimura, N.; Kind, O. M.; King, B. T.; King, M.; King, S. B.; Kirk, J.; Kiryunin, A. E.; Kishimoto, T.; Kisielewska, D.; Kiss, F.; Kiuchi, K.; Kivernyk, O.; Kladiva, E.; Klein, M. H.; Klein, M.; Klein, U.; Kleinknecht, K.; Klimek, P.; Klimentov, A.; Klingenberg, R.; Klinger, J. A.; Klioutchnikova, T.; Kluge, E. -E.; Kluit, P.; Kluth, S.; Knapik, J.; Kneringer, E.; Knoops, E. B. F. G.; Knue, A.; Kobayashi, A.; Kobayashi, D.; Kobayashi, T.; Kobel, M.; Kocian, M.; Kodys, P.; Koffas, T.; Koffeman, E.; Kogan, L. A.; Koi, T.; Kolanoski, H.; Kolb, M.; Koletsou, I.; Komar, A. A.; Komori, Y.; Kondo, T.; Kondrashova, N.; Köneke, K.; König, A. C.; Kono, T.; Konoplich, R.; Konstantinidis, N.; Kopeliansky, R.; Koperny, S.; Köpke, L.; Kopp, A. K.; Korcyl, K.; Kordas, K.; Korn, A.; Korol, A. A.; Korolkov, I.; Korolkova, E. V.; Kortner, O.; Kortner, S.; Kosek, T.; Kostyukhin, V. V.; Kotwal, A.; Kourkoumeli-Charalampidi, A.; Kourkoumelis, C.; Kouskoura, V.; Koutsman, A.; Kowalewska, A. B.; Kowalewski, R.; Kowalski, T. Z.; Kozanecki, W.; Kozhin, A. S.; Kramarenko, V. A.; Kramberger, G.; Krasnopevtsev, D.; Krasny, M. W.; Krasznahorkay, A.; Kraus, J. K.; Kravchenko, A.; Kretz, M.; Kretzschmar, J.; Kreutzfeldt, K.; Krieger, P.; Krizka, K.; Kroeninger, K.; Kroha, H.; Kroll, J.; Kroseberg, J.; Krstic, J.; Kruchonak, U.; Krüger, H.; Krumnack, N.; Kruse, A.; Kruse, M. C.; Kruskal, M.; Kubota, T.; Kucuk, H.; Kuday, S.; Kuechler, J. T.; Kuehn, S.; Kugel, A.; Kuger, F.; Kuhl, A.; Kuhl, T.; Kukhtin, V.; Kukla, R.; Kulchitsky, Y.; Kuleshov, S.; Kuna, M.; Kunigo, T.; Kupco, A.; Kurashige, H.; Kurochkin, Y. A.; Kus, V.; Kuwertz, E. S.; Kuze, M.; Kvita, J.; Kwan, T.; Kyriazopoulos, D.; La Rosa, A.; La Rosa Navarro, J. L.; La Rotonda, L.; Lacasta, C.; Lacava, F.; Lacey, J.; Lacker, H.; Lacour, D.; Lacuesta, V. R.; Ladygin, E.; Lafaye, R.; Laforge, B.; Lagouri, T.; Lai, S.; Lammers, S.; Lampl, W.; Lançon, E.; Landgraf, U.; Landon, M. P. J.; Lang, V. S.; Lange, J. C.; Lankford, A. J.; Lanni, F.; Lantzsch, K.; Lanza, A.; Laplace, S.; Lapoire, C.; Laporte, J. F.; Lari, T.; Lasagni Manghi, F.; Lassnig, M.; Laurelli, P.; Lavrijsen, W.; Law, A. T.; Laycock, P.; Lazovich, T.; Lazzaroni, M.; Le Dortz, O.; Le Guirriec, E.; Le Menedeu, E.; Le Quilleuc, E. P.; LeBlanc, M.; LeCompte, T.; Ledroit-Guillon, F.; Lee, C. A.; Lee, S. C.; Lee, L.; Lefebvre, G.; Lefebvre, M.; Legger, F.; Leggett, C.; Lehan, A.; Lehmann Miotto, G.; Lei, X.; Leight, W. A.; Leisos, A.; Leister, A. G.; Leite, M. A. L.; Leitner, R.; Lellouch, D.; Lemmer, B.; Leney, K. J. C.; Lenz, T.; Lenzi, B.; Leone, R.; Leone, S.; Leonidopoulos, C.; Leontsinis, S.; Lerner, G.; Leroy, C.; Lesage, A. A. J.; Lester, C. G.; Levchenko, M.; Levêque, J.; Levin, D.; Levinson, L. J.; Levy, M.; Leyko, A. M.; Leyton, M.; Li, B.; Li, H.; Li, H. L.; Li, L.; Li, L.; Li, Q.; Li, S.; Li, X.; Li, Y.; Liang, Z.; Liao, H.; Liberti, B.; Liblong, A.; Lichard, P.; Lie, K.; Liebal, J.; Liebig, W.; Limbach, C.; Limosani, A.; Lin, S. C.; Lin, T. H.; Lindquist, B. E.; Lipeles, E.; Lipniacka, A.; Lisovyi, M.; Liss, T. M.; Lissauer, D.; Lister, A.; Litke, A. M.; Liu, B.; Liu, D.; Liu, H.; Liu, H.; Liu, J.; Liu, J. B.; Liu, K.; Liu, L.; Liu, M.; Liu, M.; Liu, Y. L.; Liu, Y.; Livan, M.; Lleres, A.; Llorente Merino, J.; Lloyd, S. L.; Lo Sterzo, F.; Lobodzinska, E.; Loch, P.; Lockman, W. S.; Loebinger, F. K.; Loevschall-Jensen, A. E.; Loew, K. M.; Loginov, A.; Lohse, T.; Lohwasser, K.; Lokajicek, M.; Long, B. A.; Long, J. D.; Long, R. E.; Longo, L.; Looper, K. A.; Lopes, L.; Lopez Mateos, D.; Lopez Paredes, B.; Lopez Paz, I.; Lopez Solis, A.; Lorenz, J.; Lorenzo Martinez, N.; Losada, M.; Lösel, P. J.; Lou, X.; Lounis, A.; Love, J.; Love, P. A.; Lu, H.; Lu, N.; Lubatti, H. J.; Luci, C.; Lucotte, A.; Luedtke, C.; Luehring, F.; Lukas, W.; Luminari, L.; Lundberg, O.; Lund-Jensen, B.; Lynn, D.; Lysak, R.; Lytken, E.; Lyubushkin, V.; Ma, H.; Ma, L. L.; Ma, Y.; Maccarrone, G.; Macchiolo, A.; Macdonald, C. M.; Maček, B.; Machado Miguens, J.; Madaffari, D.; Madar, R.; Maddocks, H. J.; Mader, W. F.; Madsen, A.; Maeda, J.; Maeland, S.; Maeno, T.; Maevskiy, A.; Magradze, E.; Mahlstedt, J.; Maiani, C.; Maidantchik, C.; Maier, A. A.; Maier, T.; Maio, A.; Majewski, S.; Makida, Y.; Makovec, N.; Malaescu, B.; Malecki, Pa.; Maleev, V. P.; Malek, F.; Mallik, U.; Malon, D.; Malone, C.; Maltezos, S.; Malyukov, S.; Mamuzic, J.; Mancini, G.; Mandelli, B.; Mandelli, L.; Mandić, I.; Maneira, J.; Manhaes de Andrade Filho, L.; Manjarres Ramos, J.; Mann, A.; Mansoulie, B.; Mantifel, R.; Mantoani, M.; Manzoni, S.; Mapelli, L.; Marceca, G.; March, L.; Marchiori, G.; Marcisovsky, M.; Marjanovic, M.; Marley, D. E.; Marroquim, F.; Marsden, S. P.; Marshall, Z.; Marti, L. F.; Marti-Garcia, S.; Martin, B.; Martin, T. A.; Martin, V. J.; Martin dit Latour, B.; Martinez, M.; Martin-Haugh, S.; Martoiu, V. S.; Martyniuk, A. C.; Marx, M.; Marzano, F.; Marzin, A.; Masetti, L.; Mashimo, T.; Mashinistov, R.; Masik, J.; Maslennikov, A. L.; Massa, I.; Massa, L.; Mastrandrea, P.; Mastroberardino, A.; Masubuchi, T.; Mättig, P.; Mattmann, J.; Maurer, J.; Maxfield, S. J.; Maximov, D. A.; Mazini, R.; Mazza, S. M.; Mc Fadden, N. C.; Mc Goldrick, G.; Mc Kee, S. P.; McCarn, A.; McCarthy, R. L.; McCarthy, T. G.; McClymont, L. I.; McFarlane, K. W.; Mcfayden, J. A.; Mchedlidze, G.; McMahon, S. J.; McPherson, R. A.; Medinnis, M.; Meehan, S.; Mehlhase, S.; Mehta, A.; Meier, K.; Meineck, C.; Meirose, B.; Mellado Garcia, B. R.; Meloni, F.; Mengarelli, A.; Menke, S.; Meoni, E.; Mercurio, K. M.; Mergelmeyer, S.; Mermod, P.; Merola, L.; Meroni, C.; Merritt, F. S.; Messina, A.; Metcalfe, J.; Mete, A. S.; Meyer, C.; Meyer, C.; Meyer, J-P.; Meyer, J.; Meyer Zu Theenhausen, H.; Middleton, R. P.; Miglioranzi, S.; Mijović, L.; Mikenberg, G.; Mikestikova, M.; Mikuž, M.; Milesi, M.; Milic, A.; Miller, D. W.; Mills, C.; Milov, A.; Milstead, D. A.; Minaenko, A. A.; Minami, Y.; Minashvili, I. A.; Mincer, A. I.; Mindur, B.; Mineev, M.; Ming, Y.; Mir, L. M.; Mistry, K. P.; Mitani, T.; Mitrevski, J.; Mitsou, V. A.; Miucci, A.; Miyagawa, P. S.; Mjörnmark, J. U.; Moa, T.; Mochizuki, K.; Mohapatra, S.; Mohr, W.; Molander, S.; Moles-Valls, R.; Monden, R.; Mondragon, M. C.; Mönig, K.; Monk, J.; Monnier, E.; Montalbano, A.; Montejo Berlingen, J.; Monticelli, F.; Monzani, S.; Moore, R. W.; Morange, N.; Moreno, D.; Moreno Llácer, M.; Morettini, P.; Mori, D.; Mori, T.; Morii, M.; Morinaga, M.; Morisbak, V.; Moritz, S.; Morley, A. K.; Mornacchi, G.; Morris, J. D.; Mortensen, S. S.; Morvaj, L.; Mosidze, M.; Moss, J.; Motohashi, K.; Mount, R.; Mountricha, E.; Mouraviev, S. V.; Moyse, E. J. W.; Muanza, S.; Mudd, R. D.; Mueller, F.; Mueller, J.; Mueller, R. S. P.; Mueller, T.; Muenstermann, D.; Mullen, P.; Mullier, G. A.; Munoz Sanchez, F. J.; Murillo Quijada, J. A.; Murray, W. J.; Musheghyan, H.; Muškinja, M.; Myagkov, A. G.; Myska, M.; Nachman, B. P.; Nackenhorst, O.; Nadal, J.; Nagai, K.; Nagai, R.; Nagano, K.; Nagasaka, Y.; Nagata, K.; Nagel, M.; Nagy, E.; Nairz, A. M.; Nakahama, Y.; Nakamura, K.; Nakamura, T.; Nakano, I.; Namasivayam, H.; Naranjo Garcia, R. F.; Narayan, R.; Narrias Villar, D. I.; Naryshkin, I.; Naumann, T.; Navarro, G.; Nayyar, R.; Neal, H. A.; Nechaeva, P. Yu.; Neep, T. J.; Nef, P. D.; Negri, A.; Negrini, M.; Nektarijevic, S.; Nellist, C.; Nelson, A.; Nemecek, S.; Nemethy, P.; Nepomuceno, A. A.; Nessi, M.; Neubauer, M. S.; Neumann, M.; Neves, R. M.; Nevski, P.; Newman, P. R.; Nguyen, D. H.; Nickerson, R. B.; Nicolaidou, R.; Nicquevert, B.; Nielsen, J.; Nikiforov, A.; Nikolaenko, V.; Nikolic-Audit, I.; Nikolopoulos, K.; Nilsen, J. K.; Nilsson, P.; Ninomiya, Y.; Nisati, A.; Nisius, R.; Nobe, T.; Nodulman, L.; Nomachi, M.; Nomidis, I.; Nooney, T.; Norberg, S.; Nordberg, M.; Norjoharuddeen, N.; Novgorodova, O.; Nowak, S.; Nozaki, M.; Nozka, L.; Ntekas, K.; Nurse, E.; Nuti, F.; O’grady, F.; O’Neil, D. C.; O’Rourke, A. A.; O’Shea, V.; Oakham, F. G.; Oberlack, H.; Obermann, T.; Ocariz, J.; Ochi, A.; Ochoa, I.; Ochoa-Ricoux, J. P.; Oda, S.; Odaka, S.; Ogren, H.; Oh, A.; Oh, S. H.; Ohm, C. C.; Ohman, H.; Oide, H.; Okawa, H.; Okumura, Y.; Okuyama, T.; Olariu, A.; Oleiro Seabra, L. F.; Olivares Pino, S. A.; Oliveira Damazio, D.; Olszewski, A.; Olszowska, J.; Onofre, A.; Onogi, K.; Onyisi, P. U. E.; Oram, C. J.; Oreglia, M. J.; Oren, Y.; Orestano, D.; Orlando, N.; Orr, R. S.; Osculati, B.; Ospanov, R.; Otero y Garzon, G.; Otono, H.; Ouchrif, M.; Ould-Saada, F.; Ouraou, A.; Oussoren, K. P.; Ouyang, Q.; Owen, M.; Owen, R. E.; Ozcan, V. E.; Ozturk, N.; Pachal, K.; Pacheco Pages, A.; Padilla Aranda, C.; Pagáčová, M.; Pagan Griso, S.; Paige, F.; Pais, P.; Pajchel, K.; Palacino, G.; Palestini, S.; Palka, M.; Pallin, D.; Palma, A.; Panagiotopoulou, E. St.; Pandini, C. E.; Panduro Vazquez, J. G.; Pani, P.; Panitkin, S.; Pantea, D.; Paolozzi, L.; Papadopoulou, Th. D.; Papageorgiou, K.; Paramonov, A.; Paredes Hernandez, D.; Parker, A. J.; Parker, M. A.; Parker, K. A.; Parodi, F.; Parsons, J. A.; Parzefall, U.; Pascuzzi, V. R.; Pasqualucci, E.; Passaggio, S.; Pastore, F.; Pastore, Fr.; Pásztor, G.; Pataraia, S.; Patel, N. D.; Pater, J. R.; Pauly, T.; Pearce, J.; Pearson, B.; Pedersen, L. E.; Pedersen, M.; Pedraza Lopez, S.; Pedro, R.; Peleganchuk, S. V.; Pelikan, D.; Penc, O.; Peng, C.; Peng, H.; Penwell, J.; Peralva, B. S.; Perego, M. M.; Perepelitsa, D. V.; Perez Codina, E.; Perini, L.; Pernegger, H.; Perrella, S.; Peschke, R.; Peshekhonov, V. D.; Peters, K.; Peters, R. F. Y.; Petersen, B. A.; Petersen, T. C.; Petit, E.; Petridis, A.; Petridou, C.; Petroff, P.; Petrolo, E.; Petrov, M.; Petrucci, F.; Pettersson, N. E.; Peyaud, A.; Pezoa, R.; Phillips, P. W.; Piacquadio, G.; Pianori, E.; Picazio, A.; Piccaro, E.; Piccinini, M.; Pickering, M. A.; Piegaia, R.; Pilcher, J. E.; Pilkington, A. D.; Pin, A. W. J.; Pina, J.; Pinamonti, M.; Pinfold, J. L.; Pingel, A.; Pires, S.; Pirumov, H.; Pitt, M.; Plazak, L.; Pleier, M. -A.; Pleskot, V.; Plotnikova, E.; Plucinski, P.; Pluth, D.; Poettgen, R.; Poggioli, L.; Pohl, D.; Polesello, G.; Poley, A.; Policicchio, A.; Polifka, R.; Polini, A.; Pollard, C. S.; Polychronakos, V.; Pommès, K.; Pontecorvo, L.; Pope, B. G.; Popeneciu, G. A.; Popovic, D. S.; Poppleton, A.; Pospisil, S.; Potamianos, K.; Potrap, I. N.; Potter, C. J.; Potter, C. T.; Poulard, G.; Poveda, J.; Pozdnyakov, V.; Pozo Astigarraga, M. E.; Pralavorio, P.; Pranko, A.; Prell, S.; Price, D.; Price, L. E.; Primavera, M.; Prince, S.; Proissl, M.; Prokofiev, K.; Prokoshin, F.; Protopopescu, S.; Proudfoot, J.; Przybycien, M.; Puddu, D.; Puldon, D.; Purohit, M.; Puzo, P.; Qian, J.; Qin, G.; Qin, Y.; Quadt, A.; Quayle, W. B.; Queitsch-Maitland, M.; Quilty, D.; Raddum, S.; Radeka, V.; Radescu, V.; Radhakrishnan, S. K.; Radloff, P.; Rados, P.; Ragusa, F.; Rahal, G.; Raine, J. A.; Rajagopalan, S.; Rammensee, M.; Rangel-Smith, C.; Ratti, M. G.; Rauscher, F.; Rave, S.; Ravenscroft, T.; Raymond, M.; Read, A. L.; Readioff, N. P.; Rebuzzi, D. M.; Redelbach, A.; Redlinger, G.; Reece, R.; Reeves, K.; Rehnisch, L.; Reichert, J.; Reisin, H.; Rembser, C.; Ren, H.; Rescigno, M.; Resconi, S.; Rezanova, O. L.; Reznicek, P.; Rezvani, R.; Richter, R.; Richter, S.; Richter-Was, E.; Ricken, O.; Ridel, M.; Rieck, P.; Riegel, C. J.; Rieger, J.; Rifki, O.; Rijssenbeek, M.; Rimoldi, A.; Rinaldi, L.; Ristić, B.; Ritsch, E.; Riu, I.; Rizatdinova, F.; Rizvi, E.; Rizzi, C.; Robertson, S. H.; Robichaud-Veronneau, A.; Robinson, D.; Robinson, J. E. M.; Robson, A.; Roda, C.; Rodina, Y.; Rodriguez Perez, A.; Rodriguez Rodriguez, D.; Roe, S.; Rogan, C. S.; Røhne, O.; Romaniouk, A.; Romano, M.; Romano Saez, S. M.; Romero Adam, E.; Rompotis, N.; Ronzani, M.; Roos, L.; Ros, E.; Rosati, S.; Rosbach, K.; Rose, P.; Rosenthal, O.; Rossetti, V.; Rossi, E.; Rossi, L. P.; Rosten, J. H. N.; Rosten, R.; Rotaru, M.; Roth, I.; Rothberg, J.; Rousseau, D.; Royon, C. R.; Rozanov, A.; Rozen, Y.; Ruan, X.; Rubbo, F.; Rubinskiy, I.; Rud, V. I.; Rudolph, M. S.; Rühr, F.; Ruiz-Martinez, A.; Rurikova, Z.; Rusakovich, N. A.; Ruschke, A.; Russell, H. L.; Rutherfoord, J. P.; Ruthmann, N.; Ryabov, Y. F.; Rybar, M.; Rybkin, G.; Ryu, S.; Ryzhov, A.; Saavedra, A. F.; Sabato, G.; Sacerdoti, S.; Sadrozinski, H. F-W.; Sadykov, R.; Safai Tehrani, F.; Saha, P.; Sahinsoy, M.; Saimpert, M.; Saito, T.; Sakamoto, H.; Sakurai, Y.; Salamanna, G.; Salamon, A.; Salazar Loyola, J. E.; Salek, D.; Sales De Bruin, P. H.; Salihagic, D.; Salnikov, A.; Salt, J.; Salvatore, D.; Salvatore, F.; Salvucci, A.; Salzburger, A.; Sammel, D.; Sampsonidis, D.; Sanchez, A.; Sánchez, J.; Sanchez Martinez, V.; Sandaker, H.; Sandbach, R. L.; Sander, H. G.; Sanders, M. P.; Sandhoff, M.; Sandoval, C.; Sandstroem, R.; Sankey, D. P. C.; Sannino, M.; Sansoni, A.; Santoni, C.; Santonico, R.; Santos, H.; Santoyo Castillo, I.; Sapp, K.; Sapronov, A.; Saraiva, J. G.; Sarrazin, B.; Sasaki, O.; Sasaki, Y.; Sato, K.; Sauvage, G.; Sauvan, E.; Savage, G.; Savard, P.; Sawyer, C.; Sawyer, L.; Saxon, J.; Sbarra, C.; Sbrizzi, A.; Scanlon, T.; Scannicchio, D. A.; Scarcella, M.; Scarfone, V.; Schaarschmidt, J.; Schacht, P.; Schaefer, D.; Schaefer, R.; Schaeffer, J.; Schaepe, S.; Schaetzel, S.; Schäfer, U.; Schaffer, A. C.; Schaile, D.; Schamberger, R. D.; Scharf, V.; Schegelsky, V. A.; Scheirich, D.; Schernau, M.; Schiavi, C.; Schillo, C.; Schioppa, M.; Schlenker, S.; Schmieden, K.; Schmitt, C.; Schmitt, S.; Schmitz, S.; Schneider, B.; Schnellbach, Y. J.; Schnoor, U.; Schoeffel, L.; Schoening, A.; Schoenrock, B. D.; Schopf, E.; Schorlemmer, A. L. S.; Schott, M.; Schovancova, J.; Schramm, S.; Schreyer, M.; Schuh, N.; Schultens, M. J.; Schultz-Coulon, H. -C.; Schulz, H.; Schumacher, M.; Schumm, B. A.; Schune, Ph.; Schwanenberger, C.; Schwartzman, A.; Schwarz, T. A.; Schwegler, Ph.; Schweiger, H.; Schwemling, Ph.; Schwienhorst, R.; Schwindling, J.; Schwindt, T.; Sciolla, G.; Scuri, F.; Scutti, F.; Searcy, J.; Seema, P.; Seidel, S. C.; Seiden, A.; Seifert, F.; Seixas, J. M.; Sekhniaidze, G.; Sekhon, K.; Sekula, S. J.; Seliverstov, D. M.; Semprini-Cesari, N.; Serfon, C.; Serin, L.; Serkin, L.; Sessa, M.; Seuster, R.; Severini, H.; Sfiligoj, T.; Sforza, F.; Sfyrla, A.; Shabalina, E.; Shaikh, N. W.; Shan, L. Y.; Shang, R.; Shank, J. T.; Shapiro, M.; Shatalov, P. B.; Shaw, K.; Shaw, S. M.; Shcherbakova, A.; Shehu, C. Y.; Sherwood, P.; Shi, L.; Shimizu, S.; Shimmin, C. O.; Shimojima, M.; Shiyakova, M.; Shmeleva, A.; Shoaleh Saadi, D.; Shochet, M. J.; Shojaii, S.; Shrestha, S.; Shulga, E.; Shupe, M. A.; Sicho, P.; Sidebo, P. E.; Sidiropoulou, O.; Sidorov, D.; Sidoti, A.; Siegert, F.; Sijacki, Dj.; Silva, J.; Silverstein, S. B.; Simak, V.; Simard, O.; Simic, Lj.; Simion, S.; Simioni, E.; Simmons, B.; Simon, D.; Simon, M.; Sinervo, P.; Sinev, N. B.; Sioli, M.; Siragusa, G.; Sivoklokov, S. Yu.; Sjölin, J.; Sjursen, T. B.; Skinner, M. B.; Skottowe, H. P.; Skubic, P.; Slater, M.; Slavicek, T.; Slawinska, M.; Sliwa, K.; Slovak, R.; Smakhtin, V.; Smart, B. H.; Smestad, L.; Smirnov, S. Yu.; Smirnov, Y.; Smirnova, L. N.; Smirnova, O.; Smith, M. N. K.; Smith, R. W.; Smizanska, M.; Smolek, K.; Snesarev, A. A.; Snidero, G.; Snyder, S.; Sobie, R.; Socher, F.; Soffer, A.; Soh, D. A.; Sokhrannyi, G.; Solans Sanchez, C. A.; Solar, M.; Soldatov, E. Yu.; Soldevila, U.; Solodkov, A. A.; Soloshenko, A.; Solovyanov, O. V.; Solovyev, V.; Sommer, P.; Son, H.; Song, H. Y.; Sood, A.; Sopczak, A.; Sopko, V.; Sorin, V.; Sosa, D.; Sotiropoulou, C. L.; Soualah, R.; Soukharev, A. M.; South, D.; Sowden, B. C.; Spagnolo, S.; Spalla, M.; Spangenberg, M.; Spanò, F.; Sperlich, D.; Spettel, F.; Spighi, R.; Spigo, G.; Spiller, L. A.; Spousta, M.; St. Denis, R. D.; Stabile, A.; Stahlman, J.; Stamen, R.; Stamm, S.; Stanecka, E.; Stanek, R. W.; Stanescu, C.; Stanescu-Bellu, M.; Stanitzki, M. M.; Stapnes, S.; Starchenko, E. A.; Stark, G. H.; Stark, J.; Staroba, P.; Starovoitov, P.; Stärz, S.; Staszewski, R.; Steinberg, P.; Stelzer, B.; Stelzer, H. J.; Stelzer-Chilton, O.; Stenzel, H.; Stewart, G. A.; Stillings, J. A.; Stockton, M. C.; Stoebe, M.; Stoicea, G.; Stolte, P.; Stonjek, S.; Stradling, A. R.; Straessner, A.; Stramaglia, M. E.; Strandberg, J.; Strandberg, S.; Strandlie, A.; Strauss, M.; Strizenec, P.; Ströhmer, R.; Strom, D. M.; Stroynowski, R.; Strubig, A.; Stucci, S. A.; Stugu, B.; Styles, N. A.; Su, D.; Su, J.; Subramaniam, R.; Suchek, S.; Sugaya, Y.; Suk, M.; Sulin, V. V.; Sultansoy, S.; Sumida, T.; Sun, S.; Sun, X.; Sundermann, J. E.; Suruliz, K.; Susinno, G.; Sutton, M. R.; Suzuki, S.; Svatos, M.; Swiatlowski, M.; Sykora, I.; Sykora, T.; Ta, D.; Taccini, C.; Tackmann, K.; Taenzer, J.; Taffard, A.; Tafirout, R.; Taiblum, N.; Takai, H.; Takashima, R.; Takeda, H.; Takeshita, T.; Takubo, Y.; Talby, M.; Talyshev, A. A.; Tam, J. Y. C.; Tan, K. G.; Tanaka, J.; Tanaka, R.; Tanaka, S.; Tannenwald, B. B.; Tapia Araya, S.; Tapprogge, S.; Tarem, S.; Tartarelli, G. F.; Tas, P.; Tasevsky, M.; Tashiro, T.; Tassi, E.; Tavares Delgado, A.; Tayalati, Y.; Taylor, A. C.; Taylor, G. N.; Taylor, P. T. E.; Taylor, W.; Teischinger, F. A.; Teixeira-Dias, P.; Temming, K. K.; Temple, D.; Ten Kate, H.; Teng, P. K.; Teoh, J. J.; Tepel, F.; Terada, S.; Terashi, K.; Terron, J.; Terzo, S.; Testa, M.; Teuscher, R. J.; Theveneaux-Pelzer, T.; Thomas, J. P.; Thomas-Wilsker, J.; Thompson, E. N.; Thompson, P. D.; Thompson, R. J.; Thompson, A. S.; Thomsen, L. A.; Thomson, E.; Thomson, M.; Tibbetts, M. J.; Ticse Torres, R. E.; Tikhomirov, V. O.; Tikhonov, Yu. A.; Timoshenko, S.; Tipton, P.; Tisserant, S.; Todome, K.; Todorov, T.; Todorova-Nova, S.; Tojo, J.; Tokár, S.; Tokushuku, K.; Tolley, E.; Tomlinson, L.; Tomoto, M.; Tompkins, L.; Toms, K.; Tong, B.; Torrence, E.; Torres, H.; Torró Pastor, E.; Toth, J.; Touchard, F.; Tovey, D. R.; Trefzger, T.; Tricoli, A.; Trigger, I. M.; Trincaz-Duvoid, S.; Tripiana, M. F.; Trischuk, W.; Trocmé, B.; Trofymov, A.; Troncon, C.; Trottier-McDonald, M.; Trovatelli, M.; Truong, L.; Trzebinski, M.; Trzupek, A.; Tseng, J. C-L.; Tsiareshka, P. V.; Tsipolitis, G.; Tsirintanis, N.; Tsiskaridze, S.; Tsiskaridze, V.; Tskhadadze, E. G.; Tsui, K. M.; Tsukerman, I. I.; Tsulaia, V.; Tsuno, S.; Tsybychev, D.; Tudorache, A.; Tudorache, V.; Tuna, A. N.; Tupputi, S. A.; Turchikhin, S.; Turecek, D.; Turgeman, D.; Turra, R.; Turvey, A. J.; Tuts, P. M.; Tyndel, M.; Ucchielli, G.; Ueda, I.; Ueno, R.; Ughetto, M.; Ukegawa, F.; Unal, G.; Undrus, A.; Unel, G.; Ungaro, F. C.; Unno, Y.; Unverdorben, C.; Urban, J.; Urquijo, P.; Urrejola, P.; Usai, G.; Usanova, A.; Vacavant, L.; Vacek, V.; Vachon, B.; Valderanis, C.; Valdes Santurio, E.; Valencic, N.; Valentinetti, S.; Valero, A.; Valery, L.; Valkar, S.; Vallecorsa, S.; Valls Ferrer, J. A.; Van Den Wollenberg, W.; Van Der Deijl, P. C.; van der Geer, R.; van der Graaf, H.; van Eldik, N.; van Gemmeren, P.; Van Nieuwkoop, J.; van Vulpen, I.; van Woerden, M. C.; Vanadia, M.; Vandelli, W.; Vanguri, R.; Vaniachine, A.; Vankov, P.; Vardanyan, G.; Vari, R.; Varnes, E. W.; Varol, T.; Varouchas, D.; Vartapetian, A.; Varvell, K. E.; Vasquez, J. G.; Vazeille, F.; Vazquez Schroeder, T.; Veatch, J.; Veloce, L. M.; Veloso, F.; Veneziano, S.; Ventura, A.; Venturi, M.; Venturi, N.; Venturini, A.; Vercesi, V.; Verducci, M.; Verkerke, W.; Vermeulen, J. C.; Vest, A.; Vetterli, M. C.; Viazlo, O.; Vichou, I.; Vickey, T.; Vickey Boeriu, O. E.; Viehhauser, G. H. A.; Viel, S.; Vigani, L.; Vigne, R.; Villa, M.; Villaplana Perez, M.; Vilucchi, E.; Vincter, M. G.; Vinogradov, V. B.; Vittori, C.; Vivarelli, I.; Vlachos, S.; Vlasak, M.; Vogel, M.; Vokac, P.; Volpi, G.; Volpi, M.; von der Schmitt, H.; von Toerne, E.; Vorobel, V.; Vorobev, K.; Vos, M.; Voss, R.; Vossebeld, J. H.; Vranjes, N.; Vranjes Milosavljevic, M.; Vrba, V.; Vreeswijk, M.; Vuillermet, R.; Vukotic, I.; Vykydal, Z.; Wagner, P.; Wagner, W.; Wahlberg, H.; Wahrmund, S.; Wakabayashi, J.; Walder, J.; Walker, R.; Walkowiak, W.; Wallangen, V.; Wang, C.; Wang, C.; Wang, F.; Wang, H.; Wang, H.; Wang, J.; Wang, J.; Wang, K.; Wang, R.; Wang, S. M.; Wang, T.; Wang, T.; Wang, X.; Wanotayaroj, C.; Warburton, A.; Ward, C. P.; Wardrope, D. R.; Washbrook, A.; Watkins, P. M.; Watson, A. T.; Watson, I. J.; Watson, M. F.; Watts, G.; Watts, S.; Waugh, B. M.; Webb, S.; Weber, M. S.; Weber, S. W.; Webster, J. S.; Weidberg, A. R.; Weinert, B.; Weingarten, J.; Weiser, C.; Weits, H.; Wells, P. S.; Wenaus, T.; Wengler, T.; Wenig, S.; Wermes, N.; Werner, M.; Werner, P.; Wessels, M.; Wetter, J.; Whalen, K.; Whallon, N. L.; Wharton, A. M.; White, A.; White, M. J.; White, R.; White, S.; Whiteson, D.; Wickens, F. J.; Wiedenmann, W.; Wielers, M.; Wienemann, P.; Wiglesworth, C.; Wiik-Fuchs, L. A. M.; Wildauer, A.; Wilk, F.; Wilkens, H. G.; Williams, H. H.; Williams, S.; Willis, C.; Willocq, S.; Wilson, J. A.; Wingerter-Seez, I.; Winklmeier, F.; Winston, O. J.; Winter, B. T.; Wittgen, M.; Wittkowski, J.; Wollstadt, S. J.; Wolter, M. W.; Wolters, H.; Wosiek, B. K.; Wotschack, J.; Woudstra, M. J.; Wozniak, K. W.; Wu, M.; Wu, M.; Wu, S. L.; Wu, X.; Wu, Y.; Wyatt, T. R.; Wynne, B. M.; Xella, S.; Xu, D.; Xu, L.; Yabsley, B.; Yacoob, S.; Yakabe, R.; Yamaguchi, D.; Yamaguchi, Y.; Yamamoto, A.; Yamamoto, S.; Yamanaka, T.; Yamauchi, K.; Yamazaki, Y.; Yan, Z.; Yang, H.; Yang, H.; Yang, Y.; Yang, Z.; Yao, W-M.; Yap, Y. C.; Yasu, Y.; Yatsenko, E.; Yau Wong, K. H.; Ye, J.; Ye, S.; Yeletskikh, I.; Yen, A. L.; Yildirim, E.; Yorita, K.; Yoshida, R.; Yoshihara, K.; Young, C.; Young, C. J. S.; Youssef, S.; Yu, D. R.; Yu, J.; Yu, J. M.; Yu, J.; Yuan, L.; Yuen, S. P. Y.; Yusuff, I.; Zabinski, B.; Zaidan, R.; Zaitsev, A. M.; Zakharchuk, N.; Zalieckas, J.; Zaman, A.; Zambito, S.; Zanello, L.; Zanzi, D.; Zeitnitz, C.; Zeman, M.; Zemla, A.; Zeng, J. C.; Zeng, Q.; Zengel, K.; Zenin, O.; Ženiš, T.; Zerwas, D.; Zhang, D.; Zhang, F.; Zhang, G.; Zhang, H.; Zhang, J.; Zhang, L.; Zhang, R.; Zhang, R.; Zhang, X.; Zhang, Z.; Zhao, X.; Zhao, Y.; Zhao, Z.; Zhemchugov, A.; Zhong, J.; Zhou, B.; Zhou, C.; Zhou, L.; Zhou, L.; Zhou, M.; Zhou, N.; Zhu, C. G.; Zhu, H.; Zhu, J.; Zhu, Y.; Zhuang, X.; Zhukov, K.; Zibell, A.; Zieminska, D.; Zimine, N. I.; Zimmermann, C.; Zimmermann, S.; Zinonos, Z.; Zinser, M.; Ziolkowski, M.; Živković, L.; Zobernig, G.; Zoccoli, A.; zur Nedden, M.; Zurzolo, G.; Zwalinski, L.

    2016-08-22

    We presented measurements of the top-antitop quark pair production charge asymmetry in the dilepton channel, characterized by two high- pT leptons (electrons or muons), using data corresponding to an integrated luminosity of 20.3 fb$-$1 from pp collisions at a center-of-mass energy $\\sqrt{s}$ = 8 TeV collected with the ATLAS detector at the Large Hadron Collider at CERN. Inclusive and differential measurements as a function of the invariant mass, transverse momentum, and longitudinal boost of the $t\\bar{t}$ system are performed both in the full phase space and in a fiducial phase space closely matching the detector acceptance. Two observables are studied: A $ℓℓ\\atop{C}$ based on the selected leptons and A$t\\bar{t}\\atop{C}$ based on the reconstructed $t\\bar{t}$ final state. The inclusive asymmetries are measured in the full phase space to be A $ℓℓ\\atop{C}$ = 0.008 ± 0.006 and A$t\\bar{t}\\atop{C}$= 0.021 ± 0.016 , which are in agreement with the Standard Model predictions of A $ℓℓ\\atop{C}$ = 0.0064 ± 0.0003 and A$t\\bar{t}\\atop{C}$ = 0.0111 ± 0.0004 .

  3. Understanding Fomalhaut as a Cooper pair

    Science.gov (United States)

    Feng, F.; Jones, H. R. A.

    2018-03-01

    Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

  4. Frustrated Lewis Pairs

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 11. Frustrated Lewis Pairs : Enabling via inability. Sanjoy Mukherjee ... Author Affiliations. Sanjoy Mukherjee Pakkirisamy Thilagar1. Department of Inorgainic and Physical Chemistry Indian Institute of Science Bangalore 560 012, India.

  5. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel

    2015-01-01

    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  6. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.

    2013-01-01

    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  7. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

    2001-02-01

    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  8. To run or hide?: escape behaviour in a cryptic African snake | Maritz ...

    African Journals Online (AJOL)

    Optimal escape theory predicts that escape behaviour of an organism is best understood in terms of costs and benefits of escaping relative to risk of predation. However, risk of predation facing an organism is dependent on various biotic and abiotic factors. In order to better understand escape behaviour of an African snake, ...

  9. Improving escape panel selectivity in Nephrops directed fisheries by actively stimulating fish behaviour

    DEFF Research Database (Denmark)

    Krag, Ludvig Ahm; Herrmann, Bent; Feekings, Jordan P.

    2017-01-01

    The efficiency of escape panels inserted in trawls relies on fish actively attempting to escape through them. However, several studies indicate that most fish drift towards the aft end of the trawl, passing the escape panel through which they easily could have escaped, without making contact with...

  10. Energy conversion through mass loading of escaping ionospheric ions for different Kp values

    Directory of Open Access Journals (Sweden)

    M. Yamauchi

    2018-01-01

    Full Text Available By conserving momentum during the mixing of fast solar wind flow and slow planetary ion flow in an inelastic way, mass loading converts kinetic energy to other forms – e.g. first to electrical energy through charge separation and then to thermal energy (randomness through gyromotion of the newly born cold ions for the comet and Mars cases. Here, we consider the Earth's exterior cusp and plasma mantle, where the ionospheric origin escaping ions with finite temperatures are loaded into the decelerated solar wind flow. Due to direct connectivity to the ionosphere through the geomagnetic field, a large part of this electrical energy is consumed to maintain field-aligned currents (FACs toward the ionosphere, in a similar manner as the solar wind-driven ionospheric convection in the open geomagnetic field region. We show that the energy extraction rate by the mass loading of escaping ions (ΔK is sufficient to explain the cusp FACs, and that ΔK depends only on the solar wind velocity accessing the mass-loading region (usw and the total mass flux of the escaping ions into this region (mloadFload, as ΔK ∼ −mloadFloadu2sw∕4. The expected distribution of the separated charges by this process also predicts the observed flowing directions of the cusp FACs for different interplanetary magnetic field (IMF orientations if we include the deflection of the solar wind flow directions in the exterior cusp. Using empirical relations of u0 ∝ Kp + 1.2 and Fload ∝ exp(0.45Kp for Kp = 1–7, where u0 is the solar wind velocity upstream of the bow shock, ΔK becomes a simple function of Kp as log10(ΔK = 0.2 ⋅ Kp + 2 ⋅ log10(Kp + 1.2 + constant. The major contribution of this nearly linear increase is the Fload term, i.e. positive feedback between the increase of ion escaping rate Fload through the increased energy consumption in the ionosphere for high Kp, and subsequent extraction of more kinetic energy

  11. THE ESCAPE FRACTION OF IONIZING RADIATION FROM GALAXIES

    International Nuclear Information System (INIS)

    Benson, Andrew; Venkatesan, Aparna; Shull, J. Michael

    2013-01-01

    The escape of ionizing radiation from galaxies plays a critical role in the evolution of gas in galaxies, and the heating and ionization history of the intergalactic medium. We present semi-analytic calculations of the escape fraction of ionizing radiation for both hydrogen and helium from galaxies ranging from primordial systems to disk-type galaxies that are not heavily dust-obscured. We consider variations in the galaxy density profile, source type, location, and spectrum, and gas overdensity/distribution factors. For sufficiently hard first-light sources, the helium ionization fronts closely track or advance beyond that of hydrogen. Key new results in this work include calculations of the escape fractions for He I and He II ionizing radiation, and the impact of partial ionization from X-rays from early active galactic nuclei or stellar clusters on the escape fractions from galaxy halos. When factoring in frequency-dependent effects, we find that X-rays play an important role in boosting the escape fractions for both hydrogen and helium, but especially for He II. We briefly discuss the implications of these results for recent observations of the He II reionization epoch at low redshifts, as well as the UV data and emission-line signatures from early galaxies anticipated from future satellite missions.