WorldWideScience

Sample records for charge injection properties

  1. Charge injection and transport properties of an organic light-emitting diode

    Directory of Open Access Journals (Sweden)

    Peter Juhasz

    2016-01-01

    Full Text Available The charge behavior of organic light emitting diode (OLED is investigated by steady-state current–voltage technique and impedance spectroscopy at various temperatures to obtain activation energies of charge injection and transport processes. Good agreement of activation energies obtained by steady-state and frequency-domain was used to analyze their contributions to the charge injection and transport. We concluded that charge is injected into the OLED device mostly through the interfacial states at low voltage region, whereas the thermionic injection dominates in the high voltage region. This comparison of experimental techniques demonstrates their capabilities of identification of major bottleneck of charge injection and transport.

  2. Properties of Laser-Produced Highly Charged Heavy Ions for Direct Injection Scheme

    CERN Document Server

    Sakakibara, Kazuhiko; Hayashizaki, Noriyosu; Ito, Taku; Kashiwagi, Hirotsugu; Okamura, Masahiro

    2005-01-01

    To accelerate highly charged intense ion beam, we have developed the Direct Plasma Injection Scheme (DPIS) with laser ion source. In this scheme an ion beam from a laser ion source is injected directly to a RFQ linac without a low energy beam transport (LEBT) and the beam loss in the LEBT can be avoided. We achieved high current acceleration of carbon ions (60mA) by DPIS with the high current optimized RFQ. As the next setp we will use heavier elements like Ag, Pb, Al and Cu as target in LIS (using CO2, Nd-YAG or other laser) for DPIS and will examine properties of laser-produced plasma (the relationship of between charge state and laser power density, the current dependence of the distance from the target, etc).

  3. Influence of magneto-electric coefficient for magnetic and electric charge injection properties in magneto-electric MIS capacitors

    Energy Technology Data Exchange (ETDEWEB)

    Yokota, T; Tsuboi, Y; Imura, R; Kito, S; Gomi, M, E-mail: yokota.takeshi@nitech.ac.jp [Department of Material Science and Engineering, Graduate School of Nagoya Institute of Technology, Gokiso-cho, Showa-ku, Nagoya City, Aichi, 466-8555 (Japan)

    2011-10-29

    We investigated the electric charge injection properties of a floating-gate type metal-insulator Si capacitor having different-ME gate insulators. The samples showed charge-injection type behaviour in capacitance-voltage curves, and it was revealed that the amount of injected charges can be controlled by the application of an external magnetic field. The sample having a high-ME-coefficient gate insulator showed stepwise capacitance-voltage curves unlike the normal one. These results indicate that this capacitor, which employs a magnetic gate insulator, has the potential to be used in multilevel memory by the application of an external magnetic field.

  4. H- charge exchange injection systems

    International Nuclear Information System (INIS)

    Ankenbrandt, C.; Curtis, C.; Hojvat, C.; Johnson, R.P.; Owen, C.; Schmidt, C.; Teng, L.; Webber, R.C.

    1980-01-01

    The techniques and components required for injection of protons into cyclic accelerators by means of H - charge exchange processes are reviewed, with emphasis on the experience at Fermilab. The advantages of the technique are described. The design and performance of the system of injection of H - ions into the Fermilab Booster are detailed. (Auth.)

  5. OPTICALLY BASED CHARGE INJECTION SYSTEM FOR IONIZATION DETECTORS

    International Nuclear Information System (INIS)

    CHEN, H.; CITTERIO, M.; LANNI, F.; LEITE, M.A.L.; RADEKA, V.; RESCIA, S.; TAKAI, H.

    2001-01-01

    An optically coupled charge injection system for ionization based radiation detectors which allows a test charge to be injected without the creation of ground loops has been developed. An ionization like signal from an external source is brought into the detector through an optical fiber and injected into the electrodes by means of a photodiode. As an application example, crosstalk measurements on a liquid Argon electromagnetic calorimeter readout electrodes were performed

  6. Charge Injection and Transport in Organic Nanofibers

    DEFF Research Database (Denmark)

    Kjelstrup-Hansen, Jakob; Bøggild, Peter; Rubahn, H. G.

    2007-01-01

    the injection barrier height equal to the difference between the metal electrode work function and the HOMO energy level of the organic semiconductor. Semiquantitative modeling suggests that the weak temperature dependence is due to injection into a distribution of states rather than into a single energy level...

  7. Charge Injection and Current Flow in Organic Light Emitting Diodes

    Science.gov (United States)

    Smith, D. L.; Davids, P. S.; Heller, C. M.; Crone, B. K.; Campbell, I. H.; Barashkov, N. N.; Ferraris, J. P.

    1997-03-01

    We present a comparison between device model calculations and current-voltage measurements for a series of organic LED structures. The Schottky energy barrier of an injecting contact is systematically varied by changing the metal used to form that contact. The current-voltage characteristics of the structures are described using a device model that considers charge injection, transport and space charge effects in the low mobility organic material. Charge injection into the organic material is controlled by the Schottky energy barrier of the metal/organic contact. For Schottky energy barriers greater than about 0.4 eV injection into the organic material is the principal limitation to current flow. In this regime the net injected charge density is relatively small, the electric field in the structure is nearly uniform, and space charge effects are not important. For smaller energy barriers relatively large charge densities are injected into the organic material and space charge effects become the dominant limit to current flow. The measured current-voltage characteristics are quantitatively described by the device model using Schottky barrier values independently determined by internal photoemission and electroabsorption measurements.

  8. Influence of space charge during the injection in Saturne II

    International Nuclear Information System (INIS)

    Lemaire, J.L.

    Calculations were made in which a fixed acceptance window, established since the beginning of the injection, was considered, and a filling pattern that was a linear function of time was supposed. Evidently, these conditions are no longer met if the space charge modifies the wave number of the beam and, consequently, the filling rate changes with time. The importance of these conditions upon injection for the theoretical operation point zone 3 is reported

  9. Injection space charge: enlargements of flux density functioning point choice

    International Nuclear Information System (INIS)

    Ropert, A.

    In Saturne, injection consists of a synchrobetatron filling of the chamber, with the goal of providing a beam with the following characteristics circulating in the machine: horizontal flux density 90 πmm mrd, vertical flux density 210 πmm mrd, dispersion in moments +- 7 x 10 -3 , and number of particles 2 x 10 12 . The determination of the principal injection parameters was made by means of GOC calculation programs. The goal of this study is to show a certain number of phenomena induced by the forces due to space charge and left suspended up to this point: variations in the intensity injectable into the machine extension of the beam occupation zone in the ν/sub x'/ ν/sub z/ diagram, and turn-turn interactions. The effects of the space charge lead to a deterioration of the injected beam for certain functioning points leading to the selection of a zone in the ν/sub x'/ ν/sub z/ diagram that is particularly suitable for beam injection

  10. Charge Injection and Transport in Metal/Polymer Chains/Metal Sandwich Structure

    International Nuclear Information System (INIS)

    Hai-Hong, Li; Dong-Mei, Li; Yuan, Li; Kun, Gao; De-Sheng, Liu; Shi-Jie, Xie

    2008-01-01

    Using the tight-binding Su–Schrieffer–Heeger model and a nonadiabatic dynamic evolution method, we study the dynamic processes of the charge injection and transport in a metal/two coupled conjugated polymer chains/metal structure. It is found that the charge interchain transport is determined by the strength of the electric field and the magnitude of the voltage bias applied on the metal electrode. The stronger electric field and the larger voltage bias are both in favour of the charge interchain transport. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  11. Charge exchange injection for Nuclotron and Nuclotron booster

    International Nuclear Information System (INIS)

    Dinev, D.; Mikhajlov, V.

    2000-01-01

    The acceleration of polarized beams is between the major items in the JINR LHE's heavy ion superconducting synchrotron Nuclotron research programme. One effective way to increase the intensities of polarized deuteron beams is the application of the charge exchange injection into the Nuclotron. The paper represents the results of a new analytical description of the heavy ion stripping injection based on the Boltzmann kinetic equation. Expressions for the ion density evolution in the transverse phase plane for the emittance growth due to the elastic scattering and to energy losses in the stripping foil and for the number of successfully stored particles have been derived. These results have been applied to the stripping injection of polarized deuterons into the Nuclotron as well as to the stripping injection of heavy ions into the now under consideration Nuclotron rapid cycling booster. It has been shown that an estimated 40-fold intensity gain could be achieved for the stripping injection of polarized D - into the Nuclotron and that an effective stripping injection of light and medium ions into the booster could be realized

  12. Impact of charge carrier injection on single-chain photophysics of conjugated polymers

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, Felix J.; Vogelsang, Jan, E-mail: jan.vogelsang@physik.uni-regensburg.de; Lupton, John M. [Institut für Experimentelle und Angewandte Physik, Universität Regensburg, Universitätsstrasse 31, 93053 Regensburg (Germany)

    2016-06-27

    Charges in conjugated polymer materials have a strong impact on the photophysics and their interaction with the primary excited state species has to be taken into account in understanding device properties. Here, we employ single-molecule spectroscopy to unravel the influence of charges on several photoluminescence (PL) observables. The charges are injected either stochastically by a photochemical process or deterministically in a hole-injection sandwich device configuration. We find that upon charge injection, besides a blue-shift of the PL emission and a shortening of the PL lifetime due to quenching and blocking of the lowest-energy chromophores, the non-classical photon arrival time distribution of the multichromophoric chain is modified towards a more classical distribution. Surprisingly, the fidelity of photon antibunching deteriorates upon charging, whereas one would actually expect the opposite: the number of chromophores to be reduced. A qualitative model is presented to explain the observed PL changes. The results are of interest to developing a microscopic understanding of the intrinsic charge-exciton quenching interaction in devices.

  13. In vivo charge injection limits increased after 'unsafe' stimulation

    DEFF Research Database (Denmark)

    Meijs, Suzan; Sørensen, Søren; Rechendorff, Kristian

    2015-01-01

    was not observed with any of the stimulation protocols and no tissue damage was observed for the 20 mA – 200 Hz stimulation group. This indicates that the ‘safe potential window’ may not be applicable in vivo, as no damage was done stimulating with 20 mA at 200 Hz, while damage was done using the same current......The effect of unsafe stimulation on charge injection limits (Qinj) and pulsing capacitance (Cpulse) was investigated. Four stimulation protocols were applied: 20 mA – 200 and 400 Hz, 50 mA – 200 and 400 Hz. Increasing Qinj and Cpulse were observed for all stimulation protocols. Corrosion...

  14. Optimization of pentacene double floating gate memories based on charge injection regulated by SAM functionalization

    Directory of Open Access Journals (Sweden)

    S. Li

    2018-02-01

    Full Text Available Pentacene based double nano-floating gate memories (NFGM by using gold nanoparticles (Au NPs and reduced graphene oxide (rGO sheets as charge trapping layers are prepared and demonstrated. Particularly, the NFGM chemically treated by 2,3,4,5,6-pentafluorobenzenethiol (PFBT self-assembled monolayers (SAM exhibits excellent memory performances, including high mobility of 0.23 cm2V-1s-1, the large memory window of 51 V, and the stable retention property more than 108 s. Comparing the performances of NFGM without treating with PFBT SAM, the improving performances of the memory devices by SAM modification are explained by the increase of charge injection, which could be further investigated by XPS and UPS. In particular, the results highlight the utility of SAM modulations and controlling of charge transport in the development of organic transistor memories.

  15. Optimization of pentacene double floating gate memories based on charge injection regulated by SAM functionalization

    Science.gov (United States)

    Li, S.; Guérin, D.; Lenfant, S.; Lmimouni, K.

    2018-02-01

    Pentacene based double nano-floating gate memories (NFGM) by using gold nanoparticles (Au NPs) and reduced graphene oxide (rGO) sheets as charge trapping layers are prepared and demonstrated. Particularly, the NFGM chemically treated by 2,3,4,5,6-pentafluorobenzenethiol (PFBT) self-assembled monolayers (SAM) exhibits excellent memory performances, including high mobility of 0.23 cm2V-1s-1, the large memory window of 51 V, and the stable retention property more than 108 s. Comparing the performances of NFGM without treating with PFBT SAM, the improving performances of the memory devices by SAM modification are explained by the increase of charge injection, which could be further investigated by XPS and UPS. In particular, the results highlight the utility of SAM modulations and controlling of charge transport in the development of organic transistor memories.

  16. Estimation of instantaneous heat transfer coefficients for a direct-injection stratified-charge rotary engine

    Science.gov (United States)

    Lee, C. M.; Addy, H. E.; Bond, T. H.; Chun, K. S.; Lu, C. Y.

    1987-01-01

    The main objective of this report was to derive equations to estimate heat transfer coefficients in both the combustion chamber and coolant pasage of a rotary engine. This was accomplished by making detailed temperature and pressure measurements in a direct-injection stratified-charge rotary engine under a range of conditions. For each sppecific measurement point, the local physical properties of the fluids were calculated. Then an empirical correlation of the coefficients was derived by using a multiple regression program. This correlation expresses the Nusselt number as a function of the Prandtl number and Reynolds number.

  17. Lattice Issues of the CERN PSB with H- Charge exchange injection hardware

    CERN Document Server

    Aiba, M; Chanel, M; Goddard, B; Martini, M; Weterings, W

    2010-01-01

    The motivation for the construction of CERN Linac4 is to improve the performance of the PSB by raising the injection energy and implementing a new H- charge exchange multiturn injection scheme. Lattice perturbations introduced by the new injection hardware are described. Strategies to mitigate the consequences, first by minimizing the additional focusing introduced and, by compensating the residual perturbation, are reported.

  18. Charge injection and transport in quantum confined and disordered systems

    NARCIS (Netherlands)

    Houtepen, A.J.

    2007-01-01

    Quantum dots and conducting polymers are modern semiconductors with a high potential for applications such as lasers, LEDs, displays, solar cells etc. These applications require the controlled addition of charge carriers into the material and knowledge of the details of charge transport. This thesis

  19. The Role of Dopant Ions on Charge Injection and Transport in Electrochemically Doped Quantum Dot Films.

    Science.gov (United States)

    Gudjonsdottir, Solrun; van der Stam, Ward; Kirkwood, Nicholas; Evers, Wiel H; Houtepen, Arjan J

    2018-05-16

    Control over the charge density is very important for implementation of colloidal semiconductor nanocrystals into various optoelectronic applications. A promising approach to dope nanocrystal assemblies is charge injection by electrochemistry, in which the charge compensating electrolyte ions can be regarded as external dopant ions. To gain insight into the doping mechanism and the role of the external dopant ions, we investigate charge injection in ZnO nanocrystal assemblies for a large series of charge compensating electrolyte ions with spectroelectrochemical and electrochemical transistor measurements. We show that charge injection is limited by the diffusion of cations in the nanocrystal films as their diffusion coefficient are found to be ∼7 orders of magnitude lower than those of electrons. We further show that the rate of charge injection depends strongly on the cation size and cation concentration. Strikingly, the onset of electron injection varies up to 0.4 V, depending on the size of the electrolyte cation. For the small ions Li + and Na + the onset is at significantly less negative potentials. For larger ions (K + , quaternary ammonium ions) the onset is always at the same, more negative potential, suggesting that intercalation may take place for Li + and Na + . Finally, we show that the nature of the charge compensating cation does not affect the source-drain electronic conductivity and mobility, indicating that shallow donor levels from intercalating ions fully hybridize with the quantum confined energy levels and that the reorganization energy due to intercalating ions does not strongly affect electron transport in these nanocrystal assemblies.

  20. Charged Hadron Properties in Background Electric Fields

    International Nuclear Information System (INIS)

    Detmold, William; Tiburzi, Brian C.; Walker-Loud, Andre

    2010-01-01

    We report on a lattice calculation demonstrating a novel new method to extract the electric polarizability of charged pseudo-scalar mesons by analyzing two point correlation functions computed in classical background electric fields. A staple component of any electrodynamics or quantum mechanics course is the electric polarizability. Neutral material immersed in a weak external field polarizes, internally setting up an electric dipole moment, aligned so as to minimize the energy. At the atomic level, the electron clouds are distorted creating these microscopic dipole moments. The same process occurs at the hadronic level but the polarization effects are now constrained by the strong force. Polarizabilities of these bound QCD states can be viewed as a distortion of the charged pion cloud of a given hadron. One can use lattice QCD to non-perturbatively compute the quark and gluon interactions in the presence of background electric (or magnetic) fields. For sufficiently weak background fields, the low energy properties of the hadrons can be rigorously computed using effective field theory. With this treatment, a picture of hadrons emerges from chiral dynamics: that of a hadronic core surrounded by a pseudoscalar meson cloud. As some pseudoscalar mesons are charged, polarizabilities of hadrons encode the stiffness of the charged meson cloud (as well as that of the core). The form of pseudoscalar meson polarizabilities is consequently strongly constrained by chiral dynamics. However, beyond the leading order, the results depend upon essentially unknown low-energy constants, which must currently be estimated in a model-dependent fashion. In the case of the charged pion, the experimental measurement of the polarizability has proven difficult, both in the original measurement as well as the most recent published result. Currently, there is a 2-3 sigma discrepancy between the two-loop cPT prediction and the measured charged pion polarizability. New results with higher

  1. Charging properties of a dust grain in collisional plasmas

    International Nuclear Information System (INIS)

    Khrapak, S.A.; Morfill, G.E.; Khrapak, A.G.; D'yachkov, L.G.

    2006-01-01

    Charging related properties of a small spherical grain immersed in a collisional plasma are investigated. Asymptotic expressions for charging fluxes, grain surface potential, long range electrostatic potential, and the properties of grain charge fluctuations due to the discrete nature of the charging process are obtained. These analytical results are in reasonable agreement with the available results of numerical modeling

  2. Injection of an electron beam into a plasma and spacecraft charging

    International Nuclear Information System (INIS)

    Okuda, H.; Kan, J.R.

    1987-01-01

    Injection of a nonrelativistic electron beam into a fully ionized plasma from a spacecraft including the effect of charging has been studied using a one-dimensional particle simulation model. It is found that the spacecraft charging remains negligible and the beam can propagate into a plasma, if the beam density is much smaller than the ambient density. When the injection current is increased by increasing the beam density, significant spacecraft charging takes place and the reflection of beam electrons back to the spacecraft reduces the beam current significantly. On the other hand, if the injection current is increased by increasing the beam energy, spacecraft charging remains negligible and a beam current much larger than the thermal return current can be injected. It is shown that the electric field caused by the beam--plasma instability accelerates the ambient electrons toward the spacecraft thereby enhancing the return current

  3. Experimental optimization of a direct injection homogeneous charge compression ignition gasoline engine using split injections with fully automated microgenetic algorithms

    Energy Technology Data Exchange (ETDEWEB)

    Canakci, M. [Kocaeli Univ., Izmit (Turkey); Reitz, R.D. [Wisconsin Univ., Dept. of Mechanical Engineering, Madison, WI (United States)

    2003-03-01

    Homogeneous charge compression ignition (HCCI) is receiving attention as a new low-emission engine concept. Little is known about the optimal operating conditions for this engine operation mode. Combustion under homogeneous, low equivalence ratio conditions results in modest temperature combustion products, containing very low concentrations of NO{sub x} and particulate matter (PM) as well as providing high thermal efficiency. However, this combustion mode can produce higher HC and CO emissions than those of conventional engines. An electronically controlled Caterpillar single-cylinder oil test engine (SCOTE), originally designed for heavy-duty diesel applications, was converted to an HCCI direct injection (DI) gasoline engine. The engine features an electronically controlled low-pressure direct injection gasoline (DI-G) injector with a 60 deg spray angle that is capable of multiple injections. The use of double injection was explored for emission control and the engine was optimized using fully automated experiments and a microgenetic algorithm optimization code. The variables changed during the optimization include the intake air temperature, start of injection timing and the split injection parameters (per cent mass of fuel in each injection, dwell between the pulses). The engine performance and emissions were determined at 700 r/min with a constant fuel flowrate at 10 MPa fuel injection pressure. The results show that significant emissions reductions are possible with the use of optimal injection strategies. (Author)

  4. Controlling charge injection in organic electronic devices using self-assembled monolayers

    Science.gov (United States)

    Campbell, I. H.; Kress, J. D.; Martin, R. L.; Smith, D. L.; Barashkov, N. N.; Ferraris, J. P.

    1997-12-01

    We demonstrate control and improvement of charge injection in organic electronic devices by utilizing self-assembled monolayers (SAMs) to manipulate the Schottky energy barrier between a metal electrode and the organic electronic material. Hole injection from Cu electrodes into the electroluminescent conjugated polymer poly[2-methoxy,5-(2'-ethyl-hexyloxy)-1,4-phenylene vinylene] was varied by using two conjugated-thiol based SAMs. The chemically modified electrodes were incorporated in organic diode structures and changes in the metal/polymer Schottky energy barriers and current-voltage characteristics were measured. Decreasing (increasing) the Schottky energy barrier improves (degrades) charge injection into the polymer.

  5. H- charge exchange injection for the NSNS accumulator

    International Nuclear Information System (INIS)

    Blumberg, L.N.; Lee, Y.Y.

    1997-01-01

    A scheme for injection into the FODO cell of the National Spallation Neutron Source (NSNS) Accumulator ring is discussed. A 400 μg/cm 2 carbon foil is chosen for a high stripping efficiency and for heating of the foil consideration. Additional schemes to reduce losses due to nuclear and Coulomb scattering at the foil are discussed. Subsequent loss from magnetic field ionization of the residual H 0 component is estimated to be small comparable to nuclear loss. A method for sweeping and collecting the stripped electrons from the foil is presented

  6. A Method to Overcome Space Charge at Injection

    International Nuclear Information System (INIS)

    Ya. Derbenev

    2005-01-01

    The transverse space charge forces in a high current, low energy beam can be reduced by mean of a large increase of the beam's transverse sizes while maintaining the beam area in the 4D phase space. This can be achieved by transforming the beam area in phase space of each of two normal 2D transverse (either plane or circular) modes from a spot shape into a narrow ring of a large amplitude, but homogeneous in phase. Such a transformation results from the beam evolution in the island of a dipole resonance when the amplitude width of the island shrinks adiabatically. After stacking (by using stripping foils or cooling) the beam in such a state and accelerating to energies sufficiently high that the space charge becomes insignificant, the beam then can be returned back to a normal spot shape by applying the reverse transformation. An arrangement that can provide such beam gymnastics along a transport line after a linac and before a booster and/or in a ring with circulating beam will be described and numerical estimates will be presented. Other potential applications of the method will be briefly discussed

  7. Fast electron beam charge injection and switching in dielectrics

    Energy Technology Data Exchange (ETDEWEB)

    Fitting, Hans-Joachim; Schreiber, Erik [Institute of Physics, University of Rostock, Universitaetsplatz 3, 18051 Rostock (Germany); Touzin, Matthieu [Laboratoire de Structure et Proprietes de l' Etat Solide, UMR CNRS 8008, Universite de Lille 1, 59655 Villeneuve d' Ascq (France)

    2011-04-15

    Basic investigations of secondary electrons (SE) relaxation and attenuation are made by means of Monte Carlo simulations using ballistic electron scattering and interactions with optical and acoustic phonons as well as impact ionization of valence band electrons. Then the electron beam induced selfconsistent charge transport and secondary electron emission in insulators are described by means of an electron-hole flight-drift model (FDM). Ballistic secondary electrons and holes, their attenuation and drift, as well as their recombination, trapping, and field- and temperature-dependent Poole-Frenkel detrapping are included. Whereas the initial switching-on of the secondary electron emission proceeds over milli-seconds due to long-lasting selfconsistent charging, the switching-off process occurs much faster, even over femto-seconds. Thus a rapid electron beam switching becomes possible with formation of ultra-short electron beam pulses offering an application in stroboscopic electron microscopy and spectroscopy. (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  8. The Role of Dopant Ions on Charge Injection and Transport in Electrochemically Doped Quantum Dot Films

    Science.gov (United States)

    2018-01-01

    Control over the charge density is very important for implementation of colloidal semiconductor nanocrystals into various optoelectronic applications. A promising approach to dope nanocrystal assemblies is charge injection by electrochemistry, in which the charge compensating electrolyte ions can be regarded as external dopant ions. To gain insight into the doping mechanism and the role of the external dopant ions, we investigate charge injection in ZnO nanocrystal assemblies for a large series of charge compensating electrolyte ions with spectroelectrochemical and electrochemical transistor measurements. We show that charge injection is limited by the diffusion of cations in the nanocrystal films as their diffusion coefficient are found to be ∼7 orders of magnitude lower than those of electrons. We further show that the rate of charge injection depends strongly on the cation size and cation concentration. Strikingly, the onset of electron injection varies up to 0.4 V, depending on the size of the electrolyte cation. For the small ions Li+ and Na+ the onset is at significantly less negative potentials. For larger ions (K+, quaternary ammonium ions) the onset is always at the same, more negative potential, suggesting that intercalation may take place for Li+ and Na+. Finally, we show that the nature of the charge compensating cation does not affect the source-drain electronic conductivity and mobility, indicating that shallow donor levels from intercalating ions fully hybridize with the quantum confined energy levels and that the reorganization energy due to intercalating ions does not strongly affect electron transport in these nanocrystal assemblies. PMID:29718666

  9. Bulk-Like Electrical Properties Induced by Contact-Limited Charge Transport in Organic Diodes: Revised Space Charge Limited Current

    KAUST Repository

    Xu, Guangwei

    2018-02-22

    Charge transport governs the operation and performance of organic diodes. Illuminating the charge-transfer/transport processes across the interfaces and the bulk organic semiconductors is at the focus of intensive investigations. Traditionally, the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I–V characteristics, still represents a major challenge. Here, the electrical potential distribution in planar organic diodes is investigated by using the scanning Kelvin probe force microscopy technique, a method that can clearly separate the contact and bulk regimes of charge transport. Interestingly, by applying to devices based on novel, high mobility organic materials, the space-charge-limited-current-like I–V curves, which are previously believed to be a result of the bulk transport, are surprisingly but unambiguously demonstrated to be caused by contact-limited conduction. A model accounting is developed for the transport properties of both the two metal/organic interfaces and the bulk. The results indicate that pure interface-dominated transport can indeed give rise to I–V curves similar to those caused by bulk transport. These findings provide a new insight into the charge injection and transport processes in organic diodes.

  10. Injection and propagation of a nonrelativistic electron beam and spacecraft charging

    International Nuclear Information System (INIS)

    Okuda, H.; Berchem, J.

    1987-05-01

    Two-dimensional numerical simulations have been carried out in order to study the injection and propagation of a nonrelativistic electron beam from a spacecraft into a fully ionized plasma in a magnetic field. Contrary to the earlier results in one-dimension, a high density electron beam whose density is comparable to the ambient density can propagate into a plasma. A strong radial electric field resulting from the net charges in the beam causes the beam electrons to spread radially reducing the beam density. When the injection current exceeds the return current, significant charging of the spacecraft is observed along with the reflection of the injected electrons back to the spacecraft. Recent data on the electron beam injection from the Spacelab 1 (SEPAC) are discussed

  11. Memory properties and charge effect study in Si nanocrystals by scanning capacitance microscopy and spectroscopy

    Directory of Open Access Journals (Sweden)

    Bassani Franck

    2011-01-01

    Full Text Available Abstract In this letter, isolated Si nanocrystal has been formed by dewetting process with a thin silicon dioxide layer on top. Scanning capacitance microscopy and spectroscopy were used to study the memory properties and charge effect in the Si nanocrystal in ambient temperature. The retention time of trapped charges injected by different direct current (DC bias were evaluated and compared. By ramp process, strong hysteresis window was observed. The DC spectra curve shift direction and distance was observed differently for quantitative measurements. Holes or electrons can be separately injected into these Si-ncs and the capacitance changes caused by these trapped charges can be easily detected by scanning capacitance microscopy/spectroscopy at the nanometer scale. This study is very useful for nanocrystal charge trap memory application.

  12. Influence of injected charge carriers on photocurrents in polymer solar cells

    NARCIS (Netherlands)

    Wehenkel, D.J.; Koster, L.J.A.; Wienk, M.M.; Janssen, R.A.J.

    2012-01-01

    We determine and analyze the photocurrent Jph in polymer solar cells under conditions where, no, one, or two different charge carriers can be injected by choosing appropriate electrodes and compare the experimental results to simulations based on a drift-diffusion device model that accounts for

  13. To what extent can charge localization influence electron injection efficiency at graphene-porphyrin interfaces?

    KAUST Repository

    Parida, Manas R.

    2015-04-28

    Controlling the electron transfer process at donor- acceptor interfaces is a research direction that has not yet seen much progress. Here, with careful control of the charge localization on the porphyrin macrocycle using β -Cyclodextrin as an external cage, we are able to improve the electron injection efficiency from cationic porphyrin to graphene carboxylate by 120% . The detailed reaction mechanism is also discussed.

  14. Improving Charge Injection in Organic Electronic Devices Using Self-Assembled Monolayers

    Science.gov (United States)

    Campbell, I. H.; Kress, J. D.; Martin, R. L.; Smith, D. L.; Barashkov, N. N.; Ferraris, J. P.

    1997-03-01

    Organic electronic devices consist of one or more insulating organic layers contacted by metallic conductors. The Schottky energy barrier between the metal and the organic material is determined by the work function of the metal contact as described in the ideal Schottky model. The magnitude of the metal/organic Schottky energy barrier controls charge injection from the metal into the organic layer. Previously, polar alkane-thiol based self-assembled monolayers (SAMs) were used to change the Schottky energy barrier between the metal and an organic film by more than 1 eV. In these SAMs, the large energy gap of the alkane molecules blocks charge injection into the organic layer despite the decrease of the Schottky energy barrier. Here, we demonstrate improved charge injection into the organic material by using conjugated self-assembled monolayers. The conjugated SAMs have modest energy gaps which allow improved charge injection into the organic layer. We present measurements of current-voltage characteristics and metal/organic Schottky energy barriers for device structures both with and without conjugated SAMs.

  15. Optimization of operating conditions in the early direct injection premixed charge compression ignition regime

    NARCIS (Netherlands)

    Boot, M.D.; Luijten, C.C.M.; Rijk, E.P.; Albrecht, B.A.; Baert, R.S.G.

    2009-01-01

    Early Direct Injection Premixed Charge Compression Ignition (EDI PCCI) is a widely researched combustion concept, which promises soot and CO2 emission levels of a spark-ignition (SI) and compression-ignition (CI) engine, respectively. Application of this concept to a conventional CI engine using a

  16. Controlling charge injection in organic electronic devices using self-assembled monolayers

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, I.H.; Kress, J.D.; Martin, R.L.; Smith, D.L. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Barashkov, N.N.; Ferraris, J.P. [The University of Texas at Dallas, Richardson, Texas 75083 (United States)

    1997-12-01

    We demonstrate control and improvement of charge injection in organic electronic devices by utilizing self-assembled monolayers (SAMs) to manipulate the Schottky energy barrier between a metal electrode and the organic electronic material. Hole injection from Cu electrodes into the electroluminescent conjugated polymer poly[2-methoxy,5-(2{sup {prime}}-ethyl-hexyloxy)-1,4-phenylene vinylene] was varied by using two conjugated-thiol based SAMs. The chemically modified electrodes were incorporated in organic diode structures and changes in the metal/polymer Schottky energy barriers and current{endash}voltage characteristics were measured. Decreasing (increasing) the Schottky energy barrier improves (degrades) charge injection into the polymer. {copyright} {ital 1997 American Institute of Physics.}

  17. Extraction method of interfacial injected charges for SiC power MOSFETs

    Science.gov (United States)

    Wei, Jiaxing; Liu, Siyang; Li, Sheng; Song, Haiyang; Chen, Xin; Li, Ting; Fang, Jiong; Sun, Weifeng

    2018-01-01

    An improved novel extraction method which can characterize the injected charges along the gate oxide interface for silicon carbide (SiC) power metal-oxide-semiconductor field-effect transistors (MOSFETs) is proposed. According to the different interface situations of the channel region and the junction FET (JFET) region, the gate capacitance versus gate voltage (Cg-Vg) curve of the device can be divided into three relatively independent parts, through which the locations and the types of the charges injected in to the oxide above the interface can be distinguished. Moreover, the densities of these charges can also be calculated by the amplitudes of the shifts in the Cg-Vg curve. The correctness of this method is proved by TCAD simulations. Moreover, experiments on devices stressed by unclamped-inductive-switching (UIS) stress and negative bias temperature stress (NBTS) are performed to verify the validity of this method.

  18. Regressed relations for forced convection heat transfer in a direct injection stratified charge rotary engine

    Science.gov (United States)

    Lee, Chi M.; Schock, Harold J.

    1988-01-01

    Currently, the heat transfer equation used in the rotary combustion engine (RCE) simulation model is taken from piston engine studies. These relations have been empirically developed by the experimental input coming from piston engines whose geometry differs considerably from that of the RCE. The objective of this work was to derive equations to estimate heat transfer coefficients in the combustion chamber of an RCE. This was accomplished by making detailed temperature and pressure measurements in a direct injection stratified charge (DISC) RCE under a range of conditions. For each specific measurement point, the local gas velocity was assumed equal to the local rotor tip speed. Local physical properties of the fluids were then calculated. Two types of correlation equations were derived and are described in this paper. The first correlation expresses the Nusselt number as a function of the Prandtl number, Reynolds number, and characteristic temperature ratio; the second correlation expresses the forced convection heat transfer coefficient as a function of fluid temperature, pressure and velocity.

  19. Rheological properties of alumina injection feedstocks

    Directory of Open Access Journals (Sweden)

    Vivian Alexandra Krauss

    2005-06-01

    Full Text Available The rheological behavior of alumina molding feedstocks containing polyethylene glycol (PEG, polyvinylbutyral (PVB and stearic acid (SA and having different powder loads were analyzed using a capillary rheometer. Some of the feedstocks showed a pseudoplastic behavior of n < 0, which can lead to the appearance of weld lines on molded parts. Their viscosity also displayed a strong dependence on the shear rate. The slip phenomenon, which can cause an unsteady front flow, was also observed. The results indicate that the feedstock containing a lower powder load displayed the best rheological behavior. The 55 vol. % powder loaded feedstock presented the best rheological behavior, thus appearing to be more suitable than the formulation containing a vol. 59% powder load, which attained viscosities exceeding 10³ Pa.s at low shear rates, indicating its unsuitability for injection molding.

  20. Thermodynamical and dynamical properties of charged BTZ black holes

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Zi-Yu; Wang, Bin [Shanghai Jiao Tong University, Department of Physics and Astronomy, Center for Astronomy and Astrophysics, Shanghai (China); Zhang, Cheng-Yong [Peking University, Center for High-Energy Physics, Beijing (China); Kord Zangeneh, Mahdi [Shanghai Jiao Tong University, Department of Physics and Astronomy, Center for Astronomy and Astrophysics, Shanghai (China); Shahid Chamran University of Ahvaz, Physics Department, Faculty of Science, Ahvaz (Iran, Islamic Republic of); Research Institute for Astronomy and Astrophysics of Maragha (RIAAM)-Maragha, P. O. Box: 55134-441, Maragha (Iran, Islamic Republic of); Shiraz University, Physics Department and Biruni Observatory, College of Sciences, Shiraz (Iran, Islamic Republic of); Saavedra, Joel [Pontificia Universidad Catolica de Valparaiso, Instituto de Fisica, Valparaiso (Chile)

    2017-06-15

    We investigate the spacetime properties of BTZ black holes in the presence of the Maxwell field and Born-Infeld field and find rich properties in the spacetime structures when the model parameters are varied. Employing Landau-Lifshitz theory, we examine the thermodynamical phase transition in the charged BTZ black holes. We further study the dynamical perturbation in the background of the charged BTZ black holes and find different properties in the dynamics when the thermodynamical phase transition occurs. (orig.)

  1. Astronomical imaging with a low temperature InSb charge injection device (CID)

    International Nuclear Information System (INIS)

    Rouan, D.; Lacombe, F.; Tiphene, D.; Stefanovitch, D.; Phan van, D.

    1986-01-01

    InSb charge injection device (CID) technology focal plane arrays employ two coupled MIS capacitors which collect and store photon-generated charge carriers. Attention is presently given to two-dimensional arrays for 77 K and 4 K operating temperatures in astronomical applications; two such prototypes for ground observations have been developed for use with a 2-m telescope. A CID InSb array is noted to be a useful candidate for the proposed IR Space Observatory's focal plane camera. 7 references

  2. Charge injection and accumulation in organic light-emitting diode with PEDOT:PSS anode

    Energy Technology Data Exchange (ETDEWEB)

    Weis, Martin, E-mail: martin.weis@stuba.sk [Institute of Electronics and Photonics, Slovak University of Technology, Ilkovičova 3, Bratislava 81219 (Slovakia); Otsuka, Takako; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa, E-mail: iwamoto@ome.pe.titech.ac.jp [Department of Physical Electronics, Tokyo Institute of Technology, 2-12-1 O-okayama, Meguro-ku, Tokyo 152-8552 (Japan)

    2015-04-21

    Organic light-emitting diode (OLED) displays using flexible substrates have many attractive features. Since transparent conductive oxides do not fit the requirements of flexible devices, conductive polymer poly(3,4-ethylenedioxythiophene):poly(4-styrenesulfonate) (PEDOT:PSS) has been proposed as an alternative. The charge injection and accumulation in OLED devices with PEDOT:PSS anodes are investigated and compared with indium tin oxide anode devices. Higher current density and electroluminescence light intensity are achieved for the OLED device with a PEDOT:PSS anode. The electric field induced second-harmonic generation technique is used for direct observation of temporal evolution of electric fields. It is clearly demonstrated that the improvement in the device performance of the OLED device with a PEDOT:PSS anode is associated with the smooth charge injection and accumulation.

  3. The Schottky energy barrier dependence of charge injection in organic light-emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Campbell, I.H.; Davids, P.S.; Smith, D.L. [Los Alamos National Laboratory, Los Alamos, New Mexico87545 (United States); Barashkov, N.N.; Ferraris, J.P. [The University of Texas at Dallas, Richardson, Texas75083 (United States)

    1998-04-01

    We present device model calculations of the current{endash}voltage (I{endash}V) characteristics of organic diodes and compare them with measurements of structures fabricated using MEH-PPV. The structures are designed so that all of the current is injected from one contact. The I{endash}V characteristics are considered as a function of the Schottky energy barrier to charge injection from the contact. Experimentally, the Schottky barrier is varied from essentially zero to more than 1 eV by using different metal contacts. A consistent description of the device I{endash}V characteristics is obtained as the Schottky barrier is varied from small values, less than about 0.4 eV, where the current flow is space-charge limited to larger values where it is contact limited. {copyright} {ital 1998 American Institute of Physics.}

  4. The Schottky energy barrier dependence of charge injection in organic light-emitting diodes

    Science.gov (United States)

    Campbell, I. H.; Davids, P. S.; Smith, D. L.; Barashkov, N. N.; Ferraris, J. P.

    1998-04-01

    We present device model calculations of the current-voltage (I-V) characteristics of organic diodes and compare them with measurements of structures fabricated using MEH-PPV. The structures are designed so that all of the current is injected from one contact. The I-V characteristics are considered as a function of the Schottky energy barrier to charge injection from the contact. Experimentally, the Schottky barrier is varied from essentially zero to more than 1 eV by using different metal contacts. A consistent description of the device I-V characteristics is obtained as the Schottky barrier is varied from small values, less than about 0.4 eV, where the current flow is space-charge limited to larger values where it is contact limited.

  5. Impact of physical properties of biodiesel on the injection process in a common-rail direct injection system

    International Nuclear Information System (INIS)

    Boudy, Frederic; Seers, Patrice

    2009-01-01

    This paper presents the influence of biodiesel fuel properties on the injection mass flow rate of a diesel common-rail injection system. Simulations are first performed with ISO 4113 diesel fuel on a four-cylinder common-rail system to evaluate a single and triple injection strategies. For each injection strategy, the impact of modifying a single fuel property at a time is evaluated so as to quantify its influence on the injection process. The results show that fuel density is the main property that affects the injection process, such as total mass injected and pressure wave in the common-rail system. The fuel's viscosity and bulk modulus also influence, but to a lessen degree, the mass flow rate of the injector notably during multiple injection strategies as individual properties change the fuel's dampening property and friction coefficient.

  6. Charge injection engineering of ambipolar field-effect transistors for high-performance organic complementary circuits.

    Science.gov (United States)

    Baeg, Kang-Jun; Kim, Juhwan; Khim, Dongyoon; Caironi, Mario; Kim, Dong-Yu; You, In-Kyu; Quinn, Jordan R; Facchetti, Antonio; Noh, Yong-Young

    2011-08-01

    Ambipolar π-conjugated polymers may provide inexpensive large-area manufacturing of complementary integrated circuits (CICs) without requiring micro-patterning of the individual p- and n-channel semiconductors. However, current-generation ambipolar semiconductor-based CICs suffer from higher static power consumption, low operation frequencies, and degraded noise margins compared to complementary logics based on unipolar p- and n-channel organic field-effect transistors (OFETs). Here, we demonstrate a simple methodology to control charge injection and transport in ambipolar OFETs via engineering of the electrical contacts. Solution-processed caesium (Cs) salts, as electron-injection and hole-blocking layers at the interface between semiconductors and charge injection electrodes, significantly decrease the gold (Au) work function (∼4.1 eV) compared to that of a pristine Au electrode (∼4.7 eV). By controlling the electrode surface chemistry, excellent p-channel (hole mobility ∼0.1-0.6 cm(2)/(Vs)) and n-channel (electron mobility ∼0.1-0.3 cm(2)/(Vs)) OFET characteristics with the same semiconductor are demonstrated. Most importantly, in these OFETs the counterpart charge carrier currents are highly suppressed for depletion mode operation (I(off) 0.1-0.2 mA). Thus, high-performance, truly complementary inverters (high gain >50 and high noise margin >75% of ideal value) and ring oscillators (oscillation frequency ∼12 kHz) based on a solution-processed ambipolar polymer are demonstrated.

  7. The impact of the Fermi-Dirac distribution on charge injection at metal/organic interfaces.

    Science.gov (United States)

    Wang, Z B; Helander, M G; Greiner, M T; Lu, Z H

    2010-05-07

    The Fermi level has historically been assumed to be the only energy-level from which carriers are injected at metal/semiconductor interfaces. In traditional semiconductor device physics, this approximation is reasonable as the thermal distribution of delocalized states in the semiconductor tends to dominate device characteristics. However, in the case of organic semiconductors the weak intermolecular interactions results in highly localized electronic states, such that the thermal distribution of carriers in the metal may also influence device characteristics. In this work we demonstrate that the Fermi-Dirac distribution of carriers in the metal has a much more significant impact on charge injection at metal/organic interfaces than has previously been assumed. An injection model which includes the effect of the Fermi-Dirac electron distribution was proposed. This model has been tested against experimental data and was found to provide a better physical description of charge injection. This finding indicates that the thermal distribution of electronic states in the metal should, in general, be considered in the study of metal/organic interfaces.

  8. Electrical and dielectric properties of foam injection-molded polypropylene/multiwalled carbon nanotube composites

    Energy Technology Data Exchange (ETDEWEB)

    Ameli, A.; Nofar, M.; Saniei, M.; Hossieny, N.; Park, C. B. [Microcellular Plastics Manufacturing Laboratory, Department of Mechanical and Industrial Engineering, University of Toronto, 5 King’s College Road, Toronto, Ontario, Canada M5S 3G8 (Canada); Pötschke, P. [Leibniz-Institut für Polymerforschung Dresden e.V. (IPF), Hohe Strasse 6, D-01069 Dresden (Germany)

    2015-05-22

    A combination of high dielectric permittivity (ε′) and low dielectric loss (tan δ) is required for charge storage applications. In percolative systems such as conductive polymer composites, however, obtaining high ε′ and low tan δ is very challenging due to the sharp insulation-conduction transition near the threshold region. Due to the particular arrangement of conductive fillers induced by both foaming and injection molding processes, they may address this issue. Therefore, this work evaluates the application of foam injection molding process in fabricating polymer nanocomposites for energy storage. Polypropylene-multiwalled carbon nanotubes (PP-MWCNT) composites were prepared by melt mixing and foamed in an injection molding process. Electrical conductivity (σ), ε′ and tan δ were then characterized. Also, scanning and transmission electron microscopy (SEM and TEM) was used to investigate the carbon nanotube’s arrangement as well as cellular morphology. The results showed that foam injection-molded composites exhibited highly superior dielectric properties to those of solid counterparts. For instance, foamed samples had ε′=68.3 and tan δ =0.05 (at 1.25 vol.% MWCNT), as opposed to ε′=17.8 and tan δ=0.04 in solid samples (at 2.56 vol.% MWCNT). The results of this work reveal that high performance dielectric nanocomposites can be developed using foam injection molding technologies for charge storage applications.

  9. Fusion plasma losses due to the charge exchange of injected neutrals

    International Nuclear Information System (INIS)

    Bender, D.J.; Carlson, G.A.

    1975-01-01

    The interaction of a neutral beam, consisting of full, half and third energy components, with a mirror plasma is analyzed. The beam-plasma interaction is assumed to occur via ionization and charge exchange collisions. The plasma was approximated as being spherical in shape, having a uniform density, isotropic velocity distribution, and a mirror plasma energy distribution. It was found that to a first approximation, for plasma energies less than 100 keV, the charge exchange power loss (per injected atom) of the half energy component is at least twice that of the full energy component. For the third energy component, the loss is at least three times that of the full energy component. For some plasma conditions, the neutral beam can act as an energy sink for the plasma due to these charge exchange losses. (U.S.)

  10. Density functional theory calculations of charge transport properties ...

    Indian Academy of Sciences (India)

    ZIRAN CHEN

    2017-08-04

    Aug 4, 2017 ... properties of 'plate-like' coronene topological structures ... Keywords. Organic semiconductors; density functional theory; charge carrier mobility; ambipolar transport; ..... nology Department of Sichuan Province (Grant Number.

  11. Long fiber polymer composite property calculation in injection molding simulation

    Science.gov (United States)

    Jin, Xiaoshi; Wang, Jin; Han, Sejin

    2013-05-01

    Long fiber filled polymer composite materials have attracted a great attention and usage in recent years. However, the injection and compression molded long fiber composite materials possess complex microstructures that include spatial variations in fiber orientation and length. This paper presents the recent implemented anisotropic rotary diffusion - reduced strain closure (ARD-RSC) model for predicting fiber orientation distribution[1] and a newly developed fiber breakage model[2] for predicting fiber length distribution in injection and compression molding simulation, and Eshelby-Mori-Tanaka model[3,4] with fiber-matrix de-bonding model[5] have been implemented to calculate the long fiber composite property distribution with predicted fiber orientation and fiber length distributions. A validation study on fiber orientation, fiber breakage and mechanical property distributions are given with injection molding process simulation.

  12. Measurements of Lunar Dust Charging Properties by Electron Impact

    Science.gov (United States)

    Abbas, Mian M.; Tankosic, Dragana; Craven, Paul D.; Schneider, Todd A.; Vaughn, Jason A.; LeClair, Andre; Spann, James F.; Norwood, Joseph K.

    2009-01-01

    Dust grains in the lunar environment are believed to be electrostatically charged predominantly by photoelectric emissions resulting from solar UV radiation on the dayside, and on the nightside by interaction with electrons in the solar wind plasma. In the high vacuum environment on the lunar surface with virtually no atmosphere, the positive and negative charge states of micron/submicron dust grains lead to some unusual physical and dynamical dust phenomena. Knowledge of the electrostatic charging properties of dust grains in the lunar environment is required for addressing their hazardous effect on the humans and mechanical systems. It is well recognized that the charging properties of individual small micron size dust grains are substantially different from the measurements on bulk materials. In this paper we present the results of measurements on charging of individual Apollo 11 and Apollo 17 dust grains by exposing them to mono-energetic electron beams in the 10-100 eV energy range. The charging/discharging rates of positively and negatively charged particles of approx. 0.1 to 5 micron radii are discussed in terms of the sticking efficiencies and secondary electron yields. The secondary electron emission process is found to be a complex and effective charging/discharging mechanism for incident electron energies as low as 10-25 eV, with a strong dependence on particle size. Implications of the laboratory measurements on the nature of dust grain charging in the lunar environment are discussed.

  13. Influence of negative charge on the optical properties of a silver sol

    Directory of Open Access Journals (Sweden)

    JOVAN M. NEDELJKOVIC

    2000-03-01

    Full Text Available The effects of negative charge on the optical properties of a silver sol prepared using sodium borohydride as a reductant were studied. The oscillations in the position of the maximum and the intensity of the surface plasmon absorption band were obesrved. The observed effects were explained as a consequence of the fluctuation of the density of free electrons due to the alternate charging and discharging of the silver particles. The charging process involves electron injection from borohydride ions and intermediate species formed during the course of the metal-catalyzed hydrolysis of borohydride ions (BH3OH-, BH2(OH2 and BH(OH3- into the silver particles, while discharge of the silver sol, by reduction of water to hydrogen, limits the attainable negative charge on the particles.

  14. The computation of properties of injection-moulded products

    NARCIS (Netherlands)

    Douven, L.F.A.; Baaijens, F.P.T.; Meijer, H.E.H.

    1995-01-01

    Injection moulding is a flexible production technique for the manufacture of complex shaped, thin walled polymer products that require minimal finishing. During processing, the polymer experiences a complex deformation and temperature history that affects the final properties of the product. In a

  15. Trapping-charging ability and electrical properties study of amorphous insulator by dielectric spectroscopy

    International Nuclear Information System (INIS)

    Mekni, Omar; Arifa, Hakim; Askri, Besma; Yangui, Béchir; Raouadi, Khaled; Damamme, Gilles

    2014-01-01

    Usually, the trapping phenomenon in insulating materials is studied by injecting charges using a Scanning Electron Microscope. In this work, we use the dielectric spectroscopy technique for showing a correlation between the dielectric properties and the trapping-charging ability of insulating materials. The evolution of the complex permittivity (real and imaginary parts) as a function of frequency and temperature reveals different types of relaxation according to the trapping ability of the material. We found that the space charge relaxation at low frequencies affects the real part of the complex permittivity ε ′ and the dissipation factor Tan(δ). We prove that the evolution of the imaginary part of the complex permittivity against temperature ε ″ =f(T) reflects the phenomenon of charge trapping and detrapping as well as trapped charge evolution Q p (T). We also use the electric modulus formalism to better identify the space charge relaxation. The investigation of trapping or conductive nature of insulating materials was mainly made by studying the activation energy and conductivity. The conduction and trapping parameters are determined using the Correlated Barrier Hopping (CBH) model in order to confirm the relation between electrical properties and charge trapping ability.

  16. A kinetic Monte Carlo model with improved charge injection model for the photocurrent characteristics of organic solar cells

    Science.gov (United States)

    Kipp, Dylan; Ganesan, Venkat

    2013-06-01

    We develop a kinetic Monte Carlo model for photocurrent generation in organic solar cells that demonstrates improved agreement with experimental illuminated and dark current-voltage curves. In our model, we introduce a charge injection rate prefactor to correct for the electrode grid-size and electrode charge density biases apparent in the coarse-grained approximation of the electrode as a grid of single occupancy, charge-injecting reservoirs. We use the charge injection rate prefactor to control the portion of dark current attributed to each of four kinds of charge injection. By shifting the dark current between electrode-polymer pairs, we align the injection timescales and expand the applicability of the method to accommodate ohmic energy barriers. We consider the device characteristics of the ITO/PEDOT/PSS:PPDI:PBTT:Al system and demonstrate the manner in which our model captures the device charge densities unique to systems with small injection energy barriers. To elucidate the defining characteristics of our model, we first demonstrate the manner in which charge accumulation and band bending affect the shape and placement of the various current-voltage regimes. We then discuss the influence of various model parameters upon the current-voltage characteristics.

  17. Effect of main injection timing for controlling the combustion phasing of a homogeneous charge compression ignition engine using a new dual injection strategy

    International Nuclear Information System (INIS)

    Das, Pranab; Subbarao, P.M.V.; Subrahmanyam, J.P.

    2015-01-01

    Highlights: • A new dual injection concept is developed by minimum geometry modification. • The occurrence of combustion parameters strongly depend on main injection timing. • At higher load, premixed equivalence ratio dominates over main injection timing. • Retarded of main injection timing tends to retard combustion phasing. • Slightly retarded main injection timing is recommended to avoid intense knocking. - Abstract: Homogeneous charge compression ignition combustion of diesel fuel is implemented using a novel dual injection strategy. A new experimental technique is developed to modify a single cylinder direct injection diesel engine to run on homogeneous combustion mode. Effect of main injection timing is investigated covering a range from 26 to 8 crank angle degrees before top dead center with an interval of 3°. Retarded main injection timing is identified as a control strategy for delaying combustion phasing and a means of controlled combustion phasing of direct injection homogeneous charge compression ignition combustion. Two load conditions were investigated and it was observed that at higher load, start of combustion depends more on fuel air equivalence ratio than main injection timing, whereas at low load, it significantly varies with varying main injection timing. Significant improvements in smoke and oxides of nitrogen emissions are observed when compared with the baseline conventional combustion. By studying different combustion parameters, it is observed that there is an improvement in performance and emissions with marginal loss in thermal efficiency when the main injection timing is 20° before top dead center. This is identified as the optimum main injection timing for such homogeneous combustion under the same operating condition

  18. Calibration by precise charge injection of a sub-detector of CMS; Calibration par injection de charge du calorimetre electromagnetique de CMS

    Energy Technology Data Exchange (ETDEWEB)

    Yong-Wook Baek

    2001-01-26

    This thesis was carried out within the framework of the international collaboration which has the responsibility of the experience CMS (Compact Muon Solenoid) on LHC, at CERN. The physics of the fundamental particles which will be explored by this experiment is described within the standard model. The configuration of sub-detector of CMS is briefly described, with a particular weight on the read-out chain of the electromagnetic calorimeter. The work carried out to calibrate this chain by a precise charge injection at the input of preamplifiers is described. The 4 integrated circuits CTRL, TPLS, DAC, and injector which will constitute the components of this chain of calibration are described. The circuit of injection, which is the main circuit in this project, was imagined and developed at the laboratory in DMILL technology. This injector generates a signal which has a form identical to the signal of the detector. The measurements on the linearity of the injectors are presented. In order to know its behavior under real conditions (flow of neutrons {approx} 2 x 10{sup 13} neutrons/cm{sup 2}/10 years) where this circuit is installed in detector CMS, we submitted the prototypes of injector to irradiation and the results are summarized. The research and development on this circuit produced an integrated circuit hardened to irradiations, whose variation of slope is lower than 0.25% for an integrated of 2 x 10{sup 13} neutrons/cm{sup 2} and indestructible under 10{sup 15} neutrons/cm{sup 2}. This circuit has satisfactory qualities to be assembled on the electronic card which will treat the data of calorimeter ECAL of CMS. (author)

  19. Effect of injection energy on residual dose around the charge exchange foil

    Directory of Open Access Journals (Sweden)

    Kazami Yamamoto

    2012-12-01

    Full Text Available The rapid cycling synchrotron (RCS of Japan Proton Accelerator Research Complex (J-PARC and the accumulator ring (AR of Spallation Neutron Source (SNS can be used as high-power pulsed neutron sources. In both cases, the injection region becomes one of the highest activation areas in the ring. However, residual dose distributions have revealed that the highest activation points in the J-PARC RCS and the SNS AR are different in detail. The dose of the charge exchange chamber in the SNS is more than 100 times larger than that of the RCS though the ratio of beam power is less than 10. We investigated the reason of this difference by Geant4 and MARS, and the calculation results indicated that the difference was due to the dependence of the neutron and pion production rate on the injection energy.

  20. Sensitized charge carrier injection into organic crystals studied by isotope effects in weak magnetic fields

    International Nuclear Information System (INIS)

    Bube, W.; Michel-Beyerle, M.E.; Haberkorn, R.; Steffens, E.

    1977-01-01

    The magnetic field (H approximately 50 Oe) dependence of the rhodamine sensitized triplet exciton density in anthracene crystals is influenced by isotopic substitution. This confirms the hyperfine interaction as mechanism explaining the change of the spin multiplicity in the initially formed singlet state of the radical pair. The isotope effect occurs in the sensitizing dye ( 14 N/ 15 N) rather than at the molecular site of the injected charge within the crystal. This can be understood in terms of the high hopping frequency of the charge carriers as compared to the time constant of the hyperfine induced singlet-triplet transition. Since the dye molecules adsorb in an oriented fashion, the angular dependence of the magnetic field modulation of the triplet exciton density can be interpreted without assuming any additional interactions. (Auth.)

  1. Distribution of separated energy and injected charge at normal falling of fast electron beam on target

    CERN Document Server

    Smolyar, V A; Eremin, V V

    2002-01-01

    In terms of a kinetic equation diffusion model for a beam of electrons falling on a target along the normal one derived analytical formulae for distributions of separated energy and injected charge. In this case, no empirical adjustable parameters are introduced to the theory. The calculated distributions of separated energy for an electron plate directed source within infinite medium for C, Al, Sn and Pb are in good consistency with the Spencer data derived on the basis of the accurate solution of the Bethe equation being the source one in assumption of a diffusion model, as well

  2. Distribution of separated energy and injected charge at normal falling of fast electron beam on target

    International Nuclear Information System (INIS)

    Smolyar, V.A.; Eremin, A.V.; Eremin, V.V.

    2002-01-01

    In terms of a kinetic equation diffusion model for a beam of electrons falling on a target along the normal one derived analytical formulae for distributions of separated energy and injected charge. In this case, no empirical adjustable parameters are introduced to the theory. The calculated distributions of separated energy for an electron plate directed source within infinite medium for C, Al, Sn and Pb are in good consistency with the Spencer data derived on the basis of the accurate solution of the Bethe equation being the source one in assumption of a diffusion model, as well [ru

  3. Performance and combustion characteristics of direct-injection stratified-charge rotary engines

    Science.gov (United States)

    Nguyen, Hung Lee

    1987-01-01

    Computer simulations of the direct-injection stratified-charge (DISC) Wankel engine have been used to calculate heat release rates and performance and efficiency characteristics of the 1007R engine. Engine pressure data have been used in a heat release analysis to study the effects of heat transfer, leakage, and crevice flows. Predicted engine performance data are compared with experimental test data over a range of engine speeds and loads. An examination of methods to improve the performance of the Wankel engine with faster combustion, reduced leakage, higher compression ratio, and turbocharging is presented.

  4. Study of static properties of magnetron-type space charges

    International Nuclear Information System (INIS)

    Delcroix, Jean-Loup

    1953-01-01

    This research thesis reports an in-depth analysis of physical properties of static regimes to address the issue of space charges. This theoretical study of the Hull magnetron is followed by the description of experiments on the Hull magnetron which highlight transitions between the different regimes. Then, another theoretical approach aims at generalising the magnetron theory, based on other types of magnetron theory (general equations of magnetron-type space charges, inverted Hull magnetron theory, circular field magnetron theory)

  5. Charge-transfer properties in the gas electron multiplier

    International Nuclear Information System (INIS)

    Han, Sanghyo; Kim, Yongkyun; Cho, Hyosung

    2004-01-01

    The charge transfer properties of a gas electron multiplier (GEM) were systematically investigated over a broad range of electric field configurations. The electron collection efficiency and the charge sharing were found to depend on the external fields, as well as on the GEM voltage. The electron collection efficiency increased with the collection field up to 90%, but was essentially independent of the drift field strength. A double conical GEM has a 10% gain increase with time due to surface charging by avalanche ions whereas this effect was eliminated with the cylindrical GEM. The positive-ion feedback is also estimated. (author)

  6. Temperature-dependent charge injection and transport in pentacene thin-film transistors

    International Nuclear Information System (INIS)

    Kim, Dong Wook; Shin, Hyunji; Choi, Jong Sun; Park, Ji-Ho; Park, Jaehoon

    2015-01-01

    The electrical characteristics of p-channel pentacene thin-film transistors (TFTs) were analyzed at different operating temperatures ranging from 253 to 353 K. An improvement in the drain current and field-effect mobility of the pentacene TFTs is observed with increasing temperature. From the Arrhenius plots of field-effect mobility extracted at various temperatures, a lower activation energy of 99.34 meV was obtained when the device is operating in the saturation region. Such observation is ascribed to the thermally activated hole transport through the pentacene grain boundaries. On the other hand, it was found that the Au/pentacene contact significantly affects the TFTs electrical characteristics in the linear region, which resulted in a higher activation energy. The activation energy based on the linear field-effect mobility, which increased from 344.61 to 444.70 meV with decreasing temperature, implies the charge-injection-limited electrical behavior of pentacene TFTs at low temperatures. The thermally induced electrical characteristic variations in pentacene TFTs can thus be studied through the temperature dependence of the charge injection and transport processes. (paper)

  7. Charge transfer and injection barrier at the metal-organic interfaces

    Science.gov (United States)

    Yan, Li

    2002-09-01

    The metal-organic interface plays a critical role in determining the functionality and performance of many innovative organic based devices. It has attracted extensive research interests in recent years. This thesis presents investigations of the electronic structures of organic materials, such as tris-(8-hydroxyquinoline) aluminum (Alq3) and copper phthalocyanine (CuPc), during their interface formation with metals. The characterization is accomplished by X-ray and ultraviolet photoelectron spectroscopes (XPS and UPS) and inverse photoelectron spectroscopy (IPES). As discussed herein, both occupied and unoccupied electronic states at the interfaces are carefully examined in different aspects. In Chapter 4, the charge transfer and chemical reaction at various metal/Alq3 interfaces are investigated using XPS and UPS to study the electron injection into the Alga film. Electron transfer from the low work function metal and Al/LiF(CsF) bilayer to the Alga has been observed. The role of the dielectric and possible chemistry at the interface are discussed in comparison of the low work function metals. Further in Chapter 5, the origin of the metal-interface dipole and the estimation of charge injection barrier is explored using several organic materials. A thermodynamic equilibrium model is extended to explain the relation between the charge transfer process ad the interface dipole. Further, in Chapter 6 the combination of XPS, UPS and IPES detailed the evolution of both occupied and unoccupied energy states during the alkali metal doping. The energy gap modification in organic due to metal doping is observed directly for the spectra. Chapter 7 provides stability study of the organic thin films under x-ray and UV light. The results verify the usability of UPS and XPS for the organic materials used in the thesis. Chapter 7 also shows the secondary ion mass spectroscopy results of metal diffusion in organic thin films.

  8. Construction of a Direct Water-Injected Two-Stroke Engine for Phased Direct Fuel Injection-High Pressure Charging Investigations

    Science.gov (United States)

    Somsel, James P.

    1998-01-01

    The development of a water injected Orbital Combustion Process (OCP) engine was conducted to assess the viability of using the powerplant for high altitude NASA aircraft and General Aviation (GA) applications. An OCP direct fuel injected, 1.2 liter, three cylinder, two-stroke engine has been enhanced to independently inject water directly into the combustion chamber. The engine currently demonstrates low brake specific fuel consumption capability and an excellent power to weight ratio. With direct water injection, significant improvements can be made to engine power, to knock limits/ignition advance timing, and to engine NO(x) emissions. The principal aim of the testing was to validate a cyclic model developed by the Systems Analysis Branch at NASA Ames Research Center. The work is a continuation of Ames' investigations into a Phased Direct Fuel Injection Engine with High Pressure Charging (PDFI-ITPC).

  9. Multifunctional hybrid diode: Study of photoresponse, high responsivity, and charge injection mechanisms

    Science.gov (United States)

    Singh, Jitendra; Singh, R. G.; Gautam, Subodh K.; Singh, Fouran

    2018-05-01

    A multifunctional hybrid heterojunction diode is developed on porous silicon and its current density-voltage characteristics reveal a good rectification ratio along with other superior parameters such as ideality factor, barrier height and series resistance. The diode also functions as an efficient photodiode to manifest high photosensitivity with high responsivity under illumination with broadband solar light, UV light, and green light. The diode is also carefully scrutinized for its sensitivity and repeatability over many cycles under UV and green light and is found to have a quick response and extremely fast recovery times. The notable responsivity is attributed to the generation of high density of excitons in the depletion region by the absorption of incident photons and their separation by an internal electric field besides an additional photocurrent due to the charging of polymer chains. The mechanisms of generation, injection and transport of charge carriers are explained by developing a schematic energy band diagram. The transport phenomenon of carriers is further investigated from room temperature down to a very low temperature of 10 K. An Arrhenius plot is made to determine the Richardson constant. Various diode parameters as mentioned above are also determined and the dominance of the transport mechanism of charge carriers in different temperature regimes such as diffusion across the junction and/or quantum tunneling through the barriers are explained. The developed multifunction heterojunction hybrid diodes have implications for highly sensitive photodiodes in the UV and visible range of electromagnetic spectrum that can be very promising for efficient optoelectronic devices.

  10. Spin properties of charged Mn-doped quantum dota)

    Science.gov (United States)

    Besombes, L.; Léger, Y.; Maingault, L.; Mariette, H.

    2007-04-01

    The optical properties of individual quantum dots doped with a single Mn atom and charged with a single carrier are analyzed. The emission of the neutral, negatively and positively charged excitons coupled with a single magnetic atom (Mn) are observed in the same individual quantum dot. The spectrum of the charged excitons in interaction with the Mn atom shows a rich pattern attributed to a strong anisotropy of the hole-Mn exchange interaction slightly perturbed by a small valence-band mixing. The anisotropy in the exchange interaction between a single magnetic atom and a single hole is revealed by comparing the emission of a charged Mn-doped quantum dot in longitudinal and transverse magnetic field.

  11. Bulk-Like Electrical Properties Induced by Contact-Limited Charge Transport in Organic Diodes: Revised Space Charge Limited Current

    KAUST Repository

    Xu, Guangwei; Gao, Nan; Lu, Congyan; Wang, Wei; Ji, Zhuoyu; Bi, Chong; Han, Zhiheng; Lu, Nianduan; Yang, Guanhua; Li, Yuan; Liu, Qi; Li, Ling; Liu, Ming

    2018-01-01

    , the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I

  12. Physical properties of charged particle beams for use in radiotherapy

    International Nuclear Information System (INIS)

    Knapp, E.A.

    1975-01-01

    The physical properties of the possible charged particle beams used for cancer radiotherapy are reviewed. Each property is discussed for all interesting particles (π, p, α, Ne ion) and the differences are emphasized. This is followed by a short discussion of the several beam delivery systems used in particle therapy today, emphasizing the differences in the problems for the several different radiations, particularly the differences between the accelerated particle beams and those of a secondary nature. Dose calculation techniques are described

  13. Fuel-air mixing and distribution in a direct-injection stratified-charge rotary engine

    Science.gov (United States)

    Abraham, J.; Bracco, F. V.

    1989-01-01

    A three-dimensional model for flows and combustion in reciprocating and rotary engines is applied to a direct-injection stratified-charge rotary engine to identify the main parameters that control its burning rate. It is concluded that the orientation of the six sprays of the main injector with respect to the air stream is important to enhance vaporization and the production of flammable mixture. In particular, no spray should be in the wake of any other spray. It was predicted that if such a condition is respected, the indicated efficiency would increase by some 6 percent at higher loads and 2 percent at lower loads. The computations led to the design of a new injector tip that has since yielded slightly better efficiency gains than predicted.

  14. Performance of a supercharged direct-injection stratified-charge rotary combustion engine

    Science.gov (United States)

    Bartrand, Timothy A.; Willis, Edward A.

    1990-01-01

    A zero-dimensional thermodynamic performance computer model for direct-injection stratified-charge rotary combustion engines was modified and run for a single rotor supercharged engine. Operating conditions for the computer runs were a single boost pressure and a matrix of speeds, loads and engine materials. A representative engine map is presented showing the predicted range of efficient operation. After discussion of the engine map, a number of engine features are analyzed individually. These features are: heat transfer and the influence insulating materials have on engine performance and exhaust energy; intake manifold pressure oscillations and interactions with the combustion chamber; and performance losses and seal friction. Finally, code running times and convergence data are presented.

  15. A study of a direct-injection stratified-charge rotary engine for motor vehicle application

    Science.gov (United States)

    Kagawa, Ryoji; Okazaki, Syunki; Somyo, Nobuhiro; Akagi, Yuji

    1993-03-01

    A study of a direct-injection stratified-charge system (DISC), as applied to a rotary engine (RE) for motor vehicle usage, was undertaken. The goals of this study were improved fuel consumption and reduced exhaust emissions. These goals were thought feasible due to the high thermal efficiency associated with the DISC-RE. This was the first application of this technology to a motor vehicle engine. Stable ignition and ideal stratification systems were developed by means of numerical calculations, air-fuel mixture measurements, and actual engine tests. The use of DISC resulted in significantly improved fuel consumption and reduced exhaust emissions. The use of an exhaust gas recirculating system was studied and found to be beneficial in NOx reduction.

  16. Organic integrated circuits for information storage based on ambipolar polymers and charge injection engineering

    Science.gov (United States)

    Dell'Erba, Giorgio; Luzio, Alessandro; Natali, Dario; Kim, Juhwan; Khim, Dongyoon; Kim, Dong-Yu; Noh, Yong-Young; Caironi, Mario

    2014-04-01

    Ambipolar semiconducting polymers, characterized by both high electron (μe) and hole (μh) mobility, offer the advantage of realizing complex complementary electronic circuits with a single semiconducting layer, deposited by simple coating techniques. However, to achieve complementarity, one of the two conduction paths in transistors has to be suppressed, resulting in unipolar devices. Here, we adopt charge injection engineering through a specific interlayer in order to tune injection into frontier energy orbitals of a high mobility donor-acceptor co-polymer. Starting from field-effect transistors with Au contacts, showing a p-type unbalanced behaviour with μh = 0.29 cm2/V s and μe = 0.001 cm2/V s, through the insertion of a caesium salt interlayer with optimized thickness, we obtain an n-type unbalanced transistor with μe = 0.12 cm2/V s and μh = 8 × 10-4 cm2/V s. We applied this result to the development of the basic pass-transistor logic building blocks such as inverters, with high gain and good noise margin, and transmission-gates. In addition, we developed and characterized information storage circuits like D-Latches and D-Flip-Flops consisting of 16 transistors, demonstrating both their static and dynamic performances and thus the suitability of this technology for more complex circuits such as display addressing logic.

  17. Contact engineering for efficient charge injection in organic transistors with low-cost metal electrodes

    Science.gov (United States)

    Panigrahi, D.; Kumar, S.; Dhar, A.

    2017-10-01

    Controlling charge injection at the metal-semiconductor interface is very crucial for organic electronic devices in general as it can significantly influence the overall device performance. Herein, we report a facile, yet efficient contact modification approach, to enhance the hole injection efficiency through the incorporation of a high vacuum deposited TPD [N,N'-Bis(3-methylphenyl)-N,N'-diphenylbenzidine] interlayer between the electrodes and the active semiconducting layer. The device performance parameters such as mobility and on/off ratio improved significantly after the inclusion of the TPD buffer layer, and more interestingly, the devices with cost effective Ag and Cu electrodes were able to exhibit a superior device performance than the typically used Au source-drain devices. We have also observed that this contact modification technique can be even more effective than commonly used metal oxide interface modifying layers. Our investigations demonstrate the efficacy of the TPD interlayer in effectively reducing the interfacial contact resistance through the modification of pentacene energy levels, which consequently results in the substantial improvement in the device performances.

  18. Charge transfer properties of pentacene adsorbed on silver: DFT study

    Energy Technology Data Exchange (ETDEWEB)

    N, Rekha T.; Rajkumar, Beulah J. M., E-mail: beulah-rajkumar@yahoo.co.in [PG & Research Department of Physics, Lady Doak College, Madurai 625002 (India)

    2015-06-24

    Charge transfer properties of pentacene adsorbed on silver is investigated using DFT methods. Optimized geometry of pentacene after adsorption on silver indicates distortion in hexagonal structure of the ring close to the silver cluster and deviations in co-planarity of carbon atoms due to the variations in bond angles and dihedral angles. Theoretically simulated absorption spectrum has a symmetric surface plasmon resonance peak around 486nm corresponding to the transfer of charge from HOMO-2 to LUMO. Theoretical SERS confirms the process of adsorption, tilted orientation of pentacene on silver surface and the charge transfers reported. Localization of electron density arising from redistribution of electrostatic potential together with a reduced bandgap of pentacene after adsorption on silver suggests its utility in the design of electro active organic semiconducting devices.

  19. Chemical linkage to injected tissues is a distinctive property of oxidized avidin.

    Directory of Open Access Journals (Sweden)

    Rita De Santis

    Full Text Available We recently reported that the oxidized avidin, named AvidinOX®, resides for weeks within injected tissues as a consequence of the formation of Schiff's bases between its aldehyde groups and tissue protein amino groups. We also showed, in a mouse pre-clinical model, the usefulness of AvidinOX for the delivery of radiolabeled biotin to inoperable tumors. Taking into account that AvidinOX is the first oxidized glycoprotein known to chemically link to injected tissues, we tested in the mouse a panel of additional oxidized glycoproteins, with the aim of investigating the phenomenon. We produced oxidized ovalbumin and mannosylated streptavidin which share with avidin glycosylation pattern and tetrameric structure, respectively and found that neither of them linked significantly to cells in vitro nor to injected tissues in vivo, despite the presence of functional aldehyde groups. The study, extended to additional oxidized glycoproteins, showed that the in vivo chemical conjugation is a distinctive property of the oxidized avidin. Relevance of the high cationic charge of avidin into the stable linkage of AvidinOX to tissues is demonstrated as the oxidized acetylated avidin lost the property. Plasmon resonance on matrix proteins and cellular impedance analyses showed in vitro that avidin exhibits a peculiar interaction with proteins and cells that allows the formation of highly stable Schiff's bases, after oxidation.

  20. Electronic properties of mesoscopic graphene structures: Charge confinement and control of spin and charge transport

    Energy Technology Data Exchange (ETDEWEB)

    Rozhkov, A.V., E-mail: arozhkov@gmail.co [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Institute for Theoretical and Applied Electrodynamics, Russian Academy of Sciences, 125412, Moscow (Russian Federation); Giavaras, G. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Bliokh, Yury P. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Technion-Israel Institute of Technology, Haifa 32000 (Israel); Freilikher, Valentin [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Bar-Ilan University, Ramat-Gan 52900 (Israel); Nori, Franco [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, University of Michigan, Ann Arbor, MI 48109-1040 (United States)

    2011-06-15

    This brief review discusses electronic properties of mesoscopic graphene-based structures. These allow controlling the confinement and transport of charge and spin; thus, they are of interest not only for fundamental research, but also for applications. The graphene-related topics covered here are: edges, nanoribbons, quantum dots, pn-junctions, pnp-structures, and quantum barriers and waveguides. This review is partly intended as a short introduction to graphene mesoscopics.

  1. Plasma dynamics near an earth satellite and neutralization of its electric charge during electron beam injection into the ionosphere

    International Nuclear Information System (INIS)

    Fedorov, V.A.

    2000-01-01

    A study is made of the dynamics of the ionospheric plasma in the vicinity of an earth satellite injecting an electron beam. The time evolution of the electric charge of the satellite is determined. The electric potential of the satellite is found to be well below the beam-cutoff potential. It is shown that, under conditions typical of active experiments in space, the plasma electrons are capable of neutralizing the satellite's charge

  2. Structural properties of water around uncharged and charged carbon nanotubes

    International Nuclear Information System (INIS)

    Dezfoli, Amir Reza Ansari; Mehrabian, Mozaffar Ali; Rafsanjani, Hassan Hashemipour

    2013-01-01

    Studying the structural properties of water molecules around the carbon nanotubes is very important in a wide variety of carbon nanotubes applications. We studied the number of hydrogen bonds, oxygen and hydrogen density distributions, and water orientation around carbon nanotubes. The water density distribution for all carbon nanotubes was observed to have the same feature. In water-carbon nanotubes interface, a high-density region of water molecules exists around carbon nanotubes. The results reveal that the water orientation around carbon nanotubes is roughly dependent on carbon nanotubes surface charge. The water molecules in close distances to carbon nanotubes were found to make an HOH plane nearly perpendicular to the water-carbon nanotubes interface for carbon nanotubes with negative surface charge. For uncharged carbon nanotubes and carbon nanotubes with positive surface charge, the HOH plane was in tangential orientation with water-carbon nanotubes interface. There was also a significant reduction in hydrogen bond of water region around carbon nanotubes as compared with hydrogen bond in bulk water. This reduction was very obvious for carbon nanotubes with positive surface charge. In addition, the calculation of dynamic properties of water molecules in water-CNT interface revealed that there is a direct relation between the number of Hbonds and self-diffusion coefficient of water molecules

  3. The influence of charge injection from intermediate connectors on the performance of tandem organic light-emitting devices

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Dong-Ying [Institute of Functional Nano and Soft Materials (FUNSOM), Soochow University, Suzhou, Jiangsu 215123 (China); Department of Electrical and Computer Engineering and Waterloo Institute for Nanotechnology, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada); Siboni, Hossein Zamani; Wang, Qi; Aziz, Hany, E-mail: lsliao@suda.edu.cn, E-mail: h2aziz@uwaterloo.ca [Department of Electrical and Computer Engineering and Waterloo Institute for Nanotechnology, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada); Liao, Liang-Sheng, E-mail: lsliao@suda.edu.cn, E-mail: h2aziz@uwaterloo.ca [Institute of Functional Nano and Soft Materials (FUNSOM), Soochow University, Suzhou, Jiangsu 215123 (China)

    2014-12-14

    Charge generation in a typical intermediate connector, composed of “n-type doped layer/transition metal oxide (TMO)/hole transporting layer (HTL),” of a tandem organic light-emitting device (OLED) has recently been found to arise from charge transfer at the TMO/HTL interfaces. In this paper, we investigate the effect of hole injection barriers from intermediate connectors on the performance of tandem OLEDs. The hole injection barriers are caused by the offset of the highest occupied molecular orbital (HOMO) energy levels between HTLs contained in the intermediate connector and the top electroluminescence (EL) unit. We also find that although charge generation can occur at the interfaces between the TMO and a wide variety of HTLs of different HOMO values, an increase in the hole injection barrier however limits the electroluminescence efficiency of the top EL units. In the case of large hole injection barriers, significant charge accumulation in the HTLs makes the intermediate connector lose its functionality gradually over operating time, and limits device stability.

  4. Manipulation of charge carrier injection into organic field-effect transistors by self-assembled monolayers of alkanethiols

    NARCIS (Netherlands)

    Asadi, Kamal; Gholamrezaie, Fatemeh; Smits, Edsger C. P.; Blom, Paul W. M.; de Boer, Bert

    2007-01-01

    Charge carrier injection into two semiconducting polymers is investigated in field-effect transistors using gold source and drain electrodes that are modified by self-assembled monolayers of alkanethiols and perfluorinated alkanethiols. The presence of an interfacial dipole associated with the

  5. Organic integrated circuits for information storage based on ambipolar polymers and charge injection engineering

    Energy Technology Data Exchange (ETDEWEB)

    Dell' Erba, Giorgio; Natali, Dario [Center for Nano Science and Technology PoliMi, Istituto Italiano di Tecnologia, Via Pascoli 70/3, 20133 Milano (Italy); Dipartimento di Elettronica, Informazione e Bioingegneria, Politecnico di Milano, Piazza L. da Vinci 32, 20133 Milano (Italy); Luzio, Alessandro; Caironi, Mario, E-mail: mario.caironi@iit.it, E-mail: yynoh@dongguk.edu [Center for Nano Science and Technology PoliMi, Istituto Italiano di Tecnologia, Via Pascoli 70/3, 20133 Milano (Italy); Kim, Juhwan; Khim, Dongyoon; Kim, Dong-Yu [Heeger Center for Advanced Materials, School of Materials Science and Engineering, Gwangju Institute of Science and Technology (GIST), 261 Cheomdan-gwagiro, Buk-gu, Gwangju 500-712 (Korea, Republic of); Noh, Yong-Young, E-mail: mario.caironi@iit.it, E-mail: yynoh@dongguk.edu [Department of Energy and Materials Engineering, Dongguk University, 26 Pil-dong, 3-ga, Jung-gu, Seoul 100-715 (Korea, Republic of)

    2014-04-14

    Ambipolar semiconducting polymers, characterized by both high electron (μ{sub e}) and hole (μ{sub h}) mobility, offer the advantage of realizing complex complementary electronic circuits with a single semiconducting layer, deposited by simple coating techniques. However, to achieve complementarity, one of the two conduction paths in transistors has to be suppressed, resulting in unipolar devices. Here, we adopt charge injection engineering through a specific interlayer in order to tune injection into frontier energy orbitals of a high mobility donor-acceptor co-polymer. Starting from field-effect transistors with Au contacts, showing a p-type unbalanced behaviour with μ{sub h} = 0.29 cm{sup 2}/V s and μ{sub e} = 0.001 cm{sup 2}/V s, through the insertion of a caesium salt interlayer with optimized thickness, we obtain an n-type unbalanced transistor with μ{sub e} = 0.12 cm{sup 2}/V s and μ{sub h} = 8 × 10{sup −4} cm{sup 2}/V s. We applied this result to the development of the basic pass-transistor logic building blocks such as inverters, with high gain and good noise margin, and transmission-gates. In addition, we developed and characterized information storage circuits like D-Latches and D-Flip-Flops consisting of 16 transistors, demonstrating both their static and dynamic performances and thus the suitability of this technology for more complex circuits such as display addressing logic.

  6. Charge transport properties in microcrystalline KDyFe(China)6

    International Nuclear Information System (INIS)

    Aubert, P.H.; Goubard, F.; Chevrot, C.; Tabuteau, A.

    2007-01-01

    Microcrystalline solid dysprosium(III) hexacyanoferrate(II) was synthesized by co-precipitation in aqueous solution. The resulting solid has been studied by Fourier transform infrared spectroscopy, X-ray analysis and solid state electrochemistry. The use of a cavity microelectrode was necessary to explore a wide range of time scale and minimize the (undesired) capacitive currents. Cyclic voltametric experiments were very helpful to understand the kinetic of charge transfer in such microstructure. A structure-properties relationship has been established from the crystallographic and the electrochemical properties. A square-scheme is presented to explain the unique electrochemical behavior of hexacyanoferrate containing dysprosium since this compound exhibits a second redox system. The solid presents an open channel-like morphology in which the motion of charged species occurs during the redox processes. Precisely, the electronic transfer is accompanied by a cation diffusion inside the microcrystalline structure. The size of these channels strongly suggests that the kinetic of charge transfer is limited by the cation transport into these structures. - Graphical abstract: Dy and Fe polyhedra packing in the cell of KDyFe(China) 6 .3.5H 2 O shows occluded water molecules and potassium ions forming a pseudohexagonal 2D sub-lattice connected to each other by diffusion channels

  7. Charge Carrier Transport Properties of Vacuum Evaporated Anthrylvinylbenzene Thin Films

    Directory of Open Access Journals (Sweden)

    Haikel HRICHI

    2014-05-01

    Full Text Available The charge carrier conduction processes and dielectric properties of two new materials based on anthracene core structure, 1-(9 anthrylvinyl-4-benzyloxybenzene (AVB and 1,4- bis(9-anthrylvinylbenzene (AV2B diodes have been investigated using dc current density–voltage (J–V and AC impedance spectroscopy (100 Hz–10 MHz. The DC electrical properties of ITO/anthracene derivative /Al device showing an ohmic behavior at low voltages and switches to space charge limited current (SCLC conduction with exponential trap distribution at higher voltages. The best performance device was achieved from ITO/AVB/Al structure showing the high charge carrier mobility which has also been evaluated from SCLC as 6.55´10-6 cm/Vs. According to the impedance spectroscopy results the structures were modeled by equivalent circuit designed as a parallel resistor Rp and capacitor Cp network in series with resistor Rs. The evolution of the electrical parameters with frequency and bias voltage of these anthracene-based systems has been discussed. The conductivity s(w evolution with frequency and bias voltage was studied for ITO/anthracene derivatives/Al devices. The dc conductivity sdc for these devices has been determined. The ac conductivity sac showed a variation in angular frequency as A.ws with a critical exponent s< 1 suggesting a hopping conduction mechanism at high frequency.

  8. Ultrahigh mobility and efficient charge injection in monolayer organic thin-film transistors on boron nitride.

    Science.gov (United States)

    He, Daowei; Qiao, Jingsi; Zhang, Linglong; Wang, Junya; Lan, Tu; Qian, Jun; Li, Yun; Shi, Yi; Chai, Yang; Lan, Wei; Ono, Luis K; Qi, Yabing; Xu, Jian-Bin; Ji, Wei; Wang, Xinran

    2017-09-01

    Organic thin-film transistors (OTFTs) with high mobility and low contact resistance have been actively pursued as building blocks for low-cost organic electronics. In conventional solution-processed or vacuum-deposited OTFTs, due to interfacial defects and traps, the organic film has to reach a certain thickness for efficient charge transport. Using an ultimate monolayer of 2,7-dioctyl[1]benzothieno[3,2- b ][1]benzothiophene (C 8 -BTBT) molecules as an OTFT channel, we demonstrate remarkable electrical characteristics, including intrinsic hole mobility over 30 cm 2 /Vs, Ohmic contact with 100 Ω · cm resistance, and band-like transport down to 150 K. Compared to conventional OTFTs, the main advantage of a monolayer channel is the direct, nondisruptive contact between the charge transport layer and metal leads, a feature that is vital for achieving low contact resistance and current saturation voltage. On the other hand, bilayer and thicker C 8 -BTBT OTFTs exhibit strong Schottky contact and much higher contact resistance but can be improved by inserting a doped graphene buffer layer. Our results suggest that highly crystalline molecular monolayers are promising form factors to build high-performance OTFTs and investigate device physics. They also allow us to precisely model how the molecular packing changes the transport and contact properties.

  9. Optimization of the charge-carrier injection in organic light-emitting diodes; Optimierung der Ladungstraegerinjektion in organische Leuchtdioden

    Energy Technology Data Exchange (ETDEWEB)

    Krause, Ralf

    2009-07-01

    Nowadays based on resource shortage and climate warming there is a big interest in the use of power-saving lighting sources. Therefore the research on white organic light emitting devices (OLEDs) has gained importance during the last years. To obtain high power efficiencies in OLEDs it is necessary to provide low driving voltages. That can be realised by the use of doped transport layers, in which donors and acceptors are coevaporated with organic transport materials. In this thesis I discuss novel p-type and n-type doping materials for small organic molecules which decrease the ohmic loss in organic transport layers used in OLEDs. This reduction of the resistance is caused by an increase of the intrinsic charge carrier density and therefore an increase of the conductivity. First single layer devices are used to analyse the properties of potential doping materials by varying the doping concentration. The tested p-doping materials are commercially available metal oxides (MoO{sub 3} and Re{sub 2}O{sub 7}) and metal-organic complexes. Both metal oxides show a strong conductivity improvement of up to 7 orders of magnitude. The investigated n-doping materials are alkali salts, metal-organic and organic complexes. Among the alkali salts Cs{sub 2}CO{sub 3} is the best material in test with a conductivity enhancement of up to 7 orders of magnitude. For this material class I focused on the question whether the metal cation or the organic anion causes the doping effect. Using similar Caesium salts differently strong doping effects were obtained. Therefore I came to the conclusion that beside the metal cation also the anion plays a role for the doping effect. Secondly I performed a series of multilayer devices for two doping materials (Re{sub 2}O{sub 7} as acceptor and Cs{sub 2}CO{sub 3} as donor) to separate the transport and injection enhancement. The results show that a doped transport layer improves the hole or electron injection into an undoped material by several orders

  10. Treatment of H0 and H- beams spilled at the stripper foil at full energy charge-exchange injection scheme

    International Nuclear Information System (INIS)

    Yamane, Isao

    1991-01-01

    The charge-exchange injection into a synchrotron to generate high-intensity pulsed proton beams for a spallation neutron source is reviewed while focusing on the treatment of H 0 and H - beams spilled at the stripper foil. After charge-exchange injection is briefly outlined, scattering by foil atoms and causes to spill H 0 and H - beams are described. These spilled beams can amount to several μA and should be carefully treated. It is then shown that a direct H - injection system needs to be considerably long and requires a very long straight section. Because of its simplicity, two-step H 0 injection has very wide applicability to various types of rings. However, it has a problem of emittance growth due to angular divergence in the stripper magnet and an ionoptical mismatch at the stripper foil. These problems are discussed, including a new proposal for a measure to remedy this problem. The laser photoionization injection is also briefly mentioned. (author)

  11. Electronic properties of disordered Weyl semimetals at charge neutrality

    Science.gov (United States)

    Holder, Tobias; Huang, Chia-Wei; Ostrovsky, Pavel M.

    2017-11-01

    Weyl semimetals have been intensely studied as a three-dimensional realization of a Dirac-like excitation spectrum where the conduction bands and valence bands touch at isolated Weyl points in momentum space. Like in graphene, this property entails various peculiar electronic properties. However, recent theoretical studies have suggested that resonant scattering from rare regions can give rise to a nonzero density of states even at charge neutrality. Here, we give a detailed account of this effect and demonstrate how the semimetallic nature is suppressed at the lowest scales. To this end, we develop a self-consistent T -matrix approach to investigate the density of states beyond the limit of weak disorder. Our results show a nonvanishing density of states at the Weyl point, which exhibits a nonanalytic dependence on the impurity density. This unusually strong effect of rare regions leads to a revised estimate for the conductivity close to the Weyl point and emphasizes possible deviations from semimetallic behavior in dirty Weyl semimetals at charge neutrality even with very low impurity concentration.

  12. Simulation study of signal formation in position sensitive planar p-on-n silicon detectors after short range charge injection

    International Nuclear Information System (INIS)

    Peltola, T.; Eremin, V.; Verbitskaya, E.; Härkönen, J.

    2017-01-01

    Segmented silicon detectors (micropixel and microstrip) are the main type of detectors used in the inner trackers of Large Hadron Collider (LHC) experiments at CERN. Due to the high luminosity and eventual high fluence of energetic particles, detectors with fast response to fit the short shaping time of 20–25 ns and sufficient radiation hardness are required. Charge collection measurements carried out at the Ioffe Institute have shown a reversal of the pulse polarity in the detector response to short-range charge injection. Since the measured negative signal is about 30–60% of the peak positive signal, the effect strongly reduces the CCE even in non-irradiated detectors. For further investigation of the phenomenon the measurements have been reproduced by TCAD simulations. As for the measurements, the simulation study was applied for the p-on-n strip detectors similar in geometry to those developed for the ATLAS experiment and for the Ioffe Institute designed p-on-n strip detectors with each strip having a window in the metallization covering the p + implant, allowing the generation of electron-hole pairs under the strip implant. Red laser scans across the strips and the interstrip gap with varying laser diameters and Si-SiO 2 interface charge densities ( Q f ) were carried out. The results verify the experimentally observed negative response along the scan in the interstrip gap. When the laser spot is positioned on the strip p + implant the negative response vanishes and the collected charge at the active strip increases respectively. The simulation results offer a further insight and understanding of the influence of the oxide charge density in the signal formation. The main result of the study is that a threshold value of Q f , that enables negligible losses of collected charges, is defined. The observed effects and details of the detector response for different charge injection positions are discussed in the context of Ramo's theorem.

  13. Simulation study of signal formation in position sensitive planar p-on-n silicon detectors after short range charge injection

    Science.gov (United States)

    Peltola, T.; Eremin, V.; Verbitskaya, E.; Härkönen, J.

    2017-09-01

    Segmented silicon detectors (micropixel and microstrip) are the main type of detectors used in the inner trackers of Large Hadron Collider (LHC) experiments at CERN. Due to the high luminosity and eventual high fluence of energetic particles, detectors with fast response to fit the short shaping time of 20-25 ns and sufficient radiation hardness are required. Charge collection measurements carried out at the Ioffe Institute have shown a reversal of the pulse polarity in the detector response to short-range charge injection. Since the measured negative signal is about 30-60% of the peak positive signal, the effect strongly reduces the CCE even in non-irradiated detectors. For further investigation of the phenomenon the measurements have been reproduced by TCAD simulations. As for the measurements, the simulation study was applied for the p-on-n strip detectors similar in geometry to those developed for the ATLAS experiment and for the Ioffe Institute designed p-on-n strip detectors with each strip having a window in the metallization covering the p+ implant, allowing the generation of electron-hole pairs under the strip implant. Red laser scans across the strips and the interstrip gap with varying laser diameters and Si-SiO2 interface charge densities (Qf) were carried out. The results verify the experimentally observed negative response along the scan in the interstrip gap. When the laser spot is positioned on the strip p+ implant the negative response vanishes and the collected charge at the active strip increases respectively. The simulation results offer a further insight and understanding of the influence of the oxide charge density in the signal formation. The main result of the study is that a threshold value of Qf, that enables negligible losses of collected charges, is defined. The observed effects and details of the detector response for different charge injection positions are discussed in the context of Ramo's theorem.

  14. Effect of Coercive Voltage and Charge Injection on Performance of a Ferroelectric-Gate Thin-Film Transistor

    Directory of Open Access Journals (Sweden)

    P. T. Tue

    2013-01-01

    Full Text Available We adopted a lanthanum oxide capping layer between semiconducting channel and insulator layers for fabrication of a ferroelectric-gate thin-film transistor memory (FGT which uses solution-processed indium-tin-oxide (ITO and lead-zirconium-titanate (PZT film as a channel layer and a gate insulator, respectively. Good transistor characteristics such as a high “on/off” current ratio, high channel mobility, and a large memory window of 108, 15.0 cm2 V−1 s−1, and 3.5 V were obtained, respectively. Further, a correlation between effective coercive voltage, charge injection effect, and FGT’s memory window was investigated. It is found that the charge injection from the channel to the insulator layer, which occurs at a high electric field, dramatically influences the memory window. The memory window’s enhancement can be explained by a dual effect of the capping layer: (1 a reduction of the charge injection and (2 an increase of effective coercive voltage dropped on the insulator.

  15. Fault injection as a test method for an FPGA in charge of data readout for a large tracking detector

    CERN Document Server

    Roed, K; Richter, M; Fehlker, D; Helstrup, H; Alme, J; Ullaland, K

    2011-01-01

    This paper describes how fault injection has been implemented as a test method for an FPGA in an existing hardware configuration setup. As this FPGA is in charge of data readout for a large tracking detector, the reliability of this FPGA is of high importance. Due to the complexity of the readout electronics, irradiation testing is technically difficult at this stage of the system commissioning. The work presented in this paper is therefore motivated by introducing fault injection as an alternative method to characterize failures caused by SEUs. It is a method to study the effect that a configuration upset may have on the operation of the FPGA. The target platform consists of two independent modules for data acquisition and detector control functionality. Fault injection to test the response of the data acquisition module is made possible by implementing the solution as part of the detector control functionality. Correct implementation is validated by a simple shift register design. Our results demonstrate th...

  16. i-CELIV technique for investigation of charge carriers transport properties

    Energy Technology Data Exchange (ETDEWEB)

    Važgėla, J., E-mail: julius.vazgela@ff.vu.lt; Genevičius, K.; Juška, G.

    2016-10-20

    The extraction of the injected charge carriers by linearly increasing voltage (i-CELIV) is a promising method for separate analysis of the holes and electrons transport properties in the bulk heterojunction layers. We are demonstrating how to establish the mobility dependence on the electric field and obtain more precise results by performing corrections in transit time by this technique. [6,6]-Phenyl C61 butyric acid methyl ester (PCBM) and poly[2,6-(4,4-bis-(2-ethylhexyl)-4H-cyclopenta [2,1-b;3,4-b′]dithiophene)-alt-4,7(2,1,3-benzothiadiazole)] (PCPDTBT) bulk heterojunctions with different blend ratios were experimentally tested with i-CELIV method. The hole and electron mobilities were found to be heavily imbalanced in the optimised 3:1 PCBM:PCPDTBT bulk heterojunction.

  17. Charge carrier transport properties in layer structured hexagonal boron nitride

    Directory of Open Access Journals (Sweden)

    T. C. Doan

    2014-10-01

    Full Text Available Due to its large in-plane thermal conductivity, high temperature and chemical stability, large energy band gap (˜ 6.4 eV, hexagonal boron nitride (hBN has emerged as an important material for applications in deep ultraviolet photonic devices. Among the members of the III-nitride material system, hBN is the least studied and understood. The study of the electrical transport properties of hBN is of utmost importance with a view to realizing practical device applications. Wafer-scale hBN epilayers have been successfully synthesized by metal organic chemical deposition and their electrical transport properties have been probed by variable temperature Hall effect measurements. The results demonstrate that undoped hBN is a semiconductor exhibiting weak p-type at high temperatures (> 700 °K. The measured acceptor energy level is about 0.68 eV above the valence band. In contrast to the electrical transport properties of traditional III-nitride wide bandgap semiconductors, the temperature dependence of the hole mobility in hBN can be described by the form of μ ∝ (T/T0−α with α = 3.02, satisfying the two-dimensional (2D carrier transport limit dominated by the polar optical phonon scattering. This behavior is a direct consequence of the fact that hBN is a layer structured material. The optical phonon energy deduced from the temperature dependence of the hole mobility is ħω = 192 meV (or 1546 cm-1, which is consistent with values previously obtained using other techniques. The present results extend our understanding of the charge carrier transport properties beyond the traditional III-nitride semiconductors.

  18. Modulating the line shape of magnetoconductance by varying the charge injection in polymer light-emitting diodes

    Directory of Open Access Journals (Sweden)

    Nidya Chitraningrum

    2018-02-01

    Full Text Available We fabricate the phenyl-substituted poly(p-phenylene vinylene copolymer (super yellow, SY-PPV-based polymer light-emitting diodes (PLEDs with different device architectures to modulate the injection of opposite charge carriers and investigate the corresponding magnetoconductance (MC responses. At the first glance, we find that all PLEDs exhibit the positive MC responses. By applying the mathematical analysis to fit the curves with two empirical equations of a non-Lorentzian and a Lorentzian function, we are able to extract the hidden negative MC component from the positive MC curve. We attribute the growth of the negative MC component to the reduced interaction of the triplet excitons with charges to generate the free charge carriers as modulated by the applied magnetic field, known as the triplet exciton-charge reaction, by analyzing MC responses for PLEDs of the charge-unbalanced and hole-blocking device configurations. The negative MC component causes the broadening of the line shape in MC curves.

  19. Optical and electrical properties of negatively charged aluminium oxynitride films

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Kyungsoo; Jung, Sungwook; Lee, Jeoungin; Lee, Kwangsoo; Kim, Jaehong; Son, Hyukjoo [School of information and communication Engineering, Sungkyunkwan University, 300 Chunchun-dong, Jangan-gu, Suwon, 440-746 (Korea, Republic of); Yi, Junsin [School of information and communication Engineering, Sungkyunkwan University, 300 Chunchun-dong, Jangan-gu, Suwon, 440-746 (Korea, Republic of)], E-mail: yi@yurim.ac.kr

    2008-11-03

    Aluminium oxynitride (AlON) thin films were deposited by Radio Frequency (RF) magnetron sputtering on n-type silicon (Si) substrate of (100) orientation using argon (Ar) and oxygen (O{sub 2}) gases at substrate temperature of 450 {sup o}C. To know the change in electrical properties with gases ratio, a deposition was carried out for 140 s with Ar:O{sub 2} ratio changed from 1:3 to 4:3. After that, electrical properties of Metal-Insulator-Semiconductor (MIS) structure with AlON was analyzed. For Ar:O{sub 2} ratios from 1:3 to 4:3, all samples showed characteristics of negative charge. In particular, when Ar:O{sub 2} were 2:3 and 3:3, the value of flatband voltage in normal C-V curve showed above 14 V. The composition of the AlON in the film was investigated using X-ray Photoelectron Spectroscopy (XPS). The flatband voltages (V{sub FB}) in C-V curves were found to depend on compositions. The characteristics of photon energy band gap were obtained by UV/VIS spectrum.

  20. Effect of liposomes on rheological and syringeability properties of hyaluronic acid hydrogels intended for local injection of drugs.

    Science.gov (United States)

    El Kechai, Naila; Bochot, Amélie; Huang, Nicolas; Nguyen, Yann; Ferrary, Evelyne; Agnely, Florence

    2015-06-20

    The aim of this work was to thoroughly study the effect of liposomes on the rheological and the syringeability properties of hyaluronic acid (HA) hydrogels intended for the local administration of drugs by injection. Whatever the characteristics of the liposomes added (neutral, positively or negatively charged, with a corona of polyethylene glycol chains, size), the viscosity and the elasticity of HA gels increased in a lipid concentration-dependent manner. Indeed, liposomes strengthened the network formed by HA chains due to their interactions with this polymer. The nature and the resulting effects of these interactions depended on liposome composition and concentration. The highest viscosity and elasticity were observed with liposomes covered by polyethylene glycol chains while neutral liposomes displayed the lowest effect. Despite their high viscosity at rest, all the formulations remained easily injectable through needles commonly used for local injections thanks to the shear-thinning behavior of HA gels. The present study demonstrates that rheological and syringeability tests are both necessary to elucidate the behavior of such systems during and post injection. In conclusion, HA liposomal gels appear to be a promising and versatile formulation platform for a wide range of applications in local drug delivery when an injection is required. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Charge exchange measurements of MHD activity during neutral beam injection in the Princeton Large Torus and the Poloidal Divertor Experiment

    International Nuclear Information System (INIS)

    Goldston, R.J.; Kaita, R.; Beiersdorfer, P.; Gammel, G.; Herndon, D.L.; McCune, D.C.; Meyerhofer, D.D.

    1987-01-01

    The horizontally scanning, multi-angle charge exchange analysers on the Princeton Large Torus (PLT) and the Poloidal Divertor Experiment (PDX) were used to study the effects of MHD activity on the background ion distribution function and on the beam ion slowing-down process during high power neutral injection. Sawtooth oscillations were observed in the fast ion flux on PLT and PDX, and measurements with neutral beams providing local neutral density enhancement indicated that the ions were transported radially when these events occurred. With near-perpendicular injection in PDX, at the lower toroidal fields necessary to maximize the plasma beta, repetitive bursts of greatly enhanced charge exchange flux were observed. These were associated with the 'fishbone' MHD instability, and a substantial depletion of the perpendicular slowing-down spectrum below the injection energy was seen. A simple phenomenological model for this loss mechanism was developed, and its use in simulation codes has been successful in providing good agreement with the experimental data. The behaviour and characteristics of this model are well matched by direct theoretical calculations. (author)

  2. Charge transport properties of metal/metal-phthalocyanine/n-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, Afzal

    2010-12-16

    In present work the charge transport properties of metal/metal-phthalocyanine/n-Si structures with low (N{sub D} = 4 x 10{sup 14} cm{sup -3}), medium (N{sub D}=1 x 10{sup 16} cm{sup -3}) and high (N{sub D}=2 x 10{sup 19} cm{sup -3}) doped n-Si as injecting electrode and the effect of air exposure of the vacuum evaporated metal-phthalocyanine film in these structures is investigated. The results obtained through temperature dependent electrical characterizations of the structures suggest that in terms of dominant conduction mechanism in the corresponding devices Schottky-type conduction mechanism dominates the charge transport in low-bias region of these devices up to 0.8 V, 0.302 V and 0.15 V in case of low, medium and high doped n-Silicon devices. For higher voltages, in each case of devices, the space-charge-limited conduction, controlled by exponential trap distribution, is found to dominate the charge transport properties of the devices. The interface density of states at the CuPc/n-Si interface of the devices are found to be lower in case of lower work function difference at the CuPc/n-Si interface of the devices. The results also suggest that the work function difference at the CuPc/n-Si interface of these devices causes charge transfer at the interface and these phenomena results in formation of interface dipole. The width of the Schottky depletion region at the CuPc/n-Si interface of these devices is found to be higher with higher work function difference at the interface. The investigation of charge transport properties of Al/ZnPc/medium n-Si and Au/ZnPc/ medium n-Si devices suggest that the Schottky depletion region formed at the ZnPc/n-Si interface of these devices determines the charge transport in the low-bias region of both the devices. Therefore, the Schottky-type (injection limited) and the space-charge-limited (bulk limited) conduction are observed in the low and the high bias regions of these devices, respectively. The determined width of the

  3. Performance and efficiency evaluation and heat release study of a direct-injection stratified-charge rotary engine

    Science.gov (United States)

    Nguyen, H. L.; Addy, H. E.; Bond, T. H.; Lee, C. M.; Chun, K. S.

    1987-01-01

    A computer simulation which models engine performance of the Direct Injection Stratified Charge (DISC) rotary engines was used to study the effect of variations in engine design and operating parameters on engine performance and efficiency of an Outboard Marine Corporation (OMC) experimental rotary combustion engine. Engine pressure data were used in a heat release analysis to study the effects of heat transfer, leakage, and crevice flows. Predicted engine data were compared with experimental test data over a range of engine speeds and loads. An examination of methods to improve the performance of the rotary engine using advanced heat engine concepts such as faster combustion, reduced leakage, and turbocharging is also presented.

  4. Effects of noble-metal ion implantation on corrosion inhibition and charge injection capability of surgical Ti and Ti-6Al-4V

    International Nuclear Information System (INIS)

    Lee, I.S.

    1989-01-01

    Studies are described involving effects of noble-metal ion implantation on corrosion inhibition and charge injection capabilities of surgical Ti and Ti-6Al-4V. With surgical alloys, harmful biological responses are principally due to the type and quantity of metal ions released by the corrosion process. One approach to improve long-term biological performance involves surface modifications to significantly reduce degradation rates. With regard to surface-modifications, one of the most effective methods is through ion implantation. Results are presented for ion-implanted Au, Rh, and Ir. For the static in vitro corrosion properties, the noble-metal ion implanted Ti-6Al-4V and commercially-pure (CP) Ti were investigated in non-passivating acid and passivating saline solutions. It was postulated that during the early stages of corrosion (or during a corrosion pretreatment) the implanted noble-metal would enrich at the surface and significantly reduce subsequent corrosion rates. The observed behavior for the Ir and Rh implanted materials appeared to follow the postulated mechanism, with both initial and time-dependent improvements in corrosion resistance. However, the Au implanted material yielded early benefits, but the enhanced corrosion resistance deteriorated with time. X-ray photoelectron spectroscopy (XPS) analysis indicated that the implanted Au atoms remained as pure metallic Au, while the Ir and Rh atoms were in some oxide state, which gave the good adhesion of the Ir or Rh enriched surface to the Ti substrate. For a stimulating neural electrode, the charge density should be as large as possible to provide adequate stimulation of the nervous system while allowing for miniaturization of the electrode. Activated Ir has been known as having the highest charge injection capability of any material known

  5. Temperature Dependence and Magnetic Properties of Injection Molding Tool Materials Used in Induction Heating

    DEFF Research Database (Denmark)

    Guerrier, Patrick; Nielsen, Kaspar Kirstein; Hattel, Jesper Henri

    2015-01-01

    To analyze the heating phase of an induction heated injection molding tool precisely, the temperature-dependent magnetic properties, B–H curves, and the hysteresis loss are necessary for the molding tool materials. Hence, injection molding tool steels, core materials among other materials have...

  6. Three-dimensional modeling of charge transport, injection and recombination in organic light-emitting diodes

    NARCIS (Netherlands)

    Holst, van der J.J.M.

    2010-01-01

    Organic light-emitting diodes (OLEDs) are ideally suited for lighting and display applications. Commercial OLED displays as well as OLED white-light sources are presently being introduced to the market. Essential electronic processes in OLEDs are the injection of electrons and holes into an organic

  7. Silver nanoparticles as a key feature of a plasma polymer composite layer in mitigation of charge injection into polyethylene under dc stress

    International Nuclear Information System (INIS)

    Milliere, L; Makasheva, K; Laurent, C; Despax, B; Boudou, L; Teyssedre, G

    2016-01-01

    The aim of this work is to limit charge injection from a semi-conducting electrode into low density polyethylene (LDPE) under dc field by tailoring the polymer surface using a silver nanoparticles-containing layer. The layer is composed of a plane of silver nanoparticles embedded in a semi-insulating organosilicon matrix deposited on the polyethylene surface by a plasma process. Size, density and surface coverage of the nanoparticles are controlled through the plasma process. Space charge distribution in 300 μm thick LDPE samples is measured by the pulsed-electroacoustic technique following a short term (step-wise voltage increase up to 50 kV mm −1 , 20 min in duration each, followed by a polarity inversion) and a longer term (up to 12 h under 40 kV mm −1 ) protocols for voltage application. A comparative study of space charge distribution between a reference polyethylene sample and the tailored samples is presented. It is shown that the barrier effect depends on the size distribution and the surface area covered by the nanoparticles: 15 nm (average size) silver nanoparticles with a high surface density but still not percolating form an efficient barrier layer that suppress charge injection. It is worthy to note that charge injection is detected for samples tailored with (i) percolating nanoparticles embedded in organosilicon layer; (ii) with organosilicon layer only, without nanoparticles and (iii) with smaller size silver particles (<10 nm) embedded in organosilicon layer. The amount of injected charges in the tailored samples increases gradually in the samples ranking given above. The mechanism of charge injection mitigation is discussed on the basis of complementary experiments carried out on the nanocomposite layer such as surface potential measurements. The ability of silver clusters to stabilize electrical charges close to the electrode thereby counterbalancing the applied field appears to be a key factor in explaining the charge injection

  8. Modeling charge transport properties of cyano-substituted PPV

    International Nuclear Information System (INIS)

    Correia, Helena M.G.; Ramos, Marta M.D.

    2003-01-01

    In recent years, poly (p-phenylenevinylene) (PPV) and its derivatives have attracted much interest due to their applications in light-emitting diodes (LEDs). One of the issues that determine device performance is the transport of charge carriers along the polymer strands. For that reason, we investigate the influence of cyano substitution on geometry and electronic behaviour of PPV chains using self-consistent quantum molecular dynamics simulations. Our results suggest that substitution by cyano groups induce distortion in the PPV chains and a charge rearrangement among the polymer atoms. Specifically addressed is the issue concerning estimates of charge (electron and hole) mobility by computer experiments. Significant differences have been found both in the strength of the electric field needed to move positive and negative charge carriers along the polymer chain as well as in charge mobility

  9. Charge transport properties of CdMnTe radiation detectors

    Directory of Open Access Journals (Sweden)

    Prokopovich D. A.

    2012-10-01

    Full Text Available Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading charge collection is reduced with increasing values of bias voltage. The electron drift velocity was calculated from the rise time distribution of the preamplifier output pulses at each measured bias. From the dependence of drift velocity on applied electric field the electron mobility was found to be μn = (718 ± 55 cm2/Vs at room temperature.

  10. Effect of turbo charging and steam injection methods on the performance of a Miller cycle diesel engine (MCDE)

    International Nuclear Information System (INIS)

    Gonca, Guven; Sahin, Bahri

    2017-01-01

    Highlights: • Performance of a diesel engine is simulated by finite time thermodynamics. • Effect of steam injection on performance of a Miller cycle engine is examined. • Model results are verified with the experimental data with less than 7% error. - Abstract: In this study, application of the steam injection method (SIM), Miller cycle (MC) and turbo charging (TC) techniques into a four stroke, direct-injection diesel engine has been numerically and empirically conducted. NOx emissions have detrimental influences on the environment and living beings. They are formed at the high temperatures, thus the Diesel engines are serious NOx generation sources since they have higher compression ratios and higher combustion temperatures. The international regulations have decreased the emission limits due to environmental reasons. The Miller cycle (MC) application and steam injection method (SIM) have been popular to abate NOx produced from the internal combustion engines (ICEs), in the recent years. However, the MC application can cause a reduction in power output. The most known technique which maximizes the engine power and abates exhaust emissions is TC. Therefore, if these three techniques are combined, the power loss can be tolerated and pollutant emissions can be minimized. While the application of the MC and SIM causes to diminish in the brake power and brake thermal efficiency of the engine up to 6.5% and 10%, the TC increases the brake power and brake thermal efficiency of the engine up to 18% and 12%. The experimental and theoretical results have been compared in terms of the torque, the specific fuel consumption (SFC), the brake power and the brake thermal efficiency. The results acquired from theoretical modeling have been validated with empirical data with less than 7% maximum error. The results showed that developed combination can increase the engine performance and the method can be easily applied to the Diesel engines.

  11. About methods to reduce emissions of turbo charged engine gasoline direct injection

    Science.gov (United States)

    Neacsu, D.; Ivan, F.; Niculae, M.

    2017-08-01

    The paper aims to analyse and explain new methods applied on gasoline direct injection to reduce gas emissions and greenhouse effect. There are analysed the composition of emission inside the engine and which are the most harmful emission for the environment. Will be analysed the methods and systems which have a contribution to decrease emissions produced by the mixture of air and fuel. The paper contains details about after treatment systems which are designed to decrease gas emissions without any other negative consequence on the environment.

  12. Electro-optical and charge injection investigations of the donor-π-acceptor triphenylamine, oligocene–thiophene–pyrimidine and cyanoacetic acid based multifunctional dyes

    Directory of Open Access Journals (Sweden)

    Ahmad Irfan

    2015-10-01

    Full Text Available The corner stone of present study is to tune the electro-optical and charge transport properties of donor-bridge-acceptor (D-π-A triphenylamine (TPA derivatives. In the present investigation, an electron deficient moiety (pyrimidine, electron-rich moiety (thiophene and oligocene (benzene, naphthalene, anthracene, tetracene and pentacene have been incorporated as π-spacer between the donor TPA unit and cyanoacetic acid acceptor and anchoring group. The elongation of bridge usually affects the energy levels, i.e., higher the highest occupied molecular orbital (HOMO while lower the lowest unoccupied molecular orbital (LUMO thus reduces the HOMO–LUMO energy gap. The lowered LUMO energy levels of cyano-{2-[6-(4-diphenylamino-phenyl-pyrimidin-4-yl]-tetraceno[2,3-b]thiophen-8-yl}-acetic acid (TPA-PTT4 and cyano-{2-[6-(4-diphenylamino-phenyl-pyrimidin-4-yl]-pentaceno[2,3-b]thiophen-9-yl}-acetic acid (TPA-PPT5 dyes revealed that electron injected from dye to semiconductor surface might be auxiliary stable resulting in impediment of quenching. The broken co-planarity between the π-spacer conceiving LUMO and the TPA moiety would help to impede the recombination process. Moreover, it is expected that TPA derivatives with the tetracenothiophene and pentacenothiophene moieties as π-bridge would show better photovoltaic performance due to lowered LUMO energy level, higher electronic coupling constant, light harvesting efficiency and electron injection values.

  13. Role of the inversion layer on the charge injection in silicon nanocrystal multilayered light emitting devices

    Energy Technology Data Exchange (ETDEWEB)

    Tondini, S. [Nanoscience Laboratory, Department of Physics, University of Trento, Via Sommarive 14, 38123 Trento (Italy); Dipartimento di Fisica, Informatica e Matematica, Università di Modena e Reggio Emilia, Via Campi 213/a, 41125 Modena (Italy); Pucker, G. [Advanced Photonics and Photovoltaics Group, Bruno Kessler Foundation, Via Sommarive 18, 38123 Trento (Italy); Pavesi, L. [Nanoscience Laboratory, Department of Physics, University of Trento, Via Sommarive 14, 38123 Trento (Italy)

    2016-09-07

    The role of the inversion layer on injection and recombination phenomena in light emitting diodes (LEDs) is here studied on a multilayer (ML) structure of silicon nanocrystals (Si-NCs) embedded in SiO{sub 2}. Two Si-NC LEDs, which are similar for the active material but different in the fabrication process, elucidate the role of the non-radiative recombination rates at the ML/substrate interface. By studying current- and capacitance-voltage characteristics as well as electroluminescence spectra and time-resolved electroluminescence under pulsed and alternating bias pumping scheme in both the devices, we are able to ascribe the different experimental results to an efficient or inefficient minority carrier (electron) supply by the p-type substrate in the metal oxide semiconductor LEDs.

  14. Emission Characteristics for a Homogeneous Charged Compression Ignition Diesel Engine with Exhaust Gas Recirculation Using Split Injection Methodology

    Directory of Open Access Journals (Sweden)

    Changhee Lee

    2017-12-01

    Full Text Available Due to the serious issues caused by air pollution and global warming, emission regulations are becoming stricter. New technologies that reduce NOx and PM emissions are needed. To cope with these social exhaust gas regulation demands, many advanced countries are striving to develop eco-friendly vehicles in order to respond to stricter emissions regulations. The homogeneous charged compression ignition engine (HCCI incorporates a multi-stage combustion engine with multiple combustion modes, catalyst, direct fuel injection and partial mixing combustion. In this study, the HCCI combustion was applied to analyze and review the results of engines applying HCCI combustion without altering the conventional engine specifications. The optimization of exhaust gas recirculation (EGR and compression ratio changes provides an optimal fuel economy. In this study, potential for optimum economy within the range of IMEP 0.8 MPa has been evaluated.

  15. Artificially injected charged particles as a tool for the measurement of the electric field in the magnetosphere

    International Nuclear Information System (INIS)

    Pirre, M.

    1982-01-01

    Two methods of measuring the parallel electric field in the magnetosphere using artificially injected charged particles are discussed. One method uses electrons to measure the parallel electric field in the vicinity of the spacecraft. It is shown that a very good accuracy can be achieved for such a measurement. The principle of this method is briefly reviewed, the minimum theoretical value measurable by the method is shown, and the limitations on it due to the spacecraft environment are discussed. Most important among the latter is the high level of turbulence about the spacecraft. The second method uses ions to measure the electric potential along the magnetic field lines if the associated parallel electric field is directed downward. For such a field at a lower altitude, Li ions are used to maximize the returning fluxes and to increase the probability of detection. Rockets are more suitable than satellites to make such measurements. 17 references

  16. Charge transport properties of CdMnTe radiation detectors

    Energy Technology Data Exchange (ETDEWEB)

    Kim K.; Rafiel, R.; Boardman, M.; Reinhard, I.; Sarbutt, A.; Watt, G.; Watt, C.; Uxa, S.; Prokopovich, D.A.; Belas, E.; Bolotnikov, A.E.; James, R.B.

    2012-04-11

    Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe)radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading chargecollection is reduced with increasing values of bias voltage. The electron transit time was determined from time of flight measurements. From the dependence of drift velocity on applied electric field the electron mobility was found to be n = (718 55) cm2/Vs at room temperature.

  17. Charge collection properties of heavily irradiated epitaxial silicon detectors

    International Nuclear Information System (INIS)

    Kramberger, G.; Cindro, V.; Dolenc, I.; Fretwurst, E.; Lindstroem, G.; Mandic, I.; Mikuz, M.; Zavrtanik, M.

    2005-01-01

    Detectors processed on epitaxial silicon seem to be a viable solution for the extreme radiation levels in the innermost layers of tracking detectors at upgraded LHC (SLHC). A set of epitaxial pad detectors of 50 and 75μm thicknesses (ρ=50Ωcm) was irradiated with 24GeV/c protons and reactor neutrons up to equivalent fluences of 10 16 cm -2 . Charge collection for minimum ionizing electrons from a 90 Sr source was measured using a charge sensitive preamplifier and a 25ns shaping circuit. The dependence of collected charge on annealing time and operation temperature was studied. Results were used to predict the performance of fine pitch pixel detectors proposed for SLHC

  18. Charge collection properties of heavily irradiated epitaxial silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Kramberger, G. [Institute Jozef Stefan, Jamova 39, SI-1111 Ljubljana (Slovenia)]. E-mail: Gregor.Kramberger@ijs.si; Cindro, V. [Institute Jozef Stefan, Jamova 39, SI-1111 Ljubljana (Slovenia); Dolenc, I. [Institute Jozef Stefan, Jamova 39, SI-1111 Ljubljana (Slovenia); Fretwurst, E. [University of Hamburg, Institut fuer Experimentalphysik, Luruper Chaussee 149, D-22761 Hamburg (Germany); Lindstroem, G. [University of Hamburg, Institut fuer Experimentalphysik, Luruper Chaussee 149, D-22761 Hamburg (Germany); Mandic, I. [Institute Jozef Stefan, Jamova 39, SI-1111 Ljubljana (Slovenia); Mikuz, M. [Institute Jozef Stefan, Jamova 39, SI-1111 Ljubljana (Slovenia); Zavrtanik, M. [Institute Jozef Stefan, Jamova 39, SI-1111 Ljubljana (Slovenia)

    2005-12-01

    Detectors processed on epitaxial silicon seem to be a viable solution for the extreme radiation levels in the innermost layers of tracking detectors at upgraded LHC (SLHC). A set of epitaxial pad detectors of 50 and 75{mu}m thicknesses ({rho}=50{omega}cm) was irradiated with 24GeV/c protons and reactor neutrons up to equivalent fluences of 10{sup 16}cm{sup -2}. Charge collection for minimum ionizing electrons from a {sup 90}Sr source was measured using a charge sensitive preamplifier and a 25ns shaping circuit. The dependence of collected charge on annealing time and operation temperature was studied. Results were used to predict the performance of fine pitch pixel detectors proposed for SLHC.

  19. Evaluation of Heating and Shearing on the Viscoelastic Properties of Calcium Hydroxyapatite Used in Injection Laryngoplasty.

    Science.gov (United States)

    Mahboubi, Hossein; Mohraz, Ali; Verma, Sunil P

    2016-03-01

    To compare the viscoelastic properties of calcium hydroxyapatite (CaHA) to carboxymethylcellulose (CMC) injectables used for injection laryngoplasty and determine if they are affected by heating and shearing. Experimental. University laboratory. Vocal fold injection laryngoplasty with CaHA is oftentimes challenging due to the amount of pressure necessary to push the injectate through a needle. Anecdotal techniques, such as heating the product, have been suggested to facilitate injection. The viscoelastic properties of CaHA and CMC were measured with a rheometer. The effects of heating and shearing on sample viscoelasticity were recorded. CaHA was 9.5 times more viscous than CMC (43,100 vs 4540 Pa·s). Heating temporarily decreased the viscosity of CaHA by 32%. However, it also caused the viscosity to subsequently increase after time. Shearing of CaHA reduced its viscosity by 26%. Heating and shearing together temporarily reduced the viscosity of CaHA by 52%. A combination of heating and shearing had a more profound effect than heating or shearing alone on the viscosity of CaHA, potentially making it easier to inject temporarily. Long-term and in vivo studies are required to further analyze the effect of heating and shearing on CaHA injectables. © American Academy of Otolaryngology—Head and Neck Surgery Foundation 2016.

  20. Effect of prostaglandin E2 injection on the structural properties of the rat patellar tendon

    Directory of Open Access Journals (Sweden)

    Ferry Scott T

    2012-01-01

    Full Text Available Abstract Background Increased tendon production of the inflammatory mediator prostaglandin E2 (PGE2 has been suggested to be a potential etiologic agent in the development of tendinopathy. Repeated injection of PGE2 into tendon has been proposed as a potential animal model for studying treatments for tendinopathy. In contrast, nonsteroidal anti-inflammatory drugs (NSAIDs which inhibit PGE2 production and are commonly prescribed in treating tendinopathy have been shown to impair the healing of tendon after acute injury in animal models. The contradictory literature suggests the need to better define the functional effects of PGE2 on tendon. Our objective was to characterize the effects of PGE2 injection on the biomechanical and biochemical properties of tendon and the activity of the animals. Our hypothesis was that weekly PGE2 injection to the rat patellar tendon would lead to inferior biomechanical properties. Methods Forty rats were divided equally into four groups. Three groups were followed for 4 weeks with the following peritendinous injection procedures: No injection (control, 4 weekly injections of saline (saline, 4 weekly injections of 800 ng PGE2 (PGE2-4 wks. The fourth group received 4 weekly injections of 800 ng PGE2 initially and was followed for a total of 8 weeks. All animals were injected bilaterally. The main outcome measurements included: the structural and material properties of the patellar tendon under tensile loading to failure, tendon collagen content, and weekly animal activity scores. Results The ultimate load of PGE2-4 wks tendons at 4 weeks was significantly greater than control or saline group tendons. The stiffness and elastic modulus of the PGE2 injected tendons at 8 weeks was significantly greater than the control or saline tendons. No differences in animal activity, collagen content, or mean fibril diameter were observed between groups. Conclusions Four weekly peritendinous injections of PGE2 to the rat patellar

  1. Optical properties of two-dimensional charge density wave materials

    Science.gov (United States)

    Sayers, Charles; Karbassi, Sara; Friedemann, Sven; da Como, Enrico

    Titanium diselenide (TiSe2) is a member of the layered transition metal dichalcogenide (TMD) materials. It exhibits unusual chiral charge ordering below 190 K after undergoing an initial phase transition to a commensurate (2 x 2 x 2) charge density wave (CDW) at 200 K which is enhanced further in the monolayer. Recently, the first evidence of chirality in a CDW system was discovered in this material by scanning tunneling microscopy and time-resolved reflectivity experiments, where separate left and right handed charge-ordered domains were found to exist within a single sample. We have prepared single crystals of 1T-TiSe2 using iodine vapour transport, and confirmed their quality by x-ray analysis and charge transport measurements. Using a combination of polarised optical spectroscopy techniques in the mid to far infrared (4 to 700 meV photon energy), we have measured an anisotropy relating to the CDW gap. We discuss the results on the basis of chiral domains with different handedness and the nature of the CDW transition.

  2. Experimental study of combustion and emission characteristics of ethanol fuelled port injected homogeneous charge compression ignition (HCCI) combustion engine

    Energy Technology Data Exchange (ETDEWEB)

    Maurya, Rakesh Kumar; Agarwal, Avinash Kumar [Engine Research Laboratory, Department of Mechanical Engineering, Indian Institute of Technology Kanpur, Kanpur 208 016 (India)

    2011-04-15

    The homogeneous charge compression ignition (HCCI) is an alternative combustion concept for in reciprocating engines. The HCCI combustion engine offers significant benefits in terms of its high efficiency and ultra low emissions. In this investigation, port injection technique is used for preparing homogeneous charge. The combustion and emission characteristics of a HCCI engine fuelled with ethanol were investigated on a modified two-cylinder, four-stroke engine. The experiment is conducted with varying intake air temperature (120-150 C) and at different air-fuel ratios, for which stable HCCI combustion is achieved. In-cylinder pressure, heat release analysis and exhaust emission measurements were employed for combustion diagnostics. In this study, effect of intake air temperature on combustion parameters, thermal efficiency, combustion efficiency and emissions in HCCI combustion engine is analyzed and discussed in detail. The experimental results indicate that the air-fuel ratio and intake air temperature have significant effect on the maximum in-cylinder pressure and its position, gas exchange efficiency, thermal efficiency, combustion efficiency, maximum rate of pressure rise and the heat release rate. Results show that for all stable operation points, NO{sub x} emissions are lower than 10 ppm however HC and CO emissions are higher. (author)

  3. Spectroscopic techniques for measuring ion diode space-charge distributions and ion source properties

    Energy Technology Data Exchange (ETDEWEB)

    Filuk, A B; Bailey, J E; Adams, R G [Sandia Labs., Albuquerque, NM (United States); and others

    1997-12-31

    The authors are using time- and space-resolved visible spectroscopy to measure applied-B ion diode dynamics on the 20 TW Particle Beam Fusion Accelerator II. Doppler broadening of fast Li atoms, as viewed parallel to the anode, is used in a charge-exchange model to obtain the Li{sup +} ion divergence within 100 {mu}m of the anode surface. The characteristic Stark/Zeeman shifts in spectra of alkali neutrals or singly-ionized alkaline-earths are used to measure the strong electric (10{sup 9} V/m) an magnetic ({approx} 6 T) fields in the diode gap. Large Stark shifts within 0.5 mm of the anode indicate the LiF emits with a finite field threshold rather than with Child-Langmuir-type emission, and the small slope in the electric field indicates an unexpected build-up of electrons near the anode. In the diode gap, the authors aim to unfold fields to quantify the time-dependent ion and electron space-charge distributions that determine the ion beam properties. Observed electric field non-uniformities give local beam deflections that can be comparable to the total beam microdivergence. The authors are implementing active laser absorption and laser-induced fluorescence spectroscopy on low-density Na atoms injected into the diode gap prior to the power pulse. The small Doppler broadening in the Na spectra should allow simultaneous electric and magnetic field mapping with improved spatial resolution. (author). 4 figs., 13 refs.

  4. Surface characterisation and functionalisation of indium tin oxide anodes for improvement of charge injection in organic light emitting diodes

    International Nuclear Information System (INIS)

    Davenas, J.; Besbes, S.; Abderrahmen, A.; Jaffrezic, N.; Ben Ouada, H.

    2008-01-01

    Wettability studies have been performed to probe the surface properties of ITO substrates, aimed to be used as hole injecting electrode in OLEDs. The elimination of organic contaminants upon the cleaning treatment (ultrasonic bath in organic solvents) leads to an increase of the free energy of the ITO surface becoming hydrophilic. The surface energy components calculated from the Van Oss model show the appearance of a basic component upon the cleaning treatment. A thermal treatment at 100 deg. C for 3 h leads to a decrease of the surface free energy due to surface dehydration. These properties are attributed to the hydroxides formed at the ITO surface inducing improved adhesion at the ITO/polymer interface. The ITO surfaces have been functionalised with a chloroethylphosphonic acid mono-layer to increase their stability. The appearance of an acid-base component leads to a dipolar character of the ITO surface. The formation of a compact layer of a spin coated poly(phenylenevinylene) derivative induces the shielding of the ITO basic character. The weakening of the near infrared absorption associated to ITO free carriers confirms the formation of a dipole layer at the interface with the molecular layer in contact with ITO. Improved injection properties, shown by the current/voltage characteristics, result from the interface modifications

  5. Spatial variation in void volume during charged particle bombardment: the effects of injected interstitials

    International Nuclear Information System (INIS)

    Lee, E.H.; Mansur, L.K.; Yoo, M.H.

    1979-01-01

    Experimental observations of the void volume at several depths along the range of 4 MeV Ni ions in 316 stainless steel are reported. The specimens were first preconditioned by neutron irradiation at temperatures of 450 and 584 0 C to fluences of approximately 8 x 10 26 n/m -2 . The void volume after ion bombardment to 60 dpa at the peak damage depth is significantly lower at the peak damage depth than in the region between that and the free surface. The ratio of the step height to void volume at the depth of peak energy deposition between regions masked from and exposed to the beam is strongly dependent on bombardment temperature. The reduction of void volume near the peak damage depth is larger for the 584 0 C than for the 450 0 C preconditioned material. These observations are consistent with recent theoretical results which account for the injection of the bombarding ions as self-interstitials. The theory necessary to understand the effect is developed

  6. Investigation on transient flow of a centrifugal charging pump in the process of high pressure safety injection

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Fan, E-mail: zhangfan4060@gmail.com; Yuan, Shouqi; Fu, Qiang; Tao, Yi

    2015-11-15

    Highlights: • The transient flow characteristics of the charging pump with the first stage impeller in the HPSI process have been investigated numerically by CFD. • The hydraulic performance of the charging pump during the HPSI are discussed, andthe absolute errors between the simulated and measured results are analyzed in the paper. • Pressure fluctuation in the impeller and flow pattern in the impeller were studied in the HPSI process. It is influenced little at the beginning of the HPSI process while fluctuates strongly in the end of the HPSI process. - Abstract: In order to investigate the transient flow characteristics of the centrifugal charging pump during the transient transition process of high pressure safety injection (HPSI) from Q = 148 m{sup 3}/h to Q = 160 m{sup 3}/h, numerical simulation and experiment are implemented in this study. The transient flow rate, which is the most important factor, is obtained from the experiment and works as the boundary condition to accurately accomplish the numerical simulation in the transient process. Internal characteristics under the variable operating conditions are analyzed through the transient simulation. The results shows that the absolute error between the simulated and measured heads is less than 2.26% and the absolute error between the simulated and measured efficiency is less than 2.04%. Pressure fluctuation in the impeller is less influenced by variable flow rate in the HPSI process, while flow pattern in the impeller is getting better and better with the flow rate increasing. As flow rate increases, fluid blocks on the tongue of the volute and it strikes in this area at large flow rate. Correspondingly, the pressure fluctuation is intense and vortex occurs gradually during this period, which obviously lowers the efficiency of the pump. The contents of the current work can provide references for the design optimization and fluid control of the pump used in the transient process of variable operating

  7. Investigation on transient flow of a centrifugal charging pump in the process of high pressure safety injection

    International Nuclear Information System (INIS)

    Zhang, Fan; Yuan, Shouqi; Fu, Qiang; Tao, Yi

    2015-01-01

    Highlights: • The transient flow characteristics of the charging pump with the first stage impeller in the HPSI process have been investigated numerically by CFD. • The hydraulic performance of the charging pump during the HPSI are discussed, andthe absolute errors between the simulated and measured results are analyzed in the paper. • Pressure fluctuation in the impeller and flow pattern in the impeller were studied in the HPSI process. It is influenced little at the beginning of the HPSI process while fluctuates strongly in the end of the HPSI process. - Abstract: In order to investigate the transient flow characteristics of the centrifugal charging pump during the transient transition process of high pressure safety injection (HPSI) from Q = 148 m"3/h to Q = 160 m"3/h, numerical simulation and experiment are implemented in this study. The transient flow rate, which is the most important factor, is obtained from the experiment and works as the boundary condition to accurately accomplish the numerical simulation in the transient process. Internal characteristics under the variable operating conditions are analyzed through the transient simulation. The results shows that the absolute error between the simulated and measured heads is less than 2.26% and the absolute error between the simulated and measured efficiency is less than 2.04%. Pressure fluctuation in the impeller is less influenced by variable flow rate in the HPSI process, while flow pattern in the impeller is getting better and better with the flow rate increasing. As flow rate increases, fluid blocks on the tongue of the volute and it strikes in this area at large flow rate. Correspondingly, the pressure fluctuation is intense and vortex occurs gradually during this period, which obviously lowers the efficiency of the pump. The contents of the current work can provide references for the design optimization and fluid control of the pump used in the transient process of variable operating conditions.

  8. Functionalized organic semiconductor molecules to enhance charge carrier injection in electroluminescent cell

    Science.gov (United States)

    Yalcin, Eyyup; Kara, Duygu Akin; Karakaya, Caner; Yigit, Mesude Zeliha; Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Demic, Serafettin; Kus, Mahmut; Aboulouard, Abdelkhalk

    2017-07-01

    Organic semiconductor (OSC) materials as a charge carrier interface play an important role to improve the device performance of organic electroluminescent cells. In this study, 4,4″-bis(diphenyl amino)-1,1':3‧,1″-terphenyl-5'-carboxylic acid (TPA) and 4,4″-di-9H-carbazol-9-yl-1,1':3‧,1″-terphenyl-5'-carboxylic acid (CAR) has been designed and synthesized to modify indium tin oxide (ITO) layer as interface. Bare ITO and PEDOT:PSS coated on ITO was used as reference anode electrodes for comparison. Furthermore, PEDOT:PSS coated over CAR/ITO and TPA/ITO to observe stability of OSC molecules and to completely cover the ITO surface. Electrical, optical and surface characterizations were performed for each device. Almost all modified devices showed around 36% decrease at the turn on voltage with respect to bare ITO. The current density of bare ITO, ITO/CAR and ITO/TPA were measured as 288, 1525 and 1869 A/m2, respectively. By increasing current density, luminance of modified devices showed much better performance with respect to unmodified devices.

  9. Effect of Injection Molding Melt Temperatures on PLGA Craniofacial Plate Properties during In Vitro Degradation

    Directory of Open Access Journals (Sweden)

    Liliane Pimenta de Melo

    2017-01-01

    Full Text Available The purpose of this article is to present mechanical and physicochemical properties during in vitro degradation of PLGA material as craniofacial plates based on different values of injection molded temperatures. Injection molded plates were submitted to in vitro degradation in a thermostat bath at 37 ± 1°C by 16 weeks. The material was removed after 15, 30, 60, and 120 days; then bending stiffness, crystallinity, molecular weights, and viscoelasticity were studied. A significant decrease of molecular weight and mechanical properties over time and a difference in FT-IR after 60 days showed faster degradation of the material in the geometry studied. DSC analysis confirmed that the crystallization occurred, especially in higher melt temperature condition. DMA analysis suggests a greater contribution of the viscous component of higher temperature than lower temperature in thermomechanical behavior. The results suggest that physical-mechanical properties of PLGA plates among degradation differ per injection molding temperatures.

  10. Effect of Surface Hydration on Antifouling Properties of Mixed Charged Polymers.

    Science.gov (United States)

    Leng, Chuan; Huang, Hao; Zhang, Kexin; Hung, Hsiang-Chieh; Xu, Yao; Li, Yaoxin; Jiang, Shaoyi; Chen, Zhan

    2018-05-07

    Interfacial water structure on a polymer surface in water (or surface hydration) is related to the antifouling activity of the polymer. Zwitterionic polymer materials exhibit excellent antifouling activity due to their strong surface hydration. It was proposed to replace zwitterionic polymers using mixed charged polymers because it is much easier to prepare mixed charged polymer samples with much lower costs. In this study, using sum frequency generation (SFG) vibrational spectroscopy, we investigated interfacial water structures on mixed charged polymer surfaces in water, and how such structures change while exposing to salt solutions and protein solutions. The 1:1 mixed charged polymer exhibits excellent antifouling property while other mixed charged polymers with different ratios of the positive/negative charges do not. It was found that on the 1:1 mixed charged polymer surface, SFG water signal is dominated by the contribution of the strongly hydrogen bonded water molecules, indicating strong hydration of the polymer surface. The responses of the 1:1 mixed charged polymer surface to salt solutions are similar to those of zwitterionic polymers. Interestingly, exposure to high concentrations of salt solutions leads to stronger hydration of the 1:1 mixed charged polymer surface after replacing the salt solution with water. Protein molecules do not substantially perturb the interfacial water structure on the 1:1 mixed charged polymer surface and do not adsorb to the surface, showing that this mixed charged polymer is an excellent antifouling material.

  11. In vivo demonstration of injectable microstimulators based on charge-balanced rectification of epidermically applied currents

    Science.gov (United States)

    Ivorra, Antoni; Becerra-Fajardo, Laura; Castellví, Quim

    2015-12-01

    Objective. It is possible to develop implantable microstimulators whose actuation principle is based on rectification of high-frequency (HF) current bursts supplied through skin electrodes. This has been demonstrated previously by means of devices consisting of a single diode. However, previous single diode devices caused dc currents which made them impractical for clinical applications. Here flexible thread-like stimulation implants which perform charge balance are demonstrated in vivo. Approach. The implants weigh 40.5 mg and they consist of a 3 cm long tubular silicone body with a diameter of 1 mm, two electrodes at opposite ends, and, within the central section of the body, an electronic circuit made up of a diode, two capacitors, and a resistor. In the present study, each implant was percutaneously introduced through a 14 G catheter into either the gastrocnemius muscle or the cranial tibial muscle of a rabbit hindlimb. Then stimulation was performed by delivering HF bursts (amplitude pair of textile electrodes strapped around the hindlimb and either isometric plantarflexion or dorsiflexion forces were recorded. Stimulation was also assayed 1, 2 and 4 weeks after implantation. Main results. The implants produced bursts of rectified current whose mean value was of a few mA and were capable of causing local neuromuscular stimulation. The implants were well-tolerated during the 4 weeks. Significance. Existing power supply methods, and, in particular inductive links, comprise stiff and bulky parts. This hinders the development of minimally invasive implantable devices for neuroprostheses based on electrical stimulation. The proposed methodology is intended to relieving such bottleneck. In terms of mass, thinness, and flexibility, the demonstrated implants appear to be unprecedented among the intramuscular stimulation implants ever assayed in vertebrates.

  12. Charge redistribution and properties of high-temperature superconductors

    International Nuclear Information System (INIS)

    Khomskii, D.I.; Kusmartsev, F.V.

    1992-01-01

    We show that in high-T c superconductors (HTSC) with two groups of electrons (e.g., holes in CuO 2 planes and in a ''reservoir'') there should exist a charge redistribution with the temperature: the hole concentration N h in ''active'' superconducting CuO 2 planes increases below T c . This effect may explain structural changes such as the shift of the apical oxygen atom, anomalous thermal expansion, the shift of nuclear quadrupole resonance lines, the change of the positron lifetime, and the modification of the ion channeling below T c . Some other possible consequences of the charge redistribution (the modification of the temperature dependence of a gap Δ and of the ratio 2Δ 0 /T c , the phenomena at a contact of HTSC with normal metals and semiconductors) are discussed

  13. Room-Temperature Triple-Ligand Surface Engineering Synergistically Boosts Ink Stability, Recombination Dynamics, and Charge Injection toward EQE-11.6% Perovskite QLEDs.

    Science.gov (United States)

    Song, Jizhong; Li, Jinhang; Xu, Leimeng; Li, Jianhai; Zhang, Fengjuan; Han, Boning; Shan, Qingsong; Zeng, Haibo

    2018-06-10

    Developing low-cost and high-quality quantum dots (QDs) or nanocrystals (NCs) and their corresponding efficient light-emitting diodes (LEDs) is crucial for the next-generation ultra-high-definition flexible displays. Here, there is a report on a room-temperature triple-ligand surface engineering strategy to play the synergistic role of short ligands of tetraoctylammonium bromide (TOAB), didodecyldimethylammonium bromide (DDAB), and octanoic acid (OTAc) toward "ideal" perovskite QDs with a high photoluminescence quantum yield (PLQY) of >90%, unity radiative decay in its intrinsic channel, stable ink characteristics, and effective charge injection and transportation in QD films, resulting in the highly efficient QD-based LEDs (QLEDs). Furthermore, the QD films with less nonradiative recombination centers exhibit improved PL properties with a PLQY of 61% through dopant engineering in A-site. The robustness of such properties is demonstrated by the fabrication of green electroluminescent LEDs based on CsPbBr 3 QDs with the peak external quantum efficiency (EQE) of 11.6%, and the corresponding peak internal quantum efficiency (IQE) and power efficiency are 52.2% and 44.65 lm W -1 , respectively, which are the most-efficient perovskite QLEDs with colloidal CsPbBr 3 QDs as emitters up to now. These results demonstrate that the as-obtained QD inks have a wide range application in future high-definition QD displays and high-quality lightings. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Microcellular injection molding process for producing lightweight thermoplastic polyurethane with customizable properties

    Science.gov (United States)

    Ellingham, Thomas; Kharbas, Hrishikesh; Manitiu, Mihai; Scholz, Guenter; Turng, Lih-Sheng

    2018-03-01

    A three-stage molding process involving microcellular injection molding with core retraction and an "out-of-mold" expansion was developed to manufacture thermoplastic polyurethane into lightweight foams of varying local densities, microstructures, and mechanical properties in the same microcellular injection molded part. Two stages of cavity expansion through sequential core retractions and a third expansion in a separate mold at an elevated temperature were carried out. The densities varied from 0.25 to 0.42 g/cm3 (77% to 62% weight reduction). The mechanical properties varied as well. Cyclic compressive strengths and hysteresis loss ratios, together with the microstructures, were characterized and reported.

  15. Effect of hydrogen charging on the mechanical properties of medium strength aluminium alloys 2091 and 2014

    DEFF Research Database (Denmark)

    Bandopadhyay, A.; Ambat, Rajan; Dwarakadasa, E.S.

    1992-01-01

    Cathodic hydrogen charging in 3.5% NaCl solution altered the mechanical properties of 2091-T351 (Al-Cu-Li-Mg-Zr) determined by a slow (10(-3)/s) strain rate tensile testing technique. UTS and YS decreased in the caw of 2091-T351 and 2014-T6(Al-Cu-Mn-Si-Mg) with increase in charging current density....... Elongation showed a decrease with increase in charging current density for both the alloys. However, elongation occurring throughout the gauge length in uncharged specimens changed over to localized deformation, thus increasing the reduction in area in charged specimens. A transition in fracture mode from...

  16. Charge-order driven multiferroic and magneto-dielectric properties of rare earth manganates

    International Nuclear Information System (INIS)

    Serrao, Claudy Rayan; Sahu, Jyoti Ranjan; Ghosh, Anirban

    2010-01-01

    Charge-order driven magnetic ferroelectricity is shown to occur in several rare earth manganates of the general formula, Ln 1-x A x MnO 3 (Ln rare earth, A = alkaline earth). Charge-ordered manganates exhibit dielectric constant anomalies around the charge-ordering or the antiferromagnetic transition temperature. Magnetic fields have a marked effect on the dielectric properties of these compounds, indicating the presence of coupling between the magnetic and electrical order parameters. Magneto-dielectric properties are retained in small particles of the manganates. The observation of magneto-ferroelectricity in these manganates is in accordance with theoretical predictions. (author)

  17. The Effect of Voltage Charging on the Transport Properties of Gold Nanotube Membranes.

    Science.gov (United States)

    Experton, Juliette; Martin, Charles R

    2018-05-01

    Porous membranes are used in chemical separations and in many electrochemical processes and devices. Research on the transport properties of a unique class of porous membranes that contain monodisperse gold nanotubes traversing the entire membrane thickness is reviewed here. These gold nanotubes can act as conduits for ionic and molecular transports through the membrane. Because the tubes are electronically conductive, they can be electrochemically charged by applying a voltage to the membrane. How this "voltage charging" affects the transport properties of gold nanotube membranes is the subject of this Review. Experiments showing that voltage charging can be used to reversibly switch the membrane between ideally cation- and anion-transporting states are reviewed. Voltage charging can also be used to enhance the ionic conductivity of gold nanotube membranes. Finally, voltage charging to accomplish electroporation of living bacteria as they pass through gold nanotube membranes is reviewed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. An Injectable Composite Gelatin Hydrogel with pH Response Properties

    Directory of Open Access Journals (Sweden)

    Baoguo Chen

    2017-01-01

    Full Text Available On account of minimally invasive procedure and of filling irregular defects of tissues, injectable hydrogels are increasingly attractive in biomedical fields. However, traditional hydrogel formed by simple physical interaction or in situ crosslinking had inevitably some drawbacks such as low mechanical strength and lack of multifunctional properties. Though many investigations had successfully modified traditional injectable hydrogel to obtain both mechanical and functional properties, an acetalated β-cyclodextrin (Ac-β-CD nanoparticle composite injectable hydrogel designed in the research was another effective and efficient choice to solve the drawbacks. First of all, gelatin derivative (G-AA and Ac-β-CD were synthesized to prepare hydrogel and nanoparticle, respectively. In order to ensure good compatibility between nanoparticle and macromonomer and provide crosslink points between nanoparticle and macromonomer, G-AA was simultaneously functionalized onto the surface of Ac-β-CD nanoparticle during the fabrication of Ac-β-CD nanoparticle using one-step method. Finally, injectable composite hydrogel was obtained by photoinitiated polymerization in situ. Hydrogel properties like gelation time and swelling ratio were investigated. The viscoelastic behavior of hydrogels confirmed that typical characteristics of crosslinked elastomer for all hydrogel and nanoparticle in hydrogel could improve the mechanical property of hydrogel. Moreover, the transparency with time had verified obvious acid-response properties of hydrogels.

  19. Tensile properties and microstructure of helium-injected and reactor-irradiated V-20 Ti

    International Nuclear Information System (INIS)

    Tanaka, M.P.; Bloom, E.E.; Horak, J.A.

    1981-01-01

    Mechanical properties and microstructure of vanadium-20% titanium were examined following helium-injection and reactor irradiation. Helium was injected at ambient temperature to concentrations of 90 and 200 at. ppM; neutron irradiation was at 400, 575, 625, and 700 0 C to fluence of 3 x 10 26 n/m 2 , E > 0.1 MeV. Cavities representing negligible volume swelling were observed in all helium-injected specimens. Degradation of mechanical properties, especially loss of ductility due to helium, occurred at temperatures of 625 and 700 0 C. The levels of helium produced in the fusion spectrum can be expected to alter the response of vanadium alloys from that observed in fast reactor irradiations

  20. Tensile properties and microstructure of helium-injected and reactor-irradiated V-20 Ti

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, M.P.; Bloom, E.E.; Horak, J.A.

    1981-01-01

    Mechanical properties and microstructure of vanadium-20% titanium were examined following helium-injection and reactor irradiation. Helium was injected at ambient temperature to concentrations of 90 and 200 at. ppM; neutron irradiation was at 400, 575, 625, and 700/sup 0/C to fluence of 3 x 10/sup 26/ n/m/sup 2/, E > 0.1 MeV. Cavities representing negligible volume swelling were observed in all helium-injected specimens. Degradation of mechanical properties, especially loss of ductility due to helium, occurred at temperatures of 625 and 700/sup 0/C. The levels of helium produced in the fusion spectrum can be expected to alter the response of vanadium alloys from that observed in fast reactor irradiations.

  1. From Process Modeling to Elastic Property Prediction for Long-Fiber Injection-Molded Thermoplastics

    International Nuclear Information System (INIS)

    Nguyen, Ba Nghiep; Kunc, Vlastimil; Frame, Barbara J.; Phelps, Jay; Tucker III, Charles L.; Bapanapalli, Satish K.; Holbery, James D.; Smith, Mark T.

    2007-01-01

    This paper presents an experimental-modeling approach to predict the elastic properties of long-fiber injection-molded thermoplastics (LFTs). The approach accounts for fiber length and orientation distributions in LFTs. LFT samples were injection-molded for the study, and fiber length and orientation distributions were measured at different locations for use in the computation of the composite properties. The current fiber orientation model was assessed to determine its capability to predict fiber orientation in LFTs. Predicted fiber orientations for the studied LFT samples were also used in the calculation of the elastic properties of these samples, and the predicted overall moduli were then compared with the experimental results. The elastic property prediction was based on the Eshelby-Mori-Tanaka method combined with the orientation averaging technique. The predictions reasonably agree with the experimental LFT data

  2. Modulated charge injection in p-type dye-sensitized solar cells using fluorene-based light absorbers.

    Science.gov (United States)

    Liu, Zonghao; Xiong, Dehua; Xu, Xiaobao; Arooj, Qudsia; Wang, Huan; Yin, Liyuan; Li, Wenhui; Wu, Huaizhi; Zhao, Zhixin; Chen, Wei; Wang, Mingkui; Wang, Feng; Cheng, Yi-Bing; He, Hongshan

    2014-03-12

    In this study, new pull-push arylamine-fluorene based organic dyes zzx-op1, zzx-op2, and zzx-op3 have been designed and synthesized for p-type dye-sensitized solar cells (p-DSCs). In zzx-op1, a di(p-carboxyphenyl)amine (DCPA) was used as an electron donor, a perylenemonoimide (PMID) as an electron acceptor, and a fluorene (FLU) unit with two aliphatic hexyl chains as a π-conjugated linker. In zzx-op2 and zzx-op3, a 3,4-ethylenedioxythiophene (EDOT) and a thiophene were inserted consecutively between PMID and FLU to tune the energy levels of the frontier molecular orbitals of the dyes. The structural modification broadened the spectral coverage from an onset of 700 nm for zzx-op1 to 750 nm for zzx-op3. The electron-rich EDOT and thiophene lifted up the HOMO (highest occupied molecular orbital) levels of zzx-op2 and zzx-op3, making their potential more negative than zzx-op1. When three dyes were employed in p-type DSCs with I(-)/I3(-) as a redox couple and NiO nanoparticles as hole materials, zzx-op1 exhibited impressive energy conversion efficiency of 0.184% with the open-circuit voltage (VOC) of 112 mV and the short-circuit current density (JSC) of 4.36 mA cm(-2) under AM 1.5G condition. Density functional theory calculations, transient photovoltage decay measurements, and electrochemical impedance spectroscopic studies revealed that zzx-op1 sensitized solar cell exhibited much higher charge injection efficiency (90.3%) than zzx-op2 (53.9%) and zzx-op3 (39.0%), indicating a trade-off between spectral broadening and electron injection driving force in p-type DSCs.

  3. Factor Structure and Psychometric Properties of the Injection Phobia Scale-Anxiety

    Science.gov (United States)

    Olatunji, Bunmi O.; Sawchuk, Craig N.; Moretz, Melanie W.; David, Bieke; Armstrong, Thomas; Ciesielski, Bethany G.

    2010-01-01

    The present investigation examined the factor structure and psychometric properties of the Injection Phobia Scale-Anxiety (IPS-Anx). Principal components analysis of IPS-Anx items in Study 1 (n = 498) revealed a 2-factor structure consisting of Distal Fear and Contact Fear. However, CFA results in Study 2 (n = 567) suggest that a 1-factor…

  4. Electronic properties of the charge carriers on oligofluorene backbone

    International Nuclear Information System (INIS)

    Koizumi, Yoshiko; Seki, Shu; Saeki, Akinori; Tagawa, Seiichi

    2007-01-01

    The transient absorption of radical anions and cations of 9,9'-di-n-hexyl-oligofluorene was measured using pulse radiolysis and low-temperature γ-radiolysis techniques. The infrared absorption maxima of both radical anions and cations exhibit red-shift continuously upon elongation of the chain length. The absorption bands are blue-shifted by 0.04-0.07 eV with increasing the temperature from 80 to 106 K. The extinction coefficients were determined by scavenging technique, demonstrating an increase with the elongation of the chain length. The optimized geometry of fluorene trimers, calculated using density functional theory, shows that the oligofluorene molecules are more planar in its charged state than in its neutral state

  5. Experimental Investigation of Charging Properties of Interstellar Type Silica Dust Grains by Secondary Electron Emissions

    Science.gov (United States)

    Tankosic, D.; Abbas, M. M.

    2013-01-01

    The dust charging by electron impact is an important dust charging processes in astrophysical and planetary environments. Incident low energy electrons are reflected or stick to the grains charging the dust grains negatively. At sufficiently high energies electrons penetrate the grains, leading to excitation and emission of electrons referred to as secondary electron emission (SEE). Available classical theoretical models for calculations of SEE yields are generally applicable for neutral, planar, or bulk surfaces. These models, however, are not valid for calculations of the electron impact charging properties of electrostatically charged micron/submicron-size dust grains in astrophysical environments. Rigorous quantum mechanical models are not yet available, and the SEE yields have to be determined experimentally for development of more accurate models for charging of individual dust grains. At the present time, very limited experimental data are available for charging of individual micron-size dust grains, particularly for low energy electron impact. The experimental results on individual, positively charged, micron-size lunar dust grains levitated carried out by us in a unique facility at NASA-MSFC, based on an electrodynamic balance, indicate that the SEE by electron impact is a complex process. The electron impact may lead to charging or discharging of dust grains depending upon the grain size, surface potential, electron energy, electron flux, grain composition, and configuration (Abbas et al, 2010, 2012). In this paper, we discuss SEE charging properties of individual micron-size silica microspheres that are believed to be analogs of a class of interstellar dust grains. The measurements indicate charging of the 0.2m silica particles when exposed to 25 eV electron beams and discharging when exposed to higher energy electron beams. Relatively large size silica particles (5.2-6.82m) generally discharge to lower equilibrium potentials at both electron energies

  6. Alteration of Skin Mechanical Properties in Patients Undergoing Botulinum Toxin Type A Injections of Forehead Rhytides.

    Science.gov (United States)

    Min, Peiru; Zhang, Zheng; Grassetti, Luca; Perdanasari, Aurelia Trisliana; Torresetti, Matteo; Pu, Zheming; Zhang, Yan; Han, Sheng; Marsili, Riccardo; Zhang, Yi Xin; di Benedetto, Giovanni; Lazzeri, Davide

    2016-06-01

    Although application of botulinum toxin type A (BTX-A) for the treatment of forehead rhytides has become very popular, the effects of its intramuscular injections on the skin mechanical properties remain unclear. We prospectively investigated the alterations in the mechanical properties of the skin of patients who received intramuscular injections of botulinum toxin A (BTX-A) for forehead rhytides and compared two injection doses. Of the 42 enrolled patients, one randomly assigned half received intramuscular injections of two units (group I), and the other half received four units (group II) of BTX-A in each injection point. The baseline and post-treatment skin mechanical parameters, including gross elasticity (R2), net elasticity (R5), viscoelastic ratio (R6) and biological elasticity (R7), were measured using the Cutometer(®) and compared. Treatment with BTX-A resulted in significant overall alterations in the mechanical properties of skin at the injection sites of both treatment groups during the 16-week period, and no significant differences were observed between groups. Significant decreases in biological elasticity, net elasticity and viscoelasticity properties were observed at 2 weeks follow-up and began to recover at that time. All of the skin mechanical properties recovered to baseline levels by 16 weeks of follow-up in both dosage groups, which indicates that the higher dosage (4 units) did not delay relapse compared to the two-unit dosage. We concluded that intramuscular injections of BTX-A significantly regulated the gross elasticity, net elasticity, functional elasticity and viscoelastic elasticity at the injection point over a radius of 1.5 cm at 2, 4 and 8 weeks follow-up. The alteration in the skin measurements had completely diminished by the 16-week follow-up. This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or

  7. Charge Transfer Properties Through Graphene for Applications in Gaseous Detectors

    CERN Document Server

    Franchino, S.; Hall-Wilton, R.; Jackman, R.B.; Muller, H.; Nguyen, T.T.; de Oliveira, R.; Oliveri, E.; Pfeiffer, D.; Resnati, F.; Ropelewski, L.; Smith, J.; van Stenis, M.; Streli, C.; Thuiner, P.; Veenhof, R.

    2016-07-11

    Graphene is a single layer of carbon atoms arranged in a honeycomb lattice with remarkable mechanical and electrical properties. Regarded as the thinnest and narrowest conductive mesh, it has drastically different transmission behaviours when bombarded with electrons and ions in vacuum. This property, if confirmed in gas, may be a definitive solution for the ion back-flow problem in gaseous detectors. In order to ascertain this aspect, graphene layers of dimensions of about 2x2cm$^2$, grown on a copper substrate, are transferred onto a flat metal surface with holes, so that the graphene layer is freely suspended. The graphene and the support are installed into a gaseous detector equipped with a triple Gaseous Electron Multiplier (GEM), and the transparency properties to electrons and ions are studied in gas as a function of the electric fields. The techniques to produce the graphene samples are described, and we report on preliminary tests of graphene-coated GEMs.

  8. Semiconductor nanoparticles with spatial separation of charge carriers: synthesis and optical properties

    International Nuclear Information System (INIS)

    Vasiliev, Roman B; Dirin, Dmitry N; Gaskov, Alexander M

    2011-01-01

    The results of studies on core/shell semiconductor nanoparticles with spatial separation of photoexcited charge carriers are analyzed and generalized. Peculiarities of the electronic properties of semiconductor/semiconductor heterojunctions formed inside such particles are considered. Data on the effect of spatial separation of charge carriers on the optical properties of nanoparticles including spectral shifts of the exciton bands, absorption coefficients and electron–hole pair recombination times are presented. Methods of synthesis of core/shell semiconductor nanoparticles in solutions are discussed. Specific features of the optical properties of anisotropic semiconductor nanoparticles with the semiconductor/semiconductor junctions are noted. The bibliography includes 165 references.

  9. Tetracene-based organic light-emitting transistors: optoelectronic properties and electron injection mechanism

    NARCIS (Netherlands)

    Santato, C.; Capelli, R.; Loi, M.A.; Murgia, M.; Cicoira, F.; Roy, Arunesh; Stallinga, P; Zamboni, R.; Rost, C.; Karg, S.F.; Muccini, M.

    2004-01-01

    Optoelectronic properties of light-emitting field-effect transistors (LETs) fabricated on bottom-contact transistor structures using a tetracene film as charge-transport and light-emitting material are investigated. Electroluminescence generation and transistor current are correlated, and the bias

  10. Etched ion tracks in silicon oxide and silicon oxynitride as charge injection or extraction channels for novel electronic structures

    International Nuclear Information System (INIS)

    Fink, D.; Petrov, A.V.; Hoppe, K.; Fahrner, W.R.; Papaleo, R.M.; Berdinsky, A.S.; Chandra, A.; Chemseddine, A.; Zrineh, A.; Biswas, A.; Faupel, F.; Chadderton, L.T.

    2004-01-01

    The impact of swift heavy ions onto silicon oxide and silicon oxynitride on silicon creates etchable tracks in these insulators. After their etching and filling-up with highly resistive matter, these nanometric pores can be used as charge extraction or injection paths towards the conducting channel in the underlying silicon. In this way, a novel family of electronic structures has been realized. The basic characteristics of these 'TEMPOS' (=tunable electronic material with pores in oxide on silicon) structures are summarized. Their functionality is determined by the type of insulator, the etch track diameters and lengths, their areal densities, the type of conducting matter embedded therein, and of course by the underlying semiconductor and the contact geometry. Depending on the TEMPOS preparation recipe and working point, the structures may resemble gatable resistors, condensors, diodes, transistors, photocells, or sensors, and they are therefore rather universally applicable in electronics. TEMPOS structures are often sensitive to temperature, light, humidity and organic gases. Also light-emitting TEMPOS structures have been produced. About 37 TEMPOS-based circuits such as thermosensors, photosensors, humidity and alcohol sensors, amplifiers, frequency multipliers, amplitude modulators, oscillators, flip-flops and many others have already been designed and successfully tested. Sometimes TEMPOS-based circuits are more compact than conventional electronics

  11. The artificially injected charged particles as a tool for the measurement of the electric field in the magnetosphere

    International Nuclear Information System (INIS)

    Pirre, M.

    1982-01-01

    This chapter discusses two methods of measuring the parallel electric field using artificially injected charged particles. The first method uses electrons to measure the parallel electric field in the vicinity of the spacecraft. The second method uses ions to measure electric potential along the magnetic field lines if the associated parallel electric field is directed downward. The use of electrons for the measurement has many limitations due to the disturbed regions surrounding the spacecraft and to the high level of turbulence which could significantly reduce accuracy. Even if the parallel electric fields are too low to be measured owing to the broadening of the fluxes by turbulence, the electrons can still be used to study the turbulence. It is demonstrated that if parallel electric fields are predominantly directed upward at high altitude, a downward parallel electric field can exist at lower altitude. Lithium ions can be used to maximize the returning fluxes and to increase the probability of detection. Rockets are shown to be more suitable than satellites with regard to measurement

  12. Influence of injection temperatures and fiberglass compositions on mechanical properties of polypropylene

    Science.gov (United States)

    Keey, Tony Tiew Chun; Azuddin, M.

    2017-06-01

    Injection molding process appears to be one of the most suitable mass and cost efficiency manufacturing processes for polymeric parts nowadays due to its high efficiency of large scale production. When down-scaling the products and components, the limits of conventional injection molding process are reached. These constraints had initiated the development of conventional injection molding process into a new era of micro injection molding technology. In this study, fiberglass reinforced polypropylenes (PP) with various glass fiber percentage materials were used. The study start with fabrication of micro tensile specimens at three different injection temperature, 260°C, 270°C and 280°C for different percentage by weight of fiberglass reinforced PP. Then evaluate the effects of various injection temperatures on the tensile properties of micro tensile specimens. Different percentage by weight of fiberglass reinforced PP were tested as well and it was found that 20% fiberglass reinforced PP possessed the greatest percentage increase of tensile strength with increasing temperatures.

  13. Studies in Fat Grafting: Part II. Effects of Injection Mechanics on Material Properties of Fat

    Science.gov (United States)

    Atashroo, David; Raphel, Jordan; Chung, Michael T.; Paik, Kevin J.; Parisi-Amon, Andreina; McArdle, Adrian; Senarath-Yapa, Kshemendra; Zielins, Elizabeth R.; Tevlin, Ruth; Duldulao, Chris; Walmsley, Graham G.; Hu, Michael S.; Momeni, Arash; Domecus, Brian; Rimsa, Joe R.; Greenberg, Lauren; Gurtner, Geoffrey C.; Longaker, Michael T.; Wan, Derrick C.

    2014-01-01

    Background While fat grafting can address many soft tissue deficits, results remain inconsistent. In this study, we compared physical properties of fat following injection using an automated, low shear device or the modified Coleman technique. Methods Lipoaspirate was obtained from nine patients and processed for injection using either a modified Coleman technique or with an automated, low shear device. Fat was passed through a 2 mm cannula and compared to minimally processed fat. A rheometer was used to measure the storage modulus and shear rate at which tissues began to lose their solid-like properties. Viscosity was also measured and gross properties of treatment groups were qualitatively evaluated with a glass slide test. Results Fat injected through an automated, low shear device closely matched physical properties of minimally processed fat. The storage modulus (G′) of fat for the device group was greater than the modified Coleman group and the onset of breakdown was delayed. Similarly, viscosity measurement of fat from the automated device closely matched minimally processed fat and was greater than the modified Coleman group. Conclusions The physical properties of lipoaspirate processed using an automated, low shear device with a 2 mm cannula preserved the intactness of fat more than the modified Coleman technique. Our rheological data demonstrate less damage using an automated device compared to modified Coleman technique and potentially support its use for improved fat graft integrity. PMID:25028817

  14. Adsorption properties of subtropical and tropical variable charge soils: Implications from climate change and biochar amendment

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Ren-Kou; Qafoku, Nikolla; Van Ranst, Eric; Li, Jiu-yu; Jiang, Jun

    2016-01-25

    This review paper attempts to summarize the progress made in research efforts conducted over the last years to study the surface chemical properties of the tropical and subtropical soils, usually called variable charge soils, and the way they response to different management practices. The paper is composed of an introductory section that provides a brief discussion on the surface chemical properties of these soils, and five other review sections. The focus of these sections is on the evolution of surface chemical properties during the development of the variable charge properties (second section), interactions between oppositely charged particles and the resulting effects on the soil properties and especially on soil acidity (third section), the surface effects of low molecular weight organic acids sorbed to mineral surfaces and the chemical behavior of aluminum (fourth section), and the crop straw derived biochar induced changes of the surface chemical properties of these soils (fifth section). A discussion on the effect of climate change variables on the properties of the variable charge soils is included at the end of this review paper (sixth section).

  15. Charge Transfer Properties Through Graphene Layers in Gas Detectors

    CERN Document Server

    Thuiner, P.; Jackman, R.B.; Müller, H.; Nguyen, T.T.; Oliveri, E.; Pfeiffer, D.; Resnati, F.; Ropelewski, L.; Smith, J.A.; van Stenis, M.; Veenhof, R.

    2016-01-01

    Graphene is a single layer of carbon atoms arranged in a honeycomb lattice with remarkable mechanical, electrical and optical properties. For the first time graphene layers suspended on copper meshes were installed into a gas detector equipped with a gaseous electron multiplier. Measurements of low energy electron and ion transfer through graphene were conducted. In this paper we describe the sample preparation for suspended graphene layers, the testing procedures and we discuss the preliminary results followed by a prospect of further applications.

  16. The effects of intratendinous and retrocalcaneal intrabursal injections of corticosteroid on the biomechanical properties of rabbit Achilles tendons.

    Science.gov (United States)

    Hugate, Ronald; Pennypacker, Jason; Saunders, Marnie; Juliano, Paul

    2004-04-01

    The use of corticosteroid injections in the treatment of retrocalcaneal bursitis is controversial. We assessed the effects of corticosteroid injections, both within the tendon substance and into the retrocalcaneal bursa, on the biomechanical properties of rabbit Achilles tendons. The systemic effects of bilateral corticosteroid injections were also studied. The rabbits were divided into three treatment groups. The rabbits in Group I received injections of corticosteroid into the Achilles tendon on the left side and injections of normal saline solution into the Achilles tendon on the right, those in Group II received injections of corticosteroid into the retrocalcaneal bursa on the left side and injections of saline solution into the Achilles tendon on the right, and those in Group III received injections of corticosteroid into the Achilles tendon on the left side and injections of corticosteroid into the retrocalcaneal bursa on the right. These injections were given weekly for three weeks. At four weeks after the final injection, the tendons were harvested and were tested biomechanically to determine failure load, midsubstance strain and total strain, modulus of elasticity, failure stress, and total energy absorbed. The site of failure was also documented. The groups were compared according to the location of the injections, the type of injection (steroid or saline solution), and the total systemic load of steroid. Specimens from limbs that had received intratendinous injections of corticosteroid showed significantly decreased failure stress compared with those from limbs that had received intratendinous injections of saline solution (p = 0.008). Specimens from limbs that had received intrabursal injections of corticosteroid demonstrated significantly decreased failure stress (p = 0.05), significantly decreased total energy absorbed (p = 0.017), and significantly increased total strain (p = 0.049) compared with specimens from limbs that had received intratendinous

  17. Theoretical investigation of the charge-transfer properties in different meso-linked zinc porphyrins for highly efficient dye-sensitized solar cells.

    Science.gov (United States)

    Namuangruk, Supawadee; Sirithip, Kanokkorn; Rattanatwan, Rattanawelee; Keawin, Tinnagon; Kungwan, Nawee; Sudyodsuk, Taweesak; Promarak, Vinich; Surakhot, Yaowarat; Jungsuttiwong, Siriporn

    2014-06-28

    The charge transfer effect of different meso-substituted linkages on porphyrin analogue 1 (A1, B1 and C1) was theoretically investigated using density functional theory (DFT) and time-dependent DFT (TDDFT) calculations. The calculated geometry parameters and natural bond orbital analysis reveal that the twisted conformation between porphyrin macrocycle and meso-substituted linkages leads to blocking of the conjugation of the conjugated backbone, and the frontier molecular orbital plot shows that the intramolecular charge transfer of A1, B1 and C1 hardly takes place. In an attempt to improve the photoinduced intramolecular charge transfer ability of the meso-linked zinc porphyrin sensitizer, a strong electron-withdrawing group (CN) was introduced into the anchoring group of analogue 1 forming analogue 2 (A2, B2 and C2). The density difference plot of A2, B2 and C2 shows that the charge transfer properties dramatically improved. The electron injection process has been performed using TDDFT; the direct charge-transfer transition in the A2-(TiO2)38 interacting system takes place; our results strongly indicated that introducing electron-withdrawing groups into the acceptor part of porphyrin dyes can fine-tune the effective conjugation length of the π-spacer and improve intramolecular charge transfer properties, consequently inducing the electron injection process from the anchoring group of the porphyrin dye to the (TiO2)38 surface which may improve the conversion efficiency of the DSSCs. Our calculated results can provide valuable information and a promising outlook for computation-aided sensitizer design with anticipated good properties in further experimental synthesis.

  18. Coke properties in relation to charge preparation techniques. [Selective crushing

    Energy Technology Data Exchange (ETDEWEB)

    Morozov, O S

    1979-01-01

    Selective crushing is essential to obtain the required coke properties, so that in the coarse fractions there is a considerable reduction in the middlings and dirt normally difficult to crush. These are at the same time enriched with vitrinite so that there is an increase in the coal substance as such, reflected in improved caking capacity in the coarse size range. Various methods of selective crushing are employed, including air entrainment mills, fluidised bed systems. Other advantages claimed for selective crushing are the uniform pore distribution and air permeability and also the diminished breakage stress.

  19. Dependence of coke properties on the method of charge preparation

    Energy Technology Data Exchange (ETDEWEB)

    Morozov, O S

    1979-04-01

    Selective crushing is essential to obtain the required coke properties, so that in the coarse fractions there is a considerable reduction in the middlings and dirt normally difficult to crush. These are at the same time enriched with vitrinite so that there is an increase in the coal substance as such, reflected in improved caking capacity in the coarse size range. Various methods of selective crushing are employed, including air entrainment mills, fluidised bed systems. Other advantages claimed for selective crushing are the uniform pore distribution and air permeability and also the diminished breakage stress.

  20. Network access charges, vertical integration, and property rights structure - experiences from the German electricity markets

    International Nuclear Information System (INIS)

    Growitsch, C.; Wein, T.

    2005-01-01

    After the deregulation of the German electricity markets in 1998, the German government opted for a regulatory regime called negotiated third party access, which would be subject to ex-post control by the federal cartel office. Network access charges for new competitors are based on contractual arrangements between energy producers and industrial consumers. As the electricity networks are incontestable natural monopolies, the local and regional network operators are able to set (monopolistic) charges at their own discretion, restricted only by the possible interference of the federal cartel office (Bundeskartellamt). In this paper we analyze if there is evidence for varying charging behaviour depending on the supplier's economic independence (structure of property rights) or its level of vertical integration. For this purpose, we hypothesise that incorporated and vertically integrated suppliers set different charges than independent utility companies. Multivariate estimations show a relation between network access charges and the network operator's economic independence as well as level of vertical integration: on the low voltage level for an estimated annual consumption of 1700 kW/h, vertically integrated firms set-in accordance with our hypothesis-significantly lower access charges than vertically separated suppliers, whereas incorporated network operators charge significantly higher charges compared to independent suppliers. These results could not have been confirmed for other consumptions or voltage levels. (author)

  1. Improved workability of injectable calcium sulfate bone cement by regulation of self-setting properties

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Zonggang, E-mail: chenzg@sdu.edu.cn [National Glycoengineering Research Center, Shandong University, Jinan 250100 (China); Department of Materials Science and Engineering, Tsinghua University, Beijing 100084 (China); Liu, Huanye [Department of Orthodontics, School of Stomatology, China Medical University, Shenyang 110001 (China); Liu, Xi [Department of Materials Science and Engineering, Tsinghua University, Beijing 100084 (China); Lian, Xiaojie [College of Mechanics, Taiyuan University of Technology, Taiyuan 030024 (China); Guo, Zhongwu [National Glycoengineering Research Center, Shandong University, Jinan 250100 (China); Jiang, Hong-Jiang [Wendeng Hospital of Traditional Chinese Orthopedics and Traumatology, Shandong 264400 (China); Cui, Fu-Zhai, E-mail: cuifz@mail.tsinghua.edu.cn [Department of Materials Science and Engineering, Tsinghua University, Beijing 100084 (China)

    2013-04-01

    Calcium sulfate hemihydrate (CSH) powder as an injectable bone cement was prepared by hydrothermal synthesis of calcium sulfate dihydrate (CSD). The prepared materials showed X-ray diffraction peaks corresponding to the CSH structure without any secondary phases, implying complete conversion from CSD phase to CSH phase. Thermogravimetric (TG) analyses showed the crystal water content of CSH was about 6.0% (wt.), which is near to the theoretic crystal water value of CSH. From scanning electron microscopy (SEM) micrographs, sheet crystal structure of CSD was observed to transform into rod-like crystal structure of CSH. Most interesting and important of all, CSD as setting accelerator was also introduced into CSH powder to regulate self-setting properties of injectable CSH paste, and thus the self-setting time of CSH paste can be regulated from near 30 min to less than 5 min by adding various amounts of setting accelerator. Because CSD is not only the reactant of preparing CSH but also the final solidified product of CSH, the setting accelerator has no significant effect on the other properties of materials, such as mechanical properties. In vitro biocompatibility and in vivo histology studies have demonstrated that the materials have good biocompatibility and good efficacy in bone regeneration. All these will further improve the workability of CSH in clinic applications. Highlights: ► Calcium sulfate hemihydrate (CSH) can be an injectable bone cement. ► CSH was produced by hydrothermal synthesis of calcium sulfate dihydrate (CSD). ► CSD was introduced into CSH powder to regulate self-setting properties of CSH. ► Setting accelerator has no significant effect on the other properties of materials. ► Injectable CSH has good biocompatibility and good efficacy in bone regeneration.

  2. Improved workability of injectable calcium sulfate bone cement by regulation of self-setting properties

    International Nuclear Information System (INIS)

    Chen, Zonggang; Liu, Huanye; Liu, Xi; Lian, Xiaojie; Guo, Zhongwu; Jiang, Hong-Jiang; Cui, Fu-Zhai

    2013-01-01

    Calcium sulfate hemihydrate (CSH) powder as an injectable bone cement was prepared by hydrothermal synthesis of calcium sulfate dihydrate (CSD). The prepared materials showed X-ray diffraction peaks corresponding to the CSH structure without any secondary phases, implying complete conversion from CSD phase to CSH phase. Thermogravimetric (TG) analyses showed the crystal water content of CSH was about 6.0% (wt.), which is near to the theoretic crystal water value of CSH. From scanning electron microscopy (SEM) micrographs, sheet crystal structure of CSD was observed to transform into rod-like crystal structure of CSH. Most interesting and important of all, CSD as setting accelerator was also introduced into CSH powder to regulate self-setting properties of injectable CSH paste, and thus the self-setting time of CSH paste can be regulated from near 30 min to less than 5 min by adding various amounts of setting accelerator. Because CSD is not only the reactant of preparing CSH but also the final solidified product of CSH, the setting accelerator has no significant effect on the other properties of materials, such as mechanical properties. In vitro biocompatibility and in vivo histology studies have demonstrated that the materials have good biocompatibility and good efficacy in bone regeneration. All these will further improve the workability of CSH in clinic applications. Highlights: ► Calcium sulfate hemihydrate (CSH) can be an injectable bone cement. ► CSH was produced by hydrothermal synthesis of calcium sulfate dihydrate (CSD). ► CSD was introduced into CSH powder to regulate self-setting properties of CSH. ► Setting accelerator has no significant effect on the other properties of materials. ► Injectable CSH has good biocompatibility and good efficacy in bone regeneration

  3. Tribo-charging properties of waste plastic granules in process of tribo-electrostatic separation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Jia, E-mail: weee@sjtu.edu.cn; Wu, Guiqing; Xu, Zhenming

    2015-01-15

    Highlights: • The cyclone charging was more effective and stable than vibrating charging. • The small particle size was better changed than large ones and was more suitable recycled by TES. • The drying pretreatment is good for improving the short-term charging effect. - Abstract: Plastic products can be found everywhere in people’s daily life. With the consistent growth of plastic consumption, more and more plastic waste is generated. Considering the stable chemical and physics characteristics of plastic, regular waste management methods are not suitable for recycling economic strategy of each government, which has become a serious environmental problem. Recycling plastic waste is considered to be the best way to treat it, because it cannot only deduce the waste but also save the energy to produce new virgin plastic. Tribo-electrostatic separation is strongly recommended for plastic separation as it can preserve the original properties of plastic and has little additional pollution. In this study, plastic granules are generated by crushing plastic waste in waste electric and electronic equipment. The tribo-charging properties of plastic waste were studied by vibrating tribo-charging and cyclone tribo-charging. The triboelectric series obtained by vibrating was: (−)-PE–PS–PC–PVC–ABS–PP-(+), while the triboelectric series obtained by cyclone was (−)-PE–PS–PC–PVC–ABS–PP-(+). Further, the cyclone charging was more effective and stable than vibrating charging. The impact factors experiments showed that small particle size was better changed than large ones and were more suitable recycled by tribo-electrostatic separation. High relative humidity was identified as impede charging effect. The results of this study will help defining the operating parameters of subsequent separator.

  4. Tribo-charging properties of waste plastic granules in process of tribo-electrostatic separation

    International Nuclear Information System (INIS)

    Li, Jia; Wu, Guiqing; Xu, Zhenming

    2015-01-01

    Highlights: • The cyclone charging was more effective and stable than vibrating charging. • The small particle size was better changed than large ones and was more suitable recycled by TES. • The drying pretreatment is good for improving the short-term charging effect. - Abstract: Plastic products can be found everywhere in people’s daily life. With the consistent growth of plastic consumption, more and more plastic waste is generated. Considering the stable chemical and physics characteristics of plastic, regular waste management methods are not suitable for recycling economic strategy of each government, which has become a serious environmental problem. Recycling plastic waste is considered to be the best way to treat it, because it cannot only deduce the waste but also save the energy to produce new virgin plastic. Tribo-electrostatic separation is strongly recommended for plastic separation as it can preserve the original properties of plastic and has little additional pollution. In this study, plastic granules are generated by crushing plastic waste in waste electric and electronic equipment. The tribo-charging properties of plastic waste were studied by vibrating tribo-charging and cyclone tribo-charging. The triboelectric series obtained by vibrating was: (−)-PE–PS–PC–PVC–ABS–PP-(+), while the triboelectric series obtained by cyclone was (−)-PE–PS–PC–PVC–ABS–PP-(+). Further, the cyclone charging was more effective and stable than vibrating charging. The impact factors experiments showed that small particle size was better changed than large ones and were more suitable recycled by tribo-electrostatic separation. High relative humidity was identified as impede charging effect. The results of this study will help defining the operating parameters of subsequent separator

  5. Effects of piston surface treatments on performance and emissions of a methanol-fueled, direct injection, stratified charge engine

    Energy Technology Data Exchange (ETDEWEB)

    West, B.; Green, J.B. [Oak Ridge National Lab., TN (United States)

    1994-07-01

    The purpose of this study was to investigate the effects of thermal barrier coatings and/or surface treatments on the performance and emissions of a methanol-fueled, direct-injection, stratified-charge (DISC) engine. A Ricardo Hydra Mark III engine was used for this work and in previous experiments at Oak Ridge National Laboratory (ORNL). The primary focus of the study was to examine the effects of various piston insert surface treatments on hydrocarbon (HC) and oxides of nitrogen (NO{sub x}) emissions. Previous studies have shown that engines of this class have a tendency to perform poorly at low loads and have high unburned fuel emissions. A blank aluminum piston was modified to employ removable piston bowl inserts. Four different inserts were tested in the experiment: aluminum, stainless steel with a 1.27-mm (0.050-in.) air gap (to act as a thermal barrier), and two stainless steel/air-gap inserts with coatings. Two stainless steel inserts were dimensionally modified to account for the coating thickness (1.27-mm) and coated identically with partially stabilized zirconia (PSZ). One of the coated inserts then had an additional seal-coat applied. The coated inserts were otherwise identical to the stainless steel/air-gap insert (i.e., they employed the same 1.27-mm air gap). Thermal barrier coatings were employed in an attempt to increase combustion chamber surface temperatures, thereby reducing wall quenching and promoting more complete combustion of the fuel in the quench zone. The seal-coat was applied to the zirconia to reduce the surface porosity; previous research suggested that despite the possibly higher surface temperatures obtainable with a ceramic coating, the high surface area of a plasma-sprayed coating may actually allow fuel to adhere to the surface and increase the unburned fuel emissions and fuel consumption.

  6. Relation between microstructure and dielectric breakdown in the case of aluminous ceramics (SEMM method); Comportement d'alumines face a l'injection de charges. Relation microstructure - claquage dielectrique - mesure des charges d'influence (methode SEMM)

    Energy Technology Data Exchange (ETDEWEB)

    Liebault, J.

    1999-02-01

    The dielectric breakdown is strongly linked to the injection and the accumulation of charges in a non-conducting material. The physics of charged insulators proposes mechanisms of trapping and transport of charges in aluminium oxides by considering defects as localization sources of charges and of energy. In order to measure the influence of defects on dielectric breakdown, various aluminous ceramics have been elaborated. The nature and the quantity of defects have been characterized by the nature and the rate of impurities, by porosity, by the quantity of grain boundaries and by the presence and distribution of secondary phases. These materials have undergone breakdown tests. The dielectric rigidity depends strongly on the nature and the distribution of crystallographic defects (vacancy, interstitial ions and dislocation), on the other hand porosity below 5% has no influence. The doping of an alumina ceramic containing less than 100 ppm of impurities implies a diminution of its dielectric rigidity. The measurement of the SEMM (scanning electron microscopy mirror) effect allows the characterization of insulating materials. This method permits the evaluation of the ability for materials to trap charges, it gives information about the charge kinetic of trapping, charge localization and the energy levels of traps. (A.C.)

  7. Effect of boron compounds on physical, mechanical, and fire properties of injection molded wood plastic composites

    Science.gov (United States)

    Nadir Ayrilmis; Turgay Akbulut; Turker Dundar; Robert H. White; Fatih Mengeloglu; Zeki Candan; Umit Buyuksari; Erkan Avci

    2011-01-01

    Physical, mechanical, and fire properties of the injection-molded wood flour/polypropylene composites (WPCs) incorporated with different levels of boron compounds, borax/boric acid (BX/BA) (0.5:0.5 wt %) and zinc borate (ZB) (4, 8, or 12 wt %) were investigated. The effect of the coupling agent loading (2, 4, or 6 wt %), maleic anhydride-grafted PP (MAPP), on the...

  8. Investigating the effect of acene-fusion and trifluoroacetyl substitution on the electronic and charge transport properties by density functional theory

    Directory of Open Access Journals (Sweden)

    Ahmad Irfan

    2016-05-01

    Full Text Available We designed novel derivatives of 4,6-di(thiophen-2-ylpyrimidine (DTP. Two benchmark strategies including mesomerically deactivating group, as well as the extension of π-conjugation bridge (acene-fusion have been employed to enhance the electrical and charge transport properties. The density functional theory (DFT and time dependent DFT methods have been used to get optimized geometries in ground and first excited state, respectively. The structural properties (geometric parameters, electronic properties (frontier molecular orbitals; highest occupied and lowest unoccupied molecular orbitals, photophysical properties (absorption, fluorescence and phosphorescence, and important charge transport properties are discussed to establish a molecular level structure–property relationship among these derivatives. Our calculated electronic spectra i.e., absorption, fluorescence and phosphorescence have been found in good semi-quantitative agreement with available experimental data. All the newly designed derivatives displayed significantly improved electron injection ability than those of the parent molecule. The values of reorganization energy and transfer integral elucidate that DTP is a potential hole transport material. Based on our present investigation, it is expected that the naphtho and anthra derivatives of DTP are better hole transporters than those of some well-known charge transporter materials like naphthalene, anthracene, tetracene and pentacene.

  9. Computational investigation of the effects of perfluorination on the charge-transport properties of polyaromatic hydrocarbons

    International Nuclear Information System (INIS)

    Cardia, R.; Malloci, G.; Bosin, A.; Serra, G.; Cappellini, G.

    2016-01-01

    We present a systematic computational study of the effects of perfluorination on the charge-transport properties of three homologous classes of polyaromatic hydrocarbons of interest for molecular electronics: acenes, pyrenes, and circumacenes. By means of Density Functional Theory calculations we first obtained the key molecular properties for transport of both holes and electrons. We then used these parameters in the framework of Marcus theory to compare charge-transfer rates in the high temperatures regime for both unsubstituted and perfluorinated molecules. We additionally estimated the relative charge-mobility of each unsubstituted (perfluorinated) molecule with respect to unsubstituted (perfluorinated) pentacene. We found in all cases that perfluorination reduces the charge-transfer rate in absolute terms. This is largely due to the higher values of the molecular reorganization energies predicted for perfluorinated compounds. Interestingly, however, the charge-transfer rates for both holes and electrons of perfluorinated species are remarkably similar, especially for the larger species. In addition, in the case of the larger circumacenes the charge-mobility values relative to pentacene values are found to increase upon perfluorination.

  10. Tribo-charging properties of waste plastic granules in process of tribo-electrostatic separation.

    Science.gov (United States)

    Li, Jia; Wu, Guiqing; Xu, Zhenming

    2015-01-01

    Plastic products can be found everywhere in people's daily life. With the consistent growth of plastic consumption, more and more plastic waste is generated. Considering the stable chemical and physics characteristics of plastic, regular waste management methods are not suitable for recycling economic strategy of each government, which has become a serious environmental problem. Recycling plastic waste is considered to be the best way to treat it, because it cannot only deduce the waste but also save the energy to produce new virgin plastic. Tribo-electrostatic separation is strongly recommended for plastic separation as it can preserve the original properties of plastic and has little additional pollution. In this study, plastic granules are generated by crushing plastic waste in waste electric and electronic equipment. The tribo-charging properties of plastic waste were studied by vibrating tribo-charging and cyclone tribo-charging. The triboelectric series obtained by vibrating was: (-)-PE-PS-PC-PVC-ABS-PP-(+), while the triboelectric series obtained by cyclone was (-)-PE-PS-PC-PVC-ABS-PP-(+). Further, the cyclone charging was more effective and stable than vibrating charging. The impact factors experiments showed that small particle size was better changed than large ones and were more suitable recycled by tribo-electrostatic separation. High relative humidity was identified as impede charging effect. The results of this study will help defining the operating parameters of subsequent separator. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Computational investigation of the effects of perfluorination on the charge-transport properties of polyaromatic hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Cardia, R. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy); Malloci, G., E-mail: giuliano.malloci@dsf.unica.it [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Bosin, A.; Serra, G. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Cappellini, G., E-mail: giancarlo.cappellini@dsf.unica.it [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy)

    2016-10-20

    We present a systematic computational study of the effects of perfluorination on the charge-transport properties of three homologous classes of polyaromatic hydrocarbons of interest for molecular electronics: acenes, pyrenes, and circumacenes. By means of Density Functional Theory calculations we first obtained the key molecular properties for transport of both holes and electrons. We then used these parameters in the framework of Marcus theory to compare charge-transfer rates in the high temperatures regime for both unsubstituted and perfluorinated molecules. We additionally estimated the relative charge-mobility of each unsubstituted (perfluorinated) molecule with respect to unsubstituted (perfluorinated) pentacene. We found in all cases that perfluorination reduces the charge-transfer rate in absolute terms. This is largely due to the higher values of the molecular reorganization energies predicted for perfluorinated compounds. Interestingly, however, the charge-transfer rates for both holes and electrons of perfluorinated species are remarkably similar, especially for the larger species. In addition, in the case of the larger circumacenes the charge-mobility values relative to pentacene values are found to increase upon perfluorination.

  12. Effect of five-membered ring and heteroatom substitution on charge transport properties of perylene discotic derivatives: A theoretical approach

    Energy Technology Data Exchange (ETDEWEB)

    Navarro, Amparo, E-mail: anavarro@ujaen.es; Fernández-Liencres, M. Paz; Peña-Ruiz, Tomás; Granadino-Roldán, José M.; Fernández-Gómez, Manuel [Departamento de Química Física y Analítica, Universidad de Jaén, Campus Las Lagunillas, E23071 Jaén (Spain); García, Gregorio [Instituto de Energía Solar and Departamento TFB, E.T.S.I. Telecomunicación, Universidad Politécnica de Madrid, Ciudad Universitaria, Madrid 28040 (Spain)

    2016-08-07

    Density functional theory calculations were carried out to investigate the evolvement of charge transport properties of a set of new discotic systems as a function of ring and heteroatom (B, Si, S, and Se) substitution on the basic structure of perylene. The replacement of six-membered rings by five-membered rings in the reference compound has shown a prominent effect on the electron reorganization energy that decreases ∼0.2 eV from perylene to the new carbon five-membered ring derivative. Heteroatom substitution with boron also revealed to lower the LUMO energy level and increase the electron affinity, therefore lowering the electron injection barrier compared to perylene. Since the rate of the charge transfer between two molecules in columnar discotic systems is strongly dependent on the orientation of the stacked cores, the total energy and transfer integral of a dimer as a disc is rotated with respect to the other along the stacking axis have been predicted. Aimed at obtaining a more realistic approach to the bulk structure, the molecular geometry of clusters made up of five discs was fully optimized, and charge transfer rate and mobilities were estimated for charge transport along a one dimensional pathway. Heteroatom substitution with selenium yields electron transfer integral values ∼0.3 eV with a relative disc orientation of 25°, which is the preferred angle according to the dimer energy profile. All the results indicate that the tetraselenium-substituted derivative, not synthetized so far, could be a promising candidate among those studied in this work for the fabrication of n-type semiconductors based on columnar discotic liquid crystals materials.

  13. Inferring Fault Frictional and Reservoir Hydraulic Properties From Injection-Induced Seismicity

    Science.gov (United States)

    Jagalur-Mohan, Jayanth; Jha, Birendra; Wang, Zheng; Juanes, Ruben; Marzouk, Youssef

    2018-02-01

    Characterizing the rheological properties of faults and the evolution of fault friction during seismic slip are fundamental problems in geology and seismology. Recent increases in the frequency of induced earthquakes have intensified the need for robust methods to estimate fault properties. Here we present a novel approach for estimation of aquifer and fault properties, which combines coupled multiphysics simulation of injection-induced seismicity with adaptive surrogate-based Bayesian inversion. In a synthetic 2-D model, we use aquifer pressure, ground displacements, and fault slip measurements during fluid injection to estimate the dynamic fault friction, the critical slip distance, and the aquifer permeability. Our forward model allows us to observe nonmonotonic evolutions of shear traction and slip on the fault resulting from the interplay of several physical mechanisms, including injection-induced aquifer expansion, stress transfer along the fault, and slip-induced stress relaxation. This interplay provides the basis for a successful joint inversion of induced seismicity, yielding well-informed Bayesian posterior distributions of dynamic friction and critical slip. We uncover an inverse relationship between dynamic friction and critical slip distance, which is in agreement with the small dynamic friction and large critical slip reported during seismicity on mature faults.

  14. Powder injection molding of Stellite 6 powder: Sintering, microstructural and mechanical properties

    International Nuclear Information System (INIS)

    Gülsoy, H. Özkan; Özgün, Özgür; Bilketay, Sezer

    2016-01-01

    The purpose of this study was to produce Co-based Stellite 6 superalloy components by using the method of Powder Injection Molding (PIM) and to characterize the microstructural and mechanical properties of the produced components. The experimental studies were started through the formation of feedstock by mixing Stellite 6 powder with a multicomponent binder system. Prepared feedstock was formed by utilizing powder injection molding technique. Then the molded samples were subjected to the solvent and thermal debinding processes. Different sintering cycles were applied to the raw components for the purpose of determining the optimum sintering conditions. The densities of the sintered components were determined in accordance with the Archimedes' principle. The microstructural characterization was performed through scanning electron microscope (SEM) analysis, energy dispersive spectrometry (EDS) analyses, and X-ray diffraction (XRD) analysis. Hardness measurement and tensile test were conducted in order to determine the mechanical properties. The results illustrated that the injection molded Stellite 6 components were composed of fine and equiaxed grains, plenty of carbide precipitates exhibiting homogenous distribution throughout the microstructure formed at the grain boundaries and thus the mechanical properties were considerably high.

  15. Transverse acceptance calculation for continuous ion beam injection into the electron beam ion trap charge breeder of the ReA post-accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Kittimanapun, K., E-mail: kritsadak@slri.or.th [National Superconducting Cyclotron Laboratory (NSCL), Michigan State University (MSU), 640 S. Shaw Lane, East Lansing, Michigan 48824 (United States); Synchrotron Light Research Institute (SLRI), 111 University Avenue, Muang District, Nakhon Ratchasima, 30000 (Thailand); Baumann, T.M.; Lapierre, A.; Schwarz, S. [National Superconducting Cyclotron Laboratory (NSCL), Michigan State University (MSU), 640 S. Shaw Lane, East Lansing, Michigan 48824 (United States); Bollen, G. [National Superconducting Cyclotron Laboratory (NSCL), Michigan State University (MSU), 640 S. Shaw Lane, East Lansing, Michigan 48824 (United States); Facility for Rare Isotope Beams (FRIB), Michigan State University, 640 S. Shaw Lane, East Lansing, Michigan 48824 (United States)

    2015-11-11

    The ReA post-accelerator at the National Superconducting Cyclotron Laboratory (NSCL) employs an electron beam ion trap (EBIT) as a charge breeder. A Monte-Carlo simulation code was developed to calculate the transverse acceptance phase space of the EBIT for continuously injected ion beams and to determine the capture efficiency in dependence of the transverse beam emittance. For this purpose, the code records the position and time of changes in charge state of injected ions, leading either to capture or loss of ions. To benchmark and validate the code, calculated capture efficiencies were compared with results from a geometrical model and measurements. The results of the code agree with the experimental findings within a few 10%. The code predicts a maximum total capture efficiency of 50% for EBIT parameters readily achievable and an efficiency of up to 80% for an electron beam current density of 1900 A/cm{sup 2}.

  16. High-performance serial block-face SEM of nonconductive biological samples enabled by focal gas injection-based charge compensation.

    Science.gov (United States)

    Deerinck, T J; Shone, T M; Bushong, E A; Ramachandra, R; Peltier, S T; Ellisman, M H

    2018-05-01

    A longstanding limitation of imaging with serial block-face scanning electron microscopy is specimen surface charging. This charging is largely due to the difficulties in making biological specimens and the resins in which they are embedded sufficiently conductive. Local accumulation of charge on the specimen surface can result in poor image quality and distortions. Even minor charging can lead to misalignments between sequential images of the block-face due to image jitter. Typically, variable-pressure SEM is used to reduce specimen charging, but this results in a significant reduction to spatial resolution, signal-to-noise ratio and overall image quality. Here we show the development and application of a simple system that effectively mitigates specimen charging by using focal gas injection of nitrogen over the sample block-face during imaging. A standard gas injection valve is paired with a precisely positioned but retractable application nozzle, which is mechanically coupled to the reciprocating action of the serial block-face ultramicrotome. This system enables the application of nitrogen gas precisely over the block-face during imaging while allowing the specimen chamber to be maintained under high vacuum to maximise achievable SEM image resolution. The action of the ultramicrotome drives the nozzle retraction, automatically moving it away from the specimen area during the cutting cycle of the knife. The device described was added to a Gatan 3View system with minimal modifications, allowing high-resolution block-face imaging of even the most charge prone of epoxy-embedded biological samples. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.

  17. Synthesis and charge storage properties of double-layered NiSi nanocrystals

    International Nuclear Information System (INIS)

    Yoon, Jong-Hwan

    2010-01-01

    Based on bidirectional diffusion of Ni atoms, double-layered nickel silicide (NiSi) nanocrystals (NCs) for multilevel charge storage were fabricated, and their charge storage properties were examined. The double layer was produced by long-term thermal annealing (for 4 h at 900 o C) of a sandwich structure comprised of a thin Ni film of 0.3 nm sandwiched between two silicon-rich oxide (SiO 1.36 ) layers. Transmission electron microscopic image clearly exhibits a distinct NiSi nanocrystal double layer with a gap of about 7 nm between the mean positions of particle distribution in each NC layer. Capacitance-voltage measurements on the metal/oxide/semiconductor (MOS) capacitors with the double-layered NiSi nanocrystals are shown to have the apparent two plateaus of charge storage, the large memory window of about 9 V and the improved charge retention stability.

  18. Influence of gas injection on viscous and viscoelastic properties of Xanthan gum.

    Science.gov (United States)

    Bobade, Veena; Cheetham, Madalyn; Hashim, Jamal; Eshtiaghi, Nicky

    2018-05-01

    Xanthan gum is widely used as a model fluid for sludge to mimic the rheological behaviour under various conditions including impact of gas injection in sludge. However, there is no study to show the influence of gas injection on rheological properties of xanthan gum specifically at the concentrations at which it is used as a model fluid for sludge with solids concentration above 2%. In this paper, the rheological properties of aqueous xanthan gum solutions at different concentrations were measured over a range of gas injection flow rates. The effect of gas injection on both the flow and viscoelastic behaviour of Xanthan gum (using two different methods - a creep test and a time sweep test) was evaluated. The viscosity curve of different solid concentrations of digested sludge and waste activated sludge were compared with different solid concentrations of Xanthan gum and the results showed that Xanthan gum can mimic the flow behaviour of sludge in flow regime. The results in linear viscoelastic regime showed that increasing gas flow rate increases storage modulus (G'), indicating an increase in the intermolecular associations within the material structure leading to an increase in material strength and solid behaviour. Similarly, in creep test an increase in the gas flow rate decreased strain%, signifying that the material has become more resistant to flow. Both observed behaviour is opposite to what occurs in sludge under similar conditions. The results of both the creep test and the time sweep test indicated that choosing Xanthan gum aqueous solution as a transparent model fluid for sludge in viscoelastic regime under similar conditions involving gas injection in a concentration range studied is not feasible. However Xanthan gum can be used as a model material for sludge in flow regime; because it shows a similar behaviour to sludge. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Efficient charge injection in p-type polymer field-effect transistors with low-cost molybdenum electrodes through V2O5 interlayer.

    Science.gov (United States)

    Baeg, Kang-Jun; Bae, Gwang-Tae; Noh, Yong-Young

    2013-06-26

    Here we report high-performance polymer OFETs with a low-cost Mo source/drain electrode by efficient charge injection through the formation of a thermally deposited V2O5 thin film interlayer. A thermally deposited V2O5 interlayer is formed between a regioregular poly(3-hexylthiophene) (rr-P3HT) or a p-type polymer semiconductor containing dodecyl-substituted thienylenevinylene (TV) and dodecylthiophene (PC12TV12T) and the Mo source/drain electrode. The P3HT or PC12TV12T OFETs with the bare Mo electrode exhibited lower charge carrier mobility than those with Au owing to a large barrier height for hole injection (0.5-1.0 eV). By forming the V2O5 layer, the P3HT or PC12TV12T OFETs with V2O5 on the Mo electrode exhibited charge carrier mobility comparable to that of a pristine Au electrode. Best P3HT or PC12TV12T OFETs with 5 nm thick V2O5 on Mo electrode show the charge carrier mobility of 0.12 and 0.38 cm(2)/(V s), respectively. Ultraviolet photoelectron spectroscopy results exhibited the work-function of the Mo electrode progressively changed from 4.3 to 4.9 eV with an increase in V2O5 thickness from 0 to 5 nm, respectively. Interestingly, the V2O5-deposited Mo exhibits comparable Rc to Au, which mainly results from the decreased barrier height for hole carrier injection from the low-cost metal electrode to the frontier molecular orbital of the p-type polymer semiconductor after the incorporation of the transition metal oxide hole injection layer, such as V2O5. This enables the development of large-area, low-cost electronics with the Mo electrodes and V2O5 interlayer.

  20. Charge imbalance

    International Nuclear Information System (INIS)

    Clarke, J.

    1981-01-01

    This article provides a long theoretical development of the main ideas of charge imbalance in superconductors. Concepts of charge imbalance and quasiparticle charge are introduced, especially in regards to the use of tunnel injection in producing and detecting charge imbalance. Various mechanisms of charge relaxation are discussed, including inelastic scattering processes, elastic scattering in the presence of energy-gap anisotropy, and various pair-breaking mechanisms. In each case, present theories are reviewed in comparison with experimental data

  1. Phase space properties of charged fields in theories of local observables

    International Nuclear Information System (INIS)

    Buchholz, D.; D'Antoni, C.

    1994-10-01

    Within the setting of algebraic quantum field theory a relation between phase-space properties of observables and charged fields is established. These properties are expressed in terms of compactness and nuclarity conditions which are the basis for the characterization of theories with physically reasonable causal and thermal features. Relevant concepts and results of phase space analysis in algebraic qunatum field theory are reviewed and the underlying ideas are outlined. (orig.)

  2. Local charge transport properties of hydrazine reduced monolayer graphene oxide sheets prepared under pressure condition

    DEFF Research Database (Denmark)

    Ryuzaki, Sou; Meyer, Jakob Abild Stengaard; Petersen, Søren Vermehren

    2014-01-01

    Charge transport properties of chemically reduced graphene oxide (RGO) sheets prepared by treatment with hydrazine were examined using conductive atomic force microscopy. The current-voltage (I-V) characteristics of monolayer RGO sheets prepared under atmospheric pressure followed an exponentially...

  3. Injection and temporary capture of a charged particle beam in an open magnetic configuration. Optimization of the configuration. Case of cylindrical symmetry: A mirror machine

    International Nuclear Information System (INIS)

    Capdequi-Peyranere, P.

    1966-12-01

    A study has been made of a new method of transverse injection of charged particles into a magnetic mirror configuration. This injection scheme permits the penetration and temporary capture by non-adiabatic effect of a particle beam of approximately 1 cm 2 cross-section. A theoretical study of the injection and capture is made in the approximation that space charge is negligible. The original programs for IBM 7094 computer calculations are described; these programs were used to obtain an optimization of the configuration. The results of a statistical numerical study of the optimum configuration are then given. This study indicates that, if the energy of the particles of the beam is about 1 per cent greater than a minimum penetration energy, the entire beam can be captured with an average capture length of 100 meters (50 reflections between the two mirrors). If the energy is about 4 per cent greater than the minimum penetration energy, the capture length is reduced to 40 meters. We have studied the distribution of energy transverse and longitudinal with the magnetic field for the population of captured particles. For the cases of injected molecular hydrogen ions or heavy CH 4 + ions, a study is made of the capture time of protons resulting from the dissociation of the ions by collisions with the neutral gas. Finally, we describe a model experiment using electrons designed to provide an experimental verification of the capture of the primary beam. (author) [fr

  4. Effect of fuel injection parameters on combustion stability and emissions of a mineral diesel fueled partially premixed charge compression ignition (PCCI) engine

    International Nuclear Information System (INIS)

    Jain, Ayush; Singh, Akhilendra Pratap; Agarwal, Avinash Kumar

    2017-01-01

    Highlights: • NOx and PM emissions were lowest at 700 bar fuel injection pressure (FIP). • PCCI showed lower knocking than compression ignition combustion mode. • Increasing FIP reduced emissions of nitrogen oxides and smoke opacity in PCCI mode. • Increasing FIP reduced nucleation mode particle concentration. • Increasing FIP with advanced main injection timings improved PCCI combustion. - Abstract: This experimental study focuses on developing new combustion concept for compression ignition (CI) engines by achieving partially homogeneous charge, leading to low temperature combustion (LTC). Partially premixed charge compression ignition (PCCI) combustion is a single-stage phenomenon, with combustion shifting towards increasingly premixed combustion phase, resulting in lower in-cylinder temperatures. PCCI leads to relatively lower emissions of oxides of nitrogen (NOx) and particulate matter (PM) simultaneously. To investigate combustion, performance and emission characteristics of the PCCI engine, experiments were performed in a mineral diesel fueled single cylinder research engine, which was equipped with flexible fuel injection equipment (FIE). Effects of fuel injection pressure (FIP) were investigated by changing the FIP from 400 bar to 1000 bar. Experiments were carried out by varying start of main injection (SoMI) timings (from 12° to 24° before top dead center (bTDC)), when using single pilot injection. This experimental study included detailed investigations of particulate characteristics such as particulate number-size distribution using engine exhaust particle sizer (EEPS), particulate bound trace metal analysis using inductively coupled plasma-optical emission spectrometer (ICP-OES), and soot morphology using transmission electron microscopy (TEM). PCCI combustion improved with increasing FIP (up to 700 bar) due to superior fuel atomization however further increasing FIP deteriorated PCCI combustion and engine performance due to intense

  5. Dynamics of morphofunctional erythrocyte properties during intravenous glucose injection in patients with coronary heart disease

    Science.gov (United States)

    Malinova, Lidia I.; Simonenko, Georgy V.; Denisova, Tatyana P.; Tuchin, Valery V.

    2007-02-01

    Dynamics of glucose concentration in human organism is an important diagnostic characteristic for it's parameters correlate significantly with the severity of metabolic, vessel and perfusion disorders. 36 patients with stable angina pectoris of II and III functional classes were involved in this study. All of them were men in age range of 45-59 years old. 7 patients hospitalized with acute myocardial infarction (aged from 49 to 59 years old) form the group of compare. Control group (n = 5) was of practically healthy men in comparable age. To all patients intravenous glucose solution (40%) in standard loading dose was injected. Capillary and vein blood samples were withdrawn before, and 5, 60, 120, 180 and 240 minutes after glucose load. At these time points blood pressure and glucose concentration were measured. In prepared blood smears shape, deformability and sizes of erythrocytes, quantity and degree of shear stress resistant erythrocyte aggregates were studied. Received data were approximated by polynomial of high degree to receive concentration function of studied parameters, which first derivative elucidate velocity characteristics of morphofunctional erythrocyte properties during intravenous glucose injection in patients with coronary heart disease and practically healthy persons. Received data show principle differences in dynamics of morphofunctional erythrocyte properties during intravenous glucose injection in patients with coronary heart disease as a possible mechanism of coronary blood flow destabilization.

  6. Biomimetic properties of an injectable chitosan/nano-hydroxyapatite/collagen composite

    Energy Technology Data Exchange (ETDEWEB)

    Huang Zhi [Laboratory of Advanced Materials, Department of Materials Science and Engineering, Tsinghua University, Beijing 100084 (China); Feng Qingling, E-mail: biomater@mail.tsinghua.edu.cn [Laboratory of Advanced Materials, Department of Materials Science and Engineering, Tsinghua University, Beijing 100084 (China); Yu Bo; Li Songjian [Department of Orthopedics, Zhujiang Hospital of Southern Medical University, Guangzhou 510282 (China)

    2011-04-08

    To meet the challenges of designing an injectable scaffold and regenerating bone with complex three-dimensional (3D) structures, a biomimetic and injectable hydrogel scaffold based on nano-hydroxyapatite (HA), collagen (Col) and chitosan (Chi) is synthesized. The chitosan/nano-hydroxyapatite/collagen (Chi/HA/Col) solution rapidly forms a stable gel at body temperature. It shows some features of natural bone both in main composition and microstructure. The Chi/HA/Col system can be expected as a candidate for workable systemic minimally invasive scaffolds with surface properties similar to physiological bone based on scanning electron microscopic (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), X-ray diffraction (XRD) and Fourier transform infrared spectroscopy (FT-IR) results.

  7. Biomimetic properties of an injectable chitosan/nano-hydroxyapatite/collagen composite

    International Nuclear Information System (INIS)

    Huang Zhi; Feng Qingling; Yu Bo; Li Songjian

    2011-01-01

    To meet the challenges of designing an injectable scaffold and regenerating bone with complex three-dimensional (3D) structures, a biomimetic and injectable hydrogel scaffold based on nano-hydroxyapatite (HA), collagen (Col) and chitosan (Chi) is synthesized. The chitosan/nano-hydroxyapatite/collagen (Chi/HA/Col) solution rapidly forms a stable gel at body temperature. It shows some features of natural bone both in main composition and microstructure. The Chi/HA/Col system can be expected as a candidate for workable systemic minimally invasive scaffolds with surface properties similar to physiological bone based on scanning electron microscopic (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), X-ray diffraction (XRD) and Fourier transform infrared spectroscopy (FT-IR) results.

  8. Properties of the chromatin assembled on DNA injected into Xenopus oocytes and eggs

    International Nuclear Information System (INIS)

    Gargiulo, G.; Wasserman, W.; Worcel, A.

    1983-01-01

    The onset of DNA synthesis occurs between 10 and 30 minutes after activation of the egg and thus the transition from nuclease-sensitive to nuclease-resistant supercoils may take place on the newly replicated DNA. To test this possibility, the nonradioactive circular 5-kb DNA carrying the Drosophila histone gene repeat and [α -32 P]dCTP were coinjected into fertilized eggs. Such protocol labels both the injected, replicated heterologous DNA and the replicated endogenous, maternal Xenopus DNA. The labeled, presumably replicated, supercoiled DNA is resistant to micrococcal nuclease as expected. The endogenous, high-molecular-weight Xenopus DNA is degraded to 180-bp nucleosomal DNA. Thus, the nuclease resistance is not a general property of chromatin during the cleavage stage of the Xenopus embryo but is a peculiar feature of the injected DNA. 42 references, 5 figures

  9. On the effects of fuel properties and injection timing in partially premixed compression ignition of low octane fuels

    KAUST Repository

    Naser, Nimal

    2017-06-29

    A better understanding on the effects of fuel properties and injection timing is required to improve the performance of advanced engines based on low temperature combustion concepts. In this work, an experimental and computational study was conducted to investigate the effects of physical and chemical kinetic properties of low octane fuels and their surrogates in partially premixed compression ignition (PPCI) engines. The main objective was to identify the relative importance of physical versus chemical kinetic properties in predicting practical fuel combustion behavior across a range of injection timings. Two fuel/surrogate pairs were chosen for comparison: light naphtha (LN) versus the primary reference fuel (PRF) with research octane number of 65 (PRF 65), and FACE (fuels for advanced combustion engines) I gasoline versus PRF 70. Two sets of parametric studies were conducted: the first varied the amount of injected fuel mass at different injection timings to match a fixed combustion phasing, and the second maintained the same injected fuel mass at each injection timing to assess resulting combustion phasing changes. Full-cycle computational fluid dynamic engine simulations were conducted by accounting for differences in the physical properties of the original and surrogate fuels, while employing identical chemical kinetics. The simulations were found to capture trends observed in the experiments, while providing details on spatial mixing and chemical reactivity for different fuels and injection timings. It was found that differences in physical properties become increasingly important as injection timing was progressively delayed from premixed conditions, and this was rationalized by analysis of mixture stratification patterns resulting from injection of fuels with different physical properties. The results suggest that accurate descriptions of both physical and chemical behavior of fuels are critical in predictive simulations of PPCI engines for a wide range of

  10. On the effects of fuel properties and injection timing in partially premixed compression ignition of low octane fuels

    KAUST Repository

    Naser, Nimal; Jaasim, Mohammed; Atef, Nour; Chung, Suk-Ho; Im, Hong G.; Sarathy, Mani

    2017-01-01

    A better understanding on the effects of fuel properties and injection timing is required to improve the performance of advanced engines based on low temperature combustion concepts. In this work, an experimental and computational study was conducted to investigate the effects of physical and chemical kinetic properties of low octane fuels and their surrogates in partially premixed compression ignition (PPCI) engines. The main objective was to identify the relative importance of physical versus chemical kinetic properties in predicting practical fuel combustion behavior across a range of injection timings. Two fuel/surrogate pairs were chosen for comparison: light naphtha (LN) versus the primary reference fuel (PRF) with research octane number of 65 (PRF 65), and FACE (fuels for advanced combustion engines) I gasoline versus PRF 70. Two sets of parametric studies were conducted: the first varied the amount of injected fuel mass at different injection timings to match a fixed combustion phasing, and the second maintained the same injected fuel mass at each injection timing to assess resulting combustion phasing changes. Full-cycle computational fluid dynamic engine simulations were conducted by accounting for differences in the physical properties of the original and surrogate fuels, while employing identical chemical kinetics. The simulations were found to capture trends observed in the experiments, while providing details on spatial mixing and chemical reactivity for different fuels and injection timings. It was found that differences in physical properties become increasingly important as injection timing was progressively delayed from premixed conditions, and this was rationalized by analysis of mixture stratification patterns resulting from injection of fuels with different physical properties. The results suggest that accurate descriptions of both physical and chemical behavior of fuels are critical in predictive simulations of PPCI engines for a wide range of

  11. Laboratory Studies of Charging Properties of Dust Grains in Astrophysical/Planetary Environments

    Science.gov (United States)

    Tankosic, D.; Abbas, M. M.

    2012-01-01

    Dust grains in various astrophysical environments are generally charged electrostatically by photoelectric emissions with UV/X-ray radiation, as well as by electron/ion impact. Knowledge of physical and optical properties of individual dust grains is required for understanding of the physical and dynamical processes in space environments and the role of dust in formation of stellar and planetary systems. In this paper we focus on charging of individual micron/submicron dust grains by processes that include: (a) UV photoelectric emissions involving incident photon energies higher than the work function of the material and b) electron impact, where low energy electrons are scattered or stick to the dust grains, thereby charging the dust grains negatively, and at sufficiently high energies the incident electrons penetrate the grain leading to excitation and emission of electrons referred to as secondary electron emission (SEE). It is well accepted that the charging properties of individual micron/submicron size dust grains are expected to be substantially different from the bulk materials. However, no viable models for calculation of the charging properties of individual micron size dust grains are available at the present time. Therefore, the photoelectric yields, and secondary electron emission yields of micron-size dust grains have to be obtained by experimental methods. Currently, very limited experimental data are available for charging of individual micron-size dust grains. Our experimental results, obtained on individual, micron-size dust grains levitated in an electrodynamic balance facility (at NASA-MSFC), show that: (1) The measured photoelectric yields are substantially higher than the bulk values given in the literature and indicate a particle size dependence with larger particles having order-of-magnitude higher values than for submicron-size grains; (2) dust charging by low energy electron impact is a complex process. Also, our measurements indicate that

  12. Collective properties of injection-induced earthquake sequences: 1. Model description and directivity bias

    Science.gov (United States)

    Dempsey, David; Suckale, Jenny

    2016-05-01

    Induced seismicity is of increasing concern for oil and gas, geothermal, and carbon sequestration operations, with several M > 5 events triggered in recent years. Modeling plays an important role in understanding the causes of this seismicity and in constraining seismic hazard. Here we study the collective properties of induced earthquake sequences and the physics underpinning them. In this first paper of a two-part series, we focus on the directivity ratio, which quantifies whether fault rupture is dominated by one (unilateral) or two (bilateral) propagating fronts. In a second paper, we focus on the spatiotemporal and magnitude-frequency distributions of induced seismicity. We develop a model that couples a fracture mechanics description of 1-D fault rupture with fractal stress heterogeneity and the evolving pore pressure distribution around an injection well that triggers earthquakes. The extent of fault rupture is calculated from the equations of motion for two tips of an expanding crack centered at the earthquake hypocenter. Under tectonic loading conditions, our model exhibits a preference for unilateral rupture and a normal distribution of hypocenter locations, two features that are consistent with seismological observations. On the other hand, catalogs of induced events when injection occurs directly onto a fault exhibit a bias toward ruptures that propagate toward the injection well. This bias is due to relatively favorable conditions for rupture that exist within the high-pressure plume. The strength of the directivity bias depends on a number of factors including the style of pressure buildup, the proximity of the fault to failure and event magnitude. For injection off a fault that triggers earthquakes, the modeled directivity bias is small and may be too weak for practical detection. For two hypothetical injection scenarios, we estimate the number of earthquake observations required to detect directivity bias.

  13. Antibacterial properties of 2% lidocaine and reduced rate of endophthalmitis after intravitreal injection.

    Science.gov (United States)

    Tustin, Aaron; Kim, Stephen J; Chomsky, Amy; Hubbard, G Baker; Sheng, Jinsong

    2014-05-01

    To determine whether the application of subconjunctival 2% lidocaine/0.1% methylparaben for anesthesia may reduce rates of endophthalmitis after intravitreal (IVT) injection. We performed in vitro experiments to determine the antibacterial properties of 2% lidocaine/0.1% methylparaben (lidocaine) against causative organisms of endophthalmitis. Isolates of Staphylococcus aureus, Staphylococcus epidermidis, and Streptococcus viridans from patients with endophthalmitis were incubated with or without lidocaine. Aliquots (100 µL) were plated on Mueller-Hinton (S. aureus and S. epidermidis) or blood agar plates (S. viridans) at 0, 10, 30, 120, and 240 minutes, and colonies were counted after 24 hours. A retrospective review of 15,042 IVT injections was performed from January 2004 to February 2011 to determine the rate of endophthalmitis with or without application of subconjunctival lidocaine for anesthesia. Lidocaine demonstrated rapid bactericidal effects against all 3 organisms. After 10 minutes of exposure, there was approximately a 90% (P < 0.01), 95% (P < 0.001), and 92% (P < 0.001) reduction in colony forming units when compared with time 0 for S. aureus, S. epidermidis, and S. viridans, respectively. Complete elimination of colony forming units occurred at subsequent time points for each organism in contrast to logarithmic increase for control plates. There were a total of 0 cases of endophthalmitis of 6,853 IVT injections performed with subconjunctival lidocaine and 8 cases of endophthalmitis of 8,189 (0.1%) IVT injections performed with other methods of anesthesia (P = 0.03). Application of subconjunctival 2% lidocaine/0.1% methylparaben for anesthesia may reduce the incidence of endophthalmitis after IVT injection.

  14. Varying the charge of small cations in liquid water: Structural, transport, and thermodynamical properties

    Science.gov (United States)

    Martelli, Fausto; Vuilleumier, Rodolphe; Simonin, Jean-Pierre; Spezia, Riccardo

    2012-10-01

    In this work, we show how increasing the charge of small cations affects the structural, thermodynamical, and dynamical properties of these ions in liquid water. We have studied the case of lanthanoid and actinoid ions, for which we have recently developed accurate polarizable force fields, and the ionic radius is in the 0.995-1.250 Å range, and explored the valency range from 0 to 4+. We found that the ion charge strongly structures the neighboring water molecules and that, in this range of charges, the hydration enthalpies exhibit a quadratic dependence with respect to the charge, in line with the Born model. The diffusion process follows two main regimes: a hydrodynamical regime for neutral or low charges, and a dielectric friction regime for high charges in which the contraction of the ionic radius along the series of elements causes a decrease of the diffusion coefficient. This latter behavior can be qualitatively described by theoretical models, such as the Zwanzig and the solvated ion models. However, these models need be modified in order to obtain agreement with the observed behavior in the full charge range. We have thus modified the solvated ion model by introducing a dependence of the bare ion radius as a function of the ionic charge. Besides agreement between theory and simulation this modification allows one to obtain an empirical unified model. Thus, by analyzing the contributions to the drag coefficient from the viscous and the dielectric terms, we are able to explain the transition from a regime in which the effect of viscosity dominates to one in which dielectric friction governs the motion of ions with radii of ca. 1 Å.

  15. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  16. Improving charge transport property and energy transfer with carbon quantum dots in inverted polymer solar cells

    International Nuclear Information System (INIS)

    Liu, Chunyu; Chang, Kaiwen; Guo, Wenbin; Li, Hao; Shen, Liang; Chen, Weiyou; Yan, Dawei

    2014-01-01

    Carbon quantum dots (Cdots) are synthesized by a simple method and introduced into active layer of polymer solar cells (PSCs). The performance of doped devices was apparently improved, and the highest power conversion efficiency of 7.05% was obtained, corresponding to a 28.2% enhancement compared with that of the contrast device. The charge transport properties, resistance, impedance, and transient absorption spectrum are systematically investigated to explore how the Cdots affect on PSCs performance. This study reveals the importance of Cdots in enhancing the efficiency of PSCs and gives insight into the mechanism of charge transport improvement.

  17. Properties of structural steels melted out of high-purity charge

    International Nuclear Information System (INIS)

    Marchenko, V.N.; Sergeeva, T.K.; Kondakova, N.K.; Morozov, V.P.; Madorskij, L.L.

    1993-01-01

    A comparative evaluation has been made of impurities, mechanical properties and hydrogen embirittlement parameters for steels type 40Kh and 40KhS produced by electrometallurgical method with the use of direct reduced charge (DR-steels) and melted in an open-hearth furnace. Investigation results have shown that 40Kh and 40KhS Dr-steels have more coarse austenitic grains and experience more complete transformation of martensite into ferritic-pearlitic mixture on tempering. Threshold stresses increase 2.5 times due to purity enhancement at the expense of application of direct reduced charge

  18. Mechanical Properties Distribution within Polypropylene Injection Molded Samples: Effect of Mold Temperature under Uneven Thermal Conditions

    Directory of Open Access Journals (Sweden)

    Sara Liparoti

    2017-11-01

    Full Text Available The quality of the polymer parts produced by injection molding is strongly affected by the processing conditions. Uncontrolled deviations from the proper process parameters could significantly affect both internal structure and final material properties. In this work, to mimic an uneven temperature field, a strong asymmetric heating is applied during the production of injection-molded polypropylene samples. The morphology of the samples is characterized by optical and atomic force microscopy (AFM, whereas the distribution of mechanical modulus at different scales is obtained by Indentation and HarmoniX AFM tests. Results clearly show that the temperature differences between the two mold surfaces significantly affect the morphology distributions of the molded parts. This is due to both the uneven temperature field evolutions and to the asymmetric flow field. The final mechanical property distributions are determined by competition between the local molecular stretch and the local structuring achieved during solidification. The cooling rate changes affect internal structures in terms of relaxation/reorganization levels and give rise to an asymmetric distribution of mechanical properties.

  19. Investigation of the Impact of Fuel Properties on Particulate Number Emission of a Modern Gasoline Direct Injection Engine

    Energy Technology Data Exchange (ETDEWEB)

    McCormick, Robert L [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Fioroni, Gina [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Fatouraie, Mohammad [Robert Bosch LLC; Frommherz, Mario [Robert Bosch LLC; Mosburger, Michael [Robert Bosch LLC; Chapman, Elana [General Motors LLC; Li, Sharon [General Motors LLC

    2018-04-03

    Gasoline Direct Injection (GDI) has become the preferred technology for spark-ignition engines resulting in greater specific power output and lower fuel consumption, and consequently reduction in CO2 emission. However, GDI engines face a substantial challenge in meeting new and future emission limits, especially the stringent particle number (PN) emissions recently introduced in Europe and China. Studies have shown that the fuel used by a vehicle has a significant impact on engine out emissions. In this study, nine fuels with varying chemical composition and physical properties were tested on a modern turbo-charged side-mounted GDI engine with design changes to reduce particulate emissions. The fuels tested included four fuels meeting US certification requirements; two fuels meeting European certification requirements; and one fuel meeting China 6 certification requirements being proposed at the time of this work. Two risk safeguard fuels (RSG), representing the properties of worst case market fuels in Europe and China, were also included. The particle number concentration of the solid particulates was measured in the engine-out exhaust flow at steady state engine operations with load and speed sweeps, and semi-transient load steps. The test results showed a factor of 6 PN emission difference among all certification fuels tested. Combined with detailed fuel analyses, this study evaluated important factors (such as oxygenates, carbon chain length and thermo-physical properties) that cause PN emissions which were not included in PMI index. A linear regression was performed to develop a PN predictive model which showed improved fitting quality than using PMI.

  20. Protein denaturation and functional properties of Lenient Steam Injection heat treated whey protein concentrate

    DEFF Research Database (Denmark)

    Dickow, Jonatan Ahrens; Kaufmann, Niels; Wiking, Lars

    2012-01-01

    Whey protein concentrate (WPC) was heat treated by use of the novel heat treatment method of Lenient Steam Injection (LSI) to elucidate new functional properties in relation to heat-induced gelation of heat treated WPC. Denaturation was measured by both DSC and FPLC, and the results of the two...... methods were highly correlated. Temperatures of up to 90 °C were applicable using LSI, whereas only 68 °C could be reached by plate heat exchange before coagulation/fouling. Denaturation of whey proteins increased with increasing heat treatment temperature up to a degree of 30–35% denaturation at 90 °C...

  1. Effect of different photoanode nanostructures on the initial charge separation and electron injection process in dye sensitized solar cells: A photophysical study with indoline dyes

    Energy Technology Data Exchange (ETDEWEB)

    Idígoras, Jesús [Nanostructured Solar Cells Group, Department of Physical, Chemical and Natural Systems, Universidad Pablo de Olavide, Ctra. Utrera, km 1, ES-41013 Seville (Spain); Sobuś, Jan [NanoBioMedical Centre, Adam Mickiewicz University, Umultowska 85, 61-614 Poznań (Poland); Quantum Electronics Laboratory, Faculty of Physics, Adam Mickiewicz University in Poznań, Umultowska 85, 61-614 Poznań (Poland); Jancelewicz, Mariusz [NanoBioMedical Centre, Adam Mickiewicz University, Umultowska 85, 61-614 Poznań (Poland); Azaceta, Eneko; Tena-Zaera, Ramon [Materials Division, IK4-CIDETEC, Parque Tecnológico de San Sebastián, Paseo Miramón 196, Donostia-San Sebastián, 20009 (Spain); Anta, Juan A. [Nanostructured Solar Cells Group, Department of Physical, Chemical and Natural Systems, Universidad Pablo de Olavide, Ctra. Utrera, km 1, ES-41013 Seville (Spain); Ziółek, Marcin, E-mail: marziol@amu.edu.pl [Quantum Electronics Laboratory, Faculty of Physics, Adam Mickiewicz University in Poznań, Umultowska 85, 61-614 Poznań (Poland)

    2016-02-15

    Ultrafast and fast charge separation processes were investigated for complete cells based on several ZnO-based photoanode nanostructures and standard TiO{sub 2} nanoparticle layers sensitized with the indoline dye coded D358. Different ZnO morphologies (nanoparticles, nanowires, mesoporous), synthesis methods (hydrothermal, gas-phase, electrodeposition in aqueous media and ionic liquid media) and coatings (ZnO–ZnO core–shell, ZnO–TiO{sub 2} core–shell) were measured by transient absorption techniques in the time scale from 100 fs to 100 μs and in the visible and near-infrared spectral range. All of ZnO cells show worse electron injection yields with respect to those with standard TiO{sub 2} material. Lower refractive index of ZnO than that of TiO{sub 2} is suggested to be an additional factor, not considered so far, that can decrease the performance of ZnO-based solar cells. Evidence of the participation of the excited charge transfer state of the dye in the charge separation process is provided here. The lifetime of this state in fully working devices extends from several ps to several tens of ps, which is much longer than the typically postulated electron injection times in all-organic dye-sensitized solar cells. The results here provided, comprising a wide variety of morphologies and preparation methods, point to the universality of the poor performance of ZnO as photoanode material with respect to standard TiO{sub 2}. - Highlights: • Wide variety of morphologies and preparation methods has been checked for ZnO cells. • All ZnO cells work worse than TiO{sub 2} ones. • Effective refractive index might be an additional factor in solar cell performance. • Excited charge transfer state of indoline dyes participates in the charge separation.

  2. Charge-exchange measurements of MHD activity during neutral beam injection in the Princeton Large Torus and the Poloidal Divertor Experiment

    International Nuclear Information System (INIS)

    Goldston, R.J.; Kaita, R.; Beiersdorfer, P.; Gammel, G.; Herndon, D.L.; McCune, D.C.; Meyerhofer, D.D.

    1986-07-01

    The horizontally scanning, multiangle charge-exchange analyzers on the Princeton Large Torus (PLT) and the Poloidal Divertor Experiment (PDX) were used to study the effects of MHD activity on the background ion distribution function and on the beam ion slowing-down process during high-power neutral injection. Sawtooth oscillations were observed in the fast ion flux on PLT and PDX, and measurements with neutral beams providing local neutral density enhancement indicate that ions are transported radially when these events occur. With near-perpendicular injection in PDX, at the lower toroidal fields necessary to maximize beta, rapid, repetitive bursts of greatly enhanced charge-exchange flux were observed. These are associated with the ''fishbone'' MHD instability, and a substantial depletion of the perpendicular slowing-down spectrum below the injection energy was seen. A simple phenomenological model for this loss mechanism was developed, and its use in simulation codes has been successful in providing good agreement with the data. The behavior and characteristics of this model are well matched by the direct theoretical calculations

  3. Characterization of surface charge and mechanical properties of chitosan/alginate based biomaterials

    International Nuclear Information System (INIS)

    Verma, Devendra; Desai, Malav S.; Kulkarni, Namrata; Langrana, Noshir

    2011-01-01

    This study aims to examine mechanical properties and surface charge characteristics of chitosan/alginate-based films for biomedical applications. By varying the concentrations of chitosan and alginate, we have developed films with varying surface charge densities and mechanical characteristics. The surface charge densities of these films were determined by applying an analytical model on force curves derived from an atomic force microscope (AFM). The average surface charge densities of films containing 60% chitosan and 80% chitosan were found to be - 0.46 mC/m 2 and - 0.32 mC/m 2 , respectively. The surface charge density of 90% chitosan containing films was found to be neutral. The elastic moduli and the water content were found to be decreasing with increasing chitosan concentration. The films with 60%, 80% and 90% chitosan gained 93.5 ± 6.6%, 217.1 ± 22.1% and 396.8 ± 67.5% of their initial weight, respectively. Their elastic moduli were found to be 2.6 ± 0.14 MPa, 1.9 ± 0.27 MPa and 0.93 ± 0.12 MPa, respectively. The trend observed in the mechanical response of these films has been attributed to the combined effect of the concentration of polyelectrolyte complexes (PEC) and the amount of water absorbed. The Fourier transform infrared spectroscopy experiments indicate the presence of higher alginate on the surface of the films compared to the bulk in all films. The presence of higher alginate on surface is consistent with negative surface charge densities of these films, determined from AFM experiments. Highlights: → Chitosan/alginate based fibrous polyelectrolyte complex films were developed. → The average surface charge density of the films was determined using AFM. → Elastic modulus of the films increased with increase in PEC content. → FTIR analysis indicated higher alginate content on surface compared to bulk.

  4. The isolation and characterisation of jacalin [Artocarpus heterophyllus (jackfruit) lectin] based on its charge properties.

    Science.gov (United States)

    Kabir, S

    1995-02-01

    Jackfruit extracts contain a protein termed jacalin which possesses diverse biological properties. A detailed analysis of its charge properties has been lacking. The present investigation was initiated to study isoelectric properties of jacalin in detail and to isolate a single isoform of jacalin. Jacalin was isolated from jackfruit extracts by affinity chromatography on immunoglobulin-A immobilised to Sepharose 4B. Various techniques such as ion-exchange chromatography, isoelectric focusing (IEF) on polyacrylamide gels and preparative liquid IEF with the Rotofor cell were used. When analysed by IEF on thin layer polyacrylamide gels, jacalin was resolved into 35 bands over a pH range of 5.0-8.5. Upon SDS-PAGE in the second dimension all these charge species gave rise to only two-bands at 12 and 15.4 kDa. The lectin was mostly eluted with 50 and 100 mM sodium chloride when jackfruit extracts were fractionated on an anion-exchange column of DEAE-cellulose. In a single 6 hour run by preparative IEF with the Rotofor cell in the pH range of 3-9.5, it has been possible to isolate pure jacalin fractions containing fewer number of charged isomers. A single jacalin isoform was isolated by subjecting a Rotofor fraction containing fewer charged species to preparative IEF on thin layer polyacrylamide gel and eluting the band of interest from the gel. The isolated jacalin isoform was biologically active as it agglutinated erythrocytes. The study reveals the complexity of jacalin as it exists as multiple charge isomers over a broad pH range. By performing preparative IEF in solution as well as in thin layer polyacrylamide gels, it was possible to isolate a single jacalin isoform with the retention of biological activity.

  5. Aqueous lubricating properties of charged (ABC) and neutral (ABA) triblock copolymer chains

    DEFF Research Database (Denmark)

    Røn, Troels; Javakhishvili, Irakli; Patil, Navin J.

    2014-01-01

    Application of charged polymer chains as additives for lubricating neutral surfaces in aqueous envi- ronment, especially via polymer physisorption, is generally impeded by the electrostatic repulsion be- tween adjacent polymers on the surface. In this study, we have investigated the adsorption an...... improvement compared to fully charged polymer chains, e.g. poly(acrylic acid)- block -poly(2-methoxyethyl acrylate) (PAA- b -PMEA), which is attributed to dilution of charged moieties on the surface and subsequent improvement of the lubricating fi lm stability......Application of charged polymer chains as additives for lubricating neutral surfaces in aqueous envi- ronment, especially via polymer physisorption, is generally impeded by the electrostatic repulsion be- tween adjacent polymers on the surface. In this study, we have investigated the adsorption...... and aqueous lubricating properties of an amphiphilic triblock copolymer, comprised of a neutral poly(ethylene glycol) (PEG) block, a hydrophobic poly(2-methoxyethyl acrylate) (PMEA) block, and a charged poly(methacrylic acid) (PMAA) block, namely PEG- b -PMEA- b -PMAA. After adsorption onto a nonpolar...

  6. Improved charge trapping properties by embedded graphene oxide quantum-dots for flash memory application

    Science.gov (United States)

    Jia, Xinlei; Yan, Xiaobing; Wang, Hong; Yang, Tao; Zhou, Zhenyu; Zhao, Jianhui

    2018-06-01

    In this work, we have investigated two kinds of charge trapping memory devices with Pd/Al2O3/ZnO/SiO2/p-Si and Pd/Al2O3/ZnO/graphene oxide quantum-dots (GOQDs)/ZnO/SiO2/p-Si structure. Compared with the single ZnO sample, the memory window of the ZnO-GOQDs-ZnO sample reaches a larger value (more than doubled) of 2.7 V under the sweeping gate voltage ± 7 V, indicating a better charge storage capability and the significant charge trapping effects by embedding the GOQDs trapping layer. The ZnO-GOQDs-ZnO devices have better date retention properties with the high and low capacitances loss of ˜ 1.1 and ˜ 6.9%, respectively, as well as planar density of the trapped charges of 1.48 × 1012 cm- 2. It is proposed that the GOQDs play an important role in the outstanding memory characteristics due to the deep quantum potential wells and the discrete distribution of the GOQDs. The long date retention time might have resulted from the high potential barrier which suppressed both the back tunneling and the leakage current. Intercalating GOQDs in the memory device is a promising method to realize large memory window, low-power consumption and excellent retention properties.

  7. Study of static properties of magnetron-type space charges; Etude des proprietes statiques des charges d'espace du type magnetron

    Energy Technology Data Exchange (ETDEWEB)

    Delcroix, Jean-Loup

    1953-05-30

    This research thesis reports an in-depth analysis of physical properties of static regimes to address the issue of space charges. This theoretical study of the Hull magnetron is followed by the description of experiments on the Hull magnetron which highlight transitions between the different regimes. Then, another theoretical approach aims at generalising the magnetron theory, based on other types of magnetron theory (general equations of magnetron-type space charges, inverted Hull magnetron theory, circular field magnetron theory)

  8. Interplay of electronic and geometry shell effects in properties of neutral and charged Sr clusters

    DEFF Research Database (Denmark)

    Lyalin, Andrey; Solov'yov, Ilia; Solov'yov, Andrey V.

    2007-01-01

    that the size evolution of structural and electronic properties of strontium clusters is governed by an interplay of the electronic and geometry shell closures. Influence of the electronic shell effects on structural rearrangements can lead to violation of the icosahedral growth motif of strontium clusters......The optimized structure and electronic properties of neutral, singly, and doubly charged strontium clusters have been investigated using ab initio theoretical methods based on density-functional theory. We have systematically calculated the optimized geometries of neutral, singly, and doubly...... charged strontium clusters consisting of up to 14 atoms, average bonding distances, electronic shell closures, binding energies per atom, the gap between the highest occupied and the lowest unoccupied molecular orbitals, and spectra of the density of electronic states (DOS). It is demonstrated...

  9. An investigation of flow properties of metal matrix composites suspensions for injection molding

    International Nuclear Information System (INIS)

    Ahmad, F.; Bevis, M.J.

    1997-01-01

    Flow properties of metal matrix composites suspensions have significant effects on the fibre orientation during mould filling. The results presented in this paper relate to the flow properties of aluminium powder and glass fibres compounded into a sacrificial thermoplastics binder. For this purpose, a range of aluminium compounds and aluminium composite suspensions were investigated over a wide shear rate range expected to occur during injection mould process. Aluminium composites wee prepared by substituting glass fibres for aluminium in aluminium compound. Aluminium composite containing a maximum critical volume fraction of fibres which did not exhibit an increase n viscosity was determined. The effect of temperature on the flow behaviour of aluminium composite was also investigated. (author)

  10. End Uses Mechanical Properties Settled By The Modified Sintering Conditions Of The Metal Injection Molding Process

    International Nuclear Information System (INIS)

    Marray, Tarek; Jaccquet, Philippe; Moinard-Checot, Delphine; Fabre, Agnes; Barrallier, Laurent

    2011-01-01

    Most common mechanical applications require parts with specific properties as hard faced features. It is well known that treating parts under suitable atmospheres may improve hardness and strength yield of steels. Heat treatment process and more particularly thermo-chemical diffusion processes (such as carburizing or its variation: carbonitriding) can be performed to reach the industrial hardness profile requirements. In this work, a low-alloyed steel feedstock based on water soluble binder system is submitted to the MIM process steps (including injection molding, debinding and sintering). As-sintered parts are then treated under a low pressure carbonitriding treatment. This contribution focuses on preliminary results such as microstructural analyses and mechanical properties which are established at each stage of the process to determine and monitor changes.

  11. Top Quark Pair Properties - Spin Correlation, Charge Asymmetry, and Complex Final States - at ATLAS

    Directory of Open Access Journals (Sweden)

    Brost Elizabeth

    2014-04-01

    Full Text Available We present measurements of top quark pair properties performed with the ATLAS detector at the Large Hadron Collider in proton-proton collisions at a center-of-mass energy of √s = 7 TeV. The latest measurements of spin correlation and charge asymmetry in tt¯$t\\overline t $ events, as well as measurements of the cross section for tt¯$t\\overline t $ production in association with vector bosons, are presented.

  12. Field characterization of elastic properties across a fault zone reactivated by fluid injection

    Science.gov (United States)

    Jeanne, Pierre; Guglielmi, Yves; Rutqvist, Jonny; Nussbaum, Christophe; Birkholzer, Jens

    2017-08-01

    We studied the elastic properties of a fault zone intersecting the Opalinus Clay formation at 300 m depth in the Mont Terri Underground Research Laboratory (Switzerland). Four controlled water injection experiments were performed in borehole straddle intervals set at successive locations across the fault zone. A three-component displacement sensor, which allowed capturing the borehole wall movements during injection, was used to estimate the elastic properties of representative locations across the fault zone, from the host rock to the damage zone to the fault core. Young's moduli were estimated by both an analytical approach and numerical finite difference modeling. Results show a decrease in Young's modulus from the host rock to the damage zone by a factor of 5 and from the damage zone to the fault core by a factor of 2. In the host rock, our results are in reasonable agreement with laboratory data showing a strong elastic anisotropy characterized by the direction of the plane of isotropy parallel to the laminar structure of the shale formation. In the fault zone, strong rotations of the direction of anisotropy can be observed. The plane of isotropy can be oriented either parallel to bedding (when few discontinuities are present), parallel to the direction of the main fracture family intersecting the zone, and possibly oriented parallel or perpendicular to the fractures critically oriented for shear reactivation (when repeated past rupture along this plane has created a zone).

  13. Effect of thermal shock on mechanical properties of injection-molded thermoplastic denture base resins.

    Science.gov (United States)

    Takahashi, Yutaka; Hamanaka, Ippei; Shimizu, Hiroshi

    2012-07-01

    This study investigated the effect of thermal shock on the mechanical properties of injection-molded thermoplastic denture base resins. Four thermoplastic resins (two polyamides, one polyethylene terephthalate, one polycarbonate) and, as a control, a conventional heat-polymerized polymethyl methacrylate (PMMA), were tested. Specimens of each denture base material were fabricated according to ISO 1567 and were either thermocycled or not thermocycled (n = 10). The flexural strength at the proportional limit (FS-PL), the elastic modulus and the Charpy impact strength of the denture base materials were estimated. Thermocycling significantly decreased the FS-PL of one of the polyamides and the PMMA and it significantly increased the FS-PL of one of the polyamides. In addition, thermocycling significantly decreased the elastic modulus of one of the polyamides and significantly increased the elastic moduli of one of the polyamides, the polyethylene terephthalate, polycarbonate and PMMA. Thermocycling significantly decreased the impact strength of one of the polyamides and the polycarbonate. The mechanical properties of injection-molded thermoplastic denture base resins changed after themocycling.

  14. Effects of Direct Fuel Injection Strategies on Cycle-by-Cycle Variability in a Gasoline Homogeneous Charge Compression Ignition Engine: Sample Entropy Analysis

    Directory of Open Access Journals (Sweden)

    Jacek Hunicz

    2015-01-01

    Full Text Available In this study we summarize and analyze experimental observations of cyclic variability in homogeneous charge compression ignition (HCCI combustion in a single-cylinder gasoline engine. The engine was configured with negative valve overlap (NVO to trap residual gases from prior cycles and thus enable auto-ignition in successive cycles. Correlations were developed between different fuel injection strategies and cycle average combustion and work output profiles. Hypothesized physical mechanisms based on these correlations were then compared with trends in cycle-by-cycle predictability as revealed by sample entropy. The results of these comparisons help to clarify how fuel injection strategy can interact with prior cycle effects to affect combustion stability and so contribute to design control methods for HCCI engines.

  15. Effects of Te inclusions on charge-carrier transport properties in CdZnTe radiation detectors

    International Nuclear Information System (INIS)

    Gu, Yaxu; Rong, Caicai; Xu, Yadong; Shen, Hao; Zha, Gangqiang; Wang, Ning; Lv, Haoyan; Li, Xinyi; Wei, Dengke; Jie, Wanqi

    2015-01-01

    Highlights: • This work reveals the behaviors of Te inclusion in affecting charge-carrier transport properties in CdZnTe detectors for the first time and analysis the mechanism therein. • The results show that charge collection efficiencies in Te inclusion degraded regions experience fast ascent under low biases and slow descent at high applied biases, which deviates from the Hecht rule. • This phenomenon is attributed to the competitive influence of two mechanisms under different biases, namely charge carrier trapping due to uniformly distributed point defects and Te inclusion induced transient charge loss. • A modified Hecht equation is further proposed to explain the effects of high-density localized defects, say Te inclusions, on the charge collection efficiency. • We believe that this research has wide appeal to analyze the macroscopic defects and their influence on charge transport properties in semiconductor radiation detectors. - Abstract: The influence of tellurium (Te) inclusions on the charge collection efficiency in cadmium zinc telluride (CdZnTe or CZT) detectors has been investigated using ion beam induced charge (IBIC) technique. Combining the analysis of infrared transmittance image, most of the low charge collection areas in the IBIC images prove the existence of Te inclusions. To further clarify the role of Te inclusions on charge transport properties, bias dependent local IBIC scan was performed on Te inclusion related regions from 20 V to 500 V. The result shows that charge collection efficiencies in Te inclusion degraded regions experience fast ascent under low biases and slow descent at high applied biases, which deviates from Hecht rule. This behavior is attributed to the competitive influence of two mechanisms under different biases, namely charge carrier trapping due to uniformly distributed point defects and Te inclusion induced transient charge loss. A modified Hecht equation is further proposed to explain the effects of high

  16. Local mechanical properties of LFT injection molded parts: Numerical simulations versus experiments

    Science.gov (United States)

    Desplentere, F.; Soete, K.; Bonte, H.; Debrabandere, E.

    2014-05-01

    In predictive engineering for polymer processes, the proper prediction of material microstructure from known processing conditions and constituent material properties is a critical step forward properly predicting bulk properties in the finished composite. Operating within the context of long-fiber thermoplastics (LFT, length Autodesk Simulation Moldflow Insight 2014 software has been used. In this software, a fiber breakage algorithm for the polymer flow inside the mold is available. Using well known micro mechanic formulas allow to combine the local fiber length with the local orientation into local mechanical properties. Different experiments were performed using a commercially available glass fiber filled compound to compare the measured data with the numerical simulation results. In this investigation, tensile tests and 3 point bending tests are considered. To characterize the fiber length distribution of the polymer melt entering the mold (necessary for the numerical simulations), air shots were performed. For those air shots, similar homogenization conditions were used as during the injection molding tests. The fiber length distribution is characterized using automated optical method on samples for which the matrix material is burned away. Using the appropriate settings for the different experiments, good predictions of the local mechanical properties are obtained.

  17. The effect of charged groups on hydrophilic monolithic stationary phases on their chromatographic properties.

    Science.gov (United States)

    Li, Haibin; Liu, Chusheng; Wang, Qiqin; Zhou, Haibo; Jiang, Zhengjin

    2016-10-21

    In order to investigate the effect of charged groups present in hydrophilic monolithic stationary phases on their chromatographic properties, three charged hydrophilic monomers, i.e. N,N-dimethyl-N-acryloyloxyethyl-N-(3-sulfopropyl)ammonium betaine (SPDA), [2-(acryloyloxy)ethyl]trimethylammonium chloride (AETA), and 3-sulfopropyl acrylate potassium salt (SPA) were co-polymerized with the crosslinker N,N'-methylenebisacrylamide (MBA), respectively. The physicochemical properties of the three resulting charged hydrophilic monolithic columns were evaluated using scanning electron microscopy, ζ-potential analysis and micro-HPLC. High column efficiency was obtained on the three monolithic columns at a linear velocity of 1mm/s using thiourea as test compound. Comparative characterization of the three charged HILIC phases was then carried out using a set of model compounds, including nucleobases, nucleosides, benzoic acid derivatives, phenols, β-blockers and small peptides. Depending on the combination of stationary phase/mobile phase/solute, both hydrophilic interaction and other potential secondary interactions, including electrostatic interaction, hydrogen-bonding interaction, molecular shape selectivity, could contribute to the over-all retention of the analytes. Because of the strong electrostatic interaction provided by the quaternary ammonium groups in the poly (AETA-co-MBA) monolith, this cationic HILIC monolith exhibited the strongest retention for benzoic acid derivatives and small peptides with distorted peak shapes and the weakest retention for basic β-blockers. The sulfonyl groups on the poly (SPA-co-MBA) hydrophilic monolith could provide strong electrostatic attraction and hydrogen bonding for positively charged analytes and hydrogen-donor/acceptor containing analytes, respectively. Therefore, basic drugs, nucleobases and nucleotides exhibited the strongest retention on this anionic monolith. Because of the weak but distinct cation exchange properties of

  18. Tuning electronic properties of graphene nanoflake polyaromatic hydrocarbon through molecular charge-transfer interactions

    Science.gov (United States)

    Sharma, Vaishali; Dabhi, Shweta D.; Shinde, Satyam; Jha, Prafulla K.

    2018-05-01

    By means of first principles calculation we have tuned the electronic properties of graphene nanoflake polyaromatic hydrocarbon via molecular charge transfer. Acceptor/donor Tetracyanoquinodimethane (TCNQ) and Tetrathiafulvalene (TTF) organic molecules are adsorbed on polyaromatic hydrocarbons (PAH) in order to introduce the charge transfer. The substrate's n- or p- type nature depends on the accepting/donating behavior of dopant molecules. Two different classes of PAH (extended form of triangulene) namely Bow-tie graphene nanoflake (BTGNF) and triangular zigzag graphene nanoflake (TZGNF). It is revealed that all the TCNQ and TTF modified graphene nanoflakes exhibit significant changes in HOMO-LUMO gap in range from 0.58 eV to 0.64 eV and 0.01 eV to 0.05 eV respectively. The adsorption energies are in the range of -0.05 kcal/mol to -2.6 kcal/mol. The change in work function is also calculated and discussed, the maximum charge transfer is for TCNQ adsorbed BTGNF. These alluring findings in the tuning of electronic properties will be advantageous for promoting graphene nanoflake polyaromatic hydrocarbon for their applications in electronic devices.

  19. Pore structure and function of synthetic nanopores with fixed charges: tip shape and rectification properties

    Energy Technology Data Exchange (ETDEWEB)

    RamIrez, Patricio [Departament de Fisica Aplicada, Universitat Politecnica de Valencia, E-46022 Valencia (Spain); Apel, Pavel Yu [Flerov Laboratory of Nuclear Reactions, Joint Institute for Nuclear Research, Joliot-Curie street 6, 141980 Dubna (Russian Federation); Cervera, Javier; Mafe, Salvador [Departament de Fisica de la Terra i Termodinamica, Universitat de Valencia, E-46100 Burjassot (Spain)], E-mail: patraho@fis.upv.es

    2008-08-06

    We present a complete theoretical study of the relationship between the structure (tip shape and dimensions) and function (selectivity and rectification) of asymmetric nanopores on the basis of previous experimental studies. The theoretical model uses a continuum approach based on the Nernst-Planck equations. According to our results, the nanopore transport properties, such as current-voltage (I-V) characteristics, conductance, rectification ratio, and selectivity, are dictated mainly by the shape of the pore tip (we have distinguished bullet-like, conical, trumpet-like, and hybrid shapes) and the concentration of pore surface charges. As a consequence, the nanopore performance in practical applications will depend not only on the base and tip openings but also on the pore shape. In particular, we show that the pore opening dimensions estimated from the pore conductance can be very different, depending on the pore shape assumed. The results obtained can also be of practical relevance for the design of nanopores, nanopipettes, and nanoelectrodes, where the electrical interactions between the charges attached to the nanostructure and the mobile charges confined in the reduced volume of the inside solution dictate the device performance in practical applications. Because single tracks are the elementary building blocks for nanoporous membranes, the understanding and control of their individual properties should also be crucial in protein separation, water desalination, and bio-molecule detection using arrays of identical nanopores.

  20. Pore structure and function of synthetic nanopores with fixed charges: tip shape and rectification properties

    International Nuclear Information System (INIS)

    RamIrez, Patricio; Apel, Pavel Yu; Cervera, Javier; Mafe, Salvador

    2008-01-01

    We present a complete theoretical study of the relationship between the structure (tip shape and dimensions) and function (selectivity and rectification) of asymmetric nanopores on the basis of previous experimental studies. The theoretical model uses a continuum approach based on the Nernst-Planck equations. According to our results, the nanopore transport properties, such as current-voltage (I-V) characteristics, conductance, rectification ratio, and selectivity, are dictated mainly by the shape of the pore tip (we have distinguished bullet-like, conical, trumpet-like, and hybrid shapes) and the concentration of pore surface charges. As a consequence, the nanopore performance in practical applications will depend not only on the base and tip openings but also on the pore shape. In particular, we show that the pore opening dimensions estimated from the pore conductance can be very different, depending on the pore shape assumed. The results obtained can also be of practical relevance for the design of nanopores, nanopipettes, and nanoelectrodes, where the electrical interactions between the charges attached to the nanostructure and the mobile charges confined in the reduced volume of the inside solution dictate the device performance in practical applications. Because single tracks are the elementary building blocks for nanoporous membranes, the understanding and control of their individual properties should also be crucial in protein separation, water desalination, and bio-molecule detection using arrays of identical nanopores

  1. Pore structure and function of synthetic nanopores with fixed charges: tip shape and rectification properties.

    Science.gov (United States)

    Ramírez, Patricio; Apel, Pavel Yu; Cervera, Javier; Mafé, Salvador

    2008-08-06

    We present a complete theoretical study of the relationship between the structure (tip shape and dimensions) and function (selectivity and rectification) of asymmetric nanopores on the basis of previous experimental studies. The theoretical model uses a continuum approach based on the Nernst-Planck equations. According to our results, the nanopore transport properties, such as current-voltage (I-V) characteristics, conductance, rectification ratio, and selectivity, are dictated mainly by the shape of the pore tip (we have distinguished bullet-like, conical, trumpet-like, and hybrid shapes) and the concentration of pore surface charges. As a consequence, the nanopore performance in practical applications will depend not only on the base and tip openings but also on the pore shape. In particular, we show that the pore opening dimensions estimated from the pore conductance can be very different, depending on the pore shape assumed. The results obtained can also be of practical relevance for the design of nanopores, nanopipettes, and nanoelectrodes, where the electrical interactions between the charges attached to the nanostructure and the mobile charges confined in the reduced volume of the inside solution dictate the device performance in practical applications. Because single tracks are the elementary building blocks for nanoporous membranes, the understanding and control of their individual properties should also be crucial in protein separation, water desalination, and bio-molecule detection using arrays of identical nanopores.

  2. Elastin Based Cell-laden Injectable Hydrogels with Tunable Gelation, Mechanical and Biodegradation Properties

    Science.gov (United States)

    Fathi, Ali; Mithieux, Suzanne M.; Wei, Hua; Chrzanowski, Wojciech; Valtchev, Peter; Weiss, Anthony S.; Dehghani, Fariba

    2015-01-01

    Injectable hydrogels made from extracellular matrix proteins such as elastin show great promise for various biomedical applications. Use of cytotoxic reagents, fixed gelling behavior, and lack of mechanical strength in these hydrogels are the main associated drawbacks. The aim of this study was to develop highly cytocompatible and injectable elastin-based hydrogels with alterable gelation characteristics, favorable mechanical properties and structural stability for load bearing applications. A thermoresponsive copolymer, poly(N-isopropylacrylamide-co-polylactide-2-hydroxyethyl methacrylate-co-oligo(ethylene glycol)monomethyl ether methacrylate, was functionalized with succinimide ester groups by incorporating N-acryloxysuccinimide monomer. These ester groups were exploited to covalently bond this polymer, denoted as PNPHO, to different proteins with primary amine groups such as α-elastin in aqueous media. The incorporation of elastin through covalent bond formation with PNPHO promotes the structural stability, mechanical properties and live cell proliferation within the structure of hydrogels. Our results demonstrated that elastin-co-PNPHO solutions were injectable through fine gauge needles and converted to hydrogels in situ at 37 °C in the absence of any crosslinking reagent. By altering PNPHO content, the gelling time of these hydrogels can be finely tuned within the range of 2 to 15 min to ensure compatibility with surgical requirements. In addition, these hydrogels exhibited compression moduli in the range of 40 to 145 kPa, which are substantially higher than those of previously developed elastin-based hydrogels. These hydrogels were highly stable in the physiological environment with the evidence of 10 wt% mass loss in 30 days of incubation in a simulated environment. This class of hydrogels is in vivo bioabsorbable due to the gradual increase of the lower critical solution temperature of the copolymer to above 37 °C due to the cleavage of polylactide from

  3. Molding Properties of Inconel 718 Feedstocks Used in Low-Pressure Powder Injection Molding

    Directory of Open Access Journals (Sweden)

    Fouad Fareh

    2016-01-01

    Full Text Available The impact of binders and temperature on the rheological properties of feedstocks used in low-pressure powder injection molding was investigated. Experiments were conducted on different feedstock formulations obtained by mixing Inconel 718 powder with wax-based binder systems. The shear rate sensitivity index and the activation energy were used to study the degree of dependence of shear rate and temperature on the viscosity of the feedstocks. The injection performance of feedstocks was then evaluated using an analytical moldability model. The results indicated that the viscosity profiles of feedstocks depend significantly on the binder constituents, and the secondary binder constituents play an important role in the rheological behavior (pseudoplastic or near-Newtonian exhibited by the feedstock formulations. Viscosity values as low as 0.06 to 2.9 Pa·s were measured at high shear rates and high temperatures. The results indicate that a feedstock containing a surfactant agent exhibits the best moldability characteristics.

  4. Photoelectric schlieren method used to study the properties of diesel engine injection systems

    International Nuclear Information System (INIS)

    Reznicek, R.

    1987-01-01

    The time dependence of the fuel flow rate issuing from the injector nozzle represents very important information concerning the properties of Diesel engine injection systems. By analysing the delivery rate, it is possible to judge a new design, and the modifications and adjustments of Diesel engine injection systems. A number of devices for measuring the delivery rate, frequently founded on mechanical principles, have also been constructed. Mechanical methods are laborious, require complicated measuring instruments, and the analysis of the results is quite tedious. For investigating the delivery rate, one can also use the intensity of the luminous flux of the light ray which is intersected, and consequently its intensity decreased, by the flow of the delivered fuel. The schlieren method can be used for this purpose, employing a thin beam of parallel light rays and a photoelectric sensor placed immediately beyond the cut-off slit. After adjustment and calibration, the variations of the original electric signal represent the time variation of the delivery rate by the nozzle

  5. Charge carrier dynamics investigation of CuInS{sub 2} quantum dots films using injected charge extraction by linearly increasing voltage (i-CELIV): the role of ZnS Shell

    Energy Technology Data Exchange (ETDEWEB)

    Bi, Ke; Sui, Ning; Zhang, Liquan; Wang, Yinghui, E-mail: yinghui-wang@outlook.com; Liu, Qinghui, E-mail: liuqinghui@jlu.edu.cn; Tan, Mingrui [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China); Zhou, Qiang [Jilin University, Key Laboratory of Superhard Materials, College of Physics (China); Zhang, Hanzhuang, E-mail: zhanghz@jlu.edu.cn [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China)

    2016-12-15

    The role of ZnS shell on the photo-physical properties within CuInS{sub 2}/ZnS quantum dots (QDs) is carefully studied in optoelectronic devices. Linearly increasing voltage technique has been employed to investigate the charge carrier dynamics of both CuInS{sub 2} and CuInS{sub 2}/ZnS QDs films. This study shows that charge carriers follow a similar behavior of monomolecular recombination in this film, with their charge transfer rate correlates to the increase of applied voltage. It turns out that the ZnS shell could affect the carrier diffusion process through depressing the trapping states and would build up a potential barrier.

  6. Charge transfer properties and photoelectrocatalytic activity of TiO{sub 2}/MWCNT hybrid

    Energy Technology Data Exchange (ETDEWEB)

    Jiang Liaochuan [Nano Science Research Center, School of Chemistry and Chemical Engineering, South China University of Technology, 381 Wushan Road, Guangzhou 510640 (China); Zhang Weide, E-mail: zhangwd@scut.edu.c [Nano Science Research Center, School of Chemistry and Chemical Engineering, South China University of Technology, 381 Wushan Road, Guangzhou 510640 (China)

    2010-12-15

    The vertically aligned multiwalled carbon nanotube (MWCNT) arrays on tantalum foils were successfully coated with TiO{sub 2} nanoparticles by a hydrothermal process. The prepared TiO{sub 2}/MWCNT hybrid was characterized by scanning electron microscopy and transmission electron microscopy. The charge transfer properties and photocatalytic degradation of rhodamine B with and without bias potential under UV irradiation were investigated. The MWCNTs promoted the separation of photoinduced carriers in the TiO{sub 2}, thus enhanced photocatalytic activity. Applying bias potential on the photoanode further enhanced its catalytic activity. The efficient charge transportation and high photoelectrocatalytic activity towards degradation of rhodamine B made this hybrid material promising for photocatalyst and for the development of photoelectrical devices.

  7. Transport properties of triarylamine based dendrimers studied by space charge limited current transients

    Science.gov (United States)

    Szymanski, Marek Z.; Kulszewicz-Bajer, Irena; Faure-Vincent, Jérôme; Djurado, David

    2012-08-01

    We have studied hole transport in triarylamine based dendrimer using space-charge-limited current transient technique. A mobility of 8 × 10-6 cm2/(V s) and a characteristic detrapping time of about 100 ms have been obtained. We found that quasi-ohmic contact is formed with gold. The obtained mobility differs from the apparent one given by the analysis of stationary current-voltage characteristics because of a limited contact efficiency. The comparison between transients obtained from fresh and aged samples reveals no change in mobility with aging. The deterioration of electrical properties is exclusively caused by trap formation and accumulation of ionic conducting impurities. Finally, repeated transient measurements have been applied to analyze the dynamics of charge trapping process.

  8. The role of polymer dots on efficiency enhancement of organic solar cells: Improving charge transport property

    Science.gov (United States)

    Li, Jinfeng; Zhang, Xinyuan; Liu, Chunyu; Li, Zhiqi; He, Yeyuan; Zhang, Zhihui; Shen, Liang; Guo, Wenbin; Ruan, Shengping

    2017-07-01

    In this work, poly(9,9-dioctylfluorene)-co-(4,7-di-2-thienyl-2,1,3-benzothiadiazole) (PF-5DTBT) and copolymer poly(styrene-co-maleic anhydride) (PSMA) dots were prepared as additive for active layer doping to enhance the power conversion efficiency (PCE) of organic solar cells (OSCs), which based on poly[N-9″-hepta-decanyl-2,7-carbazole-alt-5,5-(4‧,7‧-di-2-thienyl-2‧,1‧,3‧-benzothiadiazole) (PCDTBT) and [6,6]-phenyl C71 butyric acid methyl-ester (PC71BM). A high efficiency of 7.40% was achieved due to increase of short-circuit current (Jsc) and fill factor (FF). The operation mechanism of OSCs doping with polymer dots was investigated, which demonstrated that the efficiency enhancement ascribes to improvement of electrical properties, such as exciton generation, exction dissociation, charge transport, and charge collection.

  9. Impact of speciation on the electron charge transfer properties of nanodiamond drug carriers.

    Science.gov (United States)

    Sun, Baichuan; Barnard, Amanda S

    2016-08-07

    Unpassivated diamond nanoparticles (bucky-diamonds) exhibit a unique surface reconstruction involving graphitization of certain crystal facets, giving rise to hybrid core-shell particles containing both aromatic and aliphatic carbon. Considerable effort is directed toward eliminating the aromatic shell, but persistent graphitization of subsequent subsurface-layers makes perdurable purification a challenge. In this study we use some simple statistical methods, in combination with electronic structure simulations, to predict the impact of different fractions of aromatic and aliphatic carbon on the charge transfer properties of the ensembles of bucky-diamonds. By predicting quality factors for a variety of cases, we find that perfect purification is not necessary to preserve selectivity, and there is a clear motivation for purifying samples to improve the sensitivity of charge transfer reactions. This may prove useful in designing drug delivery systems where the release of (selected) drugs needs to be sensitive to specific conditions at the point of delivery.

  10. Injection Molding and Mechanical Properties of Bio-Based Polymer Nanocomposites

    Directory of Open Access Journals (Sweden)

    Maria Chiara Mistretta

    2018-04-01

    Full Text Available The use of biodegradable/bio-based polymers is of great importance in addressing several issues related to environmental protection, public health, and new, stricter legislation. Yet some applications require improved properties (such as barrier or mechanical properties, suggesting the use of nanosized fillers in order to obtain bio-based polymer nanocomposites. In this work, bionanocomposites based on two different biodegradable polymers (coming from the Bioflex and MaterBi families and two different nanosized fillers (organo-modified clay and hydrophobic-coated precipitated calcium carbonate were prepared and compared with traditional nanocomposites with high-density polyethylene (HDPE as matrix. In particular, the injection molding processability, as well as the mechanical and rheological properties of the so-obtained bionanocomposites were investigated. It was found that the processability of the two biodegradable polymers and the related nanocomposites can be compared to that of the HDPE-based systems and that, in general, the bio-based systems can be taken into account as suitable alternatives.

  11. Electronic and vibronic properties of a discotic liquid-crystal and its charge transfer complex

    Energy Technology Data Exchange (ETDEWEB)

    Haverkate, Lucas A.; Mulder, Fokko M. [Reactor Institute Delft, Faculty of Applied Sciences, Delft University of Technology, Mekelweg 15, 2629JB Delft (Netherlands); Zbiri, Mohamed, E-mail: zbiri@ill.fr; Johnson, Mark R. [Institut Laue Langevin, 38042 Grenoble Cedex 9 (France); Carter, Elizabeth [Vibrational Spectroscopy Facility, School of Chemistry, The University of Sydney, NSW 2008 (Australia); Kotlewski, Arek; Picken, S. [ChemE-NSM, Faculty of Chemistry, Delft University of Technology, 2628BL/136 Delft (Netherlands); Kearley, Gordon J. [Bragg Institute, Australian Nuclear Science and Technology Organisation, Menai, NSW 2234 (Australia)

    2014-01-07

    Discotic liquid crystalline (DLC) charge transfer (CT) complexes combine visible light absorption and rapid charge transfer characteristics, being favorable properties for photovoltaic (PV) applications. We present a detailed study of the electronic and vibrational properties of the prototypic 1:1 mixture of discotic 2,3,6,7,10,11-hexakishexyloxytriphenylene (HAT6) and 2,4,7-trinitro-9-fluorenone (TNF). It is shown that intermolecular charge transfer occurs in the ground state of the complex: a charge delocalization of about 10{sup −2} electron from the HAT6 core to TNF is deduced from both Raman and our previous NMR measurements [L. A. Haverkate, M. Zbiri, M. R. Johnson, B. Deme, H. J. M. de Groot, F. Lefeber, A. Kotlewski, S. J. Picken, F. M. Mulder, and G. J. Kearley, J. Phys. Chem. B 116, 13098 (2012)], implying the presence of permanent dipoles at the donor-acceptor interface. A combined analysis of density functional theory calculations, resonant Raman and UV-VIS absorption measurements indicate that fast relaxation occurs in the UV region due to intramolecular vibronic coupling of HAT6 quinoidal modes with lower lying electronic states. Relatively slower relaxation in the visible region the excited CT-band of the complex is also indicated, which likely involves motions of the TNF nitro groups. The fast quinoidal relaxation process in the hot UV band of HAT6 relates to pseudo-Jahn-Teller interactions in a single benzene unit, suggesting that the underlying vibronic coupling mechanism can be generic for polyaromatic hydrocarbons. Both the presence of ground state CT dipoles and relatively slow relaxation processes in the excited CT band can be relevant concerning the design of DLC based organic PV systems.

  12. Chondroprotective supplementation promotes the mechanical properties of injectable scaffold for human nucleus pulposus tissue engineering.

    Science.gov (United States)

    Foss, Berit L; Maxwell, Thomas W; Deng, Ying

    2014-01-01

    A result of intervertebral disc (IVD) degeneration, the nucleus pulposus (NP) is no longer able to withstand applied load leading to pain and disability. The objective of this study is to fabricate a tissue-engineered injectable scaffold with chondroprotective supplementation in vitro to improve the mechanical properties of a degenerative NP. Tissue-engineered scaffolds were fabricated using different concentrations of alginate and calcium chloride and mechanically evaluated. Fabrication conditions were based on structural and mechanical resemblance to the native NP. Chondroprotective supplementation, glucosamine (GCSN) and chondroitin sulfate (CS), were added to scaffolds at concentrations of 0:0µg/mL (0:0-S), 125:100µg/mL (125:100-S), 250:200µg/mL (250:200-S), and 500:400µg/mL (500:400-S), GCSN and CS, respectively. Scaffolds were used to fabricate tissue-engineered constructs through encapsulation of human nucleus pulposus cells (HNPCs). The tissue-engineered constructs were collected at days 1, 14, and 28 for biochemical and biomechanical evaluations. Confocal microscopy showed HNPC viability and rounded morphology over the 28 day period. MTT analysis resulted in significant increases in cell proliferation for each group. Collagen type II ELISA quantification and compressive aggregate moduli (HA) showed increasing trends for both 250:200-S and the 500:400-S groups on Day 28 with significantly greater HA compared to 0:0-S group. Glycosaminoglycan and water content decreased for all groups. Results indicate the increased mechanical properties of the 250:200-S and the 500:400-S was due to production of a functional matrix. This study demonstrated potential for a chondroprotective supplemented injectable scaffold to restore biomechanical function of a degenerative disc through the production of a mechanically functional matrix. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Correction: The effect of recombination under short-circuit conditions on the determination of charge transport properties in nanostructured photoelectrodes.

    Science.gov (United States)

    Villanueva-Cab, J; Anta, J A; Oskam, G

    2016-05-28

    Correction for 'The effect of recombination under short-circuit conditions on the determination of charge transport properties in nanostructured photoelectrodes' by J. Villanueva-Cab et al., Phys. Chem. Chem. Phys., 2016, 18, 2303-2308.

  14. Designing thiophene-based azomethine oligomers with tailored properties: Self-assembly and charge carrier mobility

    DEFF Research Database (Denmark)

    Kiriy, N.; Bocharova, V.; Kiriy, A.

    2004-01-01

    This paper describes synthesis and characterization of two thiophene-based azomethines designed to optimize solubility, self-assembly, and charge carrier mobility. We found that incorporation of azomethine and amide moieties in the alpha,omega-position, and hexyl chains in the beta-position of th...... with the mobilities of the best organic semiconductors. All these significant differences in properties of related compounds can be attributed to the hydrogen bonding between QT-amide molecules responsible for the observed self-assembly....

  15. Correlation of nanostructure and charge transport properties of oxidized a -SiC:H films

    Energy Technology Data Exchange (ETDEWEB)

    Gordienko, S.O.; Nazarov, A.N.; Vasin, A.V.; Rusavsky, A.V.; Lysenko, V.S. [Lashkaryov Institute of Semiconductor Physics, National Academy of Sciences of Ukraine, Prospekt Nauki 41, 03028 Kyiv (Ukraine)

    2012-06-15

    This paper considers the influence of low temperature oxidation on structural and electrical properties of amorphous carbon-rich a -Si{sub 1-x}C{sub x}:H thin films fabricated by reactive RF magnetron sputtering. It is shown that oxidation leads to formation of SiO{sub x} matrix with graphite-like carbon inclusions. Such conductive precipitates has a strong effect on charge transport in oxidized a -Si{sub 1-x}C{sub x}:H films (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  16. Magnetic properties changes of MnAs thin films irradiated with highly charged ions

    OpenAIRE

    Trassinelli , Martino; Gafton , V.; Eddrief , Mahmoud; Etgens , Victor H.; Hidki , S.; Lacaze , Emmanuelle; Lamour , Emily; Luo , X.; Marangolo , Massimiliano; Merot , Jacques; Prigent , Christophe; Reuschl , Regina; Rozet , Jean-Pierre; Steydli , S.; Vernhet , Dominique

    2013-01-01

    International audience; We present the first investigation on the effect of highly charged ion bombardment on a manganese arsenide thin film. The MnAs films, 150~nm thick, are irradiated with 90 keV Ne$^{9+}$ ions with a dose varying from $1.6\\times10^{12}$ to $1.6\\times10^{15}$~ions/cm$^2$. The structural and magnetic properties of the film after irradiation are investigated using different techniques, namely, X-ray diffraction, magneto-optic Kerr effect and magnetic force microscope. Prelim...

  17. Thermal and mechanical properties of injection molded recycled high density polyethylene blends with virgin isotactic polypropylene

    International Nuclear Information System (INIS)

    Madi, N.K.

    2013-01-01

    Highlights: ► Recycled high density polyethylene and isotactic polypropylene blends have been prepared by melt compounding. ► Thermal study showed that iPP is not well dispersed into the rHDPE matrix. ► Tensile testing shows that there is strong correlation between the thermal properties and the tensile behavior of rHDPE/ipp blends. - Abstract: Polymer blending has become an important field in polymer research and especially in the area of recycling. In this research the target was to reduce the polymer waste problem. Therefore, recycled high density polyethylene (rHDPE) and virgin isotactic polypropylene (vPP) blends containing upto 30 wt% of vPP have been prepared by melt compounding method using injection molding at 220 °C. The thermal properties, thermal degradation and the mechanical properties of the polymer blends were studied using differential scanning calorimetry (DSC), Thermogravimetric analysis (TGA), and tensile testing method. DSC study shows that in all the blends there are two melting peaks, one around the melting temperature of rHDPE and another one around the melting point of vPP, indicating that vPP is not well dispersed into the rHDPE matrix. The changes in the heat of fusion for the rHDPE/iPP polymer blends versus vPP content suggests that incorporating vPP affects the crystallinity of the system. TGA analysis of the polymer blends shows that parts of rHDPE with 95/5 upto 80/20 of vPP are mostly stable composition which brings about valuable stabilization to the rHDPE. Tensile testing shows that there is strong correlation between the thermal properties and the tensile behavior of rHDPE/vpp blends

  18. Setting up charging electric stations within residential communities in current China: Gaming of government agencies and property management companies

    International Nuclear Information System (INIS)

    Wu, Tian; Ma, Lin; Mao, Zhonggen; Ou, Xunmin

    2015-01-01

    The difficulty of charging electric vehicles (EVs) is now hindering their further development. Governments generally choose to build stations for home charging (including piles) within residential communities. Given the conflict of interest between various government agencies and property management companies, constructing a charging station within residential communities would result in welfare loss for the property management companies and therefore lead to the principal–agent problem. This paper constructs a two-period imperfect information game theory model to study the moral hazard involved in this issue and government agencies' optimal choice. In the analytic solution of the model, we find that the optimal choice for a farsighted government agency is to constantly improve the incentive mechanism and introduce charging stations only when the conflict of interest is eliminated. Any benefits derived from government regulations by force would prove short-lived. The government should focus on long-term returns in the development of EVs, and its optimal mechanism should be designed to mitigate the principal–agent problem of property management companies, thereby accelerate the progress of EV charging infrastructure and improve overall social welfare. - Highlights: • The charging of electric vehicles (EVs) is hindering their use. • A game theory model is used for analysis of EV charging station construction. • Charging stations are in residential communities in China. • Government agencies are constantly improving incentive mechanisms

  19. Impact of the injected interstitial on the correlation of charged-particle and neutron-induced radiation damage

    International Nuclear Information System (INIS)

    Garner, F.A.

    1983-01-01

    The successful conclusion of an intercorrelation program developed in the U.S. Breeder program has provided significant insight on the factors governing the swelling that develops in ion-bombardment studies and its relationship to the swelling that occurs during neutron irradiation. It appears that the injected interstitial or a related phenomenon exerts a pronounced influence on ion-induced swelling. This conclusion has ramifications with respect to the conduct and interpretation of ion irradiation experiments employed to study the effect of helium or composition on swelling

  20. High flux and antifouling properties of negatively charged membrane for dyeing wastewater treatment by membrane distillation

    KAUST Repository

    An, Alicia Kyoungjin

    2016-07-25

    This study investigated the applicability of membrane distillation (MD) to treat dyeing wastewater discharged by the textile industry. Four different dyes containing methylene blue (MB), crystal violet (CV), acid red 18 (AR), and acid yellow 36 (AY) were tested. Two types of hydrophobic membranes made of polytetrafluoroethylene (PTFE) and polyvinylidene fluoride (PVDF) were used. The membranes were characterized by testing against each dye (foulant-foulant) and the membrane–dye (membrane-foulant) interfacial interactions and their mechanisms were identified. The MD membranes possessed negative charges, which facilitated the treatment of acid and azo dyes of the same charge and showed higher fluxes. In addition, PTFE membrane reduced the wettability with higher hydrophobicity of the membrane surface. The PTFE membrane evidenced especially its resistant to dye absorption, as its strong negative charge and chemical structure caused a flake-like (loose) dye–dye structure to form on the membrane surface rather than in the membrane pores. This also enabled the recovery of flux and membrane properties by water flushing (WF), thereby direct-contact MD with PTFE membrane treating 100 mg/L of dye mixtures showed stable flux and superior color removal during five days operation. Thus, MD shows a potential for stable long-term operation in conjunction with a simple membrane cleaning process, and its suitability in dyeing wastewater treatment.

  1. Direct injection of high pressure gas : scaling properties of pulsed turbulent jets

    NARCIS (Netherlands)

    Baert, R.S.G.; Klaassen, A.; Doosje, E.

    2010-01-01

    Existing gasoline DI injection equipment has been modified to generate single hole pulsed gas jets. Injection experiments have been performed at combinations of 3 different pressure ratios (2 of which supercritical) respectively 3 different hole geometries (i.e. length to diameter ratios). Injection

  2. Thermodynamic properties of charged three-dimensional black holes in the scalar-tensor gravity theory

    Science.gov (United States)

    Dehghani, M.

    2018-02-01

    Making use of the suitable transformation relations, the action of three-dimensional Einstein-Maxwell-dilaton gravity theory has been obtained from that of scalar-tensor modified gravity theory coupled to the Maxwell's electrodynamics as the matter field. Two new classes of the static three-dimensional charged dilatonic black holes, as the exact solutions to the coupled scalar, electromagnetic and gravitational field equations, have been obtained in the Einstein frame. Also, it has been found that the scalar potential can be written in the form of a generalized Liouville-type potential. The conserved black hole charge and masses as well as the black entropy, temperature, and electric potential have been calculated from the geometrical and thermodynamical approaches, separately. Through comparison of the results arisen from these two alternative approaches, the validity of the thermodynamical first law has been proved for both of the new black hole solutions in the Einstein frame. Making use of the canonical ensemble method, a black hole stability or phase transition analysis has been performed. Regarding the black hole heat capacity, with the black hole charge as a constant, the points of type-1 and type-2 phase transitions have been determined. Also, the ranges of the black hole horizon radius at which the Einstein black holes are thermally stable have been obtained for both of the new black hole solutions. Then making use of the inverse transformation relations, two new classes of the string black hole solutions have been obtained from their Einstein counterpart. The thermodynamics and thermal stability of the new string black hole solutions have been investigated. It has been found that thermodynamic properties of the new charged black holes are identical in the Einstein and Jordan frames.

  3. Materials Characterization at Utah State University: Facilities and Knowledge-base of Electronic Properties of Materials Applicable to Spacecraft Charging

    Science.gov (United States)

    Dennison, J. R.; Thomson, C. D.; Kite, J.; Zavyalov, V.; Corbridge, Jodie

    2004-01-01

    In an effort to improve the reliability and versatility of spacecraft charging models designed to assist spacecraft designers in accommodating and mitigating the harmful effects of charging on spacecraft, the NASA Space Environments and Effects (SEE) Program has funded development of facilities at Utah State University for the measurement of the electronic properties of both conducting and insulating spacecraft materials. We present here an overview of our instrumentation and capabilities, which are particularly well suited to study electron emission as related to spacecraft charging. These measurements include electron-induced secondary and backscattered yields, spectra, and angular resolved measurements as a function of incident energy, species and angle, plus investigations of ion-induced electron yields, photoelectron yields, sample charging and dielectric breakdown. Extensive surface science characterization capabilities are also available to fully characterize the samples in situ. Our measurements for a wide array of conducting and insulating spacecraft materials have been incorporated into the SEE Charge Collector Knowledge-base as a Database of Electronic Properties of Materials Applicable to Spacecraft Charging. This Database provides an extensive compilation of electronic properties, together with parameterization of these properties in a format that can be easily used with existing spacecraft charging engineering tools and with next generation plasma, charging, and radiation models. Tabulated properties in the Database include: electron-induced secondary electron yield, backscattered yield and emitted electron spectra; He, Ar and Xe ion-induced electron yields and emitted electron spectra; photoyield and solar emittance spectra; and materials characterization including reflectivity, dielectric constant, resistivity, arcing, optical microscopy images, scanning electron micrographs, scanning tunneling microscopy images, and Auger electron spectra. Further

  4. Dramatic changes in muscle contractile and structural properties after 2 botulinum toxin injections.

    Science.gov (United States)

    Minamoto, Viviane B; Suzuki, Kentaro P; Bremner, Shannon N; Lieber, Richard L; Ward, Samuel R

    2015-10-01

    Botulinum toxin is frequently administered serially to maintain therapeutic muscle paralysis, but the effect of repeated doses on muscle function are largely unknown. This study characterized the muscle response to 2 onabotulinum toxin (BoNT) injections separated by 3 months. Animal subjects received a single toxin injection (n = 8), 2 BoNT injections separated by 3 months (n = 14), or 1 BoNT and 1 saline injection separated by 3 months (n = 8). The functional effect of 2 serial injections was exponentially greater than the effect of a single injection. While both groups treated with a single BoNT injection had decreased torque in the injected leg by approximately 50% relative to contralateral legs, the double BoNT injected group had decreased torque by over 95% relative to the preinjection level. Both single and double BoNT injections produced clear signs of fiber-type grouping. These experiments demonstrate a disproportionately greater effect of repeated BoNT injections. © 2015 Wiley Periodicals, Inc.

  5. Influence of solvent polarization and non-uniform ion size on electrostatic properties between charged surfaces in an electrolyte solution

    Science.gov (United States)

    Sin, Jun-Sik

    2017-12-01

    In this paper, we study electrostatic properties between two similar or oppositely charged surfaces immersed in an electrolyte solution by using the mean-field approach accounting for solvent polarization and non-uniform size effects. Applying a free energy formalism accounting for unequal ion sizes and orientational ordering of water dipoles, we derive coupled and self-consistent equations to calculate electrostatic properties between charged surfaces. Electrostatic properties for similarly charged surfaces depend on the counterion size but not on the coion size. Moreover, electrostatic potential and osmotic pressure between similarly charged surfaces are found to be increased with increasing counterion size. On the other hand, the corresponding ones between oppositely charged surfaces are related to both sizes of positive and negative ions. For oppositely charged surfaces, the electrostatic potential, number density of solvent molecules, and relative permittivity of an electrolyte having unequal ion sizes are not symmetric about the centerline between the charged surfaces. For either case, the consideration of solvent polarization results in a decrease in the electrostatic potential and the osmotic pressure compared to the case without the effect.

  6. The influence of particle size distribution on the properties of metal-injection-moulded 17-4 PH stainless steel

    CSIR Research Space (South Africa)

    Seerane, Mandy

    2016-10-01

    Full Text Available Metal injection moulding (MIM) is a near-net-shaping powder metallurgy technique suitable for the cost-effective mass production of small and complex components. In this paper, the effects of the metal powder particle size on the final properties...

  7. Effects of moulding and environmental conditions on the mechanical and surface properties of injection moulded santoprene rubber

    DEFF Research Database (Denmark)

    Islam, Aminul; Ruby, Tobias M.; Jessen, Rikke L.

    the electronics inside from environmental hazards. The sealing ring is injection moulded in Santoprene-a thermoplastic vulcanizate consisting of Polypropelene and highly vulcanized EPDM rubber. The scope of the project was therefore to investigate the properties of Santoprene and make an immediate evaluation...

  8. 41 CFR 102-36.285 - May we charge for personal property transferred to another federal agency?

    Science.gov (United States)

    2010-07-01

    ... Property Management Federal Property Management Regulations System (Continued) FEDERAL MANAGEMENT... general fund of the Treasury or appropriated therefrom but by law reimbursable from assessment, tax, or... corporation. (b) You may charge for direct costs you incurred incident to the transfer, such as packing...

  9. Tail state-assisted charge injection and recombination at the electron-collecting interface of P3HT:PCBM bulk-heterojunction polymer solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang, He [Department of Chemical and Biological Engineering, Princeton University, Princeton, NJ 08544 (United States); Department of Electrical Engineering, Princeton University, Princeton, NJ 08544 (United States); Shah, Manas [Department of Chemical Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Ganesan, Venkat [Department of Chemical Engineering, University of Texas at Austin, Austin, TX 78712 (United States); Chabinyc, Michael L. [Materials Department, University of California Santa Barbara, CA 93106 (United States); Loo, Yueh-Lin [Department of Chemical and Biological Engineering, Princeton University, Princeton, NJ 08544 (United States)

    2012-12-15

    The systematic insertion of thin films of P3HT and PCBM at the electron- and hole-collecting interfaces, respectively, in bulk-heterojunction polymer solar cells results in different extents of reduction in device characteristics, with the insertion of P3HT at the electron-collecting interface being less disruptive to the output currents compared to the insertion of PCBM at the hole-collecting interface. This asymmetry is attributed to differences in the tail state-assisted charge injection and recombination at the active layer-electrode interfaces. P3HT exhibits a higher density of tail states compared to PCBM; holes in these tail states can thus easily recombine with electrons at the electron-collection interface during device operation. This process is subsequently compensated by the injection of holes from the cathode into these tail states, which collectively enables net current flow through the polymer solar cell. The study presented herein thus provides a plausible explanation for why preferential segregation of P3HT to the cathode interface is inconsequential to device characteristics in P3HT:PCBM bulk-heterojunction solar cells. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  10. Efficient charge carrier injection into sub-250 nm AlGaN multiple quantum well light emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Mehnke, Frank, E-mail: mehnke@physik.tu-berlin.de; Kuhn, Christian; Guttmann, Martin; Reich, Christoph; Kolbe, Tim; Rass, Jens; Wernicke, Tim [Technische Universität Berlin, Institut für Festkörperphysik, Hardenbergstr. 36, EW 6-1, 10623 Berlin (Germany); Kueller, Viola; Knauer, Arne; Lapeyrade, Mickael; Einfeldt, Sven; Weyers, Markus [Ferdinand-Braun-Institut, Leibniz-Institut für Höchstfrequenztechnik, Gustav-Kirchhoff-Str. 4, 12489 Berlin (Germany); Kneissl, Michael [Technische Universität Berlin, Institut für Festkörperphysik, Hardenbergstr. 36, EW 6-1, 10623 Berlin (Germany); Ferdinand-Braun-Institut, Leibniz-Institut für Höchstfrequenztechnik, Gustav-Kirchhoff-Str. 4, 12489 Berlin (Germany)

    2014-08-04

    The design and Mg-doping profile of AlN/Al{sub 0.7}Ga{sub 0.3}N electron blocking heterostructures (EBH) for AlGaN multiple quantum well (MQW) light emitting diodes (LEDs) emitting below 250 nm was investigated. By inserting an AlN electron blocking layer (EBL) into the EBH, we were able to increase the quantum well emission power and significantly reduce long wavelength parasitic luminescence. Furthermore, electron leakage was suppressed by optimizing the thickness of the AlN EBL while still maintaining sufficient hole injection. Ultraviolet (UV)-C LEDs with very low parasitic luminescence (7% of total emission power) and external quantum efficiencies of 0.19% at 246 nm have been realized. This concept was applied to AlGaN MQW LEDs emitting between 235 nm and 263 nm with external quantum efficiencies ranging from 0.002% to 0.93%. After processing, we were able to demonstrate an UV-C LED emitting at 234 nm with 14.5 μW integrated optical output power and an external quantum efficiency of 0.012% at 18.2 A/cm{sup 2}.

  11. Efficient charge carrier injection into sub-250 nm AlGaN multiple quantum well light emitting diodes

    International Nuclear Information System (INIS)

    Mehnke, Frank; Kuhn, Christian; Guttmann, Martin; Reich, Christoph; Kolbe, Tim; Rass, Jens; Wernicke, Tim; Kueller, Viola; Knauer, Arne; Lapeyrade, Mickael; Einfeldt, Sven; Weyers, Markus; Kneissl, Michael

    2014-01-01

    The design and Mg-doping profile of AlN/Al 0.7 Ga 0.3 N electron blocking heterostructures (EBH) for AlGaN multiple quantum well (MQW) light emitting diodes (LEDs) emitting below 250 nm was investigated. By inserting an AlN electron blocking layer (EBL) into the EBH, we were able to increase the quantum well emission power and significantly reduce long wavelength parasitic luminescence. Furthermore, electron leakage was suppressed by optimizing the thickness of the AlN EBL while still maintaining sufficient hole injection. Ultraviolet (UV)-C LEDs with very low parasitic luminescence (7% of total emission power) and external quantum efficiencies of 0.19% at 246 nm have been realized. This concept was applied to AlGaN MQW LEDs emitting between 235 nm and 263 nm with external quantum efficiencies ranging from 0.002% to 0.93%. After processing, we were able to demonstrate an UV-C LED emitting at 234 nm with 14.5 μW integrated optical output power and an external quantum efficiency of 0.012% at 18.2 A/cm 2

  12. Charge carrier mobility and electronic properties of Al(Op3: impact of excimer formation

    Directory of Open Access Journals (Sweden)

    Andrea Magri

    2015-05-01

    Full Text Available We have studied the electronic properties and the charge carrier mobility of the organic semiconductor tris(1-oxo-1H-phenalen-9-olatealuminium(III (Al(Op3 both experimentally and theoretically. We experimentally estimated the HOMO and LUMO energy levels to be −5.93 and −3.26 eV, respectively, which were close to the corresponding calculated values. Al(Op3 was successfully evaporated onto quartz substrates and was clearly identified in the absorption spectra of both the solution and the thin film. A structured steady state fluorescence emission was detected in solution, whereas a broad, red-shifted emission was observed in the thin film. This indicates the formation of excimers in the solid state, which is crucial for the transport properties. The incorporation of Al(Op3 into organic thin film transistors (TFTs was performed in order to measure the charge carrier mobility. The experimental setup detected no electron mobility, while a hole mobility between 0.6 × 10−6 and 2.1 × 10−6 cm2·V−1·s−1 was measured. Theoretical simulations, on the other hand, predicted an electron mobility of 9.5 × 10−6 cm2·V−1·s−1 and a hole mobility of 1.4 × 10−4 cm2·V−1·s−1. The theoretical simulation for the hole mobility predicted an approximately one order of magnitude higher hole mobility than was observed in the experiment, which is considered to be in good agreement. The result for the electron mobility was, on the other hand, unexpected, as both the calculated electron mobility and chemical common sense (based on the capability of extended aromatic structures to efficiently accept and delocalize additional electrons suggest more robust electron charge transport properties. This discrepancy is explained by the excimer formation, whose inclusion in the multiscale simulation workflow is expected to bring the theoretical simulation and experiment into agreement.

  13. Impact of physical properties of mixture of diesel and biodiesel fuels on hydrodynamic characteristics of fuel injection system

    Directory of Open Access Journals (Sweden)

    Filipović Ivan M.

    2014-01-01

    Full Text Available One of the alternative fuels, originating from renewable sources, is biodiesel fuel, which is introduced in diesel engines without major construction modifications on the engine. Biodiesel fuel, by its physical and chemical properties, is different from diesel fuel. Therefore, it is expected that by the application of a biodiesel fuel, the characteristic parameters of the injection system will change. These parameters have a direct impact on the process of fuel dispersion into the engine cylinder, and mixing with the air, which results in an impact on the quality of the combustion process. Method of preparation of the air-fuel mixture and the quality of the combustion process directly affect the efficiency of the engine and the level of pollutant emissions in the exhaust gas, which today is the most important criterion for assessing the quality of the engine. The paper presents a detailed analysis of the influence of physical properties of a mixture of diesel and biodiesel fuels on the output characteristics of the fuel injection system. The following parameters are shown: injection pressure, injection rate, the beginning and duration of injection, transformation of potential into kinetic energy of fuel and increase of energy losses in fuel injection system of various mixtures of diesel and biodiesel fuels. For the analysis of the results a self-developed computer program was used to simulate the injection process in the system. Computational results are verified using the experiment, for a few mixtures of diesel and biodiesel fuels. This paper presents the verification results for diesel fuel and biodiesel fuel in particular.

  14. Measurements of the Properties of Highly-charged high-Z ions

    International Nuclear Information System (INIS)

    Augustine J. Smith, Ph.D.

    2007-01-01

    We had proposed carrying out a systematic experimental investigation of the atomic physics of highly charged, high-Z ions, produced in the Lawrence Livermore National Laboratory LLNL electron beam ion trap (EBIT-I) in its high energy mode, superEBIT. In particular we were going to accurately measure line positions for Δn=0 transitions in few electron high-Z ions; this was meant to enable us to investigate relativistic and quantum electrodynamics QED contributions to the energy levels as well as the nuclear properties of heavy ions. We were also going to measure cross sections for various electron-ion interactions, the degree of polarization of emitted x-rays, and radiation cooling rates of various ionization stages of highly charged, high-Z ions. This would enable us to study fundamental atomic physics of high-Z ions at relativistic electron impact energies and in the intense nuclear fields of highly ionized, high-Z ions. This would extend previous measurements we have carried out to a regime where there is a paucity of good data. These measurements were expected to generate increased theoretical interest and activity in this area. The project will extend a very successful collaboration between Morehouse College (MC) and a national laboratory LLNL, Minority student training and development are major components of the proposal

  15. Physicochemical and biological properties of a novel injectable polyurethane system for root canal filling

    Directory of Open Access Journals (Sweden)

    Wang J

    2015-01-01

    Full Text Available Jian Wang,1 Yi Zuo,1 Minghui Zhao,1 Jiaxing Jiang,1 Yi Man,2 Jun Wu,3 Yunjiu Hu,3 Changlei Liu,4 Yubao Li,1 Jidong Li11Research Center for Nano-Biomaterials, Analytical and Testing Center, Sichuan University, Chengdu, Sichuan, People’s Republic of China; 2College of Stomatology, Sichuan University, Chengdu, Sichuan, People’s Republic of China; 3Department of Orthopedics, Chongqing Medical University, Chongqing, People’s Republic of China; 4College of Chemistry, Sichuan University, Chengdu, Sichuan, People’s Republic of ChinaAbstract: A root canal sealer with antibacterial activity can be efficacious in preventing reinfection that results from residual microorganisms and/or the leakage of microorganisms. In the present study, a series of injectable, self-curing polyurethane (PU-based antibacterial sealers with different concentrations of silver phosphate (Ag3PO4 were fabricated. Subsequently, their physicochemical properties, antibacterial abilities, and preliminary cytocompatibilities were evaluated. The results indicated that the fabricated PU-based sealers can achieve a high conversion rate in a short amount of time. More than 95% of the isocyanate group of PU sealers with 3 wt% (PU3 and 5 wt% (PU5 concentrations of Ag3PO4 were included in the curing reaction after 7 hours. With the exception of those for film thickness for PU5, the results of setting time, film thickness, and solubility were able to meet the requirements of the International Organization for Standardization. The antibacterial tests showed that PU3 and PU5 exhibit stronger antimicrobial effects than that achieved with 1 wt% Ag3PO4 (PU1 and AH Plus (positive control against Streptococcus mutans. The cytocompatibility evaluation revealed that the PU1 and PU3 sealers possess good cytocompatibility and low cytotoxicity. These results demonstrate that the PU3 sealer offers good physicochemical and antimicrobial properties along with cytocompatibility, which may hold great

  16. Real charge according to the current Serbian Draft Law on property rights and other real rights

    Directory of Open Access Journals (Sweden)

    Vujović Dragana

    2014-01-01

    Full Text Available Within reforms of loan security instruments law, Serbian Draft Law on Property Rights and Other Real Rights demonstrates interest for introducing new forms of non-accessory security rights. Real charge is a new institute in our legislation. It is a kind of real right on immovable thing that is regulated after the model of the German and Swiss laws, and which is in practice mostly used to secure a receivable, so that it is, to an extent, a personal hypothec. The most important reason for introduction of this institute into the Law was to allow for a security right on immovables that is more flexible than the accessorial hypothec, thus creating the environment conducive for the development of the secondary market of real loans, facilitating refinancing, and allowing for the extension of the offer of bank products with the reduction of transaction costs.

  17. The Properties of the Space-Charge and Net Current Density in Magnetized Plasmas

    International Nuclear Information System (INIS)

    Hatami, M. M.

    2013-01-01

    A hydrodynamic model is used to investigate the properties of positive space-charge and net current density in the sheath region of magnetized, collisional plasmas with warm positive ions. It is shown that an increase in the ion-neutral collision frequency, as well as the magnitude of the external magnetic field, leads to an increase in the net current density across the sheath region. The results also show that the accumulation of positive ions in the sheath region increases by increasing the ion-neutral collision frequency and the magnitude of the magnetic field. In addition, it is seen that an increase in the positive ion temperatures causes a decrease in the accumulation of positive ions and the net current density in the sheath region. (basic plasma phenomena)

  18. Synthesis, growth, structural modeling and physio-chemical properties of a charge transfer molecule: Guanidinium tosylate

    Science.gov (United States)

    Era, Paavai; Jauhar, RO. MU.; Vinitha, G.; Murugakoothan, P.

    2018-05-01

    An organic nonlinear optical material, guanidinium tosylate was synthesized adopting slow evaporation method and the crystals were harvested from aqueous methanolic medium with dimensions 13 × 9 × 3 mm3. Constitution of crystalline material was confirmed by single crystal X-ray diffraction study. The title compound crystallizes in the monoclinic crystal system with space group P21/c. The UV-vis-NIR spectral study of the grown crystal exhibits high transparency of 80% in the entire visible region with lower cut-off wavelength at 282 nm. Optimized molecular geometry of the grown crystal was obtained using density functional theory (DFT) and the frontier energy gaps calculated from the DFT aids to understand the charge transfer taking place in the molecule. The dielectric properties were studied as a function of temperature and frequency to find the charge distribution within the crystal. The titular compound is thermally stable up to 230 °C assessed by thermogravimetric and differential thermal analysis. Anisotropy in the mechanical behavior was observed while measuring for individual planes. The laser induced surface damage threshold of the grown crystal was measured to be 0.344 GW/cm2 for 1064 nm Nd:YAG laser radiation. Z-scan technique confirms the third-order nonlinear optical property with the ascertained nonlinear refractive index (n2), nonlinear absorption coefficient (β) and third order nonlinear susceptibility (χ(3)). Optical limiting study divulges that the transmitted output power step-up linearly with the increase of the input power at lower power realms and saturates from the threshold 24.95 mW/cm2 and amplitude 0.23 mW/cm2.

  19. The measurement of the charging properties of fine particulate materials in pneumatic suspension

    International Nuclear Information System (INIS)

    Armour-Chelu, D.I.

    1998-11-01

    This document describes a programme of work that was designed to develop an improved understanding of the electrostatic charging properties of particulate materials with a view to applying this knowledge to the measurement of particulate concentrations in air-solid suspensions. An extensive literature review has been carried out. Some eighty published works were found and these concentrated on indirect charge measurement, the measurement of the two-phase pipe flow parameters, and on finding suitable models to explain tile work function given to insulators during metal to insulator contact. These areas are covered well in the field of electrostatics but data currently available in the area of programme of work being described here is very, limited, and so it is proposed that this research project will aim to improve such understanding. A test facility was developed to provide information from the flow of a particulate material under known conditions (particle velocity, suspension density). This test facility utilised three sensing probes, each with discrete charge amplifier units, at specific locations: one at the beginning and two further down the pipeline being utilised. Hence, the charging tendencies of any material were observed using this facility. The results obtained from this facility show the charging tendency of three particulate materials under various flow conditions. Signal processing techniques were developed to infer the suspension density for each flow condition and to estimate average particle velocity. Further analysis of the data resulted in tile derivation of a power spectral estimate for some of the flow conditions. This estimate was considered with the particle size distribution, as well as the estimate of tile average particle velocity, and there is a linkage. The main material selected for this programme was aluminium hydroxide. This was tested at environmental temperatures of 19 and 30 deg. C with relative humidity (RH) levels of 35, 45, and

  20. Hyaluronidase: Understanding Its Properties and Clinical Application for Cosmetic Injection Adverse Events.

    Science.gov (United States)

    Harrison, Jeanine; Rhodes, Oriol

    The recent global consensus on the management of cosmetic aesthetic injectable complications from hyaluronic acid (HA) has increased the focus on the use of hyaluronidase more than ever before (M. Signorini et al., 2016). A comprehensive knowledge of facial anatomy, including structural positioning of facial arteries and veins, and an extensive knowledge of HA products available for injection procedures, combined with best practice protocols, will assist to prevent adverse events. Despite the growing number of patients using cosmetic fillers for facial restoration, the incidents incidence of adverse events remains low. Indeed, the avoidance of complications through safe and effective injection practice remains the key to preventing the need to use hyaluronidase.

  1. Photoconductivity enhancement and charge transport properties in ruthenium-containing block copolymer/carbon nanotube hybrids.

    Science.gov (United States)

    Lo, Kin Cheung; Hau, King In; Chan, Wai Kin

    2018-04-05

    Functional polymer/carbon nanotube (CNT) hybrid materials can serve as a good model for light harvesting systems based on CNTs. This paper presents the synthesis of block copolymer/CNT hybrids and the characterization of their photocurrent responses by both experimental and computational approaches. A series of functional diblock copolymers was synthesized by reversible addition-fragmentation chain transfer polymerizations for the dispersion and functionalization of CNTs. The block copolymers contain photosensitizing ruthenium complexes and modified pyrene-based anchoring units. The photocurrent responses of the polymer/CNT hybrids were measured by photoconductive atomic force microscopy (PCAFM), from which the experimental data were analyzed by vigorous statistical models. The difference in photocurrent response among different hybrids was correlated to the conformations of the hybrids, which were elucidated by molecular dynamics simulations, and the electronic properties of polymers. The photoresponse of the block copolymer/CNT hybrids can be enhanced by introducing an electron-accepting block between the photosensitizing block and the CNT. We have demonstrated that the application of a rigorous statistical methodology can unravel the charge transport properties of these hybrid materials and provide general guidelines for the design of molecular light harvesting systems.

  2. Influence of dense plasma on the energy levels and transition properties in highly charged ions

    Science.gov (United States)

    Chen, Zhan-Bin; Hu, Hong-Wei; Ma, Kun; Liu, Xiao-Bin; Guo, Xue-Ling; Li, Shuang; Zhu, Bo-Hong; Huang, Lian; Wang, Kai

    2018-03-01

    The studies of the influence of plasma environments on the level structures and transition properties for highly charged ions are presented. For the relativistic treatment, we implemented the multiconfiguration Dirac-Fock method incorporating the ion sphere (IS) model potential, in which the plasma screening is taken into account as a modified interaction potential between the electron and the nucleus. For the nonrelativistic treatment, analytical solutions of the Schrödinger equation with two types of the IS screened potential are proposed. The Ritz variation method is used with hydrogenic wave function as a trial wave function that contains two unknown variational parameters. Bound energies are derived from an energy equation, and the variational parameters are obtained from the minimisation condition of the expectation value of the energy. Numerical results for hydrogen-like ions in dense plasmas are presented as examples. A detailed analysis of the influence of relativistic effects on the energy levels and transition properties is also reported. Our results are compared with available results in the literature showing a good quantitative agreement.

  3. Mechanical Properties of Surface-Charged Poly(Methyl Methacrylate as Denture Resins

    Directory of Open Access Journals (Sweden)

    Sang E. Park

    2009-01-01

    Full Text Available The aim of this study was to examine the mechanical properties of a new surface-modified denture resin for its suitability as denture base material. This experimental resin is made by copolymerization of methacrylic acid (MA to poly(methyl methacrylate (PMMA to produce a negative charge. Four experimental groups consisted of Orthodontic Dental Resin (DENTSPLY Caulk as a control and three groups of modified PMMA (mPMMA produced at differing ratios of methacrylic acid (5 : 95, 10 : 90, and 20 : 80 MA : MMA. A 3-point flexural test using the Instron Universal Testing Machine (Instron Corp. measured force-deflection curves and a complete stress versus strain history to calculate the transverse strength, transverse deflection, flexural strength, and modulus of elasticity. Analysis of Variance and Scheffe Post-test were performed on the data. Resins with increased methacrylic acid content exhibited lower strength values for the measured physical properties. The most significant decrease occurred as the methacrylic acid content was increased to 20% mPMMA. No significant differences at P<.05 were found in all parameters tested between the Control and 5% mPMMA.

  4. Effect of injection parameters on mechanical and physical properties of super ultra-thin wall propylene packaging by Taguchi method

    Science.gov (United States)

    Ginghtong, Thatchanok; Nakpathomkun, Natthapon; Pechyen, Chiravoot

    2018-06-01

    The parameters of the plastic injection molding process have been investigated for the manufacture of a 64 oz. ultra-thin polypropylene bucket. The 3 main parameters, such as injection speed, melting temperature, holding pressure, were investigated to study their effect on the physical appearance and compressive strength. The orthogonal array of Taguchi's L9 (33) was used to carry out the experimental plan. The physical properties were measured and the compressive strength was determined using linear regression analysis. The differential scanning calorimeter (DSC) was used to analyze the crystalline structure of the product. The optimization results show that the proposed approach can help engineers identify optimal process parameters and achieve competitive advantages of energy consumption and product quality. In addition, the injection molding of the product includes 24 mm of shot stroke, 1.47 mm position transfer, 268 rpm screw speed, injection speed 100 mm/s, 172 ton clamping force, 800 kgf holding pressure, 0.9 s holding time and 1.4 s cooling time, make the products in the shape and proportion of the product satisfactory. The parameters of influence are injection speed 71.07%, melting temperature 23.31% and holding pressure 5.62%, respectively. The compressive strength of the product was able to withstand a pressure of up to 839 N before the product became plastic. The low melting temperature was caused by the superior crystalline structure of the super-ultra-thin wall product which leads to a lower compressive strength.

  5. The Effect of Masterbatch Recipes on the Homogenization Properties of Injection Molded Parts

    OpenAIRE

    Zsíros, László; Török, Dániel; Kovács, József Gábor

    2017-01-01

    Appearance is a key factor in most injection molding applications. Unfortunately, there is no widespread method to objectively test visual appearance, such as color inhomogeneity of the parts or other surface defects. We developed an evaluation method to characterize the color inhomogeneity of injection molded parts. First, we examined manufacturing conditions and masterbatch recipes and then the individual effects of the components and their interactions on homogeneity.

  6. The Effect of Masterbatch Recipes on the Homogenization Properties of Injection Molded Parts

    Directory of Open Access Journals (Sweden)

    László Zsíros

    2017-01-01

    Full Text Available Appearance is a key factor in most injection molding applications. Unfortunately, there is no widespread method to objectively test visual appearance, such as color inhomogeneity of the parts or other surface defects. We developed an evaluation method to characterize the color inhomogeneity of injection molded parts. First, we examined manufacturing conditions and masterbatch recipes and then the individual effects of the components and their interactions on homogeneity.

  7. Numerical investigation of natural gas direct injection properties and mixture formation in a spark ignition engine

    Directory of Open Access Journals (Sweden)

    Yadollahi Bijan

    2014-01-01

    Full Text Available In this study, a numerical model has been developed in AVL FIRE software to perform investigation of Direct Natural Gas Injection into the cylinder of Spark Ignition Internal Combustion Engines. In this regard two main parts have been taken into consideration, aiming to convert an MPFI gasoline engine to direct injection NG engine. In the first part of study multi-dimensional numerical simulation of transient injection process, mixing and flow field have been performed via three different validation cases in order to assure the numerical model validity of results. Adaption of such a modeling was found to be a challenging task because of required computational effort and numerical instabilities. In all cases present results were found to have excellent agreement with experimental and numerical results from literature. In the second part, using the moving mesh capability the validated model has been applied to methane Injection into the cylinder of a Direct Injection engine. Five different piston head shapes along with two injector types have been taken into consideration in investigations. A centrally mounted injector location has been adapted to all cases. The effects of injection parameters, combustion chamber geometry, injector type and engine RPM have been studied on mixing of air-fuel inside cylinder. Based on the results, suitable geometrical configuration for a NG DI Engine has been discussed.

  8. The effect of various quantum mechanically derived partial atomic charges on the bulk properties of chloride-based ionic liquids

    Energy Technology Data Exchange (ETDEWEB)

    Zolghadr, Amin Reza, E-mail: arzolghadr@shirazu.ac.ir [Department of Chemistry, Shiraz University, Shiraz 71946-84795 (Iran, Islamic Republic of); Ghatee, Mohammad Hadi [Department of Chemistry, Shiraz University, Shiraz 71946-84795 (Iran, Islamic Republic of); Moosavi, Fatemeh [Department of Chemistry, Ferdowsi University of Mashhad, Mashhad 91779 (Iran, Islamic Republic of)

    2016-08-22

    Partial atomic charges using various quantum mechanical calculations for [C{sub n}mim]Cl (n = 1, 4) ionic liquids (ILs) are obtained and used for development of molecular dynamics simulation (MD) force fields. The isolated ion pairs are optimized using HF, B3LYP, and MP2 methods for electronic structure with 6-311++G(d,p) basis set. Partial atomic charges are assigned to the atomic center with CHELPG and NBO methods. The effect of these sets of partial charges on the static and dynamic properties of ILs is evaluated by performing a series of MD simulations and comparing the essential thermodynamic properties with the available experimental data and available molecular dynamics simulation results. In contrast to the general trends reported for ionic liquids with BF{sub 4}, PF{sub 6}, and iodide anions (in which restrained electrostatic potential (RESP) charges are preferred), partial charges derived by B3LYP-NBO method are relatively good in prediction of the structural, dynamical, and thermodynamic energetic properties of the chloride based ILs.

  9. Changes in contractile properties of muscles receiving repeat injections of botulinum toxin (Botox).

    Science.gov (United States)

    Fortuna, Rafael; Vaz, Marco Aurélio; Youssef, Aliaa Rehan; Longino, David; Herzog, Walter

    2011-01-04

    Botulinum toxin type A (BTX-A) is a frequently used therapeutic tool to denervate muscles in the treatment of neuromuscular disorders. Although considered safe by the US Food and Drug Administration, BTX-A can produce adverse effects in target and non-target muscles. With an increased use of BTX-A for neuromuscular disorders, the effects of repeat injections of BTX-A on strength, muscle mass and structure need to be known. Therefore, the purpose of this study was to investigate the changes in strength, muscle mass and contractile material in New Zealand White (NZW) rabbits. Twenty NZW rabbits were divided into 4 groups: control and 1, 3 and 6 months of unilateral, repeat injections of BTX-A into the quadriceps femoris. Outcome measures included knee extensor torque, muscle mass and the percentage of contractile material in the quadriceps muscles of the target and non-injected contralateral hindlimbs. Strength in the injected muscles was reduced by 88%, 89% and 95% in the 1, 3 and 6 months BTX-A injected hindlimbs compared to controls. Muscle mass was reduced by 50%, 42% and 31% for the vastus lateralis (VL), rectus femoris (RF) and vastus medialis (VM), respectively, at 1 month, by 68%, 51% and 50% at 3 months and by 76%, 44% and 13% at 6 months. The percentage of contractile material was reduced for the 3 and 6 months animals to 80-64%, respectively, and was replaced primarily by fat. Similar, but less pronounced results were also observed for the quadriceps muscles of the contralateral hindlimbs, suggesting that repeat BTX-A injections cause muscle atrophy and loss of contractile tissue in target muscles and also in non-target muscles that are far removed from the injection site. Copyright © 2010 Elsevier Ltd. All rights reserved.

  10. Mechanical properties of the weld line defect in micro injection molding for various nano filled polypropylene composites

    International Nuclear Information System (INIS)

    Xie Lei; Ziegmann, Gerhard

    2011-01-01

    Research highlights: → PP/CNFs and PP/TiO 2 composites with relative high loading fractions (10, 20, 30 and 35 wt%) were fabricated by inner melt mixing process. Micro tensile test samples were formed by injection molding combined with variotherm process for all composites. → The morphological properties of all nano composites were characterized by WXRD, whose results imply the adding nano fillers did not change the crystal form of PP, but the crystallites size and distance between lattices of crystals were changed with various nano fillers and loading fractions. → DSC analysis show that due to the nucleating function of nano fillers, the peak temperature of crystallization was increased and the peak temperature of crystallization melting was decreased by adding the nanofillers. → The flow ability of nano composites was tested by high pressure single capillary rheometer and the results demonstrate that nano fillers increased the viscosity of PP matrix. → Based on these significant information and analysis foundation of the nano filled composites, the micro weld line samples were formed by injection molding process and characterized by tensile test method. From the achieved results, it can be found that in general, for functional nano filled polymer composites, the mechanical property of micro weld lines were obviously influenced by nano fillers' shape and loading fractions. → The E modulus of micro weld line was increased due to loading CNFs in PP matrix, while the elongation of the micro tensile samples with weld line is considerably decreased comparing with those of unfilled PP samples. The detrimental tensile strength of micro weld lines were observed when CNFs contents increasing, except for at a 10 wt%. → For TiO 2 nano particles filled PP, due to the poor dispersion of nano particles, at low loading fraction of 10 wt%, the E modulus and tensile strength of micro weld lines were decreased by filling nano particles, but when the loading fraction

  11. Solution processable semiconductor thin films: Correlation between morphological, structural, optical and charge transport properties

    Science.gov (United States)

    Isik, Dilek

    This Ph.D. thesis is a result of multidisciplinary research bringing together fundamental concepts in thin film engineering, materials science, materials processing and characterization, electrochemistry, microfabrication, and device physics. Experiments were conducted by tackling scientific problems in the field of thin films and interfaces, with the aim to correlate the morphology, crystalline structure, electronic structure of thin films with the functional properties of the films and the performances of electronic devices based thereon. Furthermore, novel strategies based on interfacial phenomena at electrolyte/thin film interfaces were explored and exploited to control the electrical conductivity of the thin films. Three main chemical systems were the object of the studies performed during this Ph.D., two types of organic semiconductors (azomethine-based oligomers and polymers and soluble pentacene derivatives) and one metal oxide semiconductor (tungsten trioxide, WO3). To explore the morphological properties of the thin films, atomic force microscopy was employed. The morphological properties were further investigated by hyperspectral fluorescence microscopy and tentatively correlated to the charge transport properties of the films. X-ray diffraction (Grazing incidence XRD, GIXRD) was used to investigate the crystallinity of the film and the effect of the heat treatment on such crystallinity, as well as to understand the molecular arrangement of the organic molecules in the thin film. The charge transport properties of the films were evaluated in thin film transistor configuration. For electrolyte gated thin film transistors, time dependent transient measurements were conducted, in parallel to more conventional transistor characterizations, to explore the specific effects played on the gating by the anion and cation constituting the electrolyte. The capacitances of the electrical double layers at the electrolyte/WO3 interface were obtained from

  12. Properties of vanadium-base alloys irradiated in the Dynamic Helium Charging Experiment*1

    Science.gov (United States)

    Chung, H. M.; Loomis, B. A.; Smith, D. L.

    1996-10-01

    One property of vanadium-base alloys that is not well understood in terms of their potential use a fusion reactor structural materials, is the effect of simultaneous generation of helium and neutron damage. In the present Dynamic Helium Charging Experiment (DHCE), helium was produced uniformly in the specimen at linear rates of ≈ 0.4 to 4.2 appm helium/dpa by the decay of tritium during irradiation to 18-31 dpa at 425-600°C in Li-filled capsules in a sodium-cooled fast reactor. This paper presents results of postirradiation examination and tests of microstructure and mechanical properties of V5Ti, V3Ti1Si, V8Cr6Ti, and V4Cr4Ti (the latter alloy has been identified as the most promising candidate vanadium alloy). Effects of helium on tensile strength and ductility were insignificant after irradiation and testing at > 420°C. However, postirradiation ductilities at irradiation. Ductile—brittle transition behavior of the DHCE specimens was also determined from bend tests and fracture appearance of transmission electron microscopy (TEM) disks and broken tensile specimens. No brittle behavior was observed at temperatures > - 150°C in DHCE specimens. Predominantly brittle-cleavage fracture morphologies were observed only at - 196°C in some specimens that were irradiated to 31 dpa at 425°C during the DHCE. For the helium generation rates in this experiment (≈ 0.4-4.2 appm He/dpa), grain-boundary coalescence of helium microcavities was negligible and intergranular fracture was not observed.

  13. Characterization of dextran-grafted hydrophobic charge-induction resins: Structural properties, protein adsorption and transport.

    Science.gov (United States)

    Liu, Tao; Angelo, James M; Lin, Dong-Qiang; Lenhoff, Abraham M; Yao, Shan-Jing

    2017-09-29

    The structural and functional properties of a series of dextran-grafted and non-grafted hydrophobic charge-induction chromatographic (HCIC) agarose resins were characterized by macroscopic and microscopic techniques. The effects of dextran grafting and mobile phase conditions on the pore dimensions of the resins were investigated with inverse size exclusion chromatography (ISEC). A significantly lower pore radius (17.6nm) was found for dextran-grafted than non-grafted resins (29.5nm), but increased salt concentration would narrow the gap between the respective pore radii. Two proteins, human immunoglobulin G (hIgG) and bovine serum albumin (BSA), were used to examine the effect of protein characteristics. The results of adsorption isotherms showed that the dextran-grafted resin with high ligand density had substantially higher adsorption capacity and enhanced the salt-tolerance property for hIgG, but displayed a significantly smaller benefit for BSA adsorption. Confocal laser scanning microscopy (CLSM) showed that hIgG presented more diffuse and slower moving adsorption front compared to BSA during uptake into the resins because of the selective binding of multiple species from polyclonal IgG; polymer-grafting with high ligand density could enhance the rate of hIgG transport in the dextran-grafted resins without salt addition, but not for the case with high salt and BSA. The results indicate that microscopic analysis using ISEC and CLSM is useful to improve the mechanistic understanding of resin structure and of critical functional parameters involving protein adsorption and transport, which would guide the rational design of new resins and processes. Copyright © 2017. Published by Elsevier B.V.

  14. Photochemical charges separation and photoelectric properties of flexible solar cells with two types of heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xiangyang, E-mail: lxy081276@126.com, E-mail: yzgu@henu.edu.cn; Wang, Shun; Zheng, Haiwu; Cheng, Xiuying; Gu, Yuzong, E-mail: lxy081276@126.com, E-mail: yzgu@henu.edu.cn [Institute of Microsystems Physics and School of Physics and Electronics, Henan University, Kaifeng 475004 (China)

    2015-12-14

    Photochemical charges generation, separation, and transport at nanocrystal interfaces are central to energy conversion for solar cells. Here, Zn{sub 2}SnO{sub 4} nanowires/Cu{sub 4}Bi{sub 4}S{sub 9} (ZTO/CBS), ZTO nanowires/CBS-reduced graphene oxide (ZTO/CBS-RGO), and bulk heterojunction (BHJ) solar cells were measured. The signals of steady state and electric field-induced surface photovoltage indicate that RGO with high electron mobility can evidently improve the photovoltaic response. Besides, ZTO/CBS and ZTO/CBS-RGO cells exhibit the excellent performance and the highest efficiencies of 1.2% and 2.8%, respectively. The internal relations of photoelectric properties to some factors, such as film thickness, direct paths, RGO conductive network, energy level matching, etc., were discussed in detail. Qualitative and quantitative analyses further verified the comprehensive effect of RGO and other factors. Importantly, the fine bendable characteristic of BHJ solar cells with excellent efficiency and facile, scalable production gives the as-made flexible solar cells device potential for practical application in future.

  15. A New Approach for Evaluating Charge Transport Properties of Semiconductor Detectors

    International Nuclear Information System (INIS)

    Kim, Kyung O; Kim, Jong Kyung; Kim, Soon Young; Ha, Jang Ho

    2009-01-01

    The semiconductor detectors (e.g., CdTe, CdZnTe, and HgI 2 ) have been widely used for radiation detection and medical imaging because of its various outstanding features such as excellent energy resolution, wide bandgap energy, room temperature operation, and so on. Unfortunately, the performance of these detectors is mainly limited by the charge transport properties of semiconductor, especially the mobility-lifetime products (i.e., (μτ) e and ((μτ) h ). Hence, the analysis on the mobility-lifetime products is very important for evaluating correct characteristics of semiconductor detectors. A commonly used method to analyze the mobilitylifetime products is based on their responses to α particle. However, the α particle method cannot evaluate the ((μτ)h product in many cases, because a semiconductor detector operating at positive bias voltages often yields the energy spectrum without the peaks. This method is also known to be very sensitive to the experimental conditions as well as surface conditions of the detector. In this study, a new approach with gamma-ray instead of α particle was carried out to solve the determination difficulty of the ((μτ) h product with common method. The special relation between the two mobility-lifetime products, which we call the 'Nural equation', was also developed to simply obtain each parameter based on Hecht equation

  16. Measurement of fragmentation properties of charmed particle production in charged-current neutrino interactions

    CERN Document Server

    Onengüt, G; De Jong, M; Konijn, J; Melzer, O; Oldeman, R G C; Pesen, E; Van der Poel, C A F J; Visschers, J L; Güler, M; Köse, U; Serin-Zeyrek, M; Kama, S; Sever, R; Tolun,, P; Zeyrek, M T; Catanesi, M G; De Serio, M; Ieva, M; Muciaccia, M T; Radicioni, E; Simone, S; Bülte, A; Winter, Klaus; Van de Vyver, B; Vilain, P; Wilquet, G; Saitta, B; Di Capua, E; Ogawa, S; Shibuya, H; Artamonov, A V; Brunner, J; Chizhov, M; Cussans, D G; Doucet, M; Fabre, Jean-Paul; Hristova, I R; Kawamura, T; Kolev, D; Litmaath, M; Meinhard, H; Panman, J; Papadopoulos, I M; Ricciardi, S; Rozanov, A; Saltzberg, D; Tsenov, R V; Uiterwijk, J W E; Zucchelli, P; Goldberg, J; Chikawa, M; Arik, E; Song, J S; Yoon, C S; Kodama, K; Ushida, N; Aoki, S; Hara, T; Delbar, T; Favart, D; Grégoire, G; Kalinin, S; Makhlyoueva, I V; Gorbunov, P; Khovanskii, V D; Shamanov, V V; Tsukerman, I; Bruski, N; Frekers, D; Rondeshagen, D; Wolff, T; Hoshino, K; Kawada, J; Komatsu, M; Miyanishi, M; Nakamura, M; Nakano, T; Narita, K; Niu, K; Niwa, K; Nonaka, N; Sato, O; Toshito, T; Buontempo, S; Cocco, A G; D'Ambrosio, N; De Lellis, G; De Rosa, G; Di Capua, F; Ereditato, A; Fiorillo, G; Marotta, A; Messina, M; Migliozzi, P; Pistillo, C; Santorelli, R; Scotto-Lavina, L; Strolin, P; Tioukov, V; Nakamura, K; Okusawa, T; Dore, U; FLoverre, P; Ludovici, L; Maslennikov, A L; Righini, P; Rosa, G; Santacesaria, R; Satta, A; Spada, F R; Barbuto, E; Bozza, C; Grella, G; Romano, G; Sirignano, C; Sorrentino, S; Sato, Y; Tezuka, I

    2004-01-01

    During the years 1994-97, the emulsion target of the CHORUS detector was exposed to the wideband neutrino beam of the CERN SPS. In total about 100 000 charged-current neutrino interactions were located in the nuclear emulsion target and fully reconstructed. From this sample of events which was based on the data acquired by new automatic scanning systems, 1048 D0 events were selected by a pattern recognition program. They were confirmed as neutral-particle decays through visual inspection. Fragmentation properties of deep-inelastic charm production were measured using these events. Distributions of the D0 momentum, Feynman x(x_F), z and tan thetaôut, the transverse angle out of the leptonic plane defined by the muon and the neutrino, are presented. The mean value of z was measured to be (z) = 0.63 +- 0.03(stat) +- 0.01(syst). From fits to the z distribution, values for the Peterson parameter epsilon_p = 0.108 +- 0.017(stat) +- 0.013(syst) and the Collins-Spiller parameter epsilon_CS = 0.21^+0.05_-0.04(stat) +...

  17. Magnetic properties of the charged Anderson-Brinkman-Morel state: Absence of Hc1

    International Nuclear Information System (INIS)

    Kita, T.

    1991-01-01

    Magnetic properties of the charged Anderson-Brinkman-Morel state are investigated theoretically as a special case of time-reversal-symmetry-breaking superconductivity. The magnetic field is expressed as a superposition of the one from the supercurrent j s (r) and that from the magnetic moment l(r) due to the internal motion of each Cooper pair. This procedure enables us to get rid of the paradox in zero external field that the moments are ordered (l=const) with no magnetic field nor supercurrent, leading to a natural conclusion that there is indeed a field due to l(r) which is screened almost completely by j s (r). If the system size is large enough compared with the penetration depth, the direction l(r) changes gradually toward the surface and the current j s (r) flows over the bulk. This means that the system is essentially nonuniform and forms a coreless vortex in zero external field. As for the magnetization process, the lattice of coreless vortices grows from the infinitesimal external field without H c1 (i.e., no Meissner state), which is subsequently followed by the first-order transition to the lattice with cores. Finally, the transition to the normal state occurs at H c2 enhanced over that of the conventional type-II superconductor due to the field l. An example of the magnetization curve is also given

  18. Generation of conductivity through transfer charge properties, for polyesters and polyamides with characteristic functional groups

    Science.gov (United States)

    Gonzalez, Carmen; Tagle, Luis Hernan; Terraza, Claudio A.; Barriga, Andres; Cabrera, A. L.; Volkmann, Ulrich G.

    2011-03-01

    Electro-optic properties of σ -conjugated polymers, as polysilylene; are associated with electron conjugation in the silicon atom, which allows a significant delocalization of electrons along of the chain. Thus, the conductivity is intimately connected to the mobility of charge carriers, which in turn depends on the structure and morphology of the system. We report the characterization of polyesters (PEFs) and polyamides (PAFs). Film thicknesses were obtained by ellipsometry. The vibration frequencies of the groups were determined by FT-IR and corroborated by Raman spectroscopy. Structural information was obtained from X-Ray diffraction (XRD). The structural and surface morphology were studied by scanning electron microscope (SEM). Electrical conductivity of the polymers was measured before and after exposure to iodine vapor, for films of different thicknesses. Morphological differentiation was studied by energy dispersive microscopy (EDX), showing a regular distribution of iodine within the polymer. Preliminary conductivity measurements showed adverse effects when oxidation of the polymer films is induced These effects are related to a certain grade of disorder within the system

  19. Magnetic properties of the charged Anderson-Brinkman-Morel state: Absence of Hc1

    International Nuclear Information System (INIS)

    Kita, T.

    1992-01-01

    Magnetic properties of the charged Anderson-Brinkman-Morel (ABM) state are investigated theoretically as a special case of time-reversal-symmetry-breaking (T-symmetry breaking) superconductivity, the possibility of which is discussed in heavy-fermion and high T c superconductors. In the ABM state there are two sources of current: The one from the supercurrent j s (r) and that from the moment l(r) due to the internal motion of Cooper pairs. In zero external field, the field h m (r) from l(r) is screened almost completely by j s (r), as expected, with l(r) changing gradually towards the surface and j s (r) flowing over the bulk. This means changing gradually towards the surface and j s (r) flowing over the bulk. This means that the system as a whole is a nonsingular vortex. As for the magnetization process, the lattice of nonsingular vortices grows from the infinitesimal external field without H c1 , subsequently followed by the first-order transition to the lattice with singular cores. Finally, the transition to the normal state occurs at H c2 which is enhanced over that of the conventional type-II superconductor due to the field l. (orig.)

  20. Properties of gelatin-based films incorporated with chitosan-coated microparticles charged with rutin.

    Science.gov (United States)

    Dammak, Ilyes; Bittante, Ana Mônica Quinta Barbosa; Lourenço, Rodrigo Vinicius; do Amaral Sobral, Paulo José

    2017-08-01

    The aim of this study was development an active film based on gelatin incorporated with antioxidant, rutin carried into microparticles. The complexation between oppositely charged lecithin and chitosan was applied to prepare the chitosan-coated microparticles. The generated microparticles had an average size of 520±4nm and a span of 0.3 were formulated by a rotor-stator homogenize at the homogenization speed 10,000rpm. Composite films were prepared by incorporating chitosan-coated microparticles, at various concentrations (0.05, 0.1, 0.5, or 1% (based on the weight of the gelatin powder)) in the gelatin-based films. For the prepared films, the results showed that obtained physicochemical, water vapor barrier, and mechanical were compared with native gelatin film with a slight decrease for chitosan concentration higher than 0.5%. The microstructure studies done by scanning electron microscopes, revealed different micropores embedded with oil resulting from the incorporation of the microparticles into the gelatin matrix. Moreover, the calorimetric results were comparable to those of gelatin control film with T g value 45°C and increased crystallinity percentage with increasing incorporation of microparticles. This original concept of composite biodegradable films may thus be a good alternative to incorporate liposoluble active compounds to design an active packaging with good properties. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Effects of charge-carrying amino acids on the gelatinization and retrogradation properties of potato starch.

    Science.gov (United States)

    Chen, Wenting; Zhou, Hongxian; Yang, Hong; Cui, Min

    2015-01-15

    The objective of this study was to evaluate the effects of charge-carrying amino acids (lysine (Lys), arginine (Arg), aspartic acid (Asp) and glutamic acid (Glu)) on the gelatinization and retrogradation properties of potato starch. Acidic amino acids (Asp and Glu) showed a decreasing trend in swelling power and granule size of potato starch, but increased amylose leaching and gelatinization temperature. Alkaline amino acid (Arg) showed an increasing trend in swelling power and granule size of potato starch, but decreasing amylose leaching and gelatinization temperature. Lys had no effect on the swelling power of potato starch, except at a high content (0.2 mol/kg). Like other two acidic amino acids, Lys also increased gelatinization temperature. Moreover, the addition of alkaline amino acids (Arg) decreased syneresis value of potato starch but acidic amino acids (Asp and Glu) increased it. Compared to Arg, the syneresis of potato starch with Lys was similar to that of its native starch. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Optimization of white organic light emitting diodes based on emitting layer charge carrier conduction properties

    International Nuclear Information System (INIS)

    Baek, H I; Lee, C H

    2008-01-01

    We have fabricated white organic light emitting diodes (OLEDs) with multi-emitting layer (EML) structures in which 4,4'-N,N'-dicarbazole-biphenyl (CBP) layers doped with the phosphorescent dopants fac-tris(2-phenylpyridine) iridium (Ir(ppy) 3 ) and bis(2-(2'-benzo[4,5-a]thienyl)pyridinato-N,C3')iridium(acetylacetonate) (btp 2 Ir(acac)) and the fluorescent dopant 4,4'-bis[2-{4-(N,N-diphenylamino) phenyl}vinyl]biphenyl (DPAVBi) were used as green (G), red (R) and blue (B) EMLs, respectively. A higher efficiency was expected with the R/G/B EML sequence from the hole transport layer interface than with the G/R/B sequence because of the differences in the charge carrier conduction properties of the EMLs doped with phosphorescent dopants and the luminance balance between the phosphorescent and fluorescent emissions. A high efficiency of 18.3 cd A -1 (an external quantum efficiency of 8.5%) at 100 cd m -2 and good colour stability were achieved with the R/G/B EML sequence as expected, with an additional non-doped CBP interlayer used between the G and B EMLs. In addition, the OLED with this sequence was found to have the longest lifetime of the white devices we tested

  3. Optimization of white organic light emitting diodes based on emitting layer charge carrier conduction properties

    Energy Technology Data Exchange (ETDEWEB)

    Baek, H I; Lee, C H [School of Electrical Engineering and Computer Science and Inter-University Semiconductor Research Center, Seoul National University, Seoul 151-744 (Korea, Republic of)], E-mail: hibaek75@snu.ac.kr

    2008-05-21

    We have fabricated white organic light emitting diodes (OLEDs) with multi-emitting layer (EML) structures in which 4,4'-N,N'-dicarbazole-biphenyl (CBP) layers doped with the phosphorescent dopants fac-tris(2-phenylpyridine) iridium (Ir(ppy){sub 3}) and bis(2-(2'-benzo[4,5-a]thienyl)pyridinato-N,C3')iridium(acetylacetonate) (btp{sub 2}Ir(acac)) and the fluorescent dopant 4,4'-bis[2-{l_brace}4-(N,N-diphenylamino) phenyl{r_brace}vinyl]biphenyl (DPAVBi) were used as green (G), red (R) and blue (B) EMLs, respectively. A higher efficiency was expected with the R/G/B EML sequence from the hole transport layer interface than with the G/R/B sequence because of the differences in the charge carrier conduction properties of the EMLs doped with phosphorescent dopants and the luminance balance between the phosphorescent and fluorescent emissions. A high efficiency of 18.3 cd A{sup -1} (an external quantum efficiency of 8.5%) at 100 cd m{sup -2} and good colour stability were achieved with the R/G/B EML sequence as expected, with an additional non-doped CBP interlayer used between the G and B EMLs. In addition, the OLED with this sequence was found to have the longest lifetime of the white devices we tested.

  4. The effect of hole transporting layer in charge accumulation properties of p-i-n perovskite solar cells

    Directory of Open Access Journals (Sweden)

    Fedros Galatopoulos

    2017-07-01

    Full Text Available The charge accumulation properties of p-i-n perovskite solar cells were investigated using three representative organic and inorganic hole transporting layer (HTL: (a Poly(3,4-ethylenedioxythiophene-poly(styrenesulfonate (PEDOT:PSS, Al 4083, (b copper-doped nickel oxide (Cu:NiOx, and (c Copper oxide (CuO. Through impedance spectroscopy analysis and modelling, it is shown that charge accumulation is decreased in the HTL/perovskite interface, between PEDOT:PSS to Cu:NiOx and CuO. This was indicative from the decrease in double layer capacitance (Cdl and interfacial charge accumulation capacitance (Cel, resulting in an increase to recombination resistance (Rrec, thus decreased charge recombination events between the three HTLs. Through AFM measurements, it is also shown that the reduced recombination events (followed by the increase in Rrec are also a result of increased grain size between the three HTLs, thus reduction in the grain boundary area. These charge accumulation properties of the three HTLs have resulted in an increase to the power conversion efficiency between the PEDOT:PSS (8.44%, Cu:NiOx (11.45%, and CuO (15.3%-based devices.

  5. Charge symmetry breaking nuclear forces and the properties of nuclear matter

    International Nuclear Information System (INIS)

    Haensel, P.

    1977-01-01

    The charge symmetry breaking (CSB) component of the nuclear forces yields the charge asymmetric term Esub(a)(N-Z)/A in the nuclear binding energy of nuclear matter. Calculation performed with several models of the CSB nuclear forces, and accounting for the strong short-range two-body correlations, gives Esub(a) approximately -0.2 MeV at the normal nuclear density. The charge asymmetry of the effective nucleon-nucleon interaction is determined primarily by the CSB nuclear forces at the neutron excess, observed in finite nuclei. The exclusion principle and dispersion (self-consistency) effects of the nuclear medium decrease this charge asymmetry. (author)

  6. Adsorption and Aqueous Lubricating Properties of Charged and Neutral Amphiphilic Diblock Copolymers at a Compliant, Hydrophobic Interface

    DEFF Research Database (Denmark)

    Røn, Troels; Javakhishvili, Irakli; Jankova Atanasova, Katja

    2013-01-01

    We have investigated the adsorption and lubricating properties of neutral and charged amphiphilic diblock copolymers at a hydrophobic polydimethylsiloxane (PDMS) interface in an aqueous environment. The diblock copolymers consist of a hydrophilic block of either neutral poly(ethylene glycol) (PEG......) or negatively charged poly(acrylic acid) (PAA) and of a hydrophobic block of polystyrene (PS) or poly(2-methoxyethyl acrylate) (PMEA), thus generating PEG-b-X or PAA-b-X, where X block is either PS or PMEA. The molecular weight ratios were roughly 1:1 with each block ca. 5 kDa. Comparing the neutral PEG...... effective adsorption only when PMEA was employed as the anchoring block. For PAA-b-PS, the poor adsorption properties are chiefly attributed to micellization due to the high interfacial tension between the PS core and water. The poor lubricating properties of PAA-b-PS diblock copolymer for a PDMS...

  7. Homological properties of modules with finite weak injective and weak flat dimensions

    OpenAIRE

    Zhao, Tiwei

    2017-01-01

    In this paper, we define a class of relative derived functors in terms of left or right weak flat resolutions to compute the weak flat dimension of modules. Moreover, we investigate two classes of modules larger than that of weak injective and weak flat modules, study the existence of covers and preenvelopes, and give some applications.

  8. Laser melt injection of ceramic particles in metals : Processing, microstructure and properties

    NARCIS (Netherlands)

    Ocelík, V.; De Hosson, J.Th.M.

    2010-01-01

    The objective of this paper is to present an overview of the possibilities of the laser melt injection (LMI) methodology to enhance the surface of light-weighted metals by adding hard ceramic particles in the top layer, with the aim to enhance the wear resistance and to increase the hardness. In

  9. Change of Static and Dynamic Elastic Properties due to CO² Injection in North Sea Chalk

    DEFF Research Database (Denmark)

    Alam, Mohammad Monzurul; Hjuler, M.L.; Christensen, H.F.

    2012-01-01

    important in enhanced oil recovery by CO2 injection (CO2-EOR) in chalk as, chalk reservoirs are vulnerable to compaction under changed stress and pore fluid. From South Arne field, North Sea, we used Ekofisk Formation chalk having approximately 20% non-carbonate and Tor Formation chalk having less than 5...

  10. Evolution of the electronic structure and properties of neutral and charged aluminum clusters: A comprehensive analysis

    International Nuclear Information System (INIS)

    Rao, B.K.; Jena, P.

    1999-01-01

    Density-functional theory with generalized gradient approximation for the exchange-correlation potential has been used to calculate the global equilibrium geometries and electronic structure of neutral, cationic, and anionic aluminum clusters containing up to 15 atoms. The total energies of these clusters are then used to study the evolution of their binding energy, relative stability, fragmentation channels, ionization potential, and vertical and adiabatic electron affinities as a function of size. The geometries are found to undergo a structural change from two dimensional to three dimensional when the cluster contains 6 atoms. An interior atom emerges only when clusters contain 11 or more atoms. The geometrical changes are accompanied by corresponding changes in the coordination number and the electronic structure. The latter is reflected in the relative concentration of the s and p electrons of the highest occupied molecular orbital. Aluminum behaves as a monovalent atom in clusters containing less than seven atoms and as a trivalent atom in clusters containing seven or more atoms. The binding energy evolves monotonically with size, but Al 7 , Al 7 + , Al 7 - , Al 11 - , and Al 13 - exhibit greater stability than their neighbors. Although the neutral clusters do not conform to the jellium model, the enhanced stability of these charged clusters is demonstrated to be due to the electronic shell closure. The fragmentation proceeds preferably by the ejection of a single atom irrespective of the charge state of the parent clusters. While odd-atom clusters carry a magnetic moment of 1μ B as expected, clusters containing even number of atoms carry 2μ B for n≤10 and 0 ampersand hthinsp;μ B for n>10. The calculated results agree very well with all available experimental data on magnetic properties, ionization potentials, electron affinities, and fragmentation channels. The existence of isomers of Al 13 cluster provides a unique perspective on the anomaly in the

  11. Theoretical studies on the effect of benzene and thiophene groups on the charge transport properties of Isoindigo and its derivatives

    Science.gov (United States)

    Jia, Xu-Bo; Wei, Hui-Ling; Shi, Ya-Ting; Shi, Ya-Rui; Liu, Yu-Fang

    2017-12-01

    In this work, the charge transport properties of Isoindigo (II) and its derivatives which have the same hexyl chain were theoretically investigated by the Marcus-Hush theory combined with density functional theory (DFT). Here we demonstrate that the changes of benzene and thiophene groups in molecular structure have an important influence on the charge transport properties of organic semiconductor. The benzene rings of II are replaced by thiophenes to form the thienoisoindigo (TII), and the addition of benzene rings to the TII form the benzothienoisoindigo (BTII). The results show that benzene rings and thiophenes change the chemical structure of crystal molecules, which lead to different molecule stacking, thus, the length of hydrogen bond was changed. A shorter intermolecular hydrogen bond lead to tighter molecular stacking, which reduces the center-to-center distance and enhances the ability of charge transfer. At the same time, we theoretically demonstrated that II and BTII are the ambipolar organic semiconductor. BTII has better carrier mobility. The hole mobility far greater than electron mobility in TII, which is p-type organic semiconductor. Among all hopping path, we find that the distance of face-to-face stacking in II is the shortest and the electron-transport electronic coupling Ve is the largest, but II has not a largest anisotropic mobility, because the reorganization energy has a greater influence on the mobility than the electronic coupling. This work is helpful for designing ambipolar organic semiconductor materials with higher charge transport properties by introducing benzene ring and thiophene.

  12. Tetracyanidoborates with triply charged rare earth metal cations and their optical properties

    Energy Technology Data Exchange (ETDEWEB)

    Hackbarth, Liisa

    2015-11-24

    The aim of this thesis is the description of the synthesis and characterization of a new group of tetracyanidoborates: tetracyanidoborates with trivalent rare earth metal cations. Their optical properties in the ultraviolet and visible range are also discussed. Common synthetic routes for tetracyanidoborates are adapted and applied to the preparation of the rare earth tetracyanidoborate hydrates. They are accessible with high yields and high purity through a reaction between the tetracyanidoboronic acid and rare earth hydroxides. It is shown that the rare earth tetracyanidoborates form isostructural groups, like the [LRE(H{sub 2}O){sub 5}][B(CN){sub 4}]{sub 3}.0.5 H{sub 2}O, where LRE{sup 3+} is La, Ce, Pr, Nd, Sm, Eu and Gd, the [HRE(H{sub 2}O){sub 7}][B(CN){sub 4}]{sub 3} and the [HRE(H{sub 2}O){sub 8}][B(CN){sub 4}]{sub 3}.3 H{sub 2}O, where HRE{sup 3+} is Tb, Dy, Ho, Er, Tm, Yb, Lu and Y. Furthermore, the coordination number 9 is noticed to be common among the light rare earth cations, whereas the minor coordination number 8 is prevalent for the heavy rare earth cations in their tetracyanidoborates. This different construction of the coordination spheres between light and heavy rare earth cations leads to different structures depending on the energetic efficiency of the structural arrangement. Generally, the rare earth tetracyanidoborate hydrates are found to crystallize in the monoclinic crystal system. Moreover, other different crystal structures are observed depending on the crystallization temperature and the type of coordinated ligands and co-crystallized solvent molecules. The tetracyanidoborate hydrates with triply charged rare earth cations are characterized comprehensively by X-ray diffraction, vibrational spectroscopy, NMR-spectroscopy as well as by thermal analysis. Furthermore, the optical properties of some dehydrated rare earth tetracyanidoborates are investigated by UV-spectroscopy and luminescence measurements. The results of the optical

  13. Tetracyanidoborates with triply charged rare earth metal cations and their optical properties

    International Nuclear Information System (INIS)

    Hackbarth, Liisa

    2015-01-01

    The aim of this thesis is the description of the synthesis and characterization of a new group of tetracyanidoborates: tetracyanidoborates with trivalent rare earth metal cations. Their optical properties in the ultraviolet and visible range are also discussed. Common synthetic routes for tetracyanidoborates are adapted and applied to the preparation of the rare earth tetracyanidoborate hydrates. They are accessible with high yields and high purity through a reaction between the tetracyanidoboronic acid and rare earth hydroxides. It is shown that the rare earth tetracyanidoborates form isostructural groups, like the [LRE(H_2O)_5][B(CN)_4]_3.0.5 H_2O, where LRE"3"+ is La, Ce, Pr, Nd, Sm, Eu and Gd, the [HRE(H_2O)_7][B(CN)_4]_3 and the [HRE(H_2O)_8][B(CN)_4]_3.3 H_2O, where HRE"3"+ is Tb, Dy, Ho, Er, Tm, Yb, Lu and Y. Furthermore, the coordination number 9 is noticed to be common among the light rare earth cations, whereas the minor coordination number 8 is prevalent for the heavy rare earth cations in their tetracyanidoborates. This different construction of the coordination spheres between light and heavy rare earth cations leads to different structures depending on the energetic efficiency of the structural arrangement. Generally, the rare earth tetracyanidoborate hydrates are found to crystallize in the monoclinic crystal system. Moreover, other different crystal structures are observed depending on the crystallization temperature and the type of coordinated ligands and co-crystallized solvent molecules. The tetracyanidoborate hydrates with triply charged rare earth cations are characterized comprehensively by X-ray diffraction, vibrational spectroscopy, NMR-spectroscopy as well as by thermal analysis. Furthermore, the optical properties of some dehydrated rare earth tetracyanidoborates are investigated by UV-spectroscopy and luminescence measurements. The results of the optical measurements indicate that the tetracyanidoborates with rare earth metal cations

  14. The effect of calcium on the properties of charged phospholipid bilayers

    DEFF Research Database (Denmark)

    Pedersen, U.R.; Leidy, Chad; Westh, P.

    2006-01-01

    We have performed molecular dynamics simulations to investigate the structure and dynamics of charged bilayers as well as the distribution of counterions at the bilayer interface. For this, we have considered the negatively charged di-myristoyl-phosphatidyl-glycerol (DMPG) and di-myristoyl-phosph...

  15. Bioreducible poly(amidoamine)s with charge-reversel properties for intracellular protein delivery

    NARCIS (Netherlands)

    Coué, G.M.J.P.C.; Engbersen, Johannes F.J.; Hennink, W.E.; Engbersen, J.F.J.

    2010-01-01

    An effective intracellular protein delivery system was developed using bioreducible disulfide-containing poly(amidoamine)s with negatively charged citraconic side groups that can give charge-reversal upon pH decrease. These water-soluble and linear polymers efficiently self-assemble with proteins

  16. Effects of in vivo injection of anti-chicken CD25 monoclonal antibody on regulatory T cell depletion and CD4+CD25- T cell properties in chickens.

    Science.gov (United States)

    Shanmugasundaram, Revathi; Selvaraj, Ramesh K

    2012-03-01

    Regulatory T cells (Tregs) are defined as CD4(+)CD25(+) cells in chickens. This study examined the effects of an anti-chicken CD25 monoclonal antibody injection (0.5 mg/bird) on in vivo depletion of Tregs and the properties of CD4(+)CD25(-) cells in Treg-depleted birds. The CD4(+)CD25(+) cell percentage in the blood was lower at 8 d post injection than at 0 d. Anti-CD25-mediated CD4(+)CD25(+) cell depletion in blood was maximum at 12 d post injection. The anti-CD25 antibody injection depleted CD4(+)CD25(+) cells in the spleen and cecal tonsils, but not in the thymus, at 12 d post antibody injection. CD4(+)CD25(-) cells from the spleen and cecal tonsils of birds injected with the anti-chicken CD25 antibody had higher proliferation and higher IL-2 and IFNγ mRNA amounts than the controls at 12 d post injection. At 20 d post injection, CD4(+)CD25(+) cell percentages in the blood, spleen and thymus were comparable to that of the 0 d post injection. It could be concluded that anti-chicken CD25 injection temporarily depleted Treg population and increased and IL-2 and IFNγ mRNA amounts in CD4(+)CD25(-) cells at 12d post injection. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. Impact of supercritical CO2 injection on petrophysical and rock mechanics properties of chalk: an experimental study on chalk from South Arne field, North Sea

    DEFF Research Database (Denmark)

    Alam, Mohammad Monzurul; Hjuler, Morten Leth; Christensen, Helle Foged

    2011-01-01

    Changes in chalk due to EOR by injecting supercritical CO2 (CO2-EOR) can ideally be predicted by applying geophysical methods designed from laboratory-determined petrophysical and rock mechanics properties. A series of petrophysical and rock mechanics tests were performed on Ekofisk Formation...... and Tor Formation chalk of the South Arne field to reveal the changes in petrophysical and rock mechanics properties of chalk due to the injection of CO2 at supercritical state. An increase in porosity and decrease in specific surface was observed due to injection of supercritical CO2. This indicates...... as indicated by NMR T2 relaxation time was observed. Rock mechanics testing indicates that in 30% porosity chalk from the South Arne field, injection of supercritical CO2 has no significant effect on shear strength and compaction properties, while there is probably a slight decrease in stiffness properties...

  18. Charge preamplifier

    International Nuclear Information System (INIS)

    Chaminade, R.; Passerieux, J.P.

    1961-01-01

    We describe a charge preamplifier having the following properties: - large open loop gain giving both stable gain and large input charge transfer; - stable input grid current with aging and without any adjustment; - fairly fast rise; - nearly optimum noise performance; - industrial material. (authors)

  19. Direct injection in organic SU8 nanowires and nanotubes for waveguiding properties investigation

    Science.gov (United States)

    Bigeon, J.; Huby, N.; Duvail, Jean-Luc; Bêche, Bruno

    2014-05-01

    We report photonic concepts related to injection and sub-wavelength propagation in nanofibers (nanowires and nanotubes). These nanostructures are fabricated by the wetting template method leading to aspect ratio of over 250. At first, injection into nanowires and nanotubes of SU8, a photoresist used for integrated photonics, was successfully achieved by using polymer microlensed fibers with sub-micronic radius of curvature. Theoret- ical simulation by finite domain time-dependent (FDTD) method was used to determine the sub-wavelength propagation for nanowires and nanotubes and corroborate this coupling phenomena. The original confinement of energy density into SU8 nanotubes is highlighted. Finally, characterisation of propagation losses is reported by using a cut-back method transposed to such nanotubes and determined to range between 1 and 2 dB/mm. Both injection and cut-back method developed here are compatible with any sub-micronic structures. This work on SU8 nanofibers suggests broader perspectives for future nanophotonics.

  20. Comparison of mechanical properties for polyamide 12 composite-based biomaterials fabricated by fused filament fabrication and injection molding

    Science.gov (United States)

    Rahim, Tuan Noraihan Azila Tuan; Abdullah, Abdul Manaf; Akil, Hazizan Md; Mohamad, Dasmawati

    2016-12-01

    The emergence of 3D printing technology known as fused filament fabrication (FFF) has offered the possibility of producing an anatomically accurate, patient specific implant with more affordable prices. The only weakness of this technology is related to incompatibility and lack of properties of current material to be applied in biomedical. Therefore, this study aims to develop a new, polymer composite-based biomaterial that exhibits a high processability using FFF technique, strong enough and shows acceptable biocompatibility, and safe for biomedical use. Polyamide 12 (PA12), which meets all these requirements was incorporated with two bioceramic fillers, zirconia and hydroxyapatite in order to improve the mechanical and bioactivity properties. The obtained mechanical properties were compared with injection-molded specimens and also a commercial biomedical product, HAPEXTM which is composed of hydroxyapatite and polyethylene. The yield strength and modulus of the PA12 composites increased steadily with increasing filler loading. Although the strength of printed PA12 composites were reduced compared with injection molded specimen, but still higher than HAPEXTM material. The higher surface roughness obtained by printed PA12 was expected to enhance the cell adhesion and provide better implant fixation.

  1. Injectable calcium sulfate/mineralized collagen-based bone repair materials with regulable self-setting properties.

    Science.gov (United States)

    Chen, Zonggang; Liu, Huanye; Liu, Xi; Cui, Fu-Zhai

    2011-12-15

    An injectable and self-setting bone repair materials (nano-hydroxyapatite/collagen/calcium sulfate hemihydrate, nHAC/CSH) was developed in this study. The nano-hydroxyapatite/collagen (nHAC) composite, which is the mineralized fibril by self-assembly of nano-hydrocyapatite and collagen, has the same features as natural bone in both main hierarchical microstructure and composition. It is a bioactive osteoconductor due to its high level of biocompatibility and appropriate degradation rate. However, this material lacks handling characteristics because of its particle or solid-preformed block shape. Herein, calcium sulfate hemihydrate (CSH) was introduced into nHAC to prepare an injectable and self-setting in situ bone repair materials. The morphology of materials was observed using SEM. Most important and interesting of all, calcium sulfate dihydrate (CSD), which is not only the reactant of preparing CSH but also the final solidified product of CSH, was introduced into nHAC as setting accelerator to regulate self-setting properties of injectable nHAC/CSH composite, and thus the self-setting time of nHAC/CSH composite can be regulated from more than 100 min to about 30 min and even less than 20 min by adding various amount of setting accelerator. The compressive properties of bone graft substitute after final setting are similar to those of cancellous bone. CSD as an excellent setting accelerator has no significant effect on the mechanical property and degradability of bone repair materials. In vitro biocompatibility and in vivo histology studies demonstrated that the nHAC/CSH composite could provide more adequate stimulus for cell adhesion and proliferation, embodying favorable cell biocompatibility and a strong ability to accelerate bone formation. It can offer a satisfactory biological environment for growing new bone in the implants and for stimulating bone formation. Copyright © 2011 Wiley Periodicals, Inc.

  2. Influence of thermal debinding on the final properties of Fe–Si soft magnetic alloys for metal injection molding (MIM)

    Energy Technology Data Exchange (ETDEWEB)

    Páez-Pavón, A.; Jiménez-Morales, A. [Dpto. Ciencia e Ing. de materiales e Ing. Química, Universidad Carlos III de Madrid, 28911 Leganés, Madrid (Spain); Santos, T.G. [UNIDEMI, Departamento de Engenharia Mecânica e Industrial, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal); Quintino, L. [Instituto Superior Técnico, Universidade de Lisboa, 1049-001 Lisboa (Portugal); Torralba, J.M. [Dpto. Ciencia e Ing. de materiales e Ing. Química, Universidad Carlos III de Madrid, 28911 Leganés, Madrid (Spain)

    2016-10-15

    Metal injection molding (MIM) may be used to produce soft magnetic materials with optimal mechanical and magnetic properties. Unlike other techniques, MIM enables the production of complex and small Fe–Si alloy parts with silicon contents greater than 3% by weight. In MIM process development, it is critical to design a proper debinding cycle not only to ensure complete removal of the binder system but also to obtain improved properties in the final part. This work is a preliminary study on the production of Fe-3.8Si soft magnetic parts by MIM using pre-alloyed powders and a non-industrialized binder. Two different heating rates during thermal debinding were used to study their effect on the final properties of the part. The final properties of the sintered parts are related to thermal debinding. It has been demonstrated that the heating rate during thermal debinding has a strong influence on the final properties of Fe–Si soft magnetic alloys. - Highlights: • The properties of MIM Fe-Si alloy are influenced by the debinding heating rate. • The slow debinding led to a lower porosity, lower oxygen content and grain growth. • The magnetization of the sintered samples improved after a slow thermal debinding.

  3. Semiconducting lithium indium diselenide: Charge-carrier properties and the impacts of high flux thermal neutron irradiation

    Science.gov (United States)

    Hamm, Daniel S.; Rust, Mikah; Herrera, Elan H.; Matei, Liviu; Buliga, Vladimir; Groza, Michael; Burger, Arnold; Stowe, Ashley; Preston, Jeff; Lukosi, Eric D.

    2018-06-01

    This paper reports on the charge carrier properties of several lithium indium diselenide (LISe) semiconductors. It was found that the charge collection efficiency of LISe was improved after high flux thermal neutron irradiation including the presence of a typically unobservable alpha peak from hole-only collection. Charge carrier trap energies of the irradiated sample were measured using photo-induced current transient spectroscopy. Compared to previous studies of this material, no significant differences in trap energies were observed. Through trap-filled limited voltage measurements, neutron irradiation was found to increase the density of trap states within the bulk of the semiconductor, which created a polarization effect under alpha exposure but not neutron exposure. Further, the charge collection efficiency of the irradiated sample was higher (14-15 fC) than that of alpha particles (3-5 fC), indicating that an increase in hole signal contribution resulted from the neutron irradiation. Finally, it was observed that significant charge loss takes place near the point of generation, producing a significant scintillation response and artificially inflating the W-value of all semiconducting LISe crystals.

  4. Dihedral angle control to improve the charge transport properties of conjugated polymers in organic field effect transistors

    Science.gov (United States)

    Dharmapurikar, Satej S.; Chithiravel, Sundaresan; Mane, Manoj V.; Deshmukh, Gunvant; Krishnamoorthy, Kothandam

    2018-03-01

    Diketopyrrolopyrrole (DPP) and i-Indigo (i-Ind) are two monomers that are widely explored as active materials in organic field effect transistor and solar cells. These two molecules showed impressive charge carrier mobility due to better packing that are facilitated by quadrupoles. We hypothesized that the copolymers of these monomers would also exhibit high charge carrier mobility. However, we envisioned that the dihedral angle at the connecting point between the monomers will play a crucial role in packing as well as charge transport. To understand the impact of dihedral angle on charge transport, we synthesized three copolymers, wherein the DPP was sandwiched between benzenes, thiophenes and furans. The copolymer of i-Indigo and furan comprising DPP showed a band gap of 1.4 eV with a very high dihedral angle of 179°. The polymer was found to pack better and the coherence length was found to be 112 Å. The hole carrier mobility of these polymer was found to be highest among the synthesized polymer i.e. 0.01 cm2/vs. The copolymer comprising benzene did not transport hole and electrons. The dihedral angle at the connecting point between i and Indigo and benzene DPP was 143 Å, which the packing and consequently charge transport properties.

  5. Field penetration induced charge redistribution effects on the field emission properties of carbon nanotubes - a first-principle study

    International Nuclear Information System (INIS)

    Chen, C.-W.; Lee, M.-H.; Clark, S.J.

    2004-01-01

    The effect of field penetration induced charge redistribution on the field emission properties of carbon nanotubes (CNTs) have been studied by the first-principle calculations. It is found that the carbon nanotube becomes polarized under external electric field leading to a charge redistribution. The resulting band bending induced by field penetration into the nanotube tip surface can further reduce the effective workfunction of the carbon nanotubes. The magnitude of the redistributed charge ΔQ is found to be nearly linear to the applied external field strength. In addition, we found that the capped (9, 0) zigzag nanotube demonstrates better field emission properties than the capped (5, 5) armchair nanotube due to the fact that the charge redistribution of π electrons along the zigzag-like tube axis is easier than for the armchair-like tube. The density of states (DOS) of the capped region of the nanotube is found to be enhanced with a value 30% higher than that of the sidewall part for the capped (5, 5) nanotube and 40% for the capped (9, 0) nanotube under an electric field of 0.33 V/A. Such enhancements of the DOS at the carbon nanotube tip show that electrons near the Fermi level will emit more easily due to the change of the surface band structure resulting from the field penetration in a high field

  6. Interfacial, electrical, and spin-injection properties of epitaxial Co2MnGa grown on GaAs(100)

    DEFF Research Database (Denmark)

    Damsgaard, Christian Danvad; Hickey, M. C.; Holmes, S. N.

    2009-01-01

    The interfacial, electrical, and magnetic properties of the Heusler alloy Co2MnGa grown epitaxially on GaAs(100) are presented with an emphasis on the use of this metal-semiconductor combination for a device that operates on the principles of spin-injection between the two materials. Through...... was monitored in situ by reflection high energy electron diffraction and the bulk composition was measured ex situ with inductively coupled plasma optical emission spectroscopy. The Co2MnGa L21 cubic structure is strained below a thickness of 20 nm on GaAs(100) but relaxed in films thicker than 20 nm...

  7. Charge transport in organic semiconductors.

    Science.gov (United States)

    Bässler, Heinz; Köhler, Anna

    2012-01-01

    Modern optoelectronic devices, such as light-emitting diodes, field-effect transistors and organic solar cells require well controlled motion of charges for their efficient operation. The understanding of the processes that determine charge transport is therefore of paramount importance for designing materials with improved structure-property relationships. Before discussing different regimes of charge transport in organic semiconductors, we present a brief introduction into the conceptual framework in which we interpret the relevant photophysical processes. That is, we compare a molecular picture of electronic excitations against the Su-Schrieffer-Heeger semiconductor band model. After a brief description of experimental techniques needed to measure charge mobilities, we then elaborate on the parameters controlling charge transport in technologically relevant materials. Thus, we consider the influences of electronic coupling between molecular units, disorder, polaronic effects and space charge. A particular focus is given to the recent progress made in understanding charge transport on short time scales and short length scales. The mechanism for charge injection is briefly addressed towards the end of this chapter.

  8. Symmetry properties of the transport coefficients of charged particles in disordered materials

    International Nuclear Information System (INIS)

    Baird, J.K.

    1979-01-01

    The transport coefficients of a charged particle in an isotropic material are shown to be even functions of the applied electric field. We discuss the limitation which this result and its consequences place upon formulae used to represent these coefficients

  9. Synthesis and photophysical properties of a novel terephthalic PH sensor based on internal charge transfer

    International Nuclear Information System (INIS)

    Miladinova, Polya M.

    2016-01-01

    A novel fluorescence sensing derivative of 2-aminodimethylterephthalate configured as a “fluorophore-receptor” system was synthesized and investigated. Due to the internal charge transfer, the designed fluorophore was able to act as a pH-probe via an “off-on” fluorescence sensing mechanism. The sensor activity toward protons as cations and hydroxide as anions in DMF was studied by monitoring the changes of the fluorescence intensity. Keywords: 2-aminoterephthalic derivative, ICT (internal charge transfer), pH sensor.

  10. Effect of starch types on properties of biodegradable polymer based on thermoplastic starch process by injection molding technique

    Directory of Open Access Journals (Sweden)

    Yossathorn Tanetrungroj

    2015-04-01

    Full Text Available In this study effects of different starch types on the properties of biodegradable polymer based on thermoplastic starch (TPS were investigated. Different types of starch containing different contents of amylose and amylopectin were used, i.e. cassava starch, mungbean starch, and arrowroot starch. The TPS polymers were compounded and shaped using an internal mixer and an injection molding machine, respectively. It was found that the amount of amylose and amylopectin contents on native starch influence the properties of the TPS polymer. A high amylose starch of TPMS led to higher strength, hardness, degree of crystallization than the high amylopectin starch of TPCS. In addition, function group analysis by Fourier transforms infrared spectrophotometer, water absorption, and biodegradation by soil burial test were also examined.

  11. Influence of sorbitol on mechanical and physico-chemical properties of soy protein-based bioplastics processed by injection molding

    Directory of Open Access Journals (Sweden)

    Manuel Felix

    Full Text Available Abstract Soy Protein Isolate (SPI has been evaluated as useful candidate for the development of protein-based bioplastic materials processed by injection molding. The influence of sorbitol (SB as plasticizer in mechanical properties and water uptake capacity was evaluated in SPI-based bioplastics. A mixing rheometer that allows monitoring torque and temperature during mixing and a small-scale-plunger-type injection molding machine were used to obtain SPI/Plasticizer blends and SPI-based bioplastics, respectively. Dynamic measurements were carried out to obtain mechanical spectra of different bioplastics. Moreover, the mechanical characterization was supplemented with uniaxial tensile tests. Additionally, the influence of SB in water uptake capacity was also evaluated. The introduction of SB leads to increase the rigidity of bioplastics as well as the water uptake capacity after 24h, however it involves a decrease in strain at break. Final bioplastics are plastic materials with both adequate properties for the substitution of conventional petroleum plastics and high biodegradability.

  12. Effect of fiber content on flexural properties of glass fiber-reinforced polyamide-6 prepared by injection molding.

    Science.gov (United States)

    Nagakura, Manamu; Tanimoto, Yasuhiro; Nishiyama, Norihiro

    2017-07-26

    The use of non-metal clasp denture (NMCD) materials may seriously affect the remaining tissues because of the low rigidity of NMCD materials such as polyamides. The purpose of this study was to develop a high-rigidity glass fiber-reinforced thermoplastic (GFRTP) composed of E-glass fiber and polyamide-6 for NMCDs using an injection molding. The reinforcing effects of fiber on the flexural properties of GFRTPs were investigated using glass fiber content ranging from 0 to 50 mass%. Three-point bending tests indicated that the flexural strength and elastic modulus of a GFRTP with a fiber content of 50 mass% were 5.4 and 4.7 times higher than those of unreinforced polyamide-6, respectively. The result showed that the physical characteristics of GFRTPs were greatly improved by increasing the fiber content, and the beneficial effects of fiber reinforcement were evident. The findings suggest that the injection-molded GFRTPs are adaptable to NMCDs because of their excellent mechanical properties.

  13. Investigation of a piezoelectric droplet delivery method for fuel injection and physical property evaluation

    Science.gov (United States)

    Zhao, Wei; Menon, Shyam

    2017-11-01

    A piezoelectric droplet generator is investigated to deliver liquid hydrocarbon fuels to a micro-combustor application. Besides fuel delivery, the setup is intended to measure fuel physical properties such as viscosity and surface tension. These properties are highly relevant to spray generation in internal combustion engines. Accordingly, a drop-on-demand piezoelectric dispenser is used to generate fuel droplet trains, which are studied using imaging and Phase Doppler Particle Anemometry (PDPA). The diagnostics provide information regarding droplet size and velocity and their evolution over time. The measurements are correlated with results from one-dimensional (1D) models that incorporate sub-models for piezo-electric actuation and droplet vaporization. By validating the 1D models for fuels with known physical properties, a technique is developed that has the capability to meter low-vapor pressure liquid fuels to the microcombustor and use information from the droplet train to calculate physical properties of novel fuels.

  14. Study on the Mechanical and Interfacial Property of Injection Molded Fiber Reinforced Thermoplastics

    OpenAIRE

    王, 存涛

    2014-01-01

    Fiber reinforced polymer (FRP) composites have been used widely in the land transportation, aerospace, marine structures and characteristically conservative infrastructure construction industries and generally, the interface plays very important role in the properties of FRP materials. Therefore, this research studied the mechanical and interfacial property involved in the non-weld samples, weld samples and adhesive samples of insert moldings. Green composites as one of environment-friendly m...

  15. Properties of a radiation-induced charge multiplication region in epitaxial silicon diodes

    CERN Document Server

    Lange, Jörn; Fretwurst, Eckhart; Klanner, Robert; Lindström, Gunnar

    2010-01-01

    Charge multiplication (CM) in p$^+$n epitaxial silicon pad diodes of 75, 100 and 150 $\\upmu$m thickness at high voltages after proton irradiation with 1 MeV neutron equivalent fluences in the order of $10^{16}$ cm$^{-2}$ was studied as an option to overcome the strong trapping of charge carriers in the innermost tracking region of future Super-LHC detectors. Charge collection efficiency (CCE) measurements using the Transient Current Technique (TCT) with radiation of different penetration (670, 830, 1060 nm laser light and $\\alpha$-particles with optional absorbers) were used to locate the CM region close to the p$^+$-implantation. The dependence of CM on material, thickness of the epitaxial layer, annealing and temperature was studied. The collected charge in the CM regime was found to be proportional to the deposited charge, uniform over the diode area and stable over a period of several days. Randomly occurring micro discharges at high voltages turned out to be the largest challenge for operation of the dio...

  16. Isovector coupling channel and central properties of the charge density distribution in heavy spherical nuclei

    International Nuclear Information System (INIS)

    Haddad, S.

    2010-01-01

    The influence of the isovector coupling channel on the central depression parameter and the central value of the charge density distribution in heavy spherical nuclei was studied. The isovector coupling channel leads to about 50% increase of the central depression parameter, and weakens the dependency of both central depression parameter and the central density on the asymmetry, impressively contributing to the semibubble form of the charge density distribution in heavy nuclei, and increasing the probability of larger nuclei with higher proton numbers and higher neutron-to-proton ratios stable. (author)

  17. Hot-injection synthesis of Ni-ZnO hybrid nanocrystals with tunable magnetic properties and enhanced photocatalytic activity

    Energy Technology Data Exchange (ETDEWEB)

    Zeng, Deqian; Qiu, Yulong; Chen, Yuanzhi, E-mail: yuanzhi@xmu.edu.cn; Zhang, Qinfu; Liu, Xiang; Peng, Dong-Liang, E-mail: dlpeng@xmu.edu.cn [Xiamen University, Department of Materials Science and Engineering, Fujian Provincial Key Laboratory of Materials Genome, Collaborative Innovation Center of Chemistry for Energy Materials, College of Materials (China)

    2017-04-15

    Magnetic metal-semiconductor hybrid nanocrystals containing ferromagnetic Ni and semiconductor ZnO have been prepared via a hot-injection route. The Ni-ZnO hybrid nanocrystals have a flower-like morphology that consists of Ni inner cores and ZnO petal shells. In spite of their large lattice mismatch, ZnO nanocrystals can still grow on faceted Ni nanocrystals to form stable interfaces. The composition of Ni-ZnO hybrid nanocrystals is readily controlled, and the average size of Ni core is tunable from 25 to 50 nm. Room temperature ferromagnetic properties are observed in these hybrid nanocrystals, and tunable magnetic properties also can be achieved by varying the size of Ni core. The as-prepared Ni-ZnO hybrid nanocrystals exhibit enhanced photocatalytic performance under ultraviolet light illumination as compared to pure ZnO nanocrystals. Furthermore, the superior reusability of hybrid nanocrystals for photocatalytic application is achieved by virtue of their magnetic properties. The facile and efficient seed-mediate strategy is particularly attractive to construct hybrid magnetic-semiconducting heterostructures. The as-obtained Ni-ZnO hybrid nanocrystals offer great potential for various applications due to their combined magnetic and semiconducting properties and low-cost earth-abundant availability.

  18. Physical Property Changes During CO2 Injection into Sandstone from Pukpyeong Formation, South Korea: Pore-scale Approach

    Science.gov (United States)

    Han, J.; Keehm, Y.

    2010-12-01

    Carbon dioxide is believed to be responsible for global warming and climate change, and Korea government puts a great effort in CCS (Carbon Capture and Storage). The geological sequestration is regarded as one viable option and we are looking for prospecting formations for carbon storage. In this paper, we present a new approach to determine physical property changes during CO2 injection and preliminary results from applying the method to one of prospective Tertiary formation in South Korea. The so-called computational rock physics method is composed of three steps: 1) acquisition of high-resolution pore microstructures by X-ray micro-tomography; 2) CO2 injection simulation using lattice-Boltzmann (LB) two-phase flow simulation; and 3) FEM property simulations (electrical and elastic) at different CO2 saturations during the injection. We have been shown the viability of the method last year. This year we applied this method to one of CS (carbon storage) target area, Pukpyeong formation located in north-eastern part of South Korea. From thin section analysis, we found that the formation is composed of mudstone, sandstone and conglomerate, and most of them are poorly consolidated. The mudstone and poorly-sorted conglomerate are believed to have very low permeability, and the effect of CO2 injection would be significant. Thus we focus on sandstone units and get pore microstructure of those units. We then performed the computational rock physics analysis, and present the relations of Vp - CO2 saturation, and electrical conductivity - CO2 saturation for a few sand units. We also present the preliminary upscaling results by putting combined sandstone and mudstone units into FEM modeling. The modeling results implies that the new computational approach can be very useful to characterizing the CS sites especially in early stage. Acknowledgement: This work was supported by the Energy R&D program of the Korea Institute of Energy Technology Evaluation and Planning (KETEP

  19. Influencing Factors for the Microstructure and Mechanical Properties of Micro Porous Titanium Manufactured by Metal Injection Molding

    Directory of Open Access Journals (Sweden)

    Zhen Lu

    2016-04-01

    Full Text Available Porous titanium is a new structural and functional material. It is widely used in many fields since it integrates the properties of biomaterials with those of metallic foam. A new technology that combines both the preparation and forming of porous materials has been proposed in this paper. Moreover, a new solder was developed that could be employed in the joining of porous materials. Influencing factors for microstructure and mechanical properties of the parent material and joint interface are identified. Metal injection molding (MIM technology was used for fabricating porous materials. The feedstock for injection molding of porous titanium powders was prepared from titanium powders and a polymer-based binder system. In addition, the proportion of powder loading and binders was optimized. Through MIM technology, a porous titanium filter cartridge was prepared. For the purpose of investigating the thermal debinding technology of the filter cartridge, effects of the sintering temperature on the porosity, morphology of micropores and mechanical properties were analyzed. It could be found that when the sintering temperature increased, the relative density, bending and compression strength of the components also increased. Moreover, the porosity reached 32.28% when the sintering temperature was 1000 °C. The microstructure morphology indicated that micropores connected with each other. Meanwhile, the strength of the components was relatively high, i.e., the bending and compression strength was 65 and 60 MPa, respectively. By investigating the joining technology of porous filter cartridges, the ideal components of the solder and pressure were determined. Further research revealed that the micropore structure of the joint interface is the same as that of the parent material, and that the bending strength of the joint interface is 40 MPa.

  20. Tensile properties and microstructure of helium injected and reactor irradiated V-20 Ti

    International Nuclear Information System (INIS)

    Tanaka, M.P.; Bloom, E.E.; Horak, J.A.

    1980-01-01

    The objective of this work was to determine the effect of preinjected helium followed by neutron irradiation on the mechanical properties and microstructure of V-20% Ti. These results will be used for the evaluation of the potential use of V-20% Ti in fusion reactor service

  1. Theoretical Investigation on Charge Transfer Properties of 1,3,5-Tripyrrolebenzene (TPB and its Derivatives with Electron-withdrawing Substituents

    Directory of Open Access Journals (Sweden)

    Yong Hu

    2016-06-01

    Full Text Available The electronic structures and charge transport properties of 1,3,5-tripyrrolebenzene (TPB and its substituted derivatives with –F and –CN groups have been investigated by DFT calculations in combination with the Marcus hopping model. The dimer geometry was optimized by density functional theory method with dispersion force correction being included (DFT-D. Consequently, the charge transfer integral was evaluated. The calculation results show that the introduction of electron-withdrawing substituents does not significantly change the bond lengths and molecular symmetry of TPB, but lower the coplanarity between the pyrrole and benzene rings, especially in the case of CN substitution. Meanwhile, the introduction of electron-withdrawing groups can decrease the energy of the frontier molecular orbital and enhance the air stability. Fluorination makes the λe increase obviously while cyanation dose not. Generally speaking, the λe values of the title compounds are larger than their λh. Except for compounds 6 and 9, all others keep the face to face packing or have a slight slip in dimers, but the center of mass distances increase after fluorination or cyanation due to the distortion of the monomer’s coplanarity. The predicted quasi-one-dimensional electron mobility of the dimers is up to 0.433 cm2 V-1 s-1 at 298.15 K. The electron injection barriers of 2 and 7 are lower than that of TPB. The TPB derivatives of 1, 2, and 7 are potential n-channel materials with the high electron mobility. This work is licensed under a Creative Commons Attribution 4.0 International License.

  2. Energy gaps, valence and conduction charge densities and optical properties of GaAs1‑xPx

    Science.gov (United States)

    Al-Hagan, O. A.; Algarni, H.; Bouarissa, N.; Alhuwaymel, T. F.; Ajmal Khan, M.

    2018-04-01

    The electronic structure and its derived valence and conduction charge distributions along with the optical properties of zinc-blende GaAs1‑xPx ternary alloys have been studied. The calculations are performed using a pseudopotential approach under the virtual crystal approximation (VCA) which takes into account the compositional disorder effect. Our findings are found to be generally in good accord with experiment. The composition dependence of direct and indirect bandgaps showed a clear bandgap bowing. The nature of the gap is found to depend on phosphorous content. The bonding and ionicity of the material of interest have been examined in terms of the anti-symmetric gap and charge densities. The variation in the optical constants versus phosphorous concentration has been discussed. The present investigation may give a useful applications in infrared and visible spectrum light emitters.

  3. Analysis of the Electrical Properties of an Electron Injection Layer in Alq3-Based Organic Light Emitting Diodes.

    Science.gov (United States)

    Kim, Soonkon; Choi, Pyungho; Kim, Sangsub; Park, Hyoungsun; Baek, Dohyun; Kim, Sangsoo; Choi, Byoungdeog

    2016-05-01

    We investigated the carrier transfer and luminescence characteristics of organic light emitting diodes (OLEDs) with structure ITO/HAT-CN/NPB/Alq3/Al, ITO/HAT-CN/NPB/Alq3/Liq/Al, and ITO/HAT-CN/NPB/Alq3/LiF/A. The performance of the OLED device is improved by inserting an electron injection layer (EIL), which induces lowering of the electron injection barrier. We also investigated the electrical transport behaviors of p-Si/Alq3/Al, p-Si/Alq3/Liq/Al, and p-Si/Alq3/LiF/Al Schottky diodes, by using current-voltage (L-V) and capacitance-voltage (C-V) characterization methods. The parameters of diode quality factor n and barrier height φ(b) were dependent on the interlayer materials between Alq3 and Al. The barrier heights φ(b) were 0.59, 0.49, and 0.45 eV, respectively, and the diode quality factors n were 1.34, 1.31, and 1.30, respectively, obtained from the I-V characteristics. The built in potentials V(bi) were 0.41, 0.42, and 0.42 eV, respectively, obtained from the C-V characteristics. In this experiment, Liq and LiF thin film layers improved the carrier transport behaviors by increasing electron injection from Al to Alq3, and the LiF schottky diode showed better I-V performance than the Liq schottky diode. We confirmed that a Liq or LiF thin film inter-layer governs electron and hole transport at the Al/Alq3 interface, and has an important role in determining the electrical properties of OLED devices.

  4. Experimental investigation concerning the influence of fuel type and properties on the injection and atomization of liquid biofuels in an optical combustion chamber

    International Nuclear Information System (INIS)

    Galle, J.; Defruyt, S.; Van de Maele, C.; Rodriguez, R. Piloto; Denon, Q.; Verliefde, A.; Verhelst, S.

    2013-01-01

    Due to the scarcity of fossil fuels and the future stringent emission limits, there is an increasing interest for the use of renewable biofuels in compression ignition engines. However, these fuels have different physical, chemical and thermodynamic properties affecting atomization, spray development and combustion processes. The results reported in this paper have been obtained by experimentation with a constant volume combustion chamber. The influences of physical fuel properties on injections under non-evaporating conditions are studied, using a pump-line-nozzle system from a medium speed diesel engine with injection pressures up to 1200 bar, by changing the fuel type and temperature. Experiments were conducted for diesel, biodiesel, straight vegetable oils and animal fats. Injection pressure and needle lift measurements were analyzed. A high speed camera was used to visualize the spray, which enabled us to study the spray penetration and spray angle. Our results show that the fuel temperature is an important parameter to control because it significantly affects the fuel properties. Both the injection timing and injection duration are affected by the fuel properties. The influences of these properties on the spray development were less pronounced. At low temperatures, a strongly deteriorated atomization of oils and fats was observed. -- Highlights: • Spray measurements in an optical combustion chamber. • Influence on the injections system is compared for different bio-fuels. •Temperature effects the fuel properties, with strong influence on the injection system. • Viscosity has significant influence on atomization, especially for viscous fuels. • No difference for spray penetration and angle unlike the mass distribution

  5. Effect of hole injection layer/hole transport layer polymer and device structure on the properties of white OLED.

    Science.gov (United States)

    Cho, Ho Young; Park, Eun Jung; Kim, Jin-Hoo; Park, Lee Soon

    2008-10-01

    Copolymers containing carbazole and aromatic amine unit were synthesized by using Pd-catalyzed polycondensation reaction. The polymers were characterized in terms of their molecular weight and thermal stability and their UV and PL properties in solution and film state. The band gap energy of the polymers was also determined by the UV absorption and HOMO energy level data. The polymers had high HOMO energy level of 5.19-5.25 eV and work function close to that of ITO. The polymers were thus tested as hole injection/transport layer in the white organic light emitting diodes (OLED) by using 4,4'-bis(2,2-diphenyl-ethen-1-yl)diphenyl (DPVBi) as blue emitting material and 5,6,11,12-tetraphenylnaphthacene (Rubrene) as orange emitting dopant. The synthesized polymer, poly bis[6-bromo-N-(2-ethylhexyl)-carbazole-3-yl] was found to be useful as hole injection layer/hole transport layer (HIL/HTL) multifunctional material with high luminance efficiency and stable white color coordinate in the wide range of applied voltage.

  6. INFLUENCE OF REGRIND ON PROPERTIES OF PLASTICS PRODUCED BY INJECTION MOULDING

    Directory of Open Access Journals (Sweden)

    Ľudmila Dulebová

    2011-07-01

    Full Text Available The contribution deals with the evaluation of results of selected mechanical tests. Materials Crastin® PBT (with 30 % glass fibre and Celanex® 2004-2 PBT (without filler were used at tests with various percentage of added regrind into basic material. The mechanical properties were obtained by tensile test and Shore hardness test. Utilization of regrind at the production of new moulded parts is important from aspect of reduction plastics waste and pollution abatement of environment.

  7. Mechanical and degradation properties of biodegradable Mg strengthened poly-lactic acid composite through plastic injection molding.

    Science.gov (United States)

    Butt, Muhammad Shoaib; Bai, Jing; Wan, Xiaofeng; Chu, Chenglin; Xue, Feng; Ding, Hongyan; Zhou, Guanghong

    2017-01-01

    Full biodegradable magnesium alloy (AZ31) strengthened poly-lactic acid (PLA) composite rods for potential application for bone fracture fixation were prepared by plastic injection process in this work. Their surface/interfacial morphologies, mechanical properties and vitro degradation were studied. In comparison with untreated Mg rod, porous MgO ceramic coating on Mg surface formed by Anodizing (AO) and micro-arc-oxidation (MAO)treatment can significantly improve the interfacial binding between outer PLA cladding and inner Mg rod due to the micro-anchoring action, leading to better mechanical properties and degradation performance of the composite rods.With prolonging immersion time in simulated body fluid (SBF) solution until 8weeks, the MgO porous coating were corroded gradually, along with the disappearance of original pores and the formation of a relatively smooth surface. This resulted in a rapidly reduction in mechanical properties for corresponding composite rods owing to the weakening of interfacial binding capacity. The present results indicated that this new PLA-clad Mg composite rods show good potential biomedical applications for implants and instruments of orthopedic inner fixation. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Mechanical and thermal properties of conventional and microcellular injection molded poly (lactic acid)/poly (ε-caprolactone) blends.

    Science.gov (United States)

    Zhao, Haibin; Zhao, Guoqun

    2016-01-01

    In view of their complementary properties, blending polylactide (PLA) with poly (ε-caprolactone) (PCL) becomes a good choice to improve PLA's properties without compromising its biodegradability. A series of blends of biodegradable PLA and PCL with different mass fraction were prepared by melt mixing. Standard tensile bars were produced by both conventional and microcellular injection molding to study their mechanical and thermal properties. With the increase in PCL content, the blend showed decreased tensile strength and modulus; however, elongation was dramatically increased. With the addition of PCL, the failure mode changed from brittle fracture of the neat PLA to ductile fracture of the blend as demonstrated by tensile test. Various theoretical models based on dispersion and interface adhesion were used to predict the Young's modulus and the results shows the experimental data are consistent with the predictions of the foam model and Kerner-Uemura-Takayangi model. The thermal behavior of the blends was investigated by DSC and TGA. The melting temperature and the degree of crystallinity of PCL in the PLA/PCL did not significantly change with the PCL content increasing in the whole range of blends composition. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Microstructure, surface topography and mechanical properties of slip cast and powder injection moulded microspecimens made of zirconia

    International Nuclear Information System (INIS)

    Auhorn, M.; Kasanicka, B.; Beck, T.; Schulze, V.; Loehe, D.

    2003-01-01

    Investigations on ceramic microspecimens made of Y 2 O 3 -stabilized ZrO 2 produced by slip casting or micro powder injection moulding are introduced. During the production of the microspecimens, feedstocks and sintering conditions were varied. Differently moulded specimens were examined with respect to their microstructure and surface topography using light microscopy, scanning electron microscopy (SEM) and confocal white light microscopy. Additionally, the mechanical characteristics were investigated by three-point bending tests using a micro universal testing device. The statistical analysis was realised by means of the Weibull theory and interpreted by the aid of SEM images of fracture surfaces. This research allowed to understand correlations between different feedstocks used, process parameters like the sintering conditions applied and the resulting characteristics as well as material properties of the microspecimens. These results could be used to improve the production process. (orig.)

  10. Electronic structure properties of the In(Ga)As/GaAs quantum dot–quantum well tunnel-injection system

    International Nuclear Information System (INIS)

    Sęk, Grzegorz; Andrzejewski, Janusz; Ryczko, Krzysztof; Poloczek, Przemysław; Misiewicz, Jan; Semenova, Elizaveta S; Lemaitre, Aristide; Patriarche, Gilles; Ramdane, Aberrahim

    2009-01-01

    We report on the electronic properties of GaAs-substrate-based structures designed as a tunnel-injection system composed of self-assembled InAs quantum dots and an In 0.3 Ga 0.7 As quantum well separated by a GaAs barrier. We have performed photoluminescence and photoreflectance measurements which have allowed the determination of the optical transitions in the QW–QD tunnel structure and its respective references with just quantum dots or a quantum well. The effective mass calculations of the band structure dependence on the tunnelling barrier thickness have shown that in spite of an expected significant tunnelling between both parts of the system, its strong asymmetry and the strain distribution cause that the quantum-mechanical-coupling-induced energy shift of the optical transitions is almost negligible for the lowest energy states and weakly sensitive to the width of the barrier, which finds confirmation in the existing experimental data

  11. Standard Practice for Measurement of Mechanical Properties During Charged-Particle Irradiation

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1996-01-01

    1.1 This practice covers the performance of mechanical tests on materials being irradiated with charged particles. These tests are designed to simulate or provide understanding of, or both, the mechanical behavior of materials during exposure to neutron irradiation. Practices are described that govern the test material, the particle beam, the experimental technique, and the damage calculations. Reference should be made to other ASTM standards, especially Practice E 521. Procedures are described that are applicable to creep and creep rupture tests made in tension and torsion test modes. 1.2 The word simulation is used here in a broad sense to imply an approximation of the relevant neutron irradiation environment. The degree of conformity can range from poor to nearly exact. The intent is to produce a correspondence between one or more aspects of the neutron and charged particle irradiations such that fundamental relationships are established between irradiation or material parameters and the material respons...

  12. Effect of temperature and electrolyte concentration on the surface charge properties of fe(oh)3

    International Nuclear Information System (INIS)

    Irshad, M.

    2014-01-01

    Amorphous iron hydroxide was fabricated in the laboratory by precipitation technique. Salt addition and fast titration methods were employed for the determination of zero point charge. The present study is mainly focused on the surface charge, PZC determination from the potentiometric titration data in the temperature range 293 - 323 K and to calculate the thermodynamic parameters during the exchange of surface H+/OH- ions. The PZC of the solid was decreased with increasing the temperature of electrolytic solution. The Standard thermodynamic parameters such as delta H and delta S were also determined from Berube and DeBruyn equation, which showed the endothermic nature of potential determining ion H+/OH- ions. Further, their freedom in the double layer has lost on account of the electrostatic force of interaction. The positive delta G degree values are suggesting the nonspontaneous transferring reactions of H+ and OH- from the bulk solution to the interfacial region. (author)

  13. Assessment of CO2 Mineralization and Dynamic Rock Properties at the Kemper Pilot CO2 Injection Site

    Science.gov (United States)

    Qin, F.; Kirkland, B. L.; Beckingham, L. E.

    2017-12-01

    CO2-brine-mineral reactions following CO2 injection may impact rock properties including porosity, permeability, and pore connectivity. The rate and extent of alteration largely depends on the nature and evolution of reactive mineral interfaces. In this work, the potential for geochemical reactions and the nature of the reactive mineral interface and corresponding hydrologic properties are evaluated for samples from the Lower Tuscaloosa, Washita-Fredericksburg, and Paluxy formations. These formations have been identified as future regionally extensive and attractive CO2 storage reservoirs at the CO2 Storage Complex in Kemper County, Mississippi, USA (Project ECO2S). Samples from these formations were obtained from the Geological Survey of Alabama and evaluated using a suite of complementary analyses. The mineral composition of these samples will be determined using petrography and powder X-ray Diffraction (XRD). Using these compositions, continuum-scale reactive transport simulations will be developed and the potential CO2-brine-mineral interactions will be examined. Simulations will focus on identifying potential reactive minerals as well as the corresponding rate and extent of reactions. The spatial distribution and accessibility of minerals to reactive fluids is critical to understanding mineral reaction rates and corresponding changes in the pore structure, including pore connectivity, porosity and permeability. The nature of the pore-mineral interface, and distribution of reactive minerals, will be determined through imaging analysis. Multiple 2D scanning electron microscopy (SEM) backscattered electron (BSE) images and energy dispersive x-ray spectroscopy (EDS) images will be used to create spatial maps of mineral distributions. These maps will be processed to evaluate the accessibility of reactive minerals and the potential for flow-path modifications following CO2 injection. The "Establishing an Early CO2 Storage Complex in Kemper, MS" project is funded by

  14. Effect of high magnetic fields on the charge density wave properties of KMo 6O 17

    Science.gov (United States)

    Rötger, A.; Dumas, J.; Marcus, J.; Schlenker, C.; Ulmet, J. P.; Audouard, A.; Askenazy, S.

    1992-03-01

    The electrical resistivity of the purple bronze KMo 6O 17 has been studied between 2 and 88 K with pulsed magnetic fields up to 35 T. Several anomalies are found on the curves Δρ/ρ(B) at different temperatures. The low field results are compared with previous measurements of susceptibility and magnetization. A phase diagram which may show a field displaced charge density wave instability and field induced transitions is proposed.

  15. Static and dynamical valence-charge-density properties of GaAs

    International Nuclear Information System (INIS)

    Pietsch, U.

    1993-01-01

    Owing to the close neighbourhood of Ga and As in Mendeleev's table, GaAs shows two fundamental classes of X-ray structure amplitudes distinguished by their extremely different scattering power. They are differently sensitive to the valence electron density (VED) redistribution caused by the chemical bond and must be measured by different experimental methods. Using such data, both the VED and the difference electron densities (DED) are calculated here. Comparison with theoretical densities shows that the VED is characterized by covalent, ionic and metallic contributions. The DED constructed from GaAs and Ge data demonstrates the electronic response caused by a ''protonic'' charge transfer between both f.c.c. sublattices as well as the transition from a purely covalent to a mixed covalent-ionic bond. Especially the charge-density accumulation between nearest neighbours (bond charge (BC)) depends on the distance between the bonding atoms and changes under the influence of any lattice deformation. This phenomenon is described by a BC-transfer model. Its direct experimental proof is given by measuring the variation of the scattering power of weak reflections under the influence of an external electric field. This experiment demonstrates that the ionicity of the bond changes in addition to the BC variation. (orig.)

  16. Charge transport properties of graphene: Effects of Cu-based gate electrode

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Qide [School of Physics and Optoelectronics, Xiangtan University, Xiangtan 411105 (China); Zhang, C. X., E-mail: zhangchunxiao@xtu.edu.cn; Tang, Chao, E-mail: tang-chao@xtu.edu.cn; Zhong, Jianxin [School of Physics and Optoelectronics, Xiangtan University, Xiangtan 411105 (China); Hunan Provincial Key Laboratory of Micro-Nano Energy Materials and Devices, Xiangtan University, Hunan 411105 (China); He, Chaoyu [Hunan Provincial Key Laboratory of Micro-Nano Energy Materials and Devices, Xiangtan University, Hunan 411105 (China)

    2016-07-21

    Using the first-principles nonequilibrium Green's function method, we study effects of Cu and Ni@Cu used as the Cu-based gate electrode on the charge transport of graphene in the field effect transistors (FET). We find that the transmission of graphene decreases with both Cu and Ni@Cu absorbed in the scatter region. Especially, noticeable transmission gaps are present around the Femi level. The transmission gaps are still effective, and considerable cut-off regions are found under the non-equilibrium environment. The Ni@Cu depresses the transmission of graphene more seriously than the Cu and enlarges the transmission gap in armchair direction. The effects on the charge transport are attributed to the redistribution of electronic states of graphene. Both Cu and Ni@Cu induce the localization of states, so as to block the electronic transport. The Ni@Cu transforms the interaction between graphene and gate electrode from the physisorption to the chemisorption, and then induces more localized states, so that the transmission decreases further. Our results suggest that besides being used to impose gate voltage, the Cu-based gate electrode itself will have a considerable effect on the charge transport of graphene and induces noticeable transmission gap in the FET.

  17. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  18. Charging dynamics and strong localization of a two-dimensional electron cloud

    International Nuclear Information System (INIS)

    Dianoux, R; Smilde, H J H; Marchi, F; Buffet, N; Mur, P; Comin, F; Chevrier, J

    2007-01-01

    The dynamics of charge injection in silicon nanocrystals embedded in a silicon dioxide matrix is studied using electrostatic force microscopy. We show that the presence of silicon nanocrystals with a density of 10 11 cm -2 is essential for strong localization of charges, and results in exceptional charge retention properties compared to nanocrystal-free SiO 2 samples. In both systems, a logarithmic dependence of the diameter of the charged area on the injection time is experimentally observed on a timescale between 0.1 and 10 s (voltage≤10 V). A field-emission injection, limited by Coulomb blockade and a lateral charge spreading due to a repulsive radial electric field are used to model the sample charging. Once the tip is retracted, the electron cloud is strongly confined in the nanocrystals and remains static

  19. Die-cast of a hypo-eutectic AL-SI alloy: influence of injection temperature on microstructure and mechanical properties

    International Nuclear Information System (INIS)

    Santos, Silvano Leal dos; Santos, Sydney Ferreira

    2014-01-01

    Die-casting is widely used for manufacturing light alloy components for automotive industry. Among others, hypo-eutectic Al-Si alloys are currently processed by die-casting. To obtain high quality die-cast components, a better understanding on the correlations between processing parameters, microstructures, and mechanical properties are of utmost importance. In this study, we investigate the effect of injection temperature of liquid metal on the microstructure and mechanical properties of Al-Si alloy EN AC 46000 (DIN designation). The injection temperatures were 579, 589, 643, and 709 deg C. As-cast components had their microstructures analyzed by X-ray diffraction, optical and scanning electron microscopy, and X-ray energy dispersive spectroscopy. The mechanical properties were examined by micro-hardness and tensile tests. It was observed that the ultimate tensile strength slightly increased with the increase of injection temperature. The same trend was observed for micro-hardness. The amount of porosity in the samples varies in a small amount for different injection temperatures. On the other hand, the microstructure of the alloys seems more refined for higher temperatures of injection. This refinement in microstructure might play a major role on the mechanical properties of the Al-Si die-cast alloy. (author)

  20. Charge Carrier Dynamics and pH Effect on Optical Properties of Anionic and Cationic Porphyrin-Graphene Oxide Composites

    Science.gov (United States)

    Bajjou, O.; Bakour, A.; Khenfouch, M.; Baitoul, M.; Mothudi, B.; Maaza, M.; Faulques, E.

    2018-02-01

    Composites of graphene oxide (GO) functionalized with Sn(V) tetrakis (4-pyridyl)porphyrin (SnTPyP2+) and meso-tetrakis(4-phenylsulfonic acid)porphyrin (H4TPPS4 2- ) were prepared at different pH values.Successful synthesis of water-soluble stable suspension of GO-SnTPyP2+ and GO-H4TPPS4 2-was confirmed using various spectroscopic techniques, including scanning electronic microscopy (SEM), Raman spectroscopy, and ultraviolet-visible (UV-Vis) absorption. Variation of the pH was found to strongly influence the optical properties of the GO-SnTPyP2+ and GO-H4TPPS4 2-composites, as demonstrated by the UV-Vis absorption results. Steady-state photoluminescence (PL) and time-resolved PL (TRPL) results for both composites showed PL quenching and decrease in the exciton mean lifetime, suggesting strong excited-state interactions between the different components. Moreover, charge carrier dynamics study revealed that insertion of GO into both porphyrin derivatives led to faster mean lifetime for excitons with a slight advantage in the case of the cationic porphyrin-GO composite, making it a better choice for charge separation applications thanks to the higher efficiency of charge/energy transfer interactions.

  1. Transport properties of monolayer and bilayer graphene p-n junctions with charge puddles in the quantum Hall regime

    International Nuclear Information System (INIS)

    Cheng Shuguang

    2010-01-01

    Recent experiments have confirmed that the electron-hole inhomogeneity in graphene is a new type of charge disorder. Motivated by such confirmation, we theoretically study the transport properties of a monolayer graphene (MLG) based p-n junction and a bilayer graphene (BLG) p-n junction in the quantum Hall regime where electron-hole puddles are considered. By using the non-equilibrium Green function method, both the current and conductance are obtained. We find that, in the presence of the electron-hole inhomogeneity, the lowest quantized conductance plateau at e 2 /h emerges in the MLG p-n junction under very small charge puddle disorder strength. For a BLG p-n junction, however, the conductance in the p-n region is enhanced with charge puddles, and the lowest quantized conductance plateau emerges at 2e 2 /h. Besides, when an ideal quantized conductance plateau is formed for a MLG p-n junction, the universal conductance fluctuation is found to be 2e 2 /3h. Furthermore, we also investigate the influence of Anderson disorder on such p-n junctions and the comparison and discussion are given accordingly. To compare the two models with different types of disorder, we investigate the conductance distribution specially. Finally the influence of disorder strength on the conductance of a MLG p-n junction is investigated.

  2. Theoretical Investigation of OCN(-) Charge Transfer Complexes in Condensed Phase Media: Spectroscopic Properties in Amorphous Ice

    Science.gov (United States)

    Park, Jin-Young; Woon, David E.

    2004-01-01

    Density functional theory (DFT) calculations of cyanate (OCN(-)) charge-transfer complexes were performed to model the "XCN" feature observed in interstellar icy grain mantles. OCN(-) charge-transfer complexes were formed from precursor combinations of HNCO or HOCN with either NH3 or H2O. Three different solvation strategies for realistically modeling the ice matrix environment were explored, including (1) continuum solvation, (2) pure DFT cluster calculations, and (3) an ONIOM DFT/PM3 cluster calculation. The model complexes were evaluated by their ability to reproduce seven spectroscopic measurements associated with XCN: the band origin of the OCN(-) asymmetric stretching mode, shifts in that frequency due to isotopic substitutions of C, N, O, and H, plus two weak features. The continuum solvent field method produced results consistent with some of the experimental data but failed to account for other behavior due to its limited capacity to describe molecular interactions with solvent. DFT cluster calculations successfully reproduced the available spectroscopic measurements very well. In particular, the deuterium shift showed excellent agreement in complexes where OCN(-) was fully solvated. Detailed studies of representative complexes including from two to twelve water molecules allowed the exploration of various possible solvation structures and provided insights into solvation trends. Moreover, complexes arising from cyanic or isocyanic acid in pure water suggested an alternative mechanism for the formation of OCN(-) charge-transfer complexes without the need for a strong base such as NH3 to be present. An extended ONIOM (B3LYP/PM3) cluster calculation was also performed to assess the impact of a more realistic environment on HNCO dissociation in pure water.

  3. The importance of charge-transfer interactions in determining chromophoric dissolved organic matter (CDOM) optical and photochemical properties.

    Science.gov (United States)

    Sharpless, Charles M; Blough, Neil V

    2014-04-01

    Absorption of sunlight by chromophoric dissolved natural organic matter (CDOM) is environmentally significant because it controls photic zone depth and causes photochemistry that affects elemental cycling and contaminant fate. Both the optics (absorbance and fluorescence) and photochemistry of CDOM display unusual properties that cannot easily be ascribed to a superposition of individual chromophores. These include (i) broad, unstructured absorbance that decreases monotonically well into the visible and near IR, (ii) fluorescence emission spectra that all fall into a single envelope regardless of the excitation wavelength, and (iii) photobleaching and photochemical quantum yields that decrease monotonically with increasing wavelength. In contrast to a simple superposition model, these phenomena and others can be reasonably well explained by a physical model in which charge-transfer interactions between electron donating and accepting chromophores within the CDOM control the optical and photophysical properties. This review summarizes current understanding of the processes underlying CDOM photophysics and photochemistry as well as their physical basis.

  4. Characterisation of retention properties of charge-trapping memory cells at low temperatures

    International Nuclear Information System (INIS)

    Yurchuk, E; Bollmann, J; Mikolajick, T

    2009-01-01

    The density of states of deep level centers in silicon oxynitride layer of SONOS memory cells are calculated from temperature dependent retention measurement. The dominating charge loss mechanisms are direct trap-to-band tunneling (TB) and thermally stimulated emission (TE). Retention measurements at low temperatures (80 - 300K) will be dominated by TE from more 'shallow' traps with energies below 1eV and by TB. Taking into account both independent and rival processes the density of states could be calculated self consisting. The results are in excellent agreement with elsewhere published data.

  5. Characterisation of retention properties of charge-trapping memory cells at low temperatures

    Science.gov (United States)

    Yurchuk, E.; Bollmann, J.; Mikolajick, T.

    2009-09-01

    The density of states of deep level centers in silicon oxynitride layer of SONOS memory cells are calculated from temperature dependent retention measurement. The dominating charge loss mechanisms are direct trap-to-band tunneling (TB) and thermally stimulated emission (TE). Retention measurements at low temperatures (80 - 300K) will be dominated by TE from more "shallow" traps with energies below 1eV and by TB. Taking into account both independent and rival processes the density of states could be calculated self consisting. The results are in excellent agreement with elsewhere published data.

  6. Influence of binder system and temperature on rheological properties of water atomized 316L powder injection moulding feedstocks

    Directory of Open Access Journals (Sweden)

    Uğur GÖKMEN

    2016-02-01

    Full Text Available In order to obtain a proper powder injection molding the rheological behavior of feedstocks should be known. To determine the binder effect on the rheological behavior of 316L stainless steel powders feedstock two different feedstock were prepared. In the current experiments water atomized 316L stainless steel powders (-20 µm were used. Two types of binders, one of which is mainly paraffin wax can be dissolved in heptane and the other Polietilenglikol (PEG based and can be dissolved in water, were used. Polypropylene was used as binder and steric acid was used as lubricant for both binder systems as skeleton binder. Dry binder system were mixed for 30 min in a three dimensional Turbola. Capillary rheometer was used to characterize the rheological properties of feed stocks at 150-200 °C and a pressures of 0.165-2.069 MPa. Powder loading capacity of PEG and PW based feed stocks were found to be %55 and %61 respectively. The lowest viscosity of PEG and PW based feed stocks were found to be 304.707 Pa.s and 48.857 Pa.s respectively.Keywords: PIM, Binder, Rheological properties

  7. Evolution of radiation losses and importance of charge exchange between plasma impurities and injection beam neutrals in the W VII-A stellarator

    International Nuclear Information System (INIS)

    Smeulders, P.

    1981-01-01

    In certain discharges during Neutral Injection (N.I.) (84 0 CO-injection) in the 1 = 2, m = 5 WENDELSTEIN VII-A Stellarator impurity accumulation in the plasma center seems to occur as seen by bolometric, spectroscopic and ultra soft X-ray (USX) measurement. The time evolution of the radiation losses is shown. Three possible sources of the impurities which are responsible for the high central radiation losses are: - Beam injected impurities. - Plasma wall interaction. - Molybdenum protection plates. Possible mechanisms that can be responsible for the central impurity accumulations are: - An inward flow of the plasma or beam impurities. - An increased peaking of the depostion of the beam impurities. Various factors influencing the behaviour of the central radiation are mentioned. (orig./AH)

  8. Investigation of magnetic and magneto-transport properties of ferromagnetic-charge ordered core-shell nanostructures

    Science.gov (United States)

    Das, Kalipada

    2017-10-01

    In our present study, we address in detail the magnetic and magneto-transport properties of ferromagnetic-charge ordered core-shell nanostructures. In these core-shell nanostructures, well-known half metallic La0.67Sr0.33MnO3 nanoparticles (average particle size, ˜20 nm) are wrapped by the charge ordered antiferromagnetic Pr0.67Ca0.33MnO3 (PCMO) matrix. The intrinsic properties of PCMO markedly modify it into such a core-shell form. The robustness of the PCMO matrix becomes fragile and melts at an external magnetic field (H) of ˜20 kOe. The analysis of magneto-transport data indicates the systematic reduction of the electron-electron and electron-magnon interactions in the presence of an external magnetic field in these nanostructures. The pronounced training effect appears in this phase separated compound, which was analyzed by considering the second order tunneling through the grain boundaries of the nanostructures. Additionally, the analysis of low field magnetoconductance data supports the second order tunneling and shows the close value of the universal limit (˜1.33).

  9. Elastic and transport properties of steam-cured pozzolanic-lime rock composites upon CO2 injection

    Science.gov (United States)

    Emery, Dan; Vanorio, Tiziana

    2016-04-01

    Understanding the relationship between pozzolanic ash-lime reactions and the rock physics properties of the resulting rock microstructure is important for monitoring unrest conditions in volcanic-hydrothermal systems as well as devising concrete with enhanced performance. By mixing pozzolanic ash with lime, the ancient Romans incorporated these reactions in the production of concrete. Recently, it has been discovered that a fiber-reinforced, concrete-like rock is forming naturally in the depths of the Campi Flegrei volcanic-hydrothermal systems (Vanorio and Kanitpanyacharoen, 2015). We investigate the physico-chemical conditions contributing to undermine or enhance the laboratory measured properties of the subsurface rocks of volcanic-hydrothermal systems and, in turn, build upon those processes that the ancient Romans unwittingly exploited to create their famous concrete. We prepared samples by mixing the pozzolana volcanic ash, slaked lime, aggregates of Neapolitan Yellow tuff, and seawater from Campi Flegrei in the same ratios as the ancient Romans. To mimic the conditions of the caldera, we used mineral seawater from a well in the Campi Flegrei region rich in sulfate, bicarbonate, calcium, potassium, and magnesium ions. The samples were cured by steam. We measured baseline properties of porosity, permeability, P-wave velocity, and S-wave velocity of the samples. P and S-wave velocities were used to derive bulk, shear, and Young's moduli. Subsequently, half of the samples were injected with CO2-rich aqueous solution and the changes in their microstructure and physical properties measured. One sample was subjected to rapid temperature changes to determine how porosity and permeability changed as a function of the number of thermal shocks. Exposure of CO2 to the concrete-like rock samples destabilized fibrous mineral forming and decreased the samples' ability to deform without breaking. We show that steam- and sulfur-alkaline- rich environments affect both

  10. Electronic properties of Fe charge transfer complexes – A combined experimental and theoretical approach

    International Nuclear Information System (INIS)

    Ferreira, Hendrik; Eschwege, Karel G. von; Conradie, Jeanet

    2016-01-01

    Highlights: • Experimental and computational study of Fe II -phen, -bpy & -tpy compleesx. • Close correlations between experimental redox and spectral, and computational data. • Computational methods fast-track DSSC research. - Abstract: Dye-sensitized solar cell technology holds huge potential in renewable electricity generation of the future. Due to demand urgency, ways need to be explored to reduce research time and cost. Against this background, quantum computational chemistry is illustrated to be a reliable tool at the onset of studies in this field, simulating charge transfer, spectral (solar energy absorbed) and electrochemical (ease by which electrons may be liberated) tuning of related photo-responsive dyes. Comparative experimental and theoretical DFT studies were done under similar conditions, involving an extended series of electrochemically altered phenanthrolines, bipyridyl and terpyridyl complexes of Fe II . Fe II/III oxidation waves vary from 0.363 V for tris(3,6-dimethoxybipyridyl)Fe II to 0.894 V (versus Fc/Fc + ) for the 5-nitrophenanthroline complex. Theoretical DFT computed ionization potentials in the bipyridyl sub-series achieved an almost 100% linear correlation with experimental electrochemical oxidation potentials, while the phenanthroline sub-series gave R 2 = 0.95. Apart from the terpyridyl complex which accorded an almost perfect match, in general, TDDFT oscillators were computed at slightly lower energies than what was observed experimentally, while molecular HOMO and LUMO renderings reveal desired complexes with directional charge transfer propensities.

  11. High temperature oxidation of metals: vacancy injection and consequences on the mechanical properties

    International Nuclear Information System (INIS)

    Perusin, S.

    2004-11-01

    The aim of this work is to account for the effects of the high temperature oxidation of metals on their microstructure and their mechanical properties. 'Model' materials like pure nickel, pure iron and the Ni-20Cr alloy are studied. Nickel foils have been oxidised at 1000 C on one side only in laboratory air, the other side being protected from oxidation by a reducing atmosphere. After the oxidation treatment, the unoxidized face was carefully examined by using an Atomic Force Microscope (AFM). Grain boundaries grooves were characterised and their depth were compared to the ones obtained on the same sample heat treated in the reducing atmosphere during the same time. They are found to be much deeper in the case of the single side oxidised samples. It is shown that this additional grooving is directly linked to the growth of the oxide scale on the opposite side and that it can be explained by the diffusion of the vacancies produced at the oxide scale - metal interface, across the entire sample through grain boundaries. Moreover, the comparison between single side oxidised samples and samples oxidised on both sides points out that voids in grain boundaries are only observed in this latter case proving the vacancies condensation in the metal when the two faces are oxidised. The role of the carbon content and the sample's geometry on this phenomenon is examined in detail. The diffusion of vacancies is coupled with the transport of oxygen so that a mechanism of oxygen transport by vacancies is suggested. The tensile tests realised at room temperature on nickel foils (bamboo microstructure) show that the oxide scale can constitute a barrier to the emergence of dislocations at the metal surface. Finally, the Ni-20Cr alloy is tested in tensile and creep tests between 25 and 825 C in oxidising or reducing atmospheres. (author)

  12. Two-Phase Equilibrium Properties in Charged Topological Dilaton AdS Black Holes

    Directory of Open Access Journals (Sweden)

    Hui-Hua Zhao

    2016-01-01

    Full Text Available We discuss phase transition of the charged topological dilaton AdS black holes by Maxwell equal area law. The two phases involved in the phase transition could coexist and we depict the coexistence region in P-v diagrams. The two-phase equilibrium curves in P-T diagrams are plotted, the Clapeyron equation for the black hole is derived, and the latent heat of isothermal phase transition is investigated. We also analyze the parameters of the black hole that could have an effect on the two-phase coexistence. The results show that the black holes may go through a small-large phase transition similar to that of a usual nongravity thermodynamic system.

  13. Controlling Thermodynamic Properties of Ferromagnetic Group-IV Graphene-Like Nanosheets by Dilute Charged Impurity

    Science.gov (United States)

    Yarmohammadi, Mohsen; Mirabbaszadeh, Kavoos

    2017-05-01

    Using the Kane-Mele Hamiltonian, Dirac theory and self-consistent Born approximation, we investigate the effect of dilute charged impurity on the electronic heat capacity and magnetic susceptibility of two-dimensional ferromagnetic honeycomb structure of group-IV elements including silicene, germanene and stanene within the Green’s function approach. We also find these quantities in the presence of applied external electric field. Our results show that the silicene (stanene) has the maximum (minimum) heat capacity and magnetic susceptibility at uniform electric fields. From the behavior of theses quantities, the band gap has been changed with impurity concentration, impurity scattering strength and electric field. The analysis on the impurity-dependent magnetic susceptibility curves shows a phase transition from ferromagnetic to paramagnetic and antiferromagnetic phases. Interestingly, electronic heat capacity increases (decreases) with impurity concentration in silicene (germanene and stanene) structure.

  14. Enhancement of charge transport properties of small molecule semiconductors by controlling fluorine substitution and effects on photovoltaic properties of organic solar cells and perovskite solar cells.

    Science.gov (United States)

    Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung

    2016-11-01

    We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .

  15. On the nature of high field charge transport in reinforced silicone dielectrics: Experiment and simulation

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Yanhui, E-mail: huangy12@rpi.edu; Schadler, Linda S. [Department of Material Science and Engineering, Rensselaer Polytechnic Institute, 110 8th street, Troy, New York 12180 (United States)

    2016-08-07

    The high field charge injection and transport properties in reinforced silicone dielectrics were investigated by measuring the time-dependent space charge distribution and the current under dc conditions up to the breakdown field and were compared with the properties of other dielectric polymers. It is argued that the energy and spatial distribution of localized electronic states are crucial in determining these properties for polymer dielectrics. Tunneling to localized states likely dominates the charge injection process. A transient transport regime arises due to the relaxation of charge carriers into deep traps at the energy band tails and is successfully verified by a Monte Carlo simulation using the multiple-hopping model. The charge carrier mobility is found to be highly heterogeneous due to the non-uniform trapping. The slow moving electron packet exhibits a negative field dependent drift velocity possibly due to the spatial disorder of traps.

  16. Interface-Engineered Charge-Transport Properties in Benzenedithiol Molecular Electronic Junctions via Chemically p-Doped Graphene Electrodes.

    Science.gov (United States)

    Jang, Yeonsik; Kwon, Sung-Joo; Shin, Jaeho; Jeong, Hyunhak; Hwang, Wang-Taek; Kim, Junwoo; Koo, Jeongmin; Ko, Taeg Yeoung; Ryu, Sunmin; Wang, Gunuk; Lee, Tae-Woo; Lee, Takhee

    2017-12-06

    In this study, we fabricated and characterized vertical molecular junctions consisting of self-assembled monolayers of benzenedithiol (BDT) with a p-doped multilayer graphene electrode. The p-type doping of a graphene film was performed by treating pristine graphene (work function of ∼4.40 eV) with trifluoromethanesulfonic (TFMS) acid, producing a significantly increased work function (∼5.23 eV). The p-doped graphene-electrode molecular junctions statistically showed an order of magnitude higher current density and a lower charge injection barrier height than those of the pristine graphene-electrode molecular junctions, as a result of interface engineering. This enhancement is due to the increased work function of the TFMS-treated p-doped graphene electrode in the highest occupied molecular orbital-mediated tunneling molecular junctions. The validity of these results was proven by a theoretical analysis based on a coherent transport model that considers asymmetric couplings at the electrode-molecule interfaces.

  17. Electrical properties of a charge-transfer interlayer modified organic heterojunction

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Shuwen; Salzmann, Ingo; Koch, Norbert [Humboldt-Universitaet zu Berlin (Germany). Institut f. Physik; Vollmer, Antje [HZB-BESSY, Berlin (Germany)

    2010-07-01

    We investigated the effect of a thin interlayer (ca. monolayer) of tetrafluoro-tetracyanoquinodimethane (F4-TCNQ) between prototypical hole and electron transport layers (HTL and ETL) on interface energetics and current transport. As HTL we used 4,4{sup '},4''-tris(N,N-diphenyl-amino)triphenylamine (TDATA) and tris (8-hydroxyquinoline)aluminium (Alq{sub 3}) as ETL, which are commonly employed in organic light emitting diodes. The hole injection barrier into TDATA is 0.5 eV, as measured by photoemission spectroscopy. Deposition of an F4-TCNQ interlayer on top of TDATA does not further change the energy level position. However, after applying the F4-TCNQ interlayer the energy levels of Alq3 deposited on top of TDATA are 0.15 eV closer to the Fermi-level than without the interlayer. Diodes fabricated without interlayer had a 0.6 V higher onset-voltage one order of magnitude lower current density than those with F4-TCNQ. These observations can be rationalized by an increased (non-radiative) electron-hole recombination rate at the modified organic heterojunction and a changed internal electric field distribution.

  18. Improved photoluminescence properties of a new green SrB2O4:Tb3+ phosphor by charge compensation

    International Nuclear Information System (INIS)

    Wu, Zhan-Chao; Wang, Ping; Liu, Jie; Li, Chao; Zhou, Wen-Hui; Kuang, Shao-Ping

    2012-01-01

    Highlights: ► New green-emitting SrB 2 O 4 :Tb 3+ phosphor was synthesized by solid-state reaction. ► Li + , Na + , and K + can all increase luminescent intensity of SrB 2 O 4 :Tb 3+ . ► Na + is the optimal charge compensator among Li + , Na + and K + . ► SrB 2 O 4 :Tb 3+ is a promising green phosphor for fabricating WLED. -- Abstract: A new green-emitting SrB 2 O 4 :Tb 3+ phosphor was synthesized by solid-state reaction. X-ray powder diffraction (XRD) analysis confirmed all the samples with orthorhombic formation of SrB 2 O 4 . The excitation spectra indicate the phosphor can be effectively excited by near ultraviolet (NUV) light, making it attractive as conversion phosphor for LED applications. The phosphor exhibits a bright green emission with the highest photoluminescence (PL) intensity at 544 nm excited by 378 nm light. The critical quenching concentration of Tb 3+ in SrB 2 O 4 :Tb 3+ is about 10 mol%. The effects of charge compensators (Li + , Na + , and K + ) on photoluminescence of SrB 2 O 4 :Tb 3+ were also studied. The results show that the emission intensity can be improved by all the three charge compensators and Na + is the optimal one for SrB 2 O 4 :Tb 3+ . All properties show that the phosphor is a promising green phosphor pumped by NUV InGaN chip for fabricating white light-emitting diodes (WLEDs).

  19. Effect of thermostable α-amylase injection on mechanical and physiochemical properties for saccharification of extruded corn starch.

    Science.gov (United States)

    Myat, Lin; Ryu, Gi-Hyung

    2014-01-30

    In industry, a jet cooker is used to gelatinize starch by mixing the starch slurry with steam under pressure at 100-175 °C. A higher degree of starch hydrolysis in an extruder is possible with glucoamylase. Unfortunately, it is difficult to carry out liquefaction and saccharification in parallel, because the temperature of gelatinization will be too high and will inactivate glucoamylase. Since the temperature for liquefaction and saccharification is different, it is hard to change the temperature from high (required for liquefaction) to low (required for saccharification). The industrial gelatinization process is usually carried out with 30-35% (w/w) dry solids starch slurry. Conventional jet cookers cannot be used any more at high substrate concentrations owing to higher viscosity. In this study, therefore, corn starch was extruded at different melt temperatures to overcome these limitations and to produce the highest enzyme-accessible starch extrudates. Significant effects on physical properties (water solubility index, water absorption index and color) and chemical properties (reducing sugar and % increase in reducing sugar after saccharification) were achieved by addition of thermostable α-amylase at melt temperatures of 115 and 135 °C. However, there was no significant effect on % increase in reducing sugar of extruded corn starch at 95 °C. The results show the great potential of extrusion with thermostable α-amylase injection at 115 and 135 °C as an effective pretreatment for breaking down starch granules, because of the significant increase (P < 0.05) in % reducing sugar and enzyme-accessible extrudates for saccharification yield. © 2013 Society of Chemical Industry.

  20. Neutron detection performance of silicon carbide and diamond detectors with incomplete charge collection properties

    Energy Technology Data Exchange (ETDEWEB)

    Hodgson, M., E-mail: michael.hodgson@becq.co.uk [Department of Physics, University of Surrey, Guildford GU2 7XH (United Kingdom); Lohstroh, A.; Sellin, P. [Department of Physics, University of Surrey, Guildford GU2 7XH (United Kingdom); Thomas, D. [NPL, Teddington TW11 0LW (United Kingdom)

    2017-03-01

    The benefits of neutron detection and spectroscopy with carbon based, wide band gap, semiconductor detectors have previously been discussed within the literature. However, at the time of writing there are still limitations with these detectors related to availability, cost, size and perceived quality. This study demonstrates that lower quality materials—indicated by lower charge collection efficiency (CCE), poor resolution and polarisation effect—available at wafer scale and lower cost, can fulfil requirements for fast neutron detection and spectroscopy for fluxes over several orders of magnitude, where only coarse energy discrimination is required. In this study, a single crystal diamond detector (D-SC, with 100% CCE), a polycrystalline diamond (D-PC, with ≈4% CCE) and semi-insulating silicon carbide (SiC-SI, with ≈35% CCE) have been compared for alpha and fast neutron performance. All detectors demonstrated alpha induced polarisation effects in the form of a change of both energy peak position and count rate with irradiation time. Despite these operational issues the ability to detect fast neutrons and distinguish neutron energies was observed. This performance was demonstrated over a wide dynamic range (500–40,000 neutrons/s), with neutron induced polarisation being demonstrated in D-PC and SiC-SI at high fluxes.

  1. Charge compensation and magnetic properties in Sr and Cu doped La-Fe perovskites

    Directory of Open Access Journals (Sweden)

    de Julián Fernández C.

    2013-01-01

    Full Text Available Orthorhombic lanthanum orthoferrites La0.8Sr0.2Fe1-yCuyO3-w (y = 0 and 0.10 have been studied using X-rays and neutron powder diffraction (XRPD and NPD, magnetization measurements and 57Fe Mössbauer spectroscopy. Rietveld refinements on XRPD and NPD data show that they adopt an orthorhombic ABO3 perovskite symmetry with La/Sr and Fe/Cu atoms randomly distributed on crystal A and B sites, respectively. The magnetic structure at room temperature is antiferromagnetic, with the Fe/Cu magnetic moments aligned along the a axis. Magnetization curves versus temperature show that the compounds exhibit an overall antiferromagnetic and a weak ferromagnetic behaviour in the range 5-298 K. 57Fe Mössbauer spectroscopy measurements indicate that Fe3+ and Fe5+ ions coexist in both compounds, and the relative percentage of Fe5+ is almost the same at 77 and 170 K, rejecting a charge disproportion mechanism.

  2. Corneal permeation properties of a charged lipid nanoparticle carrier containing dexamethasone

    Science.gov (United States)

    Ban, Junfeng; Zhang, Yan; Huang, Xin; Deng, Guanghan; Hou, Dongzhi; Chen, Yanzhong; Lu, Zhufen

    2017-01-01

    Drug delivery carriers can maintain effective therapeutic concentrations in the eye. To this end, we developed lipid nanoparticles (L/NPs) in which the surface was modified with positively charged chitosan, which engaged in hydrogen bonding with the phospholipid membrane. We evaluated in vitro corneal permeability and release characteristics, ocular irritation, and drug dynamics of modified and unmodified L/NPs in aqueous humor. The size of L/NPs was uniform and showed a narrow distribution. Corneal permeation was altered by the presence of chitosan and was dependent on particle size; the apparent permeability coefficient of dexamethasone increased by 2.7 and 1.8 times for chitosan-modified and unmodified L/NPs, respectively. In conclusion, a chitosan-modified system could be a promising method for increasing the ocular bioavailability of unmodified L/NPs by enhancing their retention time and permeation into the cornea. These findings provide a theoretical basis for the development of effective drug delivery systems in the treatment of ocular disease. PMID:28243093

  3. An Analysis of Rheological Properties of Inconel 625 Superalloy Feedstocks Formulated with Backbone Binder Polypropylene System for Powder Injection Molding

    Directory of Open Access Journals (Sweden)

    Gökmen U.

    2017-12-01

    Full Text Available Binder formula is one of the most significant factors which has a considerable influence on powder injection molding (PIM processes. In the study, rheological behaviors and properties of different binder systems containing PIM feedstocks, Inconel 625 powder commonly used in space industry, were investigated. The feedstocks were prepared 59%-69% (volume powder loading ratios with three diversified binder systems by use of Polypropylene as backbone binder. The average particle size of the Inconel 625 powder used was 12.86 microns. Components used in the binder were mixed for 30 minutes as dry in three dimensional mixing to prepare binder systems. Rheological features of the feedstock were characterized by using a capillary rheometer. Viscosities of the feedstocks were calculated within the range of 37.996-1900 Pa.s based on the shear rate, shear stress, binder formula and temperature. “n” parameters for PIM feedstocks were determined to be less than 1. Influences of temperature on the viscosities of the feedstocks were also studied and “Ea” under various shear stresses were determined within the range of 24.41-70.89 kJ/mol.

  4. Pre-clinical evaluation of the mechanical properties of a low-stiffness cement-injectable hip stem.

    Science.gov (United States)

    Eldesouky, Ibrahim; Harrysson, Ola; Marcellin-Little, Denis J; West, Harvey; El-Hofy, Hassan

    2017-11-01

    In total hip arthroplasty (THA), the femoral stem can be fixed with or without bone cement. Cementless stem fixation is recommended for young and active patients as it eliminates the risk of loss of fixation at the bone-cement and cement-implant interfaces. Cementless fixation, however, suffers from a relatively high early revision rate. In the current research, a novel low-stiffness hip stem was designed, fabricated and tested. The stem design provided the option to inject biodegradable bone cement that could enhance initial stem stability. The stem was made of Ti6Al4V alloy. The proximal portion of the stem was porous, with cubic cells. The stem was fabricated using electron beam melting (EBM) technology and tested in compression and bending. Finite-element analysis was used to evaluate stem performance under a dynamic load representing a stair descending cycle and compare it to the performance of a solid stem with similar geometry. The von Mises stresses and maximum principal strains generated within the bone increased after porous stem insertion compared to solid stem insertion. The low-modulus stem tested in this study has acceptable mechanical properties and generates strain patterns in bone that appear compatible with clinical use.

  5. Sintering behavior and mechanical properties of a metal injection molded Ti–Nb binary alloy as biomaterial

    International Nuclear Information System (INIS)

    Zhao, Dapeng; Chang, Keke; Ebel, Thomas; Nie, Hemin; Willumeit, Regine; Pyczak, Florian

    2015-01-01

    Highlights: • The sintering of the MIM Ti–Nb alloy consists of three steps. • The Nb particles act as diffusion barriers during sintering. • The TiC x only precipitate in the cooling step during sintering. • The TiC x hardly influence the sintering process of MIM Ti–Nb alloy. • The MIM Ti–Nb alloy exhibits high strength, low Young’s modulus but poor ductility. - Abstract: Sintering behavior, microstructure and mechanical properties of a Ti–16Nb alloy processed by metal injection molding (MIM) technology using elemental powders were investigated in this work by optical microscopy, X-ray diffraction (XRD), dilatometer, scanning electron microscopy (SEM) and energy-dispersive spectroscopy (EDS). It was found that from 700 °C to 1500 °C the homogenization and densification process of MIM Ti–16Nb alloy consisted of three steps, i.e., Ti-diffusion-controlled step, Ti–Nb-diffusion step and matrix-diffusion step. Titanium carbide formation was observed in the samples sintered at 1300 °C and 1500 °C, but not in the ones sintered at 900 °C and 1100 °C. The MIM Ti–16Nb specimens sintered at 1500 °C exhibited a good combination of high tensile strength and low Young’s modulus. However, the titanium carbide particles led to poor ductility

  6. Highly efficient tandem OLED based on C{sub 60}/rubrene: MoO{sub 3} as charge generation layer and LiF/Al as electron injection layer

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yang [School of Materials Science and Engineering, Tianjin University of Technology, Tianjin 300384 (China); Key Laboratory of Display Materials and Photoelectric Devices, Ministry of Education, Tianjin 300384 (China); Tianjin Key Laboratory of Photoelectric Materials and Devices, Tianjin 300384 (China); College of Science, Tianjin University of Technology, Tianjin 300384 (China); Wu, Xiaoming, E-mail: wxm@tjut.edu.cn [School of Materials Science and Engineering, Tianjin University of Technology, Tianjin 300384 (China); Key Laboratory of Display Materials and Photoelectric Devices, Ministry of Education, Tianjin 300384 (China); Tianjin Key Laboratory of Photoelectric Materials and Devices, Tianjin 300384 (China); Xiao, Zhihui; Gao, Jian; Zhang, Juan; Rui, Hongsong; Lin, Xin; Zhang, Nan; Hua, Yulin [School of Materials Science and Engineering, Tianjin University of Technology, Tianjin 300384 (China); Key Laboratory of Display Materials and Photoelectric Devices, Ministry of Education, Tianjin 300384 (China); Tianjin Key Laboratory of Photoelectric Materials and Devices, Tianjin 300384 (China); Yin, Shougen, E-mail: sgyin@tjut.edu.cn [School of Materials Science and Engineering, Tianjin University of Technology, Tianjin 300384 (China); Key Laboratory of Display Materials and Photoelectric Devices, Ministry of Education, Tianjin 300384 (China); Tianjin Key Laboratory of Photoelectric Materials and Devices, Tianjin 300384 (China)

    2017-08-15

    Highlights: • Highly efficient blue fluorescent tandem OLEDs are fabricated. • The optimal tandem OLED consists of C{sub 60}/rubrene: MoO{sub 3} as a CGL and LiF/Al as an EIL. • Current efficiency and power efficiency of optimal tandem OLED is markedly enhanced. • The turn-on and driving voltages of optimal tandem OLED is obviously reduced. - Abstract: Tandem organic light-emitting diodes (OLEDs) have received much attention in solid-state lighting due to their high current efficiency, long lifetime and excellent stability. The highly efficient blue fluorescent tandem OLEDs based on the charge generation layer (CGL) of C{sub 60}/rubrene: MoO{sub 3} and the electron injection layer (EIL) of LiF/Al were fabricated. The ultra-thin Al layer in EIL was introduced to further increase electron injection from CGL to the emission unit. We found that the maximal current efficiency and power efficiency of optimal tandem device can reach to 43.1 cd/A and 15.1 lm/W, respectively, which are approximately 2.8 and 1.9 times compared with those of single-emissive-unit device. Moreover, compared with the traditional tandem device, the driving voltage of the optimal device is reduced by 6 V, and the turn-on voltage is reduced by 2.4 V. We analyzed the mechanism and characterization of these tandem devices. The effective charge separation and transport of C{sub 60}/rubrene: MoO{sub 3}, and excellent electron injection ability of ultra-thin Al layer are the main factors for the remarkable enhancement in both current efficiency and power efficiency of tandem OLEDs.

  7. Spectral Properties of Dyes with Interfragmental Charge Transfer: Solvatochromism and Solvatofluorochromism of 2-(3-Coumaroyl-benzopyrylium Perchlorates

    Directory of Open Access Journals (Sweden)

    Edward V. Sanin

    2014-01-01

    Full Text Available The paper deals with the spectral properties of dyes with interfragmental charge transfer, in particular, derivatives of 2-(3-coumaroylbenzopyrylium (CBP perchlorates. The positions of long-wavelength absorption and emission bands, quantum yields, and lifetimes of fluorescence were measured, mostly in aprotic solvents. Regression analysis of the relationship between the spectral characteristics of CBP and the main solvent parameters (polarity, polarisability, nucleophilicity, and electrophilicity was carried out. It was found that the characteristics of CBP depend mainly on two solvent parameters—polarity and/or nucleophilicity. An increase in these parameters results in a hypsochromic shift of absorption bands and a decrease of lifetimes and fluorescence intensity. The positions of the emission bands can demonstrate either hypsochromism or bathochromism, depending on the nature of the substituents. The solvatofluorochromic effects are not as strong as the solvatochromic ones. We believe that the spectral behaviour of CBP can be explained by cation depolarisation and by a decrease in the stability of nucleophilic complexes with solvent molecules that is associated with interfragmental charge transfer following excitation, relaxation, and radiative deactivation of the excited state.

  8. Concentration Dependence of Luminescent Properties for Sr2TiO4:Eu3+ Red Phosphor and Its Charge Compensation

    Directory of Open Access Journals (Sweden)

    Zhou Lu

    2012-01-01

    Full Text Available Sr2TiO4:Eu3+ phosphors using M+ (M = Li+, Na+, and K+ as charge compensators were prepared by the solid-state reaction. The powders were investigated by powder X-ray diffraction (XRD and photoluminescence spectra (PL to study the phase composition, structure, and luminescent properties. The results showed that Li+ ion was the best charge compensator. The phase was Sr2TiO4 when the doping concentration was small (x≤10.0%. When x reached 15.0%, the phase turned into Sr3Ti3O7 because of the structure damage. The phosphor could be effectively excited by ultraviolet (365, 395 nm and blue light (465 nm, and thenitemitted intense red light that peaked at around 620 nm (5D0→7F2. In addition, the emission of 700 nm (5D0→7F4 enhanced the red light color purity. The CIE chromaticity coordinates of samples with the higher red emission were between (0.650, 0.344 and (0.635, 0.352. Doped layered titanate Sr2TiO4:Eu3+ is a promising candidate red phosphor for white LEDs which can be suited for both near-UV LED chip and blue LED chip.

  9. High performance organic integrated device with ultraviolet photodetective and electroluminescent properties consisting of a charge-transfer-featured naphthalimide derivative

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Hanyu; Wang, Xu; Yu, Junsheng, E-mail: luzhiyun@scu.edu.cn, E-mail: jsyu@uestc.edu.cn [State Key Laboratory of Electronic Thin Films and Integrated Devices, School of Optoelectronic Information, University of Electronic Science and Technology of China, Chengdu 610054 (China); Zhou, Jie; Lu, Zhiyun, E-mail: luzhiyun@scu.edu.cn, E-mail: jsyu@uestc.edu.cn [College of Chemistry, Sichuan University, Chengdu 610064 (China)

    2014-08-11

    A high performance organic integrated device (OID) with ultraviolet photodetective and electroluminescent (EL) properties was fabricated by using a charge-transfer-featured naphthalimide derivative of 6-(3,5-bis-[9-(4-t-butylphenyl)-9H-carbazol-3-yl]-phenoxy)-2- (4-t-butylphenyl)-benzo[de]isoquinoline-1,3-dione (CzPhONI) as the active layer. The results showed that the OID had a high detectivity of 1.5 × 10{sup 11} Jones at −3 V under the UV-350 nm illumination with an intensity of 0.6 mW/cm{sup 2}, and yielded an exciplex EL light emission with a maximum brightness of 1437 cd/m{sup 2}. Based on the energy band diagram, both the charge transfer feature of CzPhONI and matched energy level alignment were responsible for the dual ultraviolet photodetective and EL functions of OID.

  10. First results on the charge collection properties of segmented detectors made with p-type bulk silicon

    International Nuclear Information System (INIS)

    Casse, G.; Allport, P.P.; Bowcock, T.J.V.; Greenall, A.; Hanlon, M.; Jackson, J.N.

    2002-01-01

    Radiation damage of n-type bulk detectors introduces stable defects acting as effective p-type doping and leads to the change of the conductivity type of the silicon substrate (type inversion) after a fluence of a few times 10 13 protons cm -2 . The diode junction after inversion migrates from the original side to the back plane of the detector. The migration of the junction can be prevented using silicon detectors with p-type substrates. Furthermore, the use of n-side readout gives higher charge collection efficiency for segmented devices operated below the full depletion voltage. Large area (∼6.4x6.4 cm 2 ) capacitively coupled 80 μm pitch detectors using polysilicon bias resistors have been fabricated on p-type substrates (n-in-p diode structure). These detectors have been irradiated with 24 GeV/c protons to an integrated fluence of 3x10 14 cm -2 and kept for 7 days at 25 deg. C to reach the broad minimum of the annealing curve. Results are presented on the comparison of their charge collection properties with detectors using p-strip read-out after corresponding dose and annealing

  11. Triphenylamine-Thienothiophene Organic Charge-Transport Molecular Materials: Effect of Substitution Pattern on their Thermal, Photoelectrochemical, and Photovoltaic Properties.

    Science.gov (United States)

    Le, Thi Huong; Dao, Quang-Duy; Nghiêm, Mai-Phuong; Péralta, Sébastien; Guillot, Regis; Pham, Quoc Nghi; Fujii, Akihiko; Ozaki, Masanori; Goubard, Fabrice; Bui, Thanh-Tuân

    2018-04-25

    Two readily accessible thienothiophene-triphenylamine charge-transport materials have been synthesized by simply varying the substitution pattern of the triphenylamine groups on a central thienothiophene π-linker. The impact of the substitution pattern on the thermal, photoelectrochemical, and photovoltaic properties of these materials was evaluated and, based on theoretical and experimental studies, we found that the isomer in which the triphenylamine groups were located at the 2,5-positions of the thienothiophene core (TT-2,5-TPA) had better π-conjugation than the 3,6-isomer (TT-3,6-TPA). Whilst the thermal, morphological, and hydrophobic properties of the two materials were similar, their optoelectrochemical and photovoltaic properties were noticeably impacted. When applied as hole-transport materials in hybrid perovskite solar cells, the 2,5-isomer exhibited a power-conversion efficiency of 13.6 %, much higher than that of its 3,6-counterpart (0.7 %) under the same standard conditions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. RNS60, a charge-stabilized nanostructure saline alters Xenopus Laevis oocyte biophysical membrane properties by enhancing mitochondrial ATP production

    Science.gov (United States)

    Choi, Soonwook; Yu, Eunah; Kim, Duk-Soo; Sugimori, Mutsuyuki; Llinás, Rodolfo R

    2015-01-01

    We have examined the effects of RNS60, a 0.9% saline containing charge-stabilized oxygen nanobubble-based structures. RNS60 is generated by subjecting normal saline to Taylor–Couette–Poiseuille (TCP) flow under elevated oxygen pressure. This study, implemented in Xenopus laevis oocytes, addresses both the electrophysiological membrane properties and parallel biological processes in the cytoplasm. Intracellular recordings from defolliculated X. laevis oocytes were implemented in: (1) air oxygenated standard Ringer's solution, (2) RNS60-based Ringer's solution, (3) RNS10.3 (TCP-modified saline without excess oxygen)-based Ringer's, and (4) ONS60 (saline containing high pressure oxygen without TCP modification)-based Ringer's. RNS60-based Ringer's solution induced membrane hyperpolarization from the resting membrane potential. This effect was prevented by: (1) ouabain (a blocker of the sodium/potassium ATPase), (2) rotenone (a mitochondrial electron transfer chain inhibitor preventing usable ATP synthesis), and (3) oligomycin A (an inhibitor of ATP synthase) indicating that RNS60 effects intracellular ATP levels. Increased intracellular ATP levels following RNS60 treatment were directly demonstrated using luciferin/luciferase photon emission. These results indicate that RNS60 alters intrinsic the electrophysiological properties of the X. laevis oocyte membrane by increasing mitochondrial-based ATP synthesis. Ultrastructural analysis of the oocyte cytoplasm demonstrated increased mitochondrial length in the presence of RNS60-based Ringer's solution. It is concluded that the biological properties of RNS60 relate to its ability to optimize ATP synthesis. PMID:25742953

  13. Mechanical and charge transport properties of alkanethiol self-assembled monolayers on Au (111) surface: The Role of Molecular Tilt

    Energy Technology Data Exchange (ETDEWEB)

    Mulleregan, Alice; Qi, Yabing; Ratera, Imma; Park, Jeong Y.; Ashby, Paul D.; Quek, Su Ying; Neaton, J. B.; Salmeron, Miquel

    2007-11-12

    The relationship between charge transport and mechanical properties of alkanethiol self-assembled monolayers (SAM) on Au(111) films has been investigated using an atomic force microscope with a conductive tip. Molecular tilts induced by the pressure applied by the tip cause stepwise increases in film conductivity. A decay constant {beta} = 0.57 {+-} 0.03 {angstrom}{sup -1} was found for the current passing through the film as a function of tip-substrate separation due to this molecular tilt. This is significantly smaller than the value of {approx} 1 {angstrom}{sup -1} found when the separation is changed by changing the length of the alkanethiol molecules. Calculations indicate that for isolated dithiol molecules S-bonded to hollow sites, the junction conductance does not vary significantly as a function of molecular tilt. The impact of S-Au bonding on SAM conductance is discussed.

  14. Simulation of trapping properties of high κ material as the charge storage layer for flash memory application

    International Nuclear Information System (INIS)

    Yeo, Yee Ngee; Wang Yingqian; Samanta, Santanu Kumar; Yoo, Won Jong; Samudra, Ganesh; Gao, Dongyue; Chong, Chee Ching

    2006-01-01

    We investigated the trapping properties of high κ material as the charge storage layer in non-volatile flash memory devices using a two-dimensional device simulator, Medici. The high κ material is sandwiched between two silicon oxide layers, resulting in the Silicon-Oxide-High κ-Oxide-Silicon (SOHOS) structure. The trap energy levels of the bulk electron traps in high κ material were determined. The programming and erasing voltage and time using Fowler Nordheim tunneling were estimated by simulation. The effect of deep level traps on erasing was investigated. Also, the effect of bulk traps density, thickness of block oxide and thickness of high κ material on the threshold voltage of the device was simulated

  15. Charge transport properties of carbazole dendrimers in organic field-effect transistors

    Science.gov (United States)

    Mutkins, Karyn; Chen, Simon S. Y.; Aljada, Muhsen; Powell, Ben J.; Olsen, Seth; Burn, Paul L.; Meredith, Paul

    2011-10-01

    We report three generations of p-type dendrimer semiconductors comprised of spirobifluorene cores, carbazole branching units and fluorene surface groups for use in organic field-effect transistors (OFETs). The group of dendrimers are defined by their generation and noted as SBF-(Gx)2, where x is the generation. Top contact-bottom gate OFETs were fabricated by spin-coating the dendrimers onto an n-octyltrichlorosilane (OTS) passivated silicon dioxide surface. The dendrimer films were found to be amorphous. The highest mobility was measured for the first generation dendrimer (SBF-(G1)2), which had an average mobility of (6.6 +/- 0.2) × 10-5 cm2/V s and an ON/OFF ratio of 3.0 × 104. As the generation of the dendrimer was increased there was only a slight decrease in the measured mobility in spite of the significantly different molecular sizes of the dendrimers. The mobility of SBF-(G3)2, which had a hydrodynamic radius almost twice of SBF-(G1)2, still had an average mobility of (4.7 +/- 0.6) × 10-5 cm2/V s and an ON/OFF ratio of 2.7 × 103. Density functional theory calculations showed that the highest occupied molecular orbital was distributed over the core and carbazole units meaning that both intra- and intermolecular charge transfer could occur enabling the hole mobility to remain essentially constant even though the dendrimers would pack differently in the solid-state.

  16. Increased charge storage capacity of titanium nitride electrodes by deposition of boron-doped nanocrystalline diamond films

    DEFF Research Database (Denmark)

    Meijs, Suzan; McDonald, Matthew; Sørensen, Søren

    2015-01-01

    The aim of this study was to investigate the feasibility of depositing a thin layer of boron-doped nanocrystalline diamond (B-NCD) on titanium nitride (TiN) coated electrodes and the effect this has on charge injection properties. The charge storage capacity increased by applying the B-NCD film...

  17. Effects of hydrogen-charging on the properties of S235JR steel

    Science.gov (United States)

    Pietkun-Greber, Izabela

    2017-10-01

    The paper presents the test results of the S235JR steel susceptibility to damage under the influence of hydrogen. The test of mechanical properties was performed on the basis of a static stretch test of non-hydrogenated samples and after cathodic polarization. Electrochemical measurements for the assessment of corrosion resistance of non-hydrogenated and hydrogenated steels were carried out using open circuit potential measurement and registering of potentiodynamic polarization curves in a three-electrode measuring system. Hydrogenation was carried out for between 3 and 24 hours in a solution of 0.1 N sulfuric acid (VI) with the addition of 2 mg/dm 3 of arsenic oxide (III) at an electric current density of 10 mA/cm2. The hydrogen content in the steel before and after saturation with hydrogen was determined using the analyzer. Fracture samples after tensile test were observed using scanning electron microscope. The results of the research showed that as the hydrogen concentration in the examined steel increased (the lengthening of the saturation time), the deterioration of its mechanical and electrochemical properties occurred.

  18. Electro-optical properties of a polymer light-emitting diode with an injection-limited hole contact

    NARCIS (Netherlands)

    van Woudenbergh, T; Blom, PWM; Huiberts, JN

    2003-01-01

    The electro-optical characteristics of a polymer light-emitting diode with a strongly reduced hole injection have been investigated. A silver contact on poly-dialkoxy-p-phenylene vinylene decreases the hole injection by five orders of magnitude, resulting in both a highly reduced light output and

  19. Antioxidant Properties of Astaxanthin in Oil-in-Water Emulsions with Differently-Charged Emulsifiers Under Chlorophyll Photosensitization.

    Science.gov (United States)

    Yi, BoRa; Kim, Mi-Ja; Lee, JaeHwan

    2018-03-01

    The antioxidative or prooxidative properties of astaxanthin at the concentrations of 0, 10, and 100 μM were determined in oil-in-water (O/W) emulsions containing neutral, anionic, and cationic emulsifiers, which was Tween 20, sodium dodecyl sulfate, cetyltrimethylammonium bromide (CTAB), respectively, under chlorophyll photosensitization. The oxidative parameters and headspace volatiles were analyzed in O/W emulsions. In the 24 h period of visible light irradiation, 100 μM of astaxanthin acted as an antioxidant in O/W emulsions containing neutral and anionic emulsifiers. However, astaxanthin in O/W emulsions with a cationic emulsifier was neither an antioxidant nor a prooxidant. The profiles of volatile compounds showed that astaxanthin served as a singlet oxygen quencher in O/W emulsions containing neutral and anionic emulsifiers. However, in O/W emulsion with a cationic emulsifier, astaxanthin was neither a singlet oxygen quencher nor a free radical scavenger because prooxidant properties of CTAB overwhelmed the antioxidant effects of astaxanthin. Therefore, the antioxidant properties of astaxanthin were influenced by the emulsifier charges in O/W emulsions. Astaxanthin is a lipid-soluble pigment and has antioxidant, anticancer, and anti-inflammatory properties and beneficial effects on cardiovascular diseases. Many lipid-based foods are displayed on the shelves in the markets under fluorescent light. The addition of astaxanthin can extend the shelf life of O/W emulsion type foods such as beverage and dressing products under visible light irradiation. Also, oxidative stability in emulsion type foods containing astaxanthin rich natural ingredients can be predicted. © 2018 Institute of Food Technologists®.

  20. Injection and temporary capture of a charged particle beam in an open magnetic configuration. Optimization of the configuration. Case of cylindrical symmetry: A mirror machine; Etude de l'injection et de la capture temporaire d'un faisceau de particules chargees dans une configuration magnetique ouverte. Optimisation de la configuration. Cas de la symetrie de revolution: Machine a miroirs

    Energy Technology Data Exchange (ETDEWEB)

    Capdequi-Peyranere, P [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

    1966-12-01

    A study has been made of a new method of transverse injection of charged particles into a magnetic mirror configuration. This injection scheme permits the penetration and temporary capture by non-adiabatic effect of a particle beam of approximately 1 cm{sup 2} cross-section. A theoretical study of the injection and capture is made in the approximation that space charge is negligible. The original programs for IBM 7094 computer calculations are described; these programs were used to obtain an optimization of the configuration. The results of a statistical numerical study of the optimum configuration are then given. This study indicates that, if the energy of the particles of the beam is about 1 per cent greater than a minimum penetration energy, the entire beam can be captured with an average capture length of 100 meters (50 reflections between the two mirrors). If the energy is about 4 per cent greater than the minimum penetration energy, the capture length is reduced to 40 meters. We have studied the distribution of energy transverse and longitudinal with the magnetic field for the population of captured particles. For the cases of injected molecular hydrogen ions or heavy CH{sub 4}{sup +} ions, a study is made of the capture time of protons resulting from the dissociation of the ions by collisions with the neutral gas. Finally, we describe a model experiment using electrons designed to provide an experimental verification of the capture of the primary beam. (author) [French] On etudie un nouveau schema d'injection transversale de particules chargees dans une configuration magnetique a miroirs. Ce mode d'injection permet la penetration et la capture temporaire par effet non adiabatique d'un faisceau de particules presentant une section de l'ordre de 1 cm{sup 2}. Une etude theorique du probleme de l'injection et de la capture est faite en supposant la charge d'espace negligeable. On decrit des programmes originaux de calcul sur ordinateur IBM 7094 permettant l

  1. Two-column sequential injection chromatography for fast isocratic separation of two analytes of greatly differing chemical properties.

    Science.gov (United States)

    Šatínský, Dalibor; Chocholouš, Petr; Válová, Olga; Hanusová, Lucia; Solich, Petr

    2013-09-30

    This paper deals with a novel approach to separate two analytes with different chemical properties and different lipophilicity. The newly described methodology is based on the two column system that was used for isocratic separation of two analytes with very different lipophilicity-dexamethasone and cinchocaine. Simultaneous separation of model compounds cinchocaine and dexamethasone was carried under the following conditions in two-column sequential injection chromatography system (2-C SIC). A 25×4.6 mm C-18 monolithic column was used in the first dimension for retention and separation of dexamethasone with mobile phase acetonitrile:water 30:70 (v/v), flow rate 0.9 mL min(-1) and consumption of 1.7 mL. A 10×4.6 mm C-18 monolithic column with 5×4.6 mm C-18 precolumn was used in the second dimension for retention and separation of cinchocaine using mobile phase acetonitrile:water 60:40 (v/v), flow rate 0.9 mL min(-1) and consumption 1.5 mL. Whole analysis time including both mobile phase's aspirations and both column separations was performed in less than 4 min. The method was fully validated and used for determination of cinchocaine and dexamethasone in pharmaceutical otic drops. The developed 2-C SIC method was compared with HPLC method under the isocratic conditions of separation on monolithic column (25×4.6 mm C-18). Spectrophotometric detection of both compounds was performed at wavelength 240 nm. System repeatability and method precision were found in the range (0.39-3.12%) for both compounds. Linearity of determination was evaluated in the range 50-500 μg mL(-1) and coefficients of determination were found to be r(2)=0.99912 for dexamethasone and r(2)=0.99969 for cinchocaine. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Osteogenesis and angiogenesis properties of dental pulp cell on novel injectable tricalcium phosphate cement by silica doped.

    Science.gov (United States)

    Su, Ying-Fang; Lin, Chi-Chang; Huang, Tsui-Hsien; Chou, Ming-Yung; Yang, Jaw-Ji; Shie, Ming-You

    2014-09-01

    β-Tricalcium phosphate (β-TCP) is an osteoconductive material in clinical. In this study, we have doped silica (Si) into β-TCP and enhanced its bioactive and osteostimulative properties. To check its effectiveness, a series of Si-doped with different ratios were prepared to make new bioactive and biodegradable biocomposites for bone repair. Formation of the diametral tensile strength, ions released and weight loss of cements was considered after immersion. In addition, we also examined the behavior of human dental pulp cells (hDPCs) cultured on Si-doped β-TCP cements. The results showed that setting time and injectability of the Si-doped β-TCP cements were decreased as the Si content was increased. At the end of the immersion point, weight losses of 30.1%, 36.9%, 48.1%, and 55.3% were observed for the cement doping 0%, 10%, 20%, and 30% Si into β-TCP cements, respectively. In vitro cell experiments show that the Si-rich cements promote human dental pulp cell (hDPC) proliferation and differentiation. However, when the Si-doped in the cement is more than 20%, the amount of cells and osteogenesis protein of hDPCs was stimulated by Si released from Si-doped β-TCP cements. The degradation of β-TCP and osteogenesis of Si gives a strong reason to believe that these Si-doped β-TCP cements may prove to be promising bone repair materials. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Osteogenesis and angiogenesis properties of dental pulp cell on novel injectable tricalcium phosphate cement by silica doped

    Energy Technology Data Exchange (ETDEWEB)

    Su, Ying-Fang [Institute of Medicine, Chung Shan Medical University, Taichung, Taiwan (China); Department of Stomatology, Chung Shan Medical University Hospital, Taichung, Taiwan (China); School of Dentistry, Chung Shan Medical University, Taichung, Taiwan (China); Lin, Chi-Chang, E-mail: chichang31@gmail.com [Department of Anatomy, Chung Shan Medical University, Taichung City, Taiwan (China); Huang, Tsui-Hsien; Chou, Ming-Yung [Department of Stomatology, Chung Shan Medical University Hospital, Taichung, Taiwan (China); School of Dentistry, Chung Shan Medical University, Taichung, Taiwan (China); Yang, Jaw-Ji, E-mail: jjyang@csmu.edu.tw [Department of Chemical and Materials Engineering, Tunghai University, Taichung, Taiwan (China); Shie, Ming-You, E-mail: eviltacasi@gmail.com [Department of Anatomy, Chung Shan Medical University, Taichung City, Taiwan (China)

    2014-09-01

    β-Tricalcium phosphate (β-TCP) is an osteoconductive material in clinical. In this study, we have doped silica (Si) into β-TCP and enhanced its bioactive and osteostimulative properties. To check its effectiveness, a series of Si-doped with different ratios were prepared to make new bioactive and biodegradable biocomposites for bone repair. Formation of the diametral tensile strength, ions released and weight loss of cements was considered after immersion. In addition, we also examined the behavior of human dental pulp cells (hDPCs) cultured on Si-doped β-TCP cements. The results showed that setting time and injectability of the Si-doped β-TCP cements were decreased as the Si content was increased. At the end of the immersion point, weight losses of 30.1%, 36.9%, 48.1%, and 55.3% were observed for the cement doping 0%, 10%, 20%, and 30% Si into β-TCP cements, respectively. In vitro cell experiments show that the Si-rich cements promote human dental pulp cell (hDPC) proliferation and differentiation. However, when the Si-doped in the cement is more than 20%, the amount of cells and osteogenesis protein of hDPCs was stimulated by Si released from Si-doped β-TCP cements. The degradation of β-TCP and osteogenesis of Si gives a strong reason to believe that these Si-doped β-TCP cements may prove to be promising bone repair materials. - Highlights: • The higher the Si in the cement, the shorter the setting time and the higher the DTS. • Si20-doped in TCP improved cell adhesion, proliferation and differentiation. • The Si ion stimulated collagen secreted from cells. • The Si released from substrate can promote osteogenic and angiogenic.

  4. Graphene: A membrane with steadily improving charge and spin transport properties

    Science.gov (United States)

    Beschoten, Bernd

    Long electron spin lifetimes are an important prerequisite for enabling advanced spintronic devices. In this respect the 1-ns benchmark is of high technological interest as it marks the threshold at which manipulation of spins with electrical high frequency technology becomes feasible (1 ns 1 GHz). For a long time, the measured spin lifetimes were shorter than 1 ns. Here we report on a major improvement in device fabrication which pushes the spin lifetimes to 12.6 ns in single layer graphene spin transport devices at room temperature which results in spin diffusion lengths as long as 30.5 μm. This is accomplished by the fabrication of Co/MgO-electrodes on a Si/SiO2 substrate and the subsequent dry transfer of a graphene/hexagonal boron nitride (hBN) stack on top of this electrode structure where a large hBN flake is needed in order to diminish the ingress of solvents along the hBN-to-substrate interface. We demonstrate that the spin lifetime does not depend on the contact resistance area products in these devices, indicating that spin absorption at the contacts is not the predominant source for spin dephasing which may pave the way towards probing intrinsic spin properties of graphene. In the second part, we summarize our effort to replace natural by synthetically grown graphene. We report on an advanced transfer technique that allows both reusing the copper substrate of the CVD graphene growth process and making devices with carrier mobilities as high as three million cm2/(Vs) thus rivaling exfoliated ''natural'' graphene. This material quality allows truly ballistic experiments with electron mean free paths exceeding 28 μm which brings novel electron-optic devices into reach. In collaboration with M. Drögeler, C. Franzen, F. Volmer, L. Banszerus, M. Schmitz, S. Engels, J. Dauber, M. Goldsche, M. Oellers, T. Pohlmann, M. Wolter, F. Haupt, K. Watanabe, T. Taniguchi, and C. Stampfer.

  5. BiOI/TiO{sub 2}-nanorod array heterojunction solar cell: Growth, charge transport kinetics and photoelectrochemical properties

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lingyun; Daoud, Walid A., E-mail: wdaoud@cityu.edu.hk

    2015-01-01

    Highlights: • BiOI/TiO{sub 2} photoanodes were fabricated by a simple solvothermal/hydrothermal method. • BiOI/TiO{sub 2} (PVP) showed a 13-fold increase in photocurrent density compared to TiO{sub 2}. • Charge transport kinetics within the BiOI/TiO{sub 2} heterojunctions are discussed. - Abstract: A series of BiOI/TiO{sub 2}-nanorod array photoanodes were grown on fluorine-doped tin oxide (FTO) glass using a simple two-step solvothermal/hydrothermal method. The effects of the hydrothermal process, such as TiO{sub 2} nanorod growth time, BiOI concentration and the role of surfactant, polyvinylpyrrolidone (PVP), on the growth of BiOI, were investigated. The heterojunctions were characterized by X-ray diffraction, UV–vis absorbance spectroscopy and scanning electron microscopy. The photoelectrochemical properties of the as-grown junctions, such as linear sweep voltammetry (LSV) behavior, photocurrent response and incident photon-to-electron conversion efficiency (IPCE) under Xenon lamp illumination, are presented. The cell with BiOI/TiO{sub 2} (PVP) as photoanode can reach a short current density (J{sub sc}) of 0.13 mA/cm{sup 2} and open circuit voltage (V{sub oc}) of 0.46 V vs. Ag/AgCl under the irradiation of a 300 W Xenon lamp. Compared to bare TiO{sub 2}, the IPCE of BiOI/TiO{sub 2} (PVP) increased 4–5 times at 380 nm. Furthermore, the charge transport kinetics within the heterojunction is also discussed.

  6. BiOI/TiO2-nanorod array heterojunction solar cell: Growth, charge transport kinetics and photoelectrochemical properties

    International Nuclear Information System (INIS)

    Wang, Lingyun; Daoud, Walid A.

    2015-01-01

    Highlights: • BiOI/TiO 2 photoanodes were fabricated by a simple solvothermal/hydrothermal method. • BiOI/TiO 2 (PVP) showed a 13-fold increase in photocurrent density compared to TiO 2 . • Charge transport kinetics within the BiOI/TiO 2 heterojunctions are discussed. - Abstract: A series of BiOI/TiO 2 -nanorod array photoanodes were grown on fluorine-doped tin oxide (FTO) glass using a simple two-step solvothermal/hydrothermal method. The effects of the hydrothermal process, such as TiO 2 nanorod growth time, BiOI concentration and the role of surfactant, polyvinylpyrrolidone (PVP), on the growth of BiOI, were investigated. The heterojunctions were characterized by X-ray diffraction, UV–vis absorbance spectroscopy and scanning electron microscopy. The photoelectrochemical properties of the as-grown junctions, such as linear sweep voltammetry (LSV) behavior, photocurrent response and incident photon-to-electron conversion efficiency (IPCE) under Xenon lamp illumination, are presented. The cell with BiOI/TiO 2 (PVP) as photoanode can reach a short current density (J sc ) of 0.13 mA/cm 2 and open circuit voltage (V oc ) of 0.46 V vs. Ag/AgCl under the irradiation of a 300 W Xenon lamp. Compared to bare TiO 2 , the IPCE of BiOI/TiO 2 (PVP) increased 4–5 times at 380 nm. Furthermore, the charge transport kinetics within the heterojunction is also discussed

  7. Surface structure, optoelectronic properties and charge transport in ZnO nanocrystal/MDMO-PPV multilayer films.

    Science.gov (United States)

    Lian, Qing; Chen, Mu; Mokhtar, Muhamad Z; Wu, Shanglin; Zhu, Mingning; Whittaker, Eric; O'Brien, Paul; Saunders, Brian R

    2018-05-07

    Blends of semiconducting nanocrystals and conjugated polymers continue to attract major research interest because of their potential applications in optoelectronic devices, such as solar cells, photodetectors and light-emitting diodes. In this study we investigate the surface structure, morphological and optoelectronic properties of multilayer films constructed from ZnO nanocrystals (NCs) and poly[2-methoxy-5-(3',7'-dimethyloctyloxy)-1,4-phenylenevinylene] (MDMO-PPV). The effects of layer number and ZnO concentration (C ZnO ) used on the multilayer film properties are investigated. An optimised solvent blend enabled well-controlled layers to be sequentially spin coated and the construction of multilayer films containing six ZnO NC (Z) and MDMO-PPV (M) layers (denoted as (ZM) 6 ). Contact angle data showed a strong dependence on C ZnO and indicated distinct differences in the coverage of MDMO-PPV by the ZnO NCs. UV-visible spectroscopy showed that the MDMO-PPV absorption increased linearly with the number of layers in the films and demonstrates highly tuneable light absorption. Photoluminescence spectra showed reversible quenching as well as a surprising red-shift of the MDMO-PPV emission peak. Solar cells were constructed to probe vertical photo-generated charge transport. The measurements showed that (ZM) 6 devices prepared using C ZnO = 14.0 mg mL -1 had a remarkably high open circuit voltage of ∼800 mV. The device power conversion efficiency was similar to that of a control bilayer device prepared using a much thicker MDMO-PPV layer. The results of this study provide insight into the structure-optoelectronic property relationships of new semiconducting multilayer films which should also apply to other semiconducting NC/polymer combinations.

  8. Testosterone Injection

    Science.gov (United States)

    ... typical male characteristics. Testosterone injection works by supplying synthetic testosterone to replace the testosterone that is normally ... as a pellet to be injected under the skin.Testosterone injection may control your symptoms but will ...

  9. Effects of Packing Structure on the Optoelectronic and Charge Transport Properties in Poly(9,9-di-n-octylfluorene-alt-benzothiadiazole)

    DEFF Research Database (Denmark)

    Donley, C.L.; Zaumseil, J.; Andreasen, Jens Wenzel

    2005-01-01

    on the optoelectronic and charge transport properties of these films. A model based on quantum chemical calculations, wide-angle X-ray scattering, atomic force microscopy, Raman spectroscopy, photoluminescence, and electron mobility measurements was developed to describe the restructuring of the polymer film...

  10. Transport and Fatigue Properties of Ferroelectric Polymer P(VDF-TrFE) For Nonvolatile Memory Applications

    KAUST Repository

    Hanna, Amir

    2012-01-01

    injection and transport are believed to affect various properties of ferroelectric films such as remnant polarization values and polarization fatigue behavior.. Thus, this thesis aims to study charge injection in P(VDF-TrFE) and its transport properties as a

  11. Design and properties of silicon charged-particle detectors developed at the Institute of Electron Technology (ITE)

    Science.gov (United States)

    Wegrzecki, Maciej; Bar, Jan; Budzyński, Tadeusz; CieŻ, Michal; Grabiec, Piotr; Kozłowski, Roman; Kulawik, Jan; Panas, Andrzej; Sarnecki, Jerzy; Słysz, Wojciech; Szmigiel, Dariusz; Wegrzecka, Iwona; Wielunski, Marek; Witek, Krzysztof; Yakushev, Alexander; Zaborowski, Michał

    2013-07-01

    The paper discusses the design of charged-particle detectors commissioned and developed at the Institute of Electron Technology (ITE) in collaboration with foreign partners, used in international research on transactinide elements and to build personal radiation protection devices in Germany. Properties of these detectors and the results obtained using the devices are also presented. The design of the following epiplanar detector structures is discussed: ♢ 64-element chromatographic arrays for the COMPACT (Cryo On-line Multidetector for Physics And Chemistry of Transactinides) detection system used at the GSI Helmholtzzentrum für Schwerionenforschung in Darmstadt (GSI) for research on Hassium, Copernicium and Flerovium, as well as elements 119 and 120, ♢ 2-element flow detectors for the COLD (Cryo On-Line Detector) system used for research on Copernicium and Flerovium at the Joint Institute for Nuclear Research, Dubna, ♢ detectors for a radon exposimeter and sensors for a neutron dosimeter developed at the Institut für Strahlenschutz, Helmholtz Zentrum München. The design of planar detectors - single-sided and double-sided strip detectors for the Focal Plane Detector Box used at GSI for research on Flerovium and elements 119 and 120 is also discussed.

  12. Evaluation of the Intramolecular Charge-Transfer Properties in Solvatochromic and Electrochromic Zinc Octa(carbazolyl)phthalocyanines.

    Science.gov (United States)

    Majeed, Shereen A; Ghazal, Basma; Nevonen, Dustin E; Goff, Philip C; Blank, David A; Nemykin, Victor N; Makhseed, Saad

    2017-10-02

    2,3,9,10,16,17,23·24-Octakis-(9H-carbazol-9-yl) phthalocyaninato zinc(II) (3) and 2,3,9,10,16,17,23·24-octakis-(3,6-di-tert-butyl-9H-carbazole) phthalocyaninato zinc(II) (4) complexes were prepared and characterized by NMR and UV-vis spectroscopies, magnetic circular dichroism (MCD), matrix-assisted laser desorption ionization mass spectrometry, and X-ray crystallography. UV-vis and MCD data are indicative of the interligand charge-transfer nature of the broad band observed in 450-500 nm range for 3 and 4. The redox properties of 3 and 4 were probed by electrochemical and spectro-electrochemical methods, which are suggestive of phthalocyanine-centered first oxidation and reduction processes. Photophysics of 3 and 4 were investigated by steady-state fluorescence and time-resolved transient absorption spectroscopy demonstrating the influence of the carbazole substituents on deactivation from the first excited state in 3 and 4. Protonation of the meso-nitrogen atoms in 3 results in much faster deactivation kinetics from the first excited state. Spectroscopic data were correlated with density functional theory (DFT) and time-dependent DFT calculations on 3 and 4.

  13. A comparitive investigation of electrochemical charge storage properties on β, γ, δ and λ-MnO2 nanoparticles

    Science.gov (United States)

    Shafi, P. Muhammed; Johnson, Chelsea; Bose, A. Chandra

    2018-04-01

    Manganese dioxide and Manganese dioxide based materials have long been used in various energy storage systems because of their outstanding electrochemical behavior, low cost, and environmental compatibility. In recent years, many studies had focused on its nano scale applications due to the structural flexibility and the unique physicochemical properties. The basic crystal structure of manganese dioxide configures of one manganese atom surrounded by six oxygen atoms to form an octahedron. Here β-MnO2, γ-MnO2, λ-MnO2 and δ-MnO2 nanoparticles have been successfully synthesized by simple precipitation methods. Powder X-Ray Diffraction (XRD) analyses were performed for the identification and examination of the crystalline phase structures. Presence of functional groups and purity of the sample were evaluated by Fourier Transform Infrared Spectroscopy (FTIR). Morphology studies were carried out via Scanning Electron Microscopy (SEM). Electrochemical performances of the β, γ and δ phases were characterized by cyclic voltammetry (CV), Galvanostatic Charge-Discharge (GCD) and Electrochemical Impedance Spectroscopy (EIS). Among the four electrodes, δ-MnO2 exhibited the highest value for specific capacitance. These results show that the prepared MnO2 electrodes are good materials for supercapacitor application, especially δ-MnO2.

  14. The charge-transfer property and the performance of dye-sensitized solar cells of nitrogen doped zinc oxide

    International Nuclear Information System (INIS)

    Zhang Lingyun; Yang Yulin; Fan Ruiqing; Chen Haiyan; Jia Ruokun; Wang Yonghui; Ma Liqun; Wang Yazhen

    2012-01-01

    Highlights: ► Two methods (the solution and annealing methods) are used to prepare nitrogen-doped ZnO. ► The charge-transfer properties of N-doping ZnO are investigated. ► The overall conversion efficiency of N-doped ZnO-based dye-sensitized solar cells is successfully improved by N doping. - Abstract: In this study two methods, namely the solution and annealing methods, were used to prepare nitrogen-doped ZnO. The X-ray photoelectron spectroscopy (XPS) was performed to identify the composition and chemical states of N-doped ZnO. The N doping by the solution method was found to effectively decrease the acceptor effects. Surface photovoltage measurements (SPS) revealed a redshift of the threshold wavelength for the N-doped ZnO. And the recombination of photoinduced electron–hole pairs in this semiconductor material was obviously suppressed. The N-doped ZnO (solution method) exhibits the best performances among all the materials, even superior to N-doped ZnO (annealing method). Its J sc and η values (9.35 mA/cm 2 and 2.64%) have enhanced by several times compared with un-doped ZnO (J sc , 2.85 mA/cm 2 ; η, 0.67%). The overall conversion efficiency of ZnO-based dye-sensitized solar cells was successfully improved by the N doping.

  15. Vibrational Spectra of β″-Type BEDT-TTF Salts: Relationship between Conducting Property, Time-Averaged Site Charge and Inter-Molecular Distance

    Directory of Open Access Journals (Sweden)

    Takashi Yamamoto

    2012-07-01

    Full Text Available The relationship between the conducting behavior and the degree of charge fluctuation in the β″-type BEDT-TTF salts is reviewed from the standpoints of vibrational spectroscopy and crystal structure. A group of β″-type ET salts demonstrates the best model compounds for achieving the above relationship because the two-dimensional structure is simple and great diversity in conducting behavior is realized under ambient pressure. After describing the requirement for the model compound, the methodology for analyzing the results of the vibrational spectra is presented. Vibrational spectroscopy provides the time-averaged molecular charge, the charge distribution in the two-dimensional layer, and the inter-molecular interactions, etc. The experimental results applied to 2/3-filled and 3/4-filled β″-type ET salts are reported. These experimental results suggest that the conducting property, the difference in the time-averaged molecular charges between the ionic and neutral-like sites, the alternation in the inter-molecular distances and the energy levels in the charge distributions are relevant to one another. The difference in the time-averaged molecular charges, ∆ρ, is a useful criterion for indicating conducting behavior. All superconductors presented in this review are characterized as small but finite ∆ρ.

  16. Tensile properties of helium-injected V-15Cr-5Ti after irradiation in EBR-II

    International Nuclear Information System (INIS)

    Grossbeck, M.L.; Horak, J.A.

    1985-01-01

    Miniature specimens of V-15Cr-5Ti were prepared in the annealed condition and with 10, 20, and 30% cold work. The annealed specimens were cyclotron injected with helium and irradiated in sodium in EBR-II. The cold-worked specimens were irradiated in EBR-II but not helium injected. The specimens were irradiated at 400, 525, 625, and 700 0 C and received a fluence of 4.1 to 5.5 x 10 26 neutrons/m 2 (E > 0.1 meV). Tensile testing revealed very significant embrittlement as a result of the neutron irradiation but a much smaller change, mostly at 400 0 C, resulting from helium injection. 5 references, 9 figures, 2 tables

  17. Impact of hydrogeological and geomechanical properties on surface uplift at a CO2 injection site: Parameter estimation and uncertainty quantification

    Science.gov (United States)

    Newell, P.; Yoon, H.; Martinez, M. J.; Bishop, J. E.; Arnold, B. W.; Bryant, S.

    2013-12-01

    It is essential to couple multiphase flow and geomechanical response in order to predict a consequence of geological storage of CO2. In this study, we estimate key hydrogeologic features to govern the geomechanical response (i.e., surface uplift) at a large-scale CO2 injection project at In Salah, Algeria using the Sierra Toolkit - a multi-physics simulation code developed at Sandia National Laboratories. Importantly, a jointed rock model is used to study the effect of postulated fractures in the injection zone on the surface uplift. The In Salah Gas Project includes an industrial-scale demonstration of CO2 storage in an active gas field where CO2 from natural gas production is being re-injected into a brine-filled portion of the structure downdip of the gas accumulation. The observed data include millimeter scale surface deformations (e.g., uplift) reported in the literature and injection well locations and rate histories provided by the operators. Our preliminary results show that the intrinsic permeability and Biot coefficient of the injection zone are important. Moreover pre-existing fractures within the injection zone affect the uplift significantly. Estimation of additional (i.e., anisotropy ratio) and coupled parameters will help us to develop models, which account for the complex relationship between mechanical integrity and CO2 injection-induced pressure changes. Uncertainty quantification of model predictions will be also performed using various algorithms including null-space Monte Carlo and polynomial-chaos expansion methods. This work will highlight that our coupled reservoir and geomechanical simulations associated with parameter estimation can provide a practical solution for designing operating conditions and understanding subsurface processes associated with the CO2 injection. This work is supported as part of the Center for Frontiers of Subsurface Energy Security, an Energy Frontier Research Center funded by the U.S. Department of Energy, Office

  18. Properties and parameters of the electron beam injected into the mirror magnetic trap of a plasma accelerator

    Energy Technology Data Exchange (ETDEWEB)

    Andreev, V. V., E-mail: temple18@mail.ru; Novitsky, A. A.; Vinnichenko, L. A.; Umnov, A. M.; Ndong, D. O. [Peoples’ Friendship University of Russia (Russian Federation)

    2016-03-15

    The parameters of the injector of an axial plasma beam injected into a plasma accelerator operating on the basis of gyroresonance acceleration of electrons in the reverse magnetic field are determined. The trapping of the beam electrons into the regime of gyroresonance acceleration is numerically simulated by the particle- in-cell method. The optimal time of axial injection of the beam into a magnetic mirror trap is determined. The beam parameters satisfying the condition of efficient particle trapping into the gyromagnetic autoresonance regime are found.

  19. Influence of dehydrated nanotubed titanic acid on charge transport and luminescent properties of polymer light-emitting diodes with fluorescent dye

    Science.gov (United States)

    Qian, Lei; Bera, Debasis; Jin, Zhen-Sheng; Du, Zu-Liang; Xu, Zheng; Teng, Feng; Liu, Wei

    2007-09-01

    In this paper, we discuss the influence of dehydrated nanotubed titanic acid (DNTA) on charge transport and luminescent properties of polymer light-emitting diodes (PLEDs) doped with fluorescent dye. Photoluminescence results confirm the efficient energy transfer from PVK to 4-(dicyanom-ethylene)-2- t-butyl-6-(1,1,7,7-tetramethyljulolidyl-9-enyl)-4H-pyran (DCJTB) and tris-(8-hydroxtquinoline) aluminum (Alq 3) in a DNTA-doped device. The device showed lower turn-on voltages and higher charge current by doping with DNTA, which also caused a shift in the exciton's recombination region.

  20. Effect of Viscosity and Polar Properties of Solvent on Dynamics of Photoinduced Charge Transfer in BTA-1 Cation — Derivative of Thioflavin T

    Science.gov (United States)

    Gogoleva, S. D.; Stsiapura, V. I.

    2018-05-01

    It was found that the spectral and fluorescent properties of BTA-1C cation in protic and aprotic solvents differ. It was shown that for solutions in long-chain alcohols viscosity is the main factor that determines the dynamics of intramolecular charge transfer in the excited state of the BTA-1C molecule. In the case of aprotic solvents a correlation was found between the rate constant of twisted intramolecular charge transfer (TICT) during rotation of fragments of the molecule in relation to each other in the excited state and the solvent relaxation rate: k TICT 1/τ S .

  1. Discriminative stimulus properties and brain distribution of phencyclidine in rats following administration by injection and smoke inhalation

    International Nuclear Information System (INIS)

    Wessinger, W.D.; Martin, B.R.; Balster, R.L.

    1985-01-01

    Four male Sprague-Dawley rats were trained to discriminate IP injections of 3.0 mg/kg phencyclidine (PCP) from saline under a 2-lever fixed-ratio 32 schedule of food presentation. After reliable discriminative control of lever choice was established, other doses of injected PCP were tested resulting in dose-dependent increases in PCP-lever selection and dose-dependent decreases in rates of responding. When doses of PCP were administered by exposure to smoke from cigarettes containing PCP, a dose-dependent increase in PCP-lever responding was also observed. delta 9-Tetrahydrocannabinol administered via smoke exposure, up to doses which markedly suppressed response rates, did not result in PCP-appropriate responding, demonstrating the specificity of the PCP stimulus by the inhalation route. Brain levels and distribution of 3 H-PCP were determined in rats administered doses calculated to result in 50% generalization by the IP injection or smoke inhalation routes. By both routes of administration roughly equivalent brain levels were attained and the distribution was relatively even across the seven brain areas analyzed. These results demonstrate the validity of using the injection route of administration when studying PCP experimentally, in spite of the fact that PCP is abused primarily by smoking

  2. Injection and waveguiding properties in SU8 nanotubes for sub-wavelength regime propagation and nanophotonics integration

    Science.gov (United States)

    Bigeon, John; Huby, Nolwenn; Duvail, Jean-Luc; Bêche, Bruno

    2014-04-01

    We report photonic concepts related to injection and sub-wavelength propagation in nanotubes, an unusual but promising geometry for highly integrated photonic devices. Theoretical simulation by the finite domain time-dependent (FDTD) method was first used to determine the features of the direct light injection and sub-wavelength propagation regime within nanotubes. Then, the injection into nanotubes of SU8, a photoresist used for integrated photonics, was successfully achieved by using polymer microlensed fibers with a sub-micronic radius of curvature, as theoretically expected from FDTD simulations. The propagation losses in a single SU8 nanotube were determined by using a comprehensive set-up and a protocol for optical characterization. The attenuation coefficient has been evaluated at 1.25 dB mm-1 by a cut-back method transposed to such nanostructures. The mechanisms responsible for losses in nanotubes were identified with FDTD theoretical support. Both injection and cut-back methods developed here are compatible with any sub-micronic structures. This work on SU8 nanotubes suggests broader perspectives for future nanophotonics.

  3. The effect of recombination under short-circuit conditions on the determination of charge transport properties in nanostructured photoelectrodes.

    Science.gov (United States)

    Villanueva-Cab, J; Anta, J A; Oskam, G

    2016-01-28

    We report on the commonly unaccounted for process of recombination under short-circuit conditions in nanostructured photoelectrodes with special attention to the charge collection efficiency. It is observed that when recombination under short circuit conditions is significant, small perturbation methods overestimate the charge-collection efficiency, which is related to the inaccurate determination of the electron diffusion coefficient and diffusion length.

  4. Optical, structural, and chemical properties of CR-39 implanted with 5.2 MeV doubly charged carbon ions

    Science.gov (United States)

    Ali, Dilawar; Butt, M. Z.; Ishtiaq, Mohsin; Waqas Khaliq, M.; Bashir, Farooq

    2016-11-01

    Poly-allyl-diglycol-carbonate (CR-39) specimens were irradiated with 5.2 MeV doubly charged carbon ions using Pelletron accelerator. Ion dose was varied from 5 × 1013 to 5 × 1015 ions cm-2. Optical, structural, and chemical properties were investigated by UV-vis spectroscopy, x-ray diffractometer, and FTIR/Raman spectroscopy, respectively. It was found that optical absorption increases with increasing ion dose. Absorption edge shifts from UV region to visible region. The measured opacity values of pristine and ion implanted CR-39 range from 0.0519 to 4.7959 mm-1 following an exponential growth (9141%) with the increase in ion dose. The values of direct and indirect band gap energy decrease exponentially with an increase in ion dose by 59% and 71%, respectively. However, average refractive index in the visible region increases from 1.443 to 2.864 with an increase in ion dose, by 98%. A linear relation between band gap energy and crystallite size was observed. Both the number of carbon atoms in conjugation length and the number of carbon atoms per cluster increase linearly with the increase in ion dose. FTIR spectra showed that on C+2 ions irradiation, the intensity of all bands decreases gradually without appearance of any new band, indicating degradation of polymer after irradiation. Raman spectra revealed that the density of -CH2- group decreases on C+2 ions irradiation. However, the structure of CR-39 is completely destroyed on irradiation with ion dose 1 × 1015 and 5 × 1015 ions cm-2.

  5. The charge-transfer property and the performance of dye-sensitized solar cells of nitrogen doped zinc oxide

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Lingyun [Department of Chemistry, Harbin Institute of Technology, Harbin 150001 (China); School of Chemical Engineering, Northeast Dianli University, Jilin 132012 (China); Yang Yulin, E-mail: ylyang@hit.edu.cn [Department of Chemistry, Harbin Institute of Technology, Harbin 150001 (China); Fan Ruiqing, E-mail: fanruiqing@hit.edu.cn [Department of Chemistry, Harbin Institute of Technology, Harbin 150001 (China); Chen Haiyan [Department of Chemistry, Harbin Institute of Technology, Harbin 150001 (China); Jia Ruokun [School of Chemical Engineering, Northeast Dianli University, Jilin 132012 (China); Wang Yonghui [Faculty of Chemistry, Northeast Normal University, Changchun, Jilin 130024 (China); Ma Liqun; Wang Yazhen [School of Material Science of Engineering, Qiqihar University, Qiqihar 161006 (China)

    2012-07-25

    Highlights: Black-Right-Pointing-Pointer Two methods (the solution and annealing methods) are used to prepare nitrogen-doped ZnO. Black-Right-Pointing-Pointer The charge-transfer properties of N-doping ZnO are investigated. Black-Right-Pointing-Pointer The overall conversion efficiency of N-doped ZnO-based dye-sensitized solar cells is successfully improved by N doping. - Abstract: In this study two methods, namely the solution and annealing methods, were used to prepare nitrogen-doped ZnO. The X-ray photoelectron spectroscopy (XPS) was performed to identify the composition and chemical states of N-doped ZnO. The N doping by the solution method was found to effectively decrease the acceptor effects. Surface photovoltage measurements (SPS) revealed a redshift of the threshold wavelength for the N-doped ZnO. And the recombination of photoinduced electron-hole pairs in this semiconductor material was obviously suppressed. The N-doped ZnO (solution method) exhibits the best performances among all the materials, even superior to N-doped ZnO (annealing method). Its J{sub sc} and {eta} values (9.35 mA/cm{sup 2} and 2.64%) have enhanced by several times compared with un-doped ZnO (J{sub sc}, 2.85 mA/cm{sup 2}; {eta}, 0.67%). The overall conversion efficiency of ZnO-based dye-sensitized solar cells was successfully improved by the N doping.

  6. Anisotropic Transport and Magnetic Properties of Charge-Density-Wave Materials RSeTe_2 (R = La, Ce, Pr, Nd)

    International Nuclear Information System (INIS)

    Wang Pei-Pei; Long Yu-Jia; Zhao Ling-Xiao; Chen Dong; Xue Mian-Qi; Chen Gen-Fu

    2015-01-01

    Single crystals of RSeTe_2 (R = La, Ce, Pr, Nd) are synthesized using LiCl/RbCl flux. Transport and magnetic properties in the directions parallel and perpendicular to the a–c plane are investigated. We find that the resistivity anisotropy ρ_⊥/ρ_‖ lies in the range 486–615 for different compounds at 2 K, indicating the highly two-dimensional character. In both the orientations, the charge-density-wave transitions start near T_C_D_W = 284(3) K, 316(3) K, 359(3) K for NdSeTe_2, PrSeTe_2, CeSeTe_2, respectively, with a considerable increase in dc resistivity. While for LaSeTe_2, no obvious resistivity anomaly is observed up to 380 K. The value of T_C_D_W increases monotonically with the increasing lattice parameters. Below T_C_D_W, slight anomalies can be observed in NdSeTe_2, PrSeTe_2 and CeSeTe_2 with onset temperature at 193(3) K, 161(3) K, 108(3) K, respectively, decreasing as lattice parameters increase. Magnetic susceptibility measurements show that the valence state of rare earth ions are trivalence in these compounds. Antiferromagnetic-type magnetic order is formed in CeSeTe_2 at 2.1 K, while no magnetic transition is observed in PrSeTe_2 and NdSeTe_2 down to 1.8 K. (paper)

  7. Improvement of tokamak performance by injection of electrons

    International Nuclear Information System (INIS)

    Ono, Masayuki.

    1992-12-01

    Concepts for improving tokamak performance by utilizing injection of hot electrons are discussed. Motivation of this paper is to introduce the research work being performed in this area and to refer the interested readers to the literature for more detail. The electron injection based concepts presented here have been developed in the CDX, CCT, and CDX-U tokamak facilities. The following three promising application areas of electron injection are described here: 1. Non-inductive current drive, 2. Plasma preionization for tokamak start-up assist, and 3. Charging-up of tokamak flux surfaces for improved plasma confinement. The main motivation for the dc-helicity injection current drive is in its efficiency that, in theory, is independent of plasma density. This property makes it attractive for driving currents in high density reactor plasmas

  8. Around the laboratories: Dubna: Physics results and progress on bubble chamber techniques; Stanford (SLAC): Operation of a very rapid cycling bubble chamber; Daresbury: Photographs of visitors to the Laboratory; Argonne: Charge exchange injection tests into the ZGS in preparation for a proposed Booster

    CERN Multimedia

    1969-01-01

    Around the laboratories: Dubna: Physics results and progress on bubble chamber techniques; Stanford (SLAC): Operation of a very rapid cycling bubble chamber; Daresbury: Photographs of visitors to the Laboratory; Argonne: Charge exchange injection tests into the ZGS in preparation for a proposed Booster

  9. Charge-Discharge Properties of the Surface-Modified ZrNi Alloy Electrode with Different Degrees of Boiling Alkaline Treatment

    Directory of Open Access Journals (Sweden)

    Akihiro Matsuyama

    2016-09-01

    Full Text Available Charge-discharge properties of the surface-modified ZrNi negative electrodes with different degrees of boiling alkaline treatment were investigated. The boiling alkaline treatment was performed by immersing the ZrNi electrode in a boiling 6 M KOH aqueous solution for 2 h or 4 h. The initial discharge capacity for the untreated ZrNi negative electrode was 21 mAh·g−1, but it was increased to 114 mAh·g−1 and 308 mAh·g−1 after the boiling alkaline treatments for 2 h and 4 h, respectively. The discharge capacity for the ZrNi negative electrode after the treatment for 2 h steadily increased with repeating charge-discharge cycles as well as that of the untreated electrode, whereas that for the ZrNi negative electrode after the 4 h treatment greatly decreased. The high rate of dischargeability was improved with an increase in the treatment period of time, and the charge-transfer resistance was drastically decreased. Scanning electron microscopy (SEM and electron dispersive X-ray spectroscopy demonstrated the ZrO2 passive layer on the ZrNi alloy surface was removed by the boiling alkaline treatment to form a porous morphology containing Ni(OH2, which can be reduced to Ni during charging, leading to the reduction of a barrier for the charge-discharge reactions.

  10. Formation of a barrier to groundwater contaminants by the injection of zero-valent iron colloids: Suspension properties

    International Nuclear Information System (INIS)

    Kaplan, D.I.; Cantrell, K.J.; Wietsma, T.W.

    1994-01-01

    Zero-valent iron (Fe 0 ) (metallic iron) is a strong chemical reductant that is capable of degrading several halogenated-hydrocarbon compounds (e.g., trichloroethene and tetrachloroethene) and chemically reducing several highly mobile oxidized oxyanions and oxycations to their immobile forms. A series of studies was undertaken to develop methods of injecting micrometer-sized Fe 0 colloids into the subsurface environment to form a chemical barrier to these highly mobile contaminants. Forming a barrier by means of this technique may have the distinct advantage over traditional trench-and-fill technologies: it may be safer, more cost-effective, and may be used at greater depths. Several commercially available Fe 0 colloids were evaluated. One type was selected for further study based on its small size (1 to 2 microm) and the presence of an organic coating. This organic coating was weathered away within 7 days by Hanford ground water (CaCO 3 system, pH 8.1) and exposed the chemically active Fe 0 -colloid surface. Through the use of surfactants in a low ionic strength solution, the length of time that these extremely dense (7.8 g cm -3 ) colloids remained in suspension increased as much as 250%. The efficiency of quartz-sand columns to remove surfactant-coated Fe 0 colloids appeared to be at least partially controlled by injection rate; the filter coefficient values at injection rates of 6, 124, and 248 ml min -1 were 0.30, 0.05, and 0.02 cm -1 , respectively. Studies are underway to develop further understanding of this relationship and to determine the interactive effect of influent colloid concentration and injection flow rate on colloid placement in aquifer sediments for barrier formation

  11. Granisetron Injection

    Science.gov (United States)

    Granisetron immediate-release injection is used to prevent nausea and vomiting caused by cancer chemotherapy and to ... nausea and vomiting that may occur after surgery. Granisetron extended-release (long-acting) injection is used with ...

  12. Edaravone Injection

    Science.gov (United States)

    Edaravone injection is used to treat amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease; a condition in which ... die, causing the muscles to shrink and weaken). Edaravone injection is in a class of medications called ...

  13. Meropenem Injection

    Science.gov (United States)

    ... injection is in a class of medications called antibiotics. It works by killing bacteria that cause infection.Antibiotics such as meropenem injection will not work for colds, flu, or other viral infections. Taking ...

  14. Chloramphenicol Injection

    Science.gov (United States)

    ... injection is in a class of medications called antibiotics. It works by stopping the growth of bacteria..Antibiotics such as chloramphenicol injection will not work for colds, flu, or other viral infections. Taking ...

  15. Colistimethate Injection

    Science.gov (United States)

    ... injection is in a class of medications called antibiotics. It works by killing bacteria.Antibiotics such as colistimethate injection will not work for colds, flu, or other viral infections. Using ...

  16. Defibrotide Injection

    Science.gov (United States)

    Defibrotide injection is used to treat adults and children with hepatic veno-occlusive disease (VOD; blocked blood ... the body and then returned to the body). Defibrotide injection is in a class of medications called ...

  17. Nalbuphine Injection

    Science.gov (United States)

    ... injection is in a class of medications called opioid agonist-antagonists. It works by changing the way ... suddenly stop using nalbuphine injection, you may experience withdrawal symptoms including restlessness; teary eyes; runny nose; yawning; ...

  18. Photovoltaic Properties in Interpenetrating Heterojunction Organic Solar Cells Utilizing MoO3 and ZnO Charge Transport Buffer Layers

    Directory of Open Access Journals (Sweden)

    Tetsuro Hori

    2010-11-01

    Full Text Available Organic thin-film solar cells with a conducting polymer (CP/fullerene (C60 interpenetrating heterojunction structure, fabricated by spin-coating a CP onto a C60 deposit thin film, have been investigated and demonstrated to have high efficiency. The photovoltaic properties of solar cells with a structure of indium-tin-oxide/C60/ poly(3-hexylthiophene (PAT6/Au have been improved by the insertion of molybdenum trioxide (VI (MoO3 and zinc oxide charge transport buffer layers. The enhanced photovoltaic properties have been discussed, taking into consideration the ground-state charge transfer between PAT6 and MoO3 by measurement of the differential absorption spectra and the suppressed contact resistance at the interface between the organic and buffer layers.

  19. Photovoltaic Properties in Interpenetrating Heterojunction Organic Solar Cells Utilizing MoO3 and ZnO Charge Transport Buffer Layers

    Science.gov (United States)

    Hori, Tetsuro; Moritou, Hiroki; Fukuoka, Naoki; Sakamoto, Junki; Fujii, Akihiko; Ozaki, Masanori

    2010-01-01

    Organic thin-film solar cells with a conducting polymer (CP)/fullerene (C60) interpenetrating heterojunction structure, fabricated by spin-coating a CP onto a C60 deposit thin film, have been investigated and demonstrated to have high efficiency. The photovoltaic properties of solar cells with a structure of indium-tin-oxide/C60/poly(3-hexylthiophene) (PAT6)/Au have been improved by the insertion of molybdenum trioxide (VI) (MoO3) and zinc oxide charge transport buffer layers. The enhanced photovoltaic properties have been discussed, taking into consideration the ground-state charge transfer between PAT6 and MoO3 by measurement of the differential absorption spectra and the suppressed contact resistance at the interface between the organic and buffer layers. PMID:28883360

  20. Electron beam injection during active experiments. I - Electromagnetic wave emissions

    Science.gov (United States)

    Winglee, R. M.; Kellogg, P. J.

    1990-01-01

    The wave emissions produced in Echo 7 experiment by active injections of electron beams were investigated to determine the properties of the electromagnetic and electrostatic fields for both the field-aligned and cross-field injection in such experiments and to evaluate the sources of free energy and relative efficiencies for the generation of the VLF and HF emissions. It is shown that, for typical beam energies in active experiments, electromagnetic effects do not substantially change the bulk properties of the beam, spacecraft charging, and plasma particle acceleration. Through simulations, beam-generated whistlers; fundamental z-mode and harmonic x-mode radiation; and electrostatic electron-cyclotron, upper-hybrid, Langmuir, and lower-hybrid waves were identified. The characteristics of the observed wave spectra were found to be sensitive to both the ratio of the electron plasma frequency to the cyclotron frequency and the angle of injection relative to the magnetic field.

  1. Charge properties and bacterial contact-killing of hyperbranched polyurea-polyethyleneimine coatings with various degrees of alkylation

    International Nuclear Information System (INIS)

    Roest, Steven; Mei, Henny C. van der; Loontjens, Ton J.A.; Busscher, Henk J.

    2015-01-01

    Highlights: • Cationic charge density does not reflect bacterial contact-killing by QUAT coatings. • Charge carrier and density reflect bacterial killing by QUAT coatings. • Fluorescein staining cannot distinguish charge carriers in cationic coatings. • Charge carrier and density of QUAT coatings are reflected in the N401.3 eV XPS peak. • The at.% N401.3 eV should be more than 0.45% for effective bacterial contact-killing. - Abstract: Coatings of immobilized-quaternary-ammonium-ions (QUAT) uniquely kill adhering bacteria upon contact. QUAT-coatings require a minimal cationic-charge surface density for effective contact-killing of adhering bacteria of around 10 14 cm −2 . Quaternization of nitrogen is generally achieved through alkylation. Here, we investigate the contribution of additional alkylation with methyl-iodide to the cationic-charge density of hexyl-bromide alkylated, hyperbranched polyurea-polyethyleneimine coatings measuring charge density with fluorescein staining. X-ray-photoelectron-spectroscopy was used to determine the at.% alkylated-nitrogen. Also streaming potentials, water contact-angles and bacterial contact-killing were measured. Cationic-charge density increased with methyl-iodide alkylation times up to 18 h, accompanied by an increase in the at.% alkylated-nitrogen. Zeta-potentials became more negative upon alkylation as a result of shielding of cationiccharges by hydrophobic alkyl-chains. Contact-killing of Gram-positive Staphylococci only occurred when the cationic-charge density exceeded 10 16 cm −2 and was carried by alkylated-nitrogen (electron-binding energy 401.3 eV). Gram-negative Escherichia coli was not killed upon contact with the coatings. There with this study reveals that cationic-charge density is neither appropriate nor sufficient to determine the ability of QUAT-coatings to kill adhering bacteria. Alternatively, the at.% of alkylated-nitrogen at 401.3 eV is proposed, as it reflects both cationic-charge and its

  2. Charge properties and bacterial contact-killing of hyperbranched polyurea-polyethyleneimine coatings with various degrees of alkylation

    Energy Technology Data Exchange (ETDEWEB)

    Roest, Steven [University of Groningen, University Medical Center Groningen, Department of Biomedical Engineering, AntoniusDeusinglaan 1, 9713 AV Groningen (Netherlands); Mei, Henny C. van der, E-mail: h.c.van.der.mei@umcg.nl [University of Groningen, University Medical Center Groningen, Department of Biomedical Engineering, AntoniusDeusinglaan 1, 9713 AV Groningen (Netherlands); Loontjens, Ton J.A. [University of Groningen, Zernike Institute for Advanced Materials, Department of Polymer Chemistry, Nijenborgh 4, 9747 AG Groningen (Netherlands); Busscher, Henk J. [University of Groningen, University Medical Center Groningen, Department of Biomedical Engineering, AntoniusDeusinglaan 1, 9713 AV Groningen (Netherlands)

    2015-11-30

    Highlights: • Cationic charge density does not reflect bacterial contact-killing by QUAT coatings. • Charge carrier and density reflect bacterial killing by QUAT coatings. • Fluorescein staining cannot distinguish charge carriers in cationic coatings. • Charge carrier and density of QUAT coatings are reflected in the N401.3 eV XPS peak. • The at.% N401.3 eV should be more than 0.45% for effective bacterial contact-killing. - Abstract: Coatings of immobilized-quaternary-ammonium-ions (QUAT) uniquely kill adhering bacteria upon contact. QUAT-coatings require a minimal cationic-charge surface density for effective contact-killing of adhering bacteria of around 10{sup 14} cm{sup −2}. Quaternization of nitrogen is generally achieved through alkylation. Here, we investigate the contribution of additional alkylation with methyl-iodide to the cationic-charge density of hexyl-bromide alkylated, hyperbranched polyurea-polyethyleneimine coatings measuring charge density with fluorescein staining. X-ray-photoelectron-spectroscopy was used to determine the at.% alkylated-nitrogen. Also streaming potentials, water contact-angles and bacterial contact-killing were measured. Cationic-charge density increased with methyl-iodide alkylation times up to 18 h, accompanied by an increase in the at.% alkylated-nitrogen. Zeta-potentials became more negative upon alkylation as a result of shielding of cationiccharges by hydrophobic alkyl-chains. Contact-killing of Gram-positive Staphylococci only occurred when the cationic-charge density exceeded 10{sup 16} cm{sup −2} and was carried by alkylated-nitrogen (electron-binding energy 401.3 eV). Gram-negative Escherichia coli was not killed upon contact with the coatings. There with this study reveals that cationic-charge density is neither appropriate nor sufficient to determine the ability of QUAT-coatings to kill adhering bacteria. Alternatively, the at.% of alkylated-nitrogen at 401.3 eV is proposed, as it reflects both

  3. Study of the charge transport characteristics of dendrimer molecular thin films

    Energy Technology Data Exchange (ETDEWEB)

    Li, J.C., E-mail: jcli@mail.neu.edu.cn; Han, N.; Wang, S.S.; Ba, D.C.

    2011-05-31

    In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.

  4. Study of the charge transport characteristics of dendrimer molecular thin films

    International Nuclear Information System (INIS)

    Li, J.C.; Han, N.; Wang, S.S.; Ba, D.C.

    2011-01-01

    In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.

  5. Study of the pressure dependence of dielectric properties of ionic crystals with the exchange-charge model

    Energy Technology Data Exchange (ETDEWEB)

    Batana, A; Faour, J

    1987-03-01

    The formalism of the exchange-charge model (ECM) is extended for studying the pressure dependence of the static dielectric constant and the volume dependence of the effective ionic charge for b.c.c. lattices. Calculated values for CsCl, CsBr, CsI, and TlBr together with the simple shell model values and experimental values are listed and discussed.

  6. Solution-processed high-LUMO-level polymers in n-type organic field-effect transistors: a comparative study as a semiconducting layer, dielectric layer, or charge injection layer

    International Nuclear Information System (INIS)

    Liu, Chuan; Xu, Yong; Liu, Xuying; Minari, Takeo; Sirringhaus, Henning; Noh, Yong-Young

    2015-01-01

    In solution-processed organic field-effect transistors (OFETs), the polymers with high level of lowest unoccupied molecular orbitals (LUMOs, > −3.5 eV) are especially susceptible to electron-trapping that causes low electron mobility and strong instability in successive operation. However, the role of high-LUMO-level polymers could be different depending on their locations relative to the semiconductor/insulator interface, or could even possibly benefit the device in some cases. We constructed unconventional polymer heterojunction n-type OFETs to control the location of the same polymer with a high LUMO level, to be in, under, or above the accumulation channel. We found that although the devices with the polymer in the channel suffer from dramatic instability, the same polymer causes much less instability when it acts as a dielectric modification layer or charge injection layer. Especially, it may even improve the device performance in the latter case. This result helps to improve our understanding of the electron-trapping and explore the value of these polymers in OFETs. (invited article)

  7. Acid slag injection into the blast furnace tuyere zone

    Energy Technology Data Exchange (ETDEWEB)

    Haerkki, J; Tervola, K [Oulu Univ. (Finland). Dept. of Process Engineering

    1997-12-31

    The possibility of acid slag injection and its effect on the slag formation and on the melting behaviour of the charge materials are studied in the present work. The work is partly based on the literature evaluating the slag formation, slag properties and the basic slag injection. The possibility of acid slag injection is first examined by studying changes in the composition of the primary slag if the share of the acid slag component (Kostamus pellet/RR) of the charge material is lowered. Phase diagrams and viscosity charts are used to evaluate the viscosity, and solidus/liquidus temperature in the slag phase. The share of the slag phase of the pellet is evaluated by calculating the amount of the acid slag injection. The injection rate of some injectants is also examined. The primary slag formed of the sinter and the coke ash is in liquid form and its viscosity is close to the viscosity of the blast furnace slag. It is possible that the liquid slag phase can be formed in the blast furnace without the presence of the acid pellet because the melting point and the viscosity of the slag is lowered by alkalies, sulfur and the dissolved ironoxide of the slag. If high SiO{sub 2} content materials alone are used for injection there is a risk that the slag phase of the tuyere zone becomes too viscous. Olivine and some iron containing components such as fayalite are possible injection material. More information is needed to evaluate the effect of acid slag injection on the operation of the blast furnace. (orig.) SULA 2 Research Programme; 2 refs.

  8. Acid slag injection into the blast furnace tuyere zone

    Energy Technology Data Exchange (ETDEWEB)

    Tervola, K.; Haerkki, J.

    1996-12-31

    The possibility of acid slag injection and its effect on the slag formation and on the melting behaviour of the charge materials are studied in the present work. The work is partly based on the literature evaluating the slag formation, slag properties and the basic slag injection. The possibility of acid slag injection is first examined by studying changes in the composition of the primary slag if the share of the acid slag component (Kostamus pellet/RR) of the charge material is lowered. Phase diagrams and viscosity charts are used to evaluate the viscosity, and solidus/liquids temperature in the slag phase. The share of the slag phase of the pellet is evaluated by calculating the amount of the acid slag injection. The injection rate of some injectants is also examined. The primary slag formed of the sinter and the coke ash is in liquid form and its viscosity is close to the viscosity of the blast furnace slag. It is possible that the liquid slag phase can be formed in the blast furnace without the presence of the acid pellet because the melting point and the viscosity of the slag is lowered by alkalies, sulfur and the dissolved ironoxide of the slag. If high SiO{sub 2} content materials alone are used for injection there is a risk that the slag phase of the tuyere zone becomes too viscous. Olivine and some iron containing components such as fayalite are possible injection material. More information is needed to evaluate the effect of acid slag injection on the operation of the blast furnace. (orig.) (14 refs.)

  9. Acid slag injection into the blast furnace tuyere zone

    Energy Technology Data Exchange (ETDEWEB)

    Haerkki, J.; Tervola, K. [Oulu Univ. (Finland). Dept. of Process Engineering

    1996-12-31

    The possibility of acid slag injection and its effect on the slag formation and on the melting behaviour of the charge materials are studied in the present work. The work is partly based on the literature evaluating the slag formation, slag properties and the basic slag injection. The possibility of acid slag injection is first examined by studying changes in the composition of the primary slag if the share of the acid slag component (Kostamus pellet/RR) of the charge material is lowered. Phase diagrams and viscosity charts are used to evaluate the viscosity, and solidus/liquidus temperature in the slag phase. The share of the slag phase of the pellet is evaluated by calculating the amount of the acid slag injection. The injection rate of some injectants is also examined. The primary slag formed of the sinter and the coke ash is in liquid form and its viscosity is close to the viscosity of the blast furnace slag. It is possible that the liquid slag phase can be formed in the blast furnace without the presence of the acid pellet because the melting point and the viscosity of the slag is lowered by alkalies, sulfur and the dissolved ironoxide of the slag. If high SiO{sub 2} content materials alone are used for injection there is a risk that the slag phase of the tuyere zone becomes too viscous. Olivine and some iron containing components such as fayalite are possible injection material. More information is needed to evaluate the effect of acid slag injection on the operation of the blast furnace. (orig.) SULA 2 Research Programme; 2 refs.

  10. Unraveling Unprecedented Charge Carrier Mobility through Structure Property Relationship of Four Isomers of Didodecyl[1]benzothieno[3,2-b][1]benzothiophene.

    Science.gov (United States)

    Tsutsui, Yusuke; Schweicher, Guillaume; Chattopadhyay, Basab; Sakurai, Tsuneaki; Arlin, Jean-Baptiste; Ruzié, Christian; Aliev, Almaz; Ciesielski, Artur; Colella, Silvia; Kennedy, Alan R; Lemaur, Vincent; Olivier, Yoann; Hadji, Rachid; Sanguinet, Lionel; Castet, Frédéric; Osella, Silvio; Dudenko, Dmytro; Beljonne, David; Cornil, Jérôme; Samorì, Paolo; Seki, Shu; Geerts, Yves H

    2016-09-01

    The structural and electronic properties of four isomers of didodecyl[1]-benzothieno[3,2-b][1]benzothiophene (C12-BTBT) have been investigated. Results show the strong impact of the molecular packing on charge carrier transport and electronic polarization properties. Field-induced time-resolved microwave conductivity measurements unravel an unprecedented high average interfacial mobility of 170 cm(2) V(-1) s(-1) for the 2,7-isomer, holding great promise for the field of organic electronics. © 2016 The Authors. Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Efficient Spin Injection into Semiconductor

    International Nuclear Information System (INIS)

    Nahid, M.A.I.

    2010-06-01

    Spintronic research has made tremendous progress nowadays for making future devices obtain extra advantages of low power, and faster and higher scalability compared to present electronic devices. A spintronic device is based on the transport of an electron's spin instead of charge. Efficient spin injection is one of the very important requirements for future spintronic devices. However, the effective spin injection is an exceedingly difficult task. In this paper, the importance of spin injection, basics of spin current and the essential requirements of spin injection are illustrated. The experimental technique of electrical spin injection into semiconductor is also discussed based on the experimental experience. The electrical spin injection can easily be implemented for spin injection into any semiconductor. (author)

  12. Charge properties and bacterial contact-killing of hyperbranched polyurea-polyethyleneimine coatings with various degrees of alkylation

    Science.gov (United States)

    Roest, Steven; van der Mei, Henny C.; Loontjens, Ton J. A.; Busscher, Henk J.

    2015-11-01

    Coatings of immobilized-quaternary-ammonium-ions (QUAT) uniquely kill adhering bacteria upon contact. QUAT-coatings require a minimal cationic-charge surface density for effective contact-killing of adhering bacteria of around 1014 cm-2. Quaternization of nitrogen is generally achieved through alkylation. Here, we investigate the contribution of additional alkylation with methyl-iodide to the cationic-charge density of hexyl-bromide alkylated, hyperbranched polyurea-polyethyleneimine coatings measuring charge density with fluorescein staining. X-ray-photoelectron-spectroscopy was used to determine the at.% alkylated-nitrogen. Also streaming potentials, water contact-angles and bacterial contact-killing were measured. Cationic-charge density increased with methyl-iodide alkylation times up to 18 h, accompanied by an increase in the at.% alkylated-nitrogen. Zeta-potentials became more negative upon alkylation as a result of shielding of cationiccharges by hydrophobic alkyl-chains. Contact-killing of Gram-positive Staphylococci only occurred when the cationic-charge density exceeded 1016 cm-2 and was carried by alkylated-nitrogen (electron-binding energy 401.3 eV). Gram-negative Escherichia coli was not killed upon contact with the coatings. There with this study reveals that cationic-charge density is neither appropriate nor sufficient to determine the ability of QUAT-coatings to kill adhering bacteria. Alternatively, the at.% of alkylated-nitrogen at 401.3 eV is proposed, as it reflects both cationic-charge and its carrier. The at.% N401.3 eV should be above 0.45 at.% for Gram-positive bacterial contact-killing.

  13. Injection-controlled laser resonator

    Science.gov (United States)

    Chang, J.J.

    1995-07-18

    A new injection-controlled laser resonator incorporates self-filtering and self-imaging characteristics with an efficient injection scheme. A low-divergence laser signal is injected into the resonator, which enables the injection signal to be converted to the desired resonator modes before the main laser pulse starts. This injection technique and resonator design enable the laser cavity to improve the quality of the injection signal through self-filtering before the main laser pulse starts. The self-imaging property of the present resonator reduces the cavity induced diffraction effects and, in turn, improves the laser beam quality. 5 figs.

  14. Enhanced Mechanical Properties in Cellulose Nanocrystal-Poly(oligoethylene glycol methacrylate) Injectable Nanocomposite Hydrogels through Control of Physical and Chemical Cross-Linking.

    Science.gov (United States)

    De France, Kevin J; Chan, Katelyn J W; Cranston, Emily D; Hoare, Todd

    2016-02-08

    While injectable hydrogels have several advantages in the context of biomedical use, their generally weak mechanical properties often limit their applications. Herein, we describe in situ-gelling nanocomposite hydrogels based on poly(oligoethylene glycol methacrylate) (POEGMA) and rigid rod-like cellulose nanocrystals (CNCs) that can overcome this challenge. By physically incorporating CNCs into hydrazone cross-linked POEGMA hydrogels, macroscopic properties including gelation rate, swelling kinetics, mechanical properties, and hydrogel stability can be readily tailored. Strong adsorption of aldehyde- and hydrazide-modified POEGMA precursor polymers onto the surface of CNCs promotes uniform dispersion of CNCs within the hydrogel, imparts physical cross-links throughout the network, and significantly improves mechanical strength overall, as demonstrated by quartz crystal microbalance gravimetry and rheometry. When POEGMA hydrogels containing mixtures of long and short ethylene oxide side chain precursor polymers were prepared, transmission electron microscopy reveals that phase segregation occurs with CNCs hypothesized to preferentially locate within the stronger adsorbing short side chain polymer domains. Incorporating as little as 5 wt % CNCs results in dramatic enhancements in mechanical properties (up to 35-fold increases in storage modulus) coupled with faster gelation rates, decreased swelling ratios, and increased stability versus hydrolysis. Furthermore, cell viability can be maintained within 3D culture using these hydrogels independent of the CNC content. These properties collectively make POEGMA-CNC nanocomposite hydrogels of potential interest for various biomedical applications including tissue engineering scaffolds for stiffer tissues or platforms for cell growth.

  15. Tunability of Open-Shell Character, Charge Asymmetry, and Third-Order Nonlinear Optical Properties of Covalently Linked (Hetero)Phenalenyl Dimers.

    Science.gov (United States)

    Minamida, Yuka; Kishi, Ryohei; Fukuda, Kotaro; Matsui, Hiroshi; Takamuku, Shota; Yamane, Masaki; Tonami, Takayoshi; Nakano, Masayoshi

    2018-02-06

    Tunability of the open-shell character, charge asymmetry, and third-order nonlinear optical (NLO) properties of covalently linked (hetero)phenalenyl dimers are investigated by using the density functional theory method. By changing the molecular species X and substitution position (i, j) for the linker part, a variety of intermonomer distances R and relative alignments between the phenalenyl dimers can be realized from the geometry optimizations, resulting in a wide-range tuning of diradical character y and charge asymmetry. It is found that the static second hyperpolarizabilities along the stacking direction, γ yyyy , are one-order enhanced for phenalenyl dimer systems exhibiting intermediate y, a feature that is in good agreement with the "y-γ correlation". By replacing the central carbon atoms of the phenalenyl rings with a boron or a nitrogen, we have also designed covalently linked heterophenalenyl dimers. The introduction of such a charge asymmetry to the open-shell systems, which leads to closed-shell ionic ground states, is found to further enhance the γ yyyy values of the systems having longer intermonomer distance R with intermediate ionic character, that is, charge asymmetry. The present results demonstrate a promising potential of covalently linked NLO dimers with intermediate open-shell/ionic characters as a new building block of highly efficient NLO systems. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Effect of the Net Charge Distribution on the Aqueous Solution Properties of Polyampholytes Effet de la répartition de la charge nette sur les propriétés des solutions aqueuses de polyampholytes

    Directory of Open Access Journals (Sweden)

    Candau F.

    2006-12-01

    Full Text Available The zwitterion nature of ampholytic polymers provides features that are useful in environmental and industrial applications, e. g. ion-exchange membrane, as flocculants in sewage treatment and in oil recovery processes. In the latter case, the increase in viscosity which is observed in the presence of brine (anti -polyelectrolyte behavior make them ideal candidates for high salinity media. The aqueous solution properties of a series of ampholytic terpolymers based on sodium-2-acrylamido-2- rilethylpropanesulfonate (NaAMPS, Methacryloyloxyethyltrimethylammonium chloride (MADQUAT and acrylamide (AM, prepared in inverse micro emulsions have been investigated by viscometry and light scattering experiments. The distribution of the net charge among the chains was varied by adjusting the initial monomer composition and the degree of conversion. The effect of this distribution on the solubility of the samples and on the chain conformation was studied. It was found that samples with a narrow distribution of net charges were soluble in water even if the average net charge is small. Addition of salt produces a transition from an extended conformation to a more compact one in qualitative agreement with theoretical predictions. A practically alternated NaAMPS- MADQUAT copolymer prepared in homogeneous solution and with a small average net charge shows a behaviour quite similar to that of the terpolymers. La nature zwitterioniquedes polymères ampholytes présente des caractéristiques qui sont utiles dans les applications environnementales et industrielles, comme les membranes d'échange ionique, les floculants dans le traitement des eaux usées et dans les procédés de récupération de pétrole. Dans ce dernier cas, l'augmentation de viscosité qui est observée en présence de saumure (comportement antipolyélectrolyte en fait des candidats idéaux pour des milieux de salinité élevée. Les propriétés de la solution aqueuse d'une série de terpolym

  17. Study of charge transport in composite blend of P3HT and PCBM

    Science.gov (United States)

    Kumar, Manoj; Kumar, Sunil; Upadhyaya, Aditi; Yadav, Anjali; Gupta, Saral K.; Singh, Amarjeet

    2018-05-01

    Poly (3-hexylthiophene-2,5diyl) (P3HT) as donor and [6,6]-phenyl C61 butyric acid methyl ester (PCBM) as acceptor are mostly used as active medium in polymeric electronic device. In this paper we have prepare the P3HT - PCBM based bulk hetero junction thin films by spin coating technique. The charge transport properties of P3HT:PCBM blends are investigated by the current-voltage measurements using Ag as an electron injecting electrode and ITO as a hole injecting contact. The current density v/s voltage relationships are analyzed in the backdrop of Schottky and Space charge limited current model.

  18. Charge Islands Through Tunneling

    Science.gov (United States)

    Robinson, Daryl C.

    2002-01-01

    It has been recently reported that the electrical charge in a semiconductive carbon nanotube is not evenly distributed, but rather it is divided into charge "islands." This paper links the aforementioned phenomenon to tunneling and provides further insight into the higher rate of tunneling processes, which makes tunneling devices attractive. This paper also provides a basis for calculating the charge profile over the length of the tube so that nanoscale devices' conductive properties may be fully exploited.

  19. Data-driven fault mechanics: Inferring fault hydro-mechanical properties from in situ observations of injection-induced aseismic slip

    Science.gov (United States)

    Bhattacharya, P.; Viesca, R. C.

    2017-12-01

    In the absence of in situ field-scale observations of quantities such as fault slip, shear stress and pore pressure, observational constraints on models of fault slip have mostly been limited to laboratory and/or remote observations. Recent controlled fluid-injection experiments on well-instrumented faults fill this gap by simultaneously monitoring fault slip and pore pressure evolution in situ [Gugleilmi et al., 2015]. Such experiments can reveal interesting fault behavior, e.g., Gugleilmi et al. report fluid-activated aseismic slip followed only subsequently by the onset of micro-seismicity. We show that the Gugleilmi et al. dataset can be used to constrain the hydro-mechanical model parameters of a fluid-activated expanding shear rupture within a Bayesian framework. We assume that (1) pore-pressure diffuses radially outward (from the injection well) within a permeable pathway along the fault bounded by a narrow damage zone about the principal slip surface; (2) pore-pressure increase ativates slip on a pre-stressed planar fault due to reduction in frictional strength (expressed as a constant friction coefficient times the effective normal stress). Owing to efficient, parallel, numerical solutions to the axisymmetric fluid-diffusion and crack problems (under the imposed history of injection), we are able to jointly fit the observed history of pore-pressure and slip using an adaptive Monte Carlo technique. Our hydrological model provides an excellent fit to the pore-pressure data without requiring any statistically significant permeability enhancement due to the onset of slip. Further, for realistic elastic properties of the fault, the crack model fits both the onset of slip and its early time evolution reasonably well. However, our model requires unrealistic fault properties to fit the marked acceleration of slip observed later in the experiment (coinciding with the triggering of microseismicity). Therefore, besides producing meaningful and internally consistent

  20. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    Energy Technology Data Exchange (ETDEWEB)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

    2016-04-19

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  1. Charge properties and bacterial contact-killing of hyperbranched polyurea-polyethyleneimine coatings with various degrees of alkylation

    NARCIS (Netherlands)

    Roest, Steven; van der Mei, Henny C.; Loontjens, Ton J. A.; Busscher, Henk J.

    2015-01-01

    Coatings of immobilized-quaternary-ammonium-ions (QUAT) uniquely kill adhering bacteria upon contact. QUAT-coatings require a minimal cationic-charge surface density for effective contact-killing of adhering bacteria of around 10(14) cm(-2). Quaternization of nitrogen is generally achieved through

  2. Hole-capture properties of the electron-irradiation-induced deep-level H5 in p-type InP: A charge-controlled bistable model

    International Nuclear Information System (INIS)

    Bretagnon, T.; Bastide, G.; Rouzeyre, M.

    1989-01-01

    The electron-induced irradiated defect H 5 in Zn-doped p-type InP is an unusual hole trap, since its temperature-independent weak-hole capture cross section, σ c ∼10 -21 cm 2 , is 6 orders of magnitude lower than the value obtained from thermal-emission rates. We present a charge-controlled bistable configuration-coordinate diagram that explains this large difference and accounts for the optical-absorption properties. In addition, a microscopic D In n+ -Zn - defect, made by pairing under electrostatic attraction of the ionized acceptor Zn - and of a positively charged primitive defect D In n+ of the In sublattice, is tentatively proposed as a plausible complex at the origin of H 5

  3. Interpreting equilibrium-conductivity and conductivity-relaxation measurements to establish thermodynamic and transport properties for multiple charged defect conducting ceramics.

    Science.gov (United States)

    Zhu, Huayang; Ricote, Sandrine; Coors, W Grover; Kee, Robert J

    2015-01-01

    A model-based interpretation of measured equilibrium conductivity and conductivity relaxation is developed to establish thermodynamic, transport, and kinetics parameters for multiple charged defect conducting (MCDC) ceramic materials. The present study focuses on 10% yttrium-doped barium zirconate (BZY10). In principle, using the Nernst-Einstein relationship, equilibrium conductivity measurements are sufficient to establish thermodynamic and transport properties. However, in practice it is difficult to establish unique sets of properties using equilibrium conductivity alone. Combining equilibrium and conductivity-relaxation measurements serves to significantly improve the quantitative fidelity of the derived material properties. The models are developed using a Nernst-Planck-Poisson (NPP) formulation, which enables the quantitative representation of conductivity relaxations caused by very large changes in oxygen partial pressure.

  4. 41 CFR 102-36.290 - How much do we charge for excess personal property on a transfer with reimbursement?

    Science.gov (United States)

    2010-07-01

    ... market value of the property when the transfer involves property meeting conditions in § 102-36.285(a)(1... Government corporation (§ 102-36.285(a)(5) and (a)(6)), you may only require fair value reimbursement. Fair...., condition code 1), and zero percent for other personal property. A higher fair value may be used if you and...

  5. Performance enhancement in p-channel charge-trapping flash memory devices with Si/Ge super-lattice channel and band-to-band tunneling induced hot-electron injection

    International Nuclear Information System (INIS)

    Liu, Li-Jung; Chang-Liao, Kuei-Shu; Jian, Yi-Chuen; Wang, Tien-Ko; Tsai, Ming-Jinn

    2013-01-01

    P-channel charge-trapping flash memory devices with Si, SiGe, and Si/Ge super-lattice channel are investigated in this work. A Si/Ge super-lattice structure with extremely low roughness and good crystal structure is obtained by precisely controlling the epitaxy thickness of Ge layer. Both programming and erasing (P/E) speeds are significantly improved by employing this Si/Ge super-lattice channel. Moreover, satisfactory retention and excellent endurance characteristics up to 10 6 P/E cycles with 3.8 V memory window show that the degradation on reliability properties is negligible when super-lattice channel is introduced. - Highlights: ► A super-lattice structure is proposed to introduce more Ge content into channel. ► Super-lattice structure possesses low roughness and good crystal structure. ► P-channel flash devices with Si, SiGe, and super-lattice channel are investigated. ► Programming/erasing speeds are significantly improved. ► Reliability properties can be kept for device with super-lattice channel

  6. Water Quality Protection Charges

    Data.gov (United States)

    Montgomery County of Maryland — The Water Quality Protection Charge (WQPC) is a line item on your property tax bill. WQPC funds many of the County's clean water initiatives including: • Restoration...

  7. Subcutaneous Injections

    DEFF Research Database (Denmark)

    Thomsen, Maria

    This thesis is about visualization and characterization of the tissue-device interaction during subcutaneous injection. The tissue pressure build-up during subcutaneous injections was measured in humans. The insulin pen FlexTouchr (Novo Nordisk A/S) was used for the measurements and the pressure ...

  8. Hydromorphone Injection

    Science.gov (United States)

    ... anyone else to use your medication. Store hydromorphone injection in a safe place so that no one else can use it accidentally or on purpose. Keep track of how much medication is left so ... with hydromorphone injection may increase the risk that you will develop ...

  9. Ketorolac Injection

    Science.gov (United States)

    ... an older adult, you should know that ketorolac injection is not as safe as other medications that can be used to treat your condition. Your doctor may choose to prescribe a different medication ... to ketorolac injection.Your doctor or pharmacist will give you the ...

  10. Paclitaxel Injection

    Science.gov (United States)

    (pak'' li tax' el)Paclitaxel injection must be given in a hospital or medical facility under the supervision of a doctor who is experienced in giving chemotherapy medications for cancer.Paclitaxel injection may cause a large decrease in the number of white blood cells (a type of blood cell ...

  11. The macro- and micro properties of cement pastes with silica-rich materials cured by wet-mixed steaming injection

    International Nuclear Information System (INIS)

    Wu, D.S.; Peng, Y.N.

    2003-01-01

    This research used cement pastes with a low water/blaine ratio (W/b=0.27). Rice husk ashes (RHA) burned at 700 and 850 deg. C, silica fume, silica sand (Ottawa standard sand), etc., were the added ingredients. Wet-mixed steam injection (WMSI) was at five different temperatures: 65, 80, 120, 150 and 180 deg. C. We investigated cement pastes with added silica-rich materials. For different WMSI temperatures and times, we explored the relations between compressive strength, hydration products, and pozzolanic reaction mechanism. From scanning electron microscopy (SEM) and EDS, we know that hydration products become very complicated, depending on the WMSI temperatures and times. It is difficult to determine the direct effects on the strength based on changes in the products. Experimental results, however, clearly showed that the compressive strength was worst for 80 deg. C and best for 180 deg. C. High-temperature WMSI is best with 4-h presteaming period and 8-h retention time. Curing in saturated limewater for 28 days did not increase the strength. The three types of silica-rich materials used in this research all participated in the reaction during high-temperature WMSI; they helped to increase the strength. Addition of Ottawa standard sand resulted in the best strength, followed by addition of RHA, while addition of silica fume was worse than the others. Specimens treated with high-temperature WMSI would swell slightly if they were placed in air. This was different from normal-temperature curing

  12. Study on photophysical properties of Eu(III) complexes with aromatic β-diketones – Role of charge transfer states in the energy migration

    Energy Technology Data Exchange (ETDEWEB)

    Räsänen, Markus, E-mail: mpvras@utu.fi [Department of Chemistry, University of Turku, FIN-20014 Turku (Finland); Takalo, Harri [DHR Finland Oy, Innotrac Diagnostics, Biolinja 12, FIN-20750 Turku (Finland); Rosenberg, Jaana; Mäkelä, Joonas [Department of Biochemistry and Food Chemistry, University of Turku, FIN-20014 Turku (Finland); Haapakka, Keijo; Kankare, Jouko [Department of Chemistry, University of Turku, FIN-20014 Turku (Finland)

    2014-02-15

    We synthesized a set of aromatic β-diketones and measured the photophysical properties of their europium(III) complexes. According to these photophysical properties, the europium complexes can be divided into two groups: the complexes with or without the freely rotating amino-group (FRAG). On the basis of the experimental results, it can be concluded that in the FRAG complexes, the ligand-centered excitation energy is most probably transferred from a ligand to a coordinated europium via the intraligand charge transfer (ILCT) state. The temperature dependency of the lifetimes of the emissive {sup 5}D{sub 0} state revealed that in the FRAG complexes, the energy of the emissive {sup 5}D{sub 0} state is back-transferred to the ligand-to-metal charge transfer (LMCT) state and in the non-FRAG complexes, to the triplet state of the ligand. The most efficient complex synthesized was the europium complex of carbazole derivative L{sup 6} with the quantum yield of 47% and molar absorption coefficient of 70,400 M{sup −1}cm{sup −1}. -- Highlights: • We synthesized a set of substituted aromatic β-diketones and their Eu(III) complexes. • We measured the photophysical properties of these Eu(III) complexes. • Carbazole derivative of β-diketone forms the brightest Eu(III) complex. • The Jablonski diagrams proposed for the luminescence of these complexes.

  13. Unraveling the Solution-State Supramolecular Structures of Donor-Acceptor Polymers and their Influence on Solid-State Morphology and Charge-Transport Properties.

    Science.gov (United States)

    Zheng, Yu-Qing; Yao, Ze-Fan; Lei, Ting; Dou, Jin-Hu; Yang, Chi-Yuan; Zou, Lin; Meng, Xiangyi; Ma, Wei; Wang, Jie-Yu; Pei, Jian

    2017-11-01

    Polymer self-assembly in solution prior to film fabrication makes solution-state structures critical for their solid-state packing and optoelectronic properties. However, unraveling the solution-state supramolecular structures is challenging, not to mention establishing a clear relationship between the solution-state structure and the charge-transport properties in field-effect transistors. Here, for the first time, it is revealed that the thin-film morphology of a conjugated polymer inherits the features of its solution-state supramolecular structures. A "solution-state supramolecular structure control" strategy is proposed to increase the electron mobility of a benzodifurandione-based oligo(p-phenylene vinylene) (BDOPV)-based polymer. It is shown that the solution-state structures of the BDOPV-based conjugated polymer can be tuned such that it forms a 1D rod-like structure in good solvent and a 2D lamellar structure in poor solvent. By tuning the solution-state structure, films with high crystallinity and good interdomain connectivity are obtained. The electron mobility significantly increases from the original value of 1.8 to 3.2 cm 2 V -1 s -1 . This work demonstrates that "solution-state supramolecular structure" control is critical for understanding and optimization of the thin-film morphology and charge-transport properties of conjugated polymers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Effects of X irradiation and high field electron injection of the electrical properties of rapid thermal oxides

    International Nuclear Information System (INIS)

    Schubert, W.K.; Seager, C.H.

    1988-01-01

    Rapid thermal oxidation (RTO) is a promising tool for fabricating the thin gate oxides (5 to 15 nm) that will be needed in future submicron integrated circuits, because of its inherently superior time-temperature control when compared to conventional oxidation methods. It is important to demonstrate that RTO can be used without adversely affecting the radiation hardness or high field properties of the oxide. Beyond this demonstration, rapid thermal processing makes it possible to determine more precisely how the kinetics of oxidation and post oxidation annealing affect the device properties. Information of this type should prove useful in modeling relevant defect formation mechanisms. The present paper is part of a systematic study of the effect of rapid thermal processing on the radiation and high field response of thin oxides

  15. Microstructure and High Temperature Oxidation Property of Fe-Cr-B Based Metal/Ceramic Composite Manufactured by Powder Injection Molding Process

    Science.gov (United States)

    Joo, Yeun-Ah; Kim, Young-Kyun; Yoon, Tae-Sik; Lee, Kee-Ahn

    2018-03-01

    This study investigated the microstructure and high temperature oxidation property of Fe-Cr-B metal/ceramic composite manufactured using powder injection molding process. Observations of initial microstructure showed a unique structure where α-Fe and (Cr, Fe)2B form a continuous three-dimensional network. High temperature oxidation tests were performed at 900, 1000 and 1100 °C, for 24 h, and the oxidation weight gain according to each temperature condition was 0.13, 0.84 and 6.4 mg/cm2, respectively. The oxidation results according to time at 900 and 1000 °C conditions represented parabolic curves, and at 1100 °C condition formed a rectilinear curve. Observation and phase analysis results of the oxides identified Cr2O3 and SiO2 at 900 and 1000 °C. In addition to Cr2O3 and SiO2, CrBO3 and FeCr2O4 formed due to phase decomposition of boride were identified at 1100 °C. Based on the findings above, this study suggested the high temperature oxidation mechanism of Fe-Cr-B metal/ceramic composite manufactured using powder injection molding, and the possibility of its application as a high temperature component material was also discussed.

  16. Coulombic charge ice

    Science.gov (United States)

    McClarty, P. A.; O'Brien, A.; Pollmann, F.

    2014-05-01

    We consider a classical model of charges ±q on a pyrochlore lattice in the presence of long-range Coulomb interactions. This model first appeared in the early literature on charge order in magnetite [P. W. Anderson, Phys. Rev. 102, 1008 (1956), 10.1103/PhysRev.102.1008]. In the limit where the interactions become short ranged, the model has a ground state with an extensive entropy and dipolar charge-charge correlations. When long-range interactions are introduced, the exact degeneracy is broken. We study the thermodynamics of the model and show the presence of a correlated charge liquid within a temperature window in which the physics is well described as a liquid of screened charged defects. The structure factor in this phase, which has smeared pinch points at the reciprocal lattice points, may be used to detect charge ice experimentally. In addition, the model exhibits fractionally charged excitations ±q/2 which are shown to interact via a 1/r potential. At lower temperatures, the model exhibits a transition to a long-range ordered phase. We are able to treat the Coulombic charge ice model and the dipolar spin ice model on an equal footing by mapping both to a constrained charge model on the diamond lattice. We find that states of the two ice models are related by a staggering field which is reflected in the energetics of these two models. From this perspective, we can understand the origin of the spin ice and charge ice ground states as coming from a dipolar model on a diamond lattice. We study the properties of charge ice in an external electric field, finding that the correlated liquid is robust to the presence of a field in contrast to the case of spin ice in a magnetic field. Finally, we comment on the transport properties of Coulombic charge ice in the correlated liquid phase.

  17. An insight into the mechanism of charge transfer properties of hybrid organic (MEH-PPV): Inorganic (TiO2) nanocomposites

    International Nuclear Information System (INIS)

    Mittal, Tanu; Tiwari, Sangeeta; Mehta, Aarti; Sharma, Shailesh N.

    2016-01-01

    Now a days, inorganic nanoparticles are gaining importance and are potential candidate in different organic electronic device application like (LEDs, PVs) due to their novel properties and confinement in Nano-dimensions. [1, 2] In the present work, we have compared the properties of titanium di oxide (TiO 2 ) nanoparticles (NPs) synthesized by using two different chemical routes aqueous and ethanol respectively. These synthesized TiO 2 nanoparticles have been characterized by X-ray diffraction spectroscopy (XRD) for phase confirmation. It was observed that synthesized nanoparticles are in anatase phase for both preparation routes. Morphological information was collected by scanning electron microscopy (SEM) which confirms that particles are almost spherical in shape and distributed uniformly which is further ensured by transmission electron microscopy (TEM). Dynamic light scattering (DLS) technique was also used for further confirmation of size distribution of as-synthesized nanoparticles. Optical properties were also investigated by photoluminescence and UV-Vis spectroscopy and calculated bandgap was found to be in the range of 3.3-3.5eV for TiO 2 (aq/eth) nanoparticles. The increase in bandgap values with respect to bulk (3.2 eV) confirms that as- synthesized nanoparticles are confined in nanodimensions. As synthesized nanoparticles were interacted with MEHPPV polymer (donor) matrix to make their respective MEHPPV: TiO 2 nanocomposites and to confirm the charge transfer mechanism from polymer to nanoparticles. It can be observed from photoluminescence (PL) quenching experiments that continuous quenching obtained for respective nanocomposites confirms better charge transfer from polymer to inorganic TiO 2 nanoparticles respectively. Because of, better quenching and simultaneously enhanced charge transfer of respective nanocomposites, ensures that these nanocomposites are greatly applicable for photovoltaics (PVs) especially in Hybrid Solar cells (HSCs).

  18. Enhancing physicochemical properties of emulsions by heteroaggregation of oppositely charged lactoferrin coated lutein droplets and whey protein isolate coated DHA droplets.

    Science.gov (United States)

    Li, Xin; Wang, Xu; Xu, Duoxia; Cao, Yanping; Wang, Shaojia; Wang, Bei; Sun, Baoguo; Yuan, Fang; Gao, Yanxiang

    2018-01-15

    The formation and physicochemical stability of mixed functional components (lutein & DHA) emulsions through heteroaggregation were studied. It was formed by controlled heteroaggregation of oppositely charged lutein and DHA droplets coated by cationic lactoferrin (LF) and anionic whey protein isolate (WPI), respectively. Heteroaggregation was induced by mixing the oppositely charged LF-lutein and WPI-DHA emulsions together at pH 6.0. Droplet size, zeta-potential, transmission-physical stability, microrheological behavior and microstructure of the heteroaggregates formed were measured as a function of LF-lutein to WPI-DHA droplet ratio. Lutein degradation and DHA oxidation by measurement of lipid hydroperoxides and thiobarbituric acid reactive substances were determined. Upon mixing the two types of bioactive compounds droplets together, it was found that the largest aggregates and highest physical stability occurred at a droplet ratio of 40% LF-lutein droplets to 60% WPI-DHA droplets. Heteroaggregates formation altered the microrheological properties of the mixed emulsions mainly by the special network structure of the droplets. When LF-coated lutein droplets ratios were more than 30% and less than 60%, the mixed emulsions exhibited distinct decreases in the Mean Square Displacement, which indicated that their limited scope of Brownian motion and stable structure. Mixed emulsions with LF-lutein/WPI-DHA droplets ratio of 4:6 exhibited Macroscopic Viscosity Index with 13 times and Elasticity Index with 3 times of magnitudes higher than the individual emulsions from which they were prepared. Compared with the WPI-DHA emulsion or LF-lutein emulsion, the oxidative stability of the heteroaggregate of LF-lutein/WPI-DHA emulsions was improved. Heteroaggregates formed by oppositely charged bioactive compounds droplets may be useful for creating specific food structures that lead to desirable physicochemical properties, such as microrheological property, physical and chemical

  19. Molecular structure of the discotic liquid crystalline phase of hexa-peri-hexabenzocoronene/oligothiophene hybrid and their charge transport properties

    International Nuclear Information System (INIS)

    Bag, Saientan; Maingi, Vishal; Maiti, Prabal K.; Yelk, Joe; Glaser, Matthew A.; Clark, Noel A.; Walba, David M.

    2015-01-01

    Using atomistic molecular dynamics simulation, we study the discotic columnar liquid crystalline (LC) phases formed by a new organic compound having hexa-peri-Hexabenzocoronene (HBC) core with six pendant oligothiophene units recently synthesized by Nan Hu et al. [Adv. Mater. 26, 2066 (2014)]. This HBC core based LC phase was shown to have electric field responsive behavior and has important applications in organic electronics. Our simulation results confirm the hexagonal arrangement of columnar LC phase with a lattice spacing consistent with that obtained from small angle X-ray diffraction data. We have also calculated various positional and orientational correlation functions to characterize the ordering of the molecules in the columnar arrangement. The molecules in a column are arranged with an average twist of 25° having an average inter-molecular separation of ∼5 Å. Interestingly, we find an overall tilt angle of 43° between the columnar axis and HBC core. We also simulate the charge transport through this columnar phase and report the numerical value of charge carrier mobility for this liquid crystal phase. The charge carrier mobility is strongly influenced by the twist angle and average spacing of the molecules in the column

  20. Space charge and magnet error simulations for the SNS accumulator ring

    International Nuclear Information System (INIS)

    Beebe-Wang, J.; Fedotov, A.V.; Wei, J.; Machida, S.

    2000-01-01

    The effects of space charge forces and magnet errors in the beam of the Spallation Neutron Source (SNS) accumulator ring are investigated. In this paper, the focus is on the emittance growth and halo/tail formation in the beam due to space charge with and without magnet errors. The beam properties of different particle distributions resulting from various injection painting schemes are investigated. Different working points in the design of SNS accumulator ring lattice are compared. The simulations in close-to-resonance condition in the presence of space charge and magnet errors are presented. (author)

  1. [In vitro evaluation of the gels properties prepared on Pluronic F-127 as vehicles for administration prolactin by injection].

    Science.gov (United States)

    Karolewicz, Bozena; Pawlik-Gałczyńska, Anna; Pluta, Janusz; Ryszka, Florian

    2011-01-01

    The aim of this study was to prepare a thermoresponsive formulations, which are a carrier for proteins--prolactin administered directly into solid tumor and which obtain sol-gel transitions at physiological ranges of temperature. Prolactin (PRL) is a hormone that in vivo and in vitro exhibits antiangiogenic properties. Application of this protein in the proposed formulations can be particularly advantageous because of its relatively low stability and limited ability to transmembrane penetration. The paper prepared thermoresponsive carriers, based on nonionic polymer Pluronic F-127 with selected excipients such as dextran 7000, PEG 400, Tween 20 and Tween 80. The sol-gel transition temperature of the formulations was investigated and their physicochemical properties such as pH, density, osmotic pressure were studied. In the remainder of the work carried out tests of prolactin release from the proposed media. The results obtained indicate that a significant influence on the theological parameters obtained carriers and the availability of pharmaceutical composition of prolactin was developed formulation.

  2. Analysis of a Mathematical Model of Lithium-Sulfur Cells Part III: Electrochemical Reaction Kinetics, Transport Properties and Charging

    International Nuclear Information System (INIS)

    Ghaznavi, Mahmoudreza; Chen, P.

    2014-01-01

    Highlights: • The discharge behavior of Li-S cells in wide range of exchange current densities of electrochemical reactions is studied. • Among all reduction reactions, 1/2 S 8(l) +e − ⇌1/2 S 8 2− and 1/2 S 2 2− +e − ⇌2S 2− play the most important role in capacity performance. • Low diffusion increases the precipitation of polysulfides in separator which may block the anode surface. • Large solubility of Li 2 S is needed for the model to be able to simulate the charging process. - Abstract: Sensitivity analysis of a mathematical model of a lithium-sulfur (Li-S) battery was performed by investigating the response of the model to variation of the exchange current densities, diffusion coefficients, and cathode thickness over a wide range; the results of the analysis were used to explain the some aspects of the behavior of the system which may be seen in experiments. In particular, among all the exchange current densities, the exchange current density of the elemental sulfur reduction has the most significant effect on the discharge capacity of the cell. The variation of the diffusion coefficients was also analyzed, providing information on the non-uniformity of precipitants in the cell after discharge. An optimum cathode thickness was presented to gain the highest capacity of the cell. Finally, the simulation of charging was studied, showing that the model needs a large solubility product of di-lithium sulfide to be able to simulate the charge process of a cell

  3. Die-cast of a hypo-eutectic AL-SI alloy: influence of injection temperature on microstructure and mechanical properties; Fundicao sob pressao das ligas de AL-SI: influencia da temperatura de injecao nas microestruturas e propriedades mecanicas

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Silvano Leal dos; Santos, Sydney Ferreira, E-mail: silvano_lleal@yahoo.com.br [Universidade Federal do ABC (UFABC), SP (Brazil)

    2014-07-01

    Die-casting is widely used for manufacturing light alloy components for automotive industry. Among others, hypo-eutectic Al-Si alloys are currently processed by die-casting. To obtain high quality die-cast components, a better understanding on the correlations between processing parameters, microstructures, and mechanical properties are of utmost importance. In this study, we investigate the effect of injection temperature of liquid metal on the microstructure and mechanical properties of Al-Si alloy EN AC 46000 (DIN designation). The injection temperatures were 579, 589, 643, and 709 deg C. As-cast components had their microstructures analyzed by X-ray diffraction, optical and scanning electron microscopy, and X-ray energy dispersive spectroscopy. The mechanical properties were examined by micro-hardness and tensile tests. It was observed that the ultimate tensile strength slightly increased with the increase of injection temperature. The same trend was observed for micro-hardness. The amount of porosity in the samples varies in a small amount for different injection temperatures. On the other hand, the microstructure of the alloys seems more refined for higher temperatures of injection. This refinement in microstructure might play a major role on the mechanical properties of the Al-Si die-cast alloy. (author)

  4. Temozolomide Injection

    Science.gov (United States)

    ... balance or coordination fainting dizziness hair loss insomnia memory problems pain, itching, swelling, or redness in the place where the medication was injected changes in vision Some side effects can be serious. If you ...

  5. Buprenorphine Injection

    Science.gov (United States)

    ... injection is in a class of medications called opiate partial agonists. It works to prevent withdrawal symptoms ... help. If the victim has collapsed, had a seizure, has trouble breathing, or can't be awakened, ...

  6. Risperidone Injection

    Science.gov (United States)

    ... release (long-acting) injection is used to treat schizophrenia (a mental illness that causes disturbed or unusual ... may help control your symptoms but will not cure your condition. Continue to keep appointments to receive ...

  7. Haloperidol Injection

    Science.gov (United States)

    ... haloperidol extended-release injection are used to treat schizophrenia (a mental illness that causes disturbed or unusual ... may help control your symptoms but will not cure your condition. Continue to keep appointments to receive ...

  8. Omalizumab Injection

    Science.gov (United States)

    ... injection is used to decrease the number of asthma attacks (sudden episodes of wheezing, shortness of breath, and ... about how to treat symptoms of a sudden asthma attack. If your asthma symptoms get worse or if ...

  9. Injection Tests

    CERN Document Server

    Kain, V

    2009-01-01

    The success of the start-up of the LHC on 10th of September was in part due to the preparation without beam and injection tests in 2008. The injection tests allowed debugging and improvement in appropriate portions to allow safe, efficient and state-of-the-art commissioning later on. The usefulness of such an approach for a successful start-up becomes obvious when looking at the problems we encountered before and during the injection tests and could solve during this period. The outline of the preparation and highlights of the different injection tests will be presented and the excellent performance of many tools discussed. A list of shortcomings will follow, leading to some planning for the preparation of the run in 2009.

  10. Cefotaxime Injection

    Science.gov (United States)

    ... is in a class of medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as cefotaxime injection will not work for colds, flu, or other viral infections. Using ...

  11. Cefuroxime Injection

    Science.gov (United States)

    ... is in a class of medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as cefuroxime injection will not work for colds, flu, or other viral infections. Using ...

  12. Doripenem Injection

    Science.gov (United States)

    ... is in a class of medications called carbapenem antibiotics. It works by killing bacteria.Antibiotics such as doripenem injection will not work for colds, flu, or other viral infections. Taking ...

  13. Daptomycin Injection

    Science.gov (United States)

    ... in a class of medications called cyclic lipopeptide antibiotics. It works by killing bacteria.Antibiotics such as daptomycin injection will not work for treating colds, flu, or other viral infections. ...

  14. Ceftaroline Injection

    Science.gov (United States)

    ... is in a class of medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as ceftaroline injection will not work for colds, flu, or other viral infections. Using ...

  15. Aztreonam Injection

    Science.gov (United States)

    ... is in a class of medications called carbapenem antibiotics. It works by killing bacteria.Antibiotics such as aztreonam injection will not work for colds, flu, or other viral infections. Taking ...

  16. Cefazolin Injection

    Science.gov (United States)

    ... is in a class of medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as cefazolin injection will not work for colds, flu, or other viral infections. Taking ...

  17. Ceftazidime Injection

    Science.gov (United States)

    ... is in a class of medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as ceftazidime injection will not work for colds, flu, or other viral infections. Using ...

  18. Cefotetan Injection

    Science.gov (United States)

    ... is in a class of medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as cefotetan injection will not work for colds, flu, or other viral infections. Using ...

  19. Cefoxitin Injection

    Science.gov (United States)

    ... is in a class of medications called cephamycin antibiotics. It works by killing bacteria.Antibiotics such as cefoxitin injection will not work for colds, flu, or other viral infections. Taking ...

  20. Tigecycline Injection

    Science.gov (United States)

    ... is in a class of medications called tetracycline antibiotics. It works by killing bacteria that cause infection.Antibiotics such as tigecycline injection will not work for colds, flu, or other viral infections. Using ...

  1. Ertapenem Injection

    Science.gov (United States)

    ... is in a class of medications called carbapenem antibiotics. It works by killing bacteria.Antibiotics such as ertapenem injection will not work for colds, flu, or other viral infections. Taking ...

  2. Ceftriaxone Injection

    Science.gov (United States)

    ... is in a class of medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as ceftriaxone injection will not work for colds, flu, or other viral infections.Using ...

  3. Cefepime Injection

    Science.gov (United States)

    ... is in a class of medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as cefepime injection will not work for colds, flu, or other viral infections. Using ...

  4. Telavancin Injection

    Science.gov (United States)

    ... is in a class of medications called lipoglycopeptide antibiotics. It works by killing bacteria that cause infection.Antibiotics such as telavancin injection will not work for colds, flu, or other viral infections. Using ...

  5. Doxycycline Injection

    Science.gov (United States)

    ... is in a class of medications called tetracycline antibiotics. It works by killing bacteria that cause infections.Antibiotics such as doxycycline injection will not work for colds, flu, or other viral infections. Taking ...

  6. Vancomycin Injection

    Science.gov (United States)

    ... is in a class of medications called glycopeptide antibiotics. It works by killing bacteria that cause infections.Antibiotics such as vancomycin injection will not work for colds, flu, or other viral infections. Taking ...

  7. Octreotide Injection

    Science.gov (United States)

    ... carton and protect it from light. Dispose of multi-dose vials of the immediate-release injection 14 ... and immediately place the medication in a safe location – one that is up and away and out ...

  8. Moxifloxacin Injection

    Science.gov (United States)

    ... tendon area, or inability to move or to bear weight on an affected area.Using moxifloxacin injection ... muscle weakness) and cause severe difficulty breathing or death. Tell your doctor if you have myasthenia gravis. ...

  9. Delafloxacin Injection

    Science.gov (United States)

    ... a tendon area, or inability to move or bear weight on an affected area.Using delafloxacin injection ... muscle weakness) and cause severe difficulty breathing or death. Tell your doctor if you have myasthenia gravis. ...

  10. Levofloxacin Injection

    Science.gov (United States)

    ... tendon area, or inability to move or to bear weight on an affected area.Using levofloxacin injection ... muscle weakness) and cause severe difficulty breathing or death. Tell your doctor if you have myasthenia gravis. ...

  11. Ciprofloxacin Injection

    Science.gov (United States)

    ... a tendon area, or inability to move or bear weight on an affected area.Using ciprofloxacin injection ... muscle weakness) and cause severe difficulty breathing or death. Tell your doctor if you have myasthenia gravis. ...

  12. Alirocumab Injection

    Science.gov (United States)

    ... 9 (PCSK9) inhibitor monoclonal antibodies. It works by blocking the production of LDL cholesterol in the body ... hives difficulty breathing or swallowing swelling of the face, throat, tongue, lips, and eyes Alirocumab injection may ...

  13. Evolocumab Injection

    Science.gov (United States)

    ... 9 (PCSK9) inhibitor monoclonal antibody. It works by blocking the production of LDL cholesterol in the body ... hives difficulty breathing or swallowing swelling of the face, throat, tongue, lips, and eyes Evolocumab injection may ...

  14. Acyclovir Injection

    Science.gov (United States)

    ... It is also used to treat first-time genital herpes outbreaks (a herpes virus infection that causes sores ... in the body. Acyclovir injection will not cure genital herpes and may not stop the spread of genital ...

  15. Butorphanol Injection

    Science.gov (United States)

    ... Butorphanol is in a class of medications called opioid agonist-antagonists. It works by changing the way ... suddenly stop using butorphanol injection, you may experience withdrawal symptoms such as nervousness, agitation, shakiness, diarrhea, chills, ...

  16. CHANGES IN THE ELECTRICAL SURFACE CHARGE AND TRANSPLANTATION PROPERTIES OF TA3 ASCITES TUMOR CELLS DURING SHORT-TERM MAINTENANCE IN AN ISOTONIC SALT SOLUTION

    Energy Technology Data Exchange (ETDEWEB)

    Tenforde, T. S.; Richards, W. R.; Kelly, L. S.

    1980-12-01

    TA3 ascites tumor cells maintained in vitro as a dilute suspension in 0.9% NaCl solution (physiological saline) were found to undergo time-dependent degenerative processes leading to alterations in both membrane characteristics and tumor transplantation properties. A 30% decrease in the negative cellular surface charge density occurred within 2 hr. when TA3 cells were incubated in a 0.9% NaCl solution at 23 °C. A similar reduction in negative surface charge density occurred within 0.5 hr. when the medium was maintained at 37 °C. This time-dependent reduction in surface charge was prevented when cellular metabolism was blocked either by maintaining the medium at 4 °C. or by adding 1 mM cyanide ion to a 23 °C medium. TA3 cells incubated as a dilute suspension in 0.9% NaCl solution at 23 °C also exhibited a large 9 time-dependent reduction in proliferative capacity in isogeneic LAF1/J hosts, as indicated by an increase in the tumor dose for 50% mortality (TD50). Lowering the temperature of the medium to 4 °C was observed to slow the onset of the degenerative processes that lead to a decreased transplantability of TA3 cells. The modification in growth properties of TA3 cells maintained in vitro was found to be attributable in part to an alteration in tumor histocompatibility. This effect was demonstrated by comparing the tumor growth kinetics and TD50 values in normal hosts versus hosts that had been immunosuppressed by whole-body irradiation. Following the in vitro maintenance of TA3 cells, nigrosin dye exclusion tests were performed as a means of assessing cell viability. Evidence obtained in this series of experiments indicated that vital staining is an inadequate criterion for judging either the extent of cell membrane damage or the loss of cellular proliferative capacity.

  17. Degree of phase separation effects on the charge transfer properties of P3HT:Graphene nanocomposites

    International Nuclear Information System (INIS)

    Bkakri, R.; Kusmartseva, O.E.; Kusmartsev, F.V.; Song, M.; Bouazizi, A.

    2015-01-01

    Graphene layers were introduced into the matrix of regioregular poly (3-hexylthiophene-2, 5-diyl) (RR-P3HT) via solution processing in the perspective of the development of organic nanocomposites with high P3HT/Graphene interfaces areas for efficient charge transfer process. P3HT and graphene act as electrons donor and electrons acceptor materials, respectively. Spatial Fourier Transforms (FFT) and power spectral density (PSD) analysis of the AFM images show that the phase separation decreases with increasing the graphene weight ratio in the P3HT matrix. The Raman spectra of the P3HT:Graphene nanocomposites shows that the G-band of graphene shifts to low frequencies with progressive addition of graphene which proves that there is an interaction between the nanowires of P3HT and the graphene layers. We suggest that the shift of the G-band is due to electrons transfer from P3HT to graphene. The quenching of the photoluminescence (PL) intensity of P3HT with addition of graphene proves also that an electrons transfer process occurred at the P3HT/Graphene interfaces. - Highlights: • Graphene layers are elaborated from expandable graphite oxide. • The effects of the graphene doping level on the charge transfer process were studied. • The phase separation process decreases with increasing the graphene content in the P3HT matrix. • Quenching of the PL intensity is due to electrons transfer from P3HT to graphene

  18. Charged jet cross sections and properties in proton-proton collisions at $\\sqrt{s}=7$ TeV

    CERN Document Server

    Abelev, Betty Bezverkhny; Adamova, Dagmar; Aggarwal, Madan Mohan; Aglieri Rinella, Gianluca; Agnello, Michelangelo; Agostinelli, Andrea; Agrawal, Neelima; Ahammed, Zubayer; Ahmad, Nazeer; Ahmed, Ijaz; Ahn, Sang Un; Ahn, Sul-Ah; Aimo, Ilaria; Aiola, Salvatore; Ajaz, Muhammad; Akindinov, Alexander; Alam, Sk Noor; Aleksandrov, Dmitry; Alessandro, Bruno; Alexandre, Didier; Alici, Andrea; Alkin, Anton; Alme, Johan; Alt, Torsten; Altinpinar, Sedat; Altsybeev, Igor; Alves Garcia Prado, Caio; Andrei, Cristian; Andronic, Anton; Anguelov, Venelin; Anielski, Jonas; Anticic, Tome; Antinori, Federico; Antonioli, Pietro; Aphecetche, Laurent Bernard; Appelshaeuser, Harald; Arcelli, Silvia; Armesto Perez, Nestor; Arnaldi, Roberta; Aronsson, Tomas; Arsene, Ionut Cristian; Arslandok, Mesut; Augustinus, Andre; Averbeck, Ralf Peter; Awes, Terry; Azmi, Mohd Danish; Bach, Matthias Jakob; Badala, Angela; Baek, Yong Wook; Bagnasco, Stefano; Bailhache, Raphaelle Marie; Bala, Renu; Baldisseri, Alberto; Baltasar Dos Santos Pedrosa, Fernando; Baral, Rama Chandra; Barbera, Roberto; Barile, Francesco; Barnafoldi, Gergely Gabor; Barnby, Lee Stuart; Ramillien Barret, Valerie; Bartke, Jerzy Gustaw; Basile, Maurizio; Bastid, Nicole; Basu, Sumit; Bathen, Bastian; Batigne, Guillaume; Batista Camejo, Arianna; Batyunya, Boris; Batzing, Paul Christoph; Baumann, Christoph Heinrich; Bearden, Ian Gardner; Beck, Hans; Bedda, Cristina; Behera, Nirbhay Kumar; Belikov, Iouri; Bellini, Francesca; Bellwied, Rene; Belmont Moreno, Ernesto; Belmont Iii, Ronald John; Belyaev, Vladimir; Bencedi, Gyula; Beole, Stefania; Berceanu, Ionela; Bercuci, Alexandru; Berdnikov, Yaroslav; Berenyi, Daniel; Berger, Martin Emanuel; Bertens, Redmer Alexander; Berzano, Dario; Betev, Latchezar; Bhasin, Anju; Bhat, Inayat Rasool; Bhati, Ashok Kumar; Bhattacharjee, Buddhadeb; Bhom, Jihyun; Bianchi, Livio; Bianchi, Nicola; Bianchin, Chiara; Bielcik, Jaroslav; Bielcikova, Jana; Bilandzic, Ante; Bjelogrlic, Sandro; Blanco, Fernando; Blau, Dmitry; Blume, Christoph; Bock, Friederike; Bogdanov, Alexey; Boggild, Hans; Bogolyubskiy, Mikhail; Boehmer, Felix Valentin; Boldizsar, Laszlo; Bombara, Marek; Book, Julian Heinz; Borel, Herve; Borissov, Alexander; Borri, Marcello; Bossu, Francesco; Botje, Michiel; Botta, Elena; Boettger, Stefan; Braun-Munzinger, Peter; Bregant, Marco; Breitner, Timo Gunther; Broker, Theo Alexander; Browning, Tyler Allen; Broz, Michal; Bruna, Elena; Bruno, Giuseppe Eugenio; Budnikov, Dmitry; Buesching, Henner; Bufalino, Stefania; Buncic, Predrag; Busch, Oliver; Buthelezi, Edith Zinhle; Caffarri, Davide; Cai, Xu; Caines, Helen Louise; Calero Diaz, Liliet; Caliva, Alberto; Calvo Villar, Ernesto; Camerini, Paolo; Carena, Francesco; Carena, Wisla; Castillo Castellanos, Javier Ernesto; Castro, Andrew John; Casula, Ester Anna Rita; Catanescu, Vasile Ioan; Cavicchioli, Costanza; Ceballos Sanchez, Cesar; Cepila, Jan; Cerello, Piergiorgio; Chang, Beomsu; Chapeland, Sylvain; Charvet, Jean-Luc Fernand; Chattopadhyay, Subhasis; Chattopadhyay, Sukalyan; Chelnokov, Volodymyr; Cherney, Michael Gerard; Cheshkov, Cvetan Valeriev; Cheynis, Brigitte; Chibante Barroso, Vasco Miguel; Dobrigkeit Chinellato, David; Chochula, Peter; Chojnacki, Marek; Choudhury, Subikash; Christakoglou, Panagiotis; Christensen, Christian Holm; Christiansen, Peter; Chujo, Tatsuya; Chung, Suh-Urk; Cicalo, Corrado; Cifarelli, Luisa; Cindolo, Federico; Cleymans, Jean Willy Andre; Colamaria, Fabio Filippo; Colella, Domenico; Collu, Alberto; Colocci, Manuel; Conesa Balbastre, Gustavo; Conesa Del Valle, Zaida; Connors, Megan Elizabeth; Contreras Nuno, Jesus Guillermo; Cormier, Thomas Michael; Corrales Morales, Yasser; Cortese, Pietro; Cortes Maldonado, Ismael; Cosentino, Mauro Rogerio; Costa, Filippo; Crochet, Philippe; Cruz Albino, Rigoberto; Cuautle Flores, Eleazar; Cunqueiro Mendez, Leticia; Dainese, Andrea; Dang, Ruina; Danu, Andrea; Das, Debasish; Das, Indranil; Das, Kushal; Das, Supriya; Dash, Ajay Kumar; Dash, Sadhana; De, Sudipan; Delagrange, Hugues; Deloff, Andrzej; Denes, Ervin Sandor; D'Erasmo, Ginevra; De Caro, Annalisa; De Cataldo, Giacinto; De Cuveland, Jan; De Falco, Alessandro; De Gruttola, Daniele; De Marco, Nora; De Pasquale, Salvatore; De Rooij, Raoul Stefan; Diaz Corchero, Miguel Angel; Dietel, Thomas; Dillenseger, Pascal; Divia, Roberto; Di Bari, Domenico; Di Liberto, Sergio; Di Mauro, Antonio; Di Nezza, Pasquale; Djuvsland, Oeystein; Dobrin, Alexandru Florin; Dobrowolski, Tadeusz Antoni; Domenicis Gimenez, Diogenes; Donigus, Benjamin; Dordic, Olja; Dorheim, Sverre; Dubey, Anand Kumar; Dubla, Andrea; Ducroux, Laurent; Dupieux, Pascal; Dutt Mazumder, Abhee Kanti; Hilden, Timo Eero; Ehlers Iii, Raymond James; Elia, Domenico; Engel, Heiko; Erazmus, Barbara Ewa; Erdal, Hege Austrheim; Eschweiler, Dominic; Espagnon, Bruno; Esposito, Marco; Estienne, Magali Danielle; Esumi, Shinichi; Evans, David; Evdokimov, Sergey; Fabris, Daniela; Faivre, Julien; Falchieri, Davide; Fantoni, Alessandra; Fasel, Markus; Fehlker, Dominik; Feldkamp, Linus; Felea, Daniel; Feliciello, Alessandro; Feofilov, Grigory; Ferencei, Jozef; Fernandez Tellez, Arturo; Gonzalez Ferreiro, Elena; Ferretti, Alessandro; Festanti, Andrea; Figiel, Jan; Araujo Silva Figueredo, Marcel; Filchagin, Sergey; Finogeev, Dmitry; Fionda, Fiorella; Fiore, Enrichetta Maria; Floratos, Emmanouil; Floris, Michele; Foertsch, Siegfried Valentin; Foka, Panagiota; Fokin, Sergey; Fragiacomo, Enrico; Francescon, Andrea; Frankenfeld, Ulrich Michael; Fuchs, Ulrich; Furget, Christophe; Furs, Artur; Fusco Girard, Mario; Gaardhoeje, Jens Joergen; Gagliardi, Martino; Gago Medina, Alberto Martin; Gallio, Mauro; Gangadharan, Dhevan Raja; Ganoti, Paraskevi; Gao, Chaosong; Garabatos Cuadrado, Jose; Garcia-Solis, Edmundo Javier; Gargiulo, Corrado; Garishvili, Irakli; Gerhard, Jochen; Germain, Marie; Gheata, Andrei George; Gheata, Mihaela; Ghidini, Bruno; Ghosh, Premomoy; Ghosh, Sanjay Kumar; Gianotti, Paola; Giubellino, Paolo; Gladysz-Dziadus, Ewa; Glassel, Peter; Gomez Ramirez, Andres; Gonzalez Zamora, Pedro; Gorbunov, Sergey; Gorlich, Lidia Maria; Gotovac, Sven; Graczykowski, Lukasz Kamil; Grelli, Alessandro; Grigoras, Alina Gabriela; Grigoras, Costin; Grigoryev, Vladislav; Grigoryan, Ara; Grigoryan, Smbat; Grynyov, Borys; Grion, Nevio; Grosse-Oetringhaus, Jan Fiete; Grossiord, Jean-Yves; Grosso, Raffaele; Guber, Fedor; Guernane, Rachid; Guerzoni, Barbara; Guilbaud, Maxime Rene Joseph; Gulbrandsen, Kristjan Herlache; Gulkanyan, Hrant; Gumbo, Mervyn; Gunji, Taku; Gupta, Anik; Gupta, Ramni; Khan, Kamal; Haake, Rudiger; Haaland, Oystein Senneset; Hadjidakis, Cynthia Marie; Haiduc, Maria; Hamagaki, Hideki; Hamar, Gergoe; Hanratty, Luke David; Hansen, Alexander; Harris, John William; Hartmann, Helvi; Harton, Austin Vincent; Hatzifotiadou, Despina; Hayashi, Shinichi; Heckel, Stefan Thomas; Heide, Markus Ansgar; Helstrup, Haavard; Herghelegiu, Andrei Ionut; Herrera Corral, Gerardo Antonio; Hess, Benjamin Andreas; Hetland, Kristin Fanebust; Hippolyte, Boris; Hladky, Jan; Hristov, Peter Zahariev; Huang, Meidana; Humanic, Thomas; Hussain, Nur; Hussain, Tahir; Hutter, Dirk; Hwang, Dae Sung; Ilkaev, Radiy; Ilkiv, Iryna; Inaba, Motoi; Innocenti, Gian Michele; Ionita, Costin; Ippolitov, Mikhail; Irfan, Muhammad; Ivanov, Marian; Ivanov, Vladimir; Jacholkowski, Adam Wlodzimierz; Jacobs, Peter Martin; Jahnke, Cristiane; Jang, Haeng Jin; Janik, Malgorzata Anna; Pahula Hewage, Sandun; Jena, Chitrasen; Jena, Satyajit; Jimenez Bustamante, Raul Tonatiuh; Jones, Peter Graham; Jung, Hyungtaik; Jusko, Anton; Kadyshevskiy, Vladimir; Kalinak, Peter; Kalweit, Alexander Philipp; Kamin, Jason Adrian; Kang, Ju Hwan; Kaplin, Vladimir; Kar, Somnath; Karasu Uysal, Ayben; Karavichev, Oleg; Karavicheva, Tatiana; Karpechev, Evgeny; Kebschull, Udo Wolfgang; Keidel, Ralf; Keijdener, Darius Laurens; Keil, Markus; Khan, Mohammed Mohisin; Khan, Palash; Khan, Shuaib Ahmad; Khanzadeev, Alexei; Kharlov, Yury; Kileng, Bjarte; Kim, Beomkyu; Kim, Do Won; Kim, Dong Jo; Kim, Jinsook; Kim, Mimae; Kim, Minwoo; Kim, Se Yong; Kim, Taesoo; Kirsch, Stefan; Kisel, Ivan; Kiselev, Sergey; Kisiel, Adam Ryszard; Kiss, Gabor; Klay, Jennifer Lynn; Klein, Jochen; Klein-Boesing, Christian; Kluge, Alexander; Knichel, Michael Linus; Knospe, Anders Garritt; Kobdaj, Chinorat; Kofarago, Monika; Kohler, Markus Konrad; Kollegger, Thorsten; Kolozhvari, Anatoly; Kondratev, Valerii; Kondratyeva, Natalia; Konevskikh, Artem; Kovalenko, Vladimir; Kowalski, Marek; Kox, Serge; Koyithatta Meethaleveedu, Greeshma; Kral, Jiri; Kralik, Ivan; Kravcakova, Adela; Krelina, Michal; Kretz, Matthias; Krivda, Marian; Krizek, Filip; Kryshen, Evgeny; Krzewicki, Mikolaj; Kucera, Vit; Kucheryaev, Yury; Kugathasan, Thanushan; Kuhn, Christian Claude; Kuijer, Paulus Gerardus; Kulakov, Igor; Kumar, Jitendra; Kurashvili, Podist; Kurepin, Alexander; Kurepin, Alexey; Kuryakin, Alexey; Kushpil, Svetlana; Kweon, Min Jung; Kwon, Youngil; Ladron De Guevara, Pedro; Lagana Fernandes, Caio; Lakomov, Igor; Langoy, Rune; Lara Martinez, Camilo Ernesto; Lardeux, Antoine Xavier; Lattuca, Alessandra; La Pointe, Sarah Louise; La Rocca, Paola; Lea, Ramona; Leardini, Lucia; Lee, Graham Richard; Legrand, Iosif; Lehnert, Joerg Walter; Lemmon, Roy Crawford; Lenti, Vito; Leogrande, Emilia; Leoncino, Marco; Leon Monzon, Ildefonso; Levai, Peter; Li, Shuang; Lien, Jorgen Andre; Lietava, Roman; Lindal, Svein; Lindenstruth, Volker; Lippmann, Christian; Lisa, Michael Annan; Ljunggren, Hans Martin; Lodato, Davide Francesco; Lonne, Per-Ivar; Loggins, Vera Renee; Loginov, Vitaly; Lohner, Daniel; Loizides, Constantinos; Lopez, Xavier Bernard; Lopez Torres, Ernesto; Lu, Xianguo; Luettig, Philipp Johannes; Lunardon, Marcello; Luparello, Grazia; Ma, Rongrong; Maevskaya, Alla; Mager, Magnus; Mahapatra, Durga Prasad; Mahmood, Sohail Musa; Maire, Antonin; Majka, Richard Daniel; Malaev, Mikhail; Maldonado Cervantes, Ivonne Alicia; Malinina, Liudmila; Mal'Kevich, Dmitry; Malzacher, Peter; Mamonov, Alexander; Manceau, Loic Henri Antoine; Manko, Vladislav; Manso, Franck; Manzari, Vito; Marchisone, Massimiliano; Mares, Jiri; Margagliotti, Giacomo Vito; Margotti, Anselmo; Marin, Ana Maria; Markert, Christina; Marquard, Marco; Martashvili, Irakli; Martin, Nicole Alice; Martinengo, Paolo; Martinez Hernandez, Mario Ivan; Martinez-Garcia, Gines; Martin Blanco, Javier; Martynov, Yevgen; Mas, Alexis Jean-Michel; Masciocchi, Silvia; Masera, Massimo; Masoni, Alberto; Massacrier, Laure Marie; Mastroserio, Annalisa; Matyja, Adam Tomasz; Mayer, Christoph; Mazer, Joel Anthony; Mazzoni, Alessandra Maria; Mcdonald, Daniel; Meddi, Franco; Menchaca-Rocha, Arturo Alejandro; Meninno, Elisa; Mercado-Perez, Jorge; Meres, Michal; Miake, Yasuo; Mikhaylov, Konstantin; Milano, Leonardo; Milosevic, Jovan; Mischke, Andre; Mishra, Aditya Nath; Miskowiec, Dariusz Czeslaw; Mitra, Jubin; Mitu, Ciprian Mihai; Mlynarz, Jocelyn; Mohammadi, Naghmeh; Mohanty, Bedangadas; Molnar, Levente; Montano Zetina, Luis Manuel; Montes Prado, Esther; Morando, Maurizio; Moreira De Godoy, Denise Aparecida; Moretto, Sandra; Morreale, Astrid; Morsch, Andreas; Muccifora, Valeria; Mudnic, Eugen; Muhlheim, Daniel Michael; Muhuri, Sanjib; Mukherjee, Maitreyee; Muller, Hans; Gameiro Munhoz, Marcelo; Murray, Sean; Musa, Luciano; Musinsky, Jan; Nandi, Basanta Kumar; Nania, Rosario; Nappi, Eugenio; Nattrass, Christine; Nayak, Kishora; Nayak, Tapan Kumar; Nazarenko, Sergey; Nedosekin, Alexander; Nicassio, Maria; Niculescu, Mihai; Niedziela, Jeremi; Nielsen, Borge Svane; Nikolaev, Sergey; Nikulin, Sergey; Nikulin, Vladimir; Nilsen, Bjorn Steven; Noferini, Francesco; Nomokonov, Petr; Nooren, Gerardus; Norman, Jaime; Nyanin, Alexander; Nystrand, Joakim Ingemar; Oeschler, Helmut Oskar; Oh, Saehanseul; Oh, Sun Kun; Okatan, Ali; Okubo, Tsubasa; Olah, Laszlo; Oleniacz, Janusz; Oliveira Da Silva, Antonio Carlos; Onderwaater, Jacobus; Oppedisano, Chiara; Ortiz Velasquez, Antonio; Oskarsson, Anders Nils Erik; Otwinowski, Jacek Tomasz; Oyama, Ken; Ozdemir, Mahmut; Sahoo, Pragati; Pachmayer, Yvonne Chiara; Pachr, Milos; Pagano, Paola; Paic, Guy; Pajares Vales, Carlos; Pal, Susanta Kumar; Palmeri, Armando; Pant, Divyash; Papikyan, Vardanush; Pappalardo, Giuseppe; Pareek, Pooja; Park, Woojin; Parmar, Sonia; Passfeld, Annika; Patalakha, Dmitry; Paticchio, Vincenzo; Paul, Biswarup; Pawlak, Tomasz Jan; Peitzmann, Thomas; Pereira Da Costa, Hugo Denis Antonio; Pereira De Oliveira Filho, Elienos; Peresunko, Dmitry Yurevich; Perez Lara, Carlos Eugenio; Pesci, Alessandro; Peskov, Vladimir; Pestov, Yury; Petracek, Vojtech; Petran, Michal; Petris, Mariana; Petrovici, Mihai; Petta, Catia; Piano, Stefano; Pikna, Miroslav; Pillot, Philippe; Pinazza, Ombretta; Pinsky, Lawrence; Piyarathna, Danthasinghe; Ploskon, Mateusz Andrzej; Planinic, Mirko; Pluta, Jan Marian; Pochybova, Sona; Podesta Lerma, Pedro Luis Manuel; Poghosyan, Martin; Pohjoisaho, Esko Heikki Oskari; Polishchuk, Boris; Poljak, Nikola; Pop, Amalia; Porteboeuf, Sarah Julie; Porter, R Jefferson; Potukuchi, Baba; Prasad, Sidharth Kumar; Preghenella, Roberto; Prino, Francesco; Pruneau, Claude Andre; Pshenichnov, Igor; Puccio, Maximiliano; Puddu, Giovanna; Pujahari, Prabhat Ranjan; Punin, Valery; Putschke, Jorn Henning; Qvigstad, Henrik; Rachevski, Alexandre; Raha, Sibaji; Rajput, Sonia; Rak, Jan; Rakotozafindrabe, Andry Malala; Ramello, Luciano; Raniwala, Rashmi; Raniwala, Sudhir; Rasanen, Sami Sakari; Rascanu, Bogdan Theodor; Rathee, Deepika; Rauf, Aamer Wali; Razazi, Vahedeh; Read, Kenneth Francis; Real, Jean-Sebastien; Redlich, Krzysztof; Reed, Rosi Jan; Rehman, Attiq Ur; Reichelt, Patrick Simon; Reicher, Martijn; Reidt, Felix; Renfordt, Rainer Arno Ernst; Reolon, Anna Rita; Reshetin, Andrey; Rettig, Felix Vincenz; Revol, Jean-Pierre; Reygers, Klaus Johannes; Riabov, Viktor; Ricci, Renato Angelo; Richert, Tuva Ora Herenui; Richter, Matthias Rudolph; Riedler, Petra; Riegler, Werner; Riggi, Francesco; Rivetti, Angelo; Rocco, Elena; Rodriguez Cahuantzi, Mario; Rodriguez Manso, Alis; Roeed, Ketil; Rogochaya, Elena; Sharma, Rohni; Rohr, David Michael; Roehrich, Dieter; Romita, Rosa; Ronchetti, Federico; Ronflette, Lucile; Rosnet, Philippe; Rossi, Andrea; Roukoutakis, Filimon; Roy, Ankhi; Roy, Christelle Sophie; Roy, Pradip Kumar; Rubio Montero, Antonio Juan; Rui, Rinaldo; Russo, Riccardo; Ryabinkin, Evgeny; Ryabov, Yury; Rybicki, Andrzej; Sadovskiy, Sergey; Safarik, Karel; Sahlmuller, Baldo; Sahoo, Raghunath; Sahoo, Sarita; Sahu, Pradip Kumar; Saini, Jogender; Sakai, Shingo; Salgado Lopez, Carlos Alberto; Salzwedel, Jai Samuel Nielsen; Sambyal, Sanjeev Singh; Samsonov, Vladimir; Sanchez Castro, Xitzel; Sanchez Rodriguez, Fernando Javier; Sandor, Ladislav; Sandoval, Andres; Sano, Masato; Santagati, Gianluca; Sarkar, Debojit; Scapparone, Eugenio; Scarlassara, Fernando; Scharenberg, Rolf Paul; Schiaua, Claudiu Cornel; Schicker, Rainer Martin; Schmidt, Christian Joachim; Schmidt, Hans Rudolf; Schuchmann, Simone; Schukraft, Jurgen; Schulc, Martin; Schuster, Tim Robin; Schutz, Yves Roland; Schwarz, Kilian Eberhard; Schweda, Kai Oliver; Scioli, Gilda; Scomparin, Enrico; Scott, Rebecca Michelle; Segato, Gianfranco; Seger, Janet Elizabeth; Sekiguchi, Yuko; Selyuzhenkov, Ilya; Senosi, Kgotlaesele; Seo, Jeewon; Serradilla Rodriguez, Eulogio; Sevcenco, Adrian; Shabetai, Alexandre; Shabratova, Galina; Shahoyan, Ruben; Shangaraev, Artem; Sharma, Ankita; Sharma, Natasha; Sharma, Satish; Shigaki, Kenta; Shtejer Diaz, Katherin; Sibiryak, Yury; Siddhanta, Sabyasachi; Siemiarczuk, Teodor; Silvermyr, David Olle Rickard; Silvestre, Catherine Micaela; Simatovic, Goran; Singaraju, Rama Narayana; Singh, Ranbir; Singha, Subhash; Singhal, Vikas; Sinha, Bikash; Sarkar - Sinha, Tinku; Sitar, Branislav; Sitta, Mario; Skaali, Bernhard; Skjerdal, Kyrre; Slupecki, Maciej; Smirnov, Nikolai; Snellings, Raimond; Soegaard, Carsten; Soltz, Ron Ariel; Song, Jihye; Song, Myunggeun; Soramel, Francesca; Sorensen, Soren Pontoppidan; Spacek, Michal; Spiriti, Eleuterio; Sputowska, Iwona Anna; Spyropoulou-Stassinaki, Martha; Srivastava, Brijesh Kumar; Stachel, Johanna; Stan, Ionel; Stefanek, Grzegorz; Steinpreis, Matthew Donald; Stenlund, Evert Anders; Steyn, Gideon Francois; Stiller, Johannes Hendrik; Stocco, Diego; Stolpovskiy, Mikhail; Strmen, Peter; Alarcon Do Passo Suaide, Alexandre; Sugitate, Toru; Suire, Christophe Pierre; Suleymanov, Mais Kazim Oglu; Sultanov, Rishat; Sumbera, Michal; Symons, Timothy; Szabo, Alexander; Szanto De Toledo, Alejandro; Szarka, Imrich; Szczepankiewicz, Adam; Szymanski, Maciej Pawel; Takahashi, Jun; Tangaro, Marco-Antonio; Tapia Takaki, Daniel Jesus; Tarantola Peloni, Attilio; Tarazona Martinez, Alfonso; Tariq, Mohammad; Tarzila, Madalina-Gabriela; Tauro, Arturo; Tejeda Munoz, Guillermo; Telesca, Adriana; Terasaki, Kohei; Terrevoli, Cristina; Thaeder, Jochen Mathias; Thomas, Deepa; Tieulent, Raphael Noel; Timmins, Anthony Robert; Toia, Alberica; Trubnikov, Victor; Trzaska, Wladyslaw Henryk; Tsuji, Tomoya; Tumkin, Alexandr; Turrisi, Rosario; Tveter, Trine Spedstad; Ullaland, Kjetil; Uras, Antonio; Usai, Gianluca; Vajzer, Michal; Vala, Martin; Valencia Palomo, Lizardo; Vallero, Sara; Vande Vyvre, Pierre; Van Der Maarel, Jasper; Van Hoorne, Jacobus Willem; Van Leeuwen, Marco; Diozcora Vargas Trevino, Aurora; Vargyas, Marton; Varma, Raghava; Vasileiou, Maria; Vasiliev, Andrey; Vechernin, Vladimir; Veldhoen, Misha; Velure, Arild; Venaruzzo, Massimo; Vercellin, Ermanno; Vergara Limon, Sergio; Vernet, Renaud; Verweij, Marta; Vickovic, Linda; Viesti, Giuseppe; Viinikainen, Jussi Samuli; Vilakazi, Zabulon; Villalobos Baillie, Orlando; Vinogradov, Alexander; Vinogradov, Leonid; Vinogradov, Yury; Virgili, Tiziano; Vislavicius, Vytautas; Viyogi, Yogendra; Vodopyanov, Alexander; Volkl, Martin Andreas; Voloshin, Kirill; Voloshin, Sergey; Volpe, Giacomo; Von Haller, Barthelemy; Vorobyev, Ivan; Vranic, Danilo; Vrlakova, Janka; Vulpescu, Bogdan; Vyushin, Alexey; Wagner, Boris; Wagner, Jan; Wagner, Vladimir; Wang, Mengliang; Wang, Yifei; Watanabe, Daisuke; Weber, Michael; Weber, Steffen Georg; Wessels, Johannes Peter; Westerhoff, Uwe; Wiechula, Jens; Wikne, Jon; Wilde, Martin Rudolf; Wilk, Grzegorz Andrzej; Wilkinson, Jeremy John; Williams, Crispin; Windelband, Bernd Stefan; Winn, Michael Andreas; Yaldo, Chris G; Yamaguchi, Yorito; Yang, Hongyan; Yang, Ping; Yang, Shiming; Yano, Satoshi; Yasnopolskiy, Stanislav; Yi, Jungyu; Yin, Zhongbao; Yoo, In-Kwon; Yushmanov, Igor; Zaborowska, Anna; Zaccolo, Valentina; Zaman, Ali; Zampolli, Chiara; Zaporozhets, Sergey; Zarochentsev, Andrey; Zavada, Petr; Zavyalov, Nikolay; Zbroszczyk, Hanna Paulina; Zgura, Sorin Ion; Zhalov, Mikhail; Zhang, Haitao; Zhang, Xiaoming; Zhang, Yonghong; Zhao, Chengxin; Zhigareva, Natalia; Zhou, Daicui; Zhou, Fengchu; Zhou, You; Zhou, Zhuo; Zhu, Hongsheng; Zhu, Jianhui; Zhu, Xiangrong; Zichichi, Antonino; Zimmermann, Alice; Zimmermann, Markus Bernhard; Zinovjev, Gennady; Zoccarato, Yannick Denis; Zyzak, Maksym

    2015-06-22

    The differential charged jet cross sections, jet fragmentation distributions, and jet shapes are measured in minimum bias proton-proton collisions at centre-of-mass energy sqrt(s) = 7 TeV using the ALICE detector at the LHC. Jets are reconstructed from charged particle momenta in the mid-rapidity region using the sequential recombination k T and anti-k T as well as the SISCone jet finding algorithms with several resolution parameters in the range R = 0.2 – 0.6. Differential jet production cross sections measured with the three jet finders are in agreement in the transverse momentum (pT) interval 20)of the reconstructed jet pT. The fragmentation of leading jets with R = 0.4 using scaled pT spectra of the jet constituents is studied. The measurements are compared to model calculations from event generators (PYTHIA, PHOJET, HERWIG). The measured radial density distributions and distributions are well described by the PYTHIA model (tune Perugia-2011). The fragmentation distributions are better described by HER...

  19. Measurement of Production Properties of Positively Charged Kaons in Proton-Carbon Interactions at 31 GeV/c

    CERN Document Server

    Abgrall, N.; Anticic, T.; Antoniou, N.; Argyriades, J.; Baatar, B.; Blondel, A.; Blumer, J.; Bogusz, M.; Boldizsar, L.; Bravar, A.; Brooks, W.; Brzychczyk, J.; Bubak, A.; Bunyatov, S.A.; Busygina, O.; Cetner, T.; Choi, K.U.; Christakoglou, P.; Czopowicz, T.; Davis, N.; Diakonos, F.; Di Luise, S.; Dominik, W.; Dumarchez, J.; Engel, R.; Ereditato, A.; Esposito, L.S.; Feofilov, G.A.; Fodor, Z.; Ferrero, A.; Fulop, A.; Garrido, X.; Gazdzicki, M.; Golubeva, M.; Grebieszkow, K.; Grzeszczuk, A.; Guber, F.; Haesler, A.; Hakobyan, H.; Hasegawa, T.; Idczak, R.; Ivanov, Y.; Ivashkin, A.; Kadija, K.; Kapoyannis, A.; Katrynska, N.; Kielczewska, D.; Kikola, D.; Kim, J.H.; Kirejczyk, M.; Kisiel, J.; Kobayashi, T.; Kochebina, O.; Kolesnikov, V.I.; Kolev, D.; Kondratiev, V.P.; Korzenev, A.; Kowalski, S.; Krasnoperov, A.; Kuleshov, S.; Kurepin, A.; Lacey, R.; Lagoda, J.; Laszlo, A.; Lyubushkin, V.V.; Mackowiak-Pawlowska, M.; Majka, Z.; Malakhov, A.I.; Marchionni, A.; Marcinek, A.; Maris, I.; Marin, V.; Matulewicz, T.; Matveev, V.; Melkumov, G.L.; Meregaglia, A.; Messina, M.; Mrowczynski, St.; Murphy, S.; Nakadaira, T.; Nishikawa, K.; Palczewski, T.; Palla, G.; Panagiotou, A.D.; Paul, T.; Peryt, W.; Petukhov, O.; Planeta, R.; Pluta, J.; Popov, B.A.; Posiadala, M.; Pulawski, S.; Rauch, W.; Ravonel, M.; Renfordt, R.; Robert, A.; Rohrich, D.; Rondio, E.; Rossi, B.; Roth, M.; Rubbia, A.; Rybczynski, M.; Sadovsky, A.; Sakashita, K.; Sekiguchi, T.; Seyboth, P.; Shibata, M.; Skrzypczak, E.; Slodkowski, M.; Staszel, P.; Stefanek, G.; Stepaniak, J.; Strabel, C.; Strobele, H.; Susa, T.; Szaflik, P.; Szuba, M.; Tada, M.; Taranenko, A.; Tereshchenko, V.; Tsenov, R.; Turko, L.; Ulrich, R.; Unger, M.; Vassiliou, M.; Veberic, D.; Vechernin, V.V.; Vesztergombi, G.; Wilczek, A.; Wlodarczyk, Z.; Wojtaszek-Szwarc, A.; Yi, J.G.; Yoo, I.K.; Zambelli, L.; Zipper, W.

    2012-01-01

    Spectra of positively charged kaons in p+C interactions at 31 GeV/c were measured with the NA61/SHINE spectrometer at the CERN SPS. The analysis is based on the full set of data collected in 2007 with a graphite target with a thickness of 4% of a nuclear interaction length. Interaction cross sections and charged pion spectra were already measured using the same set of data. These new measurements in combination with the published ones are required to improve predictions of the neutrino flux for the T2K long baseline neutrino oscillation experiment in Japan. In particular, the knowledge of kaon production is crucial for precisely predicting the intrinsic electron neutrino component and the high energy tail of the T2K beam. The results are presented as a function of laboratory momentum in 2 intervals of the laboratory polar angle covering the range from 20 up to 240 mrad. The kaon spectra are compared with predictions of several hadron production models. Using the published...

  20. Influence of 1D and 2D Carbon Fillers and Their Functionalisation on Crystallisation and Thermomechanical Properties of Injection Moulded Nylon 6,6 Nanocomposites

    Directory of Open Access Journals (Sweden)

    Fabiola Navarro-Pardo

    2014-01-01

    Full Text Available Carbon nanotubes (CNTs and graphene were used as reinforcing fillers in nylon 6,6 in order to obtain nanocomposites by using an injection moulding process. The two differently structured nanofillers were used in their pristine or reduced form, after oxidation treatment and after amino functionalisation. Three low nanofiller contents were employed. Crystallisation behaviour and perfection of nylon 6,6 crystals were determined by differential scanning calorimetry and wide angle X-ray diffraction, respectively. Crystallinity was slightly enhanced in most samples as the content of the nanofillers was increased. The dimensionality of the materials was found to provide different interfaces and therefore different features in the nylon 6,6 crystal growth resulting in improved crystal perfection. Dynamical, mechanical analysis showed the maximum increases provided by the two nanostructures correspond to the addition of 0.1 wt.% amino functionalised CNTs, enhancing in 30% the storage modulus and the incorporation of 0.5 wt.% of graphene oxide caused an increase of 44% in this property. The latter also provided better thermal stability when compared to pure nylon 6,6 under inert conditions. The superior properties of graphene nanocomposites were attributed to the larger surface area of the two-dimensional graphene compared to the one-dimensional CNTs.