WorldWideScience

Sample records for charge injection ein

  1. Charge injection across a polymeric heterojunction

    NARCIS (Netherlands)

    van Woudenbergh, T; Wildeman, J; Blom, PWM

    2005-01-01

    The charge injection across a polymeric heterojunction of a poly-p-phenylene vinylene derivative (injecting layer) and poly (9,9-dioctylfluorene) (accepting layer) is investigated. The electric field in the accepting layer is obtained after correcting the applied voltage for the voltage drop across

  2. Localization and delocalization of charges injected in DNA

    OpenAIRE

    Heim, Thomas; Melin, Thierry; Deresmes, Dominique; Vuillaume, Dominique

    2004-01-01

    To be published in Appl. Phys. Lett. The electrical properties of DNA molecules are investigated by charge injection and electric force microscopy experiments. Prior to injection, DNA molecules exhibit a weak positively charged state. We probe the electrical behaviour of DNA by measuring the localized or delocalized character of the DNA charge states upon injection of excess charges. We show that injected charges do not delocalize for overstretched DNA prepared by a receding meniscus techn...

  3. Inductive charging of electric cars. A techno-economic assessment; Induktives Laden von Elektromobilen. Eine techno-oekonomische Bewertung

    Energy Technology Data Exchange (ETDEWEB)

    Schraven, Sebastian; Kley, Fabian; Wietschel, Martin [Fraunhofer-Institut fuer System- und Innovationsforschung (ISI), Karlsruhe (Germany). Competence Center Energy Politik und Energie Systeme

    2010-07-01

    Most concepts for charging of electric vehicles are based on cables that must be plugged in and out. In case of frequent charging or short-term charging, however, this may be impractical, and an inductive (cableless) solution would be preferable. The contribution attempts to analyze if inductive power transmission is technically feasible in electric vehicles, and in what areas it will be economically attractive to users. To begin with, the two charging technologies are presented and compared. This is followed by a cost assessment. It is found that the inductive technology involves significant additional cost, so it cannot be expected to spread quickly. In certain conditions, however, it may be applicable as a niche technology in certain commercial applications, e.g. taxis. (orig.) [German] In den bisher diskutierten Konzepten zur Ladung von Elektrofahrzeugen ist die kabelgebundene (konduktive) Ladung vorherrschend, bei der der Nutzer das Kabel zur Ladung ein- bzw. wieder ausstecken muss. Haeufige Ladevorgaenge und insbesondere Kurzladungen lassen jedoch dieses Ein- und Ausstecken neben der reduzierten Reichweite des Elektrofahrzeugs unpraktisch in der Nutzung erscheinen. Demgegenueber bietet die induktive (kabellose) Energieuebertragung das Laden ohne erforderlichen Nutzereingriff. Der vorliegende Artikel versucht die Fragen zu beantworten, ob ein Einsatz der induktiven Energieuebertragung bereits technisch zur Ladung von Elektrofahrzeugen realisierbar ist, und in welchen Bereichen diese eine wirtschaftlich attraktive Loesung fuer den Nutzer darstellt. Dazu werden zunaechst die Ladetechnologien vor- und technisch gegenuebergestellt. Auf Basis einer Kostenbetrachtung ist auch ein oekonomischer Vergleich der beiden Ladetechnologien moeglich. Es zeigt sich, dass aus wirtschaftlicher Sicht aufgrund signifikanter Mehrkosten vorlaeufig kein weitverbreiteter Einsatz der induktiven Technik zu erwarten ist. Unter bestimmten Voraussetzungen ergibt sich aber ein begrenztes

  4. Extracting electrode space charge limited current: Charge injection into conjugated polyelectrolytes with a semiconductor electrode

    Science.gov (United States)

    Walker, Ethan M.; Lonergan, Mark C.

    2016-05-01

    Conjugated polyelectrolytes and related mixed ionic-electronic conductors (MIECs) are being explored for energy applications including solid-state lighting and photovoltaics. Fundamental models of charge injection into MIECs have been primarily developed for MIECs contacted with highly conductive or metal electrodes (MEs), despite many potential applications involving semiconductors. We theoretically and experimentally demonstrate that an appropriate semiconductor electrode (SE), n-type for electron or p-type of hole injection, can limit injection into MIECs. When the SE is the injecting electrode and is under accumulation, there is little difference from a ME. When the SE acts as the extracting electrode, however, injection into the MIEC can be limited because a fraction of any applied bias must support charge depletion in the semiconductor rather than charge injection into the MIEC. In a ME/MIEC/SE system, this can lead to significant asymmetry in current-voltage and injected charge-voltage behavior.

  5. Charge Injection From Carbon Nanofibers Into Hexane Under Ambient Conditions

    NARCIS (Netherlands)

    Agiral, A.; Eral, H.B.; Ende, van den D.; Gardeniers, J.G.E.

    2011-01-01

    The observation of charge injection from carbon nanofibers (CNFs) into liquid hexane under ambient conditions is reported. A CNF-coated electrode and a counter electrode are brought into micrometer proximity in a quasi-parallel geometry using a strain-gauge-based proximity sensor. Controlled charge

  6. Laser-Assisted H- Charge Exchange Injection in Magnetic Fields

    Energy Technology Data Exchange (ETDEWEB)

    Gorlov, Timofey V [ORNL; Danilov, Viatcheslav V [ORNL; Shishlo, Andrei P [ORNL

    2010-01-01

    The use of stripping foils for charge exchange injection can cause a number of operational problems in high intensity hadron accelerators. A recently proposed three-step method of laser-assisted injection is capable of overcoming these problems. This paper presents advances in the physical model of laser-assisted charge exchange injection of H- beams and covers a wide field of atomic physics. The model allows the calculation of the evolution of an H0 beam taking into account spontaneous emission, field ionization and external electromagnetic fields. Some new data on the hydrogen atom related to the problem are calculated. The numerical calculations in the model use realistic descriptions of laser field and injection beam. Generally, the model can be used for design and optimization of a laser-assisted injection cell within an accelerator lattice. Example calculations of laser-assisted injection for an intermediate experiment at SNS in Oak Ridge and for the PS2 accelerator at CERN are presented. Two different schemes, distinctively characterized by various magnetic fields at the excitation point, are discussed. It was shown that the emittance growth of an injected beam can be drastically decreased by moving excitation point into a strong magnetic field.

  7. Laser-assisted H- charge exchange injection in magnetic fields

    Science.gov (United States)

    Gorlov, T.; Danilov, V.; Shishlo, A.

    2010-05-01

    The use of stripping foils for charge exchange injection can cause a number of operational problems in high intensity hadron accelerators. A recently proposed three-step method of laser-assisted injection is capable of overcoming these problems. This paper presents advances in the physical model of laser-assisted charge exchange injection of H- beams and covers a wide field of atomic physics. The model allows the calculation of the evolution of an H0 beam taking into account spontaneous emission, field ionization, and external electromagnetic fields. Some new data on the hydrogen atom related to the problem are calculated. The numerical calculations in the model use realistic descriptions of laser field and injection beam. Generally, the model can be used for design and optimization of a laser-assisted injection cell within an accelerator lattice. Example calculations of laser-assisted injection for an intermediate experiment at SNS in Oak Ridge and for the PS2 accelerator at CERN are presented. Two different schemes, distinctively characterized by various magnetic fields at the excitation point, are discussed. It was shown that the emittance growth of an injected beam can be drastically decreased by moving the excitation point into a strong magnetic field.

  8. Charge injection and transport in fluorene-based copolymers.

    Science.gov (United States)

    Fong, Hon Hang; Malliaras, George G.; Lu, Tianjian; Dunlap, David

    2007-03-01

    Fluorene-based copolymer is considered to be one of the most promising hole transporting and blue light-emitting conjugated polymers used in polymeric light-emitting diodes (PLEDs). Time-of-flight (TOF) technique has been employed to evaluate the charge drift mobility under a temperature range between 200 - 400 K at the thick film regime (1-10 micron). Meanwhile, contact ohmicity is studied by Dark Current Space Charge Limited Conduction (DISCLC) technique. Charge injection efficiencies from different electrical contacts are also studied and the corresponding injection barriers are independently investigated by photoemission and electroabsorption spectroscopies. Results show that the copolymers exhibit non-dispersive charge transport behavior and possess superior mobilities of up to 0.01cm^2V-1s-1 while single-carrier devices from various electrical contacts such as PEDOT:PSS are varied, depending on the chemical structure of amine component in the fluorene-triarylamine copolymers. Results will shed light on the enhancement of device efficiency and stability in the future polymer electronic devices.

  9. Method and Circuit for Injecting a Precise Amount of Charge onto a Circuit Node

    Science.gov (United States)

    Hancock, Bruce R. (Inventor)

    2016-01-01

    A method and circuit for injecting charge into a circuit node, comprising (a) resetting a capacitor's voltage through a first transistor; (b) after the resetting, pre-charging the capacitor through the first transistor; and (c) after the pre-charging, further charging the capacitor through a second transistor, wherein the second transistor is connected between the capacitor and a circuit node, and the further charging draws charge through the second transistor from the circuit node, thereby injecting charge into the circuit node.

  10. Requirements towards an ecologically based heavy vehicle charge for road haulage; Anforderungen an eine umweltorientierte Schwerverkehrsabgabe fuer den Strassengueterverkehr

    Energy Technology Data Exchange (ETDEWEB)

    Rothengatter, W.; Doll, K.

    2001-10-01

    The report investigates the consequences of introducing a kilometre-based road user charge for heavy goods vehicles with a gross weight over 12 tons on the German inter-urban road network in 2003. Starting from the calculations of average road infrastructure costs presented by the Government Commission for Infrastructure Financing in September 2000, toll levels of 0.25 DM exclusively on the motorway network and 0.40 DM on the entire inter-urban road network are used for the scenario development. In the latter case an additional improvement of railway service supply is considered. In all pricing scenarios charges are differentiated by vehicle weight (12 t-18 t, >18 t) and by emission standard (Pre-Euro - Euro-5). The effects of the resulting three pricing scenarios investigated embrace the shift of traffic to the secondary road network, productivity increase within the transport sector, effects on the fleet structure and the reactions of shippers with respect to transport demand, modal choice and location choice. For these purpose, different models, data sources and current experiences, mainly from Switzerland, have been applied. The results are expressed in changes of the vehicle mileage and the development of an environmental cost indicator by mode, road type, vehicle weight and emission factor in 2010. The study concludes, that due to the application of efficiency measures, increased cost burdens of the hauliers can be partly compensated. Thus, the estimated shift of demand from road to rail is found to be rather modest. In case of a charge of 0.40 DM on the entire road network, combined with an improved rail supply the demand for rail transport is estimated to increase by 14%, while road traffic decreases by only 3.3%. In case only the motorways are priced, a shift of vehicle mileage of 4% to the secondary network is calculated. Very positive conclusions are drawn on the possibility of increasing the share of clean lorries by a differentiation of tariffs by

  11. Switchable Charge Injection Barrier in an Organic Supramolecular Semiconductor.

    Science.gov (United States)

    Gorbunov, Andrey V; Haedler, Andreas T; Putzeys, Tristan; Zha, R Helen; Schmidt, Hans-Werner; Kivala, Milan; Urbanavičiu̅tė, Indre; Wübbenhorst, Michael; Meijer, E W; Kemerink, Martijn

    2016-06-22

    We disclose a supramolecular material that combines semiconducting and dipolar functionalities. The material consists of a discotic semiconducting carbonyl-bridged triarylamine core, which is surrounded by three dipolar amide groups. In thin films, the material self-organizes in a hexagonal columnar fashion through π-stacking of the molecular core and hydrogen bonding between the amide groups. Alignment by an electrical field in a simple metal/semiconductor/metal geometry induces a polar order in the interface layers near the metal contacts that can be reversibly switched, while the bulk material remains nonpolarized. On suitably chosen electrodes, the presence of an interfacial polarization field leads to a modulation of the barrier for charge injection into the semiconductor. Consequently, a reversible switching is possible between a high-resistance, injection-limited off-state and a low-resistance, space-charge-limited on-state. The resulting memory diode shows switchable rectification with on/off ratios of up to two orders of magnitude. This demonstrated multifunctionality of a single material is a promising concept toward possible application in low-cost, large-area, nonvolatile organic memories. PMID:27246280

  12. Controlled Electron Injection into Plasma Accelerators and Space Charge Estimates

    International Nuclear Information System (INIS)

    Plasma based accelerators are capable of producing electron sources which are ultra-compact (a few microns) and high energies (up to hundreds of MeVs) in much shorter distances than conventional accelerators. This is due to the large longitudinal electric field that can be excited without the limitation of breakdown as in RF structures.The characteristic scale length of the accelerating field is the plasma wavelength and for typical densities ranging from 1018 - 1019 cm-3, the accelerating fields and scale length can hence be on the order of 10-100GV/m and 10-40 mu m, respectively. The production of quasimonoenergetic beams was recently obtained in a regime relying on self-trapping of background plasma electrons, using a single laser pulse for wakefield generation. In this dissertation, we study the controlled injection via the beating of two lasers (the pump laser pulse creating the plasma wave and a second beam being propagated in opposite direction) which induce a localized injection of background plasma electrons. The aim of this dissertation is to describe in detail the physics of optical injection using two lasers, the characteristics of the electron beams produced (the micrometer scale plasma wavelength can result in femtosecond and even attosecond bunches) as well as a concise estimate of the effects of space charge on the dynamics of an ultra-dense electron bunch with a large energy spread

  13. Development of a plant-oil fuelable direct injection diesel engine suitable for series production; Entwicklung eines pflanzenoeltauglichen Dieselmotors mit Direkteinspritzung fuer Serienfertigung

    Energy Technology Data Exchange (ETDEWEB)

    Kampmann, H.J.

    1994-03-01

    A plant-oil-fuelable direct injection diesel engine has been developed. In its present design the engine has to be started with diesel fuel and switches automatically to plant oil as soon as the plant oil in the injection system (upstream the pump) reaches a temperature of more than 30 C. The engine has an efficiency of 42.5%, which is within the range achieved by comparable modern diesel engines. Due to the `soft` combustion, noise emissions are lower than those of diesel engines. Exhaust gas emissions are similar to those of diesel engines; the engine meets the `EURO I` exhaust gas norm and can be modified to comply with `EURO II`. Endurance tests on direct injection plant oil engines have shown that their operation is free of self-destructing effects. The engine is suitable for vehicles and farm machinery and as an energy generator on remote solitary farms and in the so-called Third World. (orig.) [Deutsch] Auf der Basis der Tabelle 3 liegt ein serienfaehiger Pflanzenoelmotor mit Direkteinspritzung vor (6 Datenblaetter als Anlage). Notwendig ist z.Z. das Starten mit Dieselkraftstoff und eine automatische Umschaltung auf Pflanzenoel, wenn das Pflanzenoel im Einspritzsystem (vor Pumpe) eine Temperatur ueber 30 C hat. Die Wirtschaftlichkeit mit bis zu 42,5% Wirkungsgrad liegt in der Groesse wie vergleichbare moderne Dieselmotoren. Die Geraeuschemission ist aufgrund der `weichen` Verbrennung geringer als beim Dieselmotor. Die Abgasemission ist vergleichbar mit dem Dieselmotor, die Abgasnorm `EURO I` wird erfuellt, die `EURO II` ist bei Bedarf erfuellbar. In Dauerlaeufen wurde der zerstoerungsfreie Lauf an direkteinspritzenden Pflanzenoelmotoren nachgewiesen. Der Motor ist fuer Inselbetrieb in der Landwirtschaft und in der 3. Welt in Fahrzeugen, Landmaschinen und Energieerzeugern geeignet. Abschliessend sei dem Bundesministerium fuer Forschung und Technologie fuer die Foerderung dieses Themas gedankt. Ohne diese Unterstuetzung wuerde dieser Motorenentwicklungsbeitrag

  14. Tuning The Optical, Charge Injection, and Charge Transport Properties of Organic Electronic Devices

    Science.gov (United States)

    Zalar, Peter

    Since the early 1900's, synthetic insulating polymers (plastics) have slowly taken over the role that traditional materials like wood or metal have had as basic components for construction, manufactured goods, and parts. Plastics allow for high throughput, low temperature processing, and control of bulk properties through molecular modifications. In the same way, pi-conjugated organic molecules are emerging as a possible substitute for inorganic materials due to their electronic properties. The semiconductive nature of pi-conjugated materials make them an attractive candidate to replace inorganic materials, primarily due to their promise for low cost and large-scale production of basic semiconducting devices such as light-emitting diodes, solar cells, and field-effect transistors. Before organic semiconductors can be realized as a commercial product, several hurdles must be cleared. The purpose of this dissertation is to address three distinct properties that dominate the functionality of devices harnessing these materials: (1) optical properties, (2) charge injection, and (3) charge transport. First, it is shown that the electron injection barrier in the emissive layer of polymer light-emitting diodes can be significantly reduced by processing of novel conjugated oligoelectrolytes or deoxyribonucleic acid atop the emissive layer. Next, the charge transport properties of several polymers could be modified by processing them from solvents containing small amounts of additives or by using regioregular and enantiopure chemical structures. It is then demonstrated that the optical and electronic properties of Lewis basic polymer structures can be readily modified by interactions with strongly electron-withdrawing Lewis acids. Through red-shifted absorption, photoluminescence, and electroluminescence, a single pi-conjugated backbone can be polychromatic. In addition, interaction with Lewis acids can remarkably p-dope the hole transport of the parent polymer, leading to a

  15. The first test experiment of H- charge-exchange injection in the KEK booster

    International Nuclear Information System (INIS)

    The H- charge-exchange injection method was applied to the 500 MeV booster of the 12 GeV proton synchrotron at KEK, as an alternative to the multi-turn injection method using direct injection of protons. The first test experiment of such injection was carried out during three weeks beginning in late September 1983. Experimental results showed that, in spite of the low injection energy used for our booster, such an injection method is promising for increasing the beam intensity of the booster. And also, some further improvements are proposed. (author)

  16. Charge injection from a surface depletion region—The Al 2O 3-silicon system

    Science.gov (United States)

    Kolk, J.; Heasell, E. L.

    1980-03-01

    Electron injection from a surface depletion region, over the surface barrier at an Al 2O 3-silicon interface is studied. The current passing over the barrier is measured by observing the rate of flat-band voltage shift as charge is trapped in the oxide. The data obtained is compared with the predictions of present models for charge injection. It is found that the so-called 'lucky-electron' model gives the most generally satisfactory agreement with the observations.

  17. Impact of charge carrier injection on single-chain photophysics of conjugated polymers

    CERN Document Server

    Hofmann, Felix J; Lupton, John M

    2016-01-01

    Charges in conjugated polymer materials have a strong impact on the photophysics and their interaction with the primary excited state species has to be taken into account in understanding device properties. Here, we employ single-molecule spectroscopy to unravel the influence of charges on several photoluminescence (PL) observables. The charges are injected either stochastically by a photochemical process, or deterministically in a hole-injection sandwich device configuration. We find that upon charge injection, besides a blue-shift of the PL emission and a shortening of the PL lifetime due to quenching and blocking of the lowest-energy chromophores, the non-classical photon arrival time distribution of the multichromophoric chain is modified towards a more classical distribution. Surprisingly, the fidelity of photon antibunching deteriorates upon charging, whereas one would actually expect the number of chromophores to be reduced. A qualitative model is presented to explain the observed PL changes. The resul...

  18. Super-knock Suppression Using Split Injection in a Turbo-Charged GDI Engine

    Directory of Open Access Journals (Sweden)

    Lv Meng

    2016-01-01

    Full Text Available Super-knock, which occurs under low-speed and big load operate condition in turbo-charged gasoline direct injection (TGDI engine, is an abnormal combustion phenomenon. Due to its potential to cause degradation of the engine, super knock has become the main obstacle for increasing specific power and lowing fuel consumption of engine. In order to investigate suppress strategies of super-knock, split injection is applied on a high boosted GDI engine. The results shows that: super knock correlates to some extent with split injection; further study shows that appropriate split injection duty ratio and the end of second injection time could reduce super knock effectively.

  19. Raising the barrier for photoinduced DNA charge injection with a cyclohexyl artificial base pair.

    Science.gov (United States)

    Singh, Arunoday P N; Harris, Michelle A; Young, Ryan M; Miller, Stephen A; Wasielewski, Michael R; Lewis, Frederick D

    2015-01-01

    The effects of an artificial cyclohexyl base pair on the quantum yields of fluorescence and dynamics of charge separation and charge recombination have been investigated for several synthetic DNA hairpins. The hairpins possess stilbenedicarboxamide, perylenediimide, or naphthalenediimide linkers and base-paired stems. In the absence of the artificial base pair hole injection into both adenine and guanine purine bases is exergonic and irreversible, except in the case of stilbene with adenine for which it is slightly endergonic and reversible. Insertion of the artificial base pair renders hole injection endergonic or isoergonic except in the case of the powerful naphthalene acceptor for which it remains exergonic. Both hole injection and charge recombination are slower for the naphthalene acceptor in the presence of the artificial base pair than in its absence. The effect of an artificial base pair on charge separation and charge recombination in hairpins possessing stilbene and naphthalene acceptor linkers and a stilbenediether donor capping group has also been investigated. In the case of the stilbene acceptor-stilbene donor capped hairpins photoinduced charge separation across six base pairs is efficient in the absence of the artificial base pair but does not occur in its presence. In the case of the naphthalene acceptor-stilbene donor capped hairpins the artificial base pair slows but does not stop charge separation and charge recombination, leading to the formation of long-lived charge separated states. PMID:26442603

  20. Profiling of the injected charge drift current transients by cross-sectional scanning technique

    Energy Technology Data Exchange (ETDEWEB)

    Gaubas, E., E-mail: eugenijus.gaubas@ff.vu.lt; Ceponis, T.; Pavlov, J.; Baskevicius, A. [Institute of Applied Research, Vilnius University, Sauletekio av. 9-III, LT-10222 Vilnius (Lithuania)

    2014-02-07

    The electric field distribution and charge drift currents in Si particle detectors are analyzed. Profiling of the injected charge drift current transients has been implemented by varying charge injection position within a cross-sectional boundary of the particle detector. The obtained profiles of the induction current density and duration of the injected charge drift pulses fit well the simulated current variations. Induction current transients have been interpreted by different stages of the bipolar and monopolar drift of the injected carriers. Profiles of the injected charge current transients registered in the non-irradiated and neutron irradiated Si diodes are compared. It has been shown that the mixed regime of the competing processes of drift, recombination, and diffusion appears in the measured current profiles on the irradiated samples. The impact of the avalanche effects can be ignored based on the investigations presented. It has been shown that even a simplified dynamic model enabled us to reproduce the main features of the profiled transients of induced charge drift current.

  1. Profiling of the injected charge drift current transients by cross-sectional scanning technique

    Science.gov (United States)

    Gaubas, E.; Ceponis, T.; Pavlov, J.; Baskevicius, A.

    2014-02-01

    The electric field distribution and charge drift currents in Si particle detectors are analyzed. Profiling of the injected charge drift current transients has been implemented by varying charge injection position within a cross-sectional boundary of the particle detector. The obtained profiles of the induction current density and duration of the injected charge drift pulses fit well the simulated current variations. Induction current transients have been interpreted by different stages of the bipolar and monopolar drift of the injected carriers. Profiles of the injected charge current transients registered in the non-irradiated and neutron irradiated Si diodes are compared. It has been shown that the mixed regime of the competing processes of drift, recombination, and diffusion appears in the measured current profiles on the irradiated samples. The impact of the avalanche effects can be ignored based on the investigations presented. It has been shown that even a simplified dynamic model enabled us to reproduce the main features of the profiled transients of induced charge drift current.

  2. Profiling of the injected charge drift current transients by cross-sectional scanning technique

    International Nuclear Information System (INIS)

    The electric field distribution and charge drift currents in Si particle detectors are analyzed. Profiling of the injected charge drift current transients has been implemented by varying charge injection position within a cross-sectional boundary of the particle detector. The obtained profiles of the induction current density and duration of the injected charge drift pulses fit well the simulated current variations. Induction current transients have been interpreted by different stages of the bipolar and monopolar drift of the injected carriers. Profiles of the injected charge current transients registered in the non-irradiated and neutron irradiated Si diodes are compared. It has been shown that the mixed regime of the competing processes of drift, recombination, and diffusion appears in the measured current profiles on the irradiated samples. The impact of the avalanche effects can be ignored based on the investigations presented. It has been shown that even a simplified dynamic model enabled us to reproduce the main features of the profiled transients of induced charge drift current

  3. Charge injection in an LED with a hybrid composite as the emissive layer

    International Nuclear Information System (INIS)

    Understanding and controlling charge transport are crucial to achieve optimized organic devices, including light emitting diodes. In this study, we investigate the charge injection in devices made with a hybrid composite (HC) containing Zn2SiO4:Mn (ZSP:Mn) in a polymeric blend consisting of poly(o-methoxyaniline) (POMA) and poly(vinylidene co-trifluorethylene) P(VDFTrFE), with the architecture ITO/HC/metallic electrode (ME). Charge injection was found to depend mainly on the POMA semiconducting phase. For ITO/HC/Au, an Ohmic junction was observed because the work function of ITO is close to that of Au, which also matches the energy levels of HC. Holes are injected through the HC/Au junction, as the highest occupied molecular orbital (HOMO) level of POMA matches the Fermi level of Au. The impedance spectroscopy data for the ITO/HC/ME devices were analyzed with a theoretical model where charge injection was assumed to occur via hopping with a distribution of potential energy barriers. The average hopping distance was estimated as 5.5 A and only the device with the Al electrode had the current limited by the interface mechanism (charge injection). For ITO/HC/Cu and ITO/HC/Au devices the limiting factor for the charge transport was the bulk resistance of the samples, in spite of the existence of a small interface energy barrier. The disorder parameter was 0.18 and 0.19 for the HC/Cu and HC/Al interfaces, respectively, which arises from the disordered nature of the hybrid material. The combination of the Cole-Cole model and the Miller-Abrahams function are a good approach to describe charge a.c. injection processes in disordered materials.

  4. Injection and transport of electric charge in a metal/copolymer structure

    Institute of Scientific and Technical Information of China (English)

    Li Dong-Mei; Yuan Xiao-Juan; Ma Jia-Sai; Liu De-Sheng

    2011-01-01

    The dynamical processes of the electric charge injection and transport from a metal electrode to the copolymer are investigated by using a nonadiabatic dynamic approach.The simulations are performed within the framework of an extended version of the one-dimensional Su-Schrieffer-Heeger (SSH) tight-binding model.It is found that the electric charge can be injected into the copolymer by increasing the applied voltage.For different structures of the copolymer,the critical voltage biases are different and the motion of the injected electric charge in the copolymer varies obviously.For the copolymer with a barrier-well-barrier configuration,the injected electric charge forms a wave packet due to the strong electron-lattice interaction in the barrier,then comes into the well and will be confined in it under a weak electric field.Under a medium electric field,the electric charge can go across the interface of two homopolymers and enter into the other potential barrier.For the copolymer with a well-barrier-well configuration,only under strong enough electric field can the electric charge transfer from the potential well into the barrier and ultimately reach a dynamic balance.

  5. Idle load losses of an injection-lubricated spur gear drive; Untersuchungen zu den Leerlaufverlusten eines einspritzgeschmierten Stirnradgetriebes

    Energy Technology Data Exchange (ETDEWEB)

    Dick, A.K.

    2000-07-01

    Arbeitsmaschine in Reihe geschaltet sind, wirkt sich dies direkt auf den Wirkungsgrad der Anlage aus. Mit dem im Rahmen dieser Arbeit gebauten Pruefstand wurde die Druckabhaengigkeit der lastunabhaengigen Verzahnungsverluste eines Stirnradpaares bis zu Umfangsgeschwindigkeiten von v{sub t}=200 m/s fuer Druecke von p{sub G}=0.13 bar / 1.4 bar ermittelt. Die gemessenen Ventilations- und Quetschverluste sind linear vom Druck abhaengig. Die aus bekannten Potenzansaetze zur Berechnung der lastunabhaengigen Verzahnungsverluste wurden bezueglich der Impulsverluste korrigiert. Ausserdem wurde der Faktor F{sub Druck} zur Beschreibung der Druckabhaengigkeit von Ventilations- und Quetschverlusten neu eingefuehrt. Die Stroemungsvorgaenge im Getriebegehaeuse beeinflussen die lastunabhaengigen Verluste. Durch das Teilvakuum werden die Stroemungsvorgaenge im Getriebe veraendert. Aehnliche Effekte koennen u.U. durch eine enge Kapselung der Rotoren erzielt werden. Die Versuchsergebnisse zeigen, dass das Potential fuer eine weitere Verlustreduzierung bei niedrigen Druecken gering ist. Da jedoch auch in Zukunft Turbogetriebe bei Atmosphaerendruck betrieben werden, sollte der Einfluss von eng anliegenden Getriebegehaeusen untersucht werden. (orig./AKF)

  6. Charge injection in thin dielectric layers by atomic force microscopy: influence of geometry and material work function of the AFM tip on the injection process.

    Science.gov (United States)

    Villeneuve-Faure, C; Makasheva, K; Boudou, L; Teyssedre, G

    2016-06-17

    Charge injection and retention in thin dielectric layers remain critical issues for the reliability of many electronic devices because of their association with a large number of failure mechanisms. To overcome this drawback, a deep understanding of the mechanisms leading to charge injection close to the injection area is needed. Even though the charge injection is extensively studied and reported in the literature to characterize the charge storage capability of dielectric materials, questions about charge injection mechanisms when using atomic force microscopy (AFM) remain open. In this paper, a thorough study of charge injection by using AFM in thin plasma-processed amorphous silicon oxynitride layers with properties close to that of thermal silica layers is presented. The study considers the impact of applied voltage polarity, work function of the AFM tip coating and tip curvature radius. A simple theoretical model was developed and used to analyze the obtained experimental results. The electric field distribution is computed as a function of tip geometry. The obtained experimental results highlight that after injection in the dielectric layer the charge lateral spreading is mainly controlled by the radial electric field component independently of the carrier polarity. The injected charge density is influenced by the nature of electrode metal coating (work function) and its geometry (tip curvature radius). The electron injection is mainly ruled by the Schottky injection barrier through the field electron emission mechanism enhanced by thermionic electron emission. The hole injection mechanism seems to differ from the electron one depending on the work function of the metal coating. Based on the performed analysis, it is suggested that for hole injection by AFM, pinning of the metal Fermi level with the metal-induced gap states in the studied silicon oxynitride layers starts playing a role in the injection mechanisms.

  7. Charge injection in thin dielectric layers by atomic force microscopy: influence of geometry and material work function of the AFM tip on the injection process

    Science.gov (United States)

    Villeneuve-Faure, C.; Makasheva, K.; Boudou, L.; Teyssedre, G.

    2016-06-01

    Charge injection and retention in thin dielectric layers remain critical issues for the reliability of many electronic devices because of their association with a large number of failure mechanisms. To overcome this drawback, a deep understanding of the mechanisms leading to charge injection close to the injection area is needed. Even though the charge injection is extensively studied and reported in the literature to characterize the charge storage capability of dielectric materials, questions about charge injection mechanisms when using atomic force microscopy (AFM) remain open. In this paper, a thorough study of charge injection by using AFM in thin plasma-processed amorphous silicon oxynitride layers with properties close to that of thermal silica layers is presented. The study considers the impact of applied voltage polarity, work function of the AFM tip coating and tip curvature radius. A simple theoretical model was developed and used to analyze the obtained experimental results. The electric field distribution is computed as a function of tip geometry. The obtained experimental results highlight that after injection in the dielectric layer the charge lateral spreading is mainly controlled by the radial electric field component independently of the carrier polarity. The injected charge density is influenced by the nature of electrode metal coating (work function) and its geometry (tip curvature radius). The electron injection is mainly ruled by the Schottky injection barrier through the field electron emission mechanism enhanced by thermionic electron emission. The hole injection mechanism seems to differ from the electron one depending on the work function of the metal coating. Based on the performed analysis, it is suggested that for hole injection by AFM, pinning of the metal Fermi level with the metal-induced gap states in the studied silicon oxynitride layers starts playing a role in the injection mechanisms.

  8. Multi-turn injection into a heavy-ion synchrotron in the presence of space charge

    CERN Document Server

    Appel, Sabrina

    2014-01-01

    For heavy-ion synchrotrons an efficient Multi-Turn Injection (MTI) from the injector linac is crucial in order to reach the specified currents using the available machine acceptance. The beam loss during the MTI must not exceed the limits determined by machine protection and by the vacuum requirements. Especially for low energy and intermediate charge state ions, the beam loss at the injection septum can cause a degradation of the vacuum and a corresponding reduction of the beam lifetime. In order to optimize the injection of intense beams a very detailed simulation model was developed. Besides the closed orbit bump, lattice errors, the position of the septum and other aperture limiting components the transverse space charge force is included self-consistently. The space charge force causes a characteristic shift of the optimum tunes and a smoothing of the phase space density.

  9. Plastification en injection des polymères fonctionnels et chargés

    OpenAIRE

    Pham, Thuy Linh

    2013-01-01

    The main objective of the thesis is modelling and visualization of the phenomena of polymer plastication in the injection-moulding process. In injection moulding or in extrusion, plastication is the step during which polymer pellets are melted by the means of mechanical dissipation provided by a rotating screw and by thermal conduction coming from a heated metallic barrel. This step is crucial for melt thermal homogeneity, charge dispersion and fibre length preservation. Although there have b...

  10. Dispersion Matching of a Space Charge dominated Beam at Injection into the CERN PS Booster

    CERN Document Server

    Hanke, Klaus; Scrivens, Richard

    2005-01-01

    In order to match the dispersion at injection into the CERN PS Booster, the optics of the injection line was simulated using two different codes (MAD and TRACE). The simulations were benchmarked versus experimental results. The model of the line was then used to re-match the dispersion. Experimental results are presented for different optics of the line. Measurements with varying beam current show the independence of the measured quantity of space-charge effects.

  11. Charge exchange momentum transfer due to ion beam injection in partially ionized plasmas

    International Nuclear Information System (INIS)

    Time responses of a helium plasma to helium gas puffing without and with helium beam injection in a linear plasma device are experimentally investigated. Increase in the neutral density due to gas puffing is suppressed by ion beam injection. The experimental results show that a momentum transport from the ion beam to the puffed neutral particles occurs due to the charge exchange interaction, suggesting that charge exchange momentum transport is one of the processes responsible for the spatial redistribution of neutral atoms in partially ionized plasmas. (author)

  12. Impact of charge carrier injection on single-chain photophysics of conjugated polymers

    Science.gov (United States)

    Hofmann, Felix J.; Vogelsang, Jan; Lupton, John M.

    2016-06-01

    Charges in conjugated polymer materials have a strong impact on the photophysics and their interaction with the primary excited state species has to be taken into account in understanding device properties. Here, we employ single-molecule spectroscopy to unravel the influence of charges on several photoluminescence (PL) observables. The charges are injected either stochastically by a photochemical process or deterministically in a hole-injection sandwich device configuration. We find that upon charge injection, besides a blue-shift of the PL emission and a shortening of the PL lifetime due to quenching and blocking of the lowest-energy chromophores, the non-classical photon arrival time distribution of the multichromophoric chain is modified towards a more classical distribution. Surprisingly, the fidelity of photon antibunching deteriorates upon charging, whereas one would actually expect the opposite: the number of chromophores to be reduced. A qualitative model is presented to explain the observed PL changes. The results are of interest to developing a microscopic understanding of the intrinsic charge-exciton quenching interaction in devices.

  13. Charge Injection and Transport in Metal/Polymer Chains/Metal Sandwich Structure

    Institute of Scientific and Technical Information of China (English)

    LI Hai-Hong; LI Dong-Mei; LI Yuan; GAO Kun; LIU De-Sheng; XIE Shi-Jie

    2008-01-01

    @@ Using the tight-binding Su-Schrieffer-Heeger model and a nonadiabatic dynamic evolution method, we study the dynamic processes of the charge injection and transport in a metal/two coupled conjugated polymer chains/metal structure. It is found that the charge interchain transport is determined by the strength of the electric field and the magnitude of the voltage bias applied on the metal electrode. The stronger electric field and the larger voltage bias are both in favour of the charge interchain transport.

  14. To what extent can charge localization influence electron injection efficiency at graphene-porphyrin interfaces?

    KAUST Repository

    Mohammed, Omar F.

    2015-04-28

    Controlling the electron transfer process at donor- acceptor interfaces is a research direction that has not yet seen much progress. Here, with careful control of the charge localization on the porphyrin macrocycle using β -Cyclodextrin as an external cage, we are able to improve the electron injection efficiency from cationic porphyrin to graphene carboxylate by 120% . The detailed reaction mechanism is also discussed.

  15. Influence of injected charge carriers on photocurrents in polymer solar cells

    NARCIS (Netherlands)

    Wehenkel, Dominique J.; Koster, L. Jan Anton; Wienk, Martijn M.; Janssen, Rene A. J.

    2012-01-01

    We determine and analyze the photocurrent Jph in polymer solar cells under conditions where, no, one, or two different charge carriers can be injected by choosing appropriate electrodes and compare the experimental results to simulations based on a drift-diffusion device model that accounts for phot

  16. Charge transport, injection, and photovoltaic phenomena in oligo(phenylenevinylene) based diodes

    NARCIS (Netherlands)

    Melzer, Christian; Krasnikov, Victor V.; Hadziioannou, Georges

    2003-01-01

    We report on the charge transport and injection phenomena of (E,E,E,E)-1,4-bis[(4-styryl)styryl]-2-methoxy-5-(2'-ethylhexoxy)benzene (MEH-OPV5) sandwiched between asymmetric contacts. The hole mobility of MEH-OPV5 was determined by means of transient electroluminescence. The steady-state current was

  17. Performance of the CERN PSB at 160 MeV with $H^{-}$ charge exchange injection

    CERN Document Server

    AUTHOR|(CDS)2084247; Santoni, Claudio

    As part of the LHC Injectors Upgrade Project, the CERN PS Booster (PSB) will be upgraded with a H- charge exchange injection system and its injection energy will be raised from 50 MeV to 160 MeV to obtain the beam brightness required for the LHC High-Luminosity Upgrade. Space charge effects like beam losses and transverse emittance blow-up at injection are expected to be the main limitations towards the achievement of the required high brightness. Studies of beam dynamics in presence of space charge in order to evaluate the performances of the PSB after the Upgrade have been performed. The first part of the work consists of measurements in the present machine, to study the effects of space charge and its interplay with resonances and to have a good set of data for code benchmarking. The code chosen for the beam tracking in presence of space charge is PTC-Orbit (and PyOrbit). Necessary numerical convergence studies are presented together with a benchmark with the PSB measurements. Once assessed the code and it...

  18. Improved charge injection of pentacene transistors by immobilizing DNA on gold source-drain electrodes

    Science.gov (United States)

    Gui, Haiyang; Wei, Bin; Zhang, Jianhua; Wang, Jun

    2014-06-01

    We successfully optimized the charge injection of pentacene-based organic thin-film transistors with bottom contact by immobilizing deoxyribonucleic acid (DNA) on gold electrodes. The single-stranded DNA having mercapto group (-SH) was used as the modified layer by molecular self-assembly onto the surface of gold electrodes. The threshold voltage is -10 V, and the field-effect mobility reaches 0.34 cm2/V s, which is comparable with that of typical top-contact devices. Mechanism of performance improvement is due to the high carrier density in contact region attracted by the phosphate group on the DNA backbone increasing the tunneling probability for improved charge injection. Furthermore, the introduction of modified layer significantly enhanced the grain size of pentacene that is beneficial for charge transport, which also is responsible for the improved device performances.

  19. Nanoscale quantification of charge injection and transportation process in Si-nanocrystal based sandwiched structure.

    Science.gov (United States)

    Xu, Jie; Xu, Jun; Zhang, Pengzhan; Li, Wei; Chen, Kunji

    2013-10-21

    Si nanocrystals are formed by using KrF pulsed laser crystallization of an amorphous SiC/ultrathin amorphous Si/amorphous SiC sandwiched structure. Electrons and holes are injected into Si nanocrystals via a biased conductive AFM tip and the carrier decay and transportation behaviours at the nanoscale are studied by joint characterization techniques of Kelvin probe force microscopy (KPFM) and conductive atomic force microscopy (CAFM). Quantification of the surface charge density is realized by solving the Poisson equation based on KPFM measurements. Besides, the asymmetric barrier height for electrons and holes is considered to play a dominant role in controlling the charge retention and transportation characteristics. The methodology developed in this work is promising for studying the charge injection and transportation process in other materials and structures at the nanoscale.

  20. Master equation approach to charge injection and transport in organic insulators.

    Science.gov (United States)

    Freire, José A; Voss, Grasiela

    2005-03-22

    We develop a master equation model of a disordered organic insulator sandwiched between metallic electrodes by treating as rate processes both the injection and the internal transport. We show how the master equation model allows for the inclusion of crucial correlation effects in the charge transport, particularly of the Pauli exclusion principle and of space-charge effects, besides, being dependent on just the microscopic form of the transfer rate between the localized electronic states, it allows for the investigation of different microscopic scenarios in the organic, such as polaronic hopping, correlated energy levels, interaction with image charge, etc. The model allows for a separate analysis of the injection and the recombination currents. We find that the disorder, besides increasing the injection current, eliminates the possibility of observation of a Fowler-Nordheim injection current at zero temperature, and that it does not alter the Schottky barrier size of the zero-field thermionic injection current from the value based on the energy difference between the electrode Fermi level and the highest occupied molecular orbital/lowest unoccupied molecular orbital levels in the organic, but it makes the Arrhenius temperature dependence appear at larger temperatures. We investigate how the I(V) characteristics of a device is affected by the presence of correlations in the site energy distribution and by the form of the internal hopping rate, specifically the Miller-Abrahams rate and the Marcus or small-polaron rate. We show that the disorder does not modify significantly the ebeta square root E field dependence of the net current due to the Schottky barrier lowering caused by the attraction between the charge and its image in the electrode. PMID:15836407

  1. Charge injection and accumulation in organic light-emitting diode with PEDOT:PSS anode

    Energy Technology Data Exchange (ETDEWEB)

    Weis, Martin, E-mail: martin.weis@stuba.sk [Institute of Electronics and Photonics, Slovak University of Technology, Ilkovičova 3, Bratislava 81219 (Slovakia); Otsuka, Takako; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa, E-mail: iwamoto@ome.pe.titech.ac.jp [Department of Physical Electronics, Tokyo Institute of Technology, 2-12-1 O-okayama, Meguro-ku, Tokyo 152-8552 (Japan)

    2015-04-21

    Organic light-emitting diode (OLED) displays using flexible substrates have many attractive features. Since transparent conductive oxides do not fit the requirements of flexible devices, conductive polymer poly(3,4-ethylenedioxythiophene):poly(4-styrenesulfonate) (PEDOT:PSS) has been proposed as an alternative. The charge injection and accumulation in OLED devices with PEDOT:PSS anodes are investigated and compared with indium tin oxide anode devices. Higher current density and electroluminescence light intensity are achieved for the OLED device with a PEDOT:PSS anode. The electric field induced second-harmonic generation technique is used for direct observation of temporal evolution of electric fields. It is clearly demonstrated that the improvement in the device performance of the OLED device with a PEDOT:PSS anode is associated with the smooth charge injection and accumulation.

  2. Electric Field Analysis of Space Charge Injection from a Conductive Nano-Filler Electrode

    International Nuclear Information System (INIS)

    A simulation on the electric field distribution near the electrode is proposed to explain the reason for using nanosized carbon black mixed with ethylene vinyl acetate, as the electrode could lead to more charge injection into the polymer than using a deposited metal electrode. The electrode is simplified to a layer of conductive semi-spheres with fixed size and constant electric potential. By using the finite element method, it is found that both the size of the semi-spheres and the distance between adjacent semi-spheres could dramatically influence the electric field near the surface of the spheres; these are considered to be the two decisive factors for the charge injecting rate at electrodes of various materials. (condensed matter: electronicstructure, electrical, magnetic, and opticalproperties)

  3. Influence of injected charge carriers on photocurrents in polymer solar cells

    OpenAIRE

    Wehenkel, Dominique J.; Koster, L. Jan Anton; Wienk, Martijn M.; Janssen, Rene A. J.

    2012-01-01

    We determine and analyze the photocurrent Jph in polymer solar cells under conditions where, no, one, or two different charge carriers can be injected by choosing appropriate electrodes and compare the experimental results to simulations based on a drift-diffusion device model that accounts for photogeneration and Langevin recombination of electrons and holes. We demonstrate that accounting for the series resistance of the device is essential to determine Jph. Without such correction, the res...

  4. Feedback Direct Injection Current Readout For Infrared Charge-Coupled Devices

    Science.gov (United States)

    Kubo, Kazuya; Wakayama, Hiroyuki; Kajihara, Nobuyuki; Awamoto, Kenji; Miyamoto, Yoshihiro

    1990-01-01

    We are proposing current readout for infrared charge coupled devices (IRCCDs) which can operate at higher temperatures. Feedback direct injection (FDI) consists of a simple amplifier of gain, AFDI was used in a medium-wavelength IRCCD operating at a high temperature. We made a 64-element HgCdTe linear IRCCD using FDI. The device operates at 195 K with an NETD of 0.5 K.

  5. Scanning capacitance microscope study of a SiO2/Si interface modified by charge injection

    Science.gov (United States)

    Tomiye, H.; Yao, T.

    We have investigated the local electrical properties of an SiO2/Si structure using a scanning capacitance microscope (SCaM) combined with an atomic force and a scanning tunneling microscope (AFM and STM). The electrical properties of the Si substrate and the SiO2/Si interface vary with position. In this experiment we have injected charge into the SiO2 and investigated the nature of charge storage at the SiO2/Si interface. We have used the combined microscope to apply a pulse to the SiO2/Si sample, causing charge to be trapped in the SiO2/Si interface. We could clearly detect the local variation of interface charge in a non-destructive manner using the SCaM and simultaneously by capacitance-voltage (C-V) characterization. The volume of the C-V curve shift along the voltage axis due to trapped charges is dependent upon the density of the trapped charges. In doing this experiment we show one of the many possible applications of the combined SCaM/AFM/STM.

  6. Theoretical study on charge injection and transport properties of six emitters with push–pull structure

    International Nuclear Information System (INIS)

    Highlights: • We investigated six small organic molecules by using computational approaches. • This investigation is mainly based on the Marcus electron transfer theory. • The density functional theory (DFT) was used in this investigation. • The IP, EA, reorganization energy and transfer integral were calculated. • We analyzed the charge properties of the molecules by using the computed results. - Abstract: The charge injection and transport properties of six organic light-emitting molecules with push–pull structures were studied by theoretical calculations. The ground-state geometries for the neutral, cationic and anionic states were optimized using density functional theory. Subsequently, the ionization potentials and electron affinities were calculated. We computed the reorganization energies and the transfer integrals based on the Marcus electron transfer theory. It was found that in addition to being emitters the six compounds are multifunctional materials being capable of transport for both holes and electrons. Moreover, the double-branched compound DCDPC2 was found to have higher charge injection ability and better balanced charge transport properties than single-branched compounds

  7. Analysis of the effects of constant-current Fowler-Nordheim-tunneling injection with charge trapping inside the potential barrier

    Science.gov (United States)

    Lopez-Villanueva, J. A.; Jimenez-Tejada, J. A.; Cartujo, P.; Bausells, J.; Carceller, J. E.

    1991-10-01

    Charge trapping and the generation of interface traps in thermally grown SiO2 and its interface with silicon, produced by Fowler-Nordheim tunneling injection at low temperatures from highly doped Si substrates, have been investigated. The results that can be obtained with the constant-current-injection method, when a moderate amount of charge is trapped inside the potential barrier, have been analyzed. This has afforded information about the position of the charge trapped in the oxide. No increase in the interface-trap density has been produced immediately after injection at 77 K, but, as the temperature is raised after injection, the growing of a peak of interface states has been observed. This phenomenon had been reported to be produced as a consequence of a previous hole trapping but, in this case, this intermediate stage of positive-charge building has not been observed. This effect is discussed, taking into account published models.

  8. Beam emittance growth in a proton storage ring employing charge exchange injection

    International Nuclear Information System (INIS)

    Recently, it has been shown that very large currents can be accumulated in medium energy proton storage rings by multiturn injection of an H- beam through a charge stripping medium. Since the particles are injected continuously into the same phase space, it is possible to increase the circulating beam brightness with respect to that of the incoming beam by a large factor. The stored protons pass repeatedly through the stripper, however, so that this phase space is gradually enlarged by scattering. The dependence of the circulating beam phase space (emittance) growth rate on the nature of the scattering process and on where it occurs in the storage ring matrix is considered. Since the motivation for this work arose in connection with the design of the proposed high-current storage ring at LAMPF, the results are focused on the specific parameters of that device. (U.S.)

  9. WFC3/UVIS Charge Injection Behavior: Results of an Initial Test

    Science.gov (United States)

    Bushouse, H.; Baggett, S.; Gilliland, R.; Noeske, K.; Petro, L.

    2011-01-01

    The WFC3 CCD Charge Injection (CI) capability has been tested on-orbit in Cycle18 calibration program 12348. Bias, dark, and science exposures of star cluster NGC 104 have been obtained in all commandable CI modes. Super-bias images were constructed for each CI mode and used to calibrate the NGC 104 exposures. Analysis has shown that the CI mode is working as expected, producing injected signals of ~15000 e-/pix. The CI signal is stable and repeatable to a level of a few e-/pix. CI rows in calibrated science images have mean residual signals of a few e-/pix with 1-sigma noise of ~18 e-/pix. Noise in science images in the rows in between CI varies from 3.5-6.5 e-/pix, compared to ~3.4 e-/pix in non-CI images.

  10. Calibration by precise charge injection of a sub-detector of CMS; Calibration par injection de charge du calorimetre electromagnetique de CMS

    Energy Technology Data Exchange (ETDEWEB)

    Yong-Wook Baek

    2001-01-26

    This thesis was carried out within the framework of the international collaboration which has the responsibility of the experience CMS (Compact Muon Solenoid) on LHC, at CERN. The physics of the fundamental particles which will be explored by this experiment is described within the standard model. The configuration of sub-detector of CMS is briefly described, with a particular weight on the read-out chain of the electromagnetic calorimeter. The work carried out to calibrate this chain by a precise charge injection at the input of preamplifiers is described. The 4 integrated circuits CTRL, TPLS, DAC, and injector which will constitute the components of this chain of calibration are described. The circuit of injection, which is the main circuit in this project, was imagined and developed at the laboratory in DMILL technology. This injector generates a signal which has a form identical to the signal of the detector. The measurements on the linearity of the injectors are presented. In order to know its behavior under real conditions (flow of neutrons {approx} 2 x 10{sup 13} neutrons/cm{sup 2}/10 years) where this circuit is installed in detector CMS, we submitted the prototypes of injector to irradiation and the results are summarized. The research and development on this circuit produced an integrated circuit hardened to irradiations, whose variation of slope is lower than 0.25% for an integrated of 2 x 10{sup 13} neutrons/cm{sup 2} and indestructible under 10{sup 15} neutrons/cm{sup 2}. This circuit has satisfactory qualities to be assembled on the electronic card which will treat the data of calorimeter ECAL of CMS. (author)

  11. Distribution of separated energy and injected charge at normal falling of fast electron beam on target

    CERN Document Server

    Smolyar, V A; Eremin, V V

    2002-01-01

    In terms of a kinetic equation diffusion model for a beam of electrons falling on a target along the normal one derived analytical formulae for distributions of separated energy and injected charge. In this case, no empirical adjustable parameters are introduced to the theory. The calculated distributions of separated energy for an electron plate directed source within infinite medium for C, Al, Sn and Pb are in good consistency with the Spencer data derived on the basis of the accurate solution of the Bethe equation being the source one in assumption of a diffusion model, as well

  12. Experimental and Theoretical Characterization of Artificial Muscles Based on Charge Injection in Carbon Nanotubes

    Science.gov (United States)

    Baughman, Ray

    2002-03-01

    We theoretically predicted that carbon nanotubes have the potential of providing at least an order of magnitude higher work capacity per cycle and stress generation capability, as compared with any prior-art material for directly converting electrical energy to mechanical energy. Experimental and theoretical results expand understanding of the nanotube actuation mechanism, and demonstrate that improvements in nanotube sheet and macrofiber properties correspondingly increase actuator performance. The actuation mechanism is electrochemical double-layer charge injection, which we show is dominated by band structure effects for low degrees of charge transfer and by intra-tube electrostatic repulsion when charge transfer is large. Measurements indicate that charge transfer is limited to the outer nanotubes in a nanotube bundle, which limits present performance (as does creep, nanotube misalignment, and poor inter-bundle stress transfer). Nevertheless, measured actuation stresses are 100 times that of natural muscle, and the measured gravimetric work-per-cycle (fixed load condition) is already much higher than for the hard ferroelectrics. Efforts to eliminate these problems (via debundling, nanotube welding, and improvements in nanotube spinning methods) will be described, together with the initial demonstration and analysis of chemically powered carbon nanotube muscles.

  13. Analytical Evaluation of the Ratio Between Injection and Space-Charge Limited Currents in Single Carrier Organic Diodes

    OpenAIRE

    Alvarez, Angel Luis; Arredondo, Belen; Romero, Beatriz; Quintana Arregui, Patxi Xabier; Gutierrez Llorente, Araceli; Mallavia, Ricardo; Otón Sánchez, José Manuel

    2008-01-01

    An analytical, complete framework to describe the current-voltage (I-V) characteristics of organic diodes without the use of previous approaches, such as injection or bulk-limited conduction is proposed. Analytical expressions to quantify the ratio between injection and space-charge-limited current from experimental I-V characteristics in organic diodes have been derived. These are used to propose a numerical model in which both bulk transport and injection mechanisms are considered simultane...

  14. Utilizing carbon nanotube electrodes to improve charge injection and transport in bis(trifluoromethyl)-dimethyl-rubrene ambipolar single crystal transistors.

    Science.gov (United States)

    Xie, Wei; Prabhumirashi, Pradyumna L; Nakayama, Yasuo; McGarry, Kathryn A; Geier, Michael L; Uragami, Yuki; Mase, Kazuhiko; Douglas, Christopher J; Ishii, Hisao; Hersam, Mark C; Frisbie, C Daniel

    2013-11-26

    We have examined the significant enhancement of ambipolar charge injection and transport properties of bottom-contact single crystal field-effect transistors (SC-FETs) based on a new rubrene derivative, bis(trifluoromethyl)-dimethyl-rubrene (fm-rubrene), by employing carbon nanotube (CNT) electrodes. The fundamental challenge associated with fm-rubrene crystals is their deep-lying HOMO and LUMO energy levels, resulting in inefficient hole injection and suboptimal electron injection from conventional Au electrodes due to large Schottky barriers. Applying thin layers of CNT network at the charge injection interface of fm-rubrene crystals substantially reduces the contact resistance for both holes and electrons; consequently, benchmark ambipolar mobilities have been achieved, reaching 4.8 cm(2) V(-1) s(-1) for hole transport and 4.2 cm(2) V(-1) s(-1) for electron transport. We find that such improved injection efficiency in fm-rubrene is beneficial for ultimately unveiling its intrinsic charge transport properties so as to exceed those of its parent molecule, rubrene, in the current device architecture. Our studies suggest that CNT electrodes may provide a universal approach to ameliorate the charge injection obstacles in organic electronic devices regardless of charge carrier type, likely due to the electric field enhancement along the nanotube located at the crystal/electrode interface. PMID:24175573

  15. ReO{sub x} charge injection/blocking layers in organic electronic devices

    Energy Technology Data Exchange (ETDEWEB)

    Luo Jiaxiu; Xiao Lixin; Chen Zhijian; Qu Bo; Gong Qihuang, E-mail: xiao66@pku.edu.c, E-mail: qhgong@pku.edu.c [State Key Laboratory for Mesoscopic Physics and Department of Physics, Peking University, Beijing 100871 (China)

    2010-09-29

    The charge transport of rhenium oxide (ReO{sub x}) in organic electronic devices was investigated. The hole injection/transport was blocked and the electron injection/transport was enhanced with doping of ReO{sub x} in organic electronic devices. Thus the charge balance and efficiency of organic light-emitting diodes were improved; current efficiency of 2.7 cd A{sup -1} at 20 mA cm{sup -2} for the device with ReO{sub x} was higher than 1.5 cd A{sup -1} for the device without it. In the case of organic photovoltaic cells, the open-circuit voltage (V{sub oc}), 0.58 V, was higher compared with the device without ReO{sub x} (0.44 V) due to the improvement of interface properties. The power conversion efficiency was increased to 2.27% by the combination of ReO{sub x} (increases V{sub oc}) with poly(3,4-ethylenedioxythiophene) : poly(styrene-sulfonate) (improves hole transport to increase J{sub sc}) on the modification of the anode, higher than 1.85% for the device without ReO{sub x}.

  16. Dimensional changes as a function of charge injection for trans-polyacetylene: A density functional theory study

    Science.gov (United States)

    Sun, Guangyu; Kurti, Jeno; Kertesz, Miklos; Baughman, Ray H.

    2002-10-01

    Charge-induced dimensional changes allow conducting polymers and single walled carbon nanotubes to function as electromechanical actuators. The unit cell of the prototypical conducting polymer, trans-polyacetylene, was calculated as a function of charge injection using density functional theory in combination with ultrasoft pseudopotentials using the solid-state Vienna ab initio simulation package. Test calculations on the charged pyridinium molecular ion give results in good agreement with the experimental geometry. Strain versus charge relationships are predicted from dimensional changes calculated using a uniform background charge ("jellium") for representing the counterions, which we show provides results consistent with experiment for doped polyacetylenes. These jellium calculations are consistent with further presented calculations that include specific counterions, showing that hybridization between the guest dopant ions and the host polyacetylene chains is unimportant. The lack of guest-host orbital hybridization allows a qualitative rigid band interpretation of the amount of charge transfer for both acceptor and donor doping. For polyacetylene, asymmetry of strain along the chain with respect to the sign of the charge is predicted: negative charge elongates and positive charge shortens the polymer. For charge less than 0.05e per carbon, an approximately linear dependence is obtained for the dependence of chain-direction strain on the amount of injected charge.

  17. Construction of a Direct Water-Injected Two-Stroke Engine for Phased Direct Fuel Injection-High Pressure Charging Investigations

    Science.gov (United States)

    Somsel, James P.

    1998-01-01

    The development of a water injected Orbital Combustion Process (OCP) engine was conducted to assess the viability of using the powerplant for high altitude NASA aircraft and General Aviation (GA) applications. An OCP direct fuel injected, 1.2 liter, three cylinder, two-stroke engine has been enhanced to independently inject water directly into the combustion chamber. The engine currently demonstrates low brake specific fuel consumption capability and an excellent power to weight ratio. With direct water injection, significant improvements can be made to engine power, to knock limits/ignition advance timing, and to engine NO(x) emissions. The principal aim of the testing was to validate a cyclic model developed by the Systems Analysis Branch at NASA Ames Research Center. The work is a continuation of Ames' investigations into a Phased Direct Fuel Injection Engine with High Pressure Charging (PDFI-ITPC).

  18. Controlled Electron Injection into Plasma Accelerators and SpaceCharge Estimates

    Energy Technology Data Exchange (ETDEWEB)

    Fubiani, Gwenael J.

    2005-09-01

    Plasma based accelerators are capable of producing electron sources which are ultra-compact (a few microns) and high energies (up to hundreds of MeVs) in much shorter distances than conventional accelerators. This is due to the large longitudinal electric field that can be excited without the limitation of breakdown as in RF structures.The characteristic scale length of the accelerating field is the plasma wavelength and for typical densities ranging from 1018 - 1019 cm-3, the accelerating fields and scale length can hence be on the order of 10-100GV/m and 10-40 mu m, respectively. The production of quasimonoenergetic beams was recently obtained in a regime relying on self-trapping of background plasma electrons, using a single laser pulse for wakefield generation. In this dissertation, we study the controlled injection via the beating of two lasers (the pump laser pulse creating the plasma wave and a second beam being propagated in opposite direction) which induce a localized injection of background plasma electrons. The aim of this dissertation is to describe in detail the physics of optical injection using two lasers, the characteristics of the electron beams produced (the micrometer scale plasma wavelength can result in femtosecond and even attosecond bunches) as well as a concise estimate of the effects of space charge on the dynamics of an ultra-dense electron bunch with a large energy spread.

  19. Controlled Electron Injection into Plasma Accelerators and SpaceCharge Estimates

    Energy Technology Data Exchange (ETDEWEB)

    Fubiani, Gwenael G.J. [Univ. of California, Berkeley, CA (United States)

    2005-09-01

    Plasma based accelerators are capable of producing electron sources which are ultra-compact (a few microns) and high energies (up to hundreds of MeVs) in much shorter distances than conventional accelerators. This is due to the large longitudinal electric field that can be excited without the limitation of breakdown as in RF structures.The characteristic scale length of the accelerating field is the plasma wavelength and for typical densities ranging from 1018 - 1019 cm-3, the accelerating fields and scale length can hence be on the order of 10-100GV/m and 10-40 μm, respectively. The production of quasimonoenergetic beams was recently obtained in a regime relying on self-trapping of background plasma electrons, using a single laser pulse for wakefield generation. In this dissertation, we study the controlled injection via the beating of two lasers (the pump laser pulse creating the plasma wave and a second beam being propagated in opposite direction) which induce a localized injection of background plasma electrons. The aim of this dissertation is to describe in detail the physics of optical injection using two lasers, the characteristics of the electron beams produced (the micrometer scale plasma wavelength can result in femtosecond and even attosecond bunches) as well as a concise estimate of the effects of space charge on the dynamics of an ultra-dense electron bunch with a large energy spread.

  20. Analytical and numerical studies of photo-injected charge transport in molecularly-doped polymers

    Science.gov (United States)

    Roy Chowdhury, Amrita

    The mobility of photo-injected charge carriers in molecularly-doped polymers (MDPs) exhibits a commonly observed, and nearly universal Poole-Frenkel field dependence, mu exp√(beta0E), that has been shown to arise from the correlated Gaussian energy distribution of transport sites encountered by charges undergoing hopping transport through the material. Analytical and numerical studies of photo-injected charge transport in these materials are presented here with an attempt to understand how specific features of the various models developed to describe these systems depend on the microscopic parameters that define them. Specifically, previously published time-of-flight mobility data for the molecularly doped polymer 30% DEH:PC (polycarbonate doped with 30 wt.% aromatic hydrazone DEH) is compared with direct analytical and numerical predictions of five disorder-based models, the Gaussian disorder model (GDM) of Bassler, and four correlated disorder models introduced by Novikov, et al., and by Parris, et al. In these numerical studies, disorder parameters describing each model were varied from reasonable starting conditions, in order to give the best overall fit. The uncorrelated GDM describes the Poole-Frenkel field dependence of the mobility only at very high fields, but fails for fields lower than about 64 V/mum. The correlated disorder models with small amounts of geometrical disorder do a good over-all job of reproducing a robust Poole-Frenkel field dependence, with correlated disorder theories that employ polaron transition rates showing qualitatively better agreement with experiment than those that employ Miller-Abrahams rates. In a separate study, the heuristic treatment of spatial or geometric disorder incorporated in existing theories is critiqued, and a randomly-diluted lattice gas model is developed to describe the spatial disorder of the transport sites in a more realistic way.

  1. Approaching charge balance in organic light-emitting diodes by tuning charge injection barriers with mixed monolayers.

    Science.gov (United States)

    Yu, Szu-Yen; Huang, Ding-Chi; Chen, Yi-Ling; Wu, Kun-Yang; Tao, Yu-Tai

    2012-01-10

    Self-assembled monolayers (SAMs) of binary mixtures of 1-butylphosphonic acid and the trifluoromethyl-terminated analogue (4,4,4-trifluoro-1-butylphosphonic acid) were formed on ITO surfaces to tune the work function of ITO over a range of 5.0 to 5.75 eV by varying the mixing ratio of the two adsorbents. The mixed SAM-modified ITO surfaces were used as the anode in the fabrication of OLED devices with a configuration of ITO/SAM/HTL/Alq3/MX/Al, where HTL was the NPB or BPAPF hole-transporting layer and MX was the LiF or Cs(2)CO(3) injection layer. It was shown that, depending on the HTL or MX used, the maximum device current and the maximum luminance efficiency occurred with anodes of different modifications because of a shift in the point of hole/electron carrier balance. This provides information on the charge balance in the device and points to the direction to improve the performance. PMID:22103763

  2. In vivo charge injection limits increased after 'unsafe' stimulation

    DEFF Research Database (Denmark)

    Meijs, Suzan; Sørensen, Søren; Rechendorff, Kristian;

    2015-01-01

    The effect of unsafe stimulation on charge injection limits (Qinj) and pulsing capacitance (Cpulse) was investigated. Four stimulation protocols were applied: 20 mA – 200 and 400 Hz, 50 mA – 200 and 400 Hz. Increasing Qinj and Cpulse were observed for all stimulation protocols. Corrosion...... was not observed with any of the stimulation protocols and no tissue damage was observed for the 20 mA – 200 Hz stimulation group. This indicates that the ‘safe potential window’ may not be applicable in vivo, as no damage was done stimulating with 20 mA at 200 Hz, while damage was done using the same current...... at 400 Hz....

  3. Laser photoionization of H0 beams for charge-changing injection

    International Nuclear Information System (INIS)

    The two-step charge-changing injection used in the Los Alamos Proton Storage Ring (PSR) requires stripping of H- to H0 by high magnetic fields and subsequent stripping of H0 to H+ by a carbon foil. The authors consider single- and multiphoton laser ionization as alternatives to using a fragile foil. The multiphoton case is of possible interest for selection of practical lasers, which tend to have increased power output at higher wavelengths. The formulas derived express the necessary laser powers for ionization of monoenergetic H0 beams; they also hold for beams of particles other than atomic hydrogen. The numerical examples given are for the 800-MeV PSR beam with momentum spread taken into account. Additionally, they discuss selective stripping as an implication of the inherent energy selectivity of the photoionization process

  4. Laser photoionization of H0 beams for charge-changing injection

    International Nuclear Information System (INIS)

    The two-step charge-changing injection used in the Los Alamos Proton Storage Ring (PSR) requires stripping of H- to H0 by high magnetic fields and subsequent stripping of H0 to H+ by a carbon foil. We consider single- and multiphoton laser ionization as alternatives to using a fragile foil. The multiphoton case is of possible interest for selection of practical lasers, which tend to have increased power output at higher wavelengths. The formulas derived express the necessary laser powers for ionization of monoenergetic H0 beams; they also hold for beams of particles other than atomic hydrogen. The numerical examples given are for the 800-MeV PSR beam with momentum spread taken into account. Additionally, we discuss selective stripping as an implication of the inherent energy selectivity of the photoionization process

  5. Organic integrated circuits for information storage based on ambipolar polymers and charge injection engineering

    International Nuclear Information System (INIS)

    Ambipolar semiconducting polymers, characterized by both high electron (μe) and hole (μh) mobility, offer the advantage of realizing complex complementary electronic circuits with a single semiconducting layer, deposited by simple coating techniques. However, to achieve complementarity, one of the two conduction paths in transistors has to be suppressed, resulting in unipolar devices. Here, we adopt charge injection engineering through a specific interlayer in order to tune injection into frontier energy orbitals of a high mobility donor-acceptor co-polymer. Starting from field-effect transistors with Au contacts, showing a p-type unbalanced behaviour with μh = 0.29 cm2/V s and μe = 0.001 cm2/V s, through the insertion of a caesium salt interlayer with optimized thickness, we obtain an n-type unbalanced transistor with μe = 0.12 cm2/V s and μh = 8 × 10−4 cm2/V s. We applied this result to the development of the basic pass-transistor logic building blocks such as inverters, with high gain and good noise margin, and transmission-gates. In addition, we developed and characterized information storage circuits like D-Latches and D-Flip-Flops consisting of 16 transistors, demonstrating both their static and dynamic performances and thus the suitability of this technology for more complex circuits such as display addressing logic

  6. Non-uniform space charge limited current injection into a nano contact solid.

    Science.gov (United States)

    Zhu, Y B; Ang, L K

    2015-01-01

    We have developed a two-dimensional (2D) non-uniform model to study the space charge limited (SCL) current injection into a trap-filled solid of nano-contact, such as organic materials and dielectrics. Assuming a solid of length D with a contact of width W, the enhancement over the well-known 1D uniform model is calculated as a function of W/D for different material properties, such as the dielectric constant (ε) and the trap distribution. The non-uniform current density profile due to edge effect is predicted. The findings reported here are different from the prior uniform 2D models, which are significant for small W/D when the size of the contact reaching nanometer scale, i.e. W = 50 nm for D = 1 μm. This model will be useful for the characterization of carrier mobility and properties of traps, which are critical to many novel devices (with small nano-contact) operating in the space charge limited condition reporting in novel device and its applications. Empirical formulas are given for future comparison with experimental results. PMID:25779769

  7. Controlling charge carrier injection in organic electroluminescent devices via ITO substrate modification

    CERN Document Server

    Day, S

    2001-01-01

    and the ITO substrate was found to shift the work function of the electrode, and so modify the barrier to hole injection. Scanning Kelvin probe measurements show that the ITO work function is increased by 0.25 eV with a film of TNAP, while a C sub 6 sub 0 film is found to reduce the work function by a comparable amount. The former has been attributed to a charge-transfer effect resulting in Fermi level alignment between the ITO and the TNAP layer, however the latter is believed to result from both charge transfer and a covalent interaction between C sub 6 sub 0 and ITO. The performance of devices incorporating these modified ITO electrode are rationalised in terms of the work function modification, film thicknesses and the hole transport properties of the two films. Competition between the induced work function change and the increasingly significant tunnelling barrier with thickness means that device performance is not as good as that provided by the SAMs. Direct processing of the ITO substrate has also been...

  8. Femtosecond insights into direct electron injection in dye anchored ZnO QDs following charge transfer excitation.

    Science.gov (United States)

    Kumar, Pushpendra; Kumar, Sunil; Ghosh, Subrata; Pal, Suman Kalyan

    2016-07-27

    The role of the charge transfer (CT) state in interfacial electron transfer in dye-sensitized semiconductor nanocrystals is still poorly understood. To address this problem, femtosecond transient absorption (TA) spectroscopy is used as a probe to investigate the electron injection across a newly synthesized coumarin dye (8-hydroxy-2-oxo-4-phenyl-2 benzo[h]chromene-3-carbonitrile, coded BC5) and ZnO quantum dots (QDs). Steady state and time-resolved spectroscopic measurements reveal that BC5 dye interacts strongly with ZnO QDs in the ground state forming a CT complex. The BC5-ZnO QD complex absorbs more towards red compared to only the dye and QDs, and emits fluorescence due to radiative recombination of photogenerated charges. The formation of charges following the excitation of the CT complex has been demonstrated by observing the signature of dye radical cations and electrons in the conduction band (CB) of the QDs in the TA spectra. The TA signals of these charges grow sharply as a result of ultrafast direct electron injection into the QD. We have monitored the complete dynamics of photogenerated charges by measuring the TA signals of the charges up to a couple of nanoseconds. The injected electrons that are free or shallowly trapped recombine with a time constant of 625 fs, whereas deeply trapped electrons disappear slowly (526 ps) via radiative recombination. Furthermore, theoretical studies based on ab initio calculations have been carried out to complement the experimental findings. PMID:27412034

  9. Balanced charge injection in multilayer polymer light-emitting diode with water soluble nonconjugated polymer dispersed by ionic compounds

    Science.gov (United States)

    Park, Dong-Kyu; Chun, A.-Rum; Kim, Soo-Hong; Kim, Min-Sook; Kim, Choong-Gi; Kwon, Tae-Woo; Cho, Seong-Jin; Woo, Hyung-Suk; Lee, Jae-Gyoung; Lee, Suck-Hyun; Guo, Zhi-Xin

    2007-07-01

    The authors have fabricated highly efficient polymeric light-emitting diode (PLED) from ionic compound dispersed water soluble nonconjugated polymer, polyurethane (PU), which was used as an ultrathin hole blocking and electron injection layer (HB-EIL) on the top of commercially available blue-emitting polymer, polyfluorene. The device with HB-EIL showed a maximum quantum efficiency of 1.7%, while the one without HB-EIL showed an efficiency of 0.6%. They propose that the better performance in PLED with PU layer was due to a well balanced charge injection in emitting layer after the enhanced electron injection due to ionic compound in the insulating PU layer.

  10. Organic integrated circuits for information storage based on ambipolar polymers and charge injection engineering

    Energy Technology Data Exchange (ETDEWEB)

    Dell' Erba, Giorgio; Natali, Dario [Center for Nano Science and Technology PoliMi, Istituto Italiano di Tecnologia, Via Pascoli 70/3, 20133 Milano (Italy); Dipartimento di Elettronica, Informazione e Bioingegneria, Politecnico di Milano, Piazza L. da Vinci 32, 20133 Milano (Italy); Luzio, Alessandro; Caironi, Mario, E-mail: mario.caironi@iit.it, E-mail: yynoh@dongguk.edu [Center for Nano Science and Technology PoliMi, Istituto Italiano di Tecnologia, Via Pascoli 70/3, 20133 Milano (Italy); Kim, Juhwan; Khim, Dongyoon; Kim, Dong-Yu [Heeger Center for Advanced Materials, School of Materials Science and Engineering, Gwangju Institute of Science and Technology (GIST), 261 Cheomdan-gwagiro, Buk-gu, Gwangju 500-712 (Korea, Republic of); Noh, Yong-Young, E-mail: mario.caironi@iit.it, E-mail: yynoh@dongguk.edu [Department of Energy and Materials Engineering, Dongguk University, 26 Pil-dong, 3-ga, Jung-gu, Seoul 100-715 (Korea, Republic of)

    2014-04-14

    Ambipolar semiconducting polymers, characterized by both high electron (μ{sub e}) and hole (μ{sub h}) mobility, offer the advantage of realizing complex complementary electronic circuits with a single semiconducting layer, deposited by simple coating techniques. However, to achieve complementarity, one of the two conduction paths in transistors has to be suppressed, resulting in unipolar devices. Here, we adopt charge injection engineering through a specific interlayer in order to tune injection into frontier energy orbitals of a high mobility donor-acceptor co-polymer. Starting from field-effect transistors with Au contacts, showing a p-type unbalanced behaviour with μ{sub h} = 0.29 cm{sup 2}/V s and μ{sub e} = 0.001 cm{sup 2}/V s, through the insertion of a caesium salt interlayer with optimized thickness, we obtain an n-type unbalanced transistor with μ{sub e} = 0.12 cm{sup 2}/V s and μ{sub h} = 8 × 10{sup −4} cm{sup 2}/V s. We applied this result to the development of the basic pass-transistor logic building blocks such as inverters, with high gain and good noise margin, and transmission-gates. In addition, we developed and characterized information storage circuits like D-Latches and D-Flip-Flops consisting of 16 transistors, demonstrating both their static and dynamic performances and thus the suitability of this technology for more complex circuits such as display addressing logic.

  11. Extreme Contrast Ratio Imaging of Sirius with a Charge Injection Device

    CERN Document Server

    Batcheldor, D; Bahr, C; Jenne, J; Ninkov, Z; Bhaskaran, S; Chapman, T

    2015-01-01

    The next fundamental steps forward in understanding our place in the universe could be a result of advances in extreme contrast ratio (ECR) imaging and point spread function (PSF) suppression. For example, blinded by quasar light we have yet to fully understand the processes of galaxy formation and evolution, and there is an ongoing race to obtain a direct image of an exoearth lost in the glare of its host star. To fully explore the features of these systems we must perform observations in which contrast ratios of at least one billion can be regularly achieved with sub 0.1" inner working angles. Here we present the details of a latest generation 32-bit charge injection device (CID) that could conceivably achieve contrast ratios on the order of one billion. We also demonstrate some of its ECR imaging abilities for astronomical imaging. At a separation of two arc minutes, we report a direct contrast ratio of Delta(m_v)=18.3, log(CR)=7.3, or 1 part in 20 million, from observations of the Sirius field. The atmosp...

  12. Extreme Contrast Ratio Imaging of Sirius with a Charge Injection Device

    Science.gov (United States)

    Batcheldor, D.; Foadi, R.; Bahr, C.; Jenne, J.; Ninkov, Z.; Bhaskaran, S.; Chapman, T.

    2016-02-01

    The next fundamental steps forward in understanding our place in the universe could be a result of advances in extreme contrast ratio (ECR) imaging and point-spread function (PSF) suppression. For example, blinded by quasar light we have yet to fully understand the processes of galaxy and star formation and evolution, and there is an ongoing race to obtain a direct image of an exo-Earth lost in the glare of its host star. To fully explore the features of these systems, we must perform observations in which contrast ratios (CRs) of at least one billion can be regularly achieved with sub 0.″1 inner working angles. Here, we present the details of a latest-generation 32-bit charge injection device (CID) that could conceivably achieve CRs on the order of one billion. We also demonstrate some of its ECR imaging abilities for astronomical imaging. At a separation of two arcminutes, we report a direct CR of {{Δ }}{m}v=18.3,{log}({CR})=7.3, or 1 part in 20 million, from observations of the Sirius field. The atmospheric conditions present during the collection of this data prevented less modest results, and we expect to be able to achieve higher CRs, with improved inner working angles, simply by operating a CID at a world-class observing site. However, CIDs do not directly provide any PSF suppression. Therefore, combining CID imaging with a simple PSF suppression technique like angular differential imaging could provide a cheap and easy alternative to the complex ECR techniques currently being employed.

  13. An experimental technique for the study of non-avalanche charge injection or trapping in MIS structures

    Science.gov (United States)

    Kolk, J.; Heasell, E.

    1980-03-01

    In the study of charge injection in the insulator-silicon system, variation of the electric field in the insulator, caused by charge trapping during a measurement, makes the interpretation and analysis of experimental data difficult. A measuring system and test device structure are described in which it is possible to monitor any change of the device threshold voltage and to adjust the applied gate voltage so as to maintain a constant electric field at the insulator-silicon interface. Experimental results will be presented which show the advantages stemming from this mode of operation.

  14. Flexible charge balanced stimulator with 5.6 fC accuracy for 140 nC injections.

    Science.gov (United States)

    Nag, Sudip; Jia, Xiaofeng; Thakor, Nitish V; Sharma, Dinesh

    2013-06-01

    Electrical stimulations of neuronal structures must ensure net injected charges to be zero for biological safety and voltage compliance reasons. We present a novel architecture of general purpose biphasic constant current stimulator that exhibits less than 5.6 fC error while injecting 140 nC charges using 1.4 mA currents. The floating current sources and conveyor switch based system can operate in monopolar or bipolar modes. Anodic-first or cathodic-first pulses with optional inter-phase delays have been demonstrated with zero quiescent current requirements at the analog front-end. The architecture eliminates blocking capacitors, electrode shorting and complex feedbacks. Bench-top and in-vivo measurement results have been presented with emulated electrode impedances (resistor-capacitor network), Ag-AgCl electrodes in saline and in-vivo (acute) peripheral nerve stimulations in anesthetized rats. PMID:23853326

  15. Effect of Coercive Voltage and Charge Injection on Performance of a Ferroelectric-Gate Thin-Film Transistor

    Directory of Open Access Journals (Sweden)

    P. T. Tue

    2013-01-01

    Full Text Available We adopted a lanthanum oxide capping layer between semiconducting channel and insulator layers for fabrication of a ferroelectric-gate thin-film transistor memory (FGT which uses solution-processed indium-tin-oxide (ITO and lead-zirconium-titanate (PZT film as a channel layer and a gate insulator, respectively. Good transistor characteristics such as a high “on/off” current ratio, high channel mobility, and a large memory window of 108, 15.0 cm2 V−1 s−1, and 3.5 V were obtained, respectively. Further, a correlation between effective coercive voltage, charge injection effect, and FGT’s memory window was investigated. It is found that the charge injection from the channel to the insulator layer, which occurs at a high electric field, dramatically influences the memory window. The memory window’s enhancement can be explained by a dual effect of the capping layer: (1 a reduction of the charge injection and (2 an increase of effective coercive voltage dropped on the insulator.

  16. Fault injection as a test method for an FPGA in charge of data readout for a large tracking detector

    CERN Document Server

    Roed, K; Richter, M; Fehlker, D; Helstrup, H; Alme, J; Ullaland, K

    2011-01-01

    This paper describes how fault injection has been implemented as a test method for an FPGA in an existing hardware configuration setup. As this FPGA is in charge of data readout for a large tracking detector, the reliability of this FPGA is of high importance. Due to the complexity of the readout electronics, irradiation testing is technically difficult at this stage of the system commissioning. The work presented in this paper is therefore motivated by introducing fault injection as an alternative method to characterize failures caused by SEUs. It is a method to study the effect that a configuration upset may have on the operation of the FPGA. The target platform consists of two independent modules for data acquisition and detector control functionality. Fault injection to test the response of the data acquisition module is made possible by implementing the solution as part of the detector control functionality. Correct implementation is validated by a simple shift register design. Our results demonstrate th...

  17. Mechanistic Studies of Charge Injection from Metallic Electrodes into Organic Semiconductors Mediated by Ionic Functionalities: Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Thuc-Quyen [UCSB; Bazan, Guillermo [UCSB; Mikhailovsky, Alexander [UCSB

    2014-04-15

    Metal-organic semiconductor interfaces are important because of their ubiquitous role in determining the performance of modern electronics such as organic light emitting diodes (OLEDs), fuel cells, batteries, field effect transistors (FETs), and organic solar cells. Interfaces between metal electrodes required for external wiring to the device and underlying organic structures directly affect the charge carrier injection/collection efficiency in organic-based electronic devices primarily due to the mismatch between energy levels in the metal and organic semiconductor. Environmentally stable and cost-effective electrode materials, such as aluminum and gold typically exhibit high potential barriers for charge carriers injection into organic devices leading to increased operational voltages in OLEDs and FETs and reduced charge extraction in photovoltaic devices. This leads to increased power consumption by the device, reduced overall efficiency, and decreased operational lifetime. These factors represent a significant obstacle for development of next generation of cheap and energy-efficient components based on organic semiconductors. It has been noticed that introduction of organic materials with conjugated backbone and ionic pendant groups known as conjugated poly- and oligoelectrolytes (CPEs and COEs), enables one to reduce the potential barriers at the metal-organic interface and achieve more efficient operation of a device, however exact mechanisms of the phenomenon have not been understood. The goal of this project was to delineate the function of organic semiconductors with ionic groups as electron injection layers. The research incorporated a multidisciplinary approach that encompassed the creation of new materials, novel processing techniques, examination of fundamental electronic properties and the incorporation of the resulting knowledgebase into development of novel organic electronic devices with increased efficiency, environmental stability, and reduced

  18. Aufbau eines Wertermittlungsinformationssystems

    OpenAIRE

    Mürle, Michael

    2007-01-01

    Das Buch beschreibt die Konzeption eines Geo-Informationssystems zur Eingabe, Verwaltung, Analyse und Präsentation von Geofachdaten des Grundstücksmarktes. Die Entwicklung von Zielkomponenten für den Aufbau eines Wertermittlungsinformationssystems orientiert sich an dem gesetzlichen Aufgabenkatalog der Gutachterausschüsse nach dem Baugesetzbuch. Zur sukzes-siven Analyse von Grundstücksmarktdaten wird eine stufenweise Analysestrategie auf der Grundlage von Ausgleichungsmodellen vorgeschlag...

  19. Die Position eines Supervisors

    OpenAIRE

    Teichmann, Volker

    2002-01-01

    Aus der Sicht eines Supervisors ist die Frage nach Qualitätssicherung Eulen nach Athen tragen. Supervision ist eines der ältesten Mittel der Qualitätssicherung und seit jeher integraler Bestandteil sowohl der Klinischen Psychologie als auch anderer Bereiche wie ABO oder Verkehrspsychologie. Ebenso sind Zertifizierung/Akkreditierung Selbstverständlichkeiten. Damit als erstes ein klares JA bezüglich der oben gestellten Frage. Verstanden als Reflexion des eigenen Handelns zur Optimierung d...

  20. Kerr electro-optic field mapping study of the effect of charge injection on the impulse breakdown strength of transformer oil

    Science.gov (United States)

    Zhang, X.; Zahn, M.

    2013-10-01

    The smart use of charge injection to improve breakdown strength in transformer oil is demonstrated in this paper. Hypothetically, bipolar homo-charge injection with reduced electric field at both electrodes may allow higher voltage operation without insulation failure, since electrical breakdown usually initiates at the electrode-dielectric interfaces. To find experimental evidence, the applicability and limitation of the hypothesis is first analyzed. Impulse breakdown tests and Kerr electro-optic field mapping measurements are then conducted with different combinations of parallel-plate aluminum and brass electrodes stressed by millisecond duration impulse. It is found that the breakdown voltage of brass anode and aluminum cathode is ˜50% higher than that of aluminum anode and brass cathode. This can be explained by charge injection patterns from Kerr measurements under a lower voltage, where aluminum and brass electrodes inject negative and positive charges, respectively. This work provides a feasible approach to investigating the effect of electrode material on breakdown strength.

  1. Photoinduced charge injection from excited triplet hypocrellin B into TiO2 colloid in ethanol

    Institute of Scientific and Technical Information of China (English)

    SHEN, Jian-Quan; SHEN, Tao; ZHANG, Man-Hua; LI, Wen; SONG, Ai-Min

    2000-01-01

    Photosensitization of TiO2 colloid by hypocrellin B (HB), a natural photodynamic pigment with extremely high plhotosta bility, has been studied by surface enhanced Raman spec troscorpy (SERS), laser flash photolysis and electron param agnetic resonance (EPR) techniques. The photosensitization of TiO2 occurred practically from the excited triplet dye and the electron injection rate constant is 1.3 × 106 s-1. The influ ences of donor and acceptor on the eleciron injection were in vestigated.

  2. Rezension: Ameisengesellschaften. Eine Faszinationsgeschichter

    Directory of Open Access Journals (Sweden)

    Raffaela Rogy

    2015-03-01

    Full Text Available In der wissenshistorischen Studie „Ameisengesellschaften. Eine Faszinationsgeschichte“ gibt der Professor für Neuere Deutsche Literatur Niels Werber an Hand eines interdisziplinären Medienaustausches zwischen naturwissenschaftlicher Fachliteratur, Belletristik und ausgewählten Filmen, einen lohnenden Einblick auf den kollektiven Verbund von Ameisen, der als Spiegel für menschliche Gesellschaftsformen gesehen werden kann.

  3. Performance and efficiency evaluation and heat release study of a direct-injection stratified-charge rotary engine

    Science.gov (United States)

    Nguyen, H. L.; Addy, H. E.; Bond, T. H.; Lee, C. M.; Chun, K. S.

    1987-01-01

    A computer simulation which models engine performance of the Direct Injection Stratified Charge (DISC) rotary engines was used to study the effect of variations in engine design and operating parameters on engine performance and efficiency of an Outboard Marine Corporation (OMC) experimental rotary combustion engine. Engine pressure data were used in a heat release analysis to study the effects of heat transfer, leakage, and crevice flows. Predicted engine data were compared with experimental test data over a range of engine speeds and loads. An examination of methods to improve the performance of the rotary engine using advanced heat engine concepts such as faster combustion, reduced leakage, and turbocharging is also presented.

  4. The Dirac field in the electromagnetic potential of a charged string; Das Dirac-Feld im elektromagnetischen Potential eines geladenen Strings

    Energy Technology Data Exchange (ETDEWEB)

    Anaguano, L.

    2005-07-01

    According to the theory of Quantum Electrodynamics (QED) the vacuum state will change in the presence of very strong electromagnetic fields. If the external field (in the simplest case purely electrostatic) exceeds a certain critical value the creation of electron-positron pairs will ensue, resulting the the formation of a charged vacuum. This process is characterized by the emergence of electron states with a binding energy larger than twice the electron rest mass. The effect up to now usually was studied for spherically symmetric systems, in particular for the Coulomb potential of a heavy nucleus. In the present thesis we investigate, how this phenomenon changes when passing from spherical to cylindrical geometry. For this, we derive the solutions of the Dirac equation for electrons in the electrostatic potential of a long, thin charged cylinder (a ''charged string'') and study the ensuing supercritical effects. Since the logarithmic potential of an infinitely long string rises indefinitely with growing distance, all electron states should be supercritical (i.e., electrons should be able to tunnel through the particle-antiparticle gap of the Dirac equation). Therefore on may expect that the central charge will surround itself with an oppositely charged sheath of vacuum electrons, leading to neutralization of the string. To develop a quantitative description of this process, we investigate the solutions of the Poisson equation and the Dirac equation in cylindrical symmetry. In the first step a series expansion of the electrostatic potential in the central plane of a homogeneously charge cylinder of finite length and finite radius is derived. Subsequently, we employ the tetrad (vierbein) formalism to separate the Dirac equation in cylindrical coordinates. The resulting radial Dirac equation is transformed to Schroedinger type. The bound states are evaluated using the method of uniform approximation (a version of the WKB approximation). We study

  5. Managing charging loads of electric vehicles by monetary incentives. A model-based optimization; Monetaere Anreize zur Steuerung der Ladelast von Elektrofahrzeugen. Eine modellgestuetzte Optimierung

    Energy Technology Data Exchange (ETDEWEB)

    Paetz, Alexandra-Gwyn; Kaschub, Thomas; Kopp, Martin; Jochem, Patrick; Fichtner, Wolf [Karlsruher Institut fuer Technologie, Karlsruhe (Germany). Inst. fuer Industriebetriebslehre und Industrielle Produktion

    2013-03-15

    Electric mobility is supposed to contribute to climate policy targets by reducing CO{sub 2}-emissions in the transportation sector. Increasing penetration rates of electric vehicles (EV) can lead to new challenges in the electricity sector, especially with regard to local distribution networks. Thus the management of charging loads is discussed as a key issue in energy economics. Due to their long parking times, high electricity and power demand, EV seem to be predestined for load management. Monetary incentives as dynamic pricing can be suitable for that: They reflect the current supply situation, pass the information to the consumers and can thus lead to a corresponding charging behaviour. In this article we analyse this interaction between dynamic pricing and charging loads. For this reason we have developed the optimization model DS-Opt+. It models a total number of 4,000 households in two residential areas of a major city with regard to its electricity demand, its mobility behaviour and its equipment of photovoltaic systems. Four different pricing models are tested for their effects on charging behaviour and thus the total load of the residential area. The results illustrate that only fairly high penetration rates of EV lead to remarkably higher electricity demand and require some load management. The tested dynamic pricing models are suitable for influencing charging loads; load-based tariffs are best in achieving a balanced load curve. In our analysis uncontrolled charging strategies are superior regarding a balanced load curve than controlled strategies by time-varying tariffs. Our results lead to several implications relevant for the energy industry and further research.

  6. Charge injection and transport in low-mobility mixed ionic/electronic conducting systems: Regimes of behavior and limiting cases

    Science.gov (United States)

    Mills, Thomas J.; Lonergan, Mark C.

    2012-01-01

    A comprehensive analysis of a model describing charge-carrier injection and transport in light-emitting electrochemical cells (LECs) and related mixed ionic electronic conductors (MIECs) is given. Ions are treated using a modified drift-diffusion transport equation that accounts for volume-exclusion effects, and electronic injection is treated using a spatially dependent tunneling mechanism that explicitly accounts for both forward and backward fluxes. Systems containing both one and two mobile ionic species are treated and compared. The unique physics of LECs stem from ionic polarization processes that can lead to field screening and narrowed injection barriers, producing increased electrode exchange currents via tunneling. The latter process promotes the establishment of electronic quasiequilibrium throughout the double-layer regions and hence promotes bulk-limited conduction. Explicit expressions are given describing the conditions necessary to assume field screening and bulk-limited conduction, which determine the applicability of either traditional semiconductor device models such as Fowler-Nordheim or electrochemical models such as the Nernst equation. Having established these conditions, several distinct regimes of bulk-limited LEC behavior are described. Explicit formulas for the biases delineating these regimes are given as well as formulas for the current in each regime. At low biases, the current generally increases exponentially with bias; the bulk remains field free, and the transport is predominantly unipolar and diffusive. At high biases, the current rises much less rapidly, and bulk transport is bipolar, occurring through a combination of drift and diffusion. The nature of the bulk region in the high-bias regime is markedly different in systems with one and two mobile ionic species. At intermediate biases, space charge effects preferentially drive injection of the minority carrier causing a transition from unipolar to bipolar injection. It is

  7. Heavy Inertial Confinement Energy: Interactions Involoving Low charge State Heavy Ion Injection Beams

    Energy Technology Data Exchange (ETDEWEB)

    DuBois, Robert D

    2006-04-14

    During the contract period, absolute cross sections for projectile ionization, and in some cases for target ionization, were measured for energetic (MeV/u) low-charge-state heavy ions interacting with gases typically found in high and ultra-high vacuum environments. This information is of interest to high-energy-density research projects as inelastic interactions with background gases can lead to serious detrimental effects when intense ion beams are accelerated to high energies, transported and possibly confined in storage rings. Thus this research impacts research and design parameters associated with projects such as the Heavy Ion Fusion Project, the High Current and Integrated Beam Experiments in the USA and the accelerator upgrade at GSI-Darmstadt, Germany. Via collaborative studies performed at GSI-Darmstadt, at the University of East Carolina, and Texas A&M University, absolute cross sections were measured for a series of collision systems using MeV/u heavy ions possessing most, or nearly all, of their bound electrons, e.g., 1.4 MeV/u Ar{sup +}, Xe{sup 3+}, and U{sup 4,6,10+}. Interactions involving such low-charge-state heavy ions at such high energies had never been previously explored. Using these, and data taken from the literature, an empirical model was developed for extrapolation to much higher energies. In order to extend our measurements to much higher energies, the gas target at the Experimental Storage Ring in GSI-Darmstadt was used. Cross sections were measured between 20 and 50 MeV/u for U{sup 28+}- H{sub 2} and - N{sub 2}, the primary components found in high and ultra-high vacuum systems. Storage lifetime measurements, information inversely proportional to the cross section, were performed up to 180 MeV/u. The lifetime and cross section data test various theoretical approaches used to calculate cross sections for many-electron systems. Various high energy density research projects directly benefit by this information. As a result, the general

  8. Beyond vibrationally mediated electron transfer: interfacial charge injection on a sub-10-fs time scale

    Science.gov (United States)

    Huber, Robert; Moser, Jacques E.; Gratzel, Michael; Wachtveitl, Josef L.

    2003-12-01

    The electron transfer (ET) from organic dye molecules to semiconductor-colloidal systems is characterized by a special energetic situation with a charge transfer reaction from a system of discrete donor levels to a continuum of acceptor states. If these systems show a strong electronic coupling they are amongst the fastest known ET systems with transfer times of less than 10 fs. In the first part a detailed discussion of the direct observation of an ET reaction with a time constant of about 6 fs will be given, with an accompanying argumentation concerning possible artifacts or other interfering signal contributions. In a second part we will try to give a simple picture for the scenario of such superfast ET reactions and one main focus will be the discussion of electronic dephasing and its consequences for the ET reaction. The actual ET process can be understood as a kind of dispersion process of the initially located electron into the colloid representing a real motion of charge density from the alizarin to the colloid.

  9. Localization of the large-angle foil-scattering beam loss caused by the multiturn charge-exchange injection

    Science.gov (United States)

    Kato, Shinichi; Yamamoto, Kazami; Yoshimoto, Masahiro; Harada, Hiroyuki; Kinsho, Michikazu

    2013-07-01

    In the 3 GeV rapid cycling synchrotron of the Japan Proton Accelerator Research Complex, significant losses were observed at the branching of the H0 dump line and the beam position monitor that was inserted downstream of the H0 dump branch duct. These losses were caused by the large-angle scattering of the injection and circulating beams at the charge-exchange foil. To realize high-power operation, these losses must be mitigated. Therefore, a new collimation system was developed and installed in October 2011. To efficiently optimize this system, the behavior of particles scattered by the foil and produced by the absorber were simulated, and the optimal position and angle of the absorber were investigated. During this process, an angle regulation method for the absorber was devised. An outline of this system, the angle regulation method for the absorber, and the performance of this new collimation system are described.

  10. Charge-injection-device performance in the high-energy-neutron environment of laser-fusion experiments.

    Science.gov (United States)

    Marshall, F J; DeHaas, T; Glebov, V Yu

    2010-10-01

    Charge-injection devices (CIDs) are being used to image x rays in laser-fusion experiments on the University of Rochester's OMEGA Laser System. The CID cameras are routinely used up to the maximum neutron yields generated (∼10(14) DT). The detectors are deployed in x-ray pinhole cameras and Kirkpatrick-Baez microscopes. The neutron fluences ranged from ∼10(7) to ∼10(9) neutrons/cm(2) and useful x-ray images were obtained even at the highest fluences. It is intended to use CID cameras at the National Ignition Facility (NIF) as a supporting means of recording x-ray images. The results of this work predict that x-ray images should be obtainable on the NIF at yields up to ∼10(15), depending on distance and shielding.

  11. Charge-injection-device performance in the high-energy-neutron environment of laser-fusion experiments

    International Nuclear Information System (INIS)

    Charge-injection devices (CIDs) are being used to image x rays in laser-fusion experiments on the University of Rochester's OMEGA Laser System. The CID cameras are routinely used up to the maximum neutron yields generated (∼1014 DT). The detectors are deployed in x-ray pinhole cameras and Kirkpatrick-Baez microscopes. The neutron fluences ranged from ∼107 to ∼109 neutrons/cm2 and useful x-ray images were obtained even at the highest fluences. It is intended to use CID cameras at the National Ignition Facility (NIF) as a supporting means of recording x-ray images. The results of this work predict that x-ray images should be obtainable on the NIF at yields up to ∼1015, depending on distance and shielding.

  12. Die neue Weltordnung:eine unipolare Ordnung oder eine Unordnung?

    OpenAIRE

    Peng, T.

    2006-01-01

    Das verstärkte Streben der USA nach der globalen Vorherrschaft, das insbesondere durch den Krieg gegen den Irak im Jahr 2003 zum Ausdruck gebracht worden ist, löst in der Wissenschaft und Politik die Debatte um eine neue unipolare oder multipolare Weltordnung aus. In dieser Debatte sehen viele Autoren ein erkennbares Ordnungsmuster in der Weltpolitik. Diese Arbeit führt eine kritische Auseinandersetzung mit der aktuellen Debatte um eine neue Weltordnung aus. Die Untersuchung der Arbeit weist ...

  13. Laser-induced forward transfer of polymer light-emitting diode pixels with increased charge injection.

    Science.gov (United States)

    Shaw-Stewart, James; Lippert, Thomas; Nagel, Matthias; Nüesch, Frank; Wokaun, Alexander

    2011-02-01

    Laser-induced forward transfer (LIFT) has been used to print 0.6 mm × 0.5 mm polymer light-emitting diode (PLED) pixels with poly[2-methoxy, 5-(2-ethylhexyloxy)-1,4-phenylene vinylene] (MEH-PPV) as the light-emitting polymer. The donor substrate used in the LIFT process is covered by a sacrificial triazene polymer (TP) release layer on top of which the aluminium cathode and functional MEH-PPV layers are deposited. To enhance electron injection into the MEH-PPV layer, a thin poly(ethylene oxide) (PEO) layer on the Al cathode or a blend of MEH-PPV and PEO was used. These donor substrates have been transferred onto both plain indium tin oxide (ITO) and bilayer ITO/PEDOT:PSS (poly(3,4-ethylenedioxythiophene) poly(styrenesulfonate) blend) receiver substrates to create the PLED pixels. For comparison, devices were fabricated in a conventional manner on ITO substrates coated with a PEDOT:PSS hole-transporting layer. Compared to multilayer devices without PEO, devices with ITO/PEDOT:PSS/MEH-PPV:PEO blend/Al architecture show a 100 fold increase of luminous efficiency (LE) reaching a maximum of 0.45 cd/A for the blend at a brightness of 400 cd/m(2). A similar increase is obtained for the polymer light-emitting diode (PLED) pixels deposited by the LIFT process, although the maximum luminous efficiency only reaches 0.05 cd/A for MEH-PPV:PEO blend, which we have attributed to the fact that LIFT transfer was carried out in an ambient atmosphere. For all devices, we confirm a strong increase in device performance and stability when using a PEDOT:PSS film on the ITO anode. For PLEDs produced by LIFT, we show that a 25 nm thick PEDOT:PSS layer on the ITO receiver substrate considerably reduces the laser fluence required for pixel transfer from 250 mJ/cm(2) without the layer to only 80 mJ/cm(2) with the layer. PMID:21261274

  14. Entwicklung eines programmierbaren Restriktionsenzyms

    OpenAIRE

    Eisenschmidt, Kristin

    2005-01-01

    In der vorliegenden Arbeit sollte die Spezifität der Restriktionsendonuklease scPvuII durch Kopplung mit der Spezifität eines TFOs (triple-helix forming Oligonukletids) erweitert werden. Hierfür wurde zuerst die scPvuIIH6G4C-Variante exprimiert und über Affinitätschromatographie gereinigt. Die DNA-Bindungseigenschaften dieser Variante wurden anschließend mit und ohne den Kofaktor Mg2+ mit Hilfe von Fluoreszenz-Anisotropie-Messung bestimmt. Anschließend wurde ein TFO mit dem C-terminalen Ende ...

  15. Charge injection properties of iridium oxide films produced on Ti-6Al-4V alloy substrates by ion-beam mixing techniques

    Energy Technology Data Exchange (ETDEWEB)

    Williams, J.M. (Oak Ridge National Lab., TN (United States)); Lee, I-S.; Buchanan, R.A. (Tennessee Univ., Knoxville, TN (United States))

    1991-10-01

    The charge injection capabilities of iridium oxide films, as produced on Ti6Al-4V alloy substrates by ion beam mixing techniques, have been investigated. Iridium oxide is a valence change oxide, and therefore has high values of charge injection density upon voltage cycling in electrolytes. Because of this property, iridium oxide films are useful as working elements in neural prostheses. Iridium films of three thicknesses, produced by sputter deposition followed by ion beam mixing, were tested in cyclic voltammetry out to 1000 cycles or more. Two surface preparations, mechanical polishing and an acid passivation treatment, were also used as controls. Surface analysis was primarily by Rutherford backscattering spectrometry. Both the ion- beam mixing and the acid pretreatment increased the lifetimes of films, in comparison with the mechanically polished standards. Reductions in charge injection capability, when they occurred, were attributed to loss of Ir from the films, and there was a close correlation between the charge injection density and the Ir inventory. 13 refs., 5 figs.

  16. Kulturalistische Unternehmensethik : ein Programm

    OpenAIRE

    Hanekamp, Gerd

    2001-01-01

    "Das Programm einer kulturalistischen Unternehmensethik wird vorgestellt. Es gründet auf einem philosophischen Ansatz, der sich als instrumentalistisch, kontextualistisch, transsubjektivistisch und individualistisch charakterisieren lässt. Hinsichtlich der ethischen Grundlagen werden starke Thesen durch den Rekurs auf eine kontextualistisch-normative Anthropologie vermieden." (Autorenreferat)

  17. RAAS - ein leichtgewichtiges Managementkonzept

    OpenAIRE

    Priemel, Annett

    2002-01-01

    Gemeinsamer Workshop von Universitaetsrechenzentrum und Professur Rechnernetze und verteilte Systeme der Fakultaet fuer Informatik der TU Chemnitz. RAAS ist ein Konzept um gleichlautende Aufgaben für und über mehrere Remote-Computer auszuführen. Das Konzept wird dargestellt und anhand von Beispielen erläutert. Das Admin-Tool wird im Anschluss mit Praxisaufgaben vorgestellt.

  18. Ein Horchposten ins Universum

    OpenAIRE

    Aufmuth, P.

    2004-01-01

    Erst seit wenigen Jahren ist es möglich, Gravitationswellen nachzuweisen. Ein neu entwickelter Gravitationswellendetektor zeichnet sich durch besondere Empfindlichkeit aus. Mit seiner Hilfe lassen sich wichtige Informationen über Schwarze Löcher, dunkle Materie und den Ursprung des Alls gewinnen

  19. Evidence for high-energy and low-emittance electron beams using ionization injection of charge in a plasma wakefield accelerator

    CERN Document Server

    Vafaei-Najafabadi, N; Clayton, C E; Joshi, C; Marsh, K A; Mori, W B; Welch, E C; Lu, W; Adli, E; Allen, J; Clarke, C I; Corde, S; Frederico, J; Gessner, S J; Green, S Z; Hogan, M J; Litos, M D; Yakimenko, V

    2015-01-01

    Ionization injection in a plasma wakefield accelerator was investigated experimentally using two lithium plasma sources of different lengths. The ionization of the helium gas, used to confine the lithium, injects electrons in the wake. After acceleration, these injected electrons were observed as a distinct group from the drive beam on the energy spectrometer. They typically have a charge of tens of pC, an energy spread of a few GeV, and a maximum energy of up to 30 GeV. The emittance of this group of electrons can be many times smaller than the initial emittance of the drive beam. The energy scaling for the trapped charge from one plasma length to the other is consistent with the blowout theory of the plasma wakefield.

  20. Diagnose: Entwicklungsstillstand - Ein Therapiebericht

    OpenAIRE

    Bronder, Gisela; Böttcher, Käte; Rohlfs, Sigrid

    1980-01-01

    Es wird uber ein verhaltenstherapeutisches Programm mit einem geistig schwerbehinderten, lO jährigen Mädchen berichtet, das extreme Eßschwierigkeiten ? Unfähigkeit, die Nahrung zu schlucken ?, sowie weder Spiel- und Sozialverhalten, noch Sprachverständnis zeigte. Das therapeutische Vorgehen beinhaltete operantes Konditionieren und Lernen am Modell, wobei imitatives Verhalten erst aufgebaut werden mußte. Nach dem Aufbau erster, einfacher Verhaltensweisen zeigte die Patientin zunehmend spontane...

  1. Prostatitis - eine endlose Geschichte?

    Directory of Open Access Journals (Sweden)

    Riedl CR

    2001-01-01

    Full Text Available Aktuelle epidemiologische Daten aus den USA zeigen, daß der urogenitale Symptomenkomplex, der langläufig als "Prostatitis" bezeichnet wird, ein nicht unbeträchtliches volksgesundheitliches und volkswirtschaftliches Problem darstellt: dieses Krankheitsbild ist jährlich für 2 Millionen Arztbesuche und für 8% aller urologischen Konsulationen in den USA verantwortlich. Umgekehrt sieht jeder Urologe im Jahr zwischen 150 und 250 Patienten mit "Prostatitis".

  2. Gauß eine Biographie

    CERN Document Server

    Mania, Hubert

    2009-01-01

    Daniel Kehlmann hat ihn wiederentdeckt, den bedeutendsten Mathematiker der Neuzeit: Karl Friedrich Gauß (1777 1855). Seine überragenden wissenschaftlichen Leistungen waren schon seinen Zeitgenossen bewusst. Da Gauß jedoch nur einen Bruchteil seiner Entdeckungen veröffentlichte, erschloss sich erst der Nachwelt die Tiefgründigkeit und Reichweite seines Werks. Hubert Mania schildert in dieser ersten umfassenden Biographie die Geschichte eines genialen Wissenschaftlers und zugleich eine ganze Epoche. Gauß war ein Mann, der in einer Welt des Aufbruchs völlig zurückgezogen lebte. Dabei hat er wie kaum ein anderer unsere Sicht der Welt revolutioniert. Als Erster formulierte er eine nichteuklidische Geometrie und schuf damit die unentbehrliche Grundlage zu Einsteins Entwicklung der allgemeinen Relativitätstheorie. Eine glänzend geschriebene Biographie des weltberühmten und doch so unbekannten Genies Karl Friedrich Gauß.

  3. Relation between microstructure and dielectric breakdown in the case of aluminous ceramics (SEMM method); Comportement d'alumines face a l'injection de charges. Relation microstructure - claquage dielectrique - mesure des charges d'influence (methode SEMM)

    Energy Technology Data Exchange (ETDEWEB)

    Liebault, J.

    1999-02-01

    The dielectric breakdown is strongly linked to the injection and the accumulation of charges in a non-conducting material. The physics of charged insulators proposes mechanisms of trapping and transport of charges in aluminium oxides by considering defects as localization sources of charges and of energy. In order to measure the influence of defects on dielectric breakdown, various aluminous ceramics have been elaborated. The nature and the quantity of defects have been characterized by the nature and the rate of impurities, by porosity, by the quantity of grain boundaries and by the presence and distribution of secondary phases. These materials have undergone breakdown tests. The dielectric rigidity depends strongly on the nature and the distribution of crystallographic defects (vacancy, interstitial ions and dislocation), on the other hand porosity below 5% has no influence. The doping of an alumina ceramic containing less than 100 ppm of impurities implies a diminution of its dielectric rigidity. The measurement of the SEMM (scanning electron microscopy mirror) effect allows the characterization of insulating materials. This method permits the evaluation of the ability for materials to trap charges, it gives information about the charge kinetic of trapping, charge localization and the energy levels of traps. (A.C.)

  4. Rechnet sich ein kleiner Nordstaat?

    OpenAIRE

    Lammers, Konrad

    2006-01-01

    Für eine umfassende Reform der bundesstaatlichen Ordnung wird häufig auch eine Neugliederung des Bundesgebietes für erforderlich gehalten. Was spricht aus der Sicht einzelner Länder dafür oder dagegen, von sich aus eine Neugliederung anzustreben? Welche Effekte sind zu erwarten, wenn sich Schleswig-Holstein und Hamburg zu einem kleinen Nordstaat zusammentun würden.

  5. Entwicklung, Umsetzung und Evaluierung eines dezentralen Lagerverwaltungssystems

    OpenAIRE

    Jung, Matthias; Le, Trung Thanh; Atz, Thomas; Günthner, Willibald A.

    2014-01-01

    Im Rahmen eines von der Deutschen Forschungsgemeinschaft (DFG) geförderten Projekts wird ein detailliertes Konzept, bestehend aus einer Softwarearchitektur und Steuerungsalgorithmen, für ein dezentrales Lagerverwaltungssystem (LVS) vorgestellt und evaluiert.

  6. Teilchenphysik ein Sachcomic

    CERN Document Server

    Whyntie, Tom

    2014-01-01

    Auf den Weg in immer Kleineres macht sich der Infocomics-Band „Teilchenphysik“. Der Weg beginnt bei der Atomtheorie im antiken Griechenland, führt vorbei an den Entdeckungen der Elektronen, des Atomkerns, der Positronen, und macht vorläufige Rast beim Higgs-Teilchen. Damit sind wir etwa an der Grenze unseres Wissenstandes angelangt: Dem Standardmodell. Hierin gibt es zwölf Teilchen (6 Quarks und 6 Leptonen) und drei elementare Wechselwirkungen, die wieder durch Teilchen (Bosonen) vermittelt werden. Viele Mitglieder dieser Elementarfamilie sind sehr scheu und können nur für kurze Momente und nur mit experimenteller Gewalt „beobachtet“ werden. Das nächste Traumziel unserer Reise wäre dann die „Supersymmetrie“ und die Einbeziehung der Gravitation. Dort würden sich die beiden noch getrennten Theorien vom ganz Großen und vom ganz Kleinen vereinen und die „Schwarzen Löcher“ im Weltall sowie unseren Wissensstand aufhellen. Eine spannende Reise, zu der uns ein ehemaliger Mitarbeiter des CERN...

  7. Marketing : eine fallstudienbasierte Einführung

    NARCIS (Netherlands)

    Griese, K.M.; Bröring, S.

    2011-01-01

    Studenten sowie Praktiker erhalten eine praxisorientierte Einführung in die zentralen Grundlagen des Marketing. Ausgangspunkt jedes Kapitels ist eine Fallstudie, die eine konkrete praktische Rahmenbedingung eines Unternehmens vorstellt. Diese Situation wird in den Ausführungen dann mit den theoretis

  8. Numerical solution of the corona discharge problem based on mesh redefinition and test for a charge injection law

    OpenAIRE

    Khaddour, Bassem; Atten, Pierre; Coulomb, Jean-Louis

    2008-01-01

    The paper presents a numerical and experimental study of corona discharge for a blade -plate configuration. Finite element method (FEM) is used to determine the electric potential between the electrodes and charge conservation equation is solved by the method of characteristics (MOC) to determine the charge density. The structured mesh is redefined at each step of the iterative scheme, the nodes of this structured mesh being the intersection points of the field and equipotential lines. The al...

  9. Effects of Direct Fuel Injection Strategies on Cycle-by-Cycle Variability in a Gasoline Homogeneous Charge Compression Ignition Engine: Sample Entropy Analysis

    Directory of Open Access Journals (Sweden)

    Jacek Hunicz

    2015-01-01

    Full Text Available In this study we summarize and analyze experimental observations of cyclic variability in homogeneous charge compression ignition (HCCI combustion in a single-cylinder gasoline engine. The engine was configured with negative valve overlap (NVO to trap residual gases from prior cycles and thus enable auto-ignition in successive cycles. Correlations were developed between different fuel injection strategies and cycle average combustion and work output profiles. Hypothesized physical mechanisms based on these correlations were then compared with trends in cycle-by-cycle predictability as revealed by sample entropy. The results of these comparisons help to clarify how fuel injection strategy can interact with prior cycle effects to affect combustion stability and so contribute to design control methods for HCCI engines.

  10. Geschlechtertheorie und Gleichstellungspraxis : eine theoretische und eine empirische Perspektive

    OpenAIRE

    Vollmer, Lina; Mosel, Juliane

    2014-01-01

    "Seit einigen Jahren finden in der hochschulischen Gleichstellungsarbeit Entwicklungen statt, die als Professionalisierungsprozesse gedeutet werden. Während das traditionelle Professionsverständnis für die Analyse der Gleichstellungsarbeit wenig zielführend ist, bieten dynamische Konzepte der Professionalisierung eine fruchtbare Forschungsperspektive. Zentral für die Professionalisierung ist dabei das an der jeweiligen Wissenschaft eines Tätigkeitsbereichs orientierte Expert-Innenwissen. Mit ...

  11. Ein Jahr Zugelassener Wirtschaftsbeteiligter (AEO)

    OpenAIRE

    Weerth, Carsten

    2009-01-01

    Der Zugelassene Wirtschaftsbeteiligte (AEO) wurde mit Wirkung vom 1. Januar 2008 geschaffen. Ein Jahr ist vergangen, nach dem es nun gilt, eine Zwischenbilanz zu ziehen – wurden die Erwartungen und Antragszahlen erreicht, was gibt es an Neuerungen und welche Tendenzen sind erkennbar? Neue rechtliche Rahmenbedingungen gelten ab dem 1. Januar 2009 – die Kriterien für alle zollrechtlichen Bewilligungen von vereinfachten Anmeldeverfahren und Anschreibeverfahren (Einfuhr, Ausfuhr, Zollverfahren mi...

  12. Topiramat als Phasenprophylaktikum - ein Fallbericht

    Directory of Open Access Journals (Sweden)

    Letmaier M

    2001-01-01

    Full Text Available Topiramat ist ein neues Antiepileptikum mit einem breiten Wirkspektrum. Aktuelle klinische Studien geben Hinweise darauf, daß Topiramat stimmungsstabilisierende Eigenschaften besitzt und somit effizient in der Behandlung der bipolaren affektiven Störung sein könnte. Vor dem Hintergrund dieser Studienberichte, behandelten wir eine 41jährige, erstmals vor 10 Jahren erkrankte Patientin mit der Diagnose einer therapierefraktären, bipolaren affektiven Störung (Rapid-Cycling mit Topiramat. Im Rahmen ihrer Erkrankung wurde die Patientin insgesamt 12mal stationär aufgenommen und meist aufgrund von akuten manischen Episoden behandelt. Dabei kamen seit 1991 folgende Phasenprophylaktika zur Anwendung: Carbamazepin, Valproat und Lamotrigin ? zuletzt nur mit mäßigem Erfolg. Daraufhin wurde zu Beginn einer neuerlichen manischen Episode ambulant eine Therapie mit Topiramat begonnen. Acht Wochen nach Therapiestart kam die Patientin in stationäre Behandlung. Der Aufenthalt dauerte weniger als drei Wochen; Topiramat wurde von der Patientin gut vertragen. Infolge eines belastenden Lebensereignisses kam es unter kontinuierlicher Therapie mit Topiramat zu einer Destabilisierung des psychischen Zustandsbildes (manische Symptome. Durch eine ambulante Erhöhung der Topiramatdosis bei gleichzeitiger Gabe von Risperidon und Clonazepam konnte jedoch eine neuerliche manische Episode erstmals ambulant behandelt werden. Die Patientin erhält derzeit 200 mg Topiramat pro Tag und ist seit mehr als 20 Monaten nahezu beschwerdefrei.

  13. Noise in space-charge-limited current in a CdS-single crystal at low injection level

    NARCIS (Netherlands)

    Driedonks, F.

    1967-01-01

    Current noise spectra (25Hz–20MHz) of a CdS-diode, working under space-charge-limited conditions. show trapping noise at low frequencies and slightly suppressed noise in the upper frequency range. Suppression is relatively small due to the effect of traps.

  14. Charge trapping studies in SiO2 using high current injection from Si-rich SiO2 films

    Science.gov (United States)

    DiMaria, D. J.; Ghez, R.; Dong, D. W.

    1980-09-01

    The high electron injection phenomenon of Si-rich SiO2 films deposited on top of SiO2 can be used for novel charge trapping studies of sites normally present or purposely introduced in the SiO2. From the position and extent of current ledges observed in dark current as a function of ramped gate voltage, the capture cross section and total number of traps can be determined. Using these measurements with capacitance as a function of gate voltage, the trap distribution centroid and number of trapped charges can also be found. Several experimental examples are given including trapping in thermal SiO2, in chemically vapor deposited (CVD) SiO2, and on W, less than a monolayer thick, sandwiched between thermal and CVD SiO2. These stepped insulator metal-insulator-silicon (SI-MIS) ramp I-V results for the trapping parameters are shown to be in good agreement with those determined using the conventional photo I-V and avalanche injection with flat-band voltage tracking techniques. A numerical simulation of the ramp I-V measurements, assuming electric field-enhanced Fowler-Nordheim tunneling at the Si-rich-SiO2-SiO2 interface, is described and is shown to give good agreement with the experimental data. These techniques for SI-MIS structures are faster and easier, although less accurate than the conventional techniques.

  15. Ein Vorgehensmodell zur Einführung eines integrativen Umweltcontrollings auf Basis eines ERP-Systems

    OpenAIRE

    Lang-Koetz, Claus

    2006-01-01

    Umweltwirkungen entstehen durch den Verbrauch von Stoffen und Energien sowie durch die Abgabe von Emissionen. Sie können durch die Optimierung der betrieblichen Stoff- und Energieströme im Sinne eines ökoeffizienten Wirtschaftens vermindert werden. Als Grundlage hierfür dient die Erhöhung der Transparenz der betrieblichen Stoffströme. Sie kann mit der Einrichtung eines Umweltcontrollings erreicht werden. Als dessen praktikabelstes Instrument haben sich Umweltkennzahlen erwiesen. Sie dienen...

  16. Phenylcarbazole and phosphine oxide/sulfide hybrids as host materials for blue phosphors: effectively tuning the charge injection property without influencing the triplet energy.

    Science.gov (United States)

    Wu, Jie; Liao, Yi; Wu, Shui-Xing; Li, Hai-Bin; Su, Zhong-Min

    2012-02-01

    Compared with red and green phosphorescent organic light-emitting diodes (PHOLEDs), efficient blue PHOLEDs are still scarce, because it is difficult for the host materials for blue phosphors to achieve a trade-off between a wide triplet energy and good charge injection properties. We theoretically studied a series of hybrid phosphine oxide/sulfide-phenylcarbazole host molecules (PO(S)PhCBZs) for blue phosphors through different linkage modes between phenylcarbazole (PhCBZ) and phosphine oxide/sulfide (PO/PS) moieties. The results indicate that the singlet excitons of all PO(S)-PhCBZs are delocalized over the entire molecule with intramolecular charge transfer (ICT) character and different linkage modes cause various degrees of ICT, which determines the injection abilities of carriers from neighboring layers following the order: PO-Phs (PO linked to the phenyl of PhCBZ) > para-POs (PO linked to the para-positions of PhCBZ) > meta-POs (PO linked to the meta-positions of PhCBZ). By contrast, the triplet excitons are confined to the carbazole unit for all PO(S)-PhCBZs. High triplet energies (E(T)) are therefore kept up for all systems, except for para-POs showing a slight drop in E(T) due to the delocalization of their triplet excitons to the phenyl moiety of PhCBZ. All hybrid PO(S)-PhCBZs, especially PO(s)-Phs, exhibit an enhancement in electron injection and triplet energy compared with the most widely used host material (N,N-dicarbazolyl-3,5-benzene) for blue PHOLEDs, and thereby have great potential for application in highly efficient light emitting diodes. PMID:22193557

  17. Comparison of charged particle identification using pulse shape discrimination and ΔE−E methods between front and rear side injection in silicon detectors

    Energy Technology Data Exchange (ETDEWEB)

    Le Neindre, N., E-mail: leneindre@lpccaen.in2p3.fr [LPC, IN2P3-CNRS, ENSICAEN et Université de Caen, F-14050 Caen Cedex (France); Bougault, R. [LPC, IN2P3-CNRS, ENSICAEN et Université de Caen, F-14050 Caen Cedex (France); Barlini, S. [INFN e Università di Firenze, via G.Sansone 1, 50019 Sesto Fiorentino (Firenze) (Italy); Bonnet, E. [GANIL, CEA/DSM-CNRS/IN2P3, B.P. 5027, F-14076 Caen Cedex (France); Borderie, B. [Institut de Physique Nucléaire, CNRS/IN2P3, Université Paris-Sud 11, F-91406 Orsay Cedex (France); Casini, G. [INFN sezione di Firenze, via G.Sansone 1, 50019 Sesto Fiorentino (Firenze) (Italy); Chbihi, A. [GANIL, CEA/DSM-CNRS/IN2P3, B.P. 5027, F-14076 Caen Cedex (France); Edelbruck, P. [Institut de Physique Nucléaire, CNRS/IN2P3, Université Paris-Sud 11, F-91406 Orsay Cedex (France); Frankland, J.D.; Gruyer, D. [GANIL, CEA/DSM-CNRS/IN2P3, B.P. 5027, F-14076 Caen Cedex (France); Legouée, E.; Lopez, O. [LPC, IN2P3-CNRS, ENSICAEN et Université de Caen, F-14050 Caen Cedex (France); Marini, P. [GANIL, CEA/DSM-CNRS/IN2P3, B.P. 5027, F-14076 Caen Cedex (France); Pârlog, M. [LPC, IN2P3-CNRS, ENSICAEN et Université de Caen, F-14050 Caen Cedex (France); Horia Hulubei, National Institute of Physics and Nuclear Engineering, RO-077125 Bucharest-Măgurele (Romania); Pasquali, G. [INFN e Università di Firenze, via G.Sansone 1, 50019 Sesto Fiorentino (Firenze) (Italy); Petcu, M. [Horia Hulubei, National Institute of Physics and Nuclear Engineering, RO-077125 Bucharest-Măgurele (Romania); and others

    2013-02-11

    The response of silicon–silicon–CsI(Tl) telescopes, developed within the FAZIA collaboration, to fragments produced in nuclear reactions {sup 84}Kr+{sup 120-124}Sn at 35 A MeV, has been used to study ion identification methods. Two techniques are considered for the identification of the nuclear products in the silicon stages. The standard ΔE−E one requires signals induced in two detection layers by ions punching through the first one. Conversely, the digital Pulse Shape Analysis (PSA) allows the identification of ions stopped in the first silicon layer. The capabilities of these two identification methods have been compared for different mountings of the silicons, i.e. rear (particles entering through the low electric field side) or front (particles entering through the high electric field side) side injection. The ΔE−E identification method gives exactly the same results in both configurations. At variance, the pulse shape discrimination is very sensitive to the detector mounting. In case of rear side injection, the identification with the “energy vs. charge rise time” PSA method presents energy thresholds which are significantly lower than in the case of front side injection.

  18. Comparison of charged particle identification using pulse shape discrimination and ΔE-E methods between front and rear side injection in silicon detectors

    Science.gov (United States)

    Le Neindre, N.; Bougault, R.; Barlini, S.; Bonnet, E.; Borderie, B.; Casini, G.; Chbihi, A.; Edelbruck, P.; Frankland, J. D.; Gruyer, D.; Legouée, E.; Lopez, O.; Marini, P.; Pârlog, M.; Pasquali, G.; Petcu, M.; Rivet, M. F.; Salomon, F.; Vient, E.; Alba, R.; Baiocco, G.; Bardelli, L.; Bini, M.; Borcea, R.; Bruno, M.; Carboni, S.; Cinausero, M.; Cruceru, I.; Degerlier, M.; Dueñas, J. A.; GaŞior, K.; Gramegna, F.; Grzeszczuk, A.; Kamuda, M.; Kozik, T.; Kravchuk, V.; Lombardo, I.; Maiolino, C.; Marchi, T.; Morelli, L.; Negoita, F.; Olmi, A.; Petrascu, H.; Piantelli, S.; Poggi, G.; Rosato, E.; Santonocito, D.; Spadaccini, G.; Stefanini, A. A.; Twaróg, T.; Vigilante, M.; Fazia Collaboration

    2013-02-01

    The response of silicon-silicon-CsI(Tl) telescopes, developed within the FAZIA collaboration, to fragments produced in nuclear reactions 84Kr+120-124Sn at 35 A MeV, has been used to study ion identification methods. Two techniques are considered for the identification of the nuclear products in the silicon stages. The standard ΔE-E one requires signals induced in two detection layers by ions punching through the first one. Conversely, the digital Pulse Shape Analysis (PSA) allows the identification of ions stopped in the first silicon layer. The capabilities of these two identification methods have been compared for different mountings of the silicons, i.e. rear (particles entering through the low electric field side) or front (particles entering through the high electric field side) side injection. The ΔE-E identification method gives exactly the same results in both configurations. At variance, the pulse shape discrimination is very sensitive to the detector mounting. In case of rear side injection, the identification with the “energy vs. charge rise time” PSA method presents energy thresholds which are significantly lower than in the case of front side injection.

  19. Main: EIN3ATERF1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available nding site found in the promoter of the Arabidopsis (A.t.) ERF1 (Ethylene-Response-Factor 1); EIN3 recognize...s its target as a homodimer; EIN3 is necessary and sufficient for ERF1 expression; Consititutive expression of ER...EIN3ATERF1 S000332 7-Sep-2000 (last modified) seki EIN3 (Ethylene-insensitive 3) bi...F1 results in the activation of a variety of ethylene response genes and phenotype; ER...F1 is a GCC-box binding site; ERF1 acts downstream of EIN3; EIN3; ERF1; Ethylene; Arabidopsis thaliana GGATTCAAGGGGCATGTATCTTGAATCC ...

  20. Ein robuster Zustandsbeobachter für ein semiaktives Fahrwerkregelsystem

    OpenAIRE

    Fröhlich, Martin

    2008-01-01

    Zur Entschärfung des Zielkonflikts zwischen Fahrsicherheit und Fahrkomfort werden in Fahrzeugen der Ober- und Mittelklasse vermehrt semiaktive Verstelldämpfersysteme eingesetzt. Im Rahmen dieser Arbeit wird ein Sensor- und Beobachterkonzept für ein solches semiaktives Fahrwerkregelsystem entwickelt, mit dem es möglich ist, die für die Regelung benötigten Bewegungsgrößen mit einer hohen Güte zu ermitteln. Die Schätzung der Bewegungsgrößen erfolgt mit dem vorgestellten Konzept robust gegenüber ...

  1. Suppression of the Oscillatory Modes of a Space Charge in the Magnetron Injection Guns of Technological Gyrotrons

    Science.gov (United States)

    Glyavin, M. Yu.; Kuntsevich, A. D.; Manuilov, V. N.

    2015-01-01

    We present the results of based on the PIC method numerical simulation of the dynamic processes of trapping of electrons into the adiabatic trap of a technological gyrotron for different configurations of the electric and magnetic fields in the electron beam formation region. The electrode geometry providing a low reflection coefficient of the magnetic mirror to suppress oscillatory modes in the space-charge cloud and ensure the stability of the electron beam with a high fraction of oscillatory energy in such a system has been found.

  2. Improving charge injection in high-mobility rubrene crystals: From contact-limited to channel-dominated transistors

    Science.gov (United States)

    Zimmerling, Tino; Batlogg, Bertram

    2014-04-01

    With progressively improving charge carrier mobility in organic semiconductors and miniaturization of organic field-effect transistors (OFETs), low contact resistances become ever more important. To study the capabilities of metal electrodes in OFETs and to explore the transition from contact-limited to channel-dominated transistor operation, we used flip-crystal FETs with gold electrodes having different contact resistances Rc to high-quality rubrene crystals. 4-terminal transfer and output measurements reveal that Rc decreases from 105-106 Ω cm for 15 min air exposure to 3 × 103 Ωcm for at least 5 h air exposure of the gold electrodes before the flip-crystal FET is assembled. We conclude the reduction of Rc to be caused by a growing contamination layer on the gold electrodes that weakens the electrostatic coupling between rubrene crystal and gold electrode, and lowers the Schottky contact diode parameter V0. In channel-dominated (low Rc) FETs, the mobility is in the range of 10-17 cm2/(Vs); in contrast, in contact-limited (high Rc) FETs, the apparent mobility decreases significantly with increasing contact resistance. The apparent μ - Rc dependence is not intrinsic, but rather the result of incorrect assumptions of the potential and the charge carrier density in the channel region. Thus, the development of high-mobility organic semiconductors requires further efforts to improve contacts beyond traditional metal electrodes.

  3. Eine systemtheoretische Betrachtung der Produktentwicklung

    OpenAIRE

    Pulm, Udo

    2007-01-01

    Produktentwicklung findet vielfach in einem komplexen sozialen System statt, in dem vollständige Transparenz und Kontrolle nicht möglich sind. Dieses Paradigma stellt eine qualitativ neue Ebene dar, die über ein gemeinsames Verständnis im Team und individuelle Denk- und Problemlöseprozesse hinausgeht. Mit Hilfe der Systemtheorie werden Ansätze entwickelt, die die Komplexität der Produktentwicklung verarbeiten helfen. Zu diesen zählen z. B. evolutionäre Entwicklungsstrategien, eindeutige Diffe...

  4. Electro-optical and charge injection investigations of the donor-π-acceptor triphenylamine, oligocene–thiophene–pyrimidine and cyanoacetic acid based multifunctional dyes

    Directory of Open Access Journals (Sweden)

    Ahmad Irfan

    2015-10-01

    Full Text Available The corner stone of present study is to tune the electro-optical and charge transport properties of donor-bridge-acceptor (D-π-A triphenylamine (TPA derivatives. In the present investigation, an electron deficient moiety (pyrimidine, electron-rich moiety (thiophene and oligocene (benzene, naphthalene, anthracene, tetracene and pentacene have been incorporated as π-spacer between the donor TPA unit and cyanoacetic acid acceptor and anchoring group. The elongation of bridge usually affects the energy levels, i.e., higher the highest occupied molecular orbital (HOMO while lower the lowest unoccupied molecular orbital (LUMO thus reduces the HOMO–LUMO energy gap. The lowered LUMO energy levels of cyano-{2-[6-(4-diphenylamino-phenyl-pyrimidin-4-yl]-tetraceno[2,3-b]thiophen-8-yl}-acetic acid (TPA-PTT4 and cyano-{2-[6-(4-diphenylamino-phenyl-pyrimidin-4-yl]-pentaceno[2,3-b]thiophen-9-yl}-acetic acid (TPA-PPT5 dyes revealed that electron injected from dye to semiconductor surface might be auxiliary stable resulting in impediment of quenching. The broken co-planarity between the π-spacer conceiving LUMO and the TPA moiety would help to impede the recombination process. Moreover, it is expected that TPA derivatives with the tetracenothiophene and pentacenothiophene moieties as π-bridge would show better photovoltaic performance due to lowered LUMO energy level, higher electronic coupling constant, light harvesting efficiency and electron injection values.

  5. Ein graphbasierter Formalismus zur Programmmanipulation

    OpenAIRE

    Stadler, Bernhard

    2013-01-01

    In dieser Arbeit wird ein Formalismus zur implementierungs-, sprach- und repräsentationsunabhängigen Beschreibung von Programmmanipulationen wie beispielsweise Merge, Featurekomposition und Interaktionsanalyse entwickelt. Dieser soll insbesondere der anwendungsnahen und wiederverwendbaren Definition von Programmanipulationen dienen. Programmmanipulationen werden auf repräsentationsunabhängige, deklarative Art mit Mitteln der Kategorientheorie beschrieben. Auf Grundlage einer Analyse des Text-...

  6. Substituent-Controlled Reversible Switching of Charge Injection Barrier Heights at Metal/Organic Semiconductor Contacts Modified with Disordered Molecular Monolayers.

    Science.gov (United States)

    Nouchi, Ryo; Tanimoto, Takaaki

    2015-07-28

    Electrically stimulated switching of a charge injection barrier at the interface between an organic semiconductor and an electrode modified with a disordered monolayer (DM) is studied by using various benzenethiol derivatives as DM molecules. The switching behavior is induced by a structural change in the DM molecules and is manifested as a reversible inversion of the polarity of DM-modified Au electrode/rubrene/DM-modified Au electrode diodes. The switching direction is found to be dominantly determined by the push-back effect of the thiol bonding group, while the terminal group modulates the switching strength. A device with 1,2-benzenedithiol DMs exhibited the highest switching ratios of 20, 10(2), and 10(3) for the switching voltages of 3, 5, and 7 V, respectively. A variation in the tilt angle of benzenethiol DMs due to the application of 7 V is estimated to be smaller than 23.6° by model calculations. This study offers an understanding for obtaining highly stable operations of organic electronic devices, especially with molecular modification layers. PMID:26161447

  7. Entwicklung eines Gasmoderators f\\"ur Positronen

    CERN Document Server

    Löwe, Benjamin

    2016-01-01

    (Translated Title: Development of a positron gas moderator) In this work a positron moderator that is based on inelastic positron scattering in nitrogen gas has been developed and set-up. A positron beam enters a gas cell through a small aperture. In the cell the positrons lose kinetic energy through collisions with the nitrogen molecules. By means of an electric field the positrons are then focused towards an exit where their kinetic energy is analysed. During measurements at the NEPOMUC beam moderated positrons could be observed. ----- Im Rahmen dieser Diplomarbeit wurde das Konzept eines Moderators f\\"ur Positronen untersucht, welches auf der Abbremsung und dem Drift von Positronen in gasf\\"ormigem Stickstoff beruht. Dazu wurde ein Versuchsaufbau konstruiert, aufgebaut und in Betrieb genommen. Ein Positronenstrahl wird durch eine kleine Blende in eine Gaszelle eingekoppelt, dort durch St\\"o{\\ss}e mit den Gasmolek\\"ulen abgebremst, durch ein elektrisches Feld auf den Ausgang fokussiert und dahinter analysie...

  8. Zivilreligion: eine, mehrere oder keine mehr?

    OpenAIRE

    Saurma, Adalbert

    1988-01-01

    Gefragt wird, was Zivilreligion ist und welche Funktion sie in der modernen Gesellschaft hat. Zwei Typen von Zivilreligion werden unterschieden: eine generelle, aber gleichwohl nicht alle Staatsbürger erfassende Form und eine spezielle, sozusagen von den besonders Motivierten geteilte Form. Die erste Form ist eine gelebte Religion der Mehrheit, die auch politische oder ökonomische Machtverhältnisse einbezieht. Die zweite, in der Diskussion im Vordergrund stehende Form, ist die eigentlich zivi...

  9. Ist die Bank der Zukunft eine Bank?

    OpenAIRE

    Spremann, Klaus

    1997-01-01

    Ist die Bank der Zukunft noch eine Bank? Ist sie noch eine Bank mit Menschen, oder wird die virtuelle Bank das Modell der Zukunft sein? Haben die Filialen noch eine Chance, oder werden künftig alle Bankgeschäfte über Computer abgewickelt? Umfragen unter Kreditinstituten bestätigen, dass die gegenwärtig drängendste Frage ist, auf welchem Weg die Bank und der Mensch zusammenkommen.

  10. Operation of photovoltaic plants on governmentally operated properties with electricity self-supply - considerations on tax and charges regulations; Der Betrieb von Photovoltaik-Anlagen mit Strom-Eigenverbrauch in hoheitlichen Einrichtungen. Eine steuerrechtliche und gebuehrenrechtliche Betrachtung

    Energy Technology Data Exchange (ETDEWEB)

    Kronawitter, Martin

    2013-11-01

    The practice of levying taxes on the operation of photovoltaic plants by private persons or legal entities governed by private law seems reasonable enough. By contrast, when photovoltaic plants are installed on the roof or land of a governmental institution (such as wastewater treatment or waste disposal facilities) and operated by a legal entity governed by public law, in particular a municipality or special-purpose association, the issue of taxation raises many questions. The present article considers various conceivable possibilities along with their implications for profit and sales tax. In regard to input tax deduction it takes account of the strict separation between the different areas of activity of the legal entity in question as prescribed by the German Federal Ministry of Finance in its letter dated 2 January 2012. The article also discusses whether and, if so, to what extent expenditures and income from photovoltaic electricity production should be considered in the calculation of fees charged by the governmental institution in question.

  11. Ueber eine Anomalie von Acromitus flagellatus (Stiasny)

    NARCIS (Netherlands)

    Stiasny, G.

    1934-01-01

    Bei erneuter Durchsicht des reichhaltigen Materiales von Acromitus flagellatus (Stiasny) in der Scyphomedusen-Sammlung des Rijksmuseum van Natuurlijke Historie in Leiden (vergl. meine Mitteilungen daruber, 1920, Uebersichtstabelle III und 1921, p. 131/136) fand ich ein Exemplar, das eine bemerkenswe

  12. Das Haarkleid eines Fetus von Schimpanse

    NARCIS (Netherlands)

    Bolk, L.

    1919-01-01

    In seiner ausführlichen Arbeit über die Richtung der Haare bei den Affenembryonen nebst allgemeinen Erörterungen über die Ursachen der Haarrichtungen, hat Schwalbe eine Fülle von Tatsachen und eine wertvolle kritische Betrachtung über das Problem der Haarrichtungen geliefert. Leider war der Autor ni

  13. Auch eine Theorie der Moderne

    Directory of Open Access Journals (Sweden)

    Sabine Rohlf

    2002-11-01

    Full Text Available Barbara Hahn zeichnet die Wege schreibender Frauen durch 200 Jahre deutsch-jüdische Kulturgeschichte nach. Ausgehend von Paul Celans vieldeutiger Jüdin Pallas Athene, werden dabei stereotype Bilder der „Jüdin“, der „Intellektuellen“ und die scharfe Trennlinie zwischen humanistisch christlicher und jüdischer Tradition zur Diskussion gestellt. Mit Celans Figur schreibt sich gleichzeitig die theoretische Herausforderung in diese Studie ein, nach Ambivalenzen und Dialogen zu fragen, deren Voraussetzungen mit beispielloser Gewalt zerstört wurden. Gestützt auf Archivmaterial und veröffentlichte Texte der von ihr vorgestellten Frauen, spannt Hahn den Bogen von frühen Strategien der Assimilierung bis in die Jahre nach 1945. Das Buch ist keine Überblicksdarstellung, sondern präsentiert einzelne, einander auch überschneidende Konstellationen – intellektuelle Netzwerke, Briefwechsel, intertextuellen Transfer.

  14. Online Marketing: Aufbau eines Virtual‐Campus

    OpenAIRE

    Cina, Christian; Blatter, Martin; Glenz‐Mounir, Chantal

    2008-01-01

    Das Internet bietet für viele Klein‐ und mittlere Unternehmen (KMU) eine Riesenchance im Marketing. Jedoch zeigt uns das Internet ein anderes Bild. KMU nutzen das Potenzial des Online Marketings zu wenig. Oft aus Zeitgründen, aber viel mehr aus Desinteresse und Geldmangel. Dabei muss Online Marketing nicht teuer sein. Aus diesem Grund wurde ein Kurs auf dem LHR‐ und GBBcampus8 eingerichtet, der kostenlos zur Verfügung steht. Im Selbststudium und mit dem dazugehörigen Buch Marketing – Erfolg i...

  15. Das Gamma Knife - eine Übersicht

    Directory of Open Access Journals (Sweden)

    Kitz K

    2002-01-01

    Full Text Available Die Radiochirurgie ist eine moderne Behandlungsform, bei der eine stereotaktisch-lokalisierte und scharf gebündelte Hochdosisbestrahlung eingesetzt wird, um kleine intrakranielle Prozesse schonend auszuschalten. Besonders in der Therapie benigner und maligner Hirntumoren hat sich die Radiochirurgie als wertvoll erwiesen und wird zunehmend als wirksame Alternative zur offenen Operation eingesetzt. Die Gamma Knife-Radiochirurgie ist eine sichere, effektive und kostensparende Alternative zur herkömmlichen Chirurgie und gilt weltweit als "goldener Standard" in der radiochirurgischen Behandlung von Hirntumoren, Gefäßmalformationen und funktionellen Erkrankungen.

  16. Ein modulares Navigationssystem für die dentale Implantologie

    OpenAIRE

    Krüger, Timo

    2006-01-01

    Die vorliegende Arbeit stellt ein modulares Navigationssystem für die dentale Implantologie vor. Dentale Implantate sind Verankerungen im Knochen eines Patienten für Zahnprothesen. Die wichtigsten Anforderungen beim Setzen von Implantaten sind ein möglichst fester Sitz der Implantate im Knochen, die Schonung sensibler Strukturen, z.B. Nerven und Kieferhöhle, eine möglichst ästhetische Prothetik, eine hohe Langzeithaltbarkeit der Implantate im Knochen, die Möglichkeit der Sofortversorgung, sch...

  17. Kriterien für eine Staatsinsolvenz

    OpenAIRE

    Martin Schütte

    2010-01-01

    Martin Schütte, Ludwig-Maximilians-Universität München, betont in seinem Kommentar die Unverzichtbarkeit eines Insolvenzverfahrens für EU-Mitgliedstaaten und entwickelt dafür einen Kriterienkatalog.

  18. Vorstellung eines Studienbesuchs in Nordrhein-Westfalen

    OpenAIRE

    Maden , Sevinç Sakarya

    2013-01-01

    Das CEDEFOP koordiniert ab dem 1. Januar 2008 bis 2013 im Auftrag der Kommission die Studienbesuche für Bildungs- und Berufsbildungsfachleute und Entscheidungsträger. Ein Studienbesuch verläuft folgendermaßen: eine kleine Gruppe von Experten und Entscheidungsträgern, die verschiedene Bildungs- und Berufsbildungsgruppen vertreten, besuchen drei bis fünf Tage einen Mitgliedstaat der EU, um dort einen bestimmten Aspekt des lebenslangen Lernens zu untersuchen.

  19. Entwurf und Implementierung eines psychoakustischen Testsystems

    OpenAIRE

    Beckmann, Thomas

    2008-01-01

    Inhalt dieser Arbeit sind Entwurf und Umsetzung eines Testsystems, das der Befragung menschlicher Probanden zu psychoakustischen Fragestellungen dienen soll. Zu diesem Zweck soll es sowohl das Erstellen und Verwalten von Testszenarien als auch die Befragung registrierter Probanden selbst realisieren. Einzelnen Testfragen können dabei variabel lange Sounddateien zugewiesen werden. Die Speicherung der Fragebögen sowie der erhobenen Daten erfolgt mit Hilfe eines Datenbanksystems. Dabei liegt das...

  20. Validierung eines hybriden Sensornetzwerks im Hubschrauberrotorblatt

    OpenAIRE

    Manner, Stephanie

    2016-01-01

    Systeme zur Zustandsüberwachung (Health and Usage Monitoring Systems, HUMS) sind von zunehmender Bedeutung für die Sicherheit von Luftfahrzeugen. Diese Arbeit untersucht die Eignung von FBG-Sensoren als redundante Datenquelle für HUMS-Systeme in Hubschraubern. Ein FBG-Sensornetzwerk wird dazu in den Faserverbund eines Hubschrauberrotorblatts integriert und experimentell untersucht. Insbesondere werden die Signaleigenschaften wie das Driftverhalten, der Temperatureinfluss und die Kalibrierbark...

  1. Das Christentum, eine Religion der Gewalt?

    OpenAIRE

    Vinnai, Gerhard

    2009-01-01

    "Das Christentum ist seinem Selbstverständnis nach eine Liebesreligion, aber seine Geschichte ist nicht zuletzt auch eine Geschichte der Gewalt. Der Text versucht diesen Widerspruch zu erklären. Er untersucht mit den Mitteln der Analytischen Sozialpsychologie, ausgehend vom Text der Bibel, was in dieser Religion der Ausübung von Gewalt entgegenkommen kann." (Autorenreferat) "in its self-image the Christianity is a religion of love, but its history itself is a history of violence too....

  2. Einfluss eines schweren Traumas auf die Frakturheilung

    OpenAIRE

    Recknagel, Stefan

    2012-01-01

    Es gibt klinische Hinweise, dass die Frakturheilung bei polytraumatisierten Patienten gestört ist. Eine der Ursachen könnte die posttraumatische systemische Inflammation darstellen. Das Thoraxtrauma ist eines der häufigsten und zugleich kritischsten Begleitverletzungen, da es verglichen mit anderen Verletzungen zu einer stärkeren systemischen Inflammation führt. Diese systemische Inflammation ist gekennzeichnet durch die Freisetzung von pro inflammatorischen Zytokinen, einer starken Aktivieru...

  3. Dopant deactivation and annealing characteristics of metal-oxide-semiconductor structures on germanium/boron-doped silicon after gamma irradiation or Fowler--Nordheim charge injection

    Energy Technology Data Exchange (ETDEWEB)

    Hashemipour, O.; Ang, S.S.; Brown, W.D.; Yeargan, J.R. (Department of Electrical Engineering, 3217 Bell Engineering Center, University of Arkansas, Fayetteville, Arkansas 72701 (USA)); West, L. (Department of Mechanical Engineering, University of Arkansas, Fayetteville, Arkansas 72701 (USA))

    1991-08-01

    Dopant deactivation and thermal annealing characteristics of metal-oxide-semiconductor capacitors fabricated on Ge/B-doped silicon after gamma irradiation or Fowler--Nordheim injection were investigated for the first time. A decrease of about 30% in active acceptor concentration was observed immediately after gamma irradiation or Fowler--Nordheim injection. Further deactivation of boron ({similar to}20%) occurred with annealing for temperatures of 80 {degree}C and higher. Hydrogen for the deactivation, which occurred during annealing, is thought to come from dissociation of weakly bonded Ge---H formed during the gamma irradiation or Fowler--Nordheim injection. Capacitors fabricated on conventional boron-doped substrates do not exhibit acceptor deactivation as a result of annealing following irradiation or injection. For annealing temperatures of 110 {degree}C and higher, the boron is first deactivated by the process noted above, and then is apparently reactivated by the dissociation of B---H bonds with hydrogen evolution from the structure.

  4. Charge exchange produced K-shell x-ray emission from Ar16+ in a tokamak plasma with neutral beam injection

    Energy Technology Data Exchange (ETDEWEB)

    Beiersdorfer, P; Bitter, M; Marion, M; Olson, R E

    2004-12-27

    High-resolution spectroscopy of hot tokamak plasma seeded with argon ions and interacting with an energetic, short-pulse neutral hydrogen beam was used to obtain the first high-resolution K-shell x-ray spectrum formed solely by charge exchange. The observed K-shell emission of Ar{sup 16+} is dominated by the intercombination and forbidden lines, providing clear signatures of charge exchange. Results from an ab initio atomic cascade model provide excellent agreement, validating a semiclassical approach for calculating charge exchange cross sections.

  5. Method of the ion beam emittance measurement in the injection beam line of DC-72 cyclotron in the presence of its space charge using the scanner to determine beam dimensions

    CERN Document Server

    Kasarinov, N Y; Kalagin, I V; Kazacha, V I

    2002-01-01

    The gradient method for measuring the transversal emittance of a high current ion beam in the injection channel of the cyclotron DC-72 is considered. The standard scanner is proposed for measuring the transversal dimensions of the beam. The formulae for determination of the mean square beam dimensions by current signals from the scanner needle are adduced. The method of the emittance recovery for axial-symmetric ion beam is set for the case when the space charge effect is essential. The algorithm for tuning of the quadrupole lenses in the injection channel of the cyclotron DC-72 for obtaining the axial-symmetric ion beam is proposed. The evaluations of the expected accuracy of the proposed method for the emittance recovery have been carried out.

  6. Compact Modeling of Floating-Base Effect in Injection-Enhanced Insulated-Gate Bipolar Transistor Based on Potential Modification by Accumulated Charge

    Science.gov (United States)

    Yamamoto, Takao; Miyake, Masataka; Miura-Mattausch, Mitiko

    2013-04-01

    We have developed a compact model of the injection-enhanced insulated-gate bipolar transistor (IGBT) applicable for circuit optimization. The main development is modeling the hole accumulation in the floating-base region. It is demonstrated that the observed negative gate capacitance is well reproduced with the developed model.

  7. Kinderwunsch Online Coaching - ein webbasiertes Selbsthilfeprogramm

    Directory of Open Access Journals (Sweden)

    Hämmerli K

    2009-01-01

    Full Text Available Immer mehr Paare bleiben ungewollt kinderlos. Obschon sich infertile Patienten generell bezüglich psychopathologischer Auffälligkeiten nicht von der Allgemeinbevölkerung unterscheiden, stellt die Zeit des Bangens und Hoffens auf ein Kind, die Behandlung und die Verarbeitung der Kinderlosigkeit eines der stressreichsten Lebensereignisse dar. Insbesondere während der reproduktionsmedizinischen Behandlung wurden kurzfristig erhöhte Werte in Depressivität und Ängstlichkeit bei infertilen Frauen bestätigt. Da oftmals psychologische Unterstützung fehlt und ein offener Umgang mit Infertilität für die Paare häufig schwierig ist, sucht eine Vielzahl infertiler Patienten aus dem Internet Informationen und Austausch – heute existieren unzählige Informationsseiten und Selbsthilfeforen zu Infertilität. Gleichzeitig besteht ein Mangel an empirisch und theoretisch fundierten psychologischen Unterstützungsansätzen. In diesem Beitrag wird das erste deutschsprachige webbasierte Selbsthilfebehandlungsprogramm für infertile Patienten vorgestellt. Erfahrungen einer ersten Evaluation des Programms werden diskutiert.

  8. Rapid Manufacturing - eine interdisziplinäre Strategie

    OpenAIRE

    Gebhardt, Andreas

    2006-01-01

    Als um 1987 ein Verfahren namens Stereolithographie und ein Stereolithography Apparatus (SLA) vorgestellt wurden, war der Traum von der Herstellung beliebiger dreidimensionaler Bauteile direkt aus Computerdaten und ohne bauteilspezifische Werkzeuge Realität geworden.

  9. Was macht erfolgreiche Bibliothekspolitik aus? Ein Seminarbericht

    Directory of Open Access Journals (Sweden)

    Rudolf Mumenthaler

    2015-04-01

    Full Text Available Im Rahmen eines Seminars an der HTW Chur wurden Möglichkeiten und Grenzen von Bibliothekspolitik in der Schweiz erläutert. Ausgehend von wenigen Fällen, bei denen es zu Protesten oder anderen Aktivitäten gekommen ist, wurden Akteurinnen und Akteure und ihr Einfluss untersucht, mögliche politische Instrumente analysiert und diskutiert, wie sich Bibliotheken aktiv beteiligen können. Im Ergebnis stellte sich heraus, dass Netzwerke in die Gesellschaft und die Politik von grosser Bedeutung sind. Im Falle eines Konflikts (Budgetkürzung, geplante Schliessung etc. kann sich dieses Netzwerk mit Hilfe der geeigneten politischen Instrumente für die Bibliothek einsetzen. Die Mobilisierung der Bevölkerung, die in den untersuchten Fällen klar auf der Seite der Bibliotheksanliegen war, ist dabei ein entscheidender Erfolgsfaktor.

  10. Numerische Simulation eines berührungsfrei gelagerten Rotors für eine Blutpumpe

    OpenAIRE

    Steinbrecher, Christian

    2007-01-01

    Im Rahmen dieser Arbeit wird eine neuartige Blutpumpe für ein Herzunterstützungssystem entwickelt, die ohne Lager betrieben werden kann. Dabei schwebt der Rotor frei in einem Gehäuse und wird nur durch hydrodynamische und magnetische Kräfte stabilisiert. Mittels stationärer Strömungssimulationen wird ein erster Prototyp der Blutpumpe entworfen und im Hinblick auf hydraulische Effizienz und hohe hydrodynamische Kräfte zur Rotorstabilisierung optimiert. Außerdem werden die Fluid-Struktur Wechse...

  11. Ende eines Dornröschenschlafs

    Directory of Open Access Journals (Sweden)

    Beate Kennedy

    2005-11-01

    Full Text Available Der gut recherchierte, zum Teil mit Abbildungen versehene Jubiläums-Band Irmgard Keun 1905/2005 bietet u. a. mit den Dokumentationen der Erstrezeption der frühen Romane Gilgi, eine von uns und Das kunstseidene Mädchen in der Weimarer Republik und der Rezeption der Exilromane in den Zeitschriften Das Wort und Internationale Literatur reichlich bisher schwer zugängliches Material. Die neuen Deutungen weisen zudem bei aller Verschiedenheit auf eine Verschiebung der Parameter in der Keun-Forschung hin: weg vom biographischen Zugriff, hin zu einer stärker erzähltheoretischen Orientierung.

  12. Managing Diversity und Gender Mainstreaming: ein Konzeptvergleich

    OpenAIRE

    Krell, Gertraude

    2004-01-01

    Seit einiger Zeit wird - vor allem von engagierten Praktikerinnen - beim Thema Chancengleichheit die Frage aufgeworfen, ob ein Fokus auf 'Gender' überhaupt noch zeitgemäß ist, und es wird gefordert, 'Gender' durch 'Diversity' bzw. Gender Mainstreaming (GM) durch Managing Diversity (MD) zu ersetzen. Die Autorin stellt vor diesem Hintergrund beide Ansätze zunächst kurz vor, um anschließend einen Konzeptvergleich vorzunehmen. Ob in einer Organisation GM oder MD umgesetzt wird, ist nach ihrer Ein...

  13. Die Teilhabegesellschaft Modell eines neuen Wohlfahrtsstaates

    OpenAIRE

    Offe, Claus; Grözinger, Gerd; Maschke, Michael

    2006-01-01

    Dass der Sozialstaat in seiner gegenwärtigen Form ein Auslaufmodell ist, darüber besteht mittlerweile weitgehend Konsens. Über die Alternativen wird noch gestritten. Zu den wohl provokantesten Alternativen gehört das Modell der Teilhabegesellschaft: Jeder junge Bürger soll mit 18 Jahren als Startkapital eine steuerfinanzierte Sozialerbschaft von 60 000 Euro erhalten. So soll ihr oder ihm die Chance eröffnet werden, seines eigenen Glückes Schmied zu sein. Die Finanzierung erfolgt aus der Beste...

  14. Talcott Parsons - Zur Zukunft eines Theorieprogramms

    OpenAIRE

    Luhmann, Niklas

    1980-01-01

    Die Form, in der Talcott Parsons die Theorie des allgemeinen Handlungssystems hinterlassen hat, ist bestimmt durch die Geschichte ihrer eigenen Entwicklung. Dennoch lassen sich die Grundentscheidungen, an die die weitere Forschung anknüpfen könnte, deutlich erkennen: Die Anhaltspunkte für eine Theorie des Systems werden aus einer Analyse des Begriffs des Handelns gewonnen. Probleme für die Weiterführung der Theorie könnten sich vor allem in zwei Hinsichten ergeben. Der eine Punkt betri...

  15. Self-modulation of a long externally injected relativistic charged-particle beam in a laser wake field acceleration scheme. A preliminary quantum-like investigation

    International Nuclear Information System (INIS)

    Recent investigations indicate that sufficiently long beams of charged particles, travelling in a plasma, experience the phenomenon of self-modulation. The self-modulation is driven by the plasma wake field excitation due to the beam itself, and it may become unstable under certain conditions. A preliminary theoretical investigation of the self-modulation of a relativistic charged-particle beam in overdense plasma in the presence of a preformed plasma wave is carried out, within the quantum-like description of charged particle beams provided by the Thermal Wave Model. A simple physical model for the self-modulation is put forward, described by a nonlinear Schrödinger equation coupled with the Poisson-like equation for the plasma wake potential (so-called Fedele–Shukla equations). The physical mechanism is based on the interplay of three concomitant effects, the radial thermal dispersion (associated with the emittance ε), the radial ponderomotive effects of a preexisting plasma wave (which provides the guidance for the beam), and the self-interaction of the plasma wake field generated by the beam itself

  16. Beitrag zur Entwicklung eines Einspritzsystems für ein teilhomogenes Brennverfahren in Pkw-Dieselmotoren

    OpenAIRE

    Espig, Stefan

    2013-01-01

    Die Absenkung der Schadstoffemissionen bei der motorischen Verbrennung ist für Fahrzeughersteller und Umwelt von großer Bedeutung. Dieses Ziel kann erreicht werden, indem bei der Verbrennung weniger Schadstoffe entstehen oder indem eine verbesserte Abgasnachbehandlung die Schadstoffe umwandelt oder herausfiltert. Im Rahmen dieser Arbeit werden innermotorische Maßnahmen zur Senkung der Schadstoffemissionen beim Dieselmotor betrachtet. Im Fokus steht die Anpassung des Einspritzsystems an ein al...

  17. Kabelfernsehen : eine Einführung

    OpenAIRE

    Zimmermann, Harald H.

    1984-01-01

    Es werden die wesentlichen Komponenten des Kabelfernsehens erklärt, mit dem Ziel, dem Bürger eine Entscheidung dafür oder dagegen zu ermöglichen. Es wird eingegangen auf technische Fragen, Kosten, fremdsprachige Programme, soziale Fragen u.a.

  18. Heinrich Bebel (1472 - 1518) : wider ein barbarisches Latein

    OpenAIRE

    Graf, Klaus

    2009-01-01

    Kann gutes Latein in einem Bewerbungsgespräch von Vorteil sein? Folgt man der Argumentation eines im Herbst 1501 vor der Tübinger Universitätsöffentlichkeit aufgeführten Dialogs, so wird man diese Frage ohne weiteres bejahen müssen. Im vierten Akt tritt ein Hofbeamter des Königs - gemeint ist Maximilian I. - auf, der als Antwort eine kleine Geschichte erzählt. In Innsbruck wandte sich ein ansonsten durchaus gebildeter Mann an Kardinal Peraudi, Botschafter des Papstes im Reich, um sich um eine...

  19. Relevanz eines persistierenden Foramen ovale bei pulmonal arterieller Hypertonie

    OpenAIRE

    Mascher, Ingo Frederik

    2015-01-01

    Die pulmonal arterielle Hypertonie (PAH) ist eine chronische Erkrankung der Blutgefäße in den Lungen. Sie kann unbehandelt innerhalb weniger Jahre durch ein Cor pulmonale chronicum mit konsekutivem Rechtsherzversagen zum Tode führen. Ein persistierendes Foramen ovale cordis (PFO) ist ein in den meisten Fällen wenige Millimeter kleines funktionell verschlossenes Loch. Bestimmte Druckverhältnisse, z.B. eine PAH, können das Foramen ovale öffnen und somit einen kardialen Rechts-Links-Shunt in...

  20. Musik – eine internationale Kunst?

    Directory of Open Access Journals (Sweden)

    Anna Langenbruch

    2009-12-01

    Full Text Available La musique est-elle un art international ? Échappant aux limites linguistiques, la musique semble destinée à transgresser le rigide système des frontières nationales. Néanmoins, la vie musicale ne reste pas à l’écart des conflits internationaux dans lesquels la musique est un instrument privilégié de construction et de consolidation de l’identité nationale. C’est de ce paradoxe que traitera cet article en se penchant sur l’image des musiciens germanophones dans le discours musical de la presse française. Les relations musicales entre la France et l’Allemagne, interrompues par la Première Guerre mondiale, sont renouvelées après les accords locarniens de 1925. Dans ce contexte, il est très intéressant de voir comment les concerts de plus en plus fréquents de musiciens allemands ou autrichiens sont accueillis par les critiques musicaux français. Dans quels contextes la nationalité des musiciens ou l’internationalité de la musique sont-elles évoquées ? Par quels concepts ou stéréotypes ? Et quelle était la place de la musique sur le plan complexe des relations franco-allemandes ? Dans cette perspective, la musique s’avère un art non pas sans frontières, mais un prisme oscillant entre le national et l’international.Ist Musik eine internationale Kunst? Tatsächlich scheint sich die Musik als nicht oder nur gering sprachgebundene Kunst einem festgefügten nationalen Grenzraster zu entziehen. Dennoch bleibt das Musikleben von internationalen politischen Konflikten natürlich nicht unberührt, sondern dient in diesem Zusammenhang nur allzu oft der Konstruktion und Konsolidierung nationaler Identität. Dieses Paradox möchte dieser Artikel anhand des Bildes deutschsprachiger Musiker im französischen musikjournalistischen Diskurs untersuchen. Ab etwa 1925 beginnen sich im Zuge des Vertrags von Locarno auch die musikalischen Beziehungen Deutschlands und Frankreichs, die der erste Weltkrieg unterbrochen hatte

  1. Decay of electric charge on corona charged polyethylene

    International Nuclear Information System (INIS)

    This paper describes a study on the surface potential decay of corona charged low density polyethylene (LDPE) films. A conventional corona charging process is used to deposit charge on the surface of film and surface potential is measured by a compact JCI 140 static monitor. The results from corona charged multilayer sample reveal that the bulk process dominates charge decay. In addition, the pulsed-electro-acoustic (PEA) technique has been employed to monitor charge profiles in corona charged LDPE films. By using the PEA technique, we are able to monitor charge migration through the bulk. Charge profiles in corona charged multilayer sample are consistent with surface potential results. Of further significance, the charge profiles clearly demonstrate that double injection has taken place in corona charged LDPE films

  2. The three cylinder Ecotec Compact Engine from Opel with port deactivation - a contribution to reduce the fleet average fuel consumption; Der Dreizylinder Ecotec Compact Motor von Opel mit Kanalabschaltung - ein Beitrag zur Absenkung des Flottenverbrauchs

    Energy Technology Data Exchange (ETDEWEB)

    Grebe, U.D. [Opel (A.) AG, Ruesselsheim (Germany); Kapus, P.E.; Poetscher, P. [AVL List GmbH, Graz (Austria)

    1999-07-01

    The Ecotec Compact Engine, introduced in 1997 by Adam Opel AG, utilizes four valve technology consequently for the reduction of fuel consumption. The introduction of the 1.0 l three cylinder engine in the Opel Corsa resulted in a reduction of fuel consumption of 11% in the European MVEG cycle compared to the 1.2 l two valve engine. This paper describes the application of a port deactivation and a high EGR rate system. Due to the high combustion stability it is possible to apply very high EGR rates of up to 25% in the vehicle. This charge dilution leads to a remarkable dethrottling of the engine at part load. Due to this and additional measures to reduce engine friction fuel consumption in the MVEG cycle could be reduced by additional 10.5% to 5.1 l/100 ml. This engine was also used for the demonstration of a so called '3-liter-car' (90 g CO{sub 2}/km). With the 750 kg concept car 'G90' presented at the 1999 Frankfurt International Motor Show (IAA) it was for the first time possible to approach the 90 g CO{sub 2}/km border with a conventional gasoline engine with port fuel injection. The consequent improvement of the engine while maintaining mixture preparation with port fuel injection leads to a considerable improvement in fuel consumption with acceptable system complexity. In that way an attractive price of the new vehicle for the customer can be realized in combination with very low operating expenses over the lifetime of the vehicle. Only by doing so it is possible to have great influence on the sales-weighted fleet average fuel consumption. (orig.) [German] Der 1997 von der Adam Opel AG vorgestellte Ecotec Compact Motor nutzt die Vierventiltechnik konsequent zur Verbrauchsreduzierung. Der 1,0 l Dreizylindermotor ermoeglichte im Opel Corsa eine Verbrauchsreduzierung im MVEG Testzyklus von annaehernd 11% gegenueber dem Vorgaenger mit 1,2 l Hubraum und Zweiventiltechnik. In diesem Beitrag wird die Anwendung einer Kanalabschaltung und eines Hoch

  3. Theoretische Psychologie – Eine Systematik der Kontroversen

    OpenAIRE

    Fahrenberg, Jochen

    2015-01-01

    Eine Theoretische Psychologie – nach dem Vorbild der Theoretischen Biologie oder Physik – existiert nicht. In der Psychologie ist die Vielfalt der Theorien, auch der Wissenschaftstheorien, unübersehbar. Die Recherchen zu den herausragenden Kontroversen erfolgen auf drei Ebenen: (1) Die hauptsächlichen Strömungen und Richtungen der Psychologie werden hinsichtlich ihrer Postulate und Prinzipien, d.h. den Positionen der Erkenntnis- und Wissenschaftstheorie, untersucht. Nach Kant, Herbart...

  4. Systematische Literatursuche ohne DIMDI. Ein Szenario

    OpenAIRE

    Knüttel, Helge

    2016-01-01

    Im Rahmen der sog. Evidenzbasierten Medizin (EBM) wird versucht, Empfehlungen für medizinisches Handeln zu erstellen. Basis dafür ist, alle Studien der medizinischen Forschung zu einem bestimmten Thema im Rahmen eines transparenten, reproduzierbaren Prozesses zu finden und zu bewerten. Hierfür wurden methodische Standards entwickelt, die sich auch auf die Literatursuche erstrecken und dabei die Einbindung von Informationsspezialisten vorsehen. In diesem Bereich findet die Rolle klassischer In...

  5. Antiinflammatorische Wirkungen und Pharmakokinetik eines standardisierten Kiefernrindenextraktes

    OpenAIRE

    Grimm, Tanja

    2005-01-01

    In der vorliegenden Arbeit wurde erstmalig die Hemmung des induzierten Abbaus von Matrixproteinen sowie von Gelatine durch Matrixmetalloproteinasen mithilfe des Kiefernrindenextraktes Pycnogenol, einer Auswahl seiner Inhaltsstoffe und seiner Metabolite d-(3,4-Dihydroxyphenyl)-g-valerolacton (M1) und d-(3-Methoxy-4-hydroxyphenyl)-g-valerolacton (M2) untersucht. Beide Metabolite zeigten eine signifikante Hemmwirkung und lagen in der Effektivität ihrer Hemmung auf einer µg/ml-Basis immer leicht ...

  6. Information als Gegenstand von Informationskompetenz. Eine Begriffsanalyse

    OpenAIRE

    Ingold, Marianne

    2011-01-01

    Der Informationsbegriff als zentraler Gegenstand von Informationskompetenz wird in der bibliothekarischen Diskussion in der Regel nicht explizit thematisiert, sondern lässt sich aus Fachliteratur und Bibliothekspraxis nur implizit erschließen. Eine theoretische Beschäftigung mit dem Informationsbegriff ist jedoch unabdingbar, soll das Konzept "Informationskompetenz" auch außerhalb des bibliothekarischen Kontextes verständlich und nutzbar gemacht werden. Im vorliegenden Text, der sich als B...

  7. Robustheit – eine Anforderung an intralogistische Systeme

    OpenAIRE

    Wildner, Christian

    2013-01-01

    Zuletzt häuften sich Erwähnungen des Begriffs 'Robustheit' in Veröffentlichungen, die die Intralogistik betreffen. Der vorliegende Beitrag bietet einen Überblick über einige dieser Sichtweisen, beleuchtet ergänzend eine Reihe relevanter Aspekte und begründet den Vorschlag einer Ausrichtung von 'Robustheit' in der Intralogistik auf die Verringerung unternehmerischer Risiken. The term 'robustness' is mentioned with an increasing frequency in the lattest papers referring to in-tralogistics. T...

  8. Accounting for a waste combustion plant; Stoffbuchhaltung fuer eine Muellverbrennungsanlage

    Energy Technology Data Exchange (ETDEWEB)

    Belevi, H.; Langmeier, M.; Moench, H.; Baccini, P. [EAWAG, Duebendorf (Switzerland); Turban, Y.; Mueller, T. [Kehrichtverbrennungsanlage Oftringen (Switzerland)

    1998-02-01

    This article describes in detail a method for goods- and materials flow in a waste combustion plant. Starting with the concept and the systems analysis, the authors are describing in detail the selection of the elements which are analysed as well as the materials which are controlled (for example sewage sludge, slags, waste water). The evaluation of the data is shown. (SR) [Deutsch] Eine Methode fuer die kontinuierliche Erfassung, Visualisierung und Interpretation der Guete- und Stofffluesse in einer Muellverbrennungsanlage wird vorgestellt. Sie dient als Grundlage sowohl fuer ein betriebliches Umweltmanagement als auch fuer ein marktorientiertes Ressourcenmanagement. Sie erlaubt zudem eine permanente Qualitaetskontrolle und Qualitaetssicherung. Die ersten Ergebnisse zeigen, dass die Methode eine Erfassung der Gueterfluesse mit einer zeitlichen Aufloesung von einigen Tagen ermoeglicht. Die Stofffluesse koennen fuer Zeitabschnitte von einigen Wochen bestimmt werden. Eine bessere Aufloesung ist grundsaetzlich moeglich, erfordert jedoch einen hoeheren finanziellen Aufwand. (orig.)

  9. Eine Enzyklopädie – aber was für eine ?

    Directory of Open Access Journals (Sweden)

    Michael Hascher

    2001-11-01

    Full Text Available Die „Enzyklopädie der DDR“ ist, anders als die „Enzyklopädie des Nationalsozialismus“, die 1999 als Band 20 der „Digitalen Bibliothek“ erschienen war, nicht die elektronische Version eines auch in einer Printausgabe erhältlichen Werkes. Vielmehr werden hier drei ältere, gedruckte Nachschlagewerke zu einer elektronischen Ausgabe zusammengeführt. In der folgende Besprechung verweist der Verfasser auf einige Mängel, die gegen diese Form eines Nachschlagewerks sprechen. Andererseits sieht das Urteil über die Brauchbarkeit der Enzyklopädie für Arbeiten in der Frauen- und Geschlechtergeschichte nicht so negativ aus, denn abgesehen von ihren Schwachstellen ist die CD durchaus eine gut zugängliche Datenkompilation.

  10. Entwicklung eines ökologischen Bewertungsmodells zur Beurteilung elektronischer Systeme

    OpenAIRE

    Nissen, Nils Frederik

    2001-01-01

    In dieser Arbeit wird eine Methode für die Umweltbewertung elektronischer Systeme vorgestellt. Dieses System soll bereits etablierte Bewertungssysteme, wie die mittlerweile in der Öffentlichkeit bekannte Ökobilanzierung, nicht ersetzen, sondern durch eine modulare Grundstruktur bisherige Ansätze geeignet ergänzen und die Anwendbarkeit in der Praxis erhöhen. Der Hauptschwachpunkt der Ökobilanz und verwandter Systeme ist der immense Aufwand zur Datenrecherche, um für ein komplexes Elektronikpro...

  11. Antwortverhalten des Luftrettungsdienstes bei zeitsensitiven Einsätzen

    OpenAIRE

    Grashey, Rupert

    2004-01-01

    Ziel der Arbeit war eine Erhebung des Status quo der Notarztversorgung in einer Region in Nordostbayern, wobei die Bedeutung der Luftrettung analysiert und der Bedarf für eine Ausweitung der Einsatzbereitschaft festgestellt wurde. Untersucht wurde eine Region von 257 Gemeinden im Einsatzgebiet des Rettungshubschraubers (RTH) Christoph 20 mit Standort in Bayreuth. Als Datengrundlage dienten die von den beteiligten Rettungsleitstellen erhobenen Einsatzdaten des Jahres 2000. Das Untersuchu...

  12. Eine Zugprüfvorrichtung zur Untersuchung mikrostrukturierter Proben

    OpenAIRE

    Ilzhöfer, A.

    1999-01-01

    Die vorliegende Arbeit befaßt sich mit der Entwicklung einer Prüfvorrichtung zur Untersuchung mikrostrukturierter Proben und Bauteile. In eine konventionelle Zugprüfmaschine wird ein neu entwickelter Lastrahmen eingebaut. In diesen Lastrahmen sind ein Kraft- und mehrere Wegmeßsysteme integriert. Mit diesen Komponenten können Festigkeitsuntersuchungen an mikrostrukturierten Proben durchgeführt werden. Zur Untersuchung des Spannungs-Dehnungs-Verhaltens von unterschiedlichen mikrostrukturierten ...

  13. Ein Beitrag zum Schrägschneiden von Leichtbauprofilen

    OpenAIRE

    Kötter, Hanno

    2010-01-01

    Gegenstand der Dissertationsschrift ist eine Darstellung des gegebenen Wissensstandes zum Scherschneiden anhand der Literatur, mit einer Einordnung des Schrägschneidens. Auf dieser Grundlage erfolgt eine Verfahrens- und Prozeßbeschreibung des Schrägschneidens, als Variante des Scherschneidens, insbesondere eine Untersuchung des auftretenden Verschleisses. Es wird die Anwendung des Laser-Pulver-Auftragschweißen an Schneidwerkzeugen zur Verschleißminimierung erprobt und bewertet.

  14. Silikose mit Autoimmunphänomen eines Achatschleifers

    OpenAIRE

    Karabin-Kehl, Bianca; Mittmann-Frank, Michaela; Wilkens, Heinrike; Wennemuth, Gunther; Buchter, Axel

    2011-01-01

    Die Silikose ist ein seit langem bekanntes Krankheitsbild, das vor allem im Bereich des Kohlebergbaus, in der Steinbruch-, Keramik-, Glas-, Stahl- und Eisenindustrie (Gießereien) sowie im Baugewerbe (Stollenarbeiter und Mineure) vorkommt. Ein mittlerweile selten gewordenes Berufsbild stellt das Edelstein- bzw. Achat-Schleifen dar. Achat gehört zu den kieselsäurehaltigen Gesteinen, durch deren Verarbeitung bei langjähriger inhalativer Exposition eine Silikose entstehen kann.

  15. Temozolomide Injection

    Science.gov (United States)

    Temozolomide is used to treat certain types of brain tumors. Temozolomide is in a class of medications called alkylating ... Temozolomide injection comes as a powder to be added to fluid and injected over 90 minutes intravenously ( ...

  16. Methotrexate Injection

    Science.gov (United States)

    Methotrexate injection is used alone or in combination with other medications to treat gestational trophoblastic tumors (a ... in bones) after surgery to remove the tumor. Methotrexate injection is also used to treat severe psoriasis ( ...

  17. Leucovorin Injection

    Science.gov (United States)

    ... injection is used to prevent harmful effects of methotrexate (Rheumatrex, Trexall; cancer chemotherapy medication) when methotrexate is used to to treat certain types of cancer. Leucovorin injection is used to treat people who ...

  18. Pembrolizumab Injection

    Science.gov (United States)

    Pembrolizumab injection is used to treat melanoma (a type of skin cancer) that cannot be treated with ... who have a specific type of melanoma tumor. Pembrolizumab injection is also used to treat a certain ...

  19. Paclitaxel Injection

    Science.gov (United States)

    ... with other medications. Paclitaxel injection manufactured with polyoxyethylated castor oil is used to treat ovarian cancer (cancer that ... cancer, and lung cancer. Paclitaxel injection with polyoxyethylated castor oil is also used to treat Kaposi's sarcoma (a ...

  20. Evolocumab Injection

    Science.gov (United States)

    Evolocumab injection is used along with diet and certain cholesterol-lowering medications, HMG-CoA reductase inhibitors (statins), ... cholesterol cannot be removed from the body normally). Evolocumab injection is in a class of medications called ...

  1. Octreotide Injection

    Science.gov (United States)

    Octreotide immediate-release injection is used to decrease the amount of growth hormone (a natural substance) produced ... be treated with surgery, radiation, or another medication. Octreotide immediate-release injection is also used to control ...

  2. Naltrexone Injection

    Science.gov (United States)

    Naltrexone injection is used along with counseling and social support to help people who have stopped drinking large amounts of alcohol to avoid drinking again. Naltrexone injection is also used along with counseling and ...

  3. Vancomycin Injection

    Science.gov (United States)

    Vancomycin injection is used alone or in combination with other medications to treat certain serious infections such ... infections of the lungs, skin, blood, and bones. Vancomycin injection is in a class of medications called ...

  4. Entwicklung eines Gumstix-Expansion-Boards für ein UAV-basiertes Rehkitzrettungssystem

    OpenAIRE

    Neugebauer, Philipp

    2011-01-01

    Während der Frühjahrsmahd werden alleine in Deutschland geschätzte 100 000 Rehkitze durch Landmaschinen getötet. Grund dafür ist der fehlende Fluchtinstinkt der im hohen Gras liegenden Tiere. Um diese vor der Mahd aufzufinden, wird ein Lösungsansatz, der auf einem UAV-System (engl. unmanned aerial vehicle - unbemanntes Luftfahrzeug) basiert, verfolgt, mit dem aus der Luft eine Detektion der Rehkitze stattfindet. Die Hauptsensorik, der an Bord mitfliegenden Messhardware, wird au...

  5. Ein Injektorkonzept zur Darstellung eines ottomotorischen Brennverfahrens mit Erdgas-Direkteinblasung

    OpenAIRE

    Bohatsch, Stefan

    2011-01-01

    Mitte der 70er Jahre wurde von Forschern eine steigende Erwärmung der Erdtemperatur seit Beginn des 19. Jahrhunderts festgestellt und die Suche nach den Ursachen begann. Dabei stellte sich heraus, dass im Vergleich zu früheren Wärmeperioden auf der Erde die Geschwindigkeit des aktuellen Temperaturanstiegs deutlich höher ist als in früheren Zeiten. Eine menschliche Einwirkung auf diesen Prozess ist durch den Umstand der zu diesem Zeitpunkt einsetzenden Industrialisierung sehr wahrscheinlich, d...

  6. Alles eine Frage der Zeit. Politische Bildung für eine nachhaltige Entwicklung

    OpenAIRE

    Reheis, Fritz

    2006-01-01

    In diesem Beitrag wird die Ökologie der Zeit als eine integrative Perspektive des Diskurses um Nachhaltige Entwicklung diskutiert. Ausgehend vom bisherigen Umgang mit dem Nachhaltigkeitsthema im Kontext von Bildung wird die Ökologie der Zeit sozial-/politökonomisch, allgemeinpädagogisch und politikdidaktisch fundiert und werden abschließend sieben Thesen präsentiert. Damit wird ein Angebot zur Fundierung der Bildung für Nachhaltige Entwicklung bzw. des Globalen Lernens erhofft. (DIPF/Orig.)...

  7. Chirurgische Behandlung von Melanomen in der Schwangerschaft: eine praktische Anleitung.

    Science.gov (United States)

    Crisan, Diana; Treiber, Nicolai; Kull, Thomas; Widschwendter, Peter; Adolph, Oliver; Schneider, Lars Alexander

    2016-06-01

    Als ein Tumor, der primär eine chirurgische Behandlung erfordert, ist ein neu diagnostiziertes oder vorbestehendes Melanom in der Schwangerschaft eine klinische Rarität. In solchen Fällen steht der Chirurg vor der Herausforderung, ein geeignetes therapeutisches Vorgehen festlegen zu müssen. Auf der Grundlage unserer klinischen Erfahrung und einer Übersicht über die Literatur geben wir in der vorliegenden Arbeit eine Anleitung für das praktische Vorgehen bei dieser seltenen klinischen Konstellation. Unserer Erfahrung nach müssen schwangere Melanom-Patientinnen im Hinblick auf ihre therapeutischen Optionen ausführlich beraten werden. Naturgemäß setzen sie ihr ungeborenes Kind an die erste Stelle und zögern, der erforderlichen Operation zuzustimmen, obwohl bei ihnen eine möglicherweise lebensbedrohliche Erkrankung diagnostiziert worden ist. Daher ist es entscheidend, diese Patientinnen klar darüber zu informieren, dass, wie die vorliegenden medizinischen Erfahrungen zeigen, eine Schwangerschaft per se kein Grund ist, eine notwendige Melanom-Operation aufzuschieben. Jedoch müssen bei einigen Parametern wie den präoperativen Bildgebungsverfahren, der Positionierung auf dem Operationstisch, der Überwachung, Anästhesie und der perioperativen Medikation bestimmte Anpassungen vorgenommen werden, um der speziellen Situation Rechnung zu tragen. PMID:27240063

  8. Naloxone Injection

    Science.gov (United States)

    ... doctor to get a new injection device.The automatic injection device has an electronic voice system that provides step by step directions ... guard has been removed, safely dispose of the automatic injection ... local garbage/recycling department to learn about take-back programs in ...

  9. Subcutaneous Injections

    DEFF Research Database (Denmark)

    Thomsen, Maria

    at the injection site was influenced by the needle length and the injected volume. Several imaging analysis tools were optimized for the characterization, and these tools were implemented also on subcutaneous injections in rats, visualized by low dose μCT, and used for characterization of the morphology in mouse...

  10. Ustekinumab Injection

    Science.gov (United States)

    ... Do not inject into an area where the skin is tender, bruised, red, or hard or where you have scars or stretch marks.Your doctor or pharmacist will ... injection.you should know that ustekinumab injection may decrease your ability ... new or changing skin lesions, minor infections (such as open cuts or ...

  11. Hermeneutische Einzelfallrekonstruktion und funktionalanalytische Theoriebildung : ein Versuch ihrer Verknüpfung, dargestellt am Beispiel der Interpretation eines Interviewprotokolls

    OpenAIRE

    Schneider, Wolfgang Ludwig

    1992-01-01

    Der vorliegende Beitrag versucht nachzuweisen, daß Hermeneutik und funktionale Analyse auf eine gemeinsame Grundfigur zurückgeführt und ihre unterschiedlichen Leistungspotentiale deshalb zu einer übergreifenden Methode objektiven Verstehens verbunden werden können. Der gemeinsame Kern der Ansätze ist das Schema von Problem (Frage) und Problemlösung (Antwort). Anhand der Interpretation eines Interviewauszugs (Verhandlungen von Wissenschaftlern mit Ministerialbeamten über die Durchführung eines...

  12. Around the laboratories: Dubna: Physics results and progress on bubble chamber techniques; Stanford (SLAC): Operation of a very rapid cycling bubble chamber; Daresbury: Photographs of visitors to the Laboratory; Argonne: Charge exchange injection tests into the ZGS in preparation for a proposed Booster

    CERN Multimedia

    1969-01-01

    Around the laboratories: Dubna: Physics results and progress on bubble chamber techniques; Stanford (SLAC): Operation of a very rapid cycling bubble chamber; Daresbury: Photographs of visitors to the Laboratory; Argonne: Charge exchange injection tests into the ZGS in preparation for a proposed Booster

  13. Decay of electric charge on corona charged polyethylene

    International Nuclear Information System (INIS)

    In this paper, the surface potential decay of corona-charged low density polyethylene (LDPE) films has been investigated. It has been found that for the same sample thickness the faster decay occurs in the sample with a higher charging voltage. For the same charging voltage, the surface potential in the thinner sample shows rapid decay. Our new evidence from both the surface potential measurement on multilayer samples and space charge measurement suggests the surface potential decay is a bulk limited process. More importantly, space charge measurement indicates double injection has taken place during corona charging process.

  14. Charge Breeding of Radioactive Ions

    CERN Document Server

    Wenander, F J C

    2013-01-01

    Charge breeding is a technique to increase the charge state of ions, in many cases radioactive ions. The singly charged radioactive ions, produced in an isotope separator on-line facility, and extracted with a low kinetic energy of some tens of keV, are injected into a charge breeder, where the charge state is increased to Q. The transformed ions are either directed towards a dedicated experiment requiring highly charged ions, or post-accelerated to higher beam energies. In this paper the physics processes involved in the production of highly charged ions will be introduced, and the injection and extraction beam parameters of the charge breeder defined. A description of the three main charge-breeding methods is given, namely: electron stripping in gas jet or foil; external ion injection into an electron-beam ion source/trap (EBIS/T); and external ion injection into an electron cyclotron resonance ion source (ECRIS). In addition, some preparatory devices for charge breeding and practical beam delivery aspects ...

  15. Pancreatitis. An update; Pankreatitis. Ein Update

    Energy Technology Data Exchange (ETDEWEB)

    Schreyer, A.G. [Universitaetsklinikum Regensburg, Institut fuer Roentgendiagnostik, Regensburg (Germany); Grenacher, L. [Diagnostik Muenchen, MVZ Radiologie, Muenchen (Germany); Juchems, M. [Klinikum Konstanz, Diagnostische und Interventionelle Radiologie, Konstanz (Germany)

    2016-04-15

    Acute and chronic pancreatitis are becoming increasingly more severe diseases in the western world with far-reaching consequences for the individual patient as well as the socioeconomic situation. This article gives an overview of the contribution of radiological imaging to the diagnostics and therapy of both forms of the disease. Acute pancreatitis can be subdivided into severe (20 %) and mild manifestations. The diagnostics should be performed with computed tomography (CT) or magnetic resonance imaging (MRI) for assessing necrosis or potential infections only in severe forms of pancreatitis. In chronic pancreatitis transabdominal ultrasound should initially be adequate for assessment of the pancreas. For the differential diagnosis between pancreatic carcinoma and chronic pancreatitis, MRI with magnetic resonance cholangiopancreatography (MRCP) followed by an endoscopic ultrasound-guided fine needle aspiration is the method of choice. For the primary diagnosis for acute and chronic pancreatitis ultrasound examination is the modality of first choice followed by radiological CT and MRI with MRCP examinations. (orig.) [German] Akute und chronische Pankreatitis sind in der westlichen Welt zunehmende schwere Krankheitsbilder mit tiefgreifenden Konsequenzen fuer den einzelnen Patienten sowie soziooekonomisch. Der Beitrag radiologischer Bildgebung zur Diagnostik und Therapie beider Erkrankungsformen soll im vorliegenden Uebersichtsbeitrag diskutiert werden. Die akute Pankreatitis kann in eine schwere (20 %) und milde Verlaufsform unterteilt werden. Lediglich bei den schweren Formen sollte eine CT- oder MRT-Diagnostik bzgl. der Beurteilung von Nekrosen und moeglichen Infektionen erfolgen. Bei der chronischen Pankreatitis genuegt zunaechst eine Beurteilung des Pankreas durch transabdominellen Ultraschall. Hier sind die MRT mit der Magnetresonanzcholangiopankreatikographie (MRCP) sowie die endosonographisch gesteuerte Feinnadelpunktion die Methode, um

  16. Entwicklung eines Ultraschallkatheters mit integriertem Mikroantrieb

    OpenAIRE

    Ledworuski, Ralf

    2006-01-01

    In der medizinischen Diagnostik werden Ultraschallkatheter häufig eingesetzt, um Gefäße wie z. B. Arterien oder den Gallengang auf Ablagerungen und krankhafte Veränderungen zu untersuchen und diese in einem sehr frühen Stadium zu erkennen. Voraussetzung dafür ist eine kontrastreiche Gefäßdarstellung mit guter Auflösung. Kathetersysteme aus dem Bereich des intravaskulären Ultraschalls (IVUS) und Minisonden des endoskopischen Ultraschalls (EUS) erzeugen zirkuläre Ultraschallbilder mit dem Ultra...

  17. Eine Schulklasse – zwei Männlichkeitskulturen

    Directory of Open Access Journals (Sweden)

    Jürgen Budde

    2007-07-01

    Full Text Available Ruth Michalek untersucht anhand von Gruppendiskussionen die Männlichkeitsvorstellungen bei Drittklässlern. Mit Hilfe zahlreicher Zitate zeichnet sie ein differenziertes und empathisches Bild der diskutierenden Jungen. Sie weist detailliert nach, dass in einer Schulklasse zwei entgegengesetzte Männlichkeitskulturen nebeneinander existieren können: Während sich die Gruppe „Rock’n’Roll AG“ an tradierten Männlichkeitsbildern orientiert, kann die Gruppe „Tigerkralle“ mit diesen männlichen Orientierungsmustern wenig anfangen. Michaleks Arbeit stellt einen anschaulichen Beitrag zur Ausdifferenzierung von Männlichkeitsvorstellungen dar.

  18. Ein Modell der Open-Source-Entwicklung

    OpenAIRE

    Evers, Steffen

    2009-01-01

    In den letzten zwanzig Jahren hat sich in Bezug auf Software viel verändert: die abgedeckte Funktionalität, wie ihre Umgebung aussieht, wie sie wirtschaftlich verwertet wird und letztendlich auch wie sie entwickelt wird. In Bezug auf die Vorgehensweise stellt die Open-Source-Entwicklung wohl die größte Abweichung von den klassischen Methoden dar. Die altbewährten Modelle für eine deterministische Entwicklung von Softwareprodukten sind dafür unzureichend. Trotzdem haben beide Bereiche viele ge...

  19. Europawahl 2004 : eine Online-Umfrage

    OpenAIRE

    Kellermann, Charlotte; Juhász, Zoltán; Rattinger, Hans

    2004-01-01

    Aus Anlass der Wahlen zum Europäischen Parlament am 13. Juni 2004 führte das Bamberger Centrum für Europäische Studien (BACES) zusammen mit dem Lehrstuhl für Politikwissenschaft II vom 04. bis 13. Juni eine bundesweite Online-Umfrage durch. Die 2.936 Befragten sind im Mittel deutlich jünger, haben höhere Bildungsabschlüsse und sind auch politisch wesentlich stärker interessiert als der Durchschnittsbürger. Somit stellen die nachfolgenden Untersuchungsergebnisse, die sich in drei Themenbereich...

  20. Corporate Venture Capital im Bankensektor: Eine Fallstudie

    OpenAIRE

    Maxin, Hannes

    2015-01-01

    Die Digitalisierung der Gesellschaft beeinflusst zunehmend das klassische Bankgeschäft, was durch die Erfolge vieler junger FinTech-Unternehmen verdeutlicht wird. Der damit verbundene Innovationsdruck führte dazu, dass die Commerzbank AG im Oktober 2013 die Main Incubator GmbH gründete. Mithilfe dieser Corporate Venture Capital-Gesellschaft (CVC-Gesellschaft) versucht die Frankfurter Großbank, eine Kooperation mit den neuen Wettbewerbern einzugehen, um mögliche Synergiepotenziale für das eige...

  1. Kjenneteikn ved yoga som bevegelsessystem. Ein intervjustudie

    OpenAIRE

    2012-01-01

    Bakgrunn: Yoga er opprinneleg eit klassisk indisk filosofisk system med røter fleire tusen år tilbake i tid. I vesten har det ofte vore mest fokus på yoga som fysisk disiplin beståande av stillingar (asanas) og pust (pranayama), også kalla hatha yoga. I dei seinare år har yoga har har hatt ei jamn auke i popularitet, og er også gjenstand for mykje forsking innan medisin og helsefag. Det presenterast ofte som ein kontrast til anna trening. Føremål: Å få auka kunnskap om kjenn...

  2. Transient analysis of charging system with centrifugal charging pumps

    International Nuclear Information System (INIS)

    The CARD (CVCS Analysis for Design) code has been developed for the transient analysis of the letdown and charging system of Korea Standard Nuclear Power Plant. The computer code has been already verified and validated by comparing with actual test results. Analyzed in this paper are the flow and pressure transients in the charging line. The sensitivity studies are performed to select the acceptable control parameters of charging line backpressure controller and seal injection flow controller. In addition, the seal injection system transient is evaluated for the pressurizer auxiliary spray operation. It is shown that the charging line backpressure controller control parameters yield a significant effect on the charging system stability. The results obtained from this study will be used to verify the system design and to select the optimum control parameters for the charging system with centrifugal charging pumps

  3. Solution-processed high-LUMO-level polymers in n-type organic field-effect transistors: a comparative study as a semiconducting layer, dielectric layer, or charge injection layer

    International Nuclear Information System (INIS)

    In solution-processed organic field-effect transistors (OFETs), the polymers with high level of lowest unoccupied molecular orbitals (LUMOs, > −3.5 eV) are especially susceptible to electron-trapping that causes low electron mobility and strong instability in successive operation. However, the role of high-LUMO-level polymers could be different depending on their locations relative to the semiconductor/insulator interface, or could even possibly benefit the device in some cases. We constructed unconventional polymer heterojunction n-type OFETs to control the location of the same polymer with a high LUMO level, to be in, under, or above the accumulation channel. We found that although the devices with the polymer in the channel suffer from dramatic instability, the same polymer causes much less instability when it acts as a dielectric modification layer or charge injection layer. Especially, it may even improve the device performance in the latter case. This result helps to improve our understanding of the electron-trapping and explore the value of these polymers in OFETs. (invited article)

  4. Ein Web-basierter Computergraphik-Kurs im Baukastensystem

    OpenAIRE

    Hönisch, F.; Klein, R.; Straßer, W

    2016-01-01

    Aus der Zusammenfassung: "Dieses Beispiel eines interaktiven Online-Kurses zeigt, wie virtuelle Experimente die traditionellen Lehrmethoden im Bereich der Computergraphik sinnvoll ergänzen. Das Zusammenspiel von Java und dem World-Wide-Web erlaubt die einheitliche Integration von hypertextuellen Vorlesungstexten, interaktiven Visualisierungen, virtuellen Experimenten, Programmierübungen und Programmierschnittstellen in eine unbeschränkt nutzbare virtuelle Lernumgebung."

  5. Ein bunter Hund, die tool-box und lipstick lesbians

    OpenAIRE

    Ruben Marc Hackler

    2007-01-01

    Sara Mills legt eine Einführung in die Diskursanalyse vor, die durch ihre Ausrichtung am Forschungsprozess und ihr Interesse an der Vielzahl von Diskursen überzeugt. Aus dem Wald von Einführungen ragt sie heraus durch ihre Konzentration auf gesellschaftskritische Fragen, wie sie unter anderem vom Feminismus aufgeworfen wurden, und vertritt ein engagiertes Wissenschaftsverständnis.

  6. Integration eines Anwendungssystems für die Tumordokumentation in ein klinisches Informationssystem

    OpenAIRE

    Stolte, Iris

    2001-01-01

    Die Tumordokumentation wurde bisher vor allem in Tumorzentren und klinischen Krebsregistern als retrospektive Erfassung der zu dokumentierenden Daten durchgeführt. Dieser Ansatz schränkt den Umfang der zu erhebenden Daten wegen des nicht unwesentlichen zusätzlichen Aufwands erheblich ein. Insbesondere für Aufgaben des Qualitätsmanagements, die in der Tumordokumentation immer stärker in den Vordergrund treten, ist es notwendig, umfangreiche, an Diagnose und Therapie der Patienten orie...

  7. Entwicklung des Kommunikationsteilsystems für ein objektorientiertes, verteiltes Betriebssystem

    OpenAIRE

    Becher, Mike

    1998-01-01

    Thema dieser Arbeit ist die Entwicklung eines Kommunikationsteilsystems fuer das Experimentiersystem CHEOPS zur Ermoeglichung einer Interobjektkommunika- tion zwischen Objekten auf dem gleichen bzw. verschiedenen Systemen. Ausgangspunkte stellen dabei eine verfuegbare Implementation eines Ethernet- Treibers der Kartenfamilie WD80x3 fuer MS-DOS, eine geforderte Kommunikations- moeglichkeit mit UNIX-Prozessen sowie die dort benutzbaren Protokoll-Familien dar. Die Arbe...

  8. Autoimmune pancreatitis. An update; Autoimmunpankreatitis. Ein Update

    Energy Technology Data Exchange (ETDEWEB)

    Helmberger, T. [Klinikum Bogenhausen, Staedt. Klinikum, Institut fuer Diagnostische und Interventionelle Radiologie, Neuroradiologie und Nuklearmedizin, Muenchen (Germany)

    2016-04-15

    have to be aware of the clinical, serological and histological parameters for AIP in order to guide clinicians towards the correct diagnosis. Only in this way can the highly efficient steroid therapy be initiated and otherwise possibly severe forms of therapy be avoided. (orig.) [German] Die Autoimmunpankreatitis (AIP) ist eine seltene Erkrankung, deren Verstaendnis sich in den letzten Jahren deutlich vertieft hat. Die haeufigste Form, die Typ-1-AIP, gehoert zu den IgG4-assoziierten Erkrankungen, die viel seltenere Typ-2-AIP ist hiervon zu differenzieren und steht mit chronisch entzuendlichen Darmerkrankungen in Verbindung. Bildgebend und klinisch besteht eine Ueberlappung zum Pankreaskarzinom. Aufgabe der Bildgebung und weiterer Parameter wie Serologie und Histologie ist es deshalb, eine Differenzierung zwischen den beiden Erkrankungsentitaeten zu schaffen, um sie jeweils der adaequaten Therapie zuzufuehren und die geringe, aber letztlich unnoetige Anzahl an Pankreatektomien wegen einer AIP zu verhindern. Die Diagnose der AIP ist komplex, wobei sich in den letzten Jahren die Konsensuskriterien der International Association of Pancreatology als Entscheidungsparameter vielfach durchgesetzt haben. Diese umfassen 5 Kardinalkriterien und ein therapeutisches Kriterium. Unter Verwendung dieser Parameter kann die AIP mit einer Sensitivitaet von 84,9 %, Spezifitaet von 100 % und Treffsicherheit von 93,8 % diagnostiziert werden. Die Diagnose einer AIP setzt sich aus verschiedenen Parametern zusammen, von denen 2 die Bildgebung betreffen. Wie bei der sonstigen Diagnostik des Pankreas sind dies Ultraschall, CT und MRT. Wesentlich fuer die Differenzialdiagnose ist der Ausschluss sekundaerer Malignitaetskriterien, wofuer CT und MRT etabliert sind. Das wesentliche diagnostische Kriterium der Histologie erfordert ausreichend Material, was in der Regel durch eine endoskopische Feinnadelpunktion (FNP) nicht gewonnen werden kann. Fuer die Identifikation des optimalen Punktionsorts und

  9. Ansätze für eine Bifurkationsanalyse von RF LC-Tank VCOs unter Berücksichtigung nichtlinearer Bauelementegleichungen

    Directory of Open Access Journals (Sweden)

    C. Zorn

    2008-05-01

    Full Text Available Es wird ein alternativer Ansatz zum Entwurf von vollintegrierten LC Oszillatoren mit Hilfe der Andronov-Hopf Bifurkationsanalyse unter Einbeziehung eines nichtlinearen Overall-Modells für MOS-Transistoren (EKV-Modell vorgestellt. Das in dieser Arbeit vorgestellte Verfahren beschreibt die MOS-Kapazität des VCOs über geometrische Gundgrößen, die damit nur als Längen- und Weitenverhältnisse in die Bifurkationsanalyse eingehen. Zur Beschreibung der MOS-Kapazität wurde ein Basic-Charge-Modell, wie es in den Arbeiten von Enz und Vittoz vorgestellt wurde, in Verbindung einer expliziten analytischen Näherung des Oberflächenpotenzials verwendet. Das Verfahren ermöglicht es, als zusätzlichen Freiheitsgrad für den Designer auch die Amplitude zur Optimierung der Bauteilparameter heranzuziehen und vorab eine genauere Abschätzung der Parameter des Varaktors zu erhalten. Zusammengefasst in einer Toolbox führt die Anwendung des Verfahrens auf einen grafischen Optimierungsprozess, mit dessen Hilfe die Parameter analytisch bestimmt werden können. Die verwendete Methode erweitert den von Hajimiri und Ham vorgestellten Entwurfsprozess von LC-Tank VCOs um eine Stabilitätsanalyse, die Berücksichtigung harmonischer höherer Ordnung und die physikalisch exakte Modellierung der Varaktorkapazitäten.

  10. Certolizumab Injection

    Science.gov (United States)

    ... and swelling and scales on the skin), active ankylosing spondylitis (a condition in which the body attacks the ... continues. When certolizumab injection is used to treat ankylosing spondylitis, it is usually given every 2 weeks for ...

  11. Olanzapine Injection

    Science.gov (United States)

    ... of interest in life, and strong or inappropriate emotions). Olanzapine injection is used to treat episodes of ... this medication affects you.you should know that alcohol can add to the drowsiness caused by this ...

  12. Haloperidol Injection

    Science.gov (United States)

    ... of interest in life, and strong or inappropriate emotions). Haloperidol injection is also used to control motor ... this medication affects you.you should know that alcohol can add to the drowsiness caused by this ...

  13. Tigecycline Injection

    Science.gov (United States)

    ... in a person who was not in the hospital), skin infections, and infections of the abdomen (area between the ... that developed in people who were in a hospital or foot infections in people who have diabetes. Tigecycline injection is ...

  14. Golimumab Injection

    Science.gov (United States)

    Golimumab injection is used alone or with other medications to relieve the symptoms of certain autoimmune disorders ( ... did not help or could not be tolerated. Golimumab is in a class of medications called tumor ...

  15. Ferumoxytol Injection

    Science.gov (United States)

    Ferumoxytol injection is used to treat iron-deficiency anemia (a lower than normal number of red blood ... pharmacist what other prescription and nonprescription medications, vitamins, nutritional supplements, and herbal products you are taking or ...

  16. Aripiprazole Injection

    Science.gov (United States)

    ... mixed with water (Abilify Maintena) and as a suspension (liquid) (Aristada) to be injected into a muscle ... decisions, and react quickly. Do not drive a car or operate machinery until you know how this ...

  17. Ertapenem Injection

    Science.gov (United States)

    Ertapenem injection is used to treat certain serious infections, including pneumonia and urinary tract, skin, diabetic foot, ... for the prevention of infections following colorectal surgery. Ertapenem is in a class of medications called carbapenem ...

  18. Testosterone Injection

    Science.gov (United States)

    Testosterone cypionate (Depo-Testosterone), testosterone enanthate (Delatestryl), testosterone undecanoate (Aveed), and testosterone pellet (Testopel) are forms of testosterone injection used to treat symptoms of low testosterone in men who have hypogonadism (a ...

  19. Fludarabine Injection

    Science.gov (United States)

    ... also sometimes used to treat non-Hodgkin's lymphoma (NHL; cancer that begins in a type of white ... this medication. You should not plan to have children while receiving fludarabine injection or for at least ...

  20. Ramucirumab Injection

    Science.gov (United States)

    ... dose of ramucirumab injection. Tell your doctor or nurse if you experience any of the following while you receive ramucirumab: uncontrollable shaking of a part of the body; back pain or spasms; chest pain and tightness; chills; flushing; ...

  1. Basiliximab Injection

    Science.gov (United States)

    ... prescribed for other uses; ask your doctor or pharmacist for more information. ... Ask your pharmacist any questions you have about basiliximab injection.It is important for you to keep a written list of ...

  2. Nafcillin Injection

    Science.gov (United States)

    ... injection is in a class of medications called penicillins. It works by killing bacteria.Antibiotics such as ... and pharmacist if you are allergic to nafcillin; penicillins; cephalosporin antibiotics such as cefaclor, cefadroxil, cefazolin, cefdinir, ...

  3. Oxacillin Injection

    Science.gov (United States)

    ... injection is in a class of medications called penicillins. It works by killing bacteria.Antibiotics such as ... and pharmacist if you are allergic to oxacillin; penicillins; cephalosporin antibiotics such as cefaclor, cefadroxil, cefazolin, cefdinir, ...

  4. Ampicillin Injection

    Science.gov (United States)

    ... injection is in a class of medications called penicillins. It works by killing bacteria.Antibiotics such as ... and pharmacist if you are allergic to ampicillin; penicillins; cephalosporin antibiotics such as cefaclor, cefadroxil, cefazolin (Ancef, ...

  5. Levofloxacin Injection

    Science.gov (United States)

    ... injection is used to treat infections such as pneumonia; chronic bronchitis; and sinus, urinary tract, kidney, prostate ( ... skin or eyes dark urine decreased urination seizures unusual bruising or bleeding joint or muscle pain Levofloxacin ...

  6. Linezolid Injection

    Science.gov (United States)

    Linezolid injection is used to treat infections, including pneumonia, and infections of the skin and blood. Linezolid ... to 2 months or more after your treatment) unusual bleeding or bruising cough, chills, sore throat, and ...

  7. Cefazolin Injection

    Science.gov (United States)

    ... joint, genital, blood, heart valve, respiratory tract (including pneumonia), biliary tract, and urinary tract infections. Cefazolin injection ... effects. Call your doctor if you have any unusual problems while using this medication.If you experience ...

  8. Moxifloxacin Injection

    Science.gov (United States)

    ... appropriate for them to remain available as a therapeutic option.FDA is continuing to assess safety issues ... review has shown that fluoroquinolones when used systemically (i.e. tablets, capsules, and injectable) are associated with disabling ...

  9. Gemcitabine Injection

    Science.gov (United States)

    ... with surgery. Gemcitabine is also used to treat cancer of the pancreas that has spread to other parts of the ... 4 weeks. When gemcitabine is used to treat cancer of pancreas it may be injected once every week. The ...

  10. Fluconazole Injection

    Science.gov (United States)

    ... and fungal infections of the eye, prostate (a male reproductive organ), skin and nails. Fluconazole injection is ... Motrin, others) and naproxen (Aleve, Anaprox, Naprelan); oral contraceptives (birth control pills); oral medication for diabetes such ...

  11. Insulin Injection

    Science.gov (United States)

    ... or buttocks. Do not inject insulin into muscles, scars, or moles. Use a different site for each ... you are using insulin.Alcohol may cause a decrease in blood sugar. Ask your doctor about the ...

  12. Tesamorelin Injection

    Science.gov (United States)

    ... is colored, cloudy, contains particles, or if the expiration date on the bottle has passed.Never reuse ... swelling of the face or throat shortness of breath difficulty breathing fast heartbeat dizziness fainting Tesamorelin injection ...

  13. Secukinumab Injection

    Science.gov (United States)

    ... secukinumab solution before injecting it. Check that the expiration date has not passed and that the liquid ... fever, sweats, or chills, muscle aches, shortness of breath, warm, red, or painful skin or sores on ...

  14. Alirocumab Injection

    Science.gov (United States)

    ... further decrease the amount of low-density lipoprotein (LDL) cholesterol ('bad cholesterol') in the blood. Alirocumab injection is ... antibodies. It works by blocking the production of LDL cholesterol in the body to decrease the amount of ...

  15. Fallbericht: Intrakranielle kontrastmittelaufnehmende Raumforderung 58 Jahre nach Resektion eines Vestibularisschwannoms: Entzündung oder Tumor?

    OpenAIRE

    Zeller, N.; Dalchow, C.; Knecht, R.

    2014-01-01

    Einleitung: Jahre nach Entfernung intracranieller Tumoren können raumfordernde Prozesse im Operationsgebiet vorkommen. Es kommen entzündliche oder neoplastische Ursachen in Betracht. In diesem Fall trat 58 Jahre nach Resektion eines Vestibularisschwannoms ein schnell progredienter Prozess auf.Fallbericht: Eine 76-jährige Patientin bei der 1955 die Resektion eines "Hühnerei-großen" Vestibularisschwannoms der mittleren Schädelgrube über eine temporale Kraniotomie und radikale Mastoidektomie r...

  16. Konfliktpotenziale zwischen Alt und Jung im deutschen Wohlfahrtsstaat: eine quantitative Analyse des European Social Survey (ESS)

    OpenAIRE

    Hollfelder, Thomas

    2012-01-01

    Bedingt durch eine niedrige Geburtenziffer und eine steigende Lebenserwartung, führt der demografische Wandel in Deutschland zu Finanzierungslücken in den sozialen Sicherungssystemen und zu einer politischen Machtverschiebung zu Gunsten der älteren Jahrgänge. Daraus wird oft vorschnell ein Konflikt der Generationen abgeleitet, ohne dass eine empirische Prüfung der dafür notwendigen sozialen Grundlagen stattgefunden hätte. In dieser Arbeit wird deshalb ein Modell entwickelt, das die Ents...

  17. Variant of a Klippel-Trenaunay syndrome - Case report; Variante eines Klippel-Trenaunay-Syndroms - ein Fallbericht

    Energy Technology Data Exchange (ETDEWEB)

    Irlbacher, K.; Behse, F.; Roericht, S.; Meyer, B.U. [Charite-Campus Virchow Klinikum, Humboldt-Univ. Berlin (Germany); Hoffmann, K.T. [Charite-Campus Virchow Klinikum, Humboldt-Univ. Berlin (Germany). Radiologische Klinik

    2000-07-01

    We report a patient with a variant of this syndrome presenting with extensive varicose veins and arteriovenous shunts within the left arm, bony hypotrophy of the left hand, mucocutaneous melanin spots in the face and thrombocytopenia. Imaging techniques play a major role in making a diagnosis in angiophakomatoses. (orig.) [German] Hier wird eine Patientin mit einer Variante eines KT vorgestellt, bei der klinisch und mit bildgebenden Verfahren folgende Befunde erhoben wurden: Segmentale varikoese Venektasien und arteriovenoese Kurzschluesse im linken Arm und Hypotrophie von Handknochen, Phlebolithen, Venenektasien in der linken Wangenschleimhaut, Pigmentnaevi in der Gesichts-, Lippen-, und Wangenschleimhaut und Thrombozytopenie. Bildgebende Verfahren helfen hier eine diagnostische Einstufung vorzunehmen. (orig.)

  18. Ein Nelson-Winter-Modell der deutschen Volkswirtschaft

    OpenAIRE

    Quaas, Georg

    2012-01-01

    Die von Nelson und Winter (1982) vorgeschlagene evolutorische Theorie hat hunderte Studien angeregt, die sich auf das Modell beziehen, das in ihrem Buch vorgestellt wird. Dieses Modell demonstrierte die empirische Gültigkeit eines neuen theoretischen und methodologischen Ansatzes auf dem Hintergrund der U.S.-amerikanischen Ökonomie und entsprechender Daten. Allerdings wurde nur in wenigen Studien versucht, das Modell durch Anwendung auf eine andere Volkswirtschaft zu replizieren. Das vorliege...

  19. Entwicklung, Aufbau und Messungen eines schnellen Eiskeimzählers

    OpenAIRE

    Nillius, Björn

    2008-01-01

    Im Rahmen dieser Arbeit wurde ein neuer Eiskeimzähler FINCH (Fast Ice Nucleus CHamber) entwickelt und erste Messungen von verschiedenen Testaerosolen im Labor und atmosphärischem Aerosol durchgeführt. Die Aerosolpartikel bzw. Ice Nuclei IN werden bei Temperaturen unter dem Gefrierpunkt und Übersättigungen in Bezug auf Eis zum Anwachsen zu Eiskristallen gebracht, um sie mittels optischer Detektion zu erfassen. In FINCH ist dies durch das Prinzip der Mischung realisiert, wodurch eine kontin...

  20. Ein Produktmodell für die Entwicklung verteilter Informationssysteme

    OpenAIRE

    Schwerin, Wolfgang

    2007-01-01

    Vorgehensmodelle unterstützen eine systematische Entwicklung, indem sie zu erbringende Entwicklungsergebnisse, synonym -produkte, und auszuführende Aktivitäten angeben. In dieser Arbeit wird eine mathematisch fundierte Grundlage für durchgängige Vorgehensmodelle zur Entwicklung verteilter Informationssysteme geschaffen. In einem Produktmodell werden die verschiedenen Arten von Entwicklungsprodukten integriert, die im Rahmen der Unternehmens- und der Anforderungsspezifikation sowie des Softwar...

  1. Entwicklung eines Zeitmodells für einen symbolischen Simulator

    OpenAIRE

    Kapp, Kai

    1998-01-01

    Lange Zeit beschränkten sich die Optimierungsverfahren beim Entwurf höchstintegrierter Schaltungen auf Schnelligkeit, geringen Flächenbedarf und minimale Kosten von Schaltkreisen. Infolgedessen wurden immer schnellere und kleinere Schaltungen mit entsprechend wachsender Integrationsdichte entwickelt, die allerdings eine erhöhte Wärmeentwicklung aufwiesen. Hohe Temperaturen beeinträchtigen jedoch die Zuverlässigkeit von Schaltkreisen. Ein Weg, die hohe Wärmeentwicklung zu minimieren, besteht i...

  2. Beziehungen: ein Educast-Projekt und sein interkulturelles Lernangebot

    OpenAIRE

    Timmermann, Waltraud

    2012-01-01

    Interculture TV ist ein didaktisches Videoprojekt des Fachgebiets Interkulturelle Wirtschaftskommunikation der Friedrich Schiller-Universität, Jena. Das Projekt stellt audiovisuelles Lehr- und Lernmaterial, das von Studierendengruppen produziert worden ist, zur freien Verfügung. Dieser Artikel konzentriert sich auf ein deutsch-chinesisches Teilprojekt von dieser Plattform: Drei Videos zum Thema Beziehungen (zwischen Chef und Angestelltem, Kind und Eltern und zwischen Freunden) zeigen fiktiona...

  3. Mikroskopische Modellierung des Außenverkehrs eines Planungsraums

    OpenAIRE

    KAGERBAUER, Martin

    2010-01-01

    Im Rahmen der mikroskopischen Verkehrsnachfragemodellierung wird ein Modell vorgestellt, das den für den Planungsraum relevanten Verkehr der in den Außenzellen wohnenden Personen abbildet. Voraussetzung dafür ist die Übertragbarkeit von individuellen Mobilitätsdaten, die auf Basis der Daten des Deutschen Mobilitätspanels (MOP) analysiert wird. Darüber hinaus wird eine Methode zur Abgrenzung von Untersuchungsgebieten für beliebige Planungsräume in Deutschland dargelegt.

  4. Ein bunter Hund, die tool-box und lipstick lesbians

    Directory of Open Access Journals (Sweden)

    Ruben Marc Hackler

    2007-11-01

    Full Text Available Sara Mills legt eine Einführung in die Diskursanalyse vor, die durch ihre Ausrichtung am Forschungsprozess und ihr Interesse an der Vielzahl von Diskursen überzeugt. Aus dem Wald von Einführungen ragt sie heraus durch ihre Konzentration auf gesellschaftskritische Fragen, wie sie unter anderem vom Feminismus aufgeworfen wurden, und vertritt ein engagiertes Wissenschaftsverständnis.

  5. Ein Referenzmodell für die Herstellung von Fachmedienprodukten

    OpenAIRE

    Delp, Martin

    2006-01-01

    Referenz-Prozessmodelle haben aufgrund ihrer breiten Anwendbarkeit an Bedeutung gewonnen, beispielsweise bei der Organisationsgestaltung, bei der Prozessverbesserung, bei der Softwareentwicklung und in anderen Bereichen. Ziel des Werkes ist die Beschreibung eines Referenzmodells der Medienherstellung. Es zeichnet sich besonders aus durch die eine umfassende Unterstützung der Herstellung, durch einen modularen Aufbau, durch die Wiederverwendbarkeit der Modellelemente sowie durch die Unterstütz...

  6. Entwicklung eines Versuchsstandes zur zweiaxialen Beanspruchung von textilbewehrtem Beton

    OpenAIRE

    Michler, Le

    2009-01-01

    Im Rahmen der vorliegenden Arbeit wird das Versuchskonzept für zweiaxiale Zug-Zug-Versuche an textilbewehrten Betonscheiben behandelt. Diese Arbeit soll einen Beitrag leisten, die Kenntnisse aus dem Maschinenbau, der Mechanik in den Bereich der Bauingenieure und Baustoffe umzusetzen, um alle Effekte, die vom Versuchstand verursacht werden, öffentlich zu machen. Es ist ein Versuchskonzept zu erarbeiten, wie ein experimenteller Zug-Zug-Versuch optimal zu gestalten ist, um das Tragverhalten d...

  7. Fallstudie J. v. T. : Ein Patient Sigmund Freuds

    OpenAIRE

    M. Neumann

    2002-01-01

    J.v.T. war ein 23-jähriger Homosexueller, der von 1907 bis 1911 bei Freud in Behandlung war. Freud überwies diesen Kranken wegen einer Depression zur stationären Behandlung an Ludwig Binswanger jun. in die Anstalt Bellevue. Dort wurde eine Dementia praecox hebephrenica diagnostiziert. Die Therapie wurde in regem Briefwechsel zwischen Freud und Binswanger diskutiert. Während des zweiten Aufenthaltes wurde der Patient von Alphonse Maeder behandelt.

  8. Claudio Magris' Danubio: ein Übersetzungskritischer Textvergleich

    Directory of Open Access Journals (Sweden)

    Dieter Kattenbusch

    1991-12-01

    Full Text Available Ober den Fluß, an dessen Ufern man lebt, spricht man nicht. Wenn ein Regensburger über die Donau redet, dann muß das einen besonderen Grund haben, wie etwa ein Jahrhunderthochwasser oder das Buch von Claudio Magris Danubio, das, wenn man dem Bayerischen Rundfunk glauben kann, zu einem deutlichen Ansteigen der Zahl italienischer Besucher in der alten Reichsstadt Regensburg geführt hat.

  9. Montagegerechte Gestaltung eines Befestigungssystems für Photovoltaikgeneratoren

    OpenAIRE

    Schumann, Sven

    2004-01-01

    Der Bedarf an elektrischer Energie ist durch die stetig wachsende Weltbevölkerung, die erhöhte Mobilität sowie das gestiegene Komfortbedürfnis innerhalb der letzten Jahrzehnte stark angestiegen. Eine Fortsetzung dieses Trends ist sehr wahrscheinlich. Bei der erforderlichen nachhaltigen Umstrukturierung der Energieversorgungssysteme kommt der Photovoltaik eine wesentliche Rolle zu. Zur Reduzierung der Kosten der Photovoltaik müssen alle kostenverursachenden Faktoren im Hinblick auf ihr Kostens...

  10. Identifizierung und Charakterisierung eines Sdr-Proteins von Staphylococcus saprophyticus

    OpenAIRE

    Sakinç, Türkân

    2001-01-01

    Gegenstand der vorliegenden Arbeit war es, das Oberflächenprotein Ssp zu klonieren und zu charakterisieren. Stattdessen wurde ein neues Zellwand-assoziertes Protein, das SdrI, ein MSCRAMM, kloniert. Dies sollte zur Klärung der Uropathogenität von Staphylococcus saprophyticus weiterhelfen. Die Voraussetzungen zur Untersuchung der Funktion des SdrI Protein von Staphylococcus saprophyticus wurde durch die Konstruktion einer isogenen Mutante geschaffen. Die Bedeutung der SdrI-Protein ...

  11. Zwischen Boykott und CSR : eine Beziehungsanalyse zu Unternehmen und NGOs

    OpenAIRE

    Curbach, Janina

    2008-01-01

    "Um zur verstehenden Analyse der vielfältigen Beziehungen zwischen dem Unternehmenssektor und Nichtregierungs-Organisationen (NGOs) beizutragen, wird im vorliegenden Artikel die Idee eines hohen gesellschaftlichen Legitimationskapitals von NGOs aufgegriffen. Darauf aufbauend werden die Strategien der Einflussnahme von NGOs und ihre Einflusschancen auf Unternehmen vorgestellt und in Beziehung zu den strategischen Reaktionsmöglichkeiten von Unternehmen gesetzt. Daraus ergibt sich eine Topograph...

  12. Evaluation eines psychosomatischen Behandlungskonzepts bei opiatabhängigen Schwangeren

    OpenAIRE

    Härtl K; Kästner R; Stauber M

    2001-01-01

    Heroinkonsum während der Schwangerschaft erhöht die Wahrscheinlichkeit spontaner Aborte, vorzeitiger Wehen, intrauteriner Asphyxie, niedrigen Geburtsgewichts und neonataler Entzugssymptome. Abrupte Entzüge von Heroin gehen mit einer erhöhten kindlichen Mortalitätsrate einher. Substitution mit Levomethadon gilt als eine sinnvolle Behandlungsmöglichkeit bei opiatabhängigen Schwangeren. Untersucht wird die Effizienz eines psychosomatischen Behandlungskonzepts bei opiatabhängigen Schwangeren hins...

  13. Ein Jahr nach stationärer Rehabilitation - was blieb?

    Directory of Open Access Journals (Sweden)

    Laimer H

    2004-01-01

    Full Text Available Im Anschluß an die Erstmanifestation einer koronaren Herzkrankheit sind umfassende sekundärpräventive und rehabilitative Maßnahmen erforderlich, um den weiteren Verlauf der Krankheit zu optimieren. Ein intensiver erster Einsatz der Rehabilitation erfolgt unmittelbar nach dem Krankenhausaufenthalt in der Phase 2, die in Österreich überwiegend stationär in einem Rehabilitationszentrum durchgeführt wird. Im Rahmen eines Anschlußheilverfahrens werden die Risikofaktoren Lipide, Gewicht und Rauchverhalten sowie die medikamentöse Einstellung erfolgreich beeinflußt. Diese günstigen Effekte zeigen sich jedoch nach einem Jahr teilweise wieder abgeschwächt, wobei vor allem die neuerliche Gewichtszunahme der Patienten imponiert. Das Ausmaß der Verschlechterung nach einem Jahr ist jedoch bei weitem nicht so ausgeprägt wie bei den Daten von 5.556 Patienten aus 15 europäischen Ländern in der EUROASPIRE-II-Studie. Zur Optimierung des Langzeiterfolges ist eine Fortführung rehabilitativer Maßnahmen auch nach der Anschlußheilbehandlung erforderlich. Ein stationäres Wiederholungsheilverfahren ein Jahr nach dem Akutereignis führt zu einer weiteren Verbesserung des Risikoprofils, kann jedoch aus Kostengründen nicht generell empfohlen werden. Als Alternative bietet sich eine der stationären Phase-2-Rehabilitation angeschlossene ambulante Phase-3-Rehabilitation an.

  14. Arbeitspensum eines Achtundsiebzigjährigen : eine unbekannte Agenda Goethes vom November und Dezember 1827

    OpenAIRE

    Donat, Sebastian

    2008-01-01

    Das Anlegen von Agenden gehört zu den grundlegenden Elementen der Arbeits- und Lebensorganisation Goethes. [...] Zwar wird diesen Arbeitslisten dort erst ab dem Jahr 1802 eine eigene (Teil)Rubrik zugestanden, doch findet sich bereits unter dem 1. Januar 1782 der Tagebucheintrag: "Früh verschiednes in Ordnung. Agenda durchgesehn und überlegt." [...] Im Januar 1790 nahm sich Goethe unter anderem die Fertigstellung der Bearbeitungen von Torquato Tasso, Lila, Jery und Bätely sowie Faust für die S...

  15. Aufbau und Inbetriebnahme eines hochsensitiven 3-He-Magnetometers für ein zukünftiges Experiment zur Bestimmung eines elektrischen Dipolmoments des freien Neutrons

    OpenAIRE

    Kraft, Andreas

    2012-01-01

    Die Messung eines möglichen elektrischen Dipolmoments des freien Neutrons erfordert genaustmögliche Kenntnis und Überwachung des magnetischen Feldes im Inneren der n2EDM-Spektrometerkammer. Die freie Spinpräzession von hyperpolarisiertem ³He kann verbunden mit einer Signalauslese mittels optisch gepumpter Cs-Magnetometer dazu genutzt werden, Messempfindlichkeit auf Magnetfeldschwankungen im Bereich weniger Femto-Tesla zu erhalten. Am Institut für Physik der Universität Mainz wurde eine ³He/Cs...

  16. Injection currents in thin disordered organic films

    International Nuclear Information System (INIS)

    Analytic model of barrier-limited injection of charge carriers from metal electrodes into organic film, which was introduced by Arkhipov and co-workers, is modified, considering effects of multiple image charges and injection from both electrodes. Limits of applicability of Arkhipov's model are discussed. Variations from Arkhipov's model are important, if film thickness is comparable with Onsager length

  17. Charge transfer and transport in DNA

    OpenAIRE

    Jortner, Joshua; Bixon, Mordechai; Langenbacher, Thomas; Michel-Beyerle, Maria E.

    1998-01-01

    We explore charge migration in DNA, advancing two distinct mechanisms of charge separation in a donor (d)–bridge ({Bj})–acceptor (a) system, where {Bj} = B1,B2, … , BN are the N-specific adjacent bases of B-DNA: (i) two-center unistep superexchange induced charge transfer, d*{Bj}a → d∓{Bj}a±, and (ii) multistep charge transport involves charge injection from d* (or d+) to {Bj}, charge hopping within {Bj}, and charge trapping by a. For off-resonance coupling, mechanism i prevails with the char...

  18. Ibritumomab Injection

    Science.gov (United States)

    ... have received ibritumomab injection.do not have any vaccinations without talking to your doctor.you should know ... cells) and myelodysplastic syndrome (condition in which blood cells do not ... online (http://www.fda.gov/Safety/MedWatch) or by phone (1-800-332-1088).

  19. Tositumomab Injection

    Science.gov (United States)

    ... have received tositumomab injection.do not have any vaccinations without talking to your doctor.you should know ... blood cells), myelodysplastic syndrome (condition in which blood cells do not ... online (http://www.fda.gov/Safety/MedWatch) or by phone (1-800-332-1088).

  20. Doxycycline Injection

    Science.gov (United States)

    ... call your doctor.plan to avoid unnecessary or prolonged exposure to sunlight and to wear protective clothing, sunglasses, and sunscreen. Doxycycline injection may make your skin sensitive to sunlight.you should know that when doxycycline is used during pregnancy or in babies or children up to age ...

  1. Adalimumab Injection

    Science.gov (United States)

    ... swelling and scales on the skin), chronic plaque psoriasis (a skin disease in which red, scaly patches form on some areas of the body). Adalimumab injection is in a class of medications called tumor necrosis factor (TNF) inhibitors. It works by blocking the action ...

  2. Medroxyprogesterone Injection

    Science.gov (United States)

    ... injection when you are a teenager or young adult. Tell your doctor if you or anyone in your family has osteoporosis; if you have or have ever had any other bone disease or anorexia nervosa (an eating disorder); or if you drink a ...

  3. Lanreotide Injection

    Science.gov (United States)

    Lanreotide injection is used to treat people with acromegaly (condition in which the body produces too much growth hormone, causing enlargement of the hands, feet, and facial features; joint pain; and other symptoms) who have not successfully, or cannot be treated ...

  4. Paliperidone Injection

    Science.gov (United States)

    Invega® Trinza® ... Paliperidone extended-release injections (Invega® Sustenna, Invega® Trinza) are used to treat schizophrenia (a mental illness that causes disturbed or unusual thinking, loss of interest in life, and strong or ...

  5. Hybridization and control of a mobile direct methanol fuel cell system; Hybridisierung und Regelung eines mobilen Direktmethanol-Brennstoffzellen-Systems

    Energy Technology Data Exchange (ETDEWEB)

    Wilhelm, Joerg Christoph

    2010-07-01

    for the dimensioning of the fuel cell as well as of the energy storage unit. Variation of parameters results in a minimum required fuel cell power of 1.3 kW as well as a minimum energy density of 66 Wh/l or a minimum power density of 355 W/l for the energy storage unit, respectively. The high energy density required and the fact that the energy storage unit must always be operated at a partial state of charge leads to faster aging, particularly of lead-acid batteries, so that a lithium battery is eventually chosen as an energy storage unit. (orig.) [German] Direktmethanol-Brennstoffzellen (DMFCs) zeichnen sich dadurch aus, dass sie die chemische Energie des fluessig zugefuehrten Brennstoffs Methanol direkt in elektrische Energie umwandeln. Methanol hat eine hohe Energiedichte und laesst sich vergleichsweise einfach speichern. Aufgrund dieser Vorteile eignen sich Direktmethanol-Brennstoffzellen- Systeme z. B. als Batterieersatz fuer den Bereich leichte Traktion in der kW-Klasse. Da das Nachtanken im Vergleich zum Laden einer Batterie viel schneller realisierbar ist, folgt hieraus ein nahezu unterbrechungsfreier Betrieb. Das Ziel der vorliegenden Arbeit ist es daher ein Direktmethanol-Brennstoffzellen-System fuer den Bereich leichte Traktion zu entwickeln. Die systemtechnische Entwicklung und Charakterisierung eines mobilen Direktmethanol-Brennstoffzellen-Systems erfolgt zuerst allgemein und anschliessend angewandt auf das Beispiel Horizontalkommissionierer aus der Klasse der Flurfoerderfahrzeuge. Hierfuer soll sowohl ein Hybridisierungs- als auch ein Regelungskonzept entwickelt werden. Die gewaehlte Vorgehensweise gliedert sich in die Charakterisierung der Anwendung, die theoretische Konzeptentwicklung und eine abschliessende Systemanalyse mithilfe von Untersuchungen am Teststand und Simulationen. Aus der Charakterisierung folgt der charakteristische Fahrzyklus der Anwendung. Die Eckdaten, wie maximale Peakleistungen beim Beschleunigen und Bremsen sowie die

  6. Hybridization and control of a mobile direct methanol fuel cell system; Hybridisierung und Regelung eines mobilen Direktmethanol-Brennstoffzellen-Systems

    Energy Technology Data Exchange (ETDEWEB)

    Wilhelm, Joerg Christoph

    2010-07-01

    for the dimensioning of the fuel cell as well as of the energy storage unit. Variation of parameters results in a minimum required fuel cell power of 1.3 kW as well as a minimum energy density of 66 Wh/l or a minimum power density of 355 W/l for the energy storage unit, respectively. The high energy density required and the fact that the energy storage unit must always be operated at a partial state of charge leads to faster aging, particularly of lead-acid batteries, so that a lithium battery is eventually chosen as an energy storage unit. (orig.) [German] Direktmethanol-Brennstoffzellen (DMFCs) zeichnen sich dadurch aus, dass sie die chemische Energie des fluessig zugefuehrten Brennstoffs Methanol direkt in elektrische Energie umwandeln. Methanol hat eine hohe Energiedichte und laesst sich vergleichsweise einfach speichern. Aufgrund dieser Vorteile eignen sich Direktmethanol-Brennstoffzellen- Systeme z. B. als Batterieersatz fuer den Bereich leichte Traktion in der kW-Klasse. Da das Nachtanken im Vergleich zum Laden einer Batterie viel schneller realisierbar ist, folgt hieraus ein nahezu unterbrechungsfreier Betrieb. Das Ziel der vorliegenden Arbeit ist es daher ein Direktmethanol-Brennstoffzellen-System fuer den Bereich leichte Traktion zu entwickeln. Die systemtechnische Entwicklung und Charakterisierung eines mobilen Direktmethanol-Brennstoffzellen-Systems erfolgt zuerst allgemein und anschliessend angewandt auf das Beispiel Horizontalkommissionierer aus der Klasse der Flurfoerderfahrzeuge. Hierfuer soll sowohl ein Hybridisierungs- als auch ein Regelungskonzept entwickelt werden. Die gewaehlte Vorgehensweise gliedert sich in die Charakterisierung der Anwendung, die theoretische Konzeptentwicklung und eine abschliessende Systemanalyse mithilfe von Untersuchungen am Teststand und Simulationen. Aus der Charakterisierung folgt der charakteristische Fahrzyklus der Anwendung. Die Eckdaten, wie maximale Peakleistungen beim Beschleunigen und Bremsen sowie die

  7. Up-to-date der Betreuung von Chorionkarzinompatientinnen - ein Fallbeispiel

    Directory of Open Access Journals (Sweden)

    Söhnchen N

    2010-01-01

    Full Text Available Das Chorionkarzinom tritt in Europa bei einer von 30.000 Schwangerschaften auf. Betroffen sind vor allem junge und ältere Mütter sowie Patientinnen mit einer positiven Anamnese für Trophoblasterkrankungen. Kardinalsymptome sind persistierende vaginale Blutungen nach der Geburt. Bei Diagnosestellung liegen häufig bereits pulmonale Metastasen vor. In der Behandlung spielt die Chirurgie nur eine untergeordnete Rolle. Der rasche und ununterbrochene Beginn einer Chemotherapie ist hingegen entscheidend. Oft reicht eine Monochemotherapie aus. Hochrisikopatienten werden hingegen mit einer Kombinationschemotherapie (EMA/CO behandelt. Das Ansprechen auf diese Therapie ist ausgesprochen gut. Wichtig sind die weiteren Kontrollen der Patientinnen mithilfe von biochemischen Markern und radiologischer Diagnostik. Kinder betroffener Frauen sollten ebenfalls kontrolliert werden, da es auch bei ihnen zu einer intrauterinen Metastasierung gekommen sein kann. Wir stellen das diagnostische und therapeutische Vorgehen anhand eines aktuellen Fallbeispiels aus unserer Klinik dar.

  8. Ein Kanon ganz für uns allein?

    Directory of Open Access Journals (Sweden)

    Annette Kliewer

    2007-11-01

    Full Text Available Die Gender-Studies haben sich immer wieder damit hervorgetan, dass sie den traditionellen Kanon im Wissenschaftsbetrieb kritisierten. Nun veranstaltete das Referat Genderforschung der Universität Wien vom 28. bis 29. 11. 2005 eine internationale Tagung, bei der nach Existenz, Entwicklung und Sinn eines Kanons für die Frauen- und Geschlechterforschung selbst gefragt wurde. Mit dieser wissenschaftspolitischen Tagung wurde das Thema einer Ringvorlesung „Ein Kanon ganz für uns allein?“ (Sommersemester 2005 auf Fragen des internationalen Wissenschaftstransfers ausgedehnt. Auch in den Gender Studies gibt es Kanonisierungen, die Wissenschaftlerinnen ausschließen, vor allem aus nichtwestlichen Zusammenhängen, seien es postkoloniale oder postsozialistische Staaten. Eingeladen waren deshalb Referentinnen aus 15 verschiedenen Ländern.

  9. Private air conditioning systems - just a matter of conscience?; Ist eine private Klimaanlage nur eine Gewissensfrage?

    Energy Technology Data Exchange (ETDEWEB)

    Rogg, W. [NOK-Energieanwendung, Baden (Switzerland)

    1996-08-01

    Until recently, air conditioning systems in private buildings and single office rooms were an exception in this country rather than the rule, but it seems that the hot summer of 1995 brought about a change in this field. Confronted with the choice of raising their energy consumption and having to face the extreme heat, many house owners decided to install an air conditioning system. (orig.) [Deutsch] Bis vor kurzem bildeten Raumkuehlgeraete in Privathaushalten und Einzelbueros hierzulande eher die Ausnahme. Dies scheint seit dem letzten Sommer der Vergangenheit anzugehoeren, will man den Verkaufszahlen des Handels Glauben schenken. Im Gewissenskonflikt zwischen Energiesparen und Hitzekollaps moegen sich so manche schweissgeplagten Mitbuerger beim Kauf eines solchen Geraets in thermischer Notwehr befunden haben. (orig.)

  10. Entwicklung und Evaluation eines psychoedukativen Elterngruppen-Trainingsprogramms für Familien mit autistischen Kindern

    OpenAIRE

    Probst, Paul

    2003-01-01

    In der Einleitung wird das Konzept des "Psychoedukativen Elterntrainings" erläutert und ein Überblick über den Forschungsstand zum Thema "Elterntraining in Familien mit autistischen Kindern" gegeben. Ausgehend von dieser Analyse wurde ein psychoedukatives Eltern-Gruppentraining für Familien mit autistischen Kindern entwickelt und im Rahmen eines 3-Monate-Follow-up-Versuchsplans evaluiert. Die beiden Hauptziele des Trainingcurriculums waren "Vermittlung eines Konzepts über Wesen, Ursach...

  11. Entwicklung und Evaluation eines psychoedukativen Elterngruppen-Trainingsprogramms für Familien mit autistischen Kindern

    OpenAIRE

    Probst, Paul

    2003-01-01

    In der Einleitung wird das Konzept des „Psychoedukativen Elterntrainings“ erläutert und ein Überblick über den Forschungsstand zum Thema „Elterntraining in Familien mit autistischen Kindern“ gegeben. Ausgehend von dieser Analyse wurde ein psychoedukatives Eltern-Gruppentraining für Familien mit autistischen Kindern entwickelt und im Rahmen eines 3-Monate-Follow-up-Versuchsplans evaluiert. Die beiden Hauptziele des Trainingcurriculums waren „Vermittlung eines Konzepts über Wesen, Ursachen, Beh...

  12. MOOCs – ein Schritt zurück, ein Schritt nach vor?

    Directory of Open Access Journals (Sweden)

    Angelika Güttl-Strahlhofer

    2015-06-01

    Full Text Available MOOCs boomen. Aber sind sie nicht ein Rückschritt beim Lernen mit digitalen Medien, diese Massenkurse mit überschaubarer Didaktik? Angelika Güttl-Strahlhofer hat sich für uns die Frage gestellt, ob bzw. inwieweit MOOCs das Lernen mit digitalen Medien voran treiben. Aktuell nehme ich an dem MOOC von Futurelearn (www.futurelearn.com der Open University, UK teil, zum Thema "Propaganda and Ideology in Everyday Life". Die Teilnahme ist kostenlos, nur für das Teilnahmezertifikat wird etwas verlangt. Angemeldet ist man in wenigen Minuten und nachdem das erledigt ist, wird man in einem hochklassigen Video von einer Universitätsprofessorin in das Thema eingeführt, nicht ganz 10 Minuten lang. Ich werde aufgefordert, meine Meinung im bereit gestellten Forum , wie das bereits etwa 1000 Personen vor mir gemacht haben, darzulegen, oder das unter dem angegebenen Twitter-Hashtag zu tun. So oder so ähnlich laufen MOOCs ab. Unter einem MOOC, im Langtext: Massive Open Online Course, versteht man einen großteils kostenfreien Kurs, der für große Personengruppen entwickelt wurde und via Internet stattfindet. Landläufig sagt man, die MOOCs kommen aus Amerika. Spricht man mit europäischen, deutschsprachigen, Weiterbildnern wird klar: ähnliche Kurse gab es auch schon in den 2000er Jahren in Europa, nur der Terminus MOOC wurde in Übersee erfunden. War zu Beginn der "MOOC-Ära" insbesondere die Vernetzung der Teilnehmenden ein Ziel, hat dies im Laufe der Zeit verglichen mit der individuellen Wissensvermittlung an Bedeutung abgenommen. Die Qualität der MOOCs variiert, genauso wie eben die Bedeutung der Vernetzung im Kurs.

  13. Fallbericht: Seltene Raumforderungen der Leiste in der klinischen Erscheinung inguinaler Hernien: eine seminomatöse Lymphknotenmetastase und ein Liposarkom des Samenstranges

    Directory of Open Access Journals (Sweden)

    Burger M

    2005-01-01

    Full Text Available Einleitung: Wir berichten über eine seminomatöse inguinale Lymphknotenmetastase und ein Liposarkom des Samenstranges, die sich klinisch als eine inguinale Hernie präsentierten. Kasuistik: Fall 1: Ein 53jähriger Patient wurde unter der Annahme einer inguinalen Hernie links in einer chirurgischen Abteilung operiert. Es fand sich eine Raumforderung, welche in der Schnellschnittuntersuchung den Befund einer seminomatösen Lymphknotenmetastase ergab. In der folgenden Abklärung ergab sich ein linksseitiges pT2-Seminom. Anamnestisch wurde vor 26 Jahren eine inguinale Varikozelektomie links vorgenommen. Fall 2: Ein 61jähriger Patient stellte sich mit einer schmerzlosen Raumforderung der rechten Leiste vor, die klinisch als inguinale Hernie imponierte und seit drei Jahren größenprogredient war. Die Ultraschall- und MRT-Befunde wurden als eine inguinale Hernie mit einem Peritonealfett enthaltenden Bruchsack gedeutet. Intraoperativ fand sich ein Liposarkom des Samenstranges. Schlußfolgerung: Trotz der Häufigkeit inguinaler Herniotomien sind überraschende maligne Raumforderungen selten. Man sollte diese Möglichkeit aber bei transskrotalen Eingriffen in der Anamnese und bei nicht eindeutig einzuordnenden Befunden differentialdiagnostisch bedenken. Inguinale Lymphknotenmetastasen testikulärer Neoplasien sind selten, in der Literatur ist ein eindeutiger Zusammenhang mit Eingriffen im Skrotal- und Leistenbereich beschrieben. Die klinische Erscheinung einer solchen als Leistenhernie ist bisher noch nicht beschrieben worden. Liposarkome des Samenstranges sind ebenfalls selten. Therapeutisch sollte eine radikale chirurgische Exzision und in Fällen unklarer Absetzungsränder eine Radiatio erfolgen. Lokalrezidive treten häufig und eventuell auch spät auf.

  14. Spannungsfeld Hochwasserrückhaltung und Trinkwassergewinnung : ein Leitfaden

    OpenAIRE

    Kühlers, Dirk; Bethge, Ekkehart; Fleig, Michael; Hillebrand, Gudrun; Hollert, Henner; Lehmann, Boris; Maier, Dietrich; Maier, Matthias; Mohrlok Ulf; Wölz, Jan

    2011-01-01

    Viele Talauen sind sowohl für die Gewinnung von Trinkwasser aus Grundwasser, als auch für die Schaffung von Hochwasserrückhalteräumen geeignet. Im vorliegenden Leitfaden werden die Prozesse des Stofftransports von der fließenden Welle über den Retentionsraum bis zu den Entnahmebrunnen eines Wasserwerks vorgestellt. Es wird deren Einfluss auf ein höheres Risiko der Verunreinigung der Grundwasserressource durch den Eintrag von Schadstoffen aus den Retentionsräumen diskutiert.

  15. Fehlprogrammierung der frequenzadaptiven Parameter eines DDD-R-Schrittmachers

    Directory of Open Access Journals (Sweden)

    Wimmer L

    2000-01-01

    Full Text Available Aufgrund einer chronotropen Inkompetenz wurde bei einem 58jährigen Patienten ein frequenzadaptiver Schrittmacher implantiert. Nach Implantation kam es unerwarteterweise zu keiner Verbesserung der klinischen Beschwerdesymptomatik. In den verschiedensten kardiologischen Spezialabteilungen wurden mehrere erfolglose Neuprogrammierungen vorgenommen. Schlußendlich konnte durch Erhöhung des Anstiegsfaktors des Akzelerometers eine prompte Beschwerdefreiheit erzielt werden. Die meisten Sensoren stellen mit der Aktivität die Akzelerometer dar. Es handelt sich dabei um einen piezoelektrischen Kristall, der auf Beschleunigungsänderungen reagiert. Sehr oft kann durch einfache Änderungen der Programmierung entscheidend die Lebensqualität für den Patienten verbessert werden.

  16. Einbrennsilikonisierung bei pharmazeutischen Glaspackmitteln - Analytische Studien eines Produktionsprozesses

    OpenAIRE

    Mundry, Tobias

    1999-01-01

    Die Einbrennsilikonisierung wird schon lange verwendet, um spezielle Eigenschaften bei pharmazeutischen Glasbehältnissen zu erzielen. Üblicherweise werden Silikonöle verwendet um Gleitfilme auf den Oberflächen vorgefüllter Glasspritzen zu erzeugen oder die Glaswand zu hydrophobieren damit wäßrige Inhalte sauber ablaufen können. Weiterhin kann durch die hydrophobe Deaktivierung der Glaswände eine Reduktion der Adsorption von Wirk- und Hilfsstoffen sowie eine Erhöhung der hydrolytischen Resiste...

  17. Odyssee im Zeptoraum eine Reise in die Physik des LHC

    CERN Document Server

    Giudice, Gian Francesco

    2010-01-01

    Der Band lädt Leser ein, die Teilchenphysik mit den Augen eines Insiders zu betrachten, dadurch bieten sich neue Einblicke in die Welt der Teilchen und ihrer Wechselwirkungen. Aufschlussreich und unterhaltsam thematisieren die Autoren die Geschichte des Large Hadron Collider (LHC) und erläutern die mit dem LHC verknüpften wissenschaftlichen Fragen: Existiert das mysteriöse Higgs-Teilchen wirklich? Erstreckt sich der Raum in zusätzliche Dimensionen? Das Buch verhilft dazu, die Entdeckungen der kommenden Jahre mitzuverfolgen und nachzuvollziehen.

  18. Eine funktionsbasierte Analyse der Technologierelevanz von Nanotechnologie in der Produktplanung

    OpenAIRE

    Heubach, Daniel

    2009-01-01

    Die Nanotechnologie bietet ein großes Innovationspotenzial durch die Schaffung neuer Funktionalitäten von Materialien und Strukturen durch deren gezielte und spezifische Gestaltung im nm-Bereich. Aufgrund der Universalität und Kombinationsmöglichkeit der funktionalen Nanomaterialien eröffnen sich vielfältige Anwendungsmöglichkeiten. In der Praxis kann jedoch eine Lücke zwischen Nanotechnologie und den möglichen Anwendung identifiziert werden. Nanotechnologische Lösungsansätze sind auf Anwendu...

  19. Game-based Learning im Bildungskontext einer Hochschule. Ein Praxisbericht

    Directory of Open Access Journals (Sweden)

    Jochen Pfannstiel

    2009-04-01

    Full Text Available Das Fach Software-Engineering stellt Lernende und Lehrende gleichermassen vor eine grosse Herausforderung, da eine Vielzahl von abstrakten Methoden und Modellen zu erlernen sind. An der Hochschule Offenburg wurde das Lernspiel «Software Engineering in the Future» als Ergänzung zur Präsenzveranstaltung entwickelt. Die Studierenden sollen über das Lernspiel motiviert werden, sich mit der Thematik zu befassen, um dann in ansprechend gestalteten authentischen Szenarien einzelne Methoden zu erlernen und zu vertiefen. Der Artikel stellt die zentralen Aspekte der Spielentwicklung und Ergebnisse einer ersten Befragung der Studierenden vor.

  20. Untersuchung spinninduzierter Streifigkeit durch Online Messungen eines Spinnprozesses

    OpenAIRE

    Moritz, Christoph

    2009-01-01

    In der Verarbeitung von Polyamid zu synthetischen Garnen gibt es oft Probleme mit der Anfärbung, speziell bei Verwendung von Säure- bzw. Metallkomplexfarbstoffen. Häufig tritt eine unregelmäßige Anfärbung in Form von Streifigkeit des Gewebes auf. In der vorliegenden Arbeit werden die Einflüsse der Spinnbedingungen auf das Problem der Streifigkeit untersucht. Eine textile Hochgeschwindigkeitsspinnanlage wird mit Hilfe von Sensoren und einer Auswertesoftware in verschiedenen Betriebszuständen u...

  1. In Lernprozessen Sinn erfahren. Eine fachdidaktische Studie zur Humanistischen Lebenskunde

    OpenAIRE

    Adloff, Peter

    2010-01-01

    Zum Selbstverständnis der Humanistischen Lebenskunde, die im ausgehenden 19. Jahrhundert begründet wurde und als Schulfach derzeit in Berlin und Brandenburg angeboten wird, und des staatlichen Ethikunterrichts, der sich als Antwort auf Säkularisierung, Individualisierung und Pluralisierung von Kulturen versteht, gehört u.a., Sinnfragen von Kindern und Jugendlichen im Rahmen eines Schulfachs aufgreifen zu können. Eine Analyse diverser Rahmenlehrpläne zeigt allerdings einen ungeklärten bzw. une...

  2. Postpartale Depression: Ein interdisziplinärer Therapie- und Forschungsansatz

    Directory of Open Access Journals (Sweden)

    Oddo S

    2008-01-01

    Full Text Available Kurzfassung: Die postpartale Depression (PPD tritt mit einer Prävalenz von 5–20 % aller Entbindenden auf und hat ihren Häufigkeitsgipfel in der 2.–6. postpartalen Woche. Zusätzlich zu den für eine Depression klassifizierten Symptomen wie Interessenverlust, Antriebslosigkeit und erhöhte Ermüdbarkeit treten im Rahmen der PPD kindbezogene Symptome wie Ambivalenz, Schuldgefühle gegenüber dem Kind, zwanghafte Impulse und Infantizidabsichten auf. Bisher existieren wenig umfassende Befunde zur Ätiologie und Pathogenese. Psychische Vorerkrankungen, verminderte soziale Unterstützung sowie Geburtskomplikationen und endokrinologische Faktoren werden mit der Entstehung einer PPD diskutiert. Inwiefern diese Faktoren zusammenhängen und sich gegenseitig beeinflussen, ist derzeit noch unklar. Auch die neuroanatomischen Grundlagen der postpartalen Depression sind bislang kaum erforscht. Aufgrund der möglichen verheerenden Auswirkungen der PPD ist eine frühzeitige Intervention notwendig. Zu diesem Zweck haben wir eine multimodale und interdisziplinäre Langzeitstudie entwickelt, um Frauen nach der Entbindung sowie Hebammen und Angehörige zu unterstützen und aufzuklären. Epidemiologische Daten und psychosoziale Faktoren werden neben Persönlichkeits- und Bindungsfaktoren sowie neuroanatomischen Aspekten untersucht. Ein umfassendes Beratungsangebot mittels Telefonhotline und therapeutischer Unterstützung wurde eingerichtet. Die ersten vorläufigen Ergebnisse unserer Studie zeigen, dass ein hoher Bedarf an Beratungsangeboten erforderlich ist, da ca. 50 Hotline-Anrufe in nur wenigen Monaten erfolgten. Die PPD-Prävalenz lag bei 8 % von 185 Frauen in einem Zeitraum von sechs Wochen nach der Entbindung. Bei 5 der 14 PPD-Patientinnen lag gleichzeitig eine verzögerte Bindung zum Kind vor. Mangelnde soziale Unterstützung sowie das Stillverhalten hingen nicht mit der PPD zusammen, vielmehr spielten psychische Vorerkrankungen in der Eigen- und

  3. Fallbericht: Japanische Aspekte eines „Floridsdorfer Frauenherzens“

    Directory of Open Access Journals (Sweden)

    Veegh W

    2006-01-01

    Full Text Available bFallbericht/bbr Das „Floridsdorfer Frauenherz“ schlägt in einer 73jährigen Patientin, die sich bei Spitalsaufnahme mit den Zeichen eines akuten Vorderwandinfarktes im EKG (Abb. 1 und typischen Angina-pectoris-Beschwerden präsentierte. Anamnestisch gab die Patientin eine Hypertonie, einen Typ-II-Diabetes und Angina pectoris seit 1991 an. Es bestand allerdings keine Infarktanamnese, seit 2001 war die Patientin wegen paroxysmalem Vorhofflimmern marcoumarisiert. Am Aufnahmetag verspürte die Patientin eine schmerzhafte Schwellung im rechten Kniegelenk ohne Trauma, sie suchte eine orthopädische Ambulanz auf, wo ein Hämarthros unter Marcoumartherapie diagnostiziert wurde. Die Patientin wurde punktiert und mit einem Verband nach Hause entlassen. Nach den Anstrengungen und Aufregungen dieses Tages setzten bei der Patientin abends typische Angina-pectoris-Schmerzen ein, die an Intensität zunahmen und sie schließlich veranlaßten, die Rettung zu verständigen. Die Spitalsaufnahme erfolgte etwa 3 Stunden nach Schmerzbeginn, CK und Troponin T waren zu diesem Zeitpunkt negativ. Der Blutdruck betrug 130/70, der Puls 100 rhythmisch, der Blutzucker 209 mg/dl. Darüber hinaus bestand zu diesem Zeitpunkt eine mäßige Sprechdyspnoe. In der kurz nach der Spitalsaufnahme durchgeführten Echokardiographie zeigte sich eine ausgedehnte apikale Wandbewegungsstörung des linken Ventrikels mit hyperdynamer Kontraktilität der basalen klappennahen Myokardabschnitte. Auffallend dabei war, daß die Wandbewegungsstörung das typische Versorgungsgebiet der LAD überschritten und quasi symmetrisch die gesamten apikalen 2/3 des linken Ventrikels umfaßt hat. Der ballonartig dilatierte Apex erinnerte dabei an ein Apexaneurysma. Weiters fanden sich bei der Patientin eine septal betonte linksventrikuläre Myokardhypertrophie, ein mäßig vergrößerter linker Vorhof und eine geringgradige Mitralinsuffizienz (Abb. 2. Neben den klinischen Symptomen der

  4. Geschlecht und Technik: eine gesellschaftliche Praxis im Blick feministischer Erkenntnistheorie

    Directory of Open Access Journals (Sweden)

    Carola Schirmer

    2001-07-01

    Full Text Available Die Rezension stellt ein vielschichtiges Buch mit sehr unterschiedlichen Beiträgen zum Thema Geschlecht und Technik vor. Das breitgefächerte Spektrum der Aufsätze bietet einen guten Überblick über sehr verschiedene Forschungsansätze. Mehrere Autorinnen analysieren Geschlecht und Technik erkenntnistheoretisch-historisch, z.B. anhand der Begriffsentwicklung in verschiedenen naturwissenschaftlichen Disziplinen wie der Mathematik, Physik, Genetik und der Künstlichen Intelligenz. Eine Reihe andere Beiträge erforscht die Seite subjektiver Erfahrungen von Frauen in technisch geprägten Arbeitsfeldern mittels empirischer Studien.

  5. Wirtschaftswachstum in den Volkswirtschaftlichen Gesamtrechnungen: Ein Vergleich Deutschland - USA

    OpenAIRE

    Wolfgang Nierhaus

    2001-01-01

    In den USA wird seit 1996 die Wachstumsrate des realen BIP auf der Basis eines "chain-type annual-weighted" Fisher-Index ermittelt, d.h. die Wachstumsrate des realen BIP ist zwar unabhängig vom Basisjahr, andererseits ist aber nicht mehr gewährleistet, dass das BIP gleich der Summe seiner Komponenten ist. Trotz dieses Nachteils könnte ein Systemwechsel in den deutschen Volkswirtschaftlichen Gesamtrechnungen dann angezeigt sein, wenn auch in Deutschland bei der Messung der Preisentwicklung im ...

  6. Coxarthrosis - an update; Koxarthrose - ein Update

    Energy Technology Data Exchange (ETDEWEB)

    Imhof, H.; Noebauer-Huhmann, I.; Trattnig, S. [Medizinische Universitaet Wien, Klinik fuer Radiodiagnostik, Wien (Austria)

    2009-05-15

    klinischen Symptomatik gestellt. Die typischen konventionell-radiologischen sowie CT-Befunde sind: Gelenkspaltverschmaelerung, Osteophytenformation, subchondrale Demineralisation/Sklerose, subchondrale Zystenbildung, freie Gelenkkoerper, Gelenkfehlstellung, Gelenkdeformitaet. Durch die MR-Diagnostik lassen sich weitere Fruehsymptome bzw. Aktivitaetszeichen festhalten: Knorpeloedem, -riss, -defekt, subchondrales Knochenmarkoedem, synoviales Oedem und Gelenkerguss sowie Muskelatrophie. Derzeit wird die Bedeutung oft nur geringfuegiger Fehlformen (z. B. Impingement, Dysplasie), Fehlstellungen, Ligamentlockerungen etc. sowie Stoerungen in der Gefaessversorgung (z. B. Osteonekrose etc.) heftig diskutiert, die alle als moegliche Praearthrose eine hohe Wahrscheinlichkeit zur Arthroseentwicklung aufweisen. Dem gesamthaften Gelenkcontainment sowie der Genderproblematik wird heute ebenfalls richtigerweise hoehere Aufmerksamkeit gewidmet. In der Forschung wird mittels verschiedener MR-Verfahren (z. B. Hoechstfeld-MR mit H- und Na- Spektroskopie, T2*-Mapping etc.) der Knorpelstoffwechsel und seine Aenderungen bei Praearthrose untersucht (biochemisches Imaging). Zweifellos sind auf diesem Gebiet bereits in wenigen Jahren neue tief greifende Erkenntnisse zu erwarten. (orig.)

  7. Eine neue Art der Gattung Fieberiella Signoret, 1880 (Insecta, Homoptera) aus Griechenland

    NARCIS (Netherlands)

    Wagner, Wilhelm

    1963-01-01

    Vom Herrn W. H. Gravestein, Amsterdam, erhielt ich eine Anzahl Zikaden zur Bestimmung, die während einer Entomologischen Exkursion des Zoologischen Museums Amsterdam in Griechenland gesammelt worden sind. Darunter befand sich auch eine neue Fieberiella-Art. Eine taxionomische Bearbeitung der drei bi

  8. Die Leiden und Freuden eines Sprachlehrers : der Pädagoge Eduard Vencl

    OpenAIRE

    Němec, Mirek

    2007-01-01

    Am Beispiel der Biographie eines aus Wien stammenden Pädagogen tschechischer Herkunft werden die politischen und nationalen Konflikte des ausgehenden 19. und der ersten Hälfte des 20. Jahrhunderts in Mitteleuropa dargestellt. Dabei wird die Rolle eines Sprachlehrers als eines Mittlers zwischen zwei Kulturen sichtbar, die allerdings in totalitären Regimen nur mit großen Schwierigkeiten wahrzunehmen ist.

  9. Internetrecherche im Biologieunterricht:Eine grundlegende Studie am Beispiel der Gentechnik

    OpenAIRE

    Wedershoven, B. (Britta); Bickel, H

    2003-01-01

    In der dargestellten Unterrichtsreihe wurde das Internet zur Erarbeitung vier verschiedener Anwendungsbereiche der Gentechnik genutzt. Die Benutzung des Internets war somit in die Erarbeitungsphase der fachspezifischen Inhalte als ein Medium in didaktischem Sinne integriert, also ein Inhalte vermittelnder Gegenstand. Die Vermittlung von internetspezifischer Medienkompetenz erfolgte dabei über die konkrete Erarbeitung der fachlichen Themen („Huckepackverfahren“). Durch eine besondere Form der ...

  10. Dezentrale selbstorganisierte Grobplanung von Intralogistiksystemen mit Hilfe eines Software-Agentensystems

    OpenAIRE

    Yousefifar, Ramin; Wehking, Karl-Heinz; Beyer, Theresa; Jazdi, Nasser; Göhner, Peter

    2014-01-01

    In diesem Beitrag wird eine dezentral aufgebaute und auf Selbstorganisation basierende Methodik zur Grobplanung von Intralogistiksystemen thematisiert. Diese Methodik sieht eine Kombination des Wissenschaftsgebiets der Agentensysteme aus der Informatik mit der Materialflussplanung vor. Dieser Artikel leistet somit einen Beitrag für die Entwicklung eines intelligenten, rechnergestützten Assistenzsystems zur Planung intralogistischer Systeme. This article introduces a decentralized and self-...

  11. Interspinöse Implantate in der Wirbelsäulenchirurgie - eine Frage der Indikation: Ein Fallbericht

    Directory of Open Access Journals (Sweden)

    Decristoforo I

    2009-01-01

    Full Text Available Ein 77-jähriger Patient war wegen manifester neurogener Claudicatio spinalis bei bekannter lumbaler Spinalkanalstenose in 3 Segmenten an einer auswärtigen Institution mit perkutanen interspinösen Implantaten versorgt worden, wonach sich die klinische Symptomatik nicht änderte. Erst die mikrochirurgische Dekompression und die Entfernung der Platzhalter führten zu einer deutlichen Besserung der Beschwerden und Verlängerung der schmerzfreien Gehstrecke. Anhand dieses Falles wird die Verwendung von interspinösen Platzhaltern beleuchtet. In der bisherigen klinischen Anwendung fehlen noch die Langzeitergebnisse. Eine korrekte Indikationsstellung zur Intervention bei Spinalkanalstenose ist Voraussetzung für ein zufriedenstellendes postoperatives Ergebnis.

  12. Highly Charged Ion Sources

    International Nuclear Information System (INIS)

    In this work a study is made for the factors affecting the production and extraction of highly charged ion beams. Discussion is made for the production of highly charged ions from: the conventional vacuum are ion sources (Pinning PIG and Duoplasmatron DP) and the recent trends type which are (Electron Beam Ion Sources EBIS, Electron Cyclotron Resonance Ion Sources ECRIS and Laser Ion source LIS). The highly charged ions with charge state +7 , O+8 ,Ne+10 , Ar+18 have been extracted from the ECRIS while fully stripped Xe+54 has been extracted from EBIS. Improving the capabilities of the conventional RF ion source to produce multiply charged ions is achieved through the use of electron injection into the plasma or with the use of RF driven ion source. The later is based on coupling the RF power to the discharge through an internal antenna in vacuum are ion source. The argon ion species extracted from these upgraded RF ion sources could reach Ar+5

  13. Leitung und Kooperation in wissenschaftlichen Bibliotheken Berlins - eine empirische Untersuchung

    OpenAIRE

    Paul, Gerhard

    1998-01-01

    Die vorliegende Arbeit greift ein im bibliotheks- und IuK-wissenschaftlichen sowie im fachprofessionellen Diskurs bisher weitgehend vernachlässigtes, aber immer bedeutsameres Thema auf: das vertikale soziale Geschehen in der Arbeitsorganisation ?wissenschaftliche Bibliothek". Die Absicht der Untersuchung lag darin, einen Zusammenhang zwischen dem Interaktionsverhalten der Leitungspersonen einerseits und der Mobilisierung von Leistungs- und Innovationspotentialen bei den Mitarbeiterinnen und M...

  14. Fehlverhalten am Arbeitsplatz – ein kostspieliges Phänomen

    OpenAIRE

    Schmid, Andreas,

    2014-01-01

    Zur Bekämpfung von Fehlverhalten am Arbeitsplatz bedarf es nicht der Repression, sondern der Stärkung der emotionalen Verbundenheit der Beschäftigten mit dem Unternehmen. Doch dafür braucht es gemeinsame Werte und eine entsprechende Ausgestaltung der relevanten HR-Praktiken.

  15. Die Wissensgesellschaft und die Bildung des Subjekts - ein Widerspruch?

    Directory of Open Access Journals (Sweden)

    Sebastian Hacke

    2009-05-01

    Full Text Available Der Beitrag untersucht, inwiefern sich medienpädagogisch relevante Diskrepanzen zwischen dem Diskurs der Wissensgesellschaft und jugendlichem Medienhandeln nachzeichnen lassen. Dazu werden zunächst einige Aspekte des Konstrukts Wissensgesellschaft skizziert, das in seiner gegenwärtig populären Form ins Fahrwasser an volkswirtschaftlichen Verwertungskalkülen orientierter Denkformen geraten ist. Dies wird in Bezug auf die sich daran gekoppelte Programmatik von Kompetenz diskutiert, welche den «homo oeconomicus» beschwört und sich darin konträr zu klassisch bildungstheoretischen Kategorien verhält. Weitergeführt werden diese Überlegungen anhand der Problematisierung des Medienkompetenztheorems, das sich bis heute damit schwer tut, sich von der Vereinnahmung durch zweckrationale und restringierende Tendenzen zu befreien. Argumentiert wird, dass mit Medienkompetenz zu wenig einer milieuspezifischen Differenzierung Rechnung getragen werden kann, die eine wichtige Prämisse für eine soziale Ungleichheiten ernst nehmende Medienpädagogik ist. Als eine Alternative diskutieren wir, inwieweit sich hier praxeologische Perspektiven zum Verständnis jugendlichen Handelns anbieten. Der Beitrag mündet in einige medienpädagogisch fruchtbare Ideen, in deren Zentrum eine reflexivere, stärker am Habitus von Jugendlichen orientierte Praxis steht.

  16. Klimaschutz und Ernährungssicherheit : ein ordnungspolitischer Ansatz

    OpenAIRE

    Presse, André; Häußner, Ludwig Paul; Köke, Sonja

    2009-01-01

    Die vorliegende Arbeit untersucht und entwickelt Maßnahmen für den Klimaschutz und bezieht hierbei finanzielle Anreize unternehmerischen Handelns ein. Das vorgestellte Drei-Ebenen-Modell führt unter Verknüpfung beider Aspekte dazu, dass hierbei zugleich Ernährungssicherheit für alle Menschen realisiert werden kann.

  17. Der Einfluss von Rekrutiererverhaltensweisen auf den Bewerber: Ein mediierter Prozess

    OpenAIRE

    Eberz, Lisa-Marie; Baum, Matthias; Kabst, Rüdiger

    2012-01-01

    In dieser Studie wird die Wirkung der Rekrutiererfreundlichkeit und -kompetenz auf den Bewerber und dessen Absicht, den Bewerbungsprozess weiter zu verfolgen, empirisch analysiert. Als theoretisches Fundament dienen das Signaling und die Theory of Reasoned Action. Unter Zuhilfenahme eines Strukturgleichungsmodells kann gezeigt werden, dass die wahrgenommene Freundlichkeit und Kompetenz des Rekrutierers entgegen bisheriger Annahmen keine direkten Auswirkungen auf den Bewerbungsprozess haben, s...

  18. Auswege aus dem Natur-Technik-Dualismus: Eine konstitutionslogische Perspektive

    Directory of Open Access Journals (Sweden)

    Bettina Bock von Wülfingen

    2003-03-01

    Full Text Available Angelika Saupe ist eine ebenso aktive feministische Naturwissenschaftskritikerin wie profunde Kennerin der metatheoretischen Materie. Ihre Arbeit zeigt: Feministische Technikforschung übersieht die „Produktion von Natur“. Diese jedoch zu erkennen, decke weitreichende feministische Gestaltungsmöglichkeiten auf.

  19. Obamacare – Hoffnung auf eine Reform des amerikanischen Gesundheitssystems?

    OpenAIRE

    Sven Neelsen; Michael Metzger

    2009-01-01

    Der Umbau des US-amerikanischen Gesundheitssystems ist eines der Vorhaben der gegenwärtigen US-Regierung. Der folgende Beitrag stellt die Organisation und die Leistungsfähigkeit des derzeitigen Gesundheitswesens vor und diskutiert die aktuellen Reformvorschläge.

  20. Ist der deutsche Mittelstand tatsächlich ein Innovationsmotor?

    OpenAIRE

    Michael Berlemann; Vera Jahn

    2014-01-01

    Michael Berlemann und Vera Jahn, Helmut-Schmidt-Universität Hamburg, liefern in diesem Beitrag eine qualitative und quantitative Abgrenzung des Mittelstands und zeigen auf, dass sich mit Hilfe dieser Abgrenzung die Hypothese stützen lässt, dass mittelständische Unternehmen überdurchschnittlich innovativ sind.

  1. Katheterablation von Vorhofflimmern: Eine Standortbestimmung im Jahr 2006

    Directory of Open Access Journals (Sweden)

    Piorkowski C

    2006-01-01

    Full Text Available Vor dem Hintergrund der großen Patientenzahl, der häufig bedeutenden Symptomatik, der negativen hämodynamischen Auswirkungen, der thromboembolischen Komplikationen sowie der Einflüsse des Vorhofflimmerns auf die Mortalität kommt der Weiterentwicklung der direkten Katheterablation von Vorhofflimmern eine bedeutende klinische und auch sozioökonomische Bedeutung zu. Bei den Strategien zur Katheterablation werden die Pulmonalvenendiskonnektion, die zirkumferentielle Pulmonalvenenisolation, die Substratmodifikation mit linearen Ablationslinien und die kombinierte Strategie aus Pulmonalvenenisolation und linearen Ablationslinien unterschieden. Kürzlich sind diese Konzepte noch um die Strategie der Ablation fragmentierter Potentiale und der Ablation an Stellen vagaler Reizantwort ergänzt worden. Die Ergebnisse der publizierten Studien variieren stark in Abhängigkeit der Selektion der Patienten sowie der Methodik der Nachbeobachtung. Prinzipiell sind die Ergebnisse besser bei paroxysmalem als bei persistierendem Vorhofflimmern, und besser bei Patienten mit leichter kardiovaskulärer Grunderkrankung als mit schwerer. Bedeutende Komplikationen treten in den publizierten Studien in etwa 1–5 % auf. Hierbei sind insbesondere die Tamponade, thromboembolische Komplikationen, die Pulmonalvenenstenose, die Ösophagusperforation und die Phrenikusparese zu nennen. Die Katheterablation von Vorhofflimmern ist heute an der Schwelle zu einem Routineverfahren. Insbesondere bei hochsymptomatischen Patienten mit paroxysmalem Vorhofflimmern, die trotz eines oder mehrerer Versuche einer medikamentösen Einstellung nicht ausreichend gut behandelt sind, ist die Katheterablation schon heute eine gute Chance auf eine dauerhafte Stabilisierung des Sinusrhythmus.

  2. Die Wirkung staatlicher Fördermaßnahmen auf die Innovationsdynamik im Bereich der erneuerbaren Energien : eine Analyse der deutschen PV-Branche auf Basis eines agentenbasierten Simulationsmodells

    OpenAIRE

    Roloff, Nils

    2012-01-01

    Der zu erwartende Anstieg des Weltenergiebedarfs macht angesichts der Klimaproblematik und der begrenzten fossilen Ressourcen eine Umgestaltung der Energiesysteme dringend notwendig. Die erneuerbaren Energien sind jedoch noch nicht in der Lage, eine zuverlässige und kostengünstige Energieversorgung zu gewährleisten. Die technologische Weiterentwicklung der regenerativen Energien sowie eine effektive Gestaltung geeigneter Förderstrategien sind daher zentrale Herausforderungen, denen Industrie ...

  3. Automatische Segmentierung der Gewebegrenzen eines schlagenden embryonalen Hühnerherzens im 2D-Videobild

    Science.gov (United States)

    Thommes, Jan; Yelbuz, Talât Mesud

    Eine Klimakammer ermöglicht es, die Herzentwicklung bei Hühnerembryonen in einer schalenlosen Kultur über einen Zeitraum von etwa 50 Stunden visuell zu beobachten. Eine Hochgeschwindigkeits-Mikroskopkamera liefert eine Aufsicht auf das schlagende embryonale Herz. Da die für eine Analyse der Herzfunktion notwendige Segmentierung der Myokardgrenzen und des blutgefüllte Cavums manuell sehr zeitaufwändig ist, wird ein Ansatz zur kontinuierlichen, automatischen Segmentierung des schlagenden embryonalen Herzens mit Active Appearance Modellen präsentiert.

  4. Prolongierte iktale Hemiparese und Aphasie in Kombination mit PLEDs im EEG: ein Fallbericht

    Directory of Open Access Journals (Sweden)

    Leutmezer F

    2002-01-01

    Full Text Available Eine 89jährige Patientin wurde wegen eines konvulsiven Status epilepticus an einer internen Abteilung aufgenommen. In der Anamnese finden sich ein Zustand nach ischämischem Insult links hoch-parietal (2 Jahre vor Aufnahme, ein Zustand nach intrazerebraler Blutung in das Infarktareal (1 Jahr vor Aufnahme mit konsekutiver symptomatischer Epilepsie, die mit Lamotrigin gut eingestellt war, sowie ein chronisches, normofrequentes Vorhofflimmern. Anhand unseres Fallberichtes möchten wir mehrere Aspekte, die unserer Ansicht nach zum Teil von klinischer, zum Teil von theoretischer Bedeutung sind, herausstreichen.

  5. Merkmals- und Prototypensemantik: Eine Einführung

    Directory of Open Access Journals (Sweden)

    Bärenfänger, Olaf

    2002-01-01

    Full Text Available Traditional componential semantics are faced with various problems in adequately describing the meaning of a word. Therefore, this contribution presents the prototype theory as a fruitful approach for the description and explanation of many phenomena in the field of lexical semantics. Starting out from a large body of empirical results, it is discussed how prototype theory conceives lexical categories and meaning or concepts respectively. Important properties of a category are fuzzy boundaries as well as that particular elements can be viewed as differently typical for a category. The degree to which an element belongs to a category is defined in terms of typical features, whereby the most central element is called "prototype" and possesses the greatest possible number of typical features. Unlike traditional componential semantics, family resemblance relations determine which elements belong to a particular category, i.e. not all elements have to share the same necessary features, but at least one typical one. Subsequent to the description of these theorems consequences for argumentation theory, lexicography and the formation of linguistic theories are discussed as well as critical aspects of the prototype theory. After an enumeration of some research desiderata a concluding chapter gives a short summary and names the most impressive achievements of this increasingly influential research paradigm. Angesichts der verschiedenen Schwierigkeiten traditioneller Merkmalssemantiken, die Bedeutung eines Wortes angemessen zu beschreiben, wird mit der Prototypentheorie im vorliegenden Beitrag eine Konzeption vorgestellt, die möglicherweise vielversprechende Lösungsansätze bereithält. Ausgehend von empirischen Befunden wird diskutiert, wie lexikalische Kategorien resp. Bedeutungen oder Begriffe von der Prototypentheorie konzipiert worden sind. Als wesentliche Kategorieneigenschaften spielen hierbei insbesondere unscharfe Kategoriengrenzen eine Rolle

  6. Kyphoplasty - Vertebroplasty. A critical assessment; Kyphoplastie - Vertebroplastie. Eine kritische Standortbestimmung

    Energy Technology Data Exchange (ETDEWEB)

    Kasperk, C. [Medizinische Universitaetsklinik Heidelberg, Sektion Osteologie, Heidelberg (Germany)

    2015-10-15

    Painful vertebral compression fractures. Analgesia. Osteoplastic procedures, such as kyphoplasty and vertebroplasty. Anamnestic and radiological associations of clinical complaints with the radiomorphological findings of vertebral compression fractures are required for an adequate consideration to assess whether an osteoplastic procedure should be carried out. A computed tomography (CT) scan allows a reliable judgement whether an osteoplastic procedure is technically feasible and promising to improve the local vertebral fracture-associated pain. Prospective controlled trials have demonstrated a satisfactory improvement of back pain associated with vertebral fractures and parameters of quality of life by osteoplastic interventions. No prospective, truly sham-controlled blind trials are currently available which demonstrate an advantage of osteoplastic interventions compared to standard pain treatment; however, the currently published prospective controlled trials show a satisfactory pain reduction by osteoplastic interventions, such as kyphoplasty and vertebroplasty. Painful vertebral fractures and progressive loss of vertebral height of compression fractures should be evaluated in an interdisciplinary team consisting of radiologists, spinal surgeons and internists to assess whether an osteoplastic procedure is technically feasible and promising to improve local pain and immobility associated with vertebral fractures. (orig.) [German] Schmerzhafte Wirbelkoerpersinterungsfraktur. Schmerztherapie. Osteoplastische Verfahren wie die Kyphoplastie und die Vertebroplastie. Anamnestische und bildgebende (moeglichst CT) Assoziation der klinischen Beschwerden (Hauptschmerzbereich) mit dem radiologischen Befund eines eingebrochenen Wirbelkoerpers. Das CT gestattet am zuverlaessigsten eine Beurteilung der technischen Durchfuehrbarkeit eines osteoplastischen Verfahrens bei einer Wirbelkoerpersinterungsfraktur. Kontrollierte prospektive Studien belegen die schmerzreduzierende

  7. Application of carbon stripping foil to HIRFL-CSR and measurement of charge state distribution

    International Nuclear Information System (INIS)

    Charged ions may be injected into the CSRm by means of the charge stripping injection or the multiple multi-turn injection. The charge state distribution of the ions passing through the carbon foil has great influence on the performance of the accelerator and thus plays a key role in the charge stripping injection. It's found that the charge state distribution is dependent on the thicknesses of the carbon foil and the energy of the ions. In present work, the carbon stripper was applied to HIRFL-CSR and the best optional charge state distribution was measured. (authors)

  8. Charge independence and charge symmetry

    CERN Document Server

    Miller, G A; Miller, Gerald A; van Oers, Willem T H

    1994-01-01

    Charge independence and charge symmetry are approximate symmetries of nature, violated by the perturbing effects of the mass difference between up and down quarks and by electromagnetic interactions. The observations of the symmetry breaking effects in nuclear and particle physics and the implications of those effects are reviewed.

  9. Large-scale injection test in a polluted site in order to assess the possibility of injecting sandy sediments; Injektionsgrossversuch zur Ermittlung der Injizierbarkeit von sandigen Sedimenten zur Abkapselung einer Altlast

    Energy Technology Data Exchange (ETDEWEB)

    Azzam, R. [Technische Univ. Bergakademie Freiberg (Germany). Inst. fuer Geotechnik; Hamad, Y. [Amann Infutec Consult AG, Bingen (Germany); Ferner, U. [GOeS GmbH, Chemiepark Bitterfeld-Wolfen, Wolfen (Germany)

    2001-06-01

    The authors investigated inhowfar it is possible to inject a silicate sealing agent into a glimmer sand used as top layer of a landfill. [German] Es wurde untersucht, wieweit es moeglich ist, einen als Deponieabdeckung benutzten Glimmersand durch Injektionen eines silikatischen Dichtungsmittels ausreichend abzudichten. (orig.)

  10. Investigation of the potential for optimisation of a DI Diesel engine with rape methyl ester combustion; Untersuchung des Optimierungspotentials eines DI-Dieselmotors bei der Verbrennung von Rapsmethylester

    Energy Technology Data Exchange (ETDEWEB)

    Stiesch, G.; Breuer, C.; Groth, K.; Merker, G.P. [Hannover Univ. (Germany). Inst. fuer Verbrennungskraftmaschinen

    1997-11-01

    A direct injection Diesel engine is operated at four defined operating points statically with rape methylester (RME) and with Diesel fuel. The quality of combustion of the fuels is judged by the specific fuel consumption and by the emission of NO{sub x}, HC, CO, CO{sub 2}, particles, PAK and carbonyl compounds. Starting from the mass production engine, parameters are varied in order to estimate the potential for optimisation of the engine for operation with RME. Basically, in RME operation in the low load range, there is poor mixture preparation, which has the effect of increased CO, carbonyl and particle emission. At high engine loads, due to the oxygen, RME reduces particle emission. Over the whole characteristic, there is increased NO{sub x} and reduced PAK emission with RME. In RME operation, an increase in compression with simultaneous supercharging air and an increase in the injection pressure have a particularly favourable effect. (orig.) 35 figs., 4 tabs. [Deutsch] Es wird ein direkteinspritzender Dieselmotor in vier definierten Betriebspunkten stationaer jeweils mit Rapsmethylester (RME) und mit Dieselkraftstoff betrieben. Die Verbrennungsguete der Kraftstoffe wird anhand des spezifischen Kraftstoffverbrauches und anhand der Emissionen von NO{sub x}, HC, CO, CO{sub 2}, Partikel, PAK und Carbonylverbindungen beurteilt. Ausgehend vom Serienmotor werden Parametervariationen durchgefuehrt, um das Optimierungspotential des Motors fuer den Betrieb mit RME abzuschaetzen. - Grundsaetzlich kommt es im RME-Betrieb im Schwachlastbereich zu einer schlechten Gemischaufbereitung, die sich durch erhoehte CO-, Carbonyl- und Partikelemissionen auswirkt. Bei grosser Motorlast bewirkt dagegen der Sauerstoff im RME ein Absinken der Partikelemission. Im ganzen Kennfeld treten mit RME erhoehte NO{sub x}- und verringerte PAK-Emissionen auf. Im RME-Betrieb wirken sich eine Steigerung der Verdichtung mit gleichzeitiger Ladeluftkuehlung sowie eine Steigerung des Einspritzdruckes

  11. CFD Investigation into Diesel PCCI Combustion with Optimized Fuel Injection

    OpenAIRE

    Lipeng Lu; Bin Liu; Weiji Wang; Zhijun Peng

    2011-01-01

    A multi-pulse injection strategy for premixed charge compression ignition (PCCI) combustion was investigated in a four-valve, direct-injection diesel engine by a computational fluid dynamics (CFD) simulation using KIVA-3V code coupled with detailed chemistry. The effects of fuel splitting proportion, injection timing, spray angles, and injection velocity were examined. The mixing process and formation of soot and nitrogen oxide (NO x ) emissions were investigated as the focus of the research....

  12. Charged Leptons

    CERN Document Server

    Albrecht, J; Babu, K; Bernstein, R H; Blum, T; Brown, D N; Casey, B C K; Cheng, C -h; Cirigliano, V; Cohen, A; Deshpande, A; Dukes, E C; Echenard, B; Gaponenko, A; Glenzinski, D; Gonzalez-Alonso, M; Grancagnolo, F; Grossman, Y; Harnik, R; Hitlin, D G; Kiburg, B; Knoepfe, K; Kumar, K; Lim, G; Lu, Z -T; McKeen, D; Miller, J P; Ramsey-Musolf, M; Ray, R; Roberts, B L; Rominsky, M; Semertzidis, Y; Stoeckinger, D; Talman, R; Van De Water, R; Winter, P

    2013-01-01

    This is the report of the Intensity Frontier Charged Lepton Working Group of the 2013 Community Summer Study "Snowmass on the Mississippi", summarizing the current status and future experimental opportunities in muon and tau lepton studies and their sensitivity to new physics. These include searches for charged lepton flavor violation, measurements of magnetic and electric dipole moments, and precision measurements of the decay spectrum and parity-violating asymmetries.

  13. Tomato Fruit Development and Ripening Are Altered by the Silencing of LeEIN2 Gene

    Institute of Scientific and Technical Information of China (English)

    Hong-Liang Zhu; Ben-Zhong Zhu; Yi Shao; Xiao-Guang Wang; Xi-Jin Lin; Yuan-Hong Xie; Ying-Cong Li; Hong-Yan Gao; Yun-Bo Luo

    2006-01-01

    Loss-of-function ethylene insensitive 2 (EIN2) mutations showed ethylene insensitivity in Arabidopsis,which indicated an essential role of EIN2 in ethylene signaling. However, the function of EIN2 in fruit ripening has not been investigated. To gain a better understanding of EIN2, the temporal regulation of LeEIN2 expression during tomato fruit development was analyzed. The expression of LeEIN2 was constant at different stages of fruit development, and was not regulated by ethylene. Moreover, LeEIN2-silenced tomato fruits were developed using a virus-induced gene silencing fruit system to study the role of LeEIN2 in tomato fruit ripening. Silenced fruits had a delay in fruit development and ripening, related to greatly descended expression of ethylene-related and ripening-related genes in comparison with those of control fruits. These results suggested LeEIN2 positively mediated ethylene signals during tomato development. In addition,there were fewer seeds and Iocules in the silenced fruit than those in the control fruit, like the phenotype of parthenocarpic tomato fruit. The content of auxin and the expression of auxin-regulated gene were declined in silenced fruit, which indicated that EIN2 might be important for crosstalk between ethylene and auxin hormones.

  14. Exploiting the bead-injection approach in the integrated sequential injection Lab-on-Valve format using hydrophobic packing materials for on-line matrix removal and preconcentration of trace levels of cadmium in environmental and biological samples via formation of non-charged chelates prior

    DEFF Research Database (Denmark)

    Miró, Manuel; Jonczyk, Sylwia; Wang, Jianhua;

    2003-01-01

    The concept of renewable microcolumns within the conduits of an automated single injection lab-on-valve system was exploited in a sorption/elution fashion using sorbents of hydrophobic nature. The scheme's practical applicability was demonstrated for the electrothermal atomic absorption spectrome...

  15. Chirurgische Therapie der Stressharninkontinenz (SUI - Ein Überblick

    Directory of Open Access Journals (Sweden)

    Riss P

    2009-01-01

    Full Text Available Die Stressharninkontinenz der Frau hat ihre höchste Prävalenz um die Zeit der Menopause. Es gibt verschiedene Erklärungsmöglichkeiten für die Kontinenz bei der Frau: die anatomische Lage des Blasenhalses, die Druckübertragung auf die proximale Urethra, eine Degeneration des M. sphincter urethrae, die sogenannte Hängemattentheorie der Unterstützung des Blasenhalses, das Trampolinmodell von P. Petros und schließlich das Konzept der mittleren Urethra. Auf letzterem beruhen die Operationen, bei denen ein Prolene-Band spannungsfrei unter die mittlere Urethra gelegt wird (TVT und Modifikationen. Wegen der Einfachheit der Durchführung und der exzellenten Erfolgsraten haben diese Operationen die bewährte Kolposuspension nach Burch weitgehend verdrängt. Faszienschlingenoperationen sind speziellen Rezidivsituationen vorbehalten.

  16. Ein Universum nach Maß. Bedingungen unserer Existenz.

    Science.gov (United States)

    Gribbin, J.; Rees, M.

    This book is a German translation, by A. Ehlers, of the English original "Cosmic coincidences. Dark matter, mankind, and anthropic cosmology", published in 1989 (see 52.003.043). Contents: I. Zufälle im Weltall. 1. Wie außergewöhnlich ist unsere Welt? 2. Himmelskunde. 3. Zwei Arten dunkler Materie. II. Der Stoff aus dem die Welt besteht. 4. Der Teilchenzoo. 5. Halomaterie. 6. Der Stoff, aus dem die Kerne sind. 7. Kosmische Strings. 8. Die Schwerkraft als Fernrohr. 9. Der Lyman-Wald: Entstehung und Entwickluing von Galaxien. III. Ein Universum nach Maß? 10. Dem Menschen auf den Leib geschneidert? 11. Ein Weltall von der Stange?

  17. Beurteilung eines Übungsphantoms zur transurethralen Resektion der Prostata

    Directory of Open Access Journals (Sweden)

    Reichelt O

    2002-01-01

    Full Text Available Wir beurteilten die Eignung eines Übungsphantoms zur Simulation transurethraler Resektionen der Vorsteherdrüse (TUR-P. Es wurde in natürlicher Größe konzipiert und besteht weitgehend aus Silikonkautschuk. Ein leitender Oberarzt und zwei Assistenzärzte beurteilten unabhängig voneinander die Vergleichbarkeit des Modells mit der TUR-P hinsichtlich anatomischer Ähnlichkeit, Handling, Resektionsablauf und Resektionswiderstand. Insbesondere hinsichtlich des Erlernens des Resektionsablaufes und des Handlings einschließlich der Beurteilung des Resektionswiderstandes und -ergebnisses wurden gute Simulationsergebnisse attestiert, so daß das Modell für die Ausbildung von Assistenzärzten empfohlen werden kann.

  18. Simulation of ion beam injection and extraction in an EBIS

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, L., E-mail: zhao@far-tech.com; Kim, J. S. [FAR-TECH, Inc., San Diego, California 92121 (United States)

    2016-02-15

    An example simulation of Au+ charge breeding using FAR-TECH’s integrated EBIS (electron beam ion source) modeling toolset is presented with the emphasis on ion beam injection and extraction. The trajectories of injected ions are calculated with PBGUNS (particle beam gun simulation) self-consistently by including the space charges from both ions and electrons. The ion beam, starting with initial conditions within the 100% acceptance of the electron beam, is then tracked by EBIS-PIC (particle-in-cell EBIS simulation code). In the trap, the evolution of the ion charge state distribution is estimated by charge state estimator. The extraction of charge bred ions is simulated with PBGUNS. The simulations of the ion injections show significant ion space charge effects on beam capture efficiency and the ionization efficiency.

  19. Simulation of ion beam injection and extraction in an EBIS

    Science.gov (United States)

    Zhao, L.; Kim, J. S.

    2016-02-01

    An example simulation of Au+ charge breeding using FAR-TECH's integrated EBIS (electron beam ion source) modeling toolset is presented with the emphasis on ion beam injection and extraction. The trajectories of injected ions are calculated with PBGUNS (particle beam gun simulation) self-consistently by including the space charges from both ions and electrons. The ion beam, starting with initial conditions within the 100% acceptance of the electron beam, is then tracked by EBIS-PIC (particle-in-cell EBIS simulation code). In the trap, the evolution of the ion charge state distribution is estimated by charge state estimator. The extraction of charge bred ions is simulated with PBGUNS. The simulations of the ion injections show significant ion space charge effects on beam capture efficiency and the ionization efficiency.

  20. Elektromobilität - Baustein eines integrierten, klimagerechten Verkehrssystems

    OpenAIRE

    Klein, Ralf

    2013-01-01

    "Das WBGU-Gutachten 'Welt im Wandel. Gesellschaftsvertrag für eine Große Transformation' (2011) sieht Elektromobilität im Zusammenhang mit der Nutzung erneuerbarer Energien als Zukunftsmodell für den Verkehr, in dem die mit endlichen fossilen Ressourcen betriebenen Fahrzeuge sukzessive ersetzt werden. Die Elektrofahrzeuge und Ladeinfrastruktur produzierenden Unternehmen befinden sich in einem zunehmenden marktwirtschaftlichen Wettbewerb. Mit politisch gesetzten Rahmenbedingungen und Strategie...

  1. Jugendmusikbewegung? Erwachsenenmusikbewegung? Zur empirischen Gründung eines Begriffs

    OpenAIRE

    Lehmann-Wermser, Andreas

    2004-01-01

    Mit „Jugend“ und „Jugendlichkeit“ werden insbesondere die Krisenphänomene und Reformansätze in den Jahren unmittelbar vor und nach der Wende zum 20. Jahrhundert verbunden, weil hier erstmals Jugendliche selbstsozialisierend aufzutreten scheinen. Auch in der musikpädagogischen Historiografie sind die Begriffe präsent. [...] Es scheint gelegentlich, dass eher unkritisch über die Begriffe eine nahtlose und umfassende Gleichsetzung der musikalischen und musikpädagogischen Reformbestrebungen der Z...

  2. Grätzeleltern. Herausforderungen und Potenziale eines Wiener Nachbarschaftsprojekts

    OpenAIRE

    Kirsch-Soriano da Silva, Katharina

    2013-01-01

    „Grätzeleltern“ ist ein 2012 gestartetes Pilotprojekt der Caritas Wien und der Gebietsbetreuung Stadterneuerung, das sich mit strukturschwachen Wohngebieten im 6. und 15. Wiener Gemeindebezirk auseinandersetzt. Unter dem Motto „Hilfe zur Selbsthilfe“ werden BewohnerInnen rund um Themen des Wohnens und Zusammenlebens geschult und geben das erworbene Wissen als MultiplikatorInnen, als sogenannte „Grätzeleltern“, im Rahmen von Hausbesuchen an weitere BewohnerInnen in ihren Communities und Bekann...

  3. Mehrwertsteuererhöhung: Eine wirtschaftspsychologische Analyse ihrer Wirkung

    OpenAIRE

    Witte, Erich H.; Van Quaquebeke, Niels; Mölders, Christina

    2005-01-01

    Mehrwertsteuererhöhungen werden in wirtschaftlichen Kreisen normalerweise als Konsumhemmer und damit als schädlich für die Binnenkonjunktur angesehen. Um diesen Sachverhalt wirtschaftspsychologisch zu betrachten, wurden zwei Studien (online, n = 929, und offline, n = 405) durchgeführt. Es konnte nachgewiesen werden, dass eine Mehrwertsteueranhebung durch die Befragten in der Tat erst einmal als konsumeinschränkend eingeschätzt wird. Bei der nachfolgend eingesetzten experimentellen Szenari...

  4. Netzwerk- und IT-Sicherheitsmanagement : eine Einführung

    OpenAIRE

    Dinger, Jochen; Hartenstein, Hannes

    2008-01-01

    Dieses Buch führt den Leser in die beiden Themengebiete Netzwerk- und IT-Sicherheitsmanagement ein. Neben den technischen Aspekten sind dabei die strategischen, planerischen, organisatorischen und steuernden Maßnahmen des Managements von besonderer Bedeutung. Zur Verdeutlichung der Inhalte werden Fallbeispiele angeführt, bei denen insbesondere auf Erfahrungen und Maßnahmen des Rechenzentrums der Universität Karlsruhe (TH) Bezug genommen wird.

  5. Zur Effizienz des Grundwasserschutzes - eine ökonomische Analyse

    OpenAIRE

    Pfister, Gerhard

    2002-01-01

    Die erneuerbare Ressource Grundwasser steht in einem Nutzungskonflikt: Einerseits wollen Trinkwasserkonsumenten durch qualitativ hochwertiges Grundwasser ein kostengünstiges Angebot an Trinkwasser erhalten. Andererseits möchten Landwirte und Gartenbauer im Rahmen ihrer betrieblichen Zielsetzung die Möglichkeit aufrecht erhalten, Grundwasser als Senke für überschüssiges Nitrat zu nutzen. Aufgrund dieser konkurrierenden Ansprüche kann das Thema "Grundwasserschutz" auch aus ökonomischer Sicht be...

  6. Sechs-Eins-Zwo - D-P-O

    OpenAIRE

    Tietel, Erhard

    1984-01-01

    Der Autor beschreibt unter dem Eindruck einer nach dem Praktikum erlittenen schweren Krankheit seine Eindrücke und Wahrnehmungen während des Praktikums in einer Beratungsstelle des Sozialpsychiatrischen Dienstes in Bremen. Er thematisiert seine Rolle innerhalb der Beratungsinstitution und geht auf seine Erfahrungen hinsichtlich der Zusammenarbeit des Sozialpsychiatrischen Dienstes mit anderen Institutionen und hinsichtlich seiner therapeutischen Bemühungen in einem Arbeitslosenzentrum ein. Ab...

  7. Evaluation eines humanisierten Mausmodells der allergischen Atemwegsentzündung

    OpenAIRE

    Martin, Helen

    2012-01-01

    Aus der zunehmenden Prävalenz allergischer Erkrankungen vor allem in den Industrienationen ergibt sich ein erhöhter Bedarf an Grundlagenforschung im Bereich von Allergie und Asthma sowie der Entwicklung innovativer Therapiestrategien. In der vorliegenden Dissertation wurden die immundefizienten Mausstämme NOD-Scid und NOD-Scid gc als vielversprechender translationaler Schritt zwischen dem reinen Tiermodell und der Erprobung neuer Therapieansätze an Probanden in klinischen Studien beleuchtet. ...

  8. Die Vorhersage von Fragenreihenfolgeeffekten durch Antwortlatenzen : eine Validierungsstudie

    OpenAIRE

    Stocké, Volker

    2002-01-01

    'Der vorliegende Beitrag untersucht, inwieweit die Geschwindigkeit bei der Beantwortung von Einstellungsfragen als valider Indikator für die Einstellungsstärke der Befragten und als zuverlässiger Prädiktor für deren Beeinflussbarkeit durch Fragenreihefolgeeffekte angesehen werden kann. Dabei werden die Abweichungen der Antwortlatenzen bei den Zielitems von der 'normalen' Antwortgeschwindigkeit der jeweiligen Befragten und damit eine standardisierte Version dieses Indikators herangezogen. Die ...

  9. Information Lifecycle Management - Eine Methode zur Wertzuweisung von Dateien

    OpenAIRE

    Turczyk, Lars Arne

    2009-01-01

    Konventionelle IT-Architekturen betrieblicher Informationssysteme stoßen im Falle von organisatorischem Wandel in der Regel schnell an ihre Grenzen. Um strukturelle Analogien zwischen Unternehmensorganisationen und Informationssystemen zu entwickeln, wurden in den letzten Jahren unterschiedliche Ansätze verfolgt. Eine ganzheitliche Problemsicht ist jedoch erst dann gegeben, wenn auch die Speicherung gemäß den Anforderungen des Ge-schäftsprozesses Berücksichtigung in einer IT-Architektur finde...

  10. Unterrichtsentwurf: „Paneuropa“ – eine utopische Europaidee?

    OpenAIRE

    Annika Jücker

    2014-01-01

    Within the context of the internal series Europaideen im 20. Jahrhundert, Annika Jücker thematised Richard N. Coudenhove-Kalergi’s pan-European concept for her lesson plan “Paneuropa“ – eine utopische Europaidee? The plan provides insight into an early 20th century European idea, as well as an interesting lesson approach to the historical development of Europe. Utilising diverse types of sources (caricature, speech, quote), the students of an advanced level course will be familiarised with th...

  11. Solar heating for a village; Ein Dorf heizt solar

    Energy Technology Data Exchange (ETDEWEB)

    Roepcke, Ina

    2013-07-05

    In Buesingen (administrative district of Konstanz) a solar thermal system with 1091 sqm collector area is put into operation. Together with two wood chip boilers they supply more than 100 private and municipal buildings with regenerative heat. [German] In Buesingen im Landkreis Konstanz ist eine solarthermische Anlage mit 1091 qm Kollektorflaeche in Betrieb gegangen. Zusammen mit zwei Hackschnitzelkesseln versorgt sie ueber 100 private und kommunale Gebaeude mit regenerativer Waerme.

  12. Beiträge zur Instrumentierung und Identifikation eines Kleinluftschiffes

    OpenAIRE

    Wimmer, Dirk-Alexander

    2008-01-01

    Die Entwicklung moderner Luftschiffe und ihrer Steuerungs- und Regelungskonzepte erfordert exakte Modelle ihres dynamischen Verhaltens. Aus diesem Grund beschäftigt sich die vorliegende Arbeit mit der Identifikation der Luftschiffdynamik. Die Basis bildet ein Modell der Flugdynamik, das am Institut für Flugmechanik und Flugregelung mit theoretischen Grundlagen und Windkanaldaten aufgebaut wurde. Das Ziel der Untersuchung ist die Überprüfung dieses Modells an Hand von Messdaten, die mit dem Fo...

  13. Konzeption und Erprobung eines biohybriden nanoanalytischen Handheld Systems

    OpenAIRE

    Schmidhuber, Michael

    2011-01-01

    Die Arbeit befasst sich mit der Konzeption und Erprobung eines mobilen Bioanalysetools. Durch einen bioelektronischen Mikrosensorchip ist es möglich, Analysen im Bereich Lebensmitteltest und Pestiziddetektion durchzuführen. Neuartig ist hierbei die Verwendung lebender biologischer Zellen als Wandler zur Signaldetektion (cellristor). Dieser Biosensor ermöglicht die Messung von zellphysiologischen Parametern im extrazellulären Umfeld der Zelle. Sensoren für pH, Sauerstoffpartialdruck, Impedanz ...

  14. Ein Beitrag zur Blutzellmorphologie ausgewählter karnivorer Zootierarten

    OpenAIRE

    Güth, Henrike

    2004-01-01

    Henrike Güth Ein Beitrag zur Blutzellmorphologie ausgewählter karnivorer Zootierarten Zoo Leipzig Januar 2003 156 Seiten, 222 Abbildungen, 67 Tabellen, 1 Graphik, 151 Literaturangaben, Anhang mit 25 Abbildungen und 6 Tabellen Zur Beurteilung des Blutbildes ist es nötig, neben der quantitativen Betrachtung der Blutzellen auch ihre Morphologie in die Untersuchungen einzubeziehen. In der Praxis werden dazu häufig nach May-Grünwald-Giemsa-gefärbte Ausstriche verwendet. Referenzwerte zur physiolog...

  15. Das bibliothekarische Konzept der Informationskompetenz - ein Überblick

    OpenAIRE

    Ingold, Marianne

    2005-01-01

    Informationskompetenz hat sich in den letzten Jahren als wichtiges Teilgebiet des Bibliothekswesens etabliert. Der vorliegende Text gibt einen einführenden Überblick über Hintergrund und Entwicklung, Terminologie, Definitionen und Inhalte, Modelle und Standards sowie Vermittlungs- und Evaluationspraxis von Informationskompetenz im bibliothekarischen Kontext. Ein Blick auf Debatten und Kritik zeigt aber auch, dass sowohl Begriff wie Konzept in bibliothekarischen Fachkreisen keineswegs unumstri...

  16. LaMedica - Eine multimediale online Lehr- und Lernplattform [

    Directory of Open Access Journals (Sweden)

    Stracke, Sylvia

    2006-02-01

    Full Text Available [english] The project LaMedica ( has as its aim the development of a multimedia teaching and learning platform, the compilation of contents for medicine and the implementation of these in the teaching process. An on-line author environment was created which supports a variety of didactic approaches: systematic and networked communication of knowledge, case-based learning, the creation of lectures and learning sequence checks. The teaching contents can be edited and illustrated, and are aimed in particular at students, doctors in continuing education and specialists. An on-line media databank supports the re-use and the exchange of contents on the basis of a content management system through the use of the Learning Objects Metadata standards (LOM. Funding is provided by the Federal Ministry for Education and Research (FKZ NM054A. [german] Das Projekt LaMedica ( hat zum Ziel, eine multimediale Lehr- und Lernplattform zu entwickeln, Inhalte für die Medizin zu erstellen und diese in die Lehre zu implementieren. Es wurde eine on-line Autorenumgebung geschaffen, die sehr unterschiedliche didaktische Ansätze unterstützt: systematische und vernetzte Wissensvermittlung, fallbasiertes Lernen, Erstellung von Vorlesungen und Lernerfolgskontrolle. Die Lehrinhalte können zielgruppenspezifisch aufbereitet und dargestellt werden und richten sich insbesondere an Studenten, Ärzte in der Weiterbildung und Fachärzte. Eine on-line Medien-Datenbank unterstützt die Wiederverwendung und den Austausch von Inhalten auf der Basis eines Content-Management-Systems durch Verwendung des Learning Objects Metadata Standards (LOM. Die Förderung erfolgt durch das BMBF (FKZ NM054A.

  17. Systems for uninterrupted power supply; USV - ein starkes Stueck Sicherheit

    Energy Technology Data Exchange (ETDEWEB)

    Schneider, D.; Soelter, W. [AEG SVS GmbH, Warstein-Belecke (Germany)

    1999-09-01

    The millennium bug is only one of the many potential hazards in information technology. Systems for uninterrupted power supply offer a solution. [German] Alle Welt spricht vom Jahr-2000-Problem (Y2K). Die Meinungen dazu reichen von Horror-Szenarien bis hin zum Ignorieren dieses Problems. Dabei steht fest: Das Jahr-2000-Problem ist nur eines unter vielen Gefahrenpotentialen fuer die Informationstechnik. Dabei lassen sich alle Stoerfaktoren, die aus der Energieversorgung resultieren mit einer USV beseitigen. USV sichern Geschaeftsablaeufe und Fertigungsprozesse. (orig.)

  18. A distance-corrected microwave sensor; Ein abstandskorrigierter Mikrowellensensor

    Energy Technology Data Exchange (ETDEWEB)

    Sklarczyk, C.; Kuehn, M. [Fraunhofer-Inst. fuer Zerstoerungsfreie Pruefverfahren (IZFP), Saarbruecken (Germany)

    2002-07-01

    The contribution presents experimental experience with a distance-corrected, contactless frequency-modulated continuous radar sensor (FMCW radar) in the frequency range between 75 and 100 GHz, in which the phase of the interfrequency signal is evaluate. The important point is to eliminate the nonlinearity of the frequency-voltage characteristic of the radar sensor. [German] Elektrisch nichtleitende und schwach leitende Pruefobjekte lassen sich beruehrungslos und zerstoerungsfrei mittels Mikrowellensensoren bezueglich ihrer Materialeigenschaften und ihrer Geometrie (Schichtdicke, Hohlraeume, Lunker, usw.) charakterisieren. Die Messsignale der fuer den Industrieeinsatz in Frage kommenden Sensoren sind ausser von den Objekteigenschaften auch vom Abstand zwischen dem Sensor und dem Pruefobjekt abhaengig. Zur Eliminierung der Abstandsabhaengigkeit ist der Einsatz eines zusaetzlichen, unabhaengigen Abstandsmessgeraets, z.B. eines Lasertriangulationssensors oder eines luftgekoppelten Ultraschallwandlers, noetig. Im folgenden werden experimentelle Erfahrungen mit einem abstandskorrigierten, beruehrungslos arbeitenden frequenzmodulierten Dauerstrich-Radarsensor (FMCW-Radar) im Frequenzbereich zwischen 75 und 100 GHz beschrieben. Dabei wird die Phase des Zwischenfrequenzsignals ausgewertet. Wichtig ist, dass die Nichtlinearitaet der Frequenz-Spannungs-Kennlinie des Radarsensors eliminiert wird.

  19. Rekonstruktive Urologie des oberen und unteren Harntraktes - ein Therapieupdate

    Directory of Open Access Journals (Sweden)

    John H

    2009-01-01

    Full Text Available Trotz des Fortschritts konservativer Therapiemöglichkeiten ist für viele urologische Erkrankungen ein chirurgisches Vorgehen unabdingbar. Hieraus resultiert die Notwendigkeit einer ausgefeilten rekonstruktiven Chirurgie, um verloren gegangene Funktionen der einzelnen Urogenitalorgane zu ersetzen bzw. wiederherzustellen. In erster Linie bedingen ausgedehnte radikalchirurgische Eingriffe der Onkologischen Urologie einen rekonstruktiven Ersatz im Bereich des oberen und unteren Harntraktes. Neben der Rekonstruktiven Urologie als Teil der Onkologie werden diese Techniken auch für Krankheitsbilder außerhalb des onkologischen Krankheitskreises benötigt. Der vorliegende Artikel gibt anhand Peer-reviewter Literatur einen Überblick der therapeutischen Möglichkeiten des Harnblasen- und Harnleiterersatzes, der rekonstruktiven Harnröhrenchirurgie und der Möglichkeiten der operativen Korrektur der Nierenbeckenabgangsstenose. Ähnlich wie in anderen Fachrichtungen wird auch in der Urologie der Gewebeersatz durch Tissue Engineering im Labor und Tiermodell vorangetrieben. Es ist davon auszugehen, dass eine optimalere und damit funktionellere Rekonstruktion möglich und dadurch die Lebensqualität der Patienten weitreichend verbessert wird. Durch Tissue Engineering wird ein Organ- und Gewebeersatz unter möglichst äquivalenten anatomischen und funktionellen Gesichtspunkten möglich. Die Kombination altbewährter Techniken mit innovativen Neuerungen wird sich vor allem in der nahen Zukunft an Therapieerfolg, Lebensqualität und Patientenzufriedenheit messen müssen.

  20. Penicillin G Procaine Injection

    Science.gov (United States)

    Penicillin G procaine injection is used to treat certain infections caused by bacteria. Penicillin G procaine injection should not be used to treat ... in the treatment of certain serious infections. Penicillin G procaine injection is in a class of medications ...

  1. Doppler-Ultraschall in der Schilddrüsenabklärung: Eine Übersicht

    Directory of Open Access Journals (Sweden)

    Radl I

    2012-01-01

    Full Text Available Die farbkodierte Dopplersonographie ermöglicht in der Schilddrüsendiagnostik die Quantifizierung der Gewebevaskularisation. Die Diagnose eines Morbus Basedow kann mithilfe der Dopplersonographie aufgrund der eindeutigen Gewebehypervaskularisation praktisch allein getroffen werden und gibt Auskunft über den Therapieerfolg. Entzündliche Veränderungen der Schilddrüse zeigen im Vergleich zum M. Basedow praktisch immer einen geringeren Vaskularisationsgrad. Auch Schilddrüsentumoren zeigen eine vermehrte Vaskularisation. Während Adenome eine perinodale Durchblutung aufweisen, zeigen Karzinome eine Zunahme der zentralen Vaskularisation. Die Dopplersonographie kann zwar eine große Hilfestellung in der Abklärung von Schilddrüsenknoten bieten, eine Differenzierung zwischen benignen und malignen Gewebeveränderungen ist jedoch nicht möglich. Daher ist die ultraschallgezielte Feinnadelpunktion unerlässlich in der präoperativen Abklärung von Schilddrüsenknoten.

  2. Intra-arterial injection of lipid nano-capsules charged in rhenium-188, for the treatment of hepatocellular carcinomas among the rat; Injection intra-arterielle de nanocapsules lipidiques chargees en rhenium-188, pour le traitement des carcinomes hepatocellulaires chez le rat

    Energy Technology Data Exchange (ETDEWEB)

    Vanpouille, C.; Lacoeuille, F.; Hindre, F. [Inserm U646, Angers, (France); Roux, J. [service commun animalerie, hospitalo-universitaire, Angers, (France); Aube, C. [service de radiologie, CHU d' Angers, (France); Oberti, F. [service de gastro-enterologie et hepatologie, CHU d' Angers, (France); Lejeune, J.J.; Couturier, O. [service de medecine nucleaire, CHU d' Angers, (France)

    2009-05-15

    The objective of this study was to evaluate the therapy efficiency of the {sup 188}Re incorporated in the middle of lipid capsules (N.C.L. {sup 188}Re-S.S.S.) on a hepato carcinoma model of rat. The preliminary results are encouraging and show the efficiency of a single injection of N.C.L.{sup 188}Re-S.S.S. in a hepato carcinoma model of rat. (N.C.)

  3. Die Siemens AG: Inkrementale Anpassung oder Unternehmenstransformation? Eine Fallstudie über Kontinuität und Wandel eines Konzerns

    OpenAIRE

    Naschold, Frieder

    1997-01-01

    In dieser Fallstudie analysiert der Autor die Anpassungsreaktionen des Unternehmens auf strategischer wie operativer Ebene. Untersucht wurde ein prominentes, derzeit noch andauerndes Restrukturierungsprogramm des größten deutschen Elektrokonzerns Siemens. Der Autor hat drei exemplarische Unternehmensbereiche - private und öffentliche Netze sowie PCs zwischen 1992/93 und 1995 untersucht und so Einblicke in die Umstrukturierungsmaßnahmen, die durch das sogenannte TOP (Time Optimized Process)-Pr...

  4. Eine Re-Analyse der Blue Mountains Eye Study zum Kataraktrisiko durch inhalative Kortikoide: Ein Beitrag zur Objektivierung der Diskussion

    OpenAIRE

    Hartung, Joachim; Knapp, Guido

    1999-01-01

    In einer Re-Analyse der Blue Mountains Eye Study von Cumming, Mitchell und Leeder (1997) wird gezeigt, daß diese Studie keinen Beitrag zur Klärung des Kataraktrisikos von inhalativen Kortikoiden leistet. Akzeptiert man die Schlußweisen der Studie, so ergibt sich ein diffuses und zugleich aber auch interessantes Bild von diversen Aussagen zu Kataraktrisiken bei inhalativen Kortikoiden, systemisch verabreichten Kortikoiden bzw. einer Kombination von inhalativen und systemisch verabreichten Kort...

  5. Höhepunkte der Thyreologie: Eine historische Vignette

    Directory of Open Access Journals (Sweden)

    Weissel M

    2014-01-01

    Full Text Available Die vorliegende Übersicht gibt einen historischen Überblick über die Entwicklung des Verständnisses für Erkrankungen der Schilddrüse und die Möglichkeiten, diese zu behandeln. Erkenntnisse vom 3. Jahrtausend vor Christus bis ins 19. Jahrhundert ergeben, dass ein mit der Nahrung aufgenommener Stoff zur Vermeidung eines Kropfes notwendig ist, dass Kröpfe (die in gebirgigen Gegenden gehäuft vorkommen oft mit Kretinismus einhergehen und dass die Schilddrüse ein Organ ist, dessen 2 Lappen durch einen Isthmus verbunden sind. Kurz nach der Entdeckung des Halogens Jod (1811 erkennt man schon seine Bedeutung für die Behandlung und Vermeidung vom Strumawachstum. Sein Vorkommen in der Schilddrüse und im menschlichen Plasma wird eine Dekade später entdeckt. Die Klinik der Hyperthyreose wird bereits genau beschrieben, nur dauert es eine gewisse Zeit, bis man sie einer Überfunktion der Schilddrüse zuordnet. Die Klärung der Ätiologie der autoimmun bedingten Hyperthyreose erfolgte erst ab der Mitte des 20. Jahrhunderts. Therapeutisch war anfangs die Kropfexstirpation die einzige Möglichkeit. Wien und Bern waren die Zentren mit der weltweit besten Expertise. Zur Behandlung des nachfolgenden Myxödems wurden Extrakte von Schaf-Schilddrüsen verwendet. Radiojod wird seit 1946 routinemäßig zur Behandlung der Hyperthyreose und auch des Schilddrüsenkarzinoms eingesetzt. Seit 1948 stehen die Thyreostatika unverändert zur Therapie der Hyperthyreose zur Verfügung. Die verschiedenen Arten der Entzündung der Schilddrüse werden ab Ende des 19. und Beginn des 20. Jahrhunderts beschrieben. Die Pathogenese der chronischen Autoimmunthyroiditis wurde 1956 geklärt, wobei unter anderem auf das außergewöhnliche Schicksal des Erstbeschreibers H. Hashimoto eingegangen wird. Das Schilddrüsenhormon Thyroxin wurde zu Beginn des 20. Jahrhunderts entdeckt. Die Synthese gelang etwa 10 Jahre danach. Die Existenz von 3,5,3’-Triojodthyronin (T3 wurde Mitte der

  6. Determinanten der Firmen- und Branchenentwicklung in evolutorischen Modellen, Analyse eines Simulationsmodells (GERMAN)

    OpenAIRE

    Martin Bemmann

    2005-01-01

    Eine formale Analyse der Firmen- und Branchenentwicklung muß nicht auf so stark vereinfachenden und damit unrealistischen Annahmen zurückgreifen, wie dies in neoklassischen Modellen geschieht. Evolutorische Simulationsmodelle bieten sich hier als eine Alternative an. Sie gestatten eine realistischere Abbildung individueller Entscheidungsprozesse, Handlungsmöglichkeiten und -weisen und ermöglichen die Analyse der sich hieraus ergebenden Interaktionen heterogener Individuen auch über lange Zeit...

  7. Das Kindersprachscreening (KiSS) - ein Verfahren zur Sprachstandserfassung vierjähriger Kinder

    OpenAIRE

    NEUMANN, K; Holler-Zittlau, I; Sick, U; Zaretsky, Y; Euler, HA

    2009-01-01

    Einleitung: Zur Feststellung von Sprachförder- oder -therapiebedarf eignet sich ein Sprachscreening, sofern es eine ausreichende Validität aufweist und über streng algorithmische Kriterien zur Auffälligkeitsklassifizierung verfügt. Material und Methode: Für eine hessenweite Erfassung der vorschulischen Sprachkompetenz wurde das psychometrisch geprüfte Kindersprachscreening (KiSS) entwickelt. 257 Kinder im Alter von 4;0 bis 4;5 Jahren wurden mit einer Testbatterie auf ihren Sprachstand ...

  8. Formale Mengenlehre und Topologie:Ein Beitrag zur Degradierung des Mengenbegriffs

    OpenAIRE

    Hohelüchter, M. (Martin)

    2007-01-01

    Die Mengenlehre hat heute eine Zwitterstellung: Einerseits beherrscht ihre Terminologie einen Großteil der Mathematik, andrerseits soll sie als eine spezielle formale axiomatische Theorie aufgebaut werden. Die Hilbertsche Auffassung der Formalität als syntaktische und somit sprachgebundene Struktur scheint diese beiden Aufgaben vereinbar zu machen. Diese Auffassung wird hier in Frage gestellt und durch eine andere rein strukturelle ersetzt, der auch die Sprache unterworfen ist. Danach sind ni...

  9. Determinanten des Verhaltens : Verhaltensprädiktion durch eine Weiterentwicklung der Theory of Planned Behavior

    OpenAIRE

    Hilkenmeier, Frederic; Treeck, Joost van

    2007-01-01

    "Obwohl die Theory of Planned Behavior eines der einflussreichsten Modelle der Sozialpsychologie ist, konnte die Wirkweise ihrer Komponenten bis heute nicht eindeutig geklärt werden. Die theoretisch naheliegende und oft publizierte Vermutung, zwischen Verhaltensabsicht und Kontrollmöglichkeit bestehe eine Interaktion, ist bisher nie eindeutig nachgewiesen worden. Diese Studie entwickelt ein Modell, das den Gedanken der Interaktivität gezielt in die Theorie integriert. Die Bestimmung von Kennw...

  10. Aufbau eines Photolumineszenz-Messplatzes zur Charakterisierung von Wafern und Solarzellen aus kristallinem Silizium

    OpenAIRE

    Steuer, Benjamin

    2011-01-01

    Die Arbeit behandelt neben den Grundlagen der Lumineszenz in Silizium den Aufbau und die Entwicklung eines Photolumineszenz-Messplatzes. Bei der Photolumineszenz-Methode kommt die optische Anregung von Ladungsträgern mittels eines Infrarotlasers bzw. mittels eines LED-Arrays zum Einsatz. Die im Silizium auftretende Rekombinationsstrahlung (Lumineszenz) wird mittels einer sensitiven Infrarotkamera detektiert, wodurch sich unter anderem Informationen über Ladungsträger-Lebensdauern in Siliziumw...

  11. Etablierung eines spezies-spezifischen in vitro-Instrumentariums zur Erfassung der Induktion des Fremdstoffmetabolismus

    OpenAIRE

    Fery, Yvonne

    2009-01-01

    Der Kernrezeptor PXR spielt eine bedeutende Rolle im Fremdstoffmetabolismus als auch im Stoffwechsel endogener Substrate. Er reguliert die Expression zahlreicher Proteine des Fremdstoffwechsels. Deshalb hat die Aktivierung oder Hemmung des PXR einen großen Einfluss auf den Stoffwechselstatus dieser Proteine. Zum derzeitigen Stand der Forschung nimmt der PXR eine Schlüsselfunktion bei der Regulation der CYP3A-Enzyme ein. Es besteht deshalb Interesse Substanzen, die in Verdacht stehen PXR abhän...

  12. Vermittlung von Informationskompetenz an der Grundschule : Erarbeitung eines integrativen Praxiskonzepts für den Deutschunterricht

    OpenAIRE

    Schulz, Lena

    2011-01-01

    Diese Arbeit stützt sich auf die These, dass die Vermittlung von Informationskompetenz bereits in der Grundschule notwendig ist, da der Computer und das Internet mittlerweile fester Bestandteil des Alltags von Grundschülern geworden sind. Deshalb sollte man ihnen Wissen, das eine kompetente Nutzung dieser Medien ermöglicht, an die Hand geben. Die Basis der Arbeit bildet eine auf einem Quellenstudium basierende Definition von Informationskompetenz inklusive eines Überblicks über verschiedene T...

  13. Ausländer in Deutschland: ein langwieriger Integrationsprozeß : demographische und sozialstrukturelle Aspekte

    OpenAIRE

    Wiegand, Erich

    1990-01-01

    Auf der empirischen Grundlage verschiedener Befragungen und statistischer Datenquellen behandelt der Beitrag demographische und sozialstrukturelle Aspekte der Integration von Ausländern in der Bundesrepublik Deutschland. Hervorgehoben wird dabei ein geringes Interesse der Ausländer an einer Einbürgerung und eine langsame Entwicklung bei der schulischen Integration. Bei der beruflichen Integration wird eine uneinheitliche Entwicklung vermerkt, die sich u.a. in einer abnehmenden Konzentration d...

  14. Design und Modellierung eines integrierten Bioprozesses zur Produktion natürlicher Aromastoffe

    OpenAIRE

    Maltzahn, Bianca

    2005-01-01

    Im Rahmen der vorliegenden Arbeit wurde ein integrierter Bioprozess zur mikrobiellen Biokonversion von L-Phenylalanin zu den natürlichen Aromastoffen 2-Phenylethanol (2-PE) und 2-Phenylethylacetat (2-PEA) entwickelt und optimiert. Zur in situ Entfernung der inhibierenden Produkte (2-PE, 2-PEA) wurde das Verfahren der organophilen Pervaporation gewählt. Nach Charakterisierung und Optimierung des Prozesses erfolgten eine Maßstabsvergrößerung sowie die Erstellung eines Modells zur Beschreibung d...

  15. Ein Risikoausgleichsmodell für den Wettbewerb um Bestandskunden in der PKV

    OpenAIRE

    Nell, Martin; Rosenbrock, Stephan

    2008-01-01

    Die Diskussion über die Portabilität der Alterungsrückstellung in der deutschen Privaten Krankenversicherung (PKV) leidet unter dem Fehlen eines konkreten Modellrahmens. Hier setzt die vorliegende Arbeit an, indem erstmals ein Risikoausgleichsmodell zur Übertragung der Alterungsrückstellung formuliert wird. Das Modell ist kompatibel mit den bestehenden Methoden der PKV-Tarifkalkulation. Zentral ist dabei ein kollektiver Risikoausgleichsbetrag, der mit der Rechnungsgrundlage Grundkopfschaden i...

  16. Eine Enzyklopädie – aber was für eine ? What kind of encyclopedia is this?

    Directory of Open Access Journals (Sweden)

    Michael Hascher

    2001-11-01

    Full Text Available Die „Enzyklopädie der DDR“ ist, anders als die „Enzyklopädie des Nationalsozialismus“, die 1999 als Band 20 der „Digitalen Bibliothek“ erschienen war, nicht die elektronische Version eines auch in einer Printausgabe erhältlichen Werkes. Vielmehr werden hier drei ältere, gedruckte Nachschlagewerke zu einer elektronischen Ausgabe zusammengeführt. In der folgende Besprechung verweist der Verfasser auf einige Mängel, die gegen diese Form eines Nachschlagewerks sprechen. Andererseits sieht das Urteil über die Brauchbarkeit der Enzyklopädie für Arbeiten in der Frauen- und Geschlechtergeschichte nicht so negativ aus, denn abgesehen von ihren Schwachstellen ist die CD durchaus eine gut zugängliche Datenkompilation.Unlike the “Encyclopedia of National Socialism,” which was published in 1999 as volume 20 of the “Digital Encyclopedia,” the Encyclopedia of the GDR is not merely a digitalized book. Rather, it combines the contents of three older print encyclopedias. The reviewer points to a few flaws which he argues arise from the digital nature of this encyclopedia. Aside from this criticism, this encyclopedia does have to offer a fair bit of useful and accessible information for anyone working in women’s studies and gender studies.

  17. How does the German executive judge the risk of a global climate change? An opinion survey on the risk management in environmental policy; Wie schaetzt die deutsche Exekutive die Gefahr eines globalen Klimawandels ein? Eine Meinungsumfrage zum Risikomanagement in der Umweltpolitik

    Energy Technology Data Exchange (ETDEWEB)

    Krueck, C. [VDI-Technologiezentrum Physikalische Technologien, Duesseldorf (Germany). Abt. Zukuenftige Technologien; Bray, D. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Gewaesserphysik

    2000-07-01

    Global warming is a problem which is scientifically complex and risky for political institutions. Coping with this problem requires elaborate methods of information exchange and accommodation between scientific and political institutions in order to facilitate risk management and decisions under uncertainty. This paper explores the relationship between science and politics based on the results of a survey of representatives of the German executive branch (both on the Federal and the Laender level) who are in charged with regulating environmental, nature and climate protection affairs. Results indicate that the top-level administrative staff in Germany perceive climate change as an urgent problem but are undecided whether 'climate research has managed to remain a neutral, value-free science'. Climate change is perceived as an exceptionally complex problem for science which is still faced with numerous knowledge gaps. At present, the relation problem for science which is still faced with numerous knowledge gaps. At present, the relation between the executive branch and climate research is trust-based but also quite distanced, particularly, at the regional (Laender) level. (orig.) [German] Die Warnung vor einer globalen Erwaermung konfrontiert die Politik mit einem Problem, das wissenschaftlich komplex und politisch riskant ist. Die Bewaeltigung derartiger Probleme erfordert ein hohes Mass an Informationsaustausch und Verstaendigung zwischen politischen und wissenschaftlichen Institutionen, um Risikomanagement zu betreiben und Entscheidungen unter Unsicherheit zu treffen. Um ein genaueres Bild davon zu gewinnen, wie die Bedrohung des Klimawandels in der deutschen Politik wahrgenommen und handhabbar gemacht wird, wurde ein wichtiges Segment des deutschen politischen Systems unter die Lupe genommen: Fuehrende Vertreter der Exekutive (Verwaltung), die auf Bundes- und Laenderebene mit Fragen des Umwelt-Natur- und Klimaschutzes befasst sind, wurden zum Thema

  18. Ein Speichermagazin für die Staatsbibliothek zu Berlin – Preussischer Kulturbesitz. Eine betriebliche Perspektive

    Directory of Open Access Journals (Sweden)

    Daniela Lülfing

    2015-01-01

    Full Text Available Da die Magazinkapazitäten der beiden Häuser der Staatsbibliothek zu Berlin Unter den Linden und Potsdamer Strasse erschöpft sind, wurde im Berliner Ortsteil Friedrichshagen ein Speichermagazin nach dem Entwurf des Münchner Architekten Eberhard Wimmer errichtet. In einem ersten Bauabschnitt ist Magazinkapazität für 6 Millionen Bände entstanden, die von der Staatsbibliothek gemeinsam mit dem Ibero-Amerikanischen Institut und der Bildagentur für Kunst, Kultur und Geschichte der SPK genutzt wird. Die Bände stehen weiterhin zur Benutzung zur Verfügung. Der Betrieb des Speichermagazins erfolgt erstmals komplett durch Dienstleister. Since the storage capacities in both buildings of the State Library of Berlin have been exhausted, a new storage library has been built in Berlin-Friedrichshagen. The architect for this building was Eberhard Wimmer from Munich. In phase one of the building work, space has been created for about 6 Million volumes. This space is going to be used by the State Library, the Ibero-American Institute, and the Bildagentur für Kunst, Kultur und Geschichte of the Stiftung Preussischer Kulturbesitz. All volumes will be equally available to all users. Also, for the first time, the storage library will be operated by an external service company. L’espace de stockage de ses bâtiments à Unter den Linden et Potsdamer Strasse étant épuisée, la Staatsbibliothek zu Berlin a construit un nouveau dépôt situé dans le quartier de Friedrichshagen à l’est de Berlin et dessiné par l’architecte munichois Eberhard Wimmer. Le premier module achevé est utilisé tant par la Staatsbibliothek que par l’Institut ibéro-américain et la Bildagentur für Kunst, Kultur und Geschichte (Agence graphique pour l’art, la culture et l’histoire de la Fondation pour le patrimoine culturel prussien SPK. Les ouvrages restent à la disposition du public. Ce dépôt est le premier de son genre entièrement géré par des prestataires de

  19. Lernen als Entwicklung der mathematischen Sinne: Ein Beispiel aus der Algebra

    OpenAIRE

    Janssen, Thomas

    2014-01-01

    Wer die Algebra beherrscht, hat ein Gespür dafür, wie mit ihren Strukturen umzugehen ist. Er oder sie weiß, wie man eine Gleichung löst, was ein Funktionsterm aussagt oder wie sich ein quadratischer Ausdruck umformen lässt. Gerade wenn die Algebra für Probleme sorgt, hört man naturalisierende Äußerungen wie: „Dafür fehlt mir der Sinn“. Dass dieser Sinn sich (weiter-)entwickeln kann, wird damit implizit verneint.

  20. Entscheidung als notwendige Fiktion: Über eine fundamentale ökonomische Narration

    OpenAIRE

    Priddat, Birger P.

    2015-01-01

    Elena Esposito analysiert das ökonomische Entscheiden in Zukunftsmärkten (finance) als „Fiktion der wahrscheinlichen Realität“ (Esposito 2007). Eine ‚wahrscheinliche Realität’ ist eine Realitätsvermutung. In der Vermutung steckt eine Vorauswahl dessen, was wahrscheinlicher ist als anderes. Damit ist angedeutet, daß weiterhin anderes, andere Realitäten im Spiel sind, aber nicht mitspielen. Wenn aber mehre Realitäten möglich sind, ist die Behauptung, eine davon wäre wahrscheinlich (eigentlich g...

  1. Charge Transport in LDPE Nanocomposites Part II—Computational Approach

    Directory of Open Access Journals (Sweden)

    Anh T. Hoang

    2016-03-01

    Full Text Available A bipolar charge transport model is employed to investigate the remarkable reduction in dc conductivity of low-density polyethylene (LDPE based material filled with uncoated nanofillers (reported in the first part of this work. The effect of temperature on charge transport is considered and the model outcomes are compared with measured conduction currents. The simulations reveal that the contribution of charge carrier recombination to the total transport process becomes more significant at elevated temperatures. Among the effects caused by the presence of nanoparticles, a reduced charge injection at electrodes has been found as the most essential one. Possible mechanisms for charge injection at different temperatures are therefore discussed.

  2. Performance enhancement in p-channel charge-trapping flash memory devices with Si/Ge super-lattice channel and band-to-band tunneling induced hot-electron injection

    International Nuclear Information System (INIS)

    P-channel charge-trapping flash memory devices with Si, SiGe, and Si/Ge super-lattice channel are investigated in this work. A Si/Ge super-lattice structure with extremely low roughness and good crystal structure is obtained by precisely controlling the epitaxy thickness of Ge layer. Both programming and erasing (P/E) speeds are significantly improved by employing this Si/Ge super-lattice channel. Moreover, satisfactory retention and excellent endurance characteristics up to 106 P/E cycles with 3.8 V memory window show that the degradation on reliability properties is negligible when super-lattice channel is introduced. - Highlights: ► A super-lattice structure is proposed to introduce more Ge content into channel. ► Super-lattice structure possesses low roughness and good crystal structure. ► P-channel flash devices with Si, SiGe, and super-lattice channel are investigated. ► Programming/erasing speeds are significantly improved. ► Reliability properties can be kept for device with super-lattice channel

  3. Public-Health-Apekte der Hypertonie: ein Update

    Directory of Open Access Journals (Sweden)

    Dorner T

    2009-01-01

    Full Text Available Die Darstellung des Public-Health-Problems aufgrund von Hypertonie ist stark verbunden mit den Auswirkungen auf das kardiovaskuläre Risiko, die kardiovaskuläre Mortalität und mit dem Einfluss auf die Lebensqualität. In Österreich ist Hypertonie für 22,8 % aller Todesfälle und 8,9 % der DALYs (Disability adjusted life years verantwortlich. Hypertonie ist ein modifizier- bis eliminierbarer Risikofaktor, dem durch die Implementierung einer medikamentösen Therapie, die Etablierung von Lebensstiltherapie oder die Kombination von beiden entgegengewirkt werden kann. Dennoch ist das Blutdruckbewusstsein ("Awareness" in der Bevölkerung geringer ausgeprägt als die Awareness bezüglich anderer kardiovaskulärer Risikofaktoren wie Rauchen oder Übergewicht. Es gibt große Mängel in der Blutdruckkontrolle, im Sinne des Erreichens und Aufrechterhaltens von Normalwerten. Die Kosten, die aufgrund von nicht oder schlecht behandelter Hypertonie entstehen, sind enorm. Das präventive Potenzial durch Blutdruckbehandlung, bei der Lebensstilmaßnahmen durch medikamentöse Maßnahmen eher unterstützt statt ersetzt werden sollen, ist sehr hoch. Ziel der Prävention ist eine Verhinderung der hypertoniebedingten Folgeerkrankungen. Dies bedingt einen interdisziplinären Zugang und integrierte Versorgungsmodelle, wobei die verschiedenen "Stakeholder" wie Ärzte und alle Health Professionals, Patienten, aber auch die Gesundheitspolitik miteinbezogen werden. „Empowerment“ der Patienten soll durch öffentliche Bewusstseinsbildung und Information gewährleistet werden. Durch Public-Health-Programme und eine umfassende Public-Health-Policy kann die Lebensqualität erhöht und die Lebenserwartung in Gesundheit gesteigert werden.

  4. Eine vergleichende Studie zweier Sextantenbiopsietechniken in derselben Prostata

    Directory of Open Access Journals (Sweden)

    Brössner C

    1999-01-01

    Full Text Available Einleitung: Ziel dieser Studie ist ein Vergleich der "Standard"-Sextantenbiopsietechnik mit der Fächerbiopsietechnik. Letztere hat ihren Schwerpunkt im Apikalbereich der Prostata, in dem die meisten Karzinome entstehen. Methoden: Insgesamt wurden 280 Patienten in diese Studie inkludiert. Von jedem Patienten wurden 12 Stanzen gewonnen. Sechs Stanzen wurden mit der "Standard"-Biopsietechnik (Technik A gewonnen: In beiden Lappen der Prostata wurden je 3 Stanzen hintereinander (Apex-Mitte-Basis in einem Winkel von ca. 45° gewonnen (Abb. 1. Sechs weitere Stanzen vom linken zum rechten Rand der Prostata, in einer Ebene immer apikal eingehend wurden mit der Fächertechnik (Technik B gewonnen (Abb. 2. Ergebnisse: Insgesamt wurden 72 Prostatakarzinome (PC entdeckt (= 25,7 %. In der PC Untergruppe mit PSA 10 hat Technik A eine Sensitivität von 88,8 % (p = 0,037, Technik B 96,2 % (p = 0,326 verglichen mit dem Referenzstandard von 100 % erzielt mit allen 12 Stanzen. In bezug auf die Anzahl der Karzinom-positiven Stanzen ist in dieser Untergruppe Technik B in 12 Fällen überlegen, Technik A in 3, ausgeglichen sind beide Techniken in 12 Fällen. In der PC Untergruppe PSA 10 hat Technik A eine Sensitivität von 93,3 % (p = 0,083, Technik B 88,8 % (p = 0,023. In bezug auf die Karzinom-positiven Stanzen ist in dieser Untergruppe Technik B in 12 Fällen überlegen, Technik A in 14, ausgeglichen sind beide Techniken in 19 Fällen. Konklusion: Die Fächerbiopsietechnik bringt Vorteile bei Patienten mit PSA 10 sowohl in Hinblick auf die Karzinomentdeckungsrate, als auch bezüglich der Anzahl der positiven Stanzen. Da die Fächerbiopsie mehr den Apikalbereich der Prostata bevorzugt, sollte sie bei frühen Karzinomen (PSA 10 Anwendung finden.

  5. Okto - Ein zukunftsträchtiges Modell medialer Partizipation

    Directory of Open Access Journals (Sweden)

    Georg Lindner

    2014-03-01

    Full Text Available Als kleiner Sender mit großen Ideen ging Okto am 28. November 2005 um 20 Uhr on air. Seither haben an die 350 verschiedene Gruppierungen unterschiedlichster Zusammensetzung, was Alter, Herkunft, Interessen und Vorstellungen betrifft, mit der Produktion eigener Sendereihen am Zustandekommen des vielfältigen, spannenden und immer professioneller hergestellten Programm des Sender mitgewirkt. Diese Erfolgsgeschichte macht es deutlich: Partizipation ist aus der medialen Gegenwart nicht mehr wegzudenken und stellt, das zeigen die Bemühungen vieler – auch kommerziell orientierter Anbieter – eine der größten und spannendsten Herausforderungen für die Medienproduktion der Zukunft dar.

  6. IB Online (3/11): eine kleine Netzschau

    OpenAIRE

    Wender, Stefan

    2014-01-01

    In der Netzschau diese Woche haben wir versucht, mal “neue” Themen für Euch rauszusuchen: so findet sich hier Links zu einer Diskussion der neuen, nicht-westlichen Weltordnung, der Bekämpfung von Ebola mittels des Militärs, einer grundsätzlichen Diskussion der Ursachen von Armut sowie – nun gut, so neu ist das nicht – der Lage in der Ost-Ukraine. Dazu gibt es ein paar unkommentierte, aber dennoch lesenswerte Links. Viel Spaß!

  7. Singen im Alterungsprozess - eine explorative Studie in der Altersgruppe 50+

    OpenAIRE

    Von Rotenhan, Monika

    2011-01-01

    Der demographische Wandel Deutschlands, der in zunehmender Lebenserwartung und zurückgehender Geburtenrate begründet ist, erfordert ein Umdenken bezüglich vorhandener Strukturen im Gesellschaftssystem, damit den Herausforderungen einer überalterten Bevölkerung begegnet werden kann. Die späte Lebensphase ist häufig durch Multimorbidität gekennzeichnet und stellt damit enorme Belastungen für das Gesundheitssystem dar; Prävention und Gesundheitsförderung rücken dadurch mehr in den Mittelpunkt. N...

  8. Propädeutikum Java : ein Buch zum Selbststudium

    OpenAIRE

    Buchwald, Hagen; Elstermann, Matthes

    2011-01-01

    Propädeutikum Java ist ein Einführungskurs in die Programmiersprache Java für Schüler und Abiturienten, die sich auf das Studium vorbereiten möchten. Die Autoren - erfahrene Dozenten, Übungsleiter und Tutoren am Karlsruher Institut für Technologie (KIT) - ermöglichen Anfängern den Einstieg in die faszinierende Welt der Programmierung anhand einer Vielzahl einfacher und einprägsamer Beispiele, die den Einstieg in die Programmierung mit Java im Selbststudium ermöglichen.

  9. Eine über 300-jährige Geschichte

    OpenAIRE

    Lerch, Gisela; Schaefgen, Annette; Aue, Stefan

    2012-01-01

    Die Berlin-Brandenburgische Akademie der Wissenschaften (vormals Preußische Akademie der Wissenschaften) ist eine moderne, zukunftsorientierte Wissenschaftseinrichtung, die in einer großen, mehr als 300-jährigen Tradition steht und auf eindrucksvolle Leistungen verweisen kann. Bis heute prägen 78 Nobelpreisträger ihre bewegte Geschichte, die - unter wechselnden Namen - bis zur Kurfürstlich Brandenburgischen Sozietät der Wissenschaften zurückreicht, welche im Jahre 1700 von Gottfried Wilhelm L...

  10. Zum Unternehmerhabitus. Eine kultursoziologische Bestimmung im Hinblick auf Schumpeter

    OpenAIRE

    Loer, Thomas

    2006-01-01

    Unternehmerisches Handeln ist soziologisch gesehen ein Typus des Handelns, der unter den Bedingungen der Moderne exemplarisch für Handeln überhaupt stehen kann, verbindet es doch Freimut zu riskanter Entscheidung mit dem Anspruch auf rationale Verlässlichkeit: Der Unternehmer kann ebenso wenig umhin, Neuerungen zu suchen und zu fördern wie er dabei auf berechnende Berücksichtigung und materiale Würdigung seiner Möglichkeiten und der Erfolgschancen seines Handelns verzichten kann. Um so handel...

  11. Odontologie im numismatischen Spiegel : Ein Beitrag zur Geschichte der Zahnheilkunde

    OpenAIRE

    Heckert, Gerold Rüdiger

    2006-01-01

    Obgleich Medaillen mit zahnheilkundlichen Motiven schon sehr lange vertreten sind, hat dies in der Literatur bisher wenig Beachtung gefunden. Eine eigenständige Veröffentlichung erschien 1988 herausgegeben von Ladendorf und Salaschek (Proskauer 1940), die sich aber nur mit der Reklame von Zahnärzten und für Zahnärzte auf Medaillen befasst. Dieser Publikation liegt die Zusammenstellung von Storer und der Katalog zur Sammlung Brettauer zu Grunde. In den USA führte der Gynäkologe Horatio...

  12. Seelsorgliche Gesprächsführung : ein Lernprogramm

    OpenAIRE

    Baumann, Urs; Reuter, Mark; Teuber, Stephan

    2002-01-01

    Wir leben in einer Zeit der Mißverständnisse, in einer Welt, in der die Menschen trotz immer besserer Kommunikationsmittel zunehmend Probleme haben, sich über das Lebensnotwendige zu verständigen. Apathie und Gleichgültigkeit, Ungeduld und Rechthaberei, Intoleranz gegenüber Ausländern bis hin zum blanken Fremdenhaß, das massenhafte Scheitern von Partnerschaften, das alles sind Anzeichen für eine Gesellschaft, in der es Menschen offenkundig schwerfällt, andere Sprachen, Kulturen und Gedankenwe...

  13. Das Verschwinden des Patriarchats : modernisierungstheoretische Ansichten eines umstrittenen Theorems

    OpenAIRE

    Kahlert, Heike

    2000-01-01

    'Die Frage von Macht und Herrschaft in den Geschlechterverhältnissen gehört auch an der Schwelle zum 3. Jahrtausend zu den nach wie vor ungelösten Kernthemen von politischer Theorie und Praxis. Folglich erweist sich das Ende des Patriarchats als eine mächtige emanzipatorische Utopie. In diesem Beitrag wird dieses utopische Moment feministischer Denk- und Politikbewegungen am Beispiel des Ansatzes der italienischen Frauen aus der Libreria delle donne di Milano diskutiert. Die Vision 'der Mailä...

  14. Ein Maulwurf für den Mars

    OpenAIRE

    Köhler, Ulrich

    2012-01-01

    Kein Planet wird gegenwärtig so intensiv erforscht wie der Mars. Nicht nur die vielfältigen Spuren, die Wasser in der Frühzeit auf dem Planeten hinterlassen hat, begründen die aufwändige Suche nach kleinen, ökologischen Nischen auf dem Mars und nach organischen Molekülen. Eine ganz andere Frage ist, wie sich der Mars zu dem Himmelskörper entwickelt hat, der er heute ist: Hier tappt die Wissenschaft noch ziemlich im Dunkeln. Das soll sich aber 2016 ändern, wenn die Forschungsstation I...

  15. Fiskalische Effekte der Zuwanderung nach Deutschland: Eine Generationenbilanz

    OpenAIRE

    Bonin, Holger

    2001-01-01

    Der Beitrag untersucht die Bedeutung von Zuwanderung für die langfristige Entwicklung öffentlicher Haushalte in Deutschland. Mit Hilfe der Generationenbilanzierung werden die Nettosteuerzahlungen von Zuwanderern von ihrer Ankunft im Aufnahmeland bis an ihr Lebensende geschätzt. Wenn künftige Einwanderer der heute in Deutschland lebenden Ausländerbevölkerung ähneln, ist der Gesamtbeitrag der Zuwanderung zu den öffentlichen Haushalten eindeutig positiv. Immigration wäre daher ein geeignetes Ins...

  16. 某增压直喷汽油机配气机构的设计优化%Optimization of a Turbo-charged Direct-injection Gasoline Valve Actuating Mechanism

    Institute of Scientific and Technical Information of China (English)

    胡景彦; 吴丰凯; 洪进

    2012-01-01

    The paper optimizes the valve actuating mechanism of a turbo-charged gasoline by means of simulation analysis and improves its valve spring and high-pressure pump cam phase. According to the calculated results, it is known that changing an original equal pitch to an irregular pitch also can be universally used. Based on introduced high-pressure oil pump, the driving torque, after torsional angle and chain pull for initial phase of high-pressure oil pump are analyzed and optimized, a best phase angle is selected.%采用仿真分析方法对某增压直喷汽油机的配气机构进行了设计优化,对该配气机构的气门弹簧以及高压油泵凸轮相位进行了改进。根据计算分析对比结果,将原等节距气门弹簧更改为变节距气门弹簧,同时实现该弹簧在发动机系列改款机型中也实现通用,并且基于高压油泵的介入,对高压油泵凸轮的初始相位从驱动力矩、扭振角度以及链条拉力等方面对比分析后进行了优化,选定某最佳相位角度。

  17. Cloning of Brassica napus EIN3 Gene and Its Expression Induced by Sclerotinia sclerotiorum%甘蓝型油菜BnEIN3基因的克隆及菌核病诱导表达研究

    Institute of Scientific and Technical Information of China (English)

    许李明; 黄军艳; 刘学群; 覃瑞; 刘胜毅

    2009-01-01

    [Objective] The study was to investigate roles of Brassica napus EIN3 in (BnEIN3) resistance to Sclerotinia sclerotiorum. [Methods] Genomic PCR and RT-PCR were carried out to isolate genomic DNA and cDNA sequences of BnEIN3 from oilseed rape, based on the highly conserved region of EIN3 gene from Arabidopsis thaliana and the homologous sequences of oilseed rape ESTs. Expression levels of BnEIN3 were detected in three varieties of oilseed rape inoculated with S.sclerotiorum by real-time quantitative PCR. [Results]A 1 947 bp DNA fragment was obtained from oilseed rape. The fragment shared 82% identity to A. thaliana EIN3, encoded 614 amino acids containing an EIN3 domain, and was named as BnEIN3. Real-time PCR results showed that expression patterns of BnEIN3 were drastically different in different varieties. In highly resistant oilseed rape variety D083, BnEIN3 expression level was significantly increased 72 h after S.sclerotiorum inoculation whereas in middle resistant and susceptible varieties Zhongshuang 9 and 84039, BnEIN3 expression was suppressed. [Conclusion] BnEIN3 may play an important role in oilseed rape resistance to S.sclerotiorum.

  18. IFRS 8 OPERATING SEGMENTS: Eine Untersuchung der erstmaligen Anwendung in der Schweiz

    OpenAIRE

    Meyer, C.; Weiss, S.

    2010-01-01

    Seit dem 1. Januar 2009 sind kotierte IFRS-Anwender verpflichtet, eine Segmentberichterstattung nach IFRS 8 zu erstellen. Anhand einer Analyse der Geschäftsberichte 2009 der an der SIX Swiss Exchange kotierten Unternehmen soll ein Überblick über die erstmalige Anwendung von IFRS 8 "Operating Segments" in der Schweiz gewonnen werden.

  19. Review Essay: Dialogische Introspektion : eine Erweiterung des empirischen Methodenspektrums durch die Wiederentdeckung von Introspektionsverfahren

    OpenAIRE

    Weggen, Jenny

    2012-01-01

    Das Buch "Dialogische Introspektion. Ein gruppengestütztes Verfahren zur Erforschung des Erlebens" beschreibt die Wiederentdeckung und Weiterentwicklung eines weitgehend in Vergessenheit geratenen qualitativen Verfahrens im Methodenspektrum von Psychologie und Sozialwissenschaften. Die Hamburger Forschungswerkstatt um Thomas BURKART, Gerhard KLEINING und Harald WITT greift das Verfahren der Introspektion auf, systematisiert es und entwickelt es unter Bezugnahme auf neue Erkenntnisse der empir...

  20. Eine bisher unbekannte Doline im Bereich des Sattels von Holte bei Osnabrück

    OpenAIRE

    Kieser, Helmuth

    2012-01-01

    Ein bisher nicht bekannt gewordener Erdfall im Gebiet östlich Holte ist auf unterirdische Ablaugung von Gips im Mittleren Muschelkalk zurückzuführen. Er befindet sich da. wo ein stärkeres Abtauchen der Schichten festzustellen ist. was seine Entstehung an dieser Stelle begünstigt haben dürfte.

  1. Der Beginn der Philosophie in Indien: Die Upanischaden, ein Überblick

    OpenAIRE

    Hausknotz, Florentina

    2002-01-01

    Vor welchem Hintergrund entstanden die Upanischaden? · gesellschaftliche, politische Situation Vedische Literatur, ein Überblick. Die Upanischaden; Themen, Hintergründe. · wichtige Denker Wie werden die Upanischaden eingeteilt? Der Hinduismus. · Hinduismus, eine Religion? · Der upanischadische Hinduismus

  2. Untersuchungen zur klinischen Anwendung von niederenergetischem, gepulstem Ultraschall bei der Distraktionsosteogenese : eine prospektiv randomisierte Studie

    OpenAIRE

    Dudda, Marcel

    2008-01-01

    Einleitung: Im Rahmen der vorliegenden Untersuchung zur Wirksamkeit von niederenergetischem, gepulstem Ultraschall bei Distraktionsosteogenesen sollte gezeigt werden, ob sich eine Beschleunigung der Regeneratreifung durch die Behandlung mit Ultraschall erzielen lässt. Methode: Hierzu wurden 40 Patienten in einer prospektiven, randomisierten Studie mit Distraktionskortikotomien >2cm eingeschlossen. Ergebnis: Es konnte eine deutliche Verkürzung der Behandlungszeit in der Untersuc...

  3. Digital Literacy – ein Garant für gesellschaftliche Partizipation?

    Directory of Open Access Journals (Sweden)

    Susanne Krucsay

    2009-09-01

    Full Text Available E-Inclusion ist ein politisches Programm der EU-Kommission – schlag nach bei Lissabon. Digital literacy wiederum wird als ein Teilbereich eben dieses Einschlusses geführt. Zu Recht? Zunächst eine Erklärung der Titelfrage: E-Inclusion ist ein politisches Programm der EU-Kommission – schlag nach bei Lissabon. Digital literacy wiederum wird als ein Teilbereich eben dieses Einschlusses geführt. Zu Recht? Mit dem Zauberwort Literacy werden wir uns in einer der nächsten Ausgaben der MEDIENIMPULSE eingehend beschäftigen, für diesen Beitrag, der im Ressort Medien/Bildung/Politik angesiedelt ist, wollen wir uns ein bisschen umsehen, was sich bildungspolitisch im Bereich Digitale Kompetenz ( nicht ganz deckungsgleiche Wiedergabe, aber dazu siehe oben tut. Die EU-Kommission, die vor einem guten Jahr eine Kommunikation, d.h. offizielle Stellungnahme zur Medienkompetenz (Media Literacy erstellt hat (http://www2.mediamanual.at/themen/kompetenz/61Zacchetti-Media-Literacy-European-approach.pdf ist bei den Kompetenzen mehrfach aktiv. Parallel zum Beratungsgremium (Expert Group für Medienkompetenz gibt es nämlich eine High-Level-Expert Group, die die Kommission in der Frage der Digitalen Kompetenz berät.

  4. Nur noch ein Mausklick trennt die da unten von denen da oben

    OpenAIRE

    Schedler, Kuno; Scharf, Maria Christina

    2000-01-01

    Das Electronic Government ist eine Chance für die Demokratie. Wenn sie erkannt und richtig umgesetzt wird. Der Artikel führt in drei verschiedene Generationen von Homepages ein, definiert drei Elemente des E-Government und zeigt den aktuellen Stand der Diskussion.

  5. Bifurkationsanalyse eines LC Tank VCOs unter Berücksichtigung der variablen Kapazität

    Directory of Open Access Journals (Sweden)

    J.-K. Bremer

    2009-05-01

    Full Text Available In dieser Arbeit präsentieren wir einen neuartigen Ansatz für den systematischen Entwurf von integrierten LC Tank VCO-Schaltungen basierend auf dem Andronov Hopf Theorem und der Störungstheorie. Der Ansatz ermöglicht es, eine Abschätzung des resultierenden Abstimmbereichs, eine Stabilitätsanalyse und eine Berechnung der Amplitude des VCOs im Vorfeld des eigentlichen Entwurfs durchzuführen. Des Weiteren erlaubt die vorgestellte Methode eine Optimierung des VCOs hinsichtlich der in den Spezifikationen geforderte Amplitude und eine Minimierung der höheren Harmonischen. Mit Hilfe eines ladungsbasierten MOS-Modells ist es möglich die spannungsabhängige Kapazität der Varaktortransistoren durch einen analytischen Ausdruck zu beschreiben. Auf Basis dieses analytischen Ausdrucks wird die amplitudenabhängige Großsignalkapazität des VCOs in Abhängigkeit von Designparametern und der Tuningspannung modelliert. Die Gültigkeit der vorgestellte Entwurfsmethode wird anhand eines Beispielentwurfes eines 2.4 GHz VCO unter Verwendung einer 0.25 μm HF-CMOS Technologie verifiziert.

  6. Koidula piiri- ja tollipunkt / Mai Šein, Aulo Padar, Juta Lember...[jt.

    Index Scriptorium Estoniae

    1999-01-01

    asendiplaan, 4 fotot, värv.: välisvaated; peaprojekteerija Eesti Projekt, peahoone: arhitekt M. Šein, sisekujundajad A. Padar, J. L:ember, veoautode tollikontrolli hall, asendiplaan: arhitekt H.-R. Aurik, trafalgoalajaama ja reservjõujaama projekteerisid E. Hirvesoo, M. Järvela, kontrollpaviljonid M. Järvela, vahimaja M. Šein, M. Järvela

  7. Persönliche Publikationslisten als hochschulweiter Dienst – Eine Bestandsaufnahme

    OpenAIRE

    Horstmann, Wolfram; Jahn, Najko

    2010-01-01

    Die persönliche Publikationsliste im Internet ist eine wichtige wissenschaftliche Informationsquelle. Anhand einer Bestandsaufnahme wird der Frage nachgegangen, welche Unterstützungsleistungen Hochschulen und Bibliotheken ihren Forschenden anbieten können. Daraufhin werden strukturelle und funktionale Anforderungen entwickelt. Abschließend wird auf Instrumente für die Erreichung eines hochschulweiten Dienstes hingewiesen.

  8. On Maximal Injectivity

    Institute of Scientific and Technical Information of China (English)

    Ming Yi WANG; Guo ZHAO

    2005-01-01

    A right R-module E over a ring R is said to be maximally injective in case for any maximal right ideal m of R, every R-homomorphism f : m → E can be extended to an R-homomorphism f' : R → E. In this paper, we first construct an example to show that maximal injectivity is a proper generalization of injectivity. Then we prove that any right R-module over a left perfect ring R is maximally injective if and only if it is injective. We also give a partial affirmative answer to Faith's conjecture by further investigating the property of maximally injective rings. Finally, we get an approximation to Faith's conjecture, which asserts that every injective right R-module over any left perfect right self-injective ring R is the injective hull of a projective submodule.

  9. Krebstiere (Crustacea) – Biologie, Vorkommen, Haltung und Erkrankungen, sowie ihre Bedeutung als Zootierobjekte und Lebensmittelressourcen : eine Literaturstudie

    OpenAIRE

    Walther, Marc

    2008-01-01

    Crustaceen stellen nicht nur eine biologisch interessante Tiergruppe dar, sondern erlangen aufgrund ihrer Haltung in Zoos und durch ihre Nutzung als wichtige Lebensmittelquelle ein immer größer werdendes Interesse. Gerade in den letzen Jahren gab es eine enorme Informationsflut über Erkrankungen bei Crustaceen. Dies wurde als Anlass genommen, das heutige Wissen in einer Abhandlung zusammenzufassen. Die Literaturstudie wird durch eine systematische zoologische und lebensmitterel...

  10. Die südafrikanische Wahrheits- und Versöhnungskommission : eine exemplarische Studie zum Umgang mit Unrechtssystemen

    OpenAIRE

    Audretsch, Andreas

    2008-01-01

    Die Apartheid in Südafrika war ein Unrechtssystem. Zu den Grausamkeiten des Regimes zählten Massaker, Folter, Mord, Freiheitsberaubung, Zwangsumsiedlung, ökonomische Benachteiligung und alltägliche Diskriminierung. Was nach dem Ende eines solchen Unrechtssystems bleibt, ist die Frage nach dem Umgang mit der Vergangenheit. Die drei grundlegenden Möglichkeiten der Vergangenheitsbewältigung sind die rein justiziare Aufarbeitung, eine Generalamnestie oder ein drittes Modell, das zum Ziel hat, die...

  11. Wie professionell sind Schweizer Audit Committees? Eine Studie zeigt, dass nur in jedem zweiten Audit Committee von Verwaltungsräten ein Finanzexperte sitzt

    OpenAIRE

    Leibfried, Peter; Roffler, Mario

    2008-01-01

    Die Mitglieder des Audit Committee eines Verwaltungsrats (VR) müssen Jahresrechnungen lesen und verstehen und mit dem Chief Financial Officer auf gleicher Augenhöhe diskutieren können. Eine Untersuchung der Universität St. Gallen unter kotierten Unternehmen hat indes gezeigt, dass diese Voraussetzung bei weitem nicht in allen Schweizer Gesellschaften erfüllt ist. Die Autoren werfen die Frage auf, ob der VR seine Kontrollfunktion so überhaupt angemessen wahrnehmen kann.

  12. Ist der Ablauf der Lock-up-Frist bei Neuemissionen ein kursrelevantes Ereignis? : Eine empirische Analyse von Unternehmen des Neuen Marktes

    OpenAIRE

    Nowak, Eric; Gropp, Alexandra

    2000-01-01

    Ja, der Ablauf der Lock-up-Frist ist ein kursrelevantes Ereignis. Wir untersuchen Kursreaktionen auf das Ende der Lock-up-Frist bei 142 Unternehmen des Neuen Marktes. Da der Ablauf der Sperrfrist bereits zum Zeitpunkt des Börsengangs bekannt ist, erwarten wir bei einem (semi-)informationseffizienten Kapitalmarkt durchschnittlich keine Kursreaktion. Im Rahmen einer Ereignisstudie zeigen wir aber, dass sich am Ende der Sperrfrist signifikant negative Überrenditen ergeben. Durch eine differenzie...

  13. Design und Implementierung von Formfokussierungsaufgaben im interaktiven inhalts- und bedeutungsorientierten DaFT1 - Unterricht. Eine Fallstudie im Rahmen eines Aktionsforschungsprojekts

    Directory of Open Access Journals (Sweden)

    Gloria Bosch-Roig

    2015-11-01

    Full Text Available Die folgende Fallstudie ist das Resultat eines Aktionsforschungsprojekts, das mit Deutschstudenten im letzten Jahr des Tourismusstudiums an der Universität der Balearen durchgeführt wurde. Die Studie geht der Frage nach, wie Formfokussierungsaufgaben im interaktiven inhalts- und bedeutungsorientierten Deutschunterricht eingesetzt und implementiert werden können, damit eine qualitativ bessere bzw. sprachlich korrektere und komplexere Lernerproduktion erreicht werden kann.

  14. Auswirkungen eines verringerten Haushaltsbudgets auf den Lebensmittelkonsum : eine empirische Untersuchung zu den finanziell bedingten Veränderungen am Lebensmitteleinkauf und beim Ernährungsverhalten

    OpenAIRE

    Yildiz, Juliane

    2014-01-01

    Problemstellung und Zielsetzung In Deutschland lässt sich beim Ernährungs- und Gesundheitsverhalten ein sozialer Gradient feststellen. Personen mit niedrigem Einkommen weisen dabei durchschnittlich ein unausgewogeneres Essverhalten auf als Personen mit höherem Einkommen. Ziel der Arbeit ist es, die Auswirkungen einer Budgetverringerung auf den Lebensmittelkonsum und das Essverhalten dynamisch zu betrachten und daraus handhabbare Interventionsstrategien abzuleiten. Methodische Vorge...

  15. Integration eines durchstimmbaren Femtosekundenlasersystems in eine Laser-Sekundärneutralteilchen-Massenspektrometrie-Apparatur zur Nachionisierung von zerstäubten Atomen und Molekülen

    OpenAIRE

    Sohn, S. (Sascha)

    2012-01-01

    Im Rahmen dieser Arbeit wurde ein bis in den UV-Bereich durchstimmbares Hochleistungsfemtosekundenlasersystem in eine Laser-Sekundärneutralteilchen-Massenspektrometrie-Apparatur (Laser-SNMS) integriert. Die sich dadurch ergebenden Möglichkeiten der Nachionisierung der durch Ionenbeschuss von der Probenoberfläche zerstäubten Teilchen wurden durch Anpassung von Wellenlänge, Leistungsdichte und zeitlichem Abstand von Ionen- und Laserpuls optimiert, so dass sowohl atomare als auch molekulare Prob...

  16. Lightweight construction, a historical challenge; Leichtbau - eine historische Herausforderung

    Energy Technology Data Exchange (ETDEWEB)

    Eigenfeld, K. [Technische Univ. Bergakademie Freiberg (Germany). Giesserei-Inst.

    2000-07-01

    The paper presents a historical outline of the development of mobility, motor cars, and lightweight construction in an integrated approach. [German] Die Entwicklung technischer Prozesse und Produkte nahm mit Beginn der industriellen Revolution einen vorher nicht gekannten Aufschwung. Mit den daraus resultierenden Veraenderungen in den Lebensgewohnheiten der Menschen hat sich, abgesehen von den elementaren Grundbeduerfnissen, die Notwendigkeit und das Beduerfnis nach Mobilitaet sukzessive herangebildet. Mobilitaet heisst nach der Definition in der damaligen Technik Bewegung durch Maschinen, und Maschinen bestehen aus Werkstoffen. Schon fruehzeitig war bekannt, dass bewegte Werkstoffe wenig Masse besitzen sollen. Die Entwicklung des Leichtbaues laesst sich demzufolge am Fortschritt des Verkehrswesens ablesen und dokumentieren. Dabei spielte, wenn auch nicht aus den gleichen Gruenden wie heute, die Verfuegbarkeit, der Energieeinsatz und die Wiederverwendbarkeit, das 'Recycling', eine wichtige Rolle. Der konstruktive und werkstoffbestimmte Leichtbau laesst sich danach in seiner Entstehung auch als Leitfaden fuer heutige Tendenzen betrachten und vieles, was wir derzeit an Entwicklungsrichtungen diskutieren, hat seine Urspruenge im Beginn des motorisierten Verkehrswesens. Ein Blick in die Historie kann jedoch nie schaden, wenn es darum geht, zukuenftige Aufgaben zu bewaeltigen. (orig.)

  17. Fotografiegeschichte greifbar machen – Ein Modell transmedialer Vermittlung

    Directory of Open Access Journals (Sweden)

    Mandy Gnägi

    2013-05-01

    Full Text Available Mit dem Modell transmedialer Vermittlung wird ein Unterrichtskonzept vorgestellt, das auf mehrsemestrigen Erfahrungen an verschiedenen Fachhochschulen der Schweiz beruht. Die methodische und pädagogische Versiertheit der Dozierenden einerseits und die unterschiedlichen Kompetenzen der Studierenden andererseits nutzend, führt das Modell aus einem vermeintlichen Chaos der heutigen Bilderflut heraus und schafft gemeinsam mit den Studierenden eine geordnete Übersicht für die Vermittlung von Fotografiegeschichte. In dem Modell kommen sowohl neue Medien zum Tragen, mit denen die Studierenden als mehrheitlich «digital natives» unterrichtsspezifische Inhalte in interne und externe Blogs, Bild- und Filmdatenbanken, Diskussionsforen, u. a. m., übertragen, als dass dies auch explizit mit der Arbeit an einer Zeitleiste verknüpft wird. Die Studierenden bringen darauf in regelmässigen, diskursiv und reflexiv aufgebauten Unterrichtseinheiten gedruckte Bilder und auf Notizzettel notierte Schlagworte zur Geschichte und Theorie der Fotografie sowie der allgemeinen Kulturgeschichte an. Durch diese transmedial angelegte Vermittlung sind Studierende Lehrende und Lernende gleichermassen und bilden auf dieser Grundlage ihre visuelle Kompetenz aus, machen Zusammenhänge sowie Beziehungen sichtbar und Fotografiegeschichte greifbar.

  18. Bildungstheoretische Kriterien der Lehrplananalyse - Ein Diskussionsangebot an die Politikdidaktik

    Directory of Open Access Journals (Sweden)

    Hennig J. Schluss

    2002-07-01

    Full Text Available Das Verhältnis von Didaktik der Politischen Bildung und Allgemeiner Pädagogik ist immer stärker von der weitergehenden Ausdifferenzierung der pädagogischen Disziplinen gezeichnet. Dies führte zu einer Entfernung der Disziplinen, die bis hin zur Kommunikationslosigkeit reicht. Anliegen dieses Beitrages ist es, anhand eines bestimmten Themas, der Lehrplananalyse, dieser Sprachlosigkeit ein Gesprächsangebot entgegenzusetzen. In einer von der DFG geförderten Forschergruppe zur Untersuchung der Übergangsphasen zu Beginn der SBZ/DDR und nach der Gründung der neuen Länder entwickelte das Projekt "Bildungstheorie und Unterricht" neun Kriterien zur Unterscheidung von affirmativen und reflektierenden Lernzielnormierungen. Diese Kriterien werden vorgestellt und auf ihre mögliche Bedeutung für die Politische Bildung hin ausgelegt und erläutert. Dabei greift der Autor u.a. auf Erfahrungen zurück, die er mit der Analyse der thüringischen Lehrplanentwicklung im Fach "Sozialkunde" gemacht hat. Zugleich sollen Anschlussmöglichkeiten an Überlegungen der Politikdidaktik zumindest kursorisch aufgezeigt werden. Als Voraussetzung dafür wird der verwendete Transformationsbegriff vorgestellt. Über das Aufzeigen von Relevanzbildungskriterien und erziehungstheoretischen Kriterien für die Lehrplananalyse soll das Gespräch zwischen den Disziplinen neu belebt werden.

  19. Energy from biomass. Teaching material; Energie aus Biomasse. Ein Lehrmaterial

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-04-01

    The textbook discusses the available options for power and heat generation from biomass as well as the limits of biomass-based power supply. The main obstacle apart from the high cost is a lack of knowledge, which the book intends to remedy. It addresses students of agriculture, forestry, environmental engineering, heating systems engineering and apprentice chimney sweepers, but it will also be useful to all other interested readers. [German] Biomasse kann aufgrund seiner vielfaeltigen Erscheinungs- und Umwandlungsformen sowohl als Brennstoff zur Waerme- und Stromgewinnung oder als Treibstoff eingesetzt werden. Die energetische Nutzung von Biomasse birgt zudem nicht zu verachtende Vorteile. Zum einen wegen des Beitrags zum Klimaschutz aufgrund der CO{sub 2}-Neutralitaet oder einfach, weil Biomasse immer wieder nachwaechst und von fossilen Ressourcen unabhaengig macht. All den bisher erschlossenen Moeglichkeiten der energetischen Nutzung von Biomasse moechte dieses Lehrbuch Rechnung tragen. Es zeigt aber auch die Grenzen auf, die mit der Energieversorgung durch Bioenergie einhergehen. Hohe Kosten und ein erhebliches Informationsdefizit behinderten bisher eine verstaerkte Nutzung dieses Energietraeges. Letzterem soll dieses Lehrbuch entgegenwirken. Das vorliegende Lehrbuch wurde fuer die Aus- und Weiterbildung erstellt. Es richtet sich vor allem an angehende Land- und Forstwirte, Umwelttechniker, Heizungsbauer und Schornsteinfeger, ist aber auch fuer all diejenigen interessant, die das Thema ''Energie aus Biomasse'' verstehen und ueberblicken moechten. (orig.)

  20. Ist der chronische nicht malignombedingte Beckenschmerz beim Mann eine neuro-urologische Erkrankung?

    Directory of Open Access Journals (Sweden)

    Zermann D-H

    1999-01-01

    Full Text Available Zielsetzung: Der im Genitalbereich und unteren Harntrakt lokalisierte Schmerz ist ein häufiges Symptom in der urologischen Praxis. Unbefriedigende Therapieansätze und langjährige ungenügende Behandlungserfolge für den Patienten charakterisieren diese Problematik. Die folgende Arbeit umfaßt eine Analyse klinischer und urodynamischer Befunde bei Patienten mit chronischen Beckenschmerzen, um die Arbeitshypothese eines Zusammenhanges zwischen Beckenschmerzen und funktionellen Störungen des unteren Harntraktes zu belegen oder auszuschließen. Material und Methode: Eine retrospektive Auswertung von Anamnese, klinischer und urodynamischer Untersuchung wurde bei 103 Männern (durchschnittliches Alter 47, von 23 bis 89 Jahren mit Beckenbeschwerden von 8/1994 bis 8/1997 durchgeführt. Alle in die Untersuchung eingeschlossenen Patienten hatten mehrere verschiedene konservative Therapieansätze ohne Erfolg hinter sich. Ergebnisse: Die Hauptlokalisationen des Schmerzes waren: Prostata/Perineum 45,6 %, Scrotum/Hoden 38,8 %, Penis 5,8 %, Harnblase 5,8 %, Unterbauch 1,9 %, Rücken 1,9 %. Eine deutliche Beckenbodendysfunktion war bei 88,3 % der Patienten reproduzierbar nachweisbar. Bei 84 Patienten wurde eine urodynamische Untersuchung durchgeführt. Hauptbefunde waren: 1 eine Zunahme des Sphinktertonus, 2 eine Reduktion des maximalen Harnflusses, 3 eine Verlängerung der funktionellen Urethralänge. Diskussion: Der Zusammenhang zwischen Beckenbodendysfunktion und Beckenschmerz ist offensichtlich. Was hierbei Ursache oder Folge ist und inwieweit diese Störungen auf einer primären oder sekundären Funktionsstörung des ZNS beruhen, kann derzeit nicht abschließend bewertet werden. Allerdings belegen Erfolge therapeutischer Maßnahmen, die am Beckenboden angreifen (Biofeedback, Alpha-Blockade, sakrale Neuromodulation die Hypothese eines Zusammenhanges zwischen Funktionsstörung und Beckenschmerzen.

  1. Charging transient in polyvinyl formal

    Indian Academy of Sciences (India)

    P K Khare; P L Jain; R K Pandey

    2001-08-01

    In the present paper charging and discharging transient currents in polyvinyl formal (PVF) were measured as a function of temperatures (40–80°C), poling fields (9.0 × 103–9.0 × 104 V/cm) and electrode combinations (Al–Al, Au–Al, Zn–Al, Bi–Al, Cu–Al and Ag–Al). The current–time characteristics have different values of slope lying between 0.42–0.56 and 1.42–1.63. The polarization is considered to be due to dipolar reorientation associated with structural motions and space charge relaxations due to trapping of injected charge carriers in energetically distributed traps.

  2. RimabotulinumtoxinB Injection

    Science.gov (United States)

    (rim a bott' you lye num bee)RimabotulinumtoxinB injection may spread from the area of injection and ... Event Reporting program online (http://www.fda.gov/Safety/MedWatch) or by phone (1-800-332-1088).

  3. Iron Sucrose Injection

    Science.gov (United States)

    Iron sucrose injection is used treat iron-deficiency anemia (a lower than normal number of red blood cells due ... may cause the kidneys to stop working). Iron sucrose injection is in a class of medications called ...

  4. Urinary incontinence - injectable implant

    Science.gov (United States)

    Injectable implants are injections of material into the urethra to help control urine leakage ( urinary incontinence ) caused by a ... into the tissue next to the sphincter. The implant procedure is usually done in the hospital. Or ...

  5. Corticotropin, Repository Injection

    Science.gov (United States)

    ... hard, or sensitive, or that has tattoos, warts, scars, or birthmarks. Do not inject the medication into ... you are injecting the medication. You can help decrease your child's pain by placing an ice cube ...

  6. Fingerübungen in Digitalien: Erfahrungsbericht eines teilnehmenden Beobachters der Digital Humanities aus Anlass eines Lehrexperiments

    Directory of Open Access Journals (Sweden)

    Hanno Ehrlicher

    2016-06-01

    Full Text Available Das neue interdisziplinäre Methodenfeld der Digital Humanities (DH hat bisher jenseits spezifischer DH-Studiengänge noch kaum Eingang in die Lehre gefunden. Der Essay beschreibt den Versuch, innerhalb der Romanistik im Rahmen einer curricularen Vorlesung eine praxis- und anwendungsnahe Einführung in die Digital Humanities zu vermitteln und will die dabei gewonnenen Erfahrungen mit allgemeineren Reflexionen über den Stand der DH zu verknüpfen. Den Verächtern der DH wird die These entgegengesetzt, dass dieser Bereich die Chance zu fruchtbaren neuen methodologischen Debatten und entsprechenden Innovationen bietet, den Anhängern, dass man zur erfolgreichen Verankerung der DH in der universitären Lehre es mit dem Bemühen um ‚harte‘ normierte Standards im Umgang mit den Daten auch nicht übertreiben sollte und Querköpfe wie Franco Moretti für eine breite interdisziplinäre Akzeptanz der Methoden unverzichtbar sind.

  7. Evaluation eines psychosomatischen Behandlungskonzepts bei opiatabhängigen Schwangeren

    Directory of Open Access Journals (Sweden)

    Härtl K

    2001-01-01

    Full Text Available Heroinkonsum während der Schwangerschaft erhöht die Wahrscheinlichkeit spontaner Aborte, vorzeitiger Wehen, intrauteriner Asphyxie, niedrigen Geburtsgewichts und neonataler Entzugssymptome. Abrupte Entzüge von Heroin gehen mit einer erhöhten kindlichen Mortalitätsrate einher. Substitution mit Levomethadon gilt als eine sinnvolle Behandlungsmöglichkeit bei opiatabhängigen Schwangeren. Untersucht wird die Effizienz eines psychosomatischen Behandlungskonzepts bei opiatabhängigen Schwangeren hinsichtlich medizinischer und psychosozialer Parameter der substituierten Frauen und deren Neugeborenen. Die Stichprobe besteht aus 100 opiatabhängigen Schwangeren, die zwischen 1990 und 2000 an der I. Universitätsfrauenklinik in München am psychosomatischen Behandlungskonzept, das aus Substitutionstherapie und psychotherapeutischer Begleitung besteht, teilnahmen. Dargestellt werden demographische und psychosoziale Parameter der substituierten Frauen, Schwangerschaftskomplikationen, Geburtsparameter und kindliche Daten. Die Daten zeigen eine psychosozial belastete Stichprobe mit einer seit durchschnittlich acht Jahren bestehenden Opiatabhängigkeit, häufiger Polytoxikomanie und mit einer späten Realisierung der Schwangerschaft nach durchschnittlich 16 Schwangerschaftswochen. Dennoch war in unserem Kollektiv die Häufigkeit von Schwangerschaftskomplikationen relativ gering, mit Ausnahme des erhöhten Risikos für vorzeitige Wehen (19 %. Das Gestationsalter lag mit durchschnittlich 38,8 Schwangerschaftswochen im Normbereich. Das Frühgeburtsrisiko war mit 14 % leicht erhöht, es kam jedoch zu keiner Totgeburt. Die Sectiorate und Rate an vaginal-operativen Entbindungen waren nicht erhöht. Die kindlichen Werte unserer Stichprobe zeigen bzgl. Kopfumfang, Apgar-Scores und pH-Werte normale Werte. Die Kinder wurden mit einem durchschnittlichen Geburtsgewicht von 2863 g geboren. 74% der Neugeborenen hatten Entzugserscheinungen, die durchschnittlich nach 39

  8. A Logic of Injectivity

    CERN Document Server

    Adamek, J; Souza, L

    2007-01-01

    Injectivity of objects with respect to a set $\\ch$ of morphisms is an important concept of algebra, model theory and homotopy theory. Here we study the logic of injectivity consequences of $\\ch$, by which we understand morphisms $h$ such that injectivity with respect to $\\ch$ implies injectivity with respect to $h$. We formulate three simple deduction rules for the injectivity logic and for its finitary version where \\mor s between finitely ranked objects are considered only, and prove that they are sound in all categories, and complete in all "reasonable" categories.

  9. Aktuelles in der Reproduktionsmedizin. Eine gemeinsame Publikation der Deutschen Gesellschaft für Gynäkologische Endokrinologie und Fortpflanzungsmedizin (DGGEF e.V.

    Directory of Open Access Journals (Sweden)

    Ludwig M

    2008-01-01

    Full Text Available Die Idee dieses Manuskriptes war eine kurze, knappe, übersichtliche Darstellung einer Reihe relevanter Punkte, die aktuell gefragt sind. Für jeden, der sich interessiert, sei es ein Laie, ein ärztlicher Kollege oder ein Journalist. Insofern erhebt das Manuskript nicht den Anspruch auf einen aktuellen Review der gesamten Reproduktionsmedizin.

  10. CFD Investigation into Diesel PCCI Combustion with Optimized Fuel Injection

    Directory of Open Access Journals (Sweden)

    Lipeng Lu

    2011-03-01

    Full Text Available A multi-pulse injection strategy for premixed charge compression ignition (PCCI combustion was investigated in a four-valve, direct-injection diesel engine by a computational fluid dynamics (CFD simulation using KIVA-3V code coupled with detailed chemistry. The effects of fuel splitting proportion, injection timing, spray angles, and injection velocity were examined. The mixing process and formation of soot and nitrogen oxide (NOx emissions were investigated as the focus of the research. The results show that the fuel splitting proportion and the injection timing impacted the combustion and emissions significantly due to the considerable changes of the mixing process and fuel distribution in the cylinder. While the spray, inclusion angle and injection velocity at the injector exit, can be adjusted to improve mixing, combustion and emissions, appropriate injection timing and fuel splitting proportion must be jointly considered for optimum combustion performance.

  11. Unterrichtsentwurf: „Paneuropa“ – eine utopische Europaidee?

    Directory of Open Access Journals (Sweden)

    Annika Jücker

    2014-12-01

    Full Text Available Within the context of the internal series Europaideen im 20. Jahrhundert, Annika Jücker thematised Richard N. Coudenhove-Kalergi’s pan-European concept for her lesson plan “Paneuropa“ – eine utopische Europaidee? The plan provides insight into an early 20th century European idea, as well as an interesting lesson approach to the historical development of Europe. Utilising diverse types of sources (caricature, speech, quote, the students of an advanced level course will be familiarised with the beginnings and problems of European unification. The plan is set out to develop a critical understanding of the nowadays taken-for-granted EU and to raise awareness of a possible European cultural consciousness.

  12. Gewalt und Geschlecht – neue Einsichten in ein altes Thema

    Directory of Open Access Journals (Sweden)

    Heike Raab

    2008-11-01

    Full Text Available Ausgehend von der Multidimensionalität von gewalttätigen Beziehungsdynamiken untersucht Constance Ohms in ihrer Monographie häusliche Gewalt in Intimbeziehungen zwischen Frauen. Hierbei wird Gewalt nicht nur als unmittelbarer Ausdruck körperlicher An- und Übergriffe begriffen. Mit Hilfe qualitativer Interviews erstellt die Autorin eine Klassifikation von gewalttätigen Beziehungsdynamiken. Im Mittelpunkt der Analyse steht die weibliche Gewalttäterin. Die Ergebnisse verdeutlichen, dass gesellschaftliche, subkulturelle und individuelle Einflussfaktoren und deren Wechselwirkung in Gewaltverhalten einfließen. Provokative Einsichten liefert Ohms Studie in zweierlei Hinsicht: zum einen wird die feministische Debatte um häusliche Gewalt, die Gewalttätigkeit mit Männlichkeit gleichsetzt, kritisiert, zum anderen wird gezeigt, dass das gängige Liebes-Ideal lesbischer Beziehungen in der Lesbenbewegung, das Thema Gewalt tabuisiert.

  13. Bibliothekarische Berufsethik in der Praxis – Ergebnisse eines Studienprojekts aus Deutschland und Großbritannien

    Directory of Open Access Journals (Sweden)

    Jens Boye

    2011-10-01

    Full Text Available Sowohl in Deutschland als auch in Großbritannien existieren seit einigen Jahren Grundsatzpapiere zur Berufsethik im Informations- und Bibliotheksbereich. Neben der bloßen Existenz derartiger Kodizes stellt sich die Frage, welche Relevanz diese Dokumente in der beruflichen Praxis haben. Dieser Frage wurde im Rahmen einer Team-Projektarbeit an der FH Köln nachgegangen. Mithilfe eines standardisierten Fragebogens wurden deutsche Bibliotheksleitungen zu der Thematik befragt. In Großbritannien wurde ein Interview mit Paul Sturges geführt, darüber hinaus erfolgte eine Analyse der Online-Angebote von CILIP, insbesondere des Information Ethics Blog.

  14. Werkzeuge zur automatischen Optimierung erweiterter Entity-Relationship Modelle und deren Abbildung in ein relationales Datenbankschema

    OpenAIRE

    Schneider, Monika

    2003-01-01

    Das Entity-Relationship Modell (kurz ER-Modell) ist eine weit verbreitete Methode zur graphischen Beschreibung von Datenbankschemata. Seine Anwendung ist auch für Laien auf dem Gebiet der Datenmodellierung leicht zu verstehen. Deshalb werden graphische Editoren entwickelt, die dem Benutzer die Erstellung von Datenbankschemata in Form von ER-Modellen ermöglichen. In der Regel ist so eine Modellierung natürlich kein Selbstzweck. Das Schema soll in eine Datenbank übertragen und benutzt werden. I...

  15. Über ein modifiziertes Verfahren zur Trennung von Sehfarbstoffisomeren durch HPLC

    OpenAIRE

    Becker, Christian Theodor

    2006-01-01

    Die enzymatische Umwandlung von all-trans in 11-cis Retinol im Rahmen des Sehzyklus ist Gegenstand intensiver Forschungsarbeit. Um ein modifiziertes Nachweisverfahren der Sehfarbstoffe mittels HPLC zu etablieren, ersetzten wir das als HPLC-Lösungsmittel gängige n-Hexan durch n-Heptan aufgrund der Tatsache, das eine frühere Arbeit der Forschungsgruppe Hinweise auf eine deutlich bessere Trennqualität erbrachte und führten hierzu Untersuchungen an den in-vitro entstehenden Isomeren des Retinals,...

  16. Die psychosoziale Anpassung an Querschnittslähmung: Eine empirische Untersuchung

    OpenAIRE

    Brodbeck, Daniela

    2010-01-01

    Untersuchung der psychosozialen Anpassung bei hoher Querschnittslähmung: Soziale Unterstzützung und Unabhängigkeit spielen als Bewältigungsstrategie eine wichtige Rolle. Weniger Suche nach Information sowie eine häufige Anwendung der Strategie Unabhängigkeit sagen am besten eine niedrige Depressivität der Patienten voraus. Der Grad der körperlichen Beeinträchtigung ist nicht prädiktiv und zur Varianzaaufklärung nicht beitragend. Bei der Vorhersage individueller Lebensqualität zeigte sich d...

  17. Der "FACES-Index" - Ein computergesteuertes Messverfahren zur Erfassung der emotionalen Sensitivität.

    OpenAIRE

    Zumkley-Münkel, Cordula; Grässer, Uwe; Maxeiner, Jürgen; Zumkley, Horst; Dreher, Eva

    2003-01-01

    HINWEIS: Zur Printversion dieses Dokumentes existiert eine CD-Rom Beilage. Diese ist über den OPAC der Saarländischen Universitäts- und Landesbibliothek (http://opac.sulb.uni-saarland.de) mit der Signatur MV 1128 erhältlich. Kurzfassung: Nachfolgend wird über die Entwicklung und Erprobung eines computergesteuerten Messverfahrens zur Bestimmung der "emotionalen Sensitivität" berichtet. Ausgangspunkt für die Verfahrensentwicklung war eine Studie von Martin et al. (1996) zum Thema individ...

  18. CHARGE Association

    Directory of Open Access Journals (Sweden)

    Semanti Chakraborty

    2012-01-01

    Full Text Available We present here a case of 17-year-old boy from Kolkata presenting with obesity, bilateral gynecomastia, mental retardation, and hypogonadotrophic hypogonadism. The patient weighed 70 kg and was of 153 cm height. Facial asymmetry (unilateral facial palsy, gynecomastia, decreased pubic and axillary hair, small penis, decreased right testicular volume, non-palpable left testis, and right-sided congenital inguinal hernia was present. The patient also had disc coloboma, convergent squint, microcornea, microphthalmia, pseudohypertelorism, low set ears, short neck, and choanalatresia. He had h/o VSD repaired with patch. Laboratory examination revealed haemoglobin 9.9 mg/dl, urea 24 mg/dl, creatinine 0.68 mg/dl. IGF1 77.80 ng/ml (decreased for age, GH <0.05 ng/ml, testosterone 0.25 ng/ml, FSH-0.95 ΅IU/ml, LH 0.60 ΅IU/ml. ACTH, 8:00 A.M cortisol, FT3, FT4, TSH, estradiol, DHEA-S, lipid profile, and LFT was within normal limits. Prolactin was elevated at 38.50 ng/ml. The patient′s karyotype was 46XY. Echocardiography revealed ventricularseptal defect closed with patch, grade 1 aortic regurgitation, and ejection fraction 67%. Ultrasound testis showed small right testis within scrotal sac and undescended left testis within left inguinal canal. CT scan paranasal sinuses revealed choanalatresia and deviation of nasal septum to the right. Sonomammography revealed bilateral proliferation of fibroglandular elements predominantly in subareoalar region of breasts. MRI of brain and pituitary region revealed markedly atrophic pituitary gland parenchyma with preserved infundibulum and hypothalamus and widened suprasellar cistern. The CHARGE association is an increasingly recognized non-random pattern of congenital anomalies comprising of coloboma, heart defect, choanal atresia, retarded growth and development, genital hypoplasia, ear abnormalities, and/or deafness. [1] These anomalies have a higher probability of occurring together. In this report, we have

  19. Der menschliche Alltag - ein unverzichtbarer Bestandteil eines wissenschaftlichen Menschenbildes [Everyday life - a vital component of every scientific model of man

    Directory of Open Access Journals (Sweden)

    Schmid-Tannwald, Ingolf

    2008-02-01

    Full Text Available [english] The inadequacy of the current model of reproduction in mammals and vertebrates and the "need for a new model of man" becomes evident as soon as the relations and interactions of heterosexual partners within their living conditions are concerned. In contrast to animals hu-mans constitute an everyday life by interpersonal (social actions. Here at first the biological processes are triggered bringing humans as unique interpersonal and biological realites into existence at the moment of fertilisation. This twofold reality may be integrated into a more comprehensive scientific model of man by means of general system theory and semiotics rep-resenting human life as a flow of signs through various sign systems.[german] Jeder Mensch ist das Ergebnis eines zwischenmenschlichen Handelns in der menschlichen Sozialwelt der dort in Gang gesetzten biologischen Prozesse. Letztere sind für den Menschen und andere Säuge- und Wirbeltieren prinzipiell gleicher maßen gültig und im gängigen naturwissenschaftlichen Fortpflanzungsmodell beschrieben. Aber das naturwissenschaftliche Modell kann dieses gewissermaßen zweifache Werden des Menschen nicht angemessen repräsentieren. Dies wäre nur dann der Fall, wenn die menschlichen Beziehungen in der Sozialwelt identisch oder zumindest sehr ähnlich wären, wie die Lebensumstände der nichtmenschlichen Säuge- und Wirbeltiere, in denen sie ihre Nachkommen hervorbringen. Dann würde sich der Unterschied zwischen dem Werden des Menschen und jenem der anderen Säuge- und Wirbeltiere auf die biologischen Fakten beschränken und diese wären mit dem Fortpflanzungsmodell hinreichend beschrieben. Die Voraussetzung gleicher Lebenswelten bei Mensch und Tier trifft aber nicht zu. Deshalb stellt das Fortpflanzungsmodell eine Verfremdung des Phänomens „Mensch“ dar, noch dazu eine folgenschwere, vor allem am Lebensanfang, da Modelle als Bilder unser Handeln im Alltag leiten, vor allem, wenn sie

  20. Increasing energy efficiency of a gasoline direct injection engine through optimal synchronization of single or double injection strategies

    International Nuclear Information System (INIS)

    Highlights: ► Advantages of split injection in a GDI engine are studied through numerical simulation. ► At high load and speed, rich conditions, split injection does not improve engine performance. ► At moderate load and speed, lean conditions, double injection improves charge stratification. ► Optimal double injection increases work, reduces HC and increases NO. - Abstract: The greatest fuel efficiency advantages of gasoline direct injection (GDI) engines are achieved under the so-called mixed mode boosting, where mixture characteristics are properly adapted to the specific working condition. In particular, in the medium range of load and speed, overall lean mixtures are suitable of being used in the so-called direct injection stratified charge operation. Present paper reports the results of numerical optimization analyses aimed at increasing the energetic efficiency of a GDI engine equipped with a high pressure multi-hole injector under both single and double injection events. In moderate-load moderate-speed lean conditions, the single or double injection synchronization in the working cycle is effected through a procedure that couples a 3D numerical model of the in-cylinder processes with an optimization tool. The choice of both the start of the injection events and the time of spark advance is realized to maximize the engine work. The optimal double injection solution is shown to increase the engine energy efficiency with respect to the case injection is realized in one shot, thus confirming that split injections improve the quality of the charge stratification under lean operation. The effect on the major pollutants is also discussed.

  1. Entwicklung einer Methodik zur monetären Bewertung von Schadensereignissen - Vorstellung einer Methodik zur Bewertung der finanziellen Auswirkungen verursacht durch eine Explosion.

    OpenAIRE

    Kustosz, Anja

    2014-01-01

    Eine Explosion ist ein seltenes Ereignis, welches sich im Lebenszyklus eines Unternehmens im besten Fall niemals oder im schlechtesten Fall nur einmal ereignet. Die Auswirkung dieses Ereignisses hat - in Abhängigkeit von der Schwere der Explosion - erhebliche finanzielle Auswirkungen auf das betroffene Unternehmen. Die Explosion kann daher zu den strategischen Risiken eines Unternehmens gezählt werden, da in den meisten Fällen nicht nur ein Unternehmensbereich betroffen ist, sonde...

  2. Epidural injections for back pain

    Science.gov (United States)

    ESI; Spinal injection for back pain; Back pain injection; Steroid injection - epidural; Steroid injection - back ... pillow under your stomach. If this position causes pain, you either sit up or lie on your ...

  3. Ein effizientes Message-Passing-Interface (MPI) für HiPPI

    OpenAIRE

    Beisel, Thomas

    1996-01-01

    In dieser Programmbeschreibung wird auf den internen Aufbau von MPI eingegangen und begründet, warum eine Erweiterung der Funktionalitäten erforderlich ist. Der Lösungsansatzes zur Erweiterung von MPI wird vorgestellt.

  4. Imaging and therapy of a chondroblastoma; Bildgebung und Therapie eines Chondroblastoms

    Energy Technology Data Exchange (ETDEWEB)

    Nickel, J.; Meyer, D.R.; Geufke, P.; Andresen, R. [Krankenhaus Guestrow, Akademisches Lehrkrankenhaus der Universitaet Rostock (Germany)

    2002-07-01

    ] Das Chondroblastom ist eine seltene lytische ossaere Laesion, welche typischerweise in den Epiphysen der langen Roehrenknochen zu finden ist. Wir praesentieren die differentialdiagnostische Bildgebung und die opterative Therapie kasuistisch an einem Chondroblastom der proximalen Tibiaepiphyse. In der traumatologischen Ambulanz stellte sich ein 16 jaehriger Patient mit unklarem, seit Monaten zunehmenden Kniegelenksschmerz vor. Ein akutes Trauma war nicht erinnerlich. Zur weiteren Abklaerung erfolgte eine konventionelle Roentgenaufnahme in zwei Ebenen, ein Duennschicht CT, ein multiplanares MRT vor und nach Gd-DTPA und eine 3-Phasen-Skelettszintigrafie. Die konventionelle Roentgendiagnostik zeigt eine glattbegrenzte, osteolytische, exzentrische Laesion mit Randsklerosierung, welche die Epiphysenfuge der proximalen Tibia nicht ueberschreitet. In der Duennschicht-CT findet sich eine exzentrische Osteolyse mit typischen, schmalen Sklerosierungssaum und zentralen Verkalkungen. In der hochaufloesenden MRT zeigen die T2 gewichteten Sequenzen eine lokal begrenzte, epiphysaere, lobulierte Laesion mit einem heterogenen z.T. angehobenen Signal, eine weitere Signalanhebung zeigt sich in den T1 gewichteten Sequenzen nach Gabe von Gd-DTPA. Perifokal findet sich ein epiphysaeres Oedem und diskrete Fluessigkeit im Kniebinnenraum. In der Skelettszintigrafie kommt es zu einer starken fokalen und diffusen Mehrbelegung der proximalen, lateralen Tibiaepiphyse. Nach Diagnosestellung wurde eine Kuerettage des Defektes durchgefuehrt und anschliessend nach histologischer Bestaetigung der Diagnose die komplettierende Kuerettage und Spongiosaplastik vorgenommen. Unter Beruecksichtigung der Tumorlokalisation und des Alters des Patienten laesst sich bereits mit der konventionellen Bildgebung eine praktisch sichere Diagnose stellen. Eine ergaenzende MRT oder CT kann zur endgueltigen Abklaerung hilfreich sein, eine 3-Phasen-Skelettszintigrafie ist ueberfluessig. Die Therapie der Wahl ist die

  5. Die App „Weltbrand 1914“ der SUB Hamburg – Ein Werkstattbericht

    Directory of Open Access Journals (Sweden)

    Markus Trapp

    2015-01-01

    Full Text Available Wie kommt eine wissenschaftliche Bibliothek  dazu, eine App entwickeln zu lassen, auf der 100 Jahre alte Zeitungsseiten der Hamburger Nachrichten gelesen werden können, in denen auf Volltextebene recherchiert werden kann und die einen Einblick in Fotos gibt, die zu Beginn des Ersten Weltkrieges veröffentlicht wurden? Wie ist die Vorgeschichte der Tablet-App für iOS und Android, wie ist die SUB Hamburg an diese Aufgabe herangegangen und wie hat sie das Projekt zusammen mit dem Hamburger Softwareunternehmen CCS realisiert? Auf diese Fragen gibt der folgende Werkstattbericht eine Antwort und liefert auch ein erstes persönliches Zwischenfazit von einem der Projektbeteiligten.

  6. Das mehrsprachige Europa: eine Herausforderung für die Sprachtechnologie

    Directory of Open Access Journals (Sweden)

    Georg Rehm

    2011-03-01

    Full Text Available In der europäischen Informationsgesellschaft des 21. Jahrhunderts sollte niemand einen sozialen oder wirtschaftlichen Nachteil dadurch erleiden, lediglich seine Muttersprache zu sprechen – sei es Lettisch, Ungarisch oder Portugiesisch. Sprachtechnologie hat das Potential dieser Herausforderung entgegen zu treten, sofern sie robust und kosteneffektiv sowie für alle europäischen Sprachen und alle Bürger Europas verfügbar ist. Um diese Ziele zu erreichen muss das Tempo von Forschung und Entwicklung durch eine gezielte und gemeinsame Anstrengung erhöht werden. Eine derartige umfangreiche Anstrengung kann nur mit Hilfe von Vertretern aller beteiligten Interessensgruppen erfolgen, vor allem Forscher, Nutzer, Anbieter und Integratoren von Technologien, den Sprachgemeinschaften, Politiker, und der gesamten Gesellschaft. META-NET, ein europäisches Kompetenznetzwerk, das aus 44 Forschungszentren aus dem Bereich Sprachtechnologie besteht und 31 Länder abdeckt, schmiedet zu diesem Zweck eine strategische Allianz: META, die Multilingual Europe Technology Alliance.

  7. Injection moulding antireflective nanostructures

    DEFF Research Database (Denmark)

    Christiansen, Alexander Bruun; Clausen, Jeppe Sandvik; Mortensen, N. Asger;

    We present a method for injection moulding antireflective nanostructures on large areas, for high volume production. Nanostructured black silicon masters were fabricated by mask-less reactive ion etching, and electroplated with nickel. The nickel shim was antistiction coated and used in an...... injection moulding process, to fabricate the antireflective surfaces. The cycle-time was 35 s. The injection moulded structures had a height of 125 nm, and the visible spectrum reflectance of injection moulded black polypropylene surfaces was reduced from 4.5±0.5% to 2.5±0.5%. The gradient of the refractive...

  8. Urinary incontinence - injectable implant

    Science.gov (United States)

    ... repair; ISD repair; Injectable bulking agents for stress urinary incontinence ... Blaivas JM, Gormley EA, et al. Female Stress Urinary Incontinence Update Panel of the American Urological Association Education ...

  9. Charge-Injection Device (CID) Infrared Staring Imaging Sensor

    Science.gov (United States)

    Baker, W. D.; Wilson, S. H.; Missman, R. A.; Nuttall, D. E.; Ting, R. N.

    1981-07-01

    A laboratory version of an infrared staring imaging sensor, based on a 32 x 32 indium antimonide CID detector array, has been developed. That sensor serves both as a test bed for array evaluation and as a tool for investigating concepts such as non-uniformity compensation. The system is microprocessor based to provide for flexible array operation as well as for the collection and logging of array operating conditions and data. Design features of the sensor, including the focal plane and the supporting electronics, are described. Operation of the sensor is discussed and some of the imaging data collected with this system is presented.

  10. Osteologische Konsiliarbetreuung im Klinikum Klagenfurt am Wörthersee: Initiale Ergebnisse eines Pilotprojekts

    Directory of Open Access Journals (Sweden)

    Mikosch P

    2011-01-01

    Full Text Available Einleitung: Patienten mit „Lowenergy“- Frakturen erhalten laut Literatur nach der chirurgischen Frakturversorgung oftmals keine Therapieempfehlungen betreffend einer medikamentös osteologischen Therapie zwecks Sekundärprophylaxe weiterer Frakturen. Ziel: Dieses bekannte Problem sollte durch ein Pilotprojekt, das interdisziplinäre Zusammenarbeit in den Vordergrund stellt, vermindert werden. Patienten, die eine „Low-energy“-Fraktur erlitten hatten, sollten durch ein osteologisch-internistisches Konsilium direkt an den chirurgischen Abteilungen betreut werden, wodurch die chirurgische Versorgung mit weiteren medikamentösen konservativen Therapieempfehlungen und eventuell in Einzelfällen auch durch zusätzliche diagnostische Maßnahmen ergänzt werden sollte. Ergebnisse: Im Rahmen des 3 Monate dauernden Pilotprojekts wurden insgesamt 77 Patienten (63 Frauen, 14 Männer vorgestellt, davon lehnten 5 Patienten ein osteologisch-internistisches Konsil ab. Obwohl die Mehrzahl der 72 betreuten Patienten ein deutlich erhöhtes Frakturrisiko basierend auf der FRAX-Analyse aufwies, hatten nur einige bereits eine vorangehende Osteoporosetherapie (Vitamin D 29,2 %, Kalzium 26,4 %, spezifische Osteoporosemedikation 19,4 % erhalten. Durch die Konsiliarbetreuungen konnte bei 66/72 Patienten eine osteologische Therapieempfehlung abgegeben werden, in 7 Fällen davon unter der Bedingung einer noch durchzuführenden Osteodensitometrie. Die Therapieempfehlungen versuchten differenziert auf die individuellen Bedürfnisse der Patienten einzugehen, wodurch die gesamte Palette aktuell verfügbarer osteologischer Therapien empfohlen wurde. Bei 5 Patienten ergaben sich keine Hinweise auf eine Osteoporose, womit eine Therapieempfehlung nicht erforderlich war. Lediglich bei einem Patienten war eine osteologische Therapieempfehlung wegen unzureichender Vordaten nicht möglich. Schlussfolgerung: Die Durchführung eines osteologisch-internistischen Konsiliums direkt am

  11. Study of the Charge Density Control Method Including the Space Charge Effect in the Proton Synchrotron

    Science.gov (United States)

    Kato, Shinichi; Harada, Hiroyuki; Hotchi, Hideaki; Okabe, Kota; Yamamoto, Kazami; Kinsho, Michikazu

    For high intensity proton accelerators, one of the beam loss sources is the incoherent tune spread caused by the space charge force. In the 3 GeV rapid cycling synchrotron of the Japan Proton Accelerator Research Complex, beams are injected sequentially and shifted slightly from the central orbit in order to increase the beam size intentionally and suppress the charge density and incoherent tune spread. This injection method has been adopted and suppressed the beam loss. However, simulations clarified that beams did not spread as much as expected because of the space charge effect in the high current case. As simulation results of the optimized beam shift pattern when the space charge effect is considered, it was obtained that the incoherent tune spread could be suppressed to an extent that has not been achieved previously.

  12. Meta-Analyse und "publication bias" : eine empirisch-statistische Fallstudie

    OpenAIRE

    Fiebig, Joachim; Rüdebusch, Gerrit; Urban, Dieter

    2012-01-01

    Die Schrift berichtet über empirische Analysen zur Identifikation eines "publication bias"” in einer Meta-Analyse von 30 Studien zu den Effekten von pädosexueller Viktimisierung auf die Entstehung von pädosexueller Delinquenz. Zur Identifikation eines möglichen "publication bias" werden verschiedene statistische Verfahren vorgestellt und erläutert (graphische und regressionsanalytische "funnel-plot"-Methodik sowie die "rank-correlation"-, "fail-safe numbers"- und "trim and fill"-Methodik). In...

  13. Friedrich Wilhelm Carové (1789 - 1952) : ein Tag auf dem Stadtturm zu Andernach

    OpenAIRE

    Graf, Klaus

    2009-01-01

    Friedrich Wilhelm Carové wurde am 20. Juni 1789 als Sohn eines kurtrierischen Hofrates in Koblenz geboren. Er besuchte das Koblenzer Gymnasium, an dem damals Joseph Görres lehrte, und absolvierte in Koblenz ein Studium an der von den Franzosen eingerichteten Rechtsfakultät. 1809 wurde er zum Lizentiaten des Rechts promoviert und als Advokat am Trierer Appellationsgerichtshof zugelassen. Um privaten Studien nachgehen zu können, nahm er 1811-1816 verschiedene Verwaltungstellen in Zütphen, Leer,...

  14. Sozialer Wandel des Risikomanagements bei Kindern und Jugendlichen. Eine Replikationsstudie zur langfristigen Zunahme des Anzeigeverhaltens

    OpenAIRE

    Köllisch, Tilman; Oberwittler, Dietrich

    2004-01-01

    In der Polizeilichen Kriminalstatistik steigen die Belastungsziffern von Kindern und Jugendlichen, insbesondere bei Gewaltdelikten, seit vielen Jahren an. Es ist jedoch umstritten und mangels regelmäßiger Täter- und Opferbefragungen schwer zu entscheiden, ob dies eher auf ein verändertes Gewaltverhalten oder eher auf ein verändertes Anzeige- und Registrierungsverhalten zurückzuführen ist. Anhand einer lokalen Vergleichsstudie im Abstand von 25 Jahren präsentieren wir erstmals einen direkten B...

  15. Kontrazeption und Schwangerschaft bei Frauen mit Epilepsie - Eine Stellungnahme der DGGEF

    Directory of Open Access Journals (Sweden)

    Rabe T

    2010-01-01

    Full Text Available Epilepsien gehören zu den häufigsten neurologischen Erkrankungen. Für Frauen, die unter einer Epilepsie leiden, ist eine enge Zusammenarbeit zwischen dem betreuenden Neurologen und Gynäkologen unerlässlich, da sowohl die Epilepsie an sich aber auch die antiepileptische Medikation viele Bereiche des Lebens der betroffenen Frauen negativ beeinflussen kann: so können Fertilität und reproduktive Funktionen eingeschränkt sein, aber auch die bidirektionalen Interaktionen zwischen der antiepileptischen Therapie und hormonalen Kontrazeptiva müssen berücksichtigt werden, um ungeplante Schwangerschaften und eine Verschlechterung der Anfallskontrolle zu verhindern. Das mit einer antiepileptischen Therapie assoziierte teratogene Risiko muss, ebenso wie das mit der Behandlung möglicherweise verbundene Risiko einer ungünstigen Beeinflussung der kognitiven Entwicklung beim Kind, gegenüber dem Nutzen einer optimalen Anfallskontrolle abgewogen werden. Wenn möglich, sollten Frauen im reproduktionsfähigen Alter auf ein wenig teratogenes Therapieregime eingestellt werden. Eine umfassende proaktive präkonzeptionelle Beratung ist bei Frauen mit Epilepsie obligat, um bei Mutter und Kind einen möglichst unproblematischen Verlauf von Schwangerschaft, Geburt und Postpartalzeit zu ermöglichen. Im Allgemeinen wird bei Frauen mit Epilepsie eine hochdosierte, bereits präkonzeptionell zu beginnende Folsäureprophylaxe angeraten, um das Risiko für das Auftreten großer Fehlbildungen zu reduzieren. Im Verlauf der Schwangerschaft können je nach antiepileptischer Therapie eine regelmäßige Überprüfung der Antieepileptikaspiegel und ggf. auch eine Anpassung der Dosierung notwendig werden. Eine differenzierte Fehlbildungsdiagnostik sollte genauso wie die regelmäßige Überwachung der Schwangerschaft auf geburtshilfliche Komplikationen Teil der Routineversorgung von Frauen mit Epilepsie sein.

  16. Untersuchungen zur deutschen Schreibsprache eines spätmittelalterlichen Gebetbuches von Ljubljana

    OpenAIRE

    Marija Javor Briški

    2015-01-01

    Der vorliegende Aufsatz  bietet eine ausführliche systematische Darstellung der deutschen Schreibsprache des Manuskriptes NUKLj Ms 224, eines spätmittelalterlichen Gebetbuches der National- und Universitätsbibliothek in Ljubljana, welches drei verschiedene Hände aufweist. Die Schreibsprache wird nach den für räumliche und zeitliche Einordnung relevanten Kriterien in drei Bereichen untersucht: im phonetisch-orthographischen, im morphologischen und im lexikalischen. Den methodologischen Untersu...

  17. Ein modulares System zur Nachrechnung und Optimierung hydraulischer Turbomaschinen radialer Bauweise

    OpenAIRE

    Schmalhorst, Carsten W.

    2014-01-01

    In dieser Arbeit wird ein Programmsystem zur Nachrechnung und Optimierung von radialen Turbomaschinen vorgestellt und seine Leistungsfähigkeit anhand von praxisbezogenen Beispielen aufgezeigt. Es wird ein Verfahren für die schnelle Voroptimierung von Turbomaschinen entwickelt und die Durchführung von CFD-Simulationen von hydraulischen Turbomaschinen weitestgehend automatisiert. Das Programmsystem wird angewendet, um Kennlinien von radialen Kreiselpumpen verschiedener Schnelläufigkeit zu erzeu...

  18. Prostitution - ein Beruf wie andere auch? : zur Kritik einer aktuellen Perspektive

    OpenAIRE

    Stallberg, Friedrich W.

    1991-01-01

    Der Beitrag wendet sich gegen die Auffassung, Prostitution sei ein Beruf wie jeder andere auch. Mit dieser Position, die aus dem Umkreis der Prostituiertenbewegung stammt, wird für eine Entdiskriminierung der Prostituierten gestritten und deren Selbstorganisation gefordert. In dem Beitrag wird darauf hingewiesen, daß Prostitution von den Sozialwissenschaften keineswegs als 'normaler Beruf' angesehen wird. Die Forschung orientiert sich eher an den Kategorien der Abweichung, der Randständigkeit...

  19. Verletzungsmanagement im Spitzensport. Eine systemtheoretisch-konstruktivistische Analyse mit Fallstudien aus den Sportarten Leichtathletik und Handball.

    OpenAIRE

    Mayer, Jochen

    2009-01-01

    Problemstellung Schmerzen, Beschwerden und Verletzungen sind ein alltägliches Phänomen im Spitzensport. Ausgehend von Hinweisen auf einen aus medizinischer Sicht höchst problematischen Umgang mit Schmerzen und Verletzungen durch Athleten und ihr Umfeld werden in der vorliegenden Arbeit Möglichkeiten und Grenzen eines ganzheitlichen Verletzungsmanagements im Spitzensport beleuchtet. Dabei stehen Fragen der verletzungsbezogenen Entscheidungspraxis und ihrer psychosozialen Entscheidungsbeding...

  20. Periimplantäre Knochenveränderungen am Frialit-2 Implantat - Eine 10-Jahresuntersuchung

    OpenAIRE

    Rombach, Stefan Joachim

    2016-01-01

    Zahnimplantate werden vermehrt zur prothetischen Rehabilitation eingesetzt. Eine wichtige Voraussetzung für den Langzeiterfolg der Implantate und damit auch des darauf verankerten Zahnersatzes ist ein niveaustabiler periimplantärer Knochen. Veränderungen in seinen Ausmaßen können radiographisch sichtbar gemacht und quantifiziert werden. Ziel dieser Studie war es, Frialit-2 Implantate mit unterschiedlicher prothetischer Versorgung in Ober- und Unterkiefer in einem Untersuchungszeitraum v...

  1. Review Essay: (Auto-) Biografie als Methode: Eine dialektische Soziologie des Alltagslebens

    OpenAIRE

    Roth, Wolff-Michael

    2002-01-01

    Our Lives as Databases ist das Produkt eines Forschungsprojekts, in dem die teilnehmenden Autoren das kollektive Schreiben und Analysieren ihrer Autobiographien als Medium zum Praktizieren akademischer Soziologie benutzen. In diesem Beitrag beschreibe ich die Struktur und den Inhalt dieses ungewöhnlichen und sehr interessanten Buches und stelle meine Lesart anhand der exemplarischen Analyse eines der Kapitel dar. Obwohl der Herausgeber des Sammelbandes überzeugend für das kollektive Schreiben...

  2. Vermittlungs- und Integrationsprozesse in transdisziplinären Projekten: eine empirische Untersuchung

    OpenAIRE

    Nell, Pina

    2012-01-01

    "Inter- und transdisziplinäre Forschungsverbünde werden in der Wissenschaft immer wichtiger. Hiermit ist die Hoffnung verbunden, dass durch die Zusammenführung unterschiedlicher Sichtweisen und Fachdisziplinen neues Wissen generiert werden kann, das über disziplinär erzeugtes Wissen hinausgeht. Heterogene Forschungsverbünde bergen jedoch auch Risiken, die häufig nicht explizit thematisiert werden. Eine These der vorliegenden Arbeit ist es, dass eine vermittelnde Instanz in Forschungsverbünden...

  3. Fortschritt und Arbeitszeit: Ein Vergleich der Ansichten von Marx, Keynes und der Sozialdemokratie

    OpenAIRE

    Bernhard Schütz

    2014-01-01

    Die Ideen von Karl Marx und John Maynard Keynes übten im Laufe der Zeit großen Einfluss auf die Ansichten der österreichischen Sozialdemokratie aus. Beide Autoren sahen das Ziel der Geschichte in der Selbstverwirklichung des Menschen. Sie gingen davon aus, dass eine weitestgehende Befreiung des Menschen von der Notwendigkeit der Arbeit eine unbedingte Voraussetzung für diese Selbstverwirklichung ist. Der vorliegende Beitrag analysiert, ob sich diese spezifische Vorstellung von Fortschritt ...

  4. Entwicklung und Überprüfung eines Strukturmodells der fachlichen Kommunikationskompetenz im Biologieunterricht

    OpenAIRE

    Kramer, Gesa

    2009-01-01

    Schüler zeigen Defizite in der sach- und fachgerechten Benutzung von Sprache im Biologieunterricht. Mit Hilfe eines Kompetenzstrukturmodells können relevante Strukturen und Zusammenhänge der fachl. Kommunikationskompetenz identifiziert werden. Entsprechend theor. Vorgaben (KMK-Bildungsstandards, Expertiseforschung u. a.) wird ein Kompetenzstrukturmodell postuliert, das die beiden Dimensionen Individuelle Wissensrepräsentation und Wissenskommunikation mit den Komponenten Wissen, Wortschatz, Ar...

  5. Der Bystander-Effekt in alltäglichen Hilfesituationen : ein nicht-reaktives Feldexperiment

    OpenAIRE

    Alle, Katrin; Mayerl, Jochen

    2010-01-01

    "Der These der Verantwortungsdiffusion zufolge sinkt die Wahrscheinlichkeit einer Hilfeleistung, wenn mehrere Zeugen eine Hilfesituation beobachten, da sich aufgrund der Anwesenheit mehrerer potentieller Helfer die individuell wahrgenommene Verantwortung reduziert (sog. Bystander-Effekt). Die vorliegende Arbeit stellt Ergebnisse eines nicht-reaktiven Feldexperiments mit verdeckter Beobachtung zur Untersuchung des Bystander-Effekts in einer ungefährlichen alltäglichen Hilfesituation mit 80 Ver...

  6. Der Bystander-Effekt in alltäglichen Hilfesituationen : ein nicht-reaktives Feldexperiment

    OpenAIRE

    Alle, Katrin; Mayerl, Jochen

    2010-01-01

    Der These der Verantwortungsdiffusion zufolge sinkt die Wahrscheinlichkeit einer Hilfeleistung, wenn mehrere Zeugen eine Hilfesituation beobachten, da sich aufgrund der Anwesenheit mehrerer potentieller Helfer die individuell wahrgenommene Verantwortung reduziert (sog. Bystander-Effekt). Die vorliegende Arbeit stellt Ergebnisse eines nicht-reaktiven Feldexperiments mit verdeckter Beobachtung zur Untersuchung des Bystander-Effekts in einer ungefährlichen alltäglichen Hilfesituation mit 80 Vers...

  7. Farbkonstanz und Farbkontrast – eine Untersuchung mit Hilfe der farbigen Schatten

    OpenAIRE

    Kallmann, Anatol Julian

    2003-01-01

    Zusammenfassung der Dissertation von Anatol Julian Kallmann Farbkonstanz und Farbkontrast – eine Untersuchung mit Hilfeder farbigen Schatten Die farbigen Schatten werden als ein Spezialfall dessimultanen Farbkontrastes angesehen. Um herauszufinden,warum die farbigen Schatten im Vergleich zur gewöhnlichenDarstellung des simultanen Farbkontrastes so intensiv farbigerscheinen, wurde das Phänomen hinsichtlich derFarbparameter Helligkeit, Sättigung und Farbton analysiert. Der Induktionsef...

  8. Ist der Ablauf der Lock-up-Frist bei Neuemissionen ein kursrelevantes Ereignis

    OpenAIRE

    Nowak, Eric; Gropp, Alexandra

    2000-01-01

    Ja, der Ablauf der Lock-up-Frist ist ein kursrelevantes Ereignis. Wir untersuchen Kursreaktionen auf das Ende der Lock-up-Frist bei 142 Unternehmen des Neuen Marktes. Da der Ablauf der Sperrfrist bereits zum Zeitpunkt des Börsengangs bekannt ist, erwarten wir bei einem (semi-)informationseffizienten Kapitalmarkt durchschnittlich keine Kursreaktion. Im Rahmen einer Ereignisstudie zeigen wir aber, dass sich am Ende der Sperrfrist signifikant negative Überrenditen ergeben. Durch eine differenzie...

  9. Untersuchung eines thermischen Lichtbogentriebwerksystems für die Lunar Mission BW1

    OpenAIRE

    Bock, Dagmar

    2009-01-01

    Die Verwendung von thermischen Lichtbogentriebwerksystemen in der 1 bis 2 kW-Klasse mit Hydrazin als Treibstoff zur Lageregelung auf geostationären Satelliten ist heutzutage Stand der Technik. In der vorliegenden Dissertation wird ein thermisches Lichtbogentriebwerksystem mit Ammoniak als Treibstoff für die Anwendung als eines der Haupttriebwerke der universitären Kleinsatellitenmission Lunar Mission BW1 des Instituts für Raumfahrtsysteme der Universität Stuttgart untersucht und charakteri...

  10. Traktionsantrieb mit linearem geschalteten Reluktanzmotor für ein autonomes Bahnfahrzeug

    OpenAIRE

    Schneider, Tobias

    2014-01-01

    Im Rahmen des NBP-Projekts wird ein Bahnsystem entwickelt, welches auf kleinen, autonom verkehrenden Fahrzeugen beruht. Diese so genannten RailCabs werden fahrerlos betrieben und können sich selbstständig zu Konvois zusammenschließen. Die Traktionskraft und damit die Beschleunigung der Fahrzeuge wird über das magnetische Luftspaltfeld eines Linearmotors erzeugt. Die Luftspaltbreite zwischen den strecken- und fahrzeugseitigen Motorteilen ist sowohl durch Witterungsbedingungen als auch durch Al...

  11. Konzeption und Implementierung eines GIS-basierten Kartierungssystems für die geowissenschaftliche Planetenforschung

    OpenAIRE

    Naß, Andrea

    2013-01-01

    Die Kartierung planetarer Körper stellt ein wesentliches Mittel der raumfahrtgestützten Exploration der Himmelskörper dar. Aktuell kommen zur Erstellung der planetaren Karten Geo-Informationssysteme (GIS) zum Einsatz. Ziel dieser Arbeit ist es, eine GIS-orientierte Prozesskette (Planetary Mapping System (PMS)) zu konzipieren, mit dem Schwerpunkt geologische und geomorphologische Karten planetarer Oberflächen einheitlich durchführen zu können und nachhaltig zugänglich zu machen.

  12. Schulbibliotheken in Schweden: Strukturen, Aufgaben und Konzepte : Eine Analyse anhand ausgewählter Beispiele

    OpenAIRE

    Reuter, Stefan

    2008-01-01

    Die Arbeit thematisiert schwedische Schulbibliotheken, ihre Strukturen, Aufgaben und an sie gestellte pädagogische Anforderungen auch im Zusammenhang mit der Vermittlung von Informationskompetenz, als eine der Kernkompetenzen von Schulbibliotheken. Die Rolle von Schulbibliotheken auf internationaler Ebene wird behandelt. Hierbei wird auf einen möglichen Zusammenhang mit den Ergebnissen der PISA-Studie eingegangen. Mit dem Schulbibliotheksmanifest der UNESCO wird ein international gültiges Gru...

  13. Informationskompetenz als Studienfach?! Eine curriculare Zusammenarbeit von Universitätsbibliothek und Fachdisziplinen

    OpenAIRE

    Wolff, Christian

    2007-01-01

    In diesem Beitrag wird ein seit 2006 an der Universität Regensburg eingeführtes Lehrprogramm für die Schlüsselqualifikation Informationskompetenz vorgestellt. Es zeichnet sich durch die Kooperation von Universitätsbibliothek, Informationswissenschaft und Medieninformatik sowie weiterer Disziplinen aus. Eine weitere Besonderheit ist die Verankerung als Nebenfach im Rahmen der Studiengänge der philosophischen Fakultäten der Universität Regensburg. We discuss a program in information literac...

  14. DISCUS – Online-Tutorial zur Förderung von Informationskompetenz - Ein Blick in die Werkstatt

    OpenAIRE

    Bieler, Detlev

    2004-01-01

    DISCUS – Online-Tutorial zur Förderung von Informationskompetenz (Developing Information Skills & Competence for University Students) ist ein E-Learning-Projekt der Universitätsbibliothek der TU Hamburg-Harburg. Der Blick in die Werkstatt beleuchtet folgende Themen: Motivation, Visualisierung, inhaltliche Strukturierung, Interaktivität und Personalisierung. Die Datei ist die Powerpoint-Präsentation (im PDF-Format) eines Vortrages auf der Campus Innovation Hamburg 2004 am 1. Oktober 2004, s...

  15. Wirksamkeitsnachweis und Indikationen des Autogenen Trainings - eine Metaanalyse nach den Cochrane Kriterien

    OpenAIRE

    Bregenzer, Maximilian

    2015-01-01

    Die Therapieoption „Autogenes Training“ wird heutzutage immer häufiger bei psychosomatischen und auch somatischen Erkrankungen diskutiert und bereits angewendet. Professor Stetter veröffentlichte im Jahr 2002 eine Metaanalyse, in der er 64 kontrollierte randomisierte klinische Studien zur Anwendung des Autogenen Trainings untersuchte. Hiermit wurde ein erster großer Schritt zur Etablierung dieser Therapieform getan. Aufgrund der noch unzureichenden Datenlage, machte es sich die vorliegende A...

  16. Der Einsatz des International Caries Detection and Assessment System (ICDAS-II) - Eine Pilotstudie

    OpenAIRE

    Busche, Jan Friedrich

    2012-01-01

    Problemstellung: In Zeiten der modernen Zahnmedizin ist ein Rückgang der Kariesprävalenz und vor allem der großflächigen kariösen Läsionen zu beobachten. Kariös veränderte Zahnhartsubstanz erscheint vermehrt als initiale Läsion. Dieser Umstand macht ein Kariesdiagnoseverfahren notwendig, welches die Zahnkaries nicht nur auf Kavitationsniveau, sondern bereits im Initialstadium erfasst und differenziert. Dieses gelingt mit ...

  17. Transaktionen anstelle von Tauschakten: Einleitung in eine Revision ökonomischer Theorie

    OpenAIRE

    Kabalak, Alihan; Priddat, Birger P.

    2011-01-01

    Die moderne Ökonomik ist in ihrem Kern immer noch tauschtheoretisch begründet. Die Bemühungen der Neuen Institutionenökonomik für eine transaktionstheoretische Fundierung sind auf halbem Wege stehengeblieben (Fokussierung von Kosten bei gegebenen Nutzen; keine spezifisch transaktionsbasierte Markttheorie, nur eine theory of the firm und institutional change aus wirtschaftshistorischer Perspektive). Wir werden die Konzepte 'Tausch' und 'Transaktion' voneinander abgrenzen und daraufhin die ökon...

  18. Ein Konzept für die merkmalsbasierte Tumor-Klassifikation mit diagnostischem Ultraschall

    OpenAIRE

    Siebers, Stefan

    2008-01-01

    Die Bildgebung mit Ultraschall (Sonographie) hat sich zu der am häufigsten verwendeten medizinischen Bildgebungsmodalität entwickelt. Eine Unterscheidung gut- und bösartiger Tumoren mit Hilfe der Sonographie setzt allerdings große Erfahrung beim Untersucher voraus und gilt als außerordentlich schwierig. In dieser Arbeit wurde daher ein Konzept zur automatisierten Klassifikation mit diagnostischem Ultraschall entwickelt und im Rahmen einer klinischen Studie mit 138 Fällen zur Digni...

  19. Auswirkungen eines präventiven Dienstsportprogramms bei der Polizei auf Gesundheitsindikatoren und Krankenstand

    OpenAIRE

    Weiler, Thorsten

    2011-01-01

    Einleitung: Die demografisch bedingte Überalterung der Mitarbeiter und hohe Krankenstände haben nicht nur in der freien Wirtschaft, sondern vor allem auch im Bereich der öffentlichen Verwaltung ein besorgniserregendes Ausmaß angenommen. Vor diesem Hintergrund gerät die Notwendigkeit betrieblicher Gesundheitsförderung (BGF) auch in der Vollzugspolizei zunehmend in die Diskussion. Ein wesentlicher Bestandteil der BGF ist der gesundheitsorientierte Dienstsport, der bislang jedoch kaum adäquat ev...

  20. Ein Interview zur Erfassung sozialer Ängste unter Einbeziehung von Körpersymptomen

    OpenAIRE

    Chaker, Samia; Haustein, Elisa; Hoyer, Jürgen; Davidson, Jonathan R.T.

    2014-01-01

    Die Brief Social Phobia Scale – German version (BSPS-G) ist ein Kurzinterview zum Screening sozialer Ängste. Dabei werden Schwere oder Verlauf einer bereits diagnostizierten sozialen Angststörung erfasst. Im Folgenden wird der Hintergrund dargelegt und eine Kurzbeschreibung des englischsprachigen Originals (BSPS) gegeben: Die soziale Phobie ist gekennzeichnet durch ausgeprägte und anhaltende Angst, sich in sozialen oder Leistungssituationen peinlich zu verhalten, gedemütigt zu werden oder...

  1. Event als Interaktion und Inszenierung. Ein Beitrag zu Theorie und Praxis der Medienästhetik

    OpenAIRE

    Wünsch, Ulrich

    2010-01-01

    Die Dissertation untersucht die ästhetische Bedingtheit und Verfasstheit eines bestimmten Mediums: des Event. Ästhetik wird als Prozess der sinnlichen Wahrnehmung und Aufmerksamkeitslenkung des psychophysischen Systems Mensch (Leib) verstanden, der symbolvermittelt auch (und gerade bei Events) außersprachlich vor sich geht. Event wird eine Veranstaltung genannt, die, vornehmlich in der Unternehmenskommunikation eingesetzt, den Nimbus des Außergewöhnlichen und Einzigartigen im Kontext der so g...

  2. In vitro Herstellung eines vorderen Kreuzbandkonstruktes aus mesenchymalen Stammzellen und einem Kollagen Typ I-Hydrogel

    OpenAIRE

    Schupp, Kathrin

    2007-01-01

    Verletzungen des vorderen Kreuzbandes gehören zu häufigsten Verletzungen des menschlichen Bandapparates. Da das vordere Kreuzband über ein schlechtes intrinsisches Heilungspotenzial verfügt, ist heutzutage die chirurgische Rekonstruktion mittels Sehnentransplantaten die Therapie der Wahl. Die vorliegende Arbeit beschäftigte sich mit der Fragestellung, ob es möglich ist, ein Kreuzband-Konstrukt aus mesenchymalen Stammzellen (MSCs) und einem Kollagen Typ I-Hydrogel herzustellen und wie die Einw...

  3. Bildung in Medienwelten?: Eine biografieanalytische Studie zu Lern- und Bildungsprozessen bei Homosexuellen im Internet

    OpenAIRE

    Bender, Claus

    2010-01-01

    Innerhalb der vorliegenden Untersuchung geht es um die Verknüpfung von Medienbildung, homosexueller Sozialität und der Methodik der Biografieanalyse. Ausgangsbasis ist eine sozialkonstruktivistische Sichtweise auf Geschlecht und (Homo-) Sexualität, wobei eine sozio-historische Kontextualisierung von Homosexualität unter Berücksichtigung von Diskriminierung erfolgt. Im Fokus steht der Coming-out-Prozess, der zwischen Zeigen und Verstecken changiert und mittels des Mediums Internet einen Raum f...

  4. Chromosomale Veränderungen bei der monoklonalen Gammopathie unbestimmter Signifikanz (MGUS) - Eine molekularzytogenetische Analyse

    OpenAIRE

    Kurb, Nadine

    2013-01-01

    Die Monoklonale Gammopathie unbestimmter Signifikanz (MGUS) resultiert aus einem klonalen Prozess, der zur monoklonalen Proliferation von Immunglobulinen führt. Das Risiko ein Multiples Myelom (MM) zu entwickeln, beträgt bei der MGUS ungefähr 1 % pro Jahr. Chromosomale Aberrationen scheinen hierbei eine entscheidende Rolle zu spielen. Beim MM wurde die Inzidenz, die pathogenetische Relevanz und die prognostische Bedeutung genetischer Veränderungen umfangreich untersucht. Die Datenlage bei der...

  5. Oplysningstidens danske oversættelser af Martin Luthers salme "Ein feste Burg ist unser Gott"

    DEFF Research Database (Denmark)

    Balslev-Clausen, Peter

    2006-01-01

    En litterær og teologisk analyse af de danske oversættelser af Martin Luthers salme "Ein feste Bug ist unser Gott" fra perioden 1775 - 1800 viser, at disse oversættelser afspejler tidens oplysningsteologi......En litterær og teologisk analyse af de danske oversættelser af Martin Luthers salme "Ein feste Bug ist unser Gott" fra perioden 1775 - 1800 viser, at disse oversættelser afspejler tidens oplysningsteologi...

  6. Ein Framework für echtzeitfähige Ethernet-Netzwerke

    Science.gov (United States)

    Dopatka, Frank

    Im Rahmen dieser Arbeit wird die Entwicklung eines formalen Framewoks vorgestellt, mit dessen Hilfe zwischen der Kompatibilität zum verbreiteten baumförmigen Standard-Ethernet und der Einhaltung von Echtzeitanforderungen einer automatisierten Anlage variiert werden kann. Damit kann bereits vor der Auswahl einer bestimmten Technologie eine Schedule der Echtzeit-Übertragungen offline kalkuliert und simuliert werden, sobald die Anforderungen der Geräte im industriellen Echtzeit-Netzwerk bekannt sind.

  7. Ein, zwei Punkte zu Nichtkommutativer Geometrie und Quantenfeldtheorie auf diskreten Räumen

    OpenAIRE

    Pöselt, Christian

    2002-01-01

    Über viele Jahre hinweg wurden wieder und wieder Argumente angeführt, die diskreten Räumen gegenüber kontinuierlichen Räumen eine fundamentalere Rolle zusprechen. Unser Zugangzur diskreten Welt wird durch neuere Überlegungen der Nichtkommutativen Geometrie (NKG) bestimmt. Seit ca. 15Jahren gibt es Anstrengungen und auch Fortschritte, Physikmit Hilfe von Nichtkommutativer Geometrie besser zuverstehen. Nur eine von vielen Möglichkeiten ist dieReformulierung des Standardmodells derElementarteil...

  8. Review: Rainer Diaz-Bone (2002). Kulturwelt, Diskurs und Lebensstil. Eine diskurstheoretische Erweiterung der bourdieuschen Distinktionstheorie

    OpenAIRE

    Angermüller, Johannes

    2004-01-01

    DIAZ-BONE legt eine Studie über den Diskurs der Populärmusik vor, in der die BOURDIEUsche Distinktionstheorie um eine diskurstheoretische Komponente erweitert wird. Anhand einer beispielhaften Diskursanalyse von Heavy Metal- und Techno-Zeitschriften wird die Bedeutung einer differenztheoretisch fundierten Diskurstheorie für die kultursoziologische Forschung demonstriert. Wegen seiner reduktionistischen Tendenz wird der BOURDIEUsche Ansatz kritisiert und die relative Autonomie diskursiver Must...

  9. Vernetztes Lernen an der Hochschule? Ergebnisse und Erfahrungen eines cMOOS

    OpenAIRE

    Kahnwald, Nina; Pscheida, Daniela

    2015-01-01

    Der Ansatz des Konnektivismus und die rasante Verbreitung von Massive Open Online Courses (MOOCs) haben eine anhaltende Debatte um die Chancen, Schwierigkeiten und Perspektiven offener Lernnetzwerke in der Hochschulbildung ausgelöst. Die Diskussion reicht dabei vom befürchteten Verlust des Einflusses der Dozierenden als Gewährleister einer kritischen und vielseitigen Auseinandersetzung mit Themen und Lerninhalten, über die lernerseitigen Voraussetzungen für eine erfolgreiche und gewinnbringen...

  10. Quantitative Datenanalyse: Arbeiten mit SPSS Statistics : Eine Einführung

    OpenAIRE

    Hoidn, Sabine

    2012-01-01

    Bei diesem Buch handelt es sich um eine verständliche Einführung in das Arbeiten mit dem quantitativen Datenanalyseprogramm SPSS Statistics. Die Studierenden setzen sich mit den Grundlagen zum Arbeiten mit SPSS Statistics auseinander, können selbständig eine SPSS Statistics-Datei erstellen, Daten einlesen, zusammenfügen und modifizieren, erfasste Daten managen und die gebräuchlichsten tabellarischen und grafischen Grundauswertungen sowie Analyseverfahren durchführen und interpretieren. Au...

  11. Therapeutische Blutdrucksenkung durch ein aktives Implantat: Ein neues Verfahren zur Behandlung der medikamentös therapierefraktären Hypertonie

    Directory of Open Access Journals (Sweden)

    Peters TK

    2008-01-01

    Full Text Available Wenn Hochdruckpatienten trotz medikamentöser Compliance unter einer Kombination aus mindestens 3 Antihypertensiva und ohne behandelbare sekundäre Ursache einen unkontrollierten Blutdruck aufweisen, kann eventuell ein neues, in der Entwicklung befindliches aktives Implantat angewandt werden. Diese Übersicht beschäftigt sich mit der Entwicklung und den frühen Daten zur Sicherheit und Wirksamkeit eines aktiven implantierbaren Gerätes zur chronischen elektrischen Stimulation der Gefäßwand der Karotisbifurkation. Das neue Gerät ist ähnlich wie ein Defibrillator vollständig implantierbar. Das seit langem bekannte und auch klinisch untersuchte Wirkprinzip basiert darauf, dass den in der Blutdruckregulation beteiligten zentralnervösen Strukturen durch elektrische Aktivierung von barorezeptorischen Afferenzen ein "erhöhter Blutdruck vorgetäuscht" wird. Das zentrale Nervensystem "antwortet" darauf mit Anpassungen der neurohumoralen Regulation, deren Ergebnis eine "reflektorische" Blutdrucksenkung ist. Eine positive Nutzen-Risiko- Bewertung von Daten aus 2 klinischen Studien (in Europa und den USA führte 2007 zur Marktzulassung in Europa (CE-Kennzeichnung. Gegen Ende 2007 waren mehr als 60 Patienten im Rahmen klinischer Studien behandelt worden. Langzeitdaten einer begrenzten Anzahl von Patienten haben gezeigt, dass auch nach 12 Monaten der systolische Blutdruck im Mittel um mehr als 25 mmHg nachhaltig reduziert war, wobei die medikamentöse Begleittherapie unverändert war. Es wurden keine unerwarteten schwerwiegenden unerwünschten Ereignisse berichtet, so dass sich diese neue Methode als Alternative bei Patienten mit schlechter Prognose unter stark hypertensiven Blutdruckwerten eignet. Die Risikobewertung hat insbesondere perioperative Risiken wie Infektionen und Verletzungen zu berücksichtigen. Allerdings könnte diese neue Therapie trotz einer notwendigerweise konservativen Risikobewertung einen Beitrag zur künftigen Behandlung von

  12. Workplace Charging. Charging Up University Campuses

    Energy Technology Data Exchange (ETDEWEB)

    Giles, Carrie [ICF International, Fairfax, VA (United States); Ryder, Carrie [ICF International, Fairfax, VA (United States); Lommele, Stephen [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2016-03-01

    This case study features the experiences of university partners in the U.S. Department of Energy's (DOE) Workplace Charging Challenge with the installation and management of plug-in electric vehicle (PEV) charging stations.

  13. Metastase eines papillären Schilddrüsenkarzinoms in den Nasennebenhöhlen - eine seltene Entität

    OpenAIRE

    Graß, I; Alduwillah, R; Bergler, W

    2014-01-01

    Einleitung: Schilddrüsenkarzinome gehören zu den häufigsten malignen endokrinen Tumoren, machen jedoch in der Gesamtheit der bösartigen Tumore nur 0,15-1% aus und sind damit eher selten. In absteigender Häufigkeit überwiegen die papillären Karzinome, gefolgt von den follikulären, den medullären und den undifferenzierten Karzinomen. Ein seltenes Erstsymptom einer Metastasierung in die Keilbeinhöhle kann eine behinderte Nasenluftpassage sein. Die häufigsten Metastasierungswege sind je nach His...

  14. Schwerpunkt: Georg Büchner und seine Zeit - Georg Büchner und seine Zeit : Ein privilegierter Schriftsteller und ein solitäres Werk

    OpenAIRE

    Oesterle, Günter

    2012-01-01

    Wenn man an die Stelle des Titels „Georg Büchner und seine Zeit“ „Georg Büchner in seiner Zeit“ setzt, hat man den Unterschied der Lebenszeit Büchners (1813-1837) und seiner Wirkung über einen umfassenderen Zeitraum im Blick. Diese doppelte Perspektive versucht der Essay durchzuhalten: Er fragt zunächst, wie es möglich wurde, dass ein jungerMann, der mit 24 Jahren starb, nicht nur als Schriftsteller, sondern auch als Wissenschaftler und Revolutionär eine herausragende Rolle spielen konnte. An...

  15. Ein Lehrbuch über Psychiatrie und Psychotherapie – Geschlechtsunterschiede unter der Lupe?

    Directory of Open Access Journals (Sweden)

    Isabella Heuser

    2007-07-01

    Full Text Available Anke Rohde und Andreas Marneros haben sich ein hohes Ziel gesetzt: ein übersichtliches Lehrbuch für Psychiatrie und Psychotherapie, das erstmals eine systematische Zusammenstellung des Wissens über geschlechtsspezifische Aspekte von Symptomatologie, Epidemiologie, Diagnostik, Pharmakotherapie und Psychotherapie psychischer Störungen enthält. Bemerkenswert ist dabei zweierlei: Erstens werden bei der Betrachtung geschlechtsspezifischer Unterschiede im Sinne der Genderforschung Frauen und Männer berücksichtigt, zweitens wird ein vollständiger Überblick sowohl über die häufigen und bekannten psychischen Störungen als auch die äußerst seltenen psychiatrischen Erkrankungen der gesamten Altersspanne gegeben. Wenngleich die Qualität der einzelnen Beiträge deutlich zwischen sehr differenzierter und leider auch für ein Handbuch eindeutig zu oberflächlicher Betrachtung variiert, liegt in dem Band ein weitgehend informatives Nachschlagewerk vor, das einen ersten Überblick über die geschlechtsspezifische Psychiatrie gibt.

  16. Medikamentös explusive Therapie von Uretersteinen - Ein systematischer Review

    Directory of Open Access Journals (Sweden)

    Seitz C

    2012-01-01

    Full Text Available Einleitung: Eine medikamentös expulsive Therapie (MET steigert Steinausscheidungsraten und reduziert Kolikepisoden. MET ist eine angemessene Therapie zur erleichterten Steinpassage bei Patienten mit einem neu diagnostizierten Ureterstein, deren Symptome kontrolliert sind. Eine adjuvante Therapie nach SWL zeigt ebenfalls höhere Steinpassageraten. Ziel: Durchführung eines systematischen Reviews der medikamentös expulsiven Therapie von Uretersteinen. Ergebnisse: MET mittels Alpha-Blocker oder Kalzium-Kanal-Blocker resultiert in einer höheren und beschleunigten Steinfreiheitsrate im Vergleich zu einer Kontrollgruppe. Höhere Steinfreiheitsraten werden für den gesamten Ureter beschrieben, obwohl die meisten Studien distale Uretersteine untersuchten. MET war effektiv nach SWL und URS. Die Kombination von MET mit Kortikosteroiden zeigt zwar vielversprechende Ergebnisse, jedoch ist die Datenlage unzureichend. Der Schmerzmittelverbrauch sowie die Anzahl an Kolikepisoden und stationären Aufnahmen wurden unter MET reduziert. Schlussfolgerung: MET erleichtert die Steinausscheidung bei Patienten mit Uretersteinen 10 mm. Bei Alpha-Blockern besteht ein Klasseneffekt in Bezug auf eine erleichterte Steinausscheidung. MET ist ebenfalls nach SWL und URS wirksam. Die Kombination mit Kortikosteroiden kann außerhalb klinischer Studien nicht empfohlen werden. Große placebokontrollierte, randomisierte Studien und die Erforschung neuer, vielversprechender Substanzen sind nötig, um die zukünftige Rolle der MET zu definieren.

  17. Bluthochdruck und Herzrhythmusstörungen - eine gefährliche Kombination

    Directory of Open Access Journals (Sweden)

    Strohmer B

    2009-01-01

    Full Text Available Herzrhythmusstörungen sind ein häufiges Problem bei Patienten mit arterieller Hypertonie. Das Auftreten von Vorhofflimmern beeinträchtigt nicht nur die Lebensqualität der oft asymptomatischen Hypertoniepatienten, sondern ist auch mit erhöhter Morbidität und Mortalität assoziiert, sofern keine entsprechenden therapeutischen Maßnahmen getroffen werden. Die Bandbreite der ventrikulären Arrhythmien reicht von der isolierten Extrasystolie bis hin zu anhaltenden Tachyarrhythmien mit erhöhtem Risiko für den plötzlichen Herztod. Die linksventrikuläre Hypertrophie, eine diastolische Dysfunktion sowie eine abnorme Vorhofdilatation bzw. -funktion sind die zugrundeliegenden Faktoren für die Entwicklung der elektrischen Instabilität bei Hypertonikern. Eine moderne antihypertensive Therapie normalisiert nicht nur den Blutdruck, sondern reduziert durch Rückbildung der linksventrikulären Hypertrophie auch das Risiko für Vorhofflimmern und den plötzlichen Herztod. Aktuelle Studien belegen insbesondere für die medikamentöse Blockade des Renin-Angiotensin- Aldosteron-Systems eine besondere Effektivität. Eine antiarrhythmische Therapie ist aufgrund ihrer potenziellen Proarrhythmie nur bei entsprechender Indikation mit Vorsicht einzusetzen.

  18. Die Amerikanischen Reisetagebücher: ein erster Zugang

    Directory of Open Access Journals (Sweden)

    Horst Bredekamp

    2015-12-01

    Full Text Available Zusammenfassung Die Reisetagebücher der Amerika-Reise (1799-1804 stellen ein Kompendium an schriftlichen Einträgen, Tabellen, Diagrammen und Zeichnungen dar, das in der Tradition römischer Papiermuseen des 17. Jhs. steht. Sie können als Mikrokosmen kleiner Kunstkammern aufgefasst werden, in denen Naturobjekte, Kunstwerke und Arbeitsmittel einen gemeinsamen Reflexionsraum bilden. Im Zentrum des vorliegenden Beitrags steht Humboldts Auffassung einer gestalteten Bestimmung von Landschaft vermittels besonders einprägsamer Bildformen. Auf erstaunliche Weise nähert sich Humboldts Ästhetik der Gesamtsicht von Natur Charles Darwins Begriff der natürlichen Schönheit an. In den Reisetagebüchern zeigt sich ein heterogener, von Lebendigkeit zeugender Charakter, der sowohl durch das unterschiedliche Format der einzelnen Hefte, als auch durch die inkonsistente Behandlung des Papiers erreicht wird. Dieser bewegliche Zug setzt sich in zahlreichen Zetteln, Briefen und weiteren Texten fort als ein eigenes Prinzip von Evolution. Abstract The travel diaries of Humboldt’s journey to the Americas (1799-1804 form a corpus of research in the form of written entries, tables, diagrams and sketches and serve as a continuation of the Roman “paper museums” of the 17th century. They can be seen as microcosms of small Kunstkammern (cabinets of curiosity in which specimens from nature, artworks and working materials are documented and presented together in a common space for reflection and contemplation. The focus of this paper is Humboldt’s conception of a “designed determination” through particularly memorable images and forms. His aesthetic of an overall vision of nature bears a striking similarity to Charles Darwin’s theory of natural beauty. His travel diaries reveal a heterogeneous character, imbued with a vibrancy that is attained through both the various formats of different notebooks, as well as by the inconsistent treatment of the of the

  19. Blutdruck-SMS: Eine Methode zur besseren Therapiesteuerung

    Directory of Open Access Journals (Sweden)

    Magometschnigg D

    2015-01-01

    Full Text Available Durch verschiedene endogene blutdruckregulierende Systeme werden die Blutdrücke während 24 Stunden in einem Bereich von ca. 50 mmHg systolisch und 35 mmHg diastolisch gehalten. Wegen dieser Blutdruckvariabilität sind Einzelmessungen mehrdeutig und sagen nichts über den Blutdruckmittelwert aus, der aus einer Vielzahl von abweichenden Einzelmessungen errechnet wird. Die Hochdruck-Guidelines empfehlen, dass die „Blutdruckhöhe“ einzelner Patienten anhand von zumindest 3 Messwerten eingeschätzt werden sollen. Wenn man der Blutdruckvariabilität einzelner Patienten eine Standardabweichung von 12 mmHg zugrunde legt, bessert sich die Reproduzierbarkeit des Befundes unwesentlich. Daher sind Einzelmessungen prinzipiell ungeeignet, um Hypertoniker zuverlässig einer Hypertonieklasse zuzuordnen. Die Zuordnung zur Klasse der therapieresistenten Hypertoniker über Einzelmessungen hat bei den Symplicity-Studien 1 und 2 zu irreführend positiven Ergebnissen und vielen nicht gerechtfertigten Behandlungen geführt. Der Missbrauch von Einzelmessungen ist bei klinischen Hypertoniestudien gang und gäbe und führt dazu, dass die Ergebnisse von Studien mit Arztmessungen ganz anders ausfallen als von Studien, die statt den „casual readings“ Mittelwerte von 24-h-Blutdruckmonitorings verwenden. Dass Schlussfolgerungen auf der Grundlage von Einzelmessungen nicht zielführend sind, hat Symplicity-HTN-3 eindrucksvoll aufgezeigt. Das Blutdruck-SMS ist ein einfaches, automatisiertes Verfahren, mit dem der Arzt die Hypertonie – ohne Mehraufwand – anstatt mit Einzelwerten über Mittelwerte und Langzeitblutdruckverläufe beurteilt. Diese zutreffendere Art der Hypertoniebeurteilung führt dazu, dass die Therapieerfolge im Routinebetrieb ähnlich hoch sind wie in klinischen Studien; über 80 % erreichen die Zielwerte [1]. Das Blutdruck-SMS vermeidet Fehldiagnosen wie Ordinationshochdruck und maskierte Hypertonie und erhöht die Medikamenten-„ Adherence“ [2]. Das

  20. Separably injective Banach spaces

    CERN Document Server

    Avilés, Antonio; Castillo, Jesús M F; González, Manuel; Moreno, Yolanda

    2016-01-01

    This monograph contains a detailed exposition of the up-to-date theory of separably injective spaces: new and old results are put into perspective with concrete examples (such as l∞/c0 and C(K) spaces, where K is a finite height compact space or an F-space, ultrapowers of L∞ spaces and spaces of universal disposition). It is no exaggeration to say that the theory of separably injective Banach spaces is strikingly different from that of injective spaces. For instance, separably injective Banach spaces are not necessarily isometric to, or complemented subspaces of, spaces of continuous functions on a compact space. Moreover, in contrast to the scarcity of examples and general results concerning injective spaces, we know of many different types of separably injective spaces and there is a rich theory around them. The monograph is completed with a preparatory chapter on injective spaces, a chapter on higher cardinal versions of separable injectivity and a lively discussion of open problems and further lines o...

  1. Perceptions of injections

    International Nuclear Information System (INIS)

    Based on interviews with experts in the petroleum and natural gas exploration industry and results of a workshop insight is given into the attitudes, opinions and perceptions on the possibility to store wastes from the exploration activities in the deep underground, e.g. by means of injection. In a separate report a comparison is made on injection and other waste processing options

  2. Spin injection into semiconductors

    Science.gov (United States)

    Oestreich, M.; Hübner, J.; Hägele, D.; Klar, P. J.; Heimbrodt, W.; Rühle, W. W.; Ashenford, D. E.; Lunn, B.

    1999-03-01

    The injection of spin-polarized electrons is presently one of the major challenges in semiconductor spin electronics. We propose and demonstrate a most efficient spin injection using diluted magnetic semiconductors as spin aligners. Time-resolved photoluminescence with a Cd0.98Mn0.02Te/CdTe structure proves the feasibility of the spin-alignment mechanism.

  3. [Intra-articular injections].

    Science.gov (United States)

    Chapelle, Ch

    2015-09-01

    It is not unusual for a specialist or general practitioner to be presented with a pathology which necessitates the use of an intra-articular injection of corticosteroids, hyaluronic acid or a local anaesthetic. It would seem to be interesting to update and to precise the techniques and methods of intraarticular injections which have appeared in recent international publications, when we know that 30 % of the injections given into the knee and so called "dry" are incorrect and, therefore, inefficient. The indication of an articular injection depends, firstly, on the diagnosis which should be done with great care; after which should be an objective analysis complete with secondary effects linked to both the injection and the product used. The conditions of asepsis, the choice of needles and quantities of the injection and even the ways of the injections should be reviewed in detail. The last studies clearly question the secondary effects of the cartilage degradations of the cortisone given as an intra-articular injection and shows its efficiency on the pain and inflammatory phenomonen in osteoarthritis. Studies on hyaluronic acid are often contradictory going from a modest result to an important pain relief but it is necessary to be aware that the objective criteria are difficult to interpret. The use of local anaesthetics in intra-articular is limited by the few indications in view of the major risk of aggravating the pre-existing lesions by the disappearing signs of pain.

  4. Spin injection from a normal metal into a mesoscopic superconductor

    Energy Technology Data Exchange (ETDEWEB)

    Wolf, Michael J.; Kolenda, Stefan [Institut fuer Nanotechnologie, KIT, 76021 Karlsruhe (Germany); Huebler, Florian [Institut fuer Nanotechnologie, KIT, 76021 Karlsruhe (Germany); Center for Functional Nanostructures, KIT, 76131 Karlsruhe (Germany); Institut fuer Festkoerperphysik, KIT, 76021 Karlsruhe (Germany); Loehneysen, Hilbert v. [Center for Functional Nanostructures, KIT, 76131 Karlsruhe (Germany); Institut fuer Festkoerperphysik, KIT, 76021 Karlsruhe (Germany); Physikalisches Institut, KIT, 76128 Karlsruhe (Germany); Beckmann, Detlef [Institut fuer Nanotechnologie, KIT, 76021 Karlsruhe (Germany); Center for Functional Nanostructures, KIT, 76131 Karlsruhe (Germany)

    2013-07-01

    We report on nonlocal transport in superconductor hybrid structures, with ferromagnetic as well as normal-metal tunnel junctions attached to the superconductor. In the presence of a strong Zeeman splitting of the density of states, both charge and spin imbalance is injected into the superconductor. While previous experiments demonstrated spin injection from ferromagnetic electrodes, we show that spin imbalance is also created for normal-metal injector contacts. Using the combination of ferromagnetic and normal-metal detectors allows us to directly discriminate between charge and spin injection, and demonstrate a complete separation of charge and spin imbalance. The relaxation length of the spin imbalance is of the order of several μm and is found to increase with a magnetic field, but is independent of temperature. We further discuss possible relaxation mechanisms for the explanation of the spin relaxation length.

  5. Mass-independent search for fractionally charged particles

    International Nuclear Information System (INIS)

    A proposed mass-independent search for fractionally charged particles with the all-electrostatic line of the IsoTRACE Laboratory at University of Toronto is described. Sensitive measurement of the fractional charge is accomplished by (1) a judicious choice of ion source and ion species, (2) charge changing and electrostatic analysis before injection into the tandem accelerator, (3) molecular destruction, charge changing, and acceleration by the tandem, (4) charge state selection and E/q analysis after acceleration, and (5) particle energy measurement with a Si surface barrier detector. In addition, the mass of the fractionally charged particles can be determined by a time of flight spectrometer. Specific cases involving +- (1/3)e and +- (2/3)e particles are discussed. Also included in the discussion are: integral charge background rejection, the procedure of the search, the signature of the fractionally charged particles, he resolutions of the analyzers and detectors, and the expected energy and time of flight spectra

  6. Der Krieg als eine besondere Form des Konflikts

    Directory of Open Access Journals (Sweden)

    Sebastian Schneider

    2011-12-01

    Full Text Available Comme le montrent les débats politiques et scientifiques actuels, la notion de guerre ne décrit pas uniquement une condition, mais a des implications normatives larges. Dans les situations de guerre, l’interdiction générale de tuer est en partie levée ou limitée. Afin d’éviter toute instrumentalisation politique et arbitraire de la notion de guerre, il faut repenser les critères de distinction entre la notion de guerre et les autres formes de conflit. Cet article se propose d’évoquer les réflexions philosophiques ainsi que politiques sur le thème de la guerre et critique le manque de réflexion sur la distinction entre la notion de guerre et les autres formes de conflits.Wie sich an aktuellen politischen und wissenschaftlichen Debatten zeigen lässt, ist der Begriff des Krieges nicht nur eine reine Zustandsbeschreibung, sondern hat auch weitreichende normative Implikationen. Im Krieg ist das ansonsten generelle Tötungsverbot partiell aufgehoben oder eingeschränkt. Um den Begriff nicht einer willkürlichen politischen Instrumentalisierung zu übergeben, muss über Kriterien zur Abgrenzung von Krieg und anderen Formen des Konflikts nachgedacht werden. Der Artikel wirft einen Blick auf die Beschäftigung der Philosophie und Politikwissenschaft mit dem Thema Krieg und kritisiert die mangelnde Abgrenzung des Krieges zu anderen Konfliktformen.

  7. Radiotherapy: an interactive learning tool; Strahlentherapie: Ein interaktives Lernprogramm

    Energy Technology Data Exchange (ETDEWEB)

    Frenzel, T.; Kruell, A.; Schmidt, R.; Dobrucki, W.; Malys, B.

    1998-11-01

    The program is primarily intended for radiological medical technicians, student nurses, students of medicine and physics, and doctors. It is designed as a tool for vocational training and further training and gives comprehensive insight into the daily routines of a radiotherapy unit. The chapters deal with: fundamental biological aspects - fundamental physical aspects - radiation sources and irradiation systems - preparatory examinations - therapies and concepts - irradiation planning - irradiation performance - termination of irradiation treatment. For every page displayed, spoken texts and written, on-screen keywords, illustrations, animated sequences and a large number of videos have been combined in a way easy to digest. The software of the program permits handling also by learners less familiar with computer-based learning. (orig./) [Deutsch] Das Programm richtet sich in erster Linie an MTRAs, Schwesternschuelerinnen, Medizin- und Physikstudenten sowie Aerzte. Es wurde zur Aus- und Weiterbildung konzipiert und soll helfen, die Arbeitsablaeufe einer Strahlentherapieabteilung transparent zu machen. Die Kapitel lauten - biologische Grundlagen - physikalische Grundlagen - Bestrahlungsgeraete - vorbereitende Untersuchungen - Behandlungskonzept - Bestrahlungsplanung - Ausfuehrung der Bestrahlung sowie Ende der Strahlenbehandlung. Fuer jede Bildschirmseite sind gesprochener Text und auf dem Bildschirm ausgegebene Stichworte, Abbildungen, Animationen und eine Vielzahl von Videos in einpraegsamer Weise kombiniert worden. Das Programm wurde so konzipiert, dass es sich auch von Personen ohne grosse Computerkenntnisse bedienen laesst. (orig.)

  8. Phase Space Dynamics of Ionization Injection in Plasma Based Accelerators

    CERN Document Server

    Xu, X L; Li, F; Zhang, C J; Yan, L X; Du, Y C; Huang, W H; Chen, H B; Tang, C X; Lu, W; Yu, P; An, W; Mori, W B; Joshi, C

    2013-01-01

    The evolution of beam phase space in ionization-induced injection into plasma wakefields is studied using theory and particle-in-cell (PIC) simulations. The injection process causes special longitudinal and transverse phase mixing leading initially to a rapid emittance growth followed by oscillation, decay, and eventual slow growth to saturation. An analytic theory for this evolution is presented that includes the effects of injection distance (time), acceleration distance, wakefield structure, and nonlinear space charge forces. Formulas for the emittance in the low and high space charge regimes are presented. The theory is verified through PIC simulations and a good agreement is obtained. This work shows how ultra-low emittance beams can be produced using ionization-induced injection.

  9. Evaluierung eines Qualitäts- und Herkunftszeichens: Das Beispiel "Geprüfte Qualität - HESSEN"

    OpenAIRE

    Will, Sabine

    2013-01-01

    Die Dissertation führt eine umfassende Erfolgskontrolle des Qualitäts- und Herkunftszeichens „Geprüfte Qualität – HESSEN“ (GQH) aus Sicht der verschiedenen Akteure durch. Die GQH ist ein regionales Qualitätssicherungssystem des hessischen Agrarmarketings. Da die Wirtschaftspartner zunehmend finanziell beteiligt sind, steigt die Erfolgsabhängigkeit des Marketings und Erfolgsanalysen sind von zunehmender Bedeutung. Auf Verbraucherebene erfolgt daher eine produktübergreifende Bewertung der Marke...

  10. Untersuchungen zum Einsatz von Antiseptika in der Behandlung akuter Wunden anhand einer evidenzbasierten Literaturanalyse, Auswertung eines Fragebogens und internationaler Symposiumdiskussion

    OpenAIRE

    Steller, Daniel

    2015-01-01

    Ziel dieser Arbeit war es anhand einer evidenzbasierten Literaturanalyse, einer Umfrage sowie eines Expertentreffens herauszufinden, welche Wundspüllösung für die Behandlung von akuten Weichgewebewunden mit/ ohne Knochenbeteiligung am geeignetsten ist und ob eine starke Evidenz für Handlungsempfehlungen besteht. Des Weiteren sollte anhand der vorliegenden Arbeit untersucht werden, inwieweit ein Konsens bezüglich der Therapie akuter Wunden besteht. Die Umfrageergebnisse als auch die Expert...

  11. Die Ordnung des Diskurses in der Flüchtlingskonstruktion : eine postkoloniale Re-Lektüre

    OpenAIRE

    Niedrig, Heike; Seukwa, Henri

    2010-01-01

    "Ziel dieses Beitrages ist eine postkoloniale Dekonstruktion der essentialisierenden Kategorie 'Flüchtling'. Die Analyse geht davon aus, dass der 'Flüchtling' ein politisch-rechtliches und soziales Konstrukt ist, das bestimmte Funktionen für die national kodierte Selbstdeutung der Mehrheitsgesellschaft hat. Die Positionen in der Dreiecksstruktur Täter-Opfer-Retter werden in den dominanten diskursiven Formationen in einer Weise zugeordnet, die eine kollektive weiße europäische Identität konstr...

  12. Konzeption eines Umweltkennzahlensystems zur Umweltleistungsmessung für Prozesse unter Beachtung der in Unternehmen vorliegenden Rahmenbedingungen

    OpenAIRE

    Scheibe, Lilly

    2004-01-01

    Die vorliegende Ausgabe beschäftigt sich mit dem Thema Umweltkennzahlensysteme für die Umweltleistungsmessung. Ziel der Arbeit ist es, Unternehmen ein Hilfsmittel zur Integration von Umweltaspekten ins allgemeine Unternehmensgeschehen an die Hand zu geben. Angestrebt ist die Konzeption eines Umweltkennzahlensystems zur Umweltleistungsmessung für Prozesse. Im ersten Schritt wird ein Öko-Controlling-Modell vorgestellt und Umweltkennzahlensysteme in dieses eingeordnet. Umweltkennzahlensysteme si...

  13. Verbraucherpräferenzen für regionale Lebensmittel : Eine repräsentative Untersuchung der Einflussfaktoren

    OpenAIRE

    Henseleit, Meike; Kubitzki, Sabine; Schütz, Daniel; Teuber, Ramona

    2007-01-01

    Während einerseits die Agrar- und Ernährungswirtschaft durch eine zunehmende Internationalisierung gekennzeichnet ist, kann gleichzeitig in vielen Ländern ein wachsendes Interesse der Verbraucher an der regionalen Herkunft von Lebensmitteln beobachtet werden (7; 3). Insbesondere bei bezüglich der Lebensmittelsicherheit sensiblen Produkten, wie beispielsweise Rindfleisch, stellt die Herkunft eines der wichtigsten, wenn nicht sogar das wichtigste Produktattribut dar (24). Der Begriff „Region...

  14. Adressierung in der ein- und zweisprachigen Lexikographie. Eine einführende Übersicht über die Forschungs- und Problemlage

    OpenAIRE

    Herbert Ernst Wiegand

    2011-01-01

    Zusammenfassung: Obwohl die Adressierungsbeziehung eine wichtige textuelle Beziehunginsbesondere in Wörterbuchartikeln ist, ohne deren theoretisches Verstandnis die Gewinnungvon lexikographischen Informationen anhand von hochverdichteten und stark standardisiertenWorterbuchartikeln nicht erklart werden kann, gibt es bisher nur wenige Beitrage, in denendie Adressierung theoriebezogen behandelt wurde.Zunachst werden einige theoretische Voraussetzungen aus einer Theorie der Worterbuchfo...

  15. Applikation von fermentierter Soja bei Krebspatienten zur Verminderung von Kachexie und Erhöhung der Apoptose - eine prospektive Pilotstudie

    Directory of Open Access Journals (Sweden)

    Jacob U

    2009-01-01

    Full Text Available Kachexie ist eine Begleiterkrankung von Krebs, Aids oder rheumatoider Arthritis. Andere Symptome dieser Erkrankungen sind Depression sowie chronische Erschöpfung. Für alle diese Begleiterkrankungen, die die Lebensqualität der schwererkrankten Patienten negativ beeinflussen, wird eine Erhöhung von Entzündungsmediatoren (z.B. IL-6 und TNF-α verantwortlich gemacht. Für Krebs wird eine Erniedrigung der Apoptose, ausgelöst durch eine Erhöhung von NFκB verantwortlich gemacht. Eine Gabe eines fermentierten Soja-Produktes, das in den USA seit 10 Jahren zur Verbesserung der Lebensqualität von Krebspatienten eingesetzt wird, wurde in einer prospektiven Studie untersucht: Für je 5 Patienten, die unter Prostata-, Ovar- oder Brustkrebs litten, konnte eine signifikante Verminderung von Kachexie, Stress und Depression festgestellt werden. Gleichzeitig konnte man für Prostata- und Ovarkrebs-Patienten eine Erhöhung der Genexpression apoptotischer Marker disseminierter Tumorzellen feststellen. Zusätzlich wurde eine starke Erhöhung der Genexpression des Tumorsuppressorgens p21 festgestellt. Auch wenn die prospektive Studie präliminär ist und die Anzahl der untersuchten Patienten zu klein, so widerspricht sie nicht unserer Annahme, dass es einen direkten Zusammenhang zwischen Krebs und Begleiterkrankungen, besonders der Kachexie, gibt.

  16. Angeleitete internetbasierte Patienteninformation - Studie zur Effektivität eines Informationssystems für Kopfschmerzpatienten

    Directory of Open Access Journals (Sweden)

    Wilfried Honekamp

    2009-11-01

    Full Text Available Eine stetig wachsende Zahl von Nutzern sucht im Internet nach Gesundheitsinformationen. Hierzu steht ihnen eine Vielzahl ganz unterschiedlicher Anbieter zur Verfügung, die bei divergierenden Interessen gesundheitsrelevante Angebote im Internet vorhalten. Abgesehen von der Informationsflut, mit der die Nutzer bei der Suche überhäuft werden, erhalten sie auch falsche, irreführende, veraltete und sogar gesundheitsgefährdende Informationen. In den letzten zehn Jahren haben verschiedene Wissenschaftler die Anforderungen an ein ideales Gesundheitsinformationssystem ermittelt.Im Rahmen des in diesem Beitrag beschriebenen Projekts wurde ein Gesundheitsinformationssystem als Prototyp zur anamnesebezogenen, internetbasierten Patienteninformation entwickelt und anhand einer Studie evaluiert. Dabei wird die Untersuchung auf deutschsprachige Erwachsene mit Kopfschmerzen eingegrenzt. Insgesamt wird die Hypothese überprüft, dass eine computerunterstützte, anamnesebezogene Internetsuche für den Patienten bessere Ergebnisse liefert, als diese durch die herkömmliche Nutzung von Gesundheitsportalen oder Suchmaschinen erreicht werden kann.Zur Evaluation wurde eine kontrollierte Zweigruppenstudie mit insgesamt 140 Teilnehmern in zwei Studienabschnitten durchgeführt. Dabei wurde im ersten Abschnitt festgestellt, dass bei einfach strukturierten Krankheitsfällen das Informationssystem gleichgute Ergebnisse liefert, wie die herkömmliche Suche. Im zweiten Abschnitt konnte allerdings festgestellt werden, dass bei komplexen Kopfschmerzfällen mit Hilfe des Prototyps signifikant (P=0,031 bessere Diagnosen gestellt werden konnten als ohne. Medizinische Expertensysteme in Kombination mit einer Meta-Suche nach maßgeschneiderten qualitätsgesicherten Informationen erweisen sich als probate Möglichkeit, den Ansprüchen an eine geeignete Versorgung mit Gesundheitsinformationen gerecht zu werden.

  17. High intensity ion beam injection into the 88-inch cyclotron

    OpenAIRE

    Wutte, Daniela; Clark, Dave J.; Laune, Bernard; Leitner, Matthaeus A.; Lyneis, Claude M.

    2000-01-01

    Low cross section experiments to produce super-heavy elements have increased the demand for high intensity heavy ion beams at energies of about 5 MeV/nucleon at the 88-Inch Cyclotron at the Lawrence Berkeley National Laboratory. Therefore, efforts are underway to increase the overall ion beam transmission through the axial injection line and the cyclotron. The ion beam emittance has been measured for various ion masses and charge states. Beam transport simulations including space charge ...

  18. Botulinum toxin injection - larynx

    Science.gov (United States)

    Injection laryngoplasty; Botox-larynx: spasmodic dysphonia-BTX; Essential voice tremor (EVT)-btx; Glottic insufficiency; Percutaneous electromyography-guided botulinum toxin treatment; Percutaneous indirect laryngoscopy-guided botulinum toxin Treatment; ...

  19. Mouse bladder wall injection.

    Science.gov (United States)

    Fu, Chi-Ling; Apelo, Charity A; Torres, Baldemar; Thai, Kim H; Hsieh, Michael H

    2011-07-12

    Mouse bladder wall injection is a useful technique to orthotopically study bladder phenomena, including stem cell, smooth muscle, and cancer biology. Before starting injections, the surgical area must be cleaned with soap and water and antiseptic solution. Surgical equipment must be sterilized before use and between each animal. Each mouse is placed under inhaled isoflurane anesthesia (2-5% for induction, 1-3% for maintenance) and its bladder exposed by making a midline abdominal incision with scissors. If the bladder is full, it is partially decompressed by gentle squeezing between two fingers. The cell suspension of interest is intramurally injected into the wall of the bladder dome using a 29 or 30 gauge needle and 1 cc or smaller syringe. The wound is then closed using wound clips and the mouse allowed to recover on a warming pad. Bladder wall injection is a delicate microsurgical technique that can be mastered with practice.

  20. Epoetin Alfa Injection

    Science.gov (United States)

    ... a medication used to treat human immunodeficiency virus (HIV). Epoetin alfa injection is also used before and ... record book.If you are being treated with dialysis (treatment to remove waste from the blood when ...