
Sample records for channel voltage dependence

  1. Voltage-dependent gating of hERG potassium channels

    Directory of Open Access Journals (Sweden)

    Yen May eCheng


    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  2. Voltage-Dependent Gating of hERG Potassium Channels (United States)

    Cheng, Yen May; Claydon, Tom W.


    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  3. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Directory of Open Access Journals (Sweden)

    Harley T Kurata


    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  4. Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels (United States)

    Cui, Jianmin


    Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

  5. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel (United States)

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael


    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  6. Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating (United States)

    Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar


    The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

  7. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence

    Directory of Open Access Journals (Sweden)

    Rajeev Gupta


    Full Text Available Voltage-Dependent Anion Channel (VDAC phosphorylated by c-Jun N-terminal Kinase-3 (JNK3 was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  8. Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence. (United States)

    Gupta, Rajeev; Ghosh, Subhendu


    Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

  9. Gabapentin Modulates HCN4 Channel Voltage-Dependence

    Directory of Open Access Journals (Sweden)

    Han-Shen Tae


    Full Text Available Gabapentin (GBP is widely used to treat epilepsy and neuropathic pain. There is evidence that GBP can act on hyperpolarization-activated cation (HCN channel-mediated Ih in brain slice experiments. However, evidence showing that GBP directly modulates HCN channels is lacking. The effect of GBP was tested using two-electrode voltage clamp recordings from human HCN1, HCN2, and HCN4 channels expressed in Xenopus oocytes. Whole-cell recordings were also made from mouse spinal cord slices targeting either parvalbumin positive (PV+ or calretinin positive (CR+ inhibitory neurons. The effect of GBP on Ih was measured in each inhibitory neuron population. HCN4 expression was assessed in the spinal cord using immunohistochemistry. When applied to HCN4 channels, GBP (100 μM caused a hyperpolarizing shift in the voltage of half activation (V1/2 thereby reducing the currents. Gabapentin had no impact on the V1/2 of HCN1 or HCN2 channels. There was a robust increase in the time to half activation for HCN4 channels with only a small increase noted for HCN1 channels. Gabapentin also caused a hyperpolarizing shift in the V1/2 of Ih measured from HCN4-expressing PV+ inhibitory neurons in the spinal dorsal horn. Gabapentin had minimal effect on Ih recorded from CR+ neurons. Consistent with this, immunohistochemical analysis revealed that the majority of CR+ inhibitory neurons do not express somatic HCN4 channels. In conclusion, GBP reduces HCN4 channel-mediated currents through a hyperpolarized shift in the V1/2. The HCN channel subtype selectivity of GBP provides a unique tool for investigating HCN4 channel function in the central nervous system. The HCN4 channel is a candidate molecular target for the acute analgesic and anticonvulsant actions of GBP.

  10. Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel. (United States)

    Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio


    Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

  11. The NH2 terminus regulates voltage-dependent gating of CALHM ion channels. (United States)

    Tanis, Jessica E; Ma, Zhongming; Foskett, J Kevin


    Calcium homeostasis modulator protein-1 (CALHM1) and its Caenorhabditis elegans (ce) homolog, CLHM-1, belong to a new family of physiologically important ion channels that are regulated by voltage and extracellular Ca 2+ (Ca 2+ o ) but lack a canonical voltage-sensing domain. Consequently, the intrinsic voltage-dependent gating mechanisms for CALHM channels are unknown. Here, we performed voltage-clamp experiments on ceCLHM-1 chimeric, deletion, insertion, and point mutants to assess the role of the NH 2 terminus (NT) in CALHM channel gating. Analyses of chimeric channels in which the ceCLHM-1 and human (h)CALHM1 NH 2 termini were interchanged showed that the hCALHM1 NT destabilized channel-closed states, whereas the ceCLHM-1 NT had a stabilizing effect. In the absence of Ca 2+ o , deletion of up to eight amino acids from the ceCLHM-1 NT caused a hyperpolarizing shift in the conductance-voltage relationship with little effect on voltage-dependent slope. However, deletion of nine or more amino acids decreased voltage dependence and induced a residual conductance at hyperpolarized voltages. Insertion of amino acids into the NH 2 -terminal helix also decreased voltage dependence but did not prevent channel closure. Mutation of ceCLHM-1 valine 9 and glutamine 13 altered half-maximal activation and voltage dependence, respectively, in 0 Ca 2+ In 2 mM Ca 2+ o , ceCLHM-1 NH 2 -terminal deletion and point mutant channels closed completely at hyperpolarized voltages with apparent affinity for Ca 2+ o indistinguishable from wild-type ceCLHM-1, although the ceCLHM-1 valine 9 mutant exhibited an altered conductance-voltage relationship and kinetics. We conclude that the NT plays critical roles modulating voltage dependence and stabilizing the closed states of CALHM channels. Copyright © 2017 the American Physiological Society.

  12. Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+ channels.

    Directory of Open Access Journals (Sweden)

    Seok-Yong Lee


    Full Text Available Voltage-dependent K(+ (Kv channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors, which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

  13. Cation gating and selectivity in a purified, reconstituted, voltage-dependent sodium channel

    International Nuclear Information System (INIS)

    Barchi, R.L.; Tanaka, J.C.


    In excitable membranes, the voltage-dependent sodium channel controls the primary membrane conductance change necessary for the generation of an action potential. Over the past four decades, the time- and voltage-dependent sodium currents gated by this channel have been thoroughly documented with increasingly sophisticated voltage-clamp techniques. Recent advances in the biochemistry of membrane proteins have led to the solubilization and purification of this channel protein from nerve (6) and from muscle (4) or muscle-derived (1) membranes, and have provided an approach to the correlation of the channel's molecular structure with its functional properties. Each of these sodium channel preparations appears to contain a large glycoprotein either as its sole component (2) or in association with several small subunits (6, 3). Evidence that these purified proteins represent the excitable membrane sodium channel is presented. 8 refs., 1 fig., 1 tab

  14. Ca2+ and voltage dependence of cardiac ryanodine receptor channel block by sphingosylphosphorylcholine. (United States)

    Yasukochi, Midori; Uehara, Akira; Kobayashi, Sei; Berlin, Joshua R


    The effect of sphingosylphosphorylcholine (SPC) on the cytoplasmic Ca(2+) and voltage dependence of channel gating by cardiac ryanodine receptors (RyR) was examined in lipid bilayer experiments. Micromolar concentrations of the lysosphingolipid SPC added to cis solutions rapidly and reversibly decreased the single-channel open probability (P(o)) of reconstituted RyR channels. The SPC-induced decrease in P(o) was marked by an increase in mean closed time and burst-like channel gating. Gating kinetics during intraburst periods were unchanged from those observed in the absence of the sphingolipid, although SPC induced a long-lived closed state that appeared to explain the observed decrease in channel P(o). SPC effects were observed over a broad range of cis [Ca(2+)] but were not competitive with Ca(2+). Interestingly, the sphingolipid-induced, long-lived closed state displayed voltage-dependent kinetics, even though other channel gating kinetics were not sensitive to voltage. Assuming SPC effects represent channel blockade, these results suggest that the blocking rate is independent of voltage whereas the unblocking rate is voltage dependent. Together, these results suggest that SPC binds directly to the cytoplasmic side of the RyR protein in a location in or near the membrane dielectric, but distinct from cytoplasmic Ca(2+) binding sites on the protein.

  15. Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels. (United States)

    Held, Katharina; Voets, Thomas; Vriens, Joris


    Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

  16. Localization and pharmacological characterization of voltage dependent calcium channels in cultured neocortical neurons

    DEFF Research Database (Denmark)

    Timmermann, D B; Lund, Trine Meldgaard; Belhage, B


    The physiological significance and subcellular distribution of voltage dependent calcium channels was defined using calcium channel blockers to inhibit potassium induced rises in cytosolic calcium concentration in cultured mouse neocortical neurons. The cytosolic calcium concentration was measured...... channels were differentially distributed in somata, neurites and nerve terminals. omega-conotoxin MVIIC (omega-CgTx MVIIC) inhibited approximately 40% of the Ca(2+)-rise in both somata and neurites and 60% of the potassium induced [3H]GABA release, indicating that the Q-type channel is the quantitatively...... most important voltage dependent calcium channel in all parts of the neuron. After treatment with thapsigargin the increase in cytosolic calcium was halved, indicating that calcium release from thapsigargin sensitive intracellular calcium stores is an important component of the potassium induced rise...

  17. Regulation of KV channel voltage-dependent activation by transmembrane β subunits

    Directory of Open Access Journals (Sweden)

    Xiaohui eSun


    Full Text Available Voltage-activated K+ (KV channels are important for shaping action potentials and maintaining resting membrane potential in excitable cells. KV channels contain a central pore-gate domain (PGD surrounded by four voltage-sensing domains (VSD. The VSDs will change conformation in response to alterations of the membrane potential thereby inducing the opening of the PGD. Many KV channels are heteromeric protein complexes containing auxiliary β subunits. These β subunits modulate channel expression and activity to increase functional diversity and render tissue specific phenotypes. This review focuses on the KV β subunits that contain transmembrane (TM segments including the KCNE family and the β subunits of large conductance, Ca2+- and voltage-activated K+ (BK channels. These TM β subunits affect the voltage-dependent activation of KV α subunits. Experimental and computational studies have described the structural location of these β subunits in the channel complexes and the biophysical effects on VSD activation, PGD opening and VSD-PGD coupling. These results reveal some common characteristics and mechanistic insights into KV channel modulation by TM β subunits.

  18. Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits. (United States)

    Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A


    Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

  19. Voltage-dependent ion channels in the mouse RPE: comparison with Norrie disease mice. (United States)

    Wollmann, Guido; Lenzner, Steffen; Berger, Wolfgang; Rosenthal, Rita; Karl, Mike O; Strauss, Olaf


    We studied electrophysiological properties of cultured retinal pigment epithelial (RPE) cells from mouse and a mouse model for Norrie disease. Wild-type RPE cells revealed the expression of ion channels known from other species: delayed-rectifier K(+) channels composed of Kv1.3 subunits, inward rectifier K(+) channels, Ca(V)1.3 L-type Ca(2+) channels and outwardly rectifying Cl(-) channels. Expression pattern and the ion channel characteristics current density, blocker sensitivity, kinetics and voltage-dependence were compared in cells from wild-type and Norrie mice. Although no significant differences were observed, our study provides a base for future studies on ion channel function and dysfunction in transgenic mouse models.

  20. Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains (United States)

    Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.


    Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

  1. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)


    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  2. The human red cell voltage-dependent cation channel. Part III: Distribution homogeneity and pH dependence

    DEFF Research Database (Denmark)

    Bennekou, P.; Barksmann, T. L.; Christophersen, P.


    The homogeneity of the distribution of the non-selective voltage-dependent cation channel (the NSVDC channel) in the human erythrocyte, and the pH dependence was investigated. Activation of this channel caused a uniform cellular dehydration, which was characterized by the changes in the erythrocyte...... osmotic resistance profiles: After 1/2 h of activation, the osmolarity at 50% hemolysis changed from 73 mM (control) to 34 mM NaCl, corresponding to 0.48% and 0.21% NaCl respectively. Unchanging standard deviations show participation of the entire erythrocyte population, which implies an even distribution...... of the NSVDC channel among the cells. Inactivation of the NSVDC channel with N-ethyl-maleimide (NEM) or blocking of the Cl- conductance with NS1652 retarded the migration of the resistance profiles towards lower osmolarities. The NSVDC channel activation was blocked by a decrease of the intracellular...

  3. The Eag domain regulates the voltage-dependent inactivation of rat Eag1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Ting-Feng Lin

    Full Text Available Eag (Kv10 and Erg (Kv11 belong to two distinct subfamilies of the ether-à-go-go K+ channel family (KCNH. While Erg channels are characterized by an inward-rectifying current-voltage relationship that results from a C-type inactivation, mammalian Eag channels display little or no voltage-dependent inactivation. Although the amino (N-terminal region such as the eag domain is not required for the C-type inactivation of Erg channels, an N-terminal deletion in mouse Eag1 has been shown to produce a voltage-dependent inactivation. To further discern the role of the eag domain in the inactivation of Eag1 channels, we generated N-terminal chimeras between rat Eag (rEag1 and human Erg (hERG1 channels that involved swapping the eag domain alone or the complete cytoplasmic N-terminal region. Functional analyses indicated that introduction of the homologous hERG1 eag domain led to both a fast phase and a slow phase of channel inactivation in the rEag1 chimeras. By contrast, the inactivation features were retained in the reverse hERG1 chimeras. Furthermore, an eag domain-lacking rEag1 deletion mutant also showed the fast phase of inactivation that was notably attenuated upon co-expression with the rEag1 eag domain fragment, but not with the hERG1 eag domain fragment. Additionally, we have identified a point mutation in the S4-S5 linker region of rEag1 that resulted in a similar inactivation phenotype. Biophysical analyses of these mutant constructs suggested that the inactivation gating of rEag1 was distinctly different from that of hERG1. Overall, our findings are consistent with the notion that the eag domain plays a critical role in regulating the inactivation gating of rEag1. We propose that the eag domain may destabilize or mask an inherent voltage-dependent inactivation of rEag1 K+ channels.

  4. Cloning and functional expression of a plant voltage-dependent chloride channel. (United States)

    Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C


    Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

  5. Investigation of channel width-dependent threshold voltage variation in a-InGaZnO thin-film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Kuan-Hsien; Chou, Wu-Ching [Department of Electrophysics, National Chiao Tung University, Hsinchu, Taiwan (China); Chang, Ting-Chang, E-mail: [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Advanced Optoelectronics Technology Center, National Cheng Kung University, Taiwan (China); Wu, Ming-Siou; Hung, Yi-Syuan; Sze, Simon M. [Department of Electronics Engineering, National Chiao Tung University, Hsinchu, Taiwan (China); Hung, Pei-Hua; Chu, Ann-Kuo [Department of Photonics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Hsieh, Tien-Yu [Department of Physics, National Sun Yat-Sen University, Kaohsiung 804, Taiwan (China); Yeh, Bo-Liang [Advanced Display Technology Research Center, AU Optronics, No. 1, Li-Hsin Rd. 2, Hsinchu Science Park, Hsinchu 30078, Taiwan (China)


    This Letter investigates abnormal channel width-dependent threshold voltage variation in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Unlike drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, the wider the channel, the larger the threshold voltage observed. Because of the surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider channel devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast IV measurement is utilized to demonstrate the self-heating induced anomalous channel width-dependent threshold voltage variation.

  6. Skin secretion of Siphonops paulensis (Gymnophiona, Amphibia forms voltage-dependent ionic channels in lipid membranes

    Directory of Open Access Journals (Sweden)

    E.F. Schwartz


    Full Text Available The effect of the skin secretion of the amphibian Siphonops paulensis was investigated by monitoring the changes in conductance of an artificial planar lipid bilayer. Skin secretion was obtained by exposure of the animals to ether-saturated air, and then rinsing the animals with distilled water. Artificial lipid bilayers were obtained by spreading a solution of azolectin over an aperture of a Delrin cup inserted into a cut-away polyvinyl chloride block. In 9 of 12 experiments, the addition of the skin secretion to lipid bilayers displayed voltage-dependent channels with average unitary conductance of 258 ± 41.67 pS, rather than nonspecific changes in bilayer conductance. These channels were not sensitive to 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid or tetraethylammonium ion, but the experimental protocol used does not permit us to specify their characteristics.

  7. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction. (United States)

    Liu, Dong-Hai; Huang, Xu; Guo, Xin; Meng, Xiang-Min; Wu, Yi-Song; Lu, Hong-Li; Zhang, Chun-Mei; Kim, Young-chul; Xu, Wen-Xie


    Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV) was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV) to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  8. Voltage dependent potassium channel remodeling in murine intestinal smooth muscle hypertrophy induced by partial obstruction.

    Directory of Open Access Journals (Sweden)

    Dong-Hai Liu

    Full Text Available Partial obstruction of the small intestine causes obvious hypertrophy of smooth muscle cells and motility disorder in the bowel proximate to the obstruction. To identify electric remodeling of hypertrophic smooth muscles in partially obstructed murine small intestine, the patch-clamp and intracellular microelectrode recording methods were used to identify the possible electric remodeling and Western blot, immunofluorescence and immunoprecipitation were utilized to examine the channel protein expression and phosphorylation level changes in this research. After 14 days of obstruction, partial obstruction caused obvious smooth muscle hypertrophy in the proximally located intestine. The slow waves of intestinal smooth muscles in the dilated region were significantly suppressed, their amplitude and frequency were reduced, whilst the resting membrane potentials were depolarized compared with normal and sham animals. The current density of voltage dependent potassium channel (KV was significantly decreased in the hypertrophic smooth muscle cells and the voltage sensitivity of KV activation was altered. The sensitivity of KV currents (IKV to TEA, a nonselective potassium channel blocker, increased significantly, but the sensitivity of IKv to 4-AP, a KV blocker, stays the same. The protein levels of KV4.3 and KV2.2 were up-regulated in the hypertrophic smooth muscle cell membrane. The serine and threonine phosphorylation levels of KV4.3 and KV2.2 were significantly increased in the hypertrophic smooth muscle cells. Thus this study represents the first identification of KV channel remodeling in murine small intestinal smooth muscle hypertrophy induced by partial obstruction. The enhanced phosphorylations of KV4.3 and KV2.2 may be involved in this process.

  9. Voltage-gated potassium channels regulate calcium-dependent pathways involved in human T lymphocyte activation. (United States)

    Lin, C S; Boltz, R C; Blake, J T; Nguyen, M; Talento, A; Fischer, P A; Springer, M S; Sigal, N H; Slaughter, R S; Garcia, M L


    The role that potassium channels play in human T lymphocyte activation has been investigated by using specific potassium channel probes. Charybdotoxin (ChTX), a blocker of small conductance Ca(2+)-activated potassium channels (PK,Ca) and voltage-gated potassium channels (PK,V) that are present in human T cells, inhibits the activation of these cells. ChTX blocks T cell activation induced by signals (e.g., anti-CD2, anti-CD3, ionomycin) that elicit a rise in intracellular calcium ([Ca2+]i) by preventing the elevation of [Ca2+]i in a dose-dependent manner. However, ChTX has no effect on the activation pathways (e.g., anti-CD28, interleukin 2 [IL-2]) that are independent of a rise in [Ca2+]i. In the former case, both proliferative response and lymphokine production (IL-2 and interferon gamma) are inhibited by ChTX. The inhibitory effect of ChTX can be demonstrated when added simultaneously, or up to 4 h after the addition of the stimulants. Since ChTX inhibits both PK,Ca and PK,V, we investigated which channel is responsible for these immunosuppressive effects with the use of two other peptides, noxiustoxin (NxTX) and margatoxin (MgTX), which are specific for PK,V. These studies demonstrate that, similar to ChTX, both NxTX and MgTX inhibit lymphokine production and the rise in [Ca2+]i. Taken together, these data provide evidence that blockade of PK,V affects the Ca(2+)-dependent pathways involved in T lymphocyte proliferation and lymphokine production by diminishing the rise in [Ca2+]i that occurs upon T cell activation.

  10. Mutagenesis in mammalian cells can be modulated by radiation-induced voltage-dependent potassium channels

    International Nuclear Information System (INIS)

    Saad, A.H.; Zhou, L.Y.; Lambe, E.K.; Hahn, G.M.


    In mammalian cells, little is known about the initial events whose ultimate consequence is mutagenesis or DNA repair. The role the plasma membrane may play as an initiator of such a pathway is not understood. We show, for the first time, that membrane voltage-dependent potassium (K + ) currents, activated by ionizing radiation play a significant role in radiation mutagenesis. Specifically, we show that the frequency of mutation at the HGPRT locus is increased as expected to 37.6±4.0 mutations per 100,000 survivors by 800 cGy of ionizing radiation from a spontaneous frequency of 1.5±1.5. This increase, however, is abolished if either K + channel blocker, CsCl or BaCl 2 , is present for 2h following irradiation of the cells. RbCl, chemically similar to CsCl but known not to block K + channels, is ineffective in reducing the mutation frequency. Treatment of cells with CsCl or BaCl 2 had no effect on radiation-induced cell killing

  11. Differential expression of T- and L-type voltage-dependent calcium channels in renal resistance vessels

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D


    The distribution of voltage-dependent calcium channels in kidney pre- and postglomerular resistance vessels was determined at the molecular and functional levels. Reverse transcription-polymerase chain reaction analysis of microdissected rat preglomerular vessels and cultured smooth muscle cells...... on vascular diameter in the afferent arteriole. We conclude that voltage-dependent L- and T-type calcium channels are expressed and of functional significance in renal cortical preglomerular vessels, in juxtamedullary efferent arterioles, and in outer medullary vasa recta, but not in cortical efferent...

  12. New insights on the voltage dependence of the KCa3.1 channel block by internal TBA. (United States)

    Banderali, Umberto; Klein, Hélène; Garneau, Line; Simoes, Manuel; Parent, Lucie; Sauvé, Rémy


    We present in this work a structural model of the open IKCa (KCa3.1) channel derived by homology modeling from the MthK channel structure, and used this model to compute the transmembrane potential profile along the channel pore. This analysis showed that the selectivity filter and the region extending from the channel inner cavity to the internal medium should respectively account for 81% and 16% of the transmembrane potential difference. We found however that the voltage dependence of the IKCa block by the quaternary ammonium ion TBA applied internally is compatible with an apparent electrical distance delta of 0.49 +/- 0.02 (n = 6) for negative potentials. To reconcile this observation with the electrostatic potential profile predicted for the channel pore, we modeled the IKCa block by TBA assuming that the voltage dependence of the block is governed by both the difference in potential between the channel cavity and the internal medium, and the potential profile along the selectivity filter region through an effect on the filter ion occupancy states. The resulting model predicts that delta should be voltage dependent, being larger at negative than positive potentials. The model also indicates that raising the internal K+ concentration should decrease the value of delta measured at negative potentials independently of the external K+ concentration, whereas raising the external K+ concentration should minimally affect delta for concentrations >50 mM. All these predictions are born out by our current experimental results. Finally, we found that the substitutions V275C and V275A increased the voltage sensitivity of the TBA block, suggesting that TBA could move further into the pore, thus leading to stronger interactions between TBA and the ions in the selectivity filter. Globally, these results support a model whereby the voltage dependence of the TBA block in IKCa is mainly governed by the voltage dependence of the ion occupancy states of the selectivity filter.

  13. Modeling hysteresis observed in the human erythrocyte voltage-dependent cation channel

    DEFF Research Database (Denmark)

    Flyvbjerg, Henrik; Gudowska-Nowak, Ewa; Christophersen, Palle


    The non-selective voltage-activated cation channel from human red cells, which is activated at depolarizing potentials, has been shown to exhibit counter-clockwise gating hysteresis. Here, we analyze this phenomenon with the simplest possible phenomenological models. Specifically, the hysteresis ...

  14. Ion Concentration- and Voltage-Dependent Push and Pull Mechanisms of Potassium Channel Ion Conduction.

    Directory of Open Access Journals (Sweden)

    Kota Kasahara

    Full Text Available The mechanism of ion conduction by potassium channels is one of the central issues in physiology. In particular, it is still unclear how the ion concentration and the membrane voltage drive ion conduction. We have investigated the dynamics of the ion conduction processes in the Kv1.2 pore domain, by molecular dynamics (MD simulations with several different voltages and ion concentrations. By focusing on the detailed ion movements through the pore including selectivity filter (SF and cavity, we found two major conduction mechanisms, called the III-IV-III and III-II-III mechanisms, and the balance between the ion concentration and the voltage determines the mechanism preference. In the III-IV-III mechanism, the outermost ion in the pore is pushed out by a new ion coming from the intracellular fluid, and four-ion states were transiently observed. In the III-II-III mechanism, the outermost ion is pulled out first, without pushing by incoming ions. Increases in the ion concentration and voltage accelerated ion conductions, but their mechanisms were different. The increase in the ion concentrations facilitated the III-IV-III conductions, while the higher voltages increased the III-II-III conductions, indicating that the pore domain of potassium channels permeates ions by using two different driving forces: a push by intracellular ions and a pull by voltage.

  15. Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane (United States)

    Vaccaro, S. R.


    The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

  16. Voltage-Dependent Inhibition of Glycine Receptor Channels by Niflumic Acid

    Directory of Open Access Journals (Sweden)

    Galyna Maleeva


    Full Text Available Niflumic acid (NFA is a member of the fenamate class of nonsteroidal anti-inflammatory drugs. This compound and its derivatives are used worldwide clinically for the relief of chronic and acute pain. NFA is also a commonly used blocker of voltage-gated chloride channels. Here we present evidence that NFA is an efficient blocker of chloride-permeable glycine receptors (GlyRs with subunit heterogeneity of action. Using the whole-cell configuration of patch-clamp recordings and molecular modeling, we analyzed the action of NFA on homomeric α1ΔIns, α2B, α3L, and heteromeric α1β and α2β GlyRs expressed in CHO cells. NFA inhibited glycine-induced currents in a voltage-dependent manner and its blocking potency in α2 and α3 GlyRs was higher than that in α1 GlyR. The Woodhull analysis suggests that NFA blocks α1 and α2 GlyRs at the fractional electrical distances of 0.16 and 0.65 from the external membrane surface, respectively. Thus, NFA binding site in α1 GlyR is closer to the external part of the membrane, while in α2 GlyR it is significantly deeper in the pore. Mutation G254A at the cytoplasmic part of the α1 GlyR pore-lining TM2 helix (level 2′ increased the NFA blocking potency, while incorporation of the β subunit did not have a significant effect. The Hill plot analysis suggests that α1 and α2 GlyRs are preferably blocked by two and one NFA molecules, respectively. Molecular modeling using Monte Carlo energy minimizations provides the structural rationale for the experimental data and proposes more than one interaction site along the pore where NFA can suppress the ion permeation.

  17. Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels (United States)

    Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah


    The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

  18. Voltage dependent anion channel-1 regulates death receptor mediated apoptosis by enabling cleavage of caspase-8

    International Nuclear Information System (INIS)

    Chacko, Alex D; Liberante, Fabio; Paul, Ian; Longley, Daniel B; Fennell, Dean A


    Activation of the extrinsic apoptosis pathway by tumour necrosis factor related apoptosis inducing ligand (TRAIL) is a novel therapeutic strategy for treating cancer that is currently under clinical evaluation. Identification of molecular biomarkers of resistance is likely to play an important role in predicting clinical anti tumour activity. The involvement of the mitochondrial type 1 voltage dependent anion channel (VDAC1) in regulating apoptosis has been highly debated. To date, a functional role in regulating the extrinsic apoptosis pathway has not been formally excluded. We carried out stable and transient RNAi knockdowns of VDAC1 in non-small cell lung cancer cells, and stimulated the extrinsic apoptotic pathway principally by incubating cells with the death ligand TRAIL. We used in-vitro apoptotic and cell viability assays, as well as western blot for markers of apoptosis, to demonstrate that TRAIL-induced toxicity is VDAC1 dependant. Confocal microscopy and mitochondrial fractionation were used to determine the importance of mitochondria for caspase-8 activation. Here we show that either stable or transient knockdown of VDAC1 is sufficient to antagonize TRAIL mediated apoptosis in non-small cell lung cancer (NSCLC) cells. Specifically, VDAC1 is required for processing of procaspase-8 to its fully active p18 form at the mitochondria. Loss of VDAC1 does not alter mitochondrial sensitivity to exogenous caspase-8-cleaved BID induced mitochondrial depolarization, even though VDAC1 expression is essential for TRAIL dependent activation of the intrinsic apoptosis pathway. Furthermore, expression of exogenous VDAC1 restores the apoptotic response to TRAIL in cells in which endogenous VDAC1 has been selectively silenced. Expression of VDAC1 is required for full processing and activation of caspase-8 and supports a role for mitochondria in regulating apoptosis signaling via the death receptor pathway

  19. Down-regulation of voltage-dependent sodium channels initiated by sodium influx in developing neurons

    International Nuclear Information System (INIS)

    Dargent, B.; Couraud, F.


    To address the issue of whether regulatory feedback exists between the electrical activity of a neuron and ion-channel density, the authors investigated the effect of Na + -channel activators (scorpion α toxin, batrachotoxin, and veratridine) on the density of Na + channels in fetal rat brain neurons in vitro. A partial but rapid (t 1/2 , 15 min) disappearance of surface Na + channels was observed as measured by a decrease in the specific binding of [ 3 H]saxitoxin and 125 I-labeled scorpion β toxin and a decrease in specific 22 Na + uptake. Moreover, the increase in the number of Na + channels that normally occurs during neuronal maturation in vitro was inhibited by chronic channel activator treatment. The induced disappearance of Na + channels was abolished by tetrodotoxin, was found to be dependent on the external Na + concentration, and was prevented when either choline (a nonpermeant ion) or Li + (a permeant ion) was substituted for Na + . Amphotericin B, a Na + ionophore, and monensin were able to mimick the effect of Na + -channel activators, while a KCl depolarization failed to do this. This feedback regulation seems to be a neuronal property since Na + -channel density in cultured astrocytes was not affected by channel activator treatment or by amphotericin B. The present evidence suggests that an increase in intracellular Na + concentration, whether elicited by Na + -channel activators or mediated by a Na + ionophore, can induce a decrease in surface Na + channels and therefore is involved in down-regulation of Na + -channel density in fetal rat brain neurons in vitro

  20. Current-voltage curve of sodium channels and concentration dependence of sodium permeability in frog skin

    DEFF Research Database (Denmark)

    Fuchs, W; Larsen, Erik Hviid; Lindemann, B


    1. The inward facing membranes of in vitro frog skin epithelium were depolarized with solutions of high K concentration. The electrical properties of the epithelium are then expected to be governed by the outward facing, Na-selective membrane.2. In this state, the transepithelial voltage (V...... was recorded. This procedure was repeated after blocking the Na channels with amiloride to obtain the current-voltage curve of transmembrane and paracellular shunt pathways. The current-voltage curve of the Na channels was computed by subtracting the shunt current from the total current.4. The instantaneous I...... of the inward facing membranes but reflects the true behaviour of P(Na).6. The steady-state P(Na) at a given (Na)(o) is smaller than the transient P(Na) observed right after a stepwise increase of (Na)(o) to this value. The time constant of P(Na)-relaxation is in the order of seconds.7. In conclusion, Na...

  1. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation.

    Directory of Open Access Journals (Sweden)

    Sameera Dharia


    Full Text Available Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR K(+ ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+ addition to the external bath. Cu(2+ is known to bind to the ShB-IR ion channel and inhibit Shaker K(+ conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  2. Monitoring voltage-dependent charge displacement of Shaker B-IR K+ ion channels using radio frequency interrogation. (United States)

    Dharia, Sameera; Rabbitt, Richard D


    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential and to measure channel-dependent membrane currents. Simultaneously, RF electric fields were applied to perturb the membrane potential about the TEVC level and to measure voltage-dependent RF displacement currents. ShB-IR expressing oocytes showed significantly larger changes in RF displacement currents upon membrane depolarization than control oocytes. Voltage-dependent changes in RF displacement currents further increased in ShB-IR expressing oocytes after ∼120 µM Cu(2+) addition to the external bath. Cu(2+) is known to bind to the ShB-IR ion channel and inhibit Shaker K(+) conductance, indicating that changes in the RF displacement current reported here were associated with RF vibration of the Cu(2+)-linked mobile domain of the ShB-IR protein. Results demonstrate the use of extracellular RF electrodes to interrogate voltage-dependent movement of charged mobile protein domains--capabilities that might enable detection of small changes in charge distribution associated with integral membrane protein conformation and/or drug-protein interactions.

  3. Monitoring Voltage-Dependent Charge Displacement of Shaker B-IR K+ Ion Channels Using Radio Frequency Interrogation


    Dharia, Sameera; Rabbitt, Richard D.


    Here we introduce a new technique that probes voltage-dependent charge displacements of excitable membrane-bound proteins using extracellularly applied radio frequency (RF, 500 kHz) electric fields. Xenopus oocytes were used as a model cell for these experiments, and were injected with cRNA encoding Shaker B-IR (ShB-IR) K(+) ion channels to express large densities of this protein in the oocyte membranes. Two-electrode voltage clamp (TEVC) was applied to command whole-cell membrane potential a...

  4. Pertussis toxin-sensitive alpha-adrenergic modulation of voltage - dependent calcium channels in spontaneously hypertensive rats (SHR)

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Dobešová, Zdenka; Líšková, Silvia; Kuneš, Jaroslav


    Roč. 24, č. S6 (2006), s. 34-34 ISSN 0263-6352. [Scientific Meeting of the International Society of Hypertension /21./. 15.10.2006-19.10.2006, Fukuoka] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : pertussis toxin * alpha adrenergic vasoconstriction * voltage-dependent calcium channels * SHR rat Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  5. Phosphorylation of rat brain purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal kinase-3 modifies open-channel noise. (United States)

    Gupta, Rajeev


    The drift kinetic energy of ionic flow through single ion channels cause vibrations of the pore walls which are observed as open-state current fluctuations (open-channel noise) during single-channel recordings. Vibration of the pore wall leads to transitions among different conformational sub-states of the channel protein in the open-state. Open-channel noise analysis can provide important information about the different conformational sub-state transitions and how biochemical modifications of ion channels would affect their transport properties. It has been shown that c-Jun N-terminal kinase-3 (JNK3) becomes activated by phosphorylation in various neurodegenerative diseases and phosphorylates outer mitochondrion associated proteins leading to neuronal apoptosis. In our earlier work, JNK3 has been reported to phosphorylate purified rat brain mitochondrial voltage-dependent anion channel (VDAC) in vitro and modify its conductance and opening probability. In this article we have compared the open-state noise profile of the native and the JNK3 phosphorylated VDAC using Power Spectral Density vs frequency plots. Power spectral density analysis of open-state noise indicated power law with average slope value α ≈1 for native VDAC at both positive and negative voltage whereas average α value open-state noise arises due to coupling of ionic transport and conformational sub-states transitions in open-state and this coupling is perturbed as a result of channel phosphorylation. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Inhibition of the voltage-dependent chloride channel of Torpedo electric organ by diisopropylfluorophosphate and its reversal by oximes

    International Nuclear Information System (INIS)

    Abalis, I.M.; Chiang, P.K.; Wirtz, R.A.; Andre, R.G.


    Diisopropylfluorophosphate (DFP), a potent organophosphate inhibitor of cholinesterases, was found to inhibit the specific binding of [ 35 S]t-butylbicyclophosphorothionate (TBPS), specific chloride channels ligand, to the electric organ membranes of Torpedo, with a Ki of 21 +/- 3 μM. The binding sites of [ 35 S]TBPS in the Torpedo membranes were found not to be GABA receptors or nicotinic acetylcholine receptors as previously described. Interestingly, a stimulation of the binding of [ 35 S]TBPS was observed in the presence of atropine and three oximes, monopyridinium oxime 2-PAM, bispyridinium bis-oxime TMB-4 and H-oxime HI-6. The maximal stimulation was 300-500% of control, after which, the stimulation was reversed at higher concentrations. The three oximes protected by more than 95% the inhibition by 1 mM DFP of the binding of [ 35 S]TBPS to the voltage-dependent chloride channel. However, atropine protected only 20% of the inhibited channel. These results, thus, suggest that the protection against the toxic effects of DFP or other anticholinesterase agents by the tested oximes may not be solely a result of the reactivation of cholinesterases but also the protection of the voltage-dependent chloride channel

  7. Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons. (United States)

    Cantrell, A R; Scheuer, T; Catterall, W A


    Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

  8. Voltage-gated lipid ion channels

    DEFF Research Database (Denmark)

    Blicher, Andreas; Heimburg, Thomas Rainer


    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  9. Chloride ions in the pore of glycine and GABA channels shape the time course and voltage dependence of agonist currents (United States)

    Moroni, Mirko; Biro, Istvan; Giugliano, Michele; Vijayan, Ranjit; Biggin, Philip C.; Beato, Marco; Sivilotti, Lucia G.


    In the vertebrate CNS, fast synaptic inhibition is mediated by GABA and glycine receptors. We recently reported that the time course of these synaptic currents is slower when intracellular chloride is high. Here we extend these findings to measure the effects of both extracellular and intracellular chloride on the deactivation of glycine and GABA currents at both negative and positive holding potentials. Currents were elicited by fast agonist application to outside-out patches from HEK293 cells expressing rat glycine or GABA receptors. The slowing effect of high extracellular chloride on current decay was detectable only in low intracellular chloride (4 mM). Our main finding is that glycine and GABA receptors “sense” chloride concentrations because of interactions between the M2 pore-lining domain and the permeating ions. This hypothesis is supported by the observation that the sensitivity of channel gating to intracellular chloride is abolished if the channel is engineered to become cation-selective, or if positive charges in the external pore vestibule are eliminated by mutagenesis. The appropriate interaction between permeating ions and channel pore is also necessary to maintain the channel voltage sensitivity of gating, which prolongs current decay at depolarized potentials. Voltage-dependence is abolished by the same mutations that suppress the effect of intracellular chloride and also by replacing chloride with another permeant ion, thiocyanate. These observations suggest that permeant chloride affects gating by a foot-in-the-door effect, binding to a channel site with asymmetrical access from the intracellular and extracellular sides of the membrane. PMID:21976494

  10. trans-Caryophyllene, a Natural Sesquiterpene, Causes Tracheal Smooth Muscle Relaxation through Blockade of Voltage-Dependent Ca2+ Channels

    Directory of Open Access Journals (Sweden)

    Jader Santos Cruz


    Full Text Available trans-Caryophyllene is a major component in the essential oils of various species of medicinal plants used in popular medicine in Brazil. It belongs to the chemical class of the sesquiterpenes and has been the subject of a number of studies. Here, we evaluated the effects of this compound in airway smooth muscle. The biological activities of trans-caryophyllene were examined in isolated bath organs to investigate the effect in basal tonus. Electromechanical and pharmacomechanical couplings were evaluated through the responses to K+ depolarization and exposure to acetylcholine (ACh, respectively. Isolated cells of rat tracheal smooth muscle were used to investigate trans-caryophyllene effects on voltage-dependent Ca2+ channels by using the whole-cell voltage-clamp configuration of the patch-clamp technique. trans-Caryophyllene showed more efficiency in the blockade of electromechanical excitation-contraction coupling while it has only minor inhibitory effect on pharmacomechanical coupling. Epithelium removal does not modify tracheal smooth muscle response elicited by trans-caryophyllene in the pharmacomechanical coupling. Under Ca2+-free conditions, pre-exposure to trans-caryophyllene did not reduce the contraction induced by ACh in isolated rat tracheal smooth muscle, regardless of the presence of intact epithelium. In the whole-cell configuration, trans-caryophyllene (3 mM, inhibited the inward Ba2+ current (IBa to approximately 50% of control levels. Altogether, our results demonstrate that trans-caryophyllene has anti-spasmodic activity on rat tracheal smooth muscle which could be explained, at least in part, by the voltage-dependent Ca2+ channels blockade.

  11. Distribution of voltage-dependent and intracellular Ca2+ channels in submucosal neurons from rat distal colon. (United States)

    Rehn, Matthias; Bader, Sandra; Bell, Anna; Diener, Martin


    We recently observed a bradykinin-induced increase in the cytosolic Ca2+ concentration in submucosal neurons of rat colon, an increase inhibited by blockers of voltage-dependent Ca2+ (Ca(v)) channels. As the types of Ca(v) channels used by this part of the enteric nervous system are unknown, the expression of various Ca(v) subunits has been investigated in whole-mount submucosal preparations by immunohistochemistry. Submucosal neurons, identified by a neuronal marker (microtubule-associated protein 2), are immunoreactive for Ca(v)1.2, Ca(v)1.3 and Ca(v)2.2, expression being confirmed by reverse transcription plus the polymerase chain reaction. These data agree with previous observations that the inhibition of L- and N-type Ca2+ currents strongly inhibits the response to bradykinin. However, whole-cell patch-clamp experiments have revealed that bradykinin does not enhance Ca2+ inward currents under voltage-clamp conditions. Consequently, bradykinin does not directly interact with Ca(v) channels. Instead, the kinin-induced Ca2+ influx is caused indirectly by the membrane depolarization evoked by this peptide. As intracellular Ca2+ channels on Ca(2+)-storing organelles can also contribute to Ca2+ signaling, their expression has been investigated by imaging experiments and immunohistochemistry. Inositol 1,4,5-trisphosphate (IP3) receptors (IP3R) have been functionally demonstrated in submucosal neurons loaded with the Ca(2+)-sensitive fluorescent dye, fura-2. Histamine, a typical agonist coupled to the phospholipase C pathway, induces an increase in the fura-2 signal ratio, which is suppressed by 2-aminophenylborate, a blocker of IP3 receptors. The expression of IP3R1 has been confirmed by immunohistochemistry. In contrast, ryanodine, tested over a wide concentration range, evokes no increase in the cytosolic Ca2+ concentration nor is there immunohistochemical evidence for the expression of ryanodine receptors in these neurons. Thus, rat submucosal neurons are equipped

  12. Biophysical and Pharmacological Characterization of Nav1.9 Voltage Dependent Sodium Channels Stably Expressed in HEK-293 Cells.

    Directory of Open Access Journals (Sweden)

    Zhixin Lin

    Full Text Available The voltage dependent sodium channel Nav1.9, is expressed preferentially in peripheral sensory neurons and has been linked to human genetic pain disorders, which makes it target of interest for the development of new pain therapeutics. However, characterization of Nav1.9 pharmacology has been limited due in part to the historical difficulty of functionally expressing recombinant channels. Here we report the successful generation and characterization of human, mouse and rat Nav1.9 stably expressed in human HEK-293 cells. These cells exhibit slowly activating and inactivating inward sodium channel currents that have characteristics of native Nav1.9. Optimal functional expression was achieved by coexpression of Nav1.9 with β1/β2 subunits. While recombinantly expressed Nav1.9 was found to be sensitive to sodium channel inhibitors TC-N 1752 and tetracaine, potency was up to 100-fold less than reported for other Nav channel subtypes despite evidence to support an interaction with the canonical local anesthetic (LA binding region on Domain 4 S6. Nav1.9 Domain 2 S6 pore domain contains a unique lysine residue (K799 which is predicted to be spatially near the local anesthetic interaction site. Mutation of this residue to the consensus asparagine (K799N resulted in an increase in potency for tetracaine, but a decrease for TC-N 1752, suggesting that this residue can influence interaction of inhibitors with the Nav1.9 pore. In summary, we have shown that stable functional expression of Nav1.9 in the widely used HEK-293 cells is possible, which opens up opportunities to better understand channel properties and may potentially aid identification of novel Nav1.9 based pharmacotherapies.

  13. Cloning, chromosomal localization, and functional expression of the alpha 1 subunit of the L-type voltage-dependent calcium channel from normal human heart

    NARCIS (Netherlands)

    Schultz, D; Mikala, G; Yatani, A; Engle, D B; Iles, D E; Segers, B; Sinke, R J; Weghuis, D O; Klöckner, U; Wakamori, M


    A unique structural variant of the cardiac L-type voltage-dependent calcium channel alpha 1 subunit cDNA was isolated from libraries derived from normal human heart mRNA. The deduced amino acid sequence shows significant homology to other calcium channel alpha 1 subunits. However, differences from

  14. Voltage-Gated Calcium Channels (United States)

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  15. A new mechanism of voltage-dependent gating exposed by KV10.1 channels interrupted between voltage sensor and pore. (United States)

    Tomczak, Adam P; Fernández-Trillo, Jorge; Bharill, Shashank; Papp, Ferenc; Panyi, Gyorgy; Stühmer, Walter; Isacoff, Ehud Y; Pardo, Luis A


    Voltage-gated ion channels couple transmembrane potential changes to ion flow. Conformational changes in the voltage-sensing domain (VSD) of the channel are thought to be transmitted to the pore domain (PD) through an α-helical linker between them (S4-S5 linker). However, our recent work on channels disrupted in the S4-S5 linker has challenged this interpretation for the KCNH family. Furthermore, a recent single-particle cryo-electron microscopy structure of K V 10.1 revealed that the S4-S5 linker is a short loop in this KCNH family member, confirming the need for an alternative gating model. Here we use "split" channels made by expression of VSD and PD as separate fragments to investigate the mechanism of gating in K V 10.1. We find that disruption of the covalent connection within the S4 helix compromises the ability of channels to close at negative voltage, whereas disconnecting the S4-S5 linker from S5 slows down activation and deactivation kinetics. Surprisingly, voltage-clamp fluorometry and MTS accessibility assays show that the motion of the S4 voltage sensor is virtually unaffected when VSD and PD are not covalently bound. Finally, experiments using constitutively open PD mutants suggest that the presence of the VSD is structurally important for the conducting conformation of the pore. Collectively, our observations offer partial support to the gating model that assumes that an inward motion of the C-terminal S4 helix, rather than the S4-S5 linker, closes the channel gate, while also suggesting that control of the pore by the voltage sensor involves more than one mechanism. © 2017 Tomczak et al.

  16. Impaired control of L-type voltage-dependent calcium channels in experimental hypertension

    Czech Academy of Sciences Publication Activity Database

    Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Behuliak, M.; Kuneš, Jaroslav; Zicha, Josef


    Roč. 58, Suppl.2 (2009), S43-S54 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA305/08/0139; GA ČR(CZ) GA305/09/0336; GA AV ČR(CZ) IAA500110902; GA MŠk(CZ) 1M0510 Institutional research plan: CEZ:AV0Z50110509 Keywords : calcium -activated K+ and Cl- channels * vasoactive systems * EDCF Subject RIV: ED - Physiology Impact factor: 1.430, year: 2009

  17. Heparin/heparan sulfates bind to and modulate neuronal L-type (Cav1.2) voltage-dependent Ca2+ channels

    DEFF Research Database (Denmark)

    Garau, Gianpiero; Magotti, Paola; Heine, Martin


    Our previous studies revealed that L-type voltage-dependent Ca2+ channels (Cav1.2 L-VDCCs) are modulated by the neural extracellular matrix backbone, polyanionic glycan hyaluronic acid. Here we used isothermal titration calorimetry and screened a set of peptides derived from the extracellular......M), integrating their enthalpic and entropic binding contributions. Interaction between heparin and recombinant as well as native full-length neuronal Cav1.2α1 channels was confirmed using the heparin–agarose pull down assay. Whole cell patch clamp recordings in HEK293 cells transfected with neuronal Cav1.......2 channels revealed that enzymatic digestion of highly sulfated heparan sulfates with heparinase 1 affects neither voltage-dependence of channel activation nor the level of steady state inactivation, but did speed up channel inactivation. Treatment of hippocampal cultures with heparinase 1 reduced the firing...

  18. Evolution of Voltage-Dependent Anion Channel Function: From Molecular Sieve to Governator to Actuator of Ferroptosis

    Directory of Open Access Journals (Sweden)

    John J. Lemasters


    Full Text Available The voltage-dependent anion channel (VDAC is well known as the pathway for passive diffusion of anionic hydrophilic mitochondrial metabolites across the outer membrane, but a more complex functionality of the three isoforms of VDAC has emerged, as addressed in the Frontiers in Oncology Research Topic on “Uncovering the Function of the Mitochondrial Protein VDAC in Health and Disease: from Structure-Function to Novel Therapeutic Strategies.” VDAC as the single most abundant protein in mitochondrial outer membranes is typically involved in isoform-specific interactions of the mitochondrion with its surroundings as, for example, during mitochondria-dependent pathways of cell death. VDAC closure can also act as an adjustable limiter (governator of global mitochondrial metabolism, as during hepatic ethanol metabolism to promote selective oxidation of membrane-permeant acetaldehyde. In cancer cells, high free tubulin inhibits VDAC1 and VDAC2, contributing to suppression of mitochondrial function in the Warburg phenomenon. Erastin, the canonical inducer of ferroptosis, opens VDAC in the presence of tubulin and hyperpolarizes mitochondria, leading to mitochondrial production of reactive oxygen species, mitochondrial dysfunction, and cell death. Our understanding of VDAC function continues to evolve.

  19. The Voltage-dependent Anion Channel 1 Mediates Amyloid β Toxicity and Represents a Potential Target for Alzheimer Disease Therapy. (United States)

    Smilansky, Angela; Dangoor, Liron; Nakdimon, Itay; Ben-Hail, Danya; Mizrachi, Dario; Shoshan-Barmatz, Varda


    The voltage-dependent anion channel 1 (VDAC1), found in the mitochondrial outer membrane, forms the main interface between mitochondrial and cellular metabolisms, mediates the passage of a variety of molecules across the mitochondrial outer membrane, and is central to mitochondria-mediated apoptosis. VDAC1 is overexpressed in post-mortem brains of Alzheimer disease (AD) patients. The development and progress of AD are associated with mitochondrial dysfunction resulting from the cytotoxic effects of accumulated amyloid β (Aβ). In this study we demonstrate the involvement of VDAC1 and a VDAC1 N-terminal peptide (VDAC1-N-Ter) in Aβ cell penetration and cell death induction. Aβ directly interacted with VDAC1 and VDAC1-N-Ter, as monitored by VDAC1 channel conductance, surface plasmon resonance, and microscale thermophoresis. Preincubated Aβ interacted with bilayer-reconstituted VDAC1 and increased its conductance ∼ 2-fold. Incubation of cells with Aβ resulted in mitochondria-mediated apoptotic cell death. However, the presence of non-cell-penetrating VDAC1-N-Ter peptide prevented Aβ cellular entry and Aβ-induced mitochondria-mediated apoptosis. Likewise, silencing VDAC1 expression by specific siRNA prevented Aβ entry into the cytosol as well as Aβ-induced toxicity. Finally, the mode of Aβ-mediated action involves detachment of mitochondria-bound hexokinase, induction of VDAC1 oligomerization, and cytochrome c release, a sequence of events leading to apoptosis. As such, we suggest that Aβ-mediated toxicity involves mitochondrial and plasma membrane VDAC1, leading to mitochondrial dysfunction and apoptosis induction. The VDAC1-N-Ter peptide targeting Aβ cytotoxicity is thus a potential new therapeutic strategy for AD treatment. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Coexpression of voltage-dependent calcium channels Cav1.2, 2.1a, and 2.1b in vascular myocytes

    DEFF Research Database (Denmark)

    Andreasen, Ditte; Friis, Ulla G; Uhrenholt, Torben R


    Voltage-dependent Ca2+ channels Cav1.2 (L type) and Cav2.1 (P/Q type) are expressed in vascular smooth muscle cells (VSMCs) and are important for the contraction of renal resistance vessels. In the present study we examined whether native renal VSMCs coexpress L-, P-, and Q-type Ca2+ currents...... microscopy revealed expression of both channels in all of the smooth muscle cells. Whole-cell patch clamp on single preglomerular VSMCs from mice showed L-, P-, and Q-type currents. Blockade of the L-type currents by calciseptine (20 nmol/L) inhibited 35.6+/-3.9% of the voltage-dependent Ca2+ current......-type and P-type channels inhibited 58.0+/-11.8%, and simultaneous inhibition of L-, P-, and Q-type channels led to blockade (88.7+/-5.6%) of the Ca2+ current. We conclude that aortic and renal preglomerular smooth muscle cells express L-, P-, and Q-type voltage-dependent Ca2+ channels in the rat and mouse....

  1. "Slow" Voltage-Dependent Inactivation of CaV2.2 Calcium Channels Is Modulated by the PKC Activator Phorbol 12-Myristate 13-Acetate (PMA.

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    Full Text Available CaV2.2 (N-type voltage-gated calcium channels (Ca2+ channels play key roles in neurons and neuroendocrine cells including the control of cellular excitability, neurotransmitter / hormone secretion, and gene expression. Calcium entry is precisely controlled by channel gating properties including multiple forms of inactivation. "Fast" voltage-dependent inactivation is relatively well-characterized and occurs over the tens-to- hundreds of milliseconds timeframe. Superimposed on this is the molecularly distinct, but poorly understood process of "slow" voltage-dependent inactivation, which develops / recovers over seconds-to-minutes. Protein kinases can modulate "slow" inactivation of sodium channels, but little is known about if/how second messengers control "slow" inactivation of Ca2+ channels. We investigated this using recombinant CaV2.2 channels expressed in HEK293 cells and native CaV2 channels endogenously expressed in adrenal chromaffin cells. The PKC activator phorbol 12-myristate 13-acetate (PMA dramatically prolonged recovery from "slow" inactivation, but an inactive control (4α-PMA had no effect. This effect of PMA was prevented by calphostin C, which targets the C1-domain on PKC, but only partially reduced by inhibitors that target the catalytic domain of PKC. The subtype of the channel β-subunit altered the kinetics of inactivation but not the magnitude of slowing produced by PMA. Intracellular GDP-β-S reduced the effect of PMA suggesting a role for G proteins in modulating "slow" inactivation. We postulate that the kinetics of recovery from "slow" inactivation could provide a molecular memory of recent cellular activity and help control CaV2 channel availability, electrical excitability, and neurotransmission in the seconds-to-minutes timeframe.

  2. Immunomodulatory effects of diclofenac in leukocytes through the targeting of Kv1.3 voltage-dependent potassium channels. (United States)

    Villalonga, Núria; David, Miren; Bielańska, Joanna; González, Teresa; Parra, David; Soler, Concepció; Comes, Núria; Valenzuela, Carmen; Felipe, Antonio


    Kv1.3 plays a crucial role in the activation and proliferation of T-lymphocytes and macrophages. While Kv1.3 is responsible for the voltage-dependent potassium current in T-cells, in macrophages this K(+) current is generated by the association of Kv1.3 and Kv1.5. Patients with autoimmune diseases show a high number of effector memory T cells that are characterized by a high expression of Kv1.3 and Kv1.3 antagonists ameliorate autoimmune disorders in vivo. Diclofenac is a non-steroidal anti-inflammatory drug (NSAID) used in patients who suffer from painful autoimmune diseases such as rheumatoid arthritis. In this study, we show that diclofenac impairs immune response via a mechanism that involves Kv1.3. While diclofenac inhibited Kv1.3 expression in activated macrophages and T-lymphocytes, Kv1.5 remained unaffected. Diclofenac also decreased iNOS levels in Raw 264.7 cells, impairing their activation in response to lipopolysaccharide (LPS). LPS-induced macrophage migration and IL-2 production in stimulated Jurkat T-cells were also blocked by pharmacological doses of diclofenac. These effects were mimicked by Margatoxin, a specific Kv1.3 inhibitor, and Charybdotoxin, which blocks both Kv1.3 and Ca(2+)-activated K(+) channels (K(Ca)3.1). Because Kv1.3 is a very good target for autoimmune therapies, the effects of diclofenac on Kv1.3 are of high pharmacological relevance. Copyright 2010 Elsevier Inc. All rights reserved.

  3. Photoaffinity labeling with cholesterol analogues precisely maps a cholesterol-binding site in voltage-dependent anion channel-1. (United States)

    Budelier, Melissa M; Cheng, Wayland W L; Bergdoll, Lucie; Chen, Zi-Wei; Janetka, James W; Abramson, Jeff; Krishnan, Kathiresan; Mydock-McGrane, Laurel; Covey, Douglas F; Whitelegge, Julian P; Evers, Alex S


    Voltage-dependent anion channel-1 (VDAC1) is a highly regulated β-barrel membrane protein that mediates transport of ions and metabolites between the mitochondria and cytosol of the cell. VDAC1 co-purifies with cholesterol and is functionally regulated by cholesterol, among other endogenous lipids. Molecular modeling studies based on NMR observations have suggested five cholesterol-binding sites in VDAC1, but direct experimental evidence for these sites is lacking. Here, to determine the sites of cholesterol binding, we photolabeled purified mouse VDAC1 (mVDAC1) with photoactivatable cholesterol analogues and analyzed the photolabeled sites with both top-down mass spectrometry (MS), and bottom-up MS paired with a clickable, stable isotope-labeled tag, FLI -tag. Using cholesterol analogues with a diazirine in either the 7 position of the steroid ring (LKM38) or the aliphatic tail (KK174), we mapped a binding pocket in mVDAC1 localized to Thr 83 and Glu 73 , respectively. When Glu 73 was mutated to a glutamine, KK174 no longer photolabeled this residue, but instead labeled the nearby Tyr 62 within this same binding pocket. The combination of analytical strategies employed in this work permits detailed molecular mapping of a cholesterol-binding site in a protein, including an orientation of the sterol within the site. Our work raises the interesting possibility that cholesterol-mediated regulation of VDAC1 may be facilitated through a specific binding site at the functionally important Glu 73 residue. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Neuroprotective effect of interleukin-6 regulation of voltage-gated Na+ channels of cortical neurons is time- and dose-dependent

    Directory of Open Access Journals (Sweden)

    Wei Xia


    Full Text Available Interleukin-6 has been shown to be involved in nerve injury and nerve regeneration, but the effects of long-term administration of high concentrations of interleukin-6 on neurons in the central nervous system is poorly understood. This study investigated the effects of 24 hour exposure of interleukin-6 on cortical neurons at various concentrations (0.1, 1, 5 and 10 ng/mL and the effects of 10 ng/mL interleukin-6 exposure to cortical neurons for various durations (2, 4, 8, 24 and 48 hours by studying voltage-gated Na + channels using a patch-clamp technique. Voltage-clamp recording results demonstrated that interleukin-6 suppressed Na + currents through its receptor in a time- and dose-dependent manner, but did not alter voltage-dependent activation and inactivation. Current-clamp recording results were consistent with voltage-clamp recording results. Interleukin-6 reduced the action potential amplitude of cortical neurons, but did not change the action potential threshold. The regulation of voltage-gated Na + channels in rat cortical neurons by interleukin-6 is time- and dose-dependent.

  5. The alpha2-delta protein: an auxiliary subunit of voltage-dependent calcium channels as a recognized drug target. (United States)

    Thorpe, Andrew J; Offord, James


    Currently, there are two drugs on the market, gabapentin (Neurontin) and pregabalin (Lyrica), that are proposed to exert their therapeutic effect through binding to the alpha2-delta subunit of voltage-sensitive calcium channels. This activity was unexpected, as the alpha2-delta subunit had previously been considered not to be a pharmacological target. In this review, the role of the alpha2-delta subunits is discussed and the mechanism of action of the alpha2-delta ligands in vitro and in vivo is summarized. Finally, new insights into the mechanism of drugs that bind to this protein are discussed.

  6. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes. (United States)

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan


    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  7. Noradrenergic mechanisms and high blood pressure maintenance in genetic hypertension: The role of Gi proteins and voltage-dependent calcium channels

    Czech Academy of Sciences Publication Activity Database

    Zicha, Josef; Pintérová, Mária; Líšková, Silvia; Dobešová, Zdenka; Kuneš, Jaroslav


    Roč. 29, č. 4 (2007), s. 229-229 ISSN 1064-1963. [International symposium on SHR /12./. 20.10.2006-21.10.2006, Kyoto] R&D Projects: GA MZd(CZ) NR7786 Institutional research plan: CEZ:AV0Z50110509 Keywords : genetic hypertension * noradrenergic mechanisms * Gi proteins * voltage-dependent calcium channels Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  8. Dual action of a dinoflagellate-derived precursor of Pacific ciguatoxins (P-CTX-4B) on voltage-dependent K(+) and Na(+) channels of single myelinated axons. (United States)

    Schlumberger, Sébastien; Mattei, César; Molgó, Jordi; Benoit, Evelyne


    The effects of Pacific ciguatoxin-4B (P-CTX-4B, also named gambiertoxin), extracted from toxic Gambierdiscus dinoflagellates, were assessed on nodal K(+) and Na(+) currents of frog myelinated axons, using a conventional voltage-clamp technique. P-CTX-4B decreased, within a few minutes, both K(+) and Na(+) currents in a dose-dependent manner, without inducing any marked change in current kinetics. The toxin was more effective in blocking K(+) than Na(+) channels. P-CTX-4B shifted the voltage-dependence of Na(+) conductance by about 14 mV towards more negative membrane potentials. This effect was reversed by increasing Ca(2+) in the external solution. A negative shift of about 16 mV in the steady-state Na(+) inactivation-voltage curve was also observed in the presence of the toxin. Unmodified and P-CTX-4B-modified Na(+) currents were similarly affected by the local anaesthetic lidocaine. The decrease of the two currents by lidocaine was dependent on both the concentration and the membrane potential during pre-pulses. In conclusion, P-CTX-4B appears about four times more effective than P-CTX-1B to affect K(+) channels, whereas it is about 50 times less efficient to affect Na(+) channels of axonal membranes. These actions may be related to subtle differences between the two chemical structures of molecules. Copyright 2009 Elsevier Ltd. All rights reserved.

  9. A comparative study of the effect of ciguatoxins on voltage-dependent Na+ and K+ channels in cerebellar neurons. (United States)

    Pérez, Sheila; Vale, Carmen; Alonso, Eva; Alfonso, Carmen; Rodríguez, Paula; Otero, Paz; Alfonso, Amparo; Vale, Paulo; Hirama, Masahiro; Vieytes, Mercedes R; Botana, Luis M


    Ciguatera is a global disease caused by the consumption of certain warm-water fish (ciguateric fish) that have accumulated orally effective levels of sodium channel activator toxins (ciguatoxins) through the marine food chain. The effect of ciguatoxin standards and contaminated ciguatoxin samples was evaluated by electrophysiological recordings in cultured cerebellar neurons. The toxins affected both voltage-gated sodium (Nav) and potassium channels (Kv) although with different potencies. CTX 3C was the most active toxin blocking the peak inward sodium currents, followed by P-CTX 1B and 51-OH CTX 3C. In contrast, P-CTX 1B was more effective in blocking potassium currents. The analysis of six different samples of contaminated fish, in which a ciguatoxin analogue of mass 1040.6, not identical with the standard 51-OH CTX 3C, was the most prevalent compound, indicated an additive effect of the different ciguatoxins present in the samples. The results presented here constitute the first comparison of the potencies of three different purified ciguatoxins on sodium and potassium channels in the same neuronal preparation and indicate that electrophysiological recordings from cultured cerebellar neurons may provide a valuable tool to detect and quantify ciguatoxins in the very low nanomolar range.

  10. Grafting voltage and pharmacological sensitivity in potassium channels. (United States)

    Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing


    A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

  11. Ropivacaine-Induced Contraction Is Attenuated by Both Endothelial Nitric Oxide and Voltage-Dependent Potassium Channels in Isolated Rat Aortae

    Directory of Open Access Journals (Sweden)

    Seong-Ho Ok


    Full Text Available This study investigated endothelium-derived vasodilators and potassium channels involved in the modulation of ropivacaine-induced contraction. In endothelium-intact rat aortae, ropivacaine concentration-response curves were generated in the presence or absence of the following inhibitors: the nonspecific nitric oxide synthase (NOS inhibitor Nω-nitro-L-arginine methyl ester (L-NAME, the neuronal NOS inhibitor Nω-propyl-L-arginine hydrochloride, the inducible NOS inhibitor 1400W dihydrochloride, the nitric oxide-sensitive guanylyl cyclase (GC inhibitor ODQ, the NOS and GC inhibitor methylene blue, the phosphoinositide-3 kinase inhibitor wortmannin, the cytochrome p450 epoxygenase inhibitor fluconazole, the voltage-dependent potassium channel inhibitor 4-aminopyridine (4-AP, the calcium-activated potassium channel inhibitor tetraethylammonium (TEA, the inward-rectifying potassium channel inhibitor barium chloride, and the ATP-sensitive potassium channel inhibitor glibenclamide. The effect of ropivacaine on endothelial nitric oxide synthase (eNOS phosphorylation in human umbilical vein endothelial cells was examined by western blotting. Ropivacaine-induced contraction was weaker in endothelium-intact aortae than in endothelium-denuded aortae. L-NAME, ODQ, and methylene blue enhanced ropivacaine-induced contraction, whereas wortmannin, Nω-propyl-L-arginine hydrochloride, 1400W dihydrochloride, and fluconazole had no effect. 4-AP and TEA enhanced ropivacaine-induced contraction; however, barium chloride and glibenclamide had no effect. eNOS phosphorylation was induced by ropivacaine. These results suggest that ropivacaine-induced contraction is attenuated primarily by both endothelial nitric oxide and voltage-dependent potassium channels.

  12. VKCDB: Voltage-gated potassium channel database

    Directory of Open Access Journals (Sweden)

    Gallin Warren J


    Full Text Available Abstract Background The family of voltage-gated potassium channels comprises a functionally diverse group of membrane proteins. They help maintain and regulate the potassium ion-based component of the membrane potential and are thus central to many critical physiological processes. VKCDB (Voltage-gated potassium [K] Channel DataBase is a database of structural and functional data on these channels. It is designed as a resource for research on the molecular basis of voltage-gated potassium channel function. Description Voltage-gated potassium channel sequences were identified by using BLASTP to search GENBANK and SWISSPROT. Annotations for all voltage-gated potassium channels were selectively parsed and integrated into VKCDB. Electrophysiological and pharmacological data for the channels were collected from published journal articles. Transmembrane domain predictions by TMHMM and PHD are included for each VKCDB entry. Multiple sequence alignments of conserved domains of channels of the four Kv families and the KCNQ family are also included. Currently VKCDB contains 346 channel entries. It can be browsed and searched using a set of functionally relevant categories. Protein sequences can also be searched using a local BLAST engine. Conclusions VKCDB is a resource for comparative studies of voltage-gated potassium channels. The methods used to construct VKCDB are general; they can be used to create specialized databases for other protein families. VKCDB is accessible at

  13. The calmodulin inhibitor CGS 9343B inhibits voltage-dependent K{sup +} channels in rabbit coronary arterial smooth muscle cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongliang; Hong, Da Hye; Kim, Han Sol; Kim, Hye Won [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of); Jung, Won-Kyo [Department of Biomedical Engineering, Center for Marine-Integrated Biomedical Technology (BK21 Plus), Pukyong National University, Busan 608-737 (Korea, Republic of); Na, Sung Hun [Institute of Medical Sciences, Department of Obstetrics and Gynecology, Kangwon National University Hospital, School of Medicine, Kangwon National University, Chuncheon, 200-701 (Korea, Republic of); Jung, In Duk; Park, Yeong-Min [Department of Immunology, Lab of Dendritic Cell Differentiation and Regulation, College of Medicine, Konkuk University, Chungju 380-701 (Korea, Republic of); Choi, Il-Whan, E-mail: [Department of Microbiology, Inje University College of Medicine, Busan, 614-735 (Korea, Republic of); Park, Won Sun, E-mail: [Institute of Medical Sciences, Department of Physiology, Kangwon National University School of Medicine, Chuncheon, 200-701 (Korea, Republic of)


    We investigated the effects of the calmodulin inhibitor CGS 9343B on voltage-dependent K{sup +} (Kv) channels using whole-cell patch clamp technique in freshly isolated rabbit coronary arterial smooth muscle cells. CGS 9343B inhibited Kv currents in a concentration-dependent manner, with a half-maximal inhibitory concentration (IC{sub 50}) value of 0.81 μM. The decay rate of Kv channel inactivation was accelerated by CGS 9343B. The rate constants of association and dissociation for CGS 9343B were 2.77 ± 0.04 μM{sup −1} s{sup −1} and 2.55 ± 1.50 s{sup −1}, respectively. CGS 9343B did not affect the steady-state activation curve, but shifted the inactivation curve toward to a more negative potential. Train pulses (1 or 2 Hz) application progressively increased the CGS 9343B-induced Kv channel inhibition. In addition, the inactivation recovery time constant was increased in the presence of CGS 9343B, suggesting that CGS 9343B-induced inhibition of Kv channel was use-dependent. Another calmodulin inhibitor, W-13, did not affect Kv currents, and did not change the inhibitory effect of CGS 9343B on Kv current. Our results demonstrated that CGS 9343B inhibited Kv currents in a state-, time-, and use-dependent manner, independent of calmodulin inhibition. - Highlights: • We investigated the effects of CGS 9394B on Kv channels. • CGS 9394B inhibited Kv current in a state-, time-, and use-dependent manner. • Caution is required when using CGS 9394B in vascular function studies.

  14. The Nitric Oxide Donor SNAP-Induced Amino Acid Neurotransmitter Release in Cortical Neurons. Effects of Blockers of Voltage-Dependent Sodium and Calcium Channels (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar


    Background The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. Findings The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Conclusions Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons. PMID:24598811

  15. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels. (United States)

    Merino, José Joaquín; Arce, Carmen; Naddaf, Ahmad; Bellver-Landete, Victor; Oset-Gasque, Maria Jesús; González, María Pilar


    The discovery that nitric oxide (NO) functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated. The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA) in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated. Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.

  16. The nitric oxide donor SNAP-induced amino acid neurotransmitter release in cortical neurons. Effects of blockers of voltage-dependent sodium and calcium channels.

    Directory of Open Access Journals (Sweden)

    José Joaquín Merino

    Full Text Available The discovery that nitric oxide (NO functions as a signalling molecule in the nervous system has radically changed the concept of neuronal communication. NO induces the release of amino acid neurotransmitters but the underlying mechanisms remain to be elucidated.The aim of this work was to study the effect of NO on amino acid neurotransmitter release (Asp, Glu, Gly and GABA in cortical neurons as well as the mechanism underlying the release of these neurotransmitters. Cortical neurons were stimulated with SNAP, a NO donor, and the release of different amino acid neurotransmitters was measured by HPLC. The involvement of voltage dependent Na+ and Ca2+ channels as well as cGMP in its mechanism of action was evaluated.Our results indicate that NO induces release of aspartate, glutamate, glycine and GABA in cortical neurons and that this release is inhibited by ODQ, an inhibitor of soluble guanylate cyclase. Thus, the NO effect on amino acid neurotransmission could be mediated by cGMP formation in cortical neurons. Our data also demonstrate that the Na+ and Ca2+ voltage- dependent calcium channels are involved in the NO effects on cortical neurons.


    Directory of Open Access Journals (Sweden)

    Samuel eGoodchild


    Full Text Available Voltage sensing domains of Kv channels control ionic conductance through coupling of the movement of charged residues in the S4 segment to conformational changes at the cytoplasmic region of the pore domain, that allow K+ ions to flow. Conformational transitions within the voltage sensing domain caused by changes in the applied voltage across the membrane field are coupled to the conducting pore region and the gating of ionic conductance. However, several other factors not directly linked to the voltage dependent movement of charged residues within the voltage sensor impact the dynamics of the voltage sensor, such as inactivation, ionic conductance, intracellular ion identity and block of the channel by intracellular ligands. The effect of intracellular ions on voltage sensor dynamics is of importance in the interpretation of gating current measurements and the physiology of pore/voltage sensor coupling. There is a significant amount of variability in the reported kinetics of voltage sensor deactivation kinetics of Kv channels attributed to different mechanisms such as open state stabilization, immobilization and relaxation processes of the voltage sensor. Here we separate these factors and focus on the causal role that intracellular ions can play in allosterically modulating the dynamics of Kv voltage sensor deactivation kinetics. These considerations are of critical importance in understanding the molecular determinants of the complete channel gating cycle from activation to deactivation.

  18. Ethanolic extract of Aconiti Brachypodi Radix attenuates nociceptive pain probably via inhibition of voltage-dependent Na⁺ channel. (United States)

    Ren, Wei; Yuan, Lin; Li, Jun; Huang, Xian-Ju; Chen, Su; Zou, Da-Jiang; Liu, Xiangming; Yang, Xin-Zhou


    Aconiti Brachypodi Radix, belonging to the genus of Aconitum (Family Ranunculaceae), are used clinically as anti-rheumatic, anti-inflammatory and anti-nociceptive in traditional medicine of China. However, its mechanism and influence on nociceptive threshold are unknown and need further investigation. The analgesic effects of ethanolic extract of Aconiti Brachypodi Radix (EABR) were thus studied in vivo and in vitro. Three pain models in mice were used to assess the effect of EABR on nociceptive threshold. In vitro study was conducted to clarify the modulation of the extract on the tetrodotoxin-sensitive (TTX-S) sodium currents in rat's dorsal root ganglion (DRG) neurons using whole-cell patch clamp technique. The results showed that EABR (5-20 mg/kg, i.g.) could produce dose-dependent analgesic effect on hot-plate tests as well as writhing response induced by acetic acid. In addition, administration of 2.5-10 mg/kg EABR (i.g.) caused significant decrease in pain responses in the first and second phases of formalin test without altering the PGE₂ production in the hind paw of the mice. Moreover, EABR (10 µg/ml -1 mg/ml) could suppress TTX-S voltage-gated sodium currents in a dose-dependent way, indicating the underlying electrophysiological mechanism of the analgesic effect of the folk plant medicine. Collectively, our results indicated that EABR has analgesic property in three pain models and useful influence on TTX-S sodium currents in DRG neurons, suggesting that the interference with pain messages caused by the modulation of EABR on TTX-S sodium currents in DRG neurones may explain some of its analgesic effect.

  19. Differential Activity of Voltage- and Ca2+-Dependent Potassium Channels in Leukemic T Cell Lines: Jurkat Cells Represent an Exceptional Case

    Directory of Open Access Journals (Sweden)

    Salvador Valle-Reyes


    Full Text Available Activation of resting T cells relies on sustained Ca2+ influx across the plasma membrane, which in turn depends on the functional expression of potassium channels, whose activity repolarizes the membrane potential. Depending on the T-cells subset, upon activation the expression of Ca2+- or voltage-activated K+ channels, KCa or Kv, is up-regulated. In this study, by means of patch-clamp technique in the whole cell mode, we have studied in detail the characteristics of Kv and KCa currents in resting and activated human T cells, the only well explored human T-leukemic cell line Jurkat, and two additional human leukemic T cell lines, CEM and MOLT-3. Voltage dependence of activation and inactivation of Kv1.3 current were shifted up to by 15 mV to more negative potentials upon a prolonged incubation in the whole cell mode and displayed little difference at a stable state in all cell lines but CEM, where the activation curve was biphasic, with a high and low potential components. In Jurkat, KCa currents were dominated by apamine-sensitive KCa2.2 channels, whereas only KCa3.1 current was detected in healthy T and leukemic CEM and MOLT-3 cells. Despite a high proliferation potential of Jurkat cells, Kv and KCa currents were unexpectedly small, more than 10-fold lesser as compared to activated healthy human T cells, CEM and MOLT-3, which displayed characteristic Kv1.3high:KCa3.1high phenotype. Our results suggest that Jurkat cells represent perhaps a singular case and call for more extensive studies on primary leukemic T cell lines as well as a verification of the therapeutic potential of specific KCa3.1 blockers to combat acute lymphoblastic T leukemias.

  20. Voltage Dependence of Supercapacitor Capacitance

    Directory of Open Access Journals (Sweden)

    Szewczyk Arkadiusz


    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  1. Mechanism of voltage-gated channel formation in lipid membranes. (United States)

    Guidelli, Rolando; Becucci, Lucia


    Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Chronic Ca2+ influx through voltage-dependent Ca2+ channels enhance delayed rectifier K+ currents via activating Src family tyrosine kinase in rat hippocampal neurons. (United States)

    Yang, Yoon-Sil; Jeon, Sang-Chan; Kim, Dong-Kwan; Eun, Su-Yong; Jung, Sung-Cherl


    Excessive influx and the subsequent rapid cytosolic elevation of Ca 2+ in neurons is the major cause to induce hyperexcitability and irreversible cell damage although it is an essential ion for cellular signalings. Therefore, most neurons exhibit several cellular mechanisms to homeostatically regulate cytosolic Ca 2+ level in normal as well as pathological conditions. Delayed rectifier K + channels (I DR channels) play a role to suppress membrane excitability by inducing K + outflow in various conditions, indicating their potential role in preventing pathogenic conditions and cell damage under Ca 2+ -mediated excitotoxic conditions. In the present study, we electrophysiologically evaluated the response of I DR channels to hyperexcitable conditions induced by high Ca 2+ pretreatment (3.6 mM, for 24 hours) in cultured hippocampal neurons. In results, high Ca 2+ -treatment significantly increased the amplitude of I DR without changes of gating kinetics. Nimodipine but not APV blocked Ca 2+ -induced I DR enhancement, confirming that the change of I DR might be targeted by Ca 2+ influx through voltage-dependent Ca 2+ channels (VDCCs) rather than NMDA receptors (NMDARs). The VDCC-mediated I DR enhancement was not affected by either Ca 2+ -induced Ca 2+ release (CICR) or small conductance Ca 2+ -activated K + channels (SK channels). Furthermore, PP2 but not H89 completely abolished I DR enhancement under high Ca 2+ condition, indicating that the activation of Src family tyrosine kinases (SFKs) is required for Ca 2+ -mediated I DR enhancement. Thus, SFKs may be sensitive to excessive Ca 2+ influx through VDCCs and enhance I DR to activate a neuroprotective mechanism against Ca 2+ -mediated hyperexcitability in neurons.

  3. Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.


    External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

  4. Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions. (United States)

    Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J


    External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

  5. Voltage-Dependent Anion Channel 2 of Arabidopsis thaliana (AtVDAC2 Is Involved in ABA-Mediated Early Seedling Development

    Directory of Open Access Journals (Sweden)

    Xufeng Li


    Full Text Available The voltage-dependent anion channel (VDAC is the major transport protein in the outer membrane of mitochondria and plays crucial roles in energy metabolism, apoptosis, and metabolites transport. In plants, the expression of VDACs can be affected by different stresses, including drought, salinity and pathogen defense. In this study, we investigated the expression pattern of AtVDAC2 in A. thaliana and found ABA suppressed the accumulation of AtVDAC2 transcripts. Further, phenotype analysis of this VDAC deregulated-expression transgenic Arabidopsis plants indicated that AtVDAC2 anti-sense line showed an ABA-insensitivity phenotype during the early seedling development under ABA treatment. The results suggested that AtVDAC2 might be involved in ABA signaling in A. thaliana.

  6. The voltage-dependent anion selective channel 1 (VDAC1 topography in the mitochondrial outer membrane as detected in intact cell.

    Directory of Open Access Journals (Sweden)

    Marianna F Tomasello

    Full Text Available Voltage-Dependent Anion selective Channel maintains the permeability of the outer mitochondrial membrane and is relevant in bioenergetic metabolism and apoptosis. The structure of the protein was shown to be a β-barrel formed by 19 strands. The topology or sideness of the pore has been predicted with various approaches but a general consensus was never reached. This is an important issue since VDAC is considered receptor of Hexokinase and Bcl-2. We fused at VDAC1 C-terminus two tags separated by a caspase cleavage site. Activation in cellulo of caspases was used to eventually separate the two reporters. This experiment did not require the isolation of mitochondria and limited the possibility of outer membrane rupture due to similar procedures. Our results show that the C-terminus end of VDAC faces the mitochondrial inter-membrane space.

  7. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Directory of Open Access Journals (Sweden)

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  8. Critical voltage effects in electron channeling patterns

    International Nuclear Information System (INIS)

    Farrow, R.C.


    Electron channeling patterns were used to study critical voltage effects in the metals molybdenum and tungsten. The purpose was to characterize both theoretically and experimentally how a critical voltage will affect the channeling pattern line shapes. The study focused on the second order critical voltage that results from the degeneracy between the Bloch wave states of the (110) and (220) reflections. Theoretical (110) series electron channeling pattern line profiles were calculated using the dynamical theory of Hirsch and Humphreys (1970). A 10 beam dynamical electron diffraction calculation was performed (using complex Fourier lattice potentials) to generate Bloch wave coefficients, excitation amplitudes, and absorption coefficients needed for determining backscattering coefficients and subsequent backscattered electron intensities. The theoretical model is applicable to electron diffraction at all energies since no high energy approximation or perturbation method was used

  9. Transcriptional upregulation of α2δ-1 elevates arterial smooth muscle cell voltage-dependent Ca2+ channel surface expression and cerebrovascular constriction in genetic hypertension. (United States)

    Bannister, John P; Bulley, Simon; Narayanan, Damodaran; Thomas-Gatewood, Candice; Luzny, Patrik; Pachuau, Judith; Jaggar, Jonathan H


    A hallmark of hypertension is an increase in arterial myocyte voltage-dependent Ca2+ (CaV1.2) currents that induces pathological vasoconstriction. CaV1.2 channels are heteromeric complexes composed of a pore-forming CaV1.2α1 with auxiliary α2δ and β subunits. Molecular mechanisms that elevate CaV1.2 currents during hypertension and the potential contribution of CaV1.2 auxiliary subunits are unclear. Here, we investigated the pathological significance of α2δ subunits in vasoconstriction associated with hypertension. Age-dependent development of hypertension in spontaneously hypertensive rats was associated with an unequal elevation in α2δ-1 and CaV1.2α1 mRNA and protein in cerebral artery myocytes, with α2δ-1 increasing more than CaV1.2α1. Other α2δ isoforms did not emerge in hypertension. Myocytes and arteries of hypertensive spontaneously hypertensive rats displayed higher surface-localized α2δ-1 and CaV1.2α1 proteins, surface α2δ-1:CaV1.2α1 ratio, CaV1.2 current density and noninactivating current, and pressure- and depolarization-induced vasoconstriction than those of Wistar-Kyoto controls. Pregabalin, an α2δ-1 ligand, did not alter α2δ-1 or CaV1.2α1 total protein but normalized α2δ-1 and CaV1.2α1 surface expression, surface α2δ-1:CaV1.2α1, CaV1.2 current density and inactivation, and vasoconstriction in myocytes and arteries of hypertensive rats to control levels. Genetic hypertension is associated with an elevation in α2δ-1 expression that promotes surface trafficking of CaV1.2 channels in cerebral artery myocytes. This leads to an increase in CaV1.2 current-density and a reduction in current inactivation that induces vasoconstriction. Data also suggest that α2δ-1 targeting is a novel strategy that may be used to reverse pathological CaV1.2 channel trafficking to induce cerebrovascular dilation in hypertension.

  10. Identification of mud crab reovirus VP12 and its interaction with the voltage-dependent anion-selective channel protein of mud crab Scylla paramamosain. (United States)

    Xu, Hai-Dong; Su, Hong-Jun; Zou, Wei-Bin; Liu, Shan-Shan; Yan, Wen-Rui; Wang, Qian-Qian; Yuan, Li-Li; Chan, Siuming Francis; Yu, Xiao-Qiang; He, Jian-Guo; Weng, Shao-Ping


    Mud crab reovirus (MCRV) is the causative agent of a severe disease in cultured mud crab (Scylla paramamosain), which has caused huge economic losses in China. MCRV is a double-stranded RNA virus with 12 genomic segments. In this paper, SDS-PAGE, mass spectrometry and Western blot analyses revealed that the VP12 protein encoded by S12 gene is a structural protein of MCRV. Immune electron microscopy assay indicated that MCRV VP12 is a component of MCRV outer shell capsid. Yeast two hybrid cDNA library of mud crab was constructed and mud crab voltage-dependent anion-selective channel (mcVDAC) was obtained by MCRV VP12 screening. The full length of mcVDAC was 1180 bp with an open reading frame (ORF) of 849 bp encoding a 282 amino acid protein. The mcVDAC had a constitutive expression pattern in different tissues of mud crab. The interaction between MCRV VP12 and mcVDAC was determined by co-immunoprecipitation assay. The results of this study have provided an insight on the mechanisms of MCRV infection and the interactions between the virus and mud crab. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Molecular mechanism of voltage sensing in voltage-gated proton channels (United States)

    Rebolledo, Santiago; Perez, Marta E.


    Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

  12. Mechanistic Exploration of Cancer Stem Cell Marker Voltage-Dependent Calcium Channel α2δ1 Subunit-mediated Chemotherapy Resistance in Small-Cell Lung Cancer. (United States)

    Yu, Jiangyong; Wang, Shuhang; Zhao, Wei; Duan, Jianchun; Wang, Zhijie; Chen, Hanxiao; Tian, Yanhua; Wang, Di; Zhao, Jun; An, Tongtong; Bai, Hua; Wu, Meina; Wang, Jie


    Purpose: Chemoresistance in small-cell lung cancer (SCLC) is reportedly attributed to the existence of resistant cancer stem cells (CSC). Studies involving CSC-specific markers and related mechanisms in SCLC remain limited. This study explored the role of the voltage-dependent calcium channel α2δ1 subunit as a CSC marker in chemoresistance of SCLC, and explored the potential mechanisms of α2δ1-mediated chemoresistance and strategies of overcoming the resistance. Experimental Design: α2δ1-positive cells were identified and isolated from SCLC cell lines and patient-derived xenograft (PDX) models, and CSC-like properties were subsequently verified. Transcriptome sequencing and Western blotting were carried out to identify pathways involved in α2δ1-mediated chemoresistance in SCLC. In addition, possible interventions to overcome α2δ1-mediated chemoresistance were examined. Results: Different proportions of α2δ1 + cells were identified in SCLC cell lines and PDX models. α2δ1 + cells exhibited CSC-like properties (self-renewal, tumorigenic, differentiation potential, and high expression of genes related to CSCs and drug resistance). Chemotherapy induced the enrichment of α2δ1 + cells instead of CD133 + cells in PDXs, and an increased proportion of α2δ1 + cells corresponded to increased chemoresistance. Activation and overexpression of ERK in the α2δ1-positive H1048 cell line was identified at the protein level. mAb 1B50-1 was observed to improve the efficacy of chemotherapy and delay relapse as maintenance therapy in PDX models. Conclusions: SCLC cells expressing α2δ1 demonstrated CSC-like properties, and may contribute to chemoresistance. ERK may play a key role in α2δ1-mediated chemoresistance. mAb 1B50-1 may serve as a potential anti-SCLC drug. Clin Cancer Res; 24(9); 2148-58. ©2018 AACR . ©2018 American Association for Cancer Research.

  13. A quantitative and comparative study of the effects of a synthetic ciguatoxin CTX3C on the kinetic properties of voltage-dependent sodium channels (United States)

    Yamaoka, Kaoru; Inoue, Masayuki; Miyahara, Hidemichi; Miyazaki, Keisuke; Hirama, Masahiro


    Ciguatoxins (CTXs) are known to bind to receptor site 5 of the voltage-dependent Na channel, but the toxin's physiological effects are poorly understood. In this study, we investigated the effects of a ciguatoxin congener (CTX3C) on three different Na-channel isoforms, rNav1.2, rNav1.4, and rNav1.5, which were transiently expressed in HEK293 cells. The toxin (1.0 μmol l−1) shifted the activation potential (V1/2 of activation curve) in the negative direction by 4–9 mV and increased the slope factor (k) from 8 mV to between 9 and 12 mV (indicative of decreased steepness of the activation curve), thereby resulting in a hyperpolarizing shift of the threshold potential by 30 mV for all Na channel isoforms. The toxin (1.0 μmol l−1) significantly accelerated the time-to-peak current from 0.62 to 0.52 ms in isoform rNav1.2. Higher doses of the toxin (3–10 μmol l−1) additionally decreased time-to-peak current in rNav1.4 and rNav1.5. A toxin effect on decay of INa at −20 mV was either absent or marginal even at relatively high doses of CTX3C. The toxin (1 μmol l−1) shifted the inactivation potential (V1/2 of inactivation curve) in the negative direction by 15–18 mV in all isoforms. INa maxima of the I–V curve (at −20 mV) were suppressed by application of 1.0 μmol l−1 CTX3C to a similar extent (80–85% of the control) in all the three isoforms. Higher doses of CTX3C up to 10 μmol l−1 further suppressed INa to 61–72% of the control. Recovery from slow inactivation induced by a depolarizing prepulse of intermediate duration (500 ms) was dramatically delayed in the presence of 1.0 μmol l−1 CTX3C, as time constants describing the monoexponential recovery were increased from 38±8 to 588±151 ms (n=5), 53±6 to 338±85 ms (n=4), and 23±3 to 232±117 ms (n=3) in rNav1.2, rNav1.4, and rNav1.5, respectively. CTX3C exerted multimodal effects on sodium channels, with simultaneous stimulatory and inhibitory aspects, probably due to the large

  14. Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation. (United States)

    Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing


    Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

  15. Sinusoidal voltage protocols for rapid characterisation of ion channel kinetics. (United States)

    Beattie, Kylie A; Hill, Adam P; Bardenet, Rémi; Cui, Yi; Vandenberg, Jamie I; Gavaghan, David J; de Boer, Teun P; Mirams, Gary R


    Ion current kinetics are commonly represented by current-voltage relationships, time constant-voltage relationships and subsequently mathematical models fitted to these. These experiments take substantial time, which means they are rarely performed in the same cell. Rather than traditional square-wave voltage clamps, we fitted a model to the current evoked by a novel sum-of-sinusoids voltage clamp that was only 8 s long. Short protocols that can be performed multiple times within a single cell will offer many new opportunities to measure how ion current kinetics are affected by changing conditions. The new model predicts the current under traditional square-wave protocols well, with better predictions of underlying currents than literature models. The current under a novel physiologically relevant series of action potential clamps is predicted extremely well. The short sinusoidal protocols allow a model to be fully fitted to individual cells, allowing us to examine cell-cell variability in current kinetics for the first time. Understanding the roles of ion currents is crucial to predict the action of pharmaceuticals and mutations in different scenarios, and thereby to guide clinical interventions in the heart, brain and other electrophysiological systems. Our ability to predict how ion currents contribute to cellular electrophysiology is in turn critically dependent on our characterisation of ion channel kinetics - the voltage-dependent rates of transition between open, closed and inactivated channel states. We present a new method for rapidly exploring and characterising ion channel kinetics, applying it to the hERG potassium channel as an example, with the aim of generating a quantitatively predictive representation of the ion current. We fitted a mathematical model to currents evoked by a novel 8 second sinusoidal voltage clamp in CHO cells overexpressing hERG1a. The model was then used to predict over 5 minutes of recordings in the same cell in response to

  16. Coupling between the voltage-sensing and pore domains in a voltage-gated potassium channel. (United States)

    Schow, Eric V; Freites, J Alfredo; Nizkorodov, Alex; White, Stephen H; Tobias, Douglas J


    Voltage-dependent potassium (Kv), sodium (Nav), and calcium channels open and close in response to changes in transmembrane (TM) potential, thus regulating cell excitability by controlling ion flow across the membrane. An outstanding question concerning voltage gating is how voltage-induced conformational changes of the channel voltage-sensing domains (VSDs) are coupled through the S4-S5 interfacial linking helices to the opening and closing of the pore domain (PD). To investigate the coupling between the VSDs and the PD, we generated a closed Kv channel configuration from Aeropyrum pernix (KvAP) using atomistic simulations with experiment-based restraints on the VSDs. Full closure of the channel required, in addition to the experimentally determined TM displacement, that the VSDs be displaced both inwardly and laterally around the PD. This twisting motion generates a tight hydrophobic interface between the S4-S5 linkers and the C-terminal ends of the pore domain S6 helices in agreement with available experimental evidence.

  17. Voltage gating of mechanosensitive PIEZO channels. (United States)

    Moroni, Mirko; Servin-Vences, M Rocio; Fleischer, Raluca; Sánchez-Carranza, Oscar; Lewin, Gary R


    Mechanosensitive PIEZO ion channels are evolutionarily conserved proteins whose presence is critical for normal physiology in multicellular organisms. Here we show that, in addition to mechanical stimuli, PIEZO channels are also powerfully modulated by voltage and can even switch to a purely voltage-gated mode. Mutations that cause human diseases, such as xerocytosis, profoundly shift voltage sensitivity of PIEZO1 channels toward the resting membrane potential and strongly promote voltage gating. Voltage modulation may be explained by the presence of an inactivation gate in the pore, the opening of which is promoted by outward permeation. Older invertebrate (fly) and vertebrate (fish) PIEZO proteins are also voltage sensitive, but voltage gating is a much more prominent feature of these older channels. We propose that the voltage sensitivity of PIEZO channels is a deep property co-opted to add a regulatory mechanism for PIEZO activation in widely different cellular contexts.

  18. LRRK2 regulates voltage-gated calcium channel function.

    Directory of Open Access Journals (Sweden)

    Cade eBedford


    Full Text Available Voltage-gated Ca2+ (CaV channels enable Ca2+ influx in response to membrane depolarization. CaV2.1 channels are localized to the presynaptic membrane of many types of neurons where they are involved in triggering neurotransmitter release. Several signaling proteins have been identified as important CaV2.1 regulators including protein kinases, G-proteins and Ca2+ binding proteins. Recently, we discovered that leucine rich repeat kinase 2 (LRRK2, a protein associated with inherited Parkinson’s disease, interacts with specific synaptic proteins and influences synaptic transmission. Since synaptic proteins functionally interact with CaV2.1 channels and synaptic transmission is triggered by Ca2+ entry via CaV2.1, we investigated whether LRRK2 could impact CaV2.1 channel function. CaV2.1 channel properties were measured using whole cell patch clamp electrophysiology in HEK293 cells transfected with CaV2.1 subunits and various LRRK2 constructs. Our results demonstrate that both wild type LRRK2 and the G2019S LRRK2 mutant caused a significant increase in whole cell Ca2+ current density compared to cells expressing only the CaV2.1 channel complex. In addition, LRRK2 expression caused a significant hyperpolarizing shift in voltage-dependent activation while having no significant effect on inactivation properties. These functional changes in CaV2.1 activity are likely due to a direct action of LRRK2 as we detected a physical interaction between LRRK2 and the β3 CaV channel subunit via coimmunoprecipitation. Furthermore, effects on CaV2.1 channel function are dependent on LRRK2 kinase activity as these could be reversed via treatment with a LRRK2 inhibitor. Interestingly, LRRK2 also augmented endogenous voltage-gated Ca2+ channel function in PC12 cells suggesting other CaV channels could also be regulated by LRRK2. Overall, our findings support a novel physiological role for LRRK2 in regulating CaV2.1 function that could have implications for how

  19. Cnidarian Toxins Acting on Voltage-Gated Ion Channels

    Directory of Open Access Journals (Sweden)

    Robert M. Greenberg


    Full Text Available Abstract: Voltage-gated ion channels generate electrical activity in excitable cells. As such, they are essential components of neuromuscular and neuronal systems, and are targeted by toxins from a wide variety of phyla, including the cnidarians. Here, we review cnidarian toxins known to target voltage-gated ion channels, the specific channel types targeted, and, where known, the sites of action of cnidarian toxins on different channels.

  20. Chronic electroconvulsive stimulation but not chronic restraint stress modulates mRNA expression of voltage-dependent potassium channels Kv7.2 and Kv11.1 in the rat piriform cortex

    DEFF Research Database (Denmark)

    Hjæresen, Marie-Louise; Hageman, Ida; Wörtwein, Gitta


    The mechanisms by which stress and electroconvulsive therapy exert opposite effects on the course of major depression are not known. Potential candidates might include the voltage-dependent potassium channels. Potassium channels play an important role in maintaining the resting membrane potential...... and controlling neuronal excitability. To explore this hypothesis, we examined the effects of one or several electroconvulsive stimulations and chronic restraint stress (6 h/day for 21 days) on the expression of voltage-dependent potassium channel Kv7.2, Kv11.1, and Kv11.3 mRNA in the rat brain using in situ...... hybridization. Repeated, but not acute, electroconvulsive stimulation increased Kv7.2 and Kv11.1 mRNA levels in the piriform cortex. In contrast, restraint stress had no significant effect on mRNA expression of Kv7.2, Kv11.1, or Kv11.3 in any of the brain regions examined. Thus, it appears that the investigated...

  1. Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells. (United States)

    Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik


    Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely

  2. Vascular smooth muscle cells express the alpha(1A) subunit of a P-/Q-type voltage-dependent Ca(2+)Channel, and It is functionally important in renal afferent arterioles

    DEFF Research Database (Denmark)

    Hansen, Pernille B. Lærkegaard; Jensen, Boye L.; Andreasen, D


    In the present study, we tested whether the alpha(1A) subunit, which encodes a neuronal isoform of voltage-dependent Ca(2+) channels (VDCCs) (P-/Q-type), was present and functional in vascular smooth muscle and renal resistance vessels. By reverse transcription-polymerase chain reaction...... preglomerular resistance vessels and aorta, as well as mesangial cells, and that P-type VDCCs contribute to Ca(2+) influx in aortic and renal VSMCs and are involved in depolarization-mediated contraction in renal afferent arterioles....

  3. Dual Regulation of Voltage-Sensitive Ion Channels by PIP2

    Directory of Open Access Journals (Sweden)

    Aldo A Rodríguez Menchaca


    Full Text Available Over the past 16 years, there has been an impressive number of ion channels shown to be sensitive to the major phosphoinositide in the plasma membrane, phosphatidilinositol 4,5-bisphosphate (PIP2. Among them are voltage-gated channels, which are crucial for both neuronal and cardiac excitability. Voltage-gated calcium (Cav channels were shown to be regulated bidirectionally by PIP2. On one hand, PIP2 stabilized their activity by reducing current rundown but on the other hand it produced a voltage-dependent inhibition by shifting the activation curve to more positive voltages. For voltage-gated potassium (Kv channels PIP2 was first shown to prevent N-type inactivation. Careful examination of the effects of PIP2 on the activation mechanism of Kv1.2 has shown a similar bidirectional regulation as in the Cav channels. The two effects could be distinguished kinetically, in terms of their sensitivities to PIP2 and by distinct molecular determinants. The rightward shift of the Kv1.2 voltage dependence implicated basic residues in the S4-S5 linker and was consistent with stabilization of the inactive state of the voltage sensor. A third type of a voltage-gated ion channel modulated by PIP2 is the hyperpolarization-activated cyclic nucleotide-gated (HCN channel. PIP2 has been shown to enhance the opening of HCN channels by shifting their voltage-dependent activation toward depolarized potentials. The sea urchin HCN channel, SpIH, showed again a PIP2-mediated bidirectional effect but in reverse order than the depolarization-activated Cav and Kv channels: a voltage-dependent potentiation, like the mammalian HCN channels, but also an inhibition of the cGMP-induced current activation. Just like the Kv1.2 channels, distinct molecular determinants underlied the PIP2 dual effects on SpIH channels. The dual regulation of these very different ion channels, all of which are voltage dependent, points to conserved mechanisms of regulation of these channels by PIP2.

  4. Optimized expression and purification of NavAb provide the structural insight into the voltage dependence. (United States)

    Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori


    Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

  5. Large conductance Ca2+-activated K+ (BK channel: Activation by Ca2+ and voltage

    Directory of Open Access Journals (Sweden)



    Full Text Available Large conductance Ca2+-activated K+ (BK channels belong to the S4 superfamily of K+ channels that include voltage-dependent K+ (Kv channels characterized by having six (S1-S6 transmembrane domains and a positively charged S4 domain. As Kv channels, BK channels contain a S4 domain, but they have an extra (S0 transmembrane domain that leads to an external NH2-terminus. The BK channel is activated by internal Ca2+, and using chimeric channels and mutagenesis, three distinct Ca2+-dependent regulatory mechanisms with different divalent cation selectivity have been identified in its large COOH-terminus. Two of these putative Ca2+-binding domains activate the BK channel when cytoplasmic Ca2+ reaches micromolar concentrations, and a low Ca2+ affinity mechanism may be involved in the physiological regulation by Mg2+. The presence in the BK channel of multiple Ca2+-binding sites explains the huge Ca2+ concentration range (0.1 μM-100 μM in which the divalent cation influences channel gating. BK channels are also voltage-dependent, and all the experimental evidence points toward the S4 domain as the domain in charge of sensing the voltage. Calcium can open BK channels when all the voltage sensors are in their resting configuration, and voltage is able to activate channels in the complete absence of Ca2+. Therefore, Ca2+ and voltage act independently to enhance channel opening, and this behavior can be explained using a two-tiered allosteric gating mechanism.

  6. Functional diversity of potassium channel voltage-sensing domains. (United States)

    Islas, León D


    Voltage-gated potassium channels or Kv's are membrane proteins with fundamental physiological roles. They are composed of 2 main functional protein domains, the pore domain, which regulates ion permeation, and the voltage-sensing domain, which is in charge of sensing voltage and undergoing a conformational change that is later transduced into pore opening. The voltage-sensing domain or VSD is a highly conserved structural motif found in all voltage-gated ion channels and can also exist as an independent feature, giving rise to voltage sensitive enzymes and also sustaining proton fluxes in proton-permeable channels. In spite of the structural conservation of VSDs in potassium channels, there are several differences in the details of VSD function found across variants of Kvs. These differences are mainly reflected in variations in the electrostatic energy needed to open different potassium channels. In turn, the differences in detailed VSD functioning among voltage-gated potassium channels might have physiological consequences that have not been explored and which might reflect evolutionary adaptations to the different roles played by Kv channels in cell physiology.

  7. Mechanism of electromechanical coupling in voltage-gated potassium channels

    Directory of Open Access Journals (Sweden)

    Rikard eBlunck


    Full Text Available Voltage-gated ion channels play a central role in the generation of action potentials in the nervous system. They are selective for one type of ion – sodium, calcium or potassium. Voltage-gated ion channels are composed of a central pore that allows ions to pass through the membrane and four peripheral voltage sensing domains that respond to changes in the membrane potential. Upon depolarization, voltage sensors in voltage-gated potassium channels (Kv undergo conformational changes driven by positive charges in the S4 segment and aided by pairwise electrostatic interactions with the surrounding voltage sensor. Structure-function relations of Kv channels have been investigated in detail, and the resulting models on the movement of the voltage sensors now converge to a consensus; the S4 segment undergoes a combined movement of rotation, tilt and vertical displacement in order to bring 3-4 e+ each through the electric field focused in this region. Nevertheless, the mechanism by which the voltage sensor movement leads to pore opening, the electromechanical coupling, is still not fully understood. Thus, recently, electromechanical coupling in different Kv channels has been investigated with a multitude of techniques including electrophysiology, 3D crystal structures, fluorescence spectroscopy and molecular dynamics simulations. Evidently, the S4-S5 linker, the covalent link between the voltage sensor and pore, plays a crucial role. The linker transfers the energy from the voltage sensor movement to the pore domain via an interaction with the S6 C-termini, which are pulled open during gating. In addition, other contact regions have been proposed. This review aims to provide (i an in-depth comparison of the molecular mechanisms of electromechanical coupling in different Kv channels; (ii insight as to how the voltage sensor and pore domain influence one another; and (iii theoretical predictions on the movement of the cytosolic face of the KV channels

  8. The voltage-sensing domain of a phosphatase gates the pore of a potassium channel. (United States)

    Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna


    The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.

  9. Temperature and Voltage Coupling to Channel Opening in Transient Receptor Potential Melastatin 8 (TRPM8)*♦ (United States)

    Raddatz, Natalia; Castillo, Juan P.; Gonzalez, Carlos; Alvarez, Osvaldo; Latorre, Ramon


    Expressed in somatosensory neurons of the dorsal root and trigeminal ganglion, the transient receptor potential melastatin 8 (TRPM8) channel is a Ca2+-permeable cation channel activated by cold, voltage, phosphatidylinositol 4,5-bisphosphate, and menthol. Although TRPM8 channel gating has been characterized at the single channel and macroscopic current levels, there is currently no consensus regarding the extent to which temperature and voltage sensors couple to the conduction gate. In this study, we extended the range of voltages where TRPM8-induced ionic currents were measured and made careful measurements of the maximum open probability the channel can attain at different temperatures by means of fluctuation analysis. The first direct measurements of TRPM8 channel temperature-driven conformational rearrangements provided here suggest that temperature alone is able to open the channel and that the opening reaction is voltage-independent. Voltage is a partial activator of TRPM8 channels, because absolute open probability values measured with fully activated voltage sensors are less than 1, and they decrease as temperature rises. By unveiling the fast temperature-dependent deactivation process, we show that TRPM8 channel deactivation is well described by a double exponential time course. The fast and slow deactivation processes are temperature-dependent with enthalpy changes of 27.2 and 30.8 kcal mol−1. The overall Q10 for the closing reaction is about 33. A three-tiered allosteric model containing four voltage sensors and four temperature sensors can account for the complex deactivation kinetics and coupling between voltage and temperature sensor activation and channel opening. PMID:25352597

  10. Constraints on voltage sensor movement in the shaker K+ channel. (United States)

    Darman, Rachel B; Ivy, Allison A; Ketty, Vina; Blaustein, Robert O


    In nerve and muscle cells, the voltage-gated opening and closing of cation-selective ion channels is accompanied by the translocation of 12-14 elementary charges across the membrane's electric field. Although most of these charges are carried by residues in the S4 helix of the gating module of these channels, the precise nature of their physical movement is currently the topic of spirited debate. Broadly speaking, two classes of models have emerged: those that suggest that small-scale motions can account for the extensive charge displacement, and those that invoke a much larger physical movement. In the most recent incarnation of the latter type of model, which is based on structural and functional data from the archaebacterial K(+) channel KvAP, a "voltage-sensor paddle" comprising a helix-turn-helix of S3-S4 translocates approximately 20 A through the bilayer during the gating cycle (Jiang, Y., A. Lee, J. Chen, V. Ruta, M. Cadene, B.T. Chait, and R. MacKinnon. 2003. Nature. 423:33-41; Jiang, Y., V. Ruta, J. Chen, A. Lee, and R. MacKinnon. 2003. Nature. 423:42-48.; Ruta, V., J. Chen, and R. MacKinnon. 2005. Cell. 123:463-475). We used two methods to test for analogous motions in the Shaker K(+) channel, each examining the aqueous exposure of residues near S3. In the first, we employed a pore-blocking maleimide reagent (Blaustein, R.O., P.A. Cole, C. Williams, and C. Miller. 2000. Nat. Struct. Biol. 7:309-311) to probe for state-dependent changes in the chemical reactivity of substituted cysteines; in the second, we tested the state-dependent accessibility of a tethered biotin to external streptavidin (Qiu, X.Q., K.S. Jakes, A. Finkelstein, and S.L. Slatin. 1994. J. Biol. Chem. 269:7483-7488; Slatin, S.L., X.Q. Qiu, K.S. Jakes, and A. Finkelstein. 1994. Nature. 371:158-161). In both types of experiments, residues predicted to lie near the top of S3 did not exhibit any change in aqueous exposure during the gating cycle. This lack of state dependence argues against

  11. C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1. (United States)

    Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer


    Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.

  12. Voltage-gated sodium channels: action players with many faces

    NARCIS (Netherlands)

    Koopmann, Tamara T.; Bezzina, Connie R.; Wilde, Arthur A. M.


    Voltage-gated sodium channels are responsible for the upstroke of the action potential and thereby play an important role in propagation of the electrical impulse in excitable tissues like muscle, nerve and the heart. Duplication of the sodium channels encoding genes during evolution generated the

  13. Voltage-gated proton channel is expressed on phagosomes

    International Nuclear Information System (INIS)

    Okochi, Yoshifumi; Sasaki, Mari; Iwasaki, Hirohide; Okamura, Yasushi


    Voltage-gated proton channel has been suggested to help NADPH oxidase activity during respiratory burst of phagocytes through its activities of compensating charge imbalance and regulation of pH. In phagocytes, robust production of reactive oxygen species occurs in closed membrane compartments, which are called phagosomes. However, direct evidence for the presence of voltage-gated proton channels in phagosome has been lacking. In this study, the expression of voltage-gated proton channels was studied by Western blot with the antibody specific to the voltage-sensor domain protein, VSOP/Hv1, that has recently been identified as the molecular correlate for the voltage-gated proton channel. Phagosomal membranes of neutrophils contain VSOP/Hv1 in accordance with subunits of NADPH oxidases, gp91, p22, p47 and p67. Superoxide anion production upon PMA activation was significantly reduced in neutrophils from VSOP/Hv1 knockout mice. These are consistent with the idea that voltage-gated proton channels help NADPH oxidase in phagocytes to produce reactive oxygen species.

  14. Expression and distribution of voltage-gated ion channels in ferret sinoatrial node. (United States)

    Brahmajothi, Mulugu V; Morales, Michael J; Campbell, Donald L; Steenbergen, Charles; Strauss, Harold C


    Spontaneous diastolic depolarization in the sinoatrial (SA) node enables it to serve as pacemaker of the heart. The variable cell morphology within the SA node predicts that ion channel expression would be heterogeneous and different from that in the atrium. To evaluate ion channel heterogeneity within the SA node, we used fluorescent in situ hybridization to examine ion channel expression in the ferret SA node region and atrial appendage. SA nodal cells were distinguished from surrounding cardiac myocytes by expression of the slow (SA node) and cardiac (surrounding tissue) forms of troponin I. Nerve cells in the sections were identified by detection of GAP-43 and cytoskeletal middle neurofilament. Transcript expression was characterized for the 4 hyperpolarization-activated cation channels, 6 voltage-gated Na(+) channels, 3 voltage-gated Ca(2+) channels, 24 voltage-gated K(+) channel α-subunits, and 3 ancillary subunits. To ensure that transcript expression was representative of protein expression, immunofluorescence was used to verify localization patterns of voltage-dependent K(+) channels. Colocalizations were performed to observe any preferential patterns. Some overlapping and nonoverlapping binding patterns were observed. Measurement of different cation channel transcripts showed heterogeneous expression with many different patterns of expression, attesting to the complexity of electrical activity in the SA node. This study provides insight into the possible role ion channel heterogeneity plays in SA node pacemaker activity.

  15. Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain. (United States)

    Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo


    The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

  16. Kv7.1 ion channels require a lipid to couple voltage sensing to pore opening. (United States)

    Zaydman, Mark A; Silva, Jonathan R; Delaloye, Kelli; Li, Yang; Liang, Hongwu; Larsson, H Peter; Shi, Jingyi; Cui, Jianmin


    Voltage-gated ion channels generate dynamic ionic currents that are vital to the physiological functions of many tissues. These proteins contain separate voltage-sensing domains, which detect changes in transmembrane voltage, and pore domains, which conduct ions. Coupling of voltage sensing and pore opening is critical to the channel function and has been modeled as a protein-protein interaction between the two domains. Here, we show that coupling in Kv7.1 channels requires the lipid phosphatidylinositol 4,5-bisphosphate (PIP2). We found that voltage-sensing domain activation failed to open the pore in the absence of PIP2. This result is due to loss of coupling because PIP2 was also required for pore opening to affect voltage-sensing domain activation. We identified a critical site for PIP2-dependent coupling at the interface between the voltage-sensing domain and the pore domain. This site is actually a conserved lipid-binding site among different K(+) channels, suggesting that lipids play an important role in coupling in many ion channels.

  17. Identification of an HV 1 voltage-gated proton channel in insects. (United States)

    Chaves, Gustavo; Derst, Christian; Franzen, Arne; Mashimo, Yuta; Machida, Ryuichiro; Musset, Boris


    The voltage-gated proton channel 1 (HV 1) is an important component of the cellular proton extrusion machinery and is essential for charge compensation during the respiratory burst of phagocytes. HV 1 has been identified in a wide range of eukaryotes throughout the animal kingdom, with the exception of insects. Therefore, it has been proposed that insects do not possess an HV 1 channel. In the present study, we report the existence of an HV 1-type proton channel in insects. We searched insect transcriptome shotgun assembly (TSA) sequence databases and found putative HV 1 orthologues in various polyneopteran insects. To confirm that these putative HV 1 orthologues were functional channels, we studied the HV 1 channel of Nicoletia phytophila (NpHV 1), an insect of the Zygentoma order, in more detail. NpHV 1 comprises 239 amino acids and is 33% identical to the human voltage-gated proton channel 1. Patch clamp measurements in a heterologous expression system showed proton selectivity, as well as pH- and voltage-dependent gating. Interestingly, NpHV 1 shows slightly enhanced pH-dependent gating compared to the human channel. Mutations in the first transmembrane segment at position 66 (Asp66), the presumed selectivity filter, lead to a loss of proton-selective conduction, confirming the importance of this aspartate residue in voltage-gated proton channels. Nucleotide sequence data have been deposited in the GenBank database under accession number KT780722. © 2016 Federation of European Biochemical Societies.

  18. Gating of Connexin Channels by transjunctional-voltage: Conformations and models of open and closed states. (United States)

    Bargiello, Thaddeus A; Oh, Seunghoon; Tang, Qingxiu; Bargiello, Nicholas K; Dowd, Terry L; Kwon, Taekyung


    Voltage is an important physiologic regulator of channels formed by the connexin gene family. Connexins are unique among ion channels in that both plasma membrane inserted hemichannels (undocked hemichannels) and intercellular channels (aggregates of which form gap junctions) have important physiological roles. The hemichannel is the fundamental unit of gap junction voltage-gating. Each hemichannel displays two distinct voltage-gating mechanisms that are primarily sensitive to a voltage gradient formed along the length of the channel pore (the transjunctional voltage) rather than sensitivity to the absolute membrane potential (V m or V i-o ). These transjunctional voltage dependent processes have been termed V j - or fast-gating and loop- or slow-gating. Understanding the mechanism of voltage-gating, defined as the sequence of voltage-driven transitions that connect open and closed states, first and foremost requires atomic resolution models of the end states. Although ion channels formed by connexins were among the first to be characterized structurally by electron microscopy and x-ray diffraction in the early 1980's, subsequent progress has been slow. Much of the current understanding of the structure-function relations of connexin channels is based on two crystal structures of Cx26 gap junction channels. Refinement of crystal structure by all-atom molecular dynamics and incorporation of charge changing protein modifications has resulted in an atomic model of the open state that arguably corresponds to the physiologic open state. Obtaining validated atomic models of voltage-dependent closed states is more challenging, as there are currently no methods to solve protein structure while a stable voltage gradient is applied across the length of an oriented channel. It is widely believed that the best approach to solve the atomic structure of a voltage-gated closed ion channel is to apply different but complementary experimental and computational methods and to use

  19. Ca2+-dependent K+ Channels in Exocrine Salivary Glands (United States)

    Catalán, Marcelo A.; Peña-Munzenmayer, Gaspar; Melvin, James E.


    In the last 15 years, remarkable progress has been realized in identifying the genes that encode the ion-transporting proteins involved in exocrine gland function, including salivary glands. Among these proteins, Ca2+-dependent K+ channels take part in key functions including membrane potential regulation, fluid movement and K+ secretion in exocrine glands. Two K+ channels have been identified in exocrine salivary glands: 1) a Ca2+-activated K+ channel of intermediate single channel conductance encoded by the KCNN4 gene; and, 2) a voltage- and Ca2+-dependent K+ channel of large single channel conductance encoded by the KCNMA1 gene. This review focuses on the physiological roles of Ca2+-dependent K+ channels in exocrine salivary glands. We also discuss interesting recent findings on the regulation of Ca2+-dependent K+ channels by protein-protein interactions that may significantly impact exocrine gland physiology. PMID:24559652

  20. A Non-canonical Voltage-Sensing Mechanism Controls Gating in K2P K(+) Channels. (United States)

    Schewe, Marcus; Nematian-Ardestani, Ehsan; Sun, Han; Musinszki, Marianne; Cordeiro, Sönke; Bucci, Giovanna; de Groot, Bert L; Tucker, Stephen J; Rapedius, Markus; Baukrowitz, Thomas


    Two-pore domain (K2P) K(+) channels are major regulators of excitability that endow cells with an outwardly rectifying background "leak" conductance. In some K2P channels, strong voltage-dependent activation has been observed, but the mechanism remains unresolved because they lack a canonical voltage-sensing domain. Here, we show voltage-dependent gating is common to most K2P channels and that this voltage sensitivity originates from the movement of three to four ions into the high electric field of an inactive selectivity filter. Overall, this ion-flux gating mechanism generates a one-way "check valve" within the filter because outward movement of K(+) induces filter opening, whereas inward movement promotes inactivation. Furthermore, many physiological stimuli switch off this flux gating mode to convert K2P channels into a leak conductance. These findings provide insight into the functional plasticity of a K(+)-selective filter and also refine our understanding of K2P channels and the mechanisms by which ion channels can sense voltage. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Genotypic to expression profiling of bovine calcium channel, voltage-dependent, alpha-2/delta subunit 1 gene, and their association with bovine mastitis among Frieswal (HFX Sahiwal) crossbred cattle of Indian origin. (United States)

    Deb, Rajib; Singh, Umesh; Kumar, Sushil; Kumar, Arun; Singh, Rani; Sengar, Gyanendra; Mann, Sandeep; Sharma, Arjava


    Calcium channel, voltage-dependent, alpha-2/delta subunit 1 (CACNA2D1) gene is considered to be an important noncytokine candidate gene influencing mastitis. Scanty of reports are available until today regarding the role play of CACNA2D1 gene on the susceptibility of bovine mastitis. We interrogated the CACNA2D1 G519663A [A>G] SNP by PCR-RFLP among two hundreds Frieswal (HF X Sahiwal) crossbred cattle of Indian origin. Genotypic frequency of AA (51.5, n=101) was comparatively higher than AG (35, n=70) and GG (14.5, n=29). Association of Somatic cell score (SCS) with genotypes revealed that, GG genotypes showing lesser count (less susceptible to mastitis) compare to AA and AG. Relative expression of CACNA2D1 transcript (in milk samples) was significantly higher among GG than AG and AA. Further we have also isolated blood sample from the all groups and PBMCs were cultured from each blood sample as per the standard protocol. They were treated with Calcium channel blocker and the expression level of the CACNA2D1 gene was evaluated by Real Time PCR. Results show that expression level decline in each genotypic group after treatment and expression level of GG are again significantly higher than AA and AG. Thus, it may be concluded that GG genotypic animals are favorable for selecting disease resistant breeds.

  2. Axonal voltage-gated ion channels as pharmacological targets for pain

    DEFF Research Database (Denmark)

    Moldovan, Mihai; Alvarez, Susana; Romer Rosberg, Mette


    Upon peripheral nerve injury (caused by trauma or disease process) axons of the dorsal root ganglion (DRG) somatosensory neurons have the ability to sprout and regrow/remyelinate to reinnervate distant target tissue or form a tangled scar mass called a neuroma. This regenerative response can become...... maladaptive leading to a persistent and debilitating pain state referred to as chronic pain corresponding to the clinical description of neuropathic/chronic inflammatory pain. There is little agreement to what causes peripheral chronic pain other than hyperactivity of the nociceptive DRG neurons which...... ultimately depends on the function of voltage-gated ion channels. This review focuses on the pharmacological modulators of voltage-gated ion channels known to be present on axonal membrane which represents by far the largest surface of DRG neurons. Blockers of voltage-gated Na(+) channels, openers of voltage...

  3. Voltage-dependent amplification of synaptic inputs in respiratory motoneurones (United States)

    Enríquez Denton, M; Wienecke, J; Zhang, M; Hultborn, H; Kirkwood, P A


    The role of persistent inward currents (PICs) in cat respiratory motoneurones (phrenic inspiratory and thoracic expiratory) was investigated by studying the voltage-dependent amplification of central respiratory drive potentials (CRDPs), recorded intracellularly, with action potentials blocked with the local anaesthetic derivative, QX-314. Decerebrate unanaesthetized or barbiturate-anaesthetized preparations were used. In expiratory motoneurones, plateau potentials were observed in the decerebrates, but not under anaesthesia. For phrenic motoneurones, no plateau potentials were observed in either state (except in one motoneurone after the abolition of the respiratory drive by means of a medullary lesion), but all motoneurones showed voltage-dependent amplification of the CRDPs, over a wide range of membrane potentials, too wide to result mainly from PIC activation. The measurements of the amplification were restricted to the phase of excitation, thus excluding the inhibitory phase. Amplification was found to be greatest for the smallest CRDPs in the lowest resistance motoneurones and was reduced or abolished following intracellular injection of the NMDA channel blocker, MK-801. Plateau potentials were readily evoked in non-phrenic cervical motoneurones in the same (decerebrate) preparations. We conclude that the voltage-dependent amplification of synaptic excitation in phrenic motoneurones is mainly the result of NMDA channel modulation rather than the activation of Ca2+ channel mediated PICs, despite phrenic motoneurones being strongly immunohistochemically labelled for CaV1.3 channels. The differential PIC activation in different motoneurones, all of which are CaV1.3 positive, leads us to postulate that the descending modulation of PICs is more selective than has hitherto been believed. PMID:22495582

  4. Free-energy relationships in ion channels activated by voltage and ligand (United States)

    Chowdhury, Sandipan


    Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

  5. Local anesthetics disrupt energetic coupling between the voltage-sensing segments of a sodium channel. (United States)

    Muroi, Yukiko; Chanda, Baron


    Local anesthetics block sodium channels in a state-dependent fashion, binding with higher affinity to open and/or inactivated states. Gating current measurements show that local anesthetics immobilize a fraction of the gating charge, suggesting that the movement of voltage sensors is modified when a local anesthetic binds to the pore of the sodium channel. Here, using voltage clamp fluorescence measurements, we provide a quantitative description of the effect of local anesthetics on the steady-state behavior of the voltage-sensing segments of a sodium channel. Lidocaine and QX-314 shifted the midpoints of the fluorescence-voltage (F-V) curves of S4 domain III in the hyperpolarizing direction by 57 and 65 mV, respectively. A single mutation in the S6 of domain IV (F1579A), a site critical for local anesthetic block, abolished the effect of QX-314 on the voltage sensor of domain III. Both local anesthetics modestly shifted the F-V relationships of S4 domain IV toward hyperpolarized potentials. In contrast, the F-V curve of the S4 domain I was shifted by 11 mV in the depolarizing direction upon QX-314 binding. These antagonistic effects of the local anesthetic indicate that the drug modifies the coupling between the voltage-sensing domains of the sodium channel. Our findings suggest a novel role of local anesthetics in modulating the gating apparatus of the sodium channel.

  6. Cardiovascular action of insulin in health and disease: focus in endothelial L-arginine transport and cardiac voltage-dependent potassium channels.

    Directory of Open Access Journals (Sweden)

    Sebastián eDubó


    Full Text Available The impairment of insulin signaling on diabetes mellitus has been related to cardiovascular dysfunction, heart failure and sudden death. In human endothelium, cationic amino acid transporter 1 (hCAT-1 is related to the synthesis of nitric oxide (NO. Insulin has a vascular effect in endothelial cells through a signaling pathway that involved increases of hCAT-1 expression and L-arginine transport. This mechanism is disrupted in diabetes, a phenomenon potentiated by excessive accumulation of reactive oxygen species (ROS, which contributes to lower availability of NO and endothelial dysfunction. On the other hand, the electrical remodeling in cardiomyocytes is considered a key factor in heart failure progression associated to diabetes mellitus, generating a challenge to understand the specific role of insulin and the pathways involved in cardiac function. Studies on isolated mammalian cardiomyocytes have shown a prolongated action potential in ventricular repolarization phase that produces a long QT interval. The long QT generated is well explained by attenuation in the repolarizing potassium currents in cardiac ventricles. The impaired insulin signaling causes specific changes in these currents, such a decrease amplitude of the transient outward K+ (Ito and the ultra-rapid delayed rectifier (IKur currents where, together, a reduction of mRNA and protein expression levels of α-subunits (Ito, fast; Kv 4.2 and IKs; Kv 1.5 or β-subunits (KChIP2 and MiRP of K+ channels involved in these currents in a MAPK mediated pathway process have been described. These results support the hypothesis that the lack of insulin signaling can produce an abnormal repolarization in cardiomyocytes. Furthermore, the arrhythmogenic potential due to reduced Ito current can contribute to an increase in the incidence of sudden death in heart failure. This review aims to show, based on pathophysiological models, the regulatory function that would have insulin in vascular

  7. Investigating ion channel conformational changes using voltage clamp fluorometry. (United States)

    Talwar, Sahil; Lynch, Joseph W


    Ion channels are membrane proteins whose functions are governed by conformational changes. The widespread distribution of ion channels, coupled with their involvement in most physiological and pathological processes and their importance as therapeutic targets, renders the elucidation of these conformational mechanisms highly compelling from a drug discovery perspective. Thanks to recent advances in structural biology techniques, we now have high-resolution static molecular structures for members of the major ion channel families. However, major questions remain to be resolved about the conformational states that ion channels adopt during activation, drug modulation and desensitization. Patch-clamp electrophysiology has long been used to define ion channel conformational states based on functional criteria. It achieves this by monitoring conformational changes at the channel gate and cannot detect conformational changes occurring in regions distant from the gate. Voltage clamp fluorometry involves labelling cysteines introduced into domains of interest with environmentally sensitive fluorophores and inferring structural rearrangements from voltage or ligand-induced fluorescence changes. Ion channel currents are monitored simultaneously to verify the conformational status. By defining real time conformational changes in domains distant from the gate, this technique provides unexpected new insights into ion channel structure and function. This review aims to summarise the methodology and highlight recent innovative applications of this powerful technique. This article is part of the Special Issue entitled 'Fluorescent Tools in Neuropharmacology'. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Voltage-gated sodium channels as targets for pyrethroid insecticides. (United States)

    Field, Linda M; Emyr Davies, T G; O'Reilly, Andrias O; Williamson, Martin S; Wallace, B A


    The pyrethroid insecticides are a very successful group of compounds that have been used extensively for the control of arthropod pests of agricultural crops and vectors of animal and human disease. Unfortunately, this has led to the development of resistance to the compounds in many species. The mode of action of pyrethroids is known to be via interactions with the voltage-gated sodium channel. Understanding how binding to the channel is affected by amino acid substitutions that give rise to resistance has helped to elucidate the mode of action of the compounds and the molecular basis of their selectivity for insects vs mammals and between insects and other arthropods. Modelling of the channel/pyrethroid interactions, coupled with the ability to express mutant channels in oocytes and study function, has led to knowledge of both how the channels function and potentially how to design novel insecticides with greater species selectivity.

  9. Voltage-gated sodium channels in taste bud cells. (United States)

    Gao, Na; Lu, Min; Echeverri, Fernando; Laita, Bianca; Kalabat, Dalia; Williams, Mark E; Hevezi, Peter; Zlotnik, Albert; Moyer, Bryan D


    Taste bud cells transmit information regarding the contents of food from taste receptors embedded in apical microvilli to gustatory nerve fibers innervating basolateral membranes. In particular, taste cells depolarize, activate voltage-gated sodium channels, and fire action potentials in response to tastants. Initial cell depolarization is attributable to sodium influx through TRPM5 in sweet, bitter, and umami cells and an undetermined cation influx through an ion channel in sour cells expressing PKD2L1, a candidate sour taste receptor. The molecular identity of the voltage-gated sodium channels that sense depolarizing signals and subsequently initiate action potentials coding taste information to gustatory nerve fibers is unknown. We describe the molecular and histological expression profiles of cation channels involved in electrical signal transmission from apical to basolateral membrane domains. TRPM5 was positioned immediately beneath tight junctions to receive calcium signals originating from sweet, bitter, and umami receptor activation, while PKD2L1 was positioned at the taste pore. Using mouse taste bud and lingual epithelial cells collected by laser capture microdissection, SCN2A, SCN3A, and SCN9A voltage-gated sodium channel transcripts were expressed in taste tissue. SCN2A, SCN3A, and SCN9A were expressed beneath tight junctions in subsets of taste cells. SCN3A and SCN9A were expressed in TRPM5 cells, while SCN2A was expressed in TRPM5 and PKD2L1 cells. HCN4, a gene previously implicated in sour taste, was expressed in PKD2L1 cells and localized to cell processes beneath the taste pore. SCN2A, SCN3A and SCN9A voltage-gated sodium channels are positioned to sense initial depolarizing signals stemming from taste receptor activation and initiate taste cell action potentials. SCN2A, SCN3A and SCN9A gene products likely account for the tetrodotoxin-sensitive sodium currents in taste receptor cells.

  10. The metal-ion-dependent adhesion site in the Von Willebrand factor-A domain of α2δ subunits is key to trafficking voltage-gated Ca2+ channels (United States)

    Cantí, C.; Nieto-Rostro, M.; Foucault, I.; Heblich, F.; Wratten, J.; Richards, M. W.; Hendrich, J.; Douglas, L.; Page, K. M.; Davies, A.; Dolphin, A. C.


    All auxiliary α2δ subunits of voltage-gated Ca2+ (CaV) channels contain an extracellular Von Willebrand factor-A (VWA) domain that, in α2δ-1 and -2, has a perfect metal-ion-dependent adhesion site (MIDAS). Modeling of the α2δ-2 VWA domain shows it to be highly likely to bind a divalent cation. Mutating the three key MIDAS residues responsible for divalent cation binding resulted in a MIDAS mutant α2δ-2 subunit that was still processed and trafficked normally when it was expressed alone. However, unlike WT α2δ-2, the MIDAS mutant α2δ-2 subunit did not enhance and, in some cases, further diminished CaV1.2, -2.1, and -2.2 currents coexpressed with β1b by using either Ba2+ or Na+ as a permeant ion. Furthermore, expression of the MIDAS mutant α2δ-2 reduced surface expression and strongly increased the perinuclear retention of CaVα1 subunits at the earliest time at which expression was observed in both Cos-7 and NG108–15 cells. Despite the presence of endogenous α2δ subunits, heterologous expression of α2δ-2 in differentiated NG108–15 cells further enhanced the endogenous high-threshold Ca2+ currents, whereas this enhancement was prevented by the MIDAS mutations. Our results indicate that α2δ subunits normally interact with the CaVα1 subunit early in their maturation, before the appearance of functional plasma membrane channels, and an intact MIDAS motif in the α2δ subunit is required to promote trafficking of the α1 subunit to the plasma membrane by an integrin-like switch. This finding provides evidence for a primary role of a VWA domain in intracellular trafficking of a multimeric complex, in contrast to the more usual roles in binding extracellular ligands in other exofacial VWA domains. PMID:16061813

  11. Gating transitions in the selectivity filter region of a sodium channel are coupled to the domain IV voltage sensor. (United States)

    Capes, Deborah L; Arcisio-Miranda, Manoel; Jarecki, Brian W; French, Robert J; Chanda, Baron


    Voltage-dependent ion channels are crucial for generation and propagation of electrical activity in biological systems. The primary mechanism for voltage transduction in these proteins involves the movement of a voltage-sensing domain (D), which opens a gate located on the cytoplasmic side. A distinct conformational change in the selectivity filter near the extracellular side has been implicated in slow inactivation gating, which is important for spike frequency adaptation in neural circuits. However, it remains an open question whether gating transitions in the selectivity filter region are also actuated by voltage sensors. Here, we examine conformational coupling between each of the four voltage sensors and the outer pore of a eukaryotic voltage-dependent sodium channel. The voltage sensors of these sodium channels are not structurally symmetric and exhibit functional specialization. To track the conformational rearrangements of individual voltage-sensing domains, we recorded domain-specific gating pore currents. Our data show that, of the four voltage sensors, only the domain IV voltage sensor is coupled to the conformation of the selectivity filter region of the sodium channel. Trapping the outer pore in a particular conformation with a high-affinity toxin or disulphide crossbridge impedes the return of this voltage sensor to its resting conformation. Our findings directly establish that, in addition to the canonical electromechanical coupling between voltage sensor and inner pore gates of a sodium channel, gating transitions in the selectivity filter region are also coupled to the movement of a voltage sensor. Furthermore, our results also imply that the voltage sensor of domain IV is unique in this linkage and in the ability to initiate slow inactivation in sodium channels.

  12. The Voltage-Dependent Anion Channel 1 (AtVDAC1 Negatively Regulates Plant Cold Responses during Germination and Seedling Development in Arabidopsis and Interacts with Calcium Sensor CBL1

    Directory of Open Access Journals (Sweden)

    Zhi-Yong Li


    Full Text Available The voltage-dependent anion channel (VDAC, a highly conserved major mitochondrial outer membrane protein, plays crucial roles in energy metabolism and metabolite transport. However, knowledge about the roles of the VDAC family in plants is limited. In this study, we investigated the expression pattern of VDAC1 in Arabidopsis and found that cold stress promoted the accumulation of VDAC1 transcripts in imbibed seeds and mature plants. Overexpression of VDAC1 reduced tolerance to cold stress in Arabidopsis. Phenotype analysis of VDAC1 T-DNA insertion mutant plants indicated that a vdac1 mutant line had faster germination kinetics under cold treatment and showed enhanced tolerance to freezing. The yeast two-hybrid system revealed that VDAC1 interacts with CBL1, a calcium sensor in plants. Like the vdac1, a cbl1 mutant also exhibited a higher seed germination rate. We conclude that both VDAC1 and CBL1 regulate cold stress responses during seed germination and plant development.

  13. Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function

    Directory of Open Access Journals (Sweden)

    Richard J. Lewis


    Full Text Available Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.

  14. Ciguatoxins: Cyclic Polyether Modulators of Voltage-gated Iion Channel Function (United States)

    Nicholson, Graham M.; Lewis, Richard J.


    Ciguatoxins are cyclic polyether toxins, derived from marine dinoflagellates, which are responsible for the symptoms of ciguatera poisoning. Ingestion of tropical and subtropical fin fish contaminated by ciguatoxins results in an illness characterised by neurological, cardiovascular and gastrointestinal disorders. The pharmacology of ciguatoxins is characterised by their ability to cause persistent activation of voltage-gated sodium channels, to increase neuronal excitability and neurotransmitter release, to impair synaptic vesicle recycling, and to cause cell swelling. It is these effects, in combination with an action to block voltage-gated potassium channels at high doses, which are believed to underlie the complex of symptoms associated with ciguatera. This review examines the sources, structures and pharmacology of ciguatoxins. In particular, attention is placed on their cellular modes of actions to modulate voltage-gated ion channels and other Na+-dependent mechanisms in numerous cell types and to current approaches for detection and treatment of ciguatera.

  15. Cholesterol influences voltage-gated calcium channels and BK-type potassium channels in auditory hair cells.

    Directory of Open Access Journals (Sweden)

    Erin K Purcell

    Full Text Available The influence of membrane cholesterol content on a variety of ion channel conductances in numerous cell models has been shown, but studies exploring its role in auditory hair cell physiology are scarce. Recent evidence shows that cholesterol depletion affects outer hair cell electromotility and the voltage-gated potassium currents underlying tall hair cell development, but the effects of cholesterol on the major ionic currents governing auditory hair cell excitability are unknown. We investigated the effects of a cholesterol-depleting agent (methyl beta cyclodextrin, MβCD on ion channels necessary for the early stages of sound processing. Large-conductance BK-type potassium channels underlie temporal processing and open in a voltage- and calcium-dependent manner. Voltage-gated calcium channels (VGCCs are responsible for calcium-dependent exocytosis and synaptic transmission to the auditory nerve. Our results demonstrate that cholesterol depletion reduced peak steady-state calcium-sensitive (BK-type potassium current by 50% in chick cochlear hair cells. In contrast, MβCD treatment increased peak inward calcium current (~30%, ruling out loss of calcium channel expression or function as a cause of reduced calcium-sensitive outward current. Changes in maximal conductance indicated a direct impact of cholesterol on channel number or unitary conductance. Immunoblotting following sucrose-gradient ultracentrifugation revealed BK expression in cholesterol-enriched microdomains. Both direct impacts of cholesterol on channel biophysics, as well as channel localization in the membrane, may contribute to the influence of cholesterol on hair cell physiology. Our results reveal a new role for cholesterol in the regulation of auditory calcium and calcium-activated potassium channels and add to the growing evidence that cholesterol is a key determinant in auditory physiology.

  16. Voltage-Gated Proton Channels: Molecular Biology, Physiology, and Pathophysiology of the HV Family (United States)


    Voltage-gated proton channels (HV) are unique, in part because the ion they conduct is unique. HV channels are perfectly selective for protons and have a very small unitary conductance, both arguably manifestations of the extremely low H+ concentration in physiological solutions. They open with membrane depolarization, but their voltage dependence is strongly regulated by the pH gradient across the membrane (ΔpH), with the result that in most species they normally conduct only outward current. The HV channel protein is strikingly similar to the voltage-sensing domain (VSD, the first four membrane-spanning segments) of voltage-gated K+ and Na+ channels. In higher species, HV channels exist as dimers in which each protomer has its own conduction pathway, yet gating is cooperative. HV channels are phylogenetically diverse, distributed from humans to unicellular marine life, and perhaps even plants. Correspondingly, HV functions vary widely as well, from promoting calcification in coccolithophores and triggering bioluminescent flashes in dinoflagellates to facilitating killing bacteria, airway pH regulation, basophil histamine release, sperm maturation, and B lymphocyte responses in humans. Recent evidence that hHV1 may exacerbate breast cancer metastasis and cerebral damage from ischemic stroke highlights the rapidly expanding recognition of the clinical importance of hHV1. PMID:23589829

  17. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid. (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi


    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

  18. Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid (United States)

    Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi


    The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

  19. Voltage Dependence of a Neuromodulator-Activated Ionic Current123 (United States)


    Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

  20. Voltage-gated calcium channels of Paramecium cilia. (United States)

    Lodh, Sukanya; Yano, Junji; Valentine, Megan S; Van Houten, Judith L


    Paramecium cells swim by beating their cilia, and make turns by transiently reversing their power stroke. Reversal is caused by Ca 2+ entering the cilium through voltage-gated Ca 2+ (Ca V ) channels that are found exclusively in the cilia. As ciliary Ca 2+ levels return to normal, the cell pivots and swims forward in a new direction. Thus, the activation of the Ca V channels causes cells to make a turn in their swimming paths. For 45 years, the physiological characteristics of the Paramecium ciliary Ca V channels have been known, but the proteins were not identified until recently, when the P. tetraurelia ciliary membrane proteome was determined. Three Ca V α1 subunits that were identified among the proteins were cloned and confirmed to be expressed in the cilia. We demonstrate using RNA interference that these channels function as the ciliary Ca V channels that are responsible for the reversal of ciliary beating. Furthermore, we show that Pawn (pw) mutants of Paramecium that cannot swim backward for lack of Ca V channel activity do not express any of the three Ca V 1 channels in their ciliary membrane, until they are rescued from the mutant phenotype by expression of the wild-type PW gene. These results reinforce the correlation of the three Ca V channels with backward swimming through ciliary reversal. The PwB protein, found in endoplasmic reticulum fractions, co-immunoprecipitates with the Ca V 1c channel and perhaps functions in trafficking. The PwA protein does not appear to have an interaction with the channel proteins but affects their appearance in the cilia. © 2016. Published by The Company of Biologists Ltd.

  1. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien


    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  2. Voltage-Sensitive Ion Channels Biophysics of Molecular Excitability

    CERN Document Server

    Leuchtag, H. Richard


    Voltage-sensitive ion channels are macromolecules embedded in the membranes of nerve and muscle fibers of animals. Because of their physiological functions, biochemical structures and electrical switching properties, they are at an intersection of biology, chemistry and physics. Despite decades of intensive research under the traditional approach of gated structural pores, the relation between the structure of these molecules and their function remains enigmatic. This book critically examines physically oriented approaches not covered in other ion-channel books. It looks at optical and thermal as well as electrical data, and at studies in the frequency domain as well as in the time domain. Rather than presenting the reader with only an option of mechanistic models at an inappropriate pseudo-macroscopic scale, it emphasizes concepts established in organic chemistry and condensed state physics. The book’s approach to the understanding of these unique structures breaks with the unproven view of ion channels as...


    Rowan, Matthew JM; Bulley, Simon; Purpura, Lauren; Ripps, Harris; Shen, Wen


    Taurine activates not only Cl−-permeable ionotropic receptors, but also receptors that mediate metabotropic responses. The metabotropic property of taurine was revealed in electrophysiological recordings obtained after fully blocking Cl−-permeable receptors with an inhibitory “cocktail” consisting of picrotoxin, SR95531, and strychnine. We found that taurine’s metabotropic effects regulate voltage-gated channels in retinal neurons. After applying the inhibitory cocktail, taurine enhanced delayed outward rectifier K+ channels preferentially in Off-bipolar cells, and the effect was completely blocked by the specific PKC inhibitor, GF109203X. Additionally, taurine also acted through a metabotropic pathway to suppress both L- and N-type Ca2+ channels in retinal neurons, which were insensitive to the potent GABAB receptor inhibitor, CGP55845. This study reinforces our previous finding that taurine in physiological concentrations produces a multiplicity of metabotropic effects that precisely govern the integration of signals being transmitted from the retina to the brain. PMID:23392926

  4. Cloning and expression of the translocator protein (18 kDa), voltage-dependent anion channel, and diazepam binding inhibitor in the gonad of largemouth bass (Micropterus salmoides) across the reproductive cycle. (United States)

    Doperalski, Nicholas J; Martyniuk, Christopher J; Prucha, Melinda S; Kroll, Kevin J; Denslow, Nancy D; Barber, David S


    Cholesterol transport across the mitochondrial membrane is rate-limiting for steroidogenesis in vertebrates. Previous studies in fish have characterized expression of the steroidogenic acute regulatory protein, however the function and regulation of other genes and proteins involved in piscine cholesterol transport have not been evaluated. In the current study, mRNA sequences of the 18 kDa translocator protein (tspo; formerly peripheral benzodiazepine receptor), voltage-dependent anion channel (vdac), and diazepam binding inhibitor (dbi; also acyl-CoA binding protein) were cloned from largemouth bass. Gonadal expression was examined across reproductive stages to determine if expression is correlated with changes in steroid levels and with indicators of reproductive maturation. In testis, transcript abundance of tspo and dbi increased with reproductive maturation (6- and 23-fold maximal increase, respectively) and expression of tspo and dbi was positively correlated with reproductive stage, gonadosomatic index (GSI), and circulating levels of testosterone. Testis vdac expression was positively correlated with reproductive stage and GSI. In females, gonadal tspo and vdac expression was negatively correlated with GSI and levels of plasma testosterone and 17β-estradiol. Ovarian dbi expression was not correlated with indicators of reproductive maturation. These studies represent the first investigation of the steroidogenic role of tspo, vdac, and dbi in fish. Findings suggest that cholesterol transport in largemouth bass testis, but not in ovary, may be transcriptionally-regulated, however further investigation will be necessary to fully elucidate the role of these genes in largemouth bass steroidogenesis. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Voltage-gated sodium channels in taste bud cells

    Directory of Open Access Journals (Sweden)

    Williams Mark E


    Full Text Available Abstract Background Taste bud cells transmit information regarding the contents of food from taste receptors embedded in apical microvilli to gustatory nerve fibers innervating basolateral membranes. In particular, taste cells depolarize, activate voltage-gated sodium channels, and fire action potentials in response to tastants. Initial cell depolarization is attributable to sodium influx through TRPM5 in sweet, bitter, and umami cells and an undetermined cation influx through an ion channel in sour cells expressing PKD2L1, a candidate sour taste receptor. The molecular identity of the voltage-gated sodium channels that sense depolarizing signals and subsequently initiate action potentials coding taste information to gustatory nerve fibers is unknown. Results We describe the molecular and histological expression profiles of cation channels involved in electrical signal transmission from apical to basolateral membrane domains. TRPM5 was positioned immediately beneath tight junctions to receive calcium signals originating from sweet, bitter, and umami receptor activation, while PKD2L1 was positioned at the taste pore. Using mouse taste bud and lingual epithelial cells collected by laser capture microdissection, SCN2A, SCN3A, and SCN9A voltage-gated sodium channel transcripts were expressed in taste tissue. SCN2A, SCN3A, and SCN9A were expressed beneath tight junctions in subsets of taste cells. SCN3A and SCN9A were expressed in TRPM5 cells, while SCN2A was expressed in TRPM5 and PKD2L1 cells. HCN4, a gene previously implicated in sour taste, was expressed in PKD2L1 cells and localized to cell processes beneath the taste pore. Conclusion SCN2A, SCN3A and SCN9A voltage-gated sodium channels are positioned to sense initial depolarizing signals stemming from taste receptor activation and initiate taste cell action potentials. SCN2A, SCN3A and SCN9A gene products likely account for the tetrodotoxin-sensitive sodium currents in taste receptor cells.

  6. Sterol Regulation of Voltage-Gated K+ Channels. (United States)

    Balajthy, Andras; Hajdu, Peter; Panyi, Gyorgy; Varga, Zoltan


    Cholesterol is an essential lipid building block of the cellular plasma membrane. In addition to its structural role, it regulates the fluidity and raft structure of the membrane and influences the course of numerous membrane-linked signaling pathways and the function of transmembrane proteins, including ion channels. This is supported by a vast body of scientific data, which demonstrates the modulation of ion channels with a great variety of ion selectivity, gating, and tissue distribution by changes in membrane cholesterol. Here, we review what is currently known about the modulation of voltage-gated K + (Kv) channels by changes in membrane cholesterol content, considering raft association of the channels, the roles of cholesterol recognition sites, and those of adaptor proteins in cholesterol-Kv channel interactions. We specifically focus on Kv1.3, the dominant K + channel of human T cells. Effects of cholesterol depletion and enrichment and 7-dehydrocholesterol enrichment on Kv1.3 gating are discussed in the context of the immunological synapse and the comparison of the in vitro effects of sterol modifications on Kv1.3 function with ex vivo effects on cells from hypercholesterolemic and Smith-Lemli-Opitz patients. © 2017 Elsevier Inc. All rights reserved.

  7. Direct Interaction between the Voltage Sensors Produces Cooperative Sustained Deactivation in Voltage-gated H+ Channel Dimers*


    Okuda, Hiroko; Yonezawa, Yasushige; Takano, Yu; Okamura, Yasushi; Fujiwara, Yuichiro


    The voltage-gated H+ channel (Hv) is a voltage sensor domain-like protein consisting of four transmembrane segments (S1?S4). The native Hv structure is a homodimer, with the two channel subunits functioning cooperatively. Here we show that the two voltage sensor S4 helices within the dimer directly cooperate via a ?-stacking interaction between Trp residues at the middle of each segment. Scanning mutagenesis showed that Trp situated around the original position provides the slow gating kineti...

  8. Unfolding of a Temperature-Sensitive Domain Controls Voltage-Gated Channel Activation. (United States)

    Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S; Minor, Daniel L


    Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNa(V)) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNa(V) CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNa(V) CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNa(V) voltage dependencies, and demonstrate that a discrete domain can encode the temperature-dependent response of a channel. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. The cooperative voltage sensor motion that gates a potassium channel. (United States)

    Pathak, Medha; Kurtz, Lisa; Tombola, Francesco; Isacoff, Ehud


    The four arginine-rich S4 helices of a voltage-gated channel move outward through the membrane in response to depolarization, opening and closing gates to generate a transient ionic current. Coupling of voltage sensing to gating was originally thought to operate with the S4s moving independently from an inward/resting to an outward/activated conformation, so that when all four S4s are activated, the gates are driven to open or closed. However, S4 has also been found to influence the cooperative opening step (Smith-Maxwell et al., 1998a), suggesting a more complex mechanism of coupling. Using fluorescence to monitor structural rearrangements in a Shaker channel mutant, the ILT channel (Ledwell and Aldrich, 1999), that energetically isolates the steps of activation from the cooperative opening step, we find that opening is accompanied by a previously unknown and cooperative movement of S4. This gating motion of S4 appears to be coupled to the internal S6 gate and to two forms of slow inactivation. Our results suggest that S4 plays a direct role in gating. While large transmembrane rearrangements of S4 may be required to unlock the gating machinery, as proposed before, it appears to be the gating motion of S4 that drives the gates to open and close.

  10. Marine Toxins That Target Voltage-gated Sodium Channels

    Directory of Open Access Journals (Sweden)

    Robert J. French


    Full Text Available Abstract: Eukaryotic, voltage-gated sodium (NaV channels are large membrane proteins which underlie generation and propagation of rapid electrical signals in nerve, muscle and heart. Nine different NaV receptor sites, for natural ligands and/or drugs, have been identified, based on functional analyses and site-directed mutagenesis. In the marine ecosystem, numerous toxins have evolved to disrupt NaV channel function, either by inhibition of current flow through the channels, or by modifying the activation and inactivation gating processes by which the channels open and close. These toxins function in their native environment as offensive or defensive weapons in prey capture or deterrence of predators. In composition, they range from organic molecules of varying size and complexity to peptides consisting of ~10-70 amino acids. We review the variety of known NaV-targeted marine toxins, outlining, where known, their sites of interaction with the channel protein and their functional effects. In a number of cases, these natural ligands have the potential applications as drugs in clinical settings, or as models for drug development.

  11. Surface dynamics of voltage-gated ion channels (United States)

    Heine, Martin; Ciuraszkiewicz, Anna; Voigt, Andreas; Heck, Jennifer; Bikbaev, Arthur


    ABSTRACT Neurons encode information in fast changes of the membrane potential, and thus electrical membrane properties are critically important for the integration and processing of synaptic inputs by a neuron. These electrical properties are largely determined by ion channels embedded in the membrane. The distribution of most ion channels in the membrane is not spatially uniform: they undergo activity-driven changes in the range of minutes to days. Even in the range of milliseconds, the composition and topology of ion channels are not static but engage in highly dynamic processes including stochastic or activity-dependent transient association of the pore-forming and auxiliary subunits, lateral diffusion, as well as clustering of different channels. In this review we briefly discuss the potential impact of mobile sodium, calcium and potassium ion channels and the functional significance of this for individual neurons and neuronal networks. PMID:26891382

  12. Toxins That Affect Voltage-Gated Sodium Channels. (United States)

    Ji, Yonghua


    Voltage-gated sodium channels (VGSCs) are critical in generation and conduction of electrical signals in multiple excitable tissues. Natural toxins, produced by animal, plant, and microorganisms, target VGSCs through diverse strategies developed over millions of years of evolutions. Studying of the diverse interaction between VGSC and VGSC-targeting toxins has been contributing to the increasing understanding of molecular structure and function, pharmacology, and drug development potential of VGSCs. This chapter aims to summarize some of the current views on the VGSC-toxin interaction based on the established receptor sites of VGSC for natural toxins.

  13. Contributions of counter-charge in a potassium channel voltage-sensor domain

    DEFF Research Database (Denmark)

    Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P


    Voltage-sensor domains couple membrane potential to conformational changes in voltage-gated ion channels and phosphatases. Highly coevolved acidic and aromatic side chains assist the transfer of cationic side chains across the transmembrane electric field during voltage sensing. We investigated...... the functional contribution of negative electrostatic potentials from these residues to channel gating and voltage sensing with unnatural amino acid mutagenesis, electrophysiology, voltage-clamp fluorometry and ab initio calculations. The data show that neutralization of two conserved acidic side chains...

  14. Twenty-channel high-voltage pulse generators

    International Nuclear Information System (INIS)

    Anan'in, P.S.; Kashirin, A.P.


    A 20-channel high-voltage pulse generator operating with a mismatched load is described. The generator contains shaping lines 20 m long made of coaxial cable, a trigatron-type discharged, and isolating plates. The channel characteristic impedance is 50 Ohm. The maximum pulse amplitude is up to 15 kV on a high-resistance load and 7.5 kV on a matched one. The pulse duration is 100 ns at a pulse rise time of 12 ns, the delay introduced by the generator is 200 +-2.5 ns. Provision is made in the control circuit for compensation of the shaped pulse and separation of a pulse reflected from the load. The reflected pulse shape and amplitude characterize load parameters. Generator tests proved its high operational reliability (after 10 5 operations no significant changes in generator performances have been observed). The generator is intended for filmless data output from spark chambers

  15. Modulation of voltage-gated channel currents by harmaline and harmane. (United States)

    Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich


    Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system. While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABA(A) receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels. The aim of this study was to investigate the effects of harmaline and harmane on voltage-activated calcium- (I(Ca(V))), sodium- (I(Na(V))) and potassium (I(K(V)))-channel currents, using the whole-cell patch-clamp method with cultured dorsal root ganglion neurones of 3-week-old rats. Currents were elicited by voltage steps from the holding potential to different command potentials. Harmaline and harmane reduced I(Ca(V)), I(Na(V)) and I(K(V)) concentration-dependent (10-500 microM) over the voltage range tested. I(Ca(V)) was reduced with an IC(50) of 100.6 microM for harmaline and by a significantly lower concentration of 75.8 microM (P<0.001, t-test) for harmane. The Hill coefficient was close to 1. Threshold concentration was around 10 microM for both substances. The steady state of inhibition of I(Ca(V)) by harmaline or harmane was reached within several minutes. The action was not use-dependent and at least partly reversible. It was mainly due to a reduction in the sustained calcium channel current (I(Ca(L+N))), while the transient voltage-gated calcium channel current (I(Ca(T))) was only partially affected. We conclude that harmaline and harmane are modulators of I(Ca(V)) in vitro. This might be related to their neuroprotective effects.

  16. Neuronal trafficking of voltage-gated potassium channels

    DEFF Research Database (Denmark)

    Jensen, Camilla S; Rasmussen, Hanne Borger; Misonou, Hiroaki


    The computational ability of CNS neurons depends critically on the specific localization of ion channels in the somatodendritic and axonal membranes. Neuronal dendrites receive synaptic inputs at numerous spines and integrate them in time and space. The integration of synaptic potentials is regul......The computational ability of CNS neurons depends critically on the specific localization of ion channels in the somatodendritic and axonal membranes. Neuronal dendrites receive synaptic inputs at numerous spines and integrate them in time and space. The integration of synaptic potentials...

  17. Photocontrol of Voltage-Gated Ion Channel Activity by Azobenzene Trimethylammonium Bromide in Neonatal Rat Cardiomyocytes.

    Directory of Open Access Journals (Sweden)

    Sheyda R Frolova

    Full Text Available The ability of azobenzene trimethylammonium bromide (azoTAB to sensitize cardiac tissue excitability to light was recently reported. The dark, thermally relaxed trans- isomer of azoTAB suppressed spontaneous activity and excitation propagation speed, whereas the cis- isomer had no detectable effect on the electrical properties of cardiomyocyte monolayers. As the membrane potential of cardiac cells is mainly controlled by activity of voltage-gated ion channels, this study examined whether the sensitization effect of azoTAB was exerted primarily via the modulation of voltage-gated ion channel activity. The effects of trans- and cis- isomers of azoTAB on voltage-dependent sodium (INav, calcium (ICav, and potassium (IKv currents in isolated neonatal rat cardiomyocytes were investigated using the whole-cell patch-clamp technique. The experiments showed that azoTAB modulated ion currents, causing suppression of sodium (Na+ and calcium (Ca2+ currents and potentiation of net potassium (K+ currents. This finding confirms that azoTAB-effect on cardiac tissue excitability do indeed result from modulation of voltage-gated ion channels responsible for action potential.

  18. KCNE5 induces time- and voltage-dependent modulation of the KCNQ1 current

    DEFF Research Database (Denmark)

    Angelo, Kamilla; Jespersen, Thomas; Grunnet, Morten


    The function of the KCNE5 (KCNE1-like) protein has not previously been described. Here we show that KCNE5 induces both a time- and voltage-dependent modulation of the KCNQ1 current. Interaction of the KCNQ1 channel with KCNE5 shifted the voltage activation curve of KCNQ1 by more than 140 mV in th...... the I(Ks) current in certain parts of the mammalian heart....

  19. Domain IV voltage-sensor movement is both sufficient and rate limiting for fast inactivation in sodium channels. (United States)

    Capes, Deborah L; Goldschen-Ohm, Marcel P; Arcisio-Miranda, Manoel; Bezanilla, Francisco; Chanda, Baron


    Voltage-gated sodium channels are critical for the generation and propagation of electrical signals in most excitable cells. Activation of Na(+) channels initiates an action potential, and fast inactivation facilitates repolarization of the membrane by the outward K(+) current. Fast inactivation is also the main determinant of the refractory period between successive electrical impulses. Although the voltage sensor of domain IV (DIV) has been implicated in fast inactivation, it remains unclear whether the activation of DIV alone is sufficient for fast inactivation to occur. Here, we functionally neutralize each specific voltage sensor by mutating several critical arginines in the S4 segment to glutamines. We assess the individual role of each voltage-sensing domain in the voltage dependence and kinetics of fast inactivation upon its specific inhibition. We show that movement of the DIV voltage sensor is the rate-limiting step for both development and recovery from fast inactivation. Our data suggest that activation of the DIV voltage sensor alone is sufficient for fast inactivation to occur, and that activation of DIV before channel opening is the molecular mechanism for closed-state inactivation. We propose a kinetic model of sodium channel gating that can account for our major findings over a wide voltage range by postulating that DIV movement is both necessary and sufficient for fast inactivation.

  20. Dynamics of the resistive state of a narrow superconducting channel in the ac voltage-driven regime

    International Nuclear Information System (INIS)

    Yerin, Yu.S.; Fenchenko, V.N.


    Within the time-dependent Ginzburg-Landau equations the dynamics of the order parameter in superconducting narrow channels of different lengths is investigated in the ac voltage-driven regime. The resistive state of the system at low frequencies of the applied voltage is characterized by the formation of periodic-in-time groups of oscillating phase-slip centers (PSC). An increase in frequency reduces the duration of the existence of these periodic groups. Depending on the length of the channel the ac voltage either tends to revert the channel to the state with one central PSC in periodic groups or minimizes the number of forming PSCs and orders their pattern in the system. A further increase in frequency for rather short channels leads to suppression of the order parameter without any creation of PSCs. For systems, whose length exceeds the specified limit, the formation of PSC occurs after a certain time which increases rapidly with frequency. The current-voltage characteristics of rather short channels at different applied voltage frequencies are calculated too. It is found that the current-voltage characteristics have a step-like structure, and the height of the first step is determined by the quadruple value of the Josephson frequency.

  1. A complicated complex: Ion channels, voltage sensing, cell membranes and peptide inhibitors. (United States)

    Zhang, Alan H; Sharma, Gagan; Undheim, Eivind A B; Jia, Xinying; Mobli, Mehdi


    Voltage-gated ion channels (VGICs) are specialised ion channels that have a voltage dependent mode of action, where ion conduction, or gating, is controlled by a voltage-sensing mechanism. VGICs are critical for electrical signalling and are therefore important pharmacological targets. Among these, voltage-gated sodium channels (Na V s) have attracted particular attention as potential analgesic targets. Na V s, however, comprise several structurally similar subtypes with unique localisations and distinct functions, ranging from amplification of action potentials in nociception (e.g. Na V 1.7) to controlling electrical signalling in cardiac function (Na V 1.5). Understanding the structural basis of Na V function is therefore of great significance, both to our knowledge of electrical signalling and in development of subtype and state selective drugs. An important tool in this pursuit has been the use of peptides from animal venoms as selective Na V modulators. In this review, we look at peptides, particularly from spider venoms, that inhibit Na V s by binding to the voltage sensing domain (VSD) of this channel, known as gating modifier toxins (GMT). In the first part of the review, we look at the structural determinants of voltage sensing in VGICs, the gating cycle and the conformational changes that accompany VSD movement. Next, the modulation of the analgesic target Na V 1.7 by GMTs is reviewed to develop bioinformatic tools that, based on sequence information alone, can identify toxins that are likely to inhibit this channel. The same approach is also used to define VSD sequences, other than that from Na V 1.7, which are likely to be sensitive to this class of toxins. The final section of the review focuses on the important role of the cellular membrane in channel modulation and also how the lipid composition affects measurements of peptide-channel interactions both in binding kinetics measurements in solution and in cell-based functional assays. Copyright © 2018

  2. Scorpion β-toxin interference with NaV channel voltage sensor gives rise to excitatory and depressant modes (United States)

    Leipold, Enrico; Borges, Adolfo


    Scorpion β toxins, peptides of ∼70 residues, specifically target voltage-gated sodium (NaV) channels to cause use-dependent subthreshold channel openings via a voltage–sensor trapping mechanism. This excitatory action is often overlaid by a not yet understood depressant mode in which NaV channel activity is inhibited. Here, we analyzed these two modes of gating modification by β-toxin Tz1 from Tityus zulianus on heterologously expressed NaV1.4 and NaV1.5 channels using the whole cell patch-clamp method. Tz1 facilitated the opening of NaV1.4 in a use-dependent manner and inhibited channel opening with a reversed use dependence. In contrast, the opening of NaV1.5 was exclusively inhibited without noticeable use dependence. Using chimeras of NaV1.4 and NaV1.5 channels, we demonstrated that gating modification by Tz1 depends on the specific structure of the voltage sensor in domain 2. Although residue G658 in NaV1.4 promotes the use-dependent transitions between Tz1 modification phenotypes, the equivalent residue in NaV1.5, N803, abolishes them. Gating charge neutralizations in the NaV1.4 domain 2 voltage sensor identified arginine residues at positions 663 and 669 as crucial for the outward and inward movement of this sensor, respectively. Our data support a model in which Tz1 can stabilize two conformations of the domain 2 voltage sensor: a preactivated outward position leading to NaV channels that open at subthreshold potentials, and a deactivated inward position preventing channels from opening. The results are best explained by a two-state voltage–sensor trapping model in that bound scorpion β toxin slows the activation as well as the deactivation kinetics of the voltage sensor in domain 2. PMID:22450487

  3. Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels. (United States)

    Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E


    Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms

  4. Molecular identity of dendritic voltage-gated sodium channels. (United States)

    Lorincz, Andrea; Nusser, Zoltan


    Active invasion of the dendritic tree by action potentials (APs) generated in the axon is essential for associative synaptic plasticity and neuronal ensemble formation. In cortical pyramidal cells (PCs), this AP back-propagation is supported by dendritic voltage-gated Na+ (Nav) channels, whose molecular identity is unknown. Using a highly sensitive electron microscopic immunogold technique, we revealed the presence of the Nav1.6 subunit in hippocampal CA1 PC proximal and distal dendrites. Here, the subunit density is lower by a factor of 35 to 80 than that found in axon initial segments. A gradual decrease in Nav1.6 density along the proximodistal axis of the dendritic tree was also detected without any labeling in dendritic spines. Our results reveal the characteristic subcellular distribution of the Nav1.6 subunit, identifying this molecule as a key substrate enabling dendritic excitability.

  5. Sleep disturbances in voltage-gated potassium channel antibody syndrome. (United States)

    Barone, Daniel A; Krieger, Ana C


    Voltage-gated potassium channels (VGKCs) are a family of membrane proteins responsible for controlling cell membrane potential. The presence of antibodies (Ab) against neuronal VGKC complexes aids in the diagnosis of idiopathic and paraneoplastic autoimmune neurologic disorders. The diagnosis of VGKC Ab-associated encephalopathy (VCKC Ab syndrome) should be suspected in patients with subacute onset of disorientation, confusion, and memory loss in the presence of seizures or a movement disorder. VGKC Ab syndrome may present with sleep-related symptoms, and the purpose of this communication is to alert sleep and neurology clinicians of this still-under-recognized condition. In this case, we are presenting the VGKC Ab syndrome which improved after treatment with solumedrol. The prompt recognition and treatment of this condition may prevent the morbidity associated with cerebral atrophy and the mortality associated with intractable seizures and electrolyte disturbances. Copyright © 2016. Published by Elsevier B.V.

  6. Atomistic Modeling of Ion Conduction through the Voltage-Sensing Domain of the Shaker K+ Ion Channel. (United States)

    Wood, Mona L; Freites, J Alfredo; Tombola, Francesco; Tobias, Douglas J


    Voltage-sensing domains (VSDs) sense changes in the membrane electrostatic potential and, through conformational changes, regulate a specific function. The VSDs of wild-type voltage-dependent K + , Na + , and Ca 2+ channels do not conduct ions, but they can become ion-permeable through pathological mutations in the VSD. Relatively little is known about the underlying mechanisms of conduction through VSDs. The most detailed studies have been performed on Shaker K + channel variants in which ion conduction through the VSD is manifested in electrophysiology experiments as a voltage-dependent inward current, the so-called omega current, which appears when the VSDs are in their resting state conformation. Only monovalent cations appear to permeate the Shaker VSD via a pathway that is believed to be, at least in part, the same as that followed by the S4 basic side chains during voltage-dependent activation. We performed μs-time scale atomistic molecular dynamics simulations of a cation-conducting variant of the Shaker VSD under applied electric fields in an experimentally validated resting-state conformation, embedded in a lipid bilayer surrounded by solutions containing guanidinium chloride or potassium chloride. Our simulations provide insights into the Shaker VSD permeation pathway, the protein-ion interactions that control permeation kinetics, and the mechanism of voltage-dependent activation of voltage-gated ion channels.

  7. Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels. (United States)

    Carvalho-de-Souza, Joao L; Bezanilla, Francisco


    Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018

  8. Functional characterization of Kv11.1 (hERG) potassium channels split in the voltage-sensing domain. (United States)

    de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco


    Voltage-dependent KCNH family potassium channel functionality can be reconstructed using non-covalently linked voltage-sensing domain (VSD) and pore modules (split channels). However, the necessity of a covalent continuity for channel function has not been evaluated at other points within the two functionally independent channel modules. We find here that by cutting Kv11.1 (hERG, KCNH2) channels at the different loops linking the transmembrane spans of the channel core, not only channels split at the S4-S5 linker level, but also those split at the intracellular S2-S3 and the extracellular S3-S4 loops, yield fully functional channel proteins. Our data indicate that albeit less markedly, channels split after residue 482 in the S2-S3 linker resemble the uncoupled gating phenotype of those split at the C-terminal end of the VSD S4 transmembrane segment. Channels split after residues 514 and 518 in the S3-S4 linker show gating characteristics similar to those of the continuous wild-type channel. However, breaking the covalent link at this level strongly accelerates the voltage-dependent accessibility of a membrane impermeable methanethiosulfonate reagent to an engineered cysteine at the N-terminal region of the S4 transmembrane helix. Thus, besides that of the S4-S5 linker, structural integrity of the intracellular S2-S3 linker seems to constitute an important factor for proper transduction of VSD rearrangements to opening and closing the cytoplasmic gate. Furthermore, our data suggest that the short and probably rigid characteristics of the extracellular S3-S4 linker are not an essential component of the Kv11.1 voltage sensing machinery.

  9. Induced voltage due to time-dependent magnetisation textures

    International Nuclear Information System (INIS)

    Kudtarkar, Santosh Kumar; Dhadwal, Renu


    We determine the induced voltage generated by spatial and temporal magnetisation textures (inhomogeneities) in metallic ferromagnets due to the spin diffusion of non-equilibrium electrons. Using time dependent semi-classical theory as formulated in Zhang and Li and the drift-diffusion model of transport it is shown that the voltage generated depends critically on the difference in the diffusion constants of up and down spins. Including spin relaxation results in a crucial contribution to the induced voltage. We also show that the presence of magnetisation textures results in the modification of the conductivity of the system. As an illustration, we calculate the voltage generated due to a time dependent field driven helimagnet by solving the Landau-Lifshitz equation with Gilbert damping and explicitly calculate the dependence on the relaxation and damping parameters.

  10. Bupivacaine inhibits large conductance, voltage- and Ca2+- activated K+ channels in human umbilical artery smooth muscle cells (United States)

    Martín, Pedro; Enrique, Nicolás; Palomo, Ana R. Roldán; Rebolledo, Alejandro; Milesi, Veronica


    Bupivacaine is a local anesthetic compound belonging to the amino amide group. Its anesthetic effect is commonly related to its inhibitory effect on voltage-gated sodium channels. However, several studies have shown that this drug can also inhibit voltage-operated K+ channels by a different blocking mechanism. This could explain the observed contractile effects of bupivacaine on blood vessels. Up to now, there were no previous reports in the literature about bupivacaine effects on large conductance voltage- and Ca2+-activated K+ channels (BKCa). Using the patch-clamp technique, it is shown that bupivacaine inhibits single-channel and whole-cell K+ currents carried by BKCa channels in smooth muscle cells isolated from human umbilical artery (HUA). At the single-channel level bupivacaine produced, in a concentration- and voltage-dependent manner (IC50 324 µM at +80 mV), a reduction of single-channel current amplitude and induced a flickery mode of the open channel state. Bupivacaine (300 µM) can also block whole-cell K+ currents (~45% blockage) in which, under our working conditions, BKCa is the main component. This study presents a new inhibitory effect of bupivacaine on an ion channel involved in different cell functions. Hence, the inhibitory effect of bupivacaine on BKCa channel activity could affect different physiological functions where these channels are involved. Since bupivacaine is commonly used during labor and delivery, its effects on umbilical arteries, where this channel is highly expressed, should be taken into account. PMID:22688134

  11. New Role of P/Q-type Voltage-gated Calcium Channels

    DEFF Research Database (Denmark)

    Hansen, Pernille B L


    Voltage-gated calcium channels are important for the depolarization-evoked contraction of vascular smooth muscle cells (SMCs), with L-type channels being the classical channel involved in this mechanism. However, it has been demonstrated that the CaV2.1 subunit, which encodes a neuronal isoform...... of the voltage-gated calcium channels (P/Q-type), is also expressed and contributes functionally to contraction of renal blood vessels in both mice and humans. Furthermore, preglomerular vascular SMCs and aortic SMCs coexpress L-, P-, and Q-type calcium channels within the same cell. Calcium channel blockers...... are widely used as pharmacological treatments. However, calcium channel antagonists vary in their selectivity for the various calcium channel subtypes, and the functional contribution from P/Q-type channels as compared with L-type should be considered. Confirming the presence of P/Q-type voltage...

  12. Voltage and pH sensing by the voltage-gated proton channel, HV1. (United States)

    DeCoursey, Thomas E


    Voltage-gated proton channels are unique ion channels, membrane proteins that allow protons but no other ions to cross cell membranes. They are found in diverse species, from unicellular marine life to humans. In all cells, their function requires that they open and conduct current only under certain conditions, typically when the electrochemical gradient for protons is outwards. Consequently, these proteins behave like rectifiers, conducting protons out of cells. Their activity has electrical consequences and also changes the pH on both sides of the membrane. Here we summarize what is known about the way these proteins sense the membrane potential and the pH inside and outside the cell. Currently, it is hypothesized that membrane potential is sensed by permanently charged arginines (with very high p K a ) within the protein, which results in parts of the protein moving to produce a conduction pathway. The mechanism of pH sensing appears to involve titratable side chains of particular amino acids. For this purpose their p K a needs to be within the operational pH range. We propose a 'counter-charge' model for pH sensing in which electrostatic interactions within the protein are selectively disrupted by protonation of internally or externally accessible groups. © 2018 The Author.

  13. Voltage and pH sensing by the voltage-gated proton channel, HV1 (United States)


    Voltage-gated proton channels are unique ion channels, membrane proteins that allow protons but no other ions to cross cell membranes. They are found in diverse species, from unicellular marine life to humans. In all cells, their function requires that they open and conduct current only under certain conditions, typically when the electrochemical gradient for protons is outwards. Consequently, these proteins behave like rectifiers, conducting protons out of cells. Their activity has electrical consequences and also changes the pH on both sides of the membrane. Here we summarize what is known about the way these proteins sense the membrane potential and the pH inside and outside the cell. Currently, it is hypothesized that membrane potential is sensed by permanently charged arginines (with very high pKa) within the protein, which results in parts of the protein moving to produce a conduction pathway. The mechanism of pH sensing appears to involve titratable side chains of particular amino acids. For this purpose their pKa needs to be within the operational pH range. We propose a ‘counter-charge’ model for pH sensing in which electrostatic interactions within the protein are selectively disrupted by protonation of internally or externally accessible groups. PMID:29643227

  14. A voltage-gated H+ channel underlying pH homeostasis in calcifying coccolithophores.

    Directory of Open Access Journals (Sweden)

    Alison R Taylor


    Full Text Available Marine coccolithophorid phytoplankton are major producers of biogenic calcite, playing a significant role in the global carbon cycle. Predicting the impacts of ocean acidification on coccolithophore calcification has received much recent attention and requires improved knowledge of cellular calcification mechanisms. Uniquely amongst calcifying organisms, coccolithophores produce calcified scales (coccoliths in an intracellular compartment and secrete them to the cell surface, requiring large transcellular ionic fluxes to support calcification. In particular, intracellular calcite precipitation using HCO₃⁻ as the substrate generates equimolar quantities of H+ that must be rapidly removed to prevent cytoplasmic acidification. We have used electrophysiological approaches to identify a plasma membrane voltage-gated H+ conductance in Coccolithus pelagicus ssp braarudii with remarkably similar biophysical and functional properties to those found in metazoans. We show that both C. pelagicus and Emiliania huxleyi possess homologues of metazoan H(v1 H+ channels, which function as voltage-gated H+ channels when expressed in heterologous systems. Homologues of the coccolithophore H+ channels were also identified in a diversity of eukaryotes, suggesting a wide range of cellular roles for the H(v1 class of proteins. Using single cell imaging, we demonstrate that the coccolithophore H+ conductance mediates rapid H+ efflux and plays an important role in pH homeostasis in calcifying cells. The results demonstrate a novel cellular role for voltage gated H+ channels and provide mechanistic insight into biomineralisation by establishing a direct link between pH homeostasis and calcification. As the coccolithophore H+ conductance is dependent on the trans-membrane H+ electrochemical gradient, this mechanism will be directly impacted by, and may underlie adaptation to, ocean acidification. The presence of this H+ efflux pathway suggests that there is no obligate

  15. Mechanisms of Gain Control by Voltage-Gated Channels in Intrinsically-Firing Neurons (United States)

    Patel, Ameera X.; Burdakov, Denis


    Gain modulation is a key feature of neural information processing, but underlying mechanisms remain unclear. In single neurons, gain can be measured as the slope of the current-frequency (input-output) relationship over any given range of inputs. While much work has focused on the control of basal firing rates and spike rate adaptation, gain control has been relatively unstudied. Of the limited studies on gain control, some have examined the roles of synaptic noise and passive somatic currents, but the roles of voltage-gated channels present ubiquitously in neurons have been less explored. Here, we systematically examined the relationship between gain and voltage-gated ion channels in a conductance-based, tonically-active, model neuron. Changes in expression (conductance density) of voltage-gated channels increased (Ca2+ channel), reduced (K+ channels), or produced little effect (h-type channel) on gain. We found that the gain-controlling ability of channels increased exponentially with the steepness of their activation within the dynamic voltage window (voltage range associated with firing). For depolarization-activated channels, this produced a greater channel current per action potential at higher firing rates. This allowed these channels to modulate gain by contributing to firing preferentially at states of higher excitation. A finer analysis of the current-voltage relationship during tonic firing identified narrow voltage windows at which the gain-modulating channels exerted their effects. As a proof of concept, we show that h-type channels can be tuned to modulate gain by changing the steepness of their activation within the dynamic voltage window. These results show how the impact of an ion channel on gain can be predicted from the relationship between channel kinetics and the membrane potential during firing. This is potentially relevant to understanding input-output scaling in a wide class of neurons found throughout the brain and other nervous systems

  16. Hydrogen bonds as molecular timers for slow inactivation in voltage-gated potassium channels

    DEFF Research Database (Denmark)

    Pless, Stephan Alexander; Galpin, Jason D; Niciforovic, Ana P


    Voltage-gated potassium (Kv) channels enable potassium efflux and membrane repolarization in excitable tissues. Many Kv channels undergo a progressive loss of ion conductance in the presence of a prolonged voltage stimulus, termed slow inactivation, but the atomic determinants that regulate the k...... subunit(s). DOI:

  17. Micromolar-Affinity Benzodiazepine Receptors Regulate Voltage-Sensitive Calcium Channels in Nerve Terminal Preparations (United States)

    Taft, William C.; Delorenzo, Robert J.


    Benzodiazepines in micromolar concentrations significantly inhibit depolarization-sensitive Ca2+ uptake in intact nerve-terminal preparations. Benzodiazepine inhibition of Ca2+ uptake is concentration dependent and stereospecific. Micromolar-affinity benzodiazepine receptors have been identified and characterized in brain membrane and shown to be distinct from nanomolar-affinity benzodiazepine receptors. Evidence is presented that micromolar, and not nanomolar, benzodiazepine binding sites mediate benzodiazepine inhibition of Ca2+ uptake. Irreversible binding to micromolar benzodiazepine binding sites also irreversibly blocked depolarization-dependent Ca2+ uptake in synaptosomes, indicating that these compounds may represent a useful marker for identifying the molecular components of Ca2+ channels in brain. Characterization of benzodiazepine inhibition of Ca2+ uptake demonstrates that these drugs function as Ca2+ channel antagonists, because benzodiazepines effectively blocked voltage-sensitive Ca2+ uptake inhibited by Mn2+, Co2+, verapamil, nitrendipine, and nimodipine. These results indicate that micromolar benzodiazepine binding sites regulate voltage-sensitive Ca2+ channels in brain membrane and suggest that some of the neuronal stabilizing effects of micromolar benzodiazepine receptors may be mediated by the regulation of Ca2+ conductance.

  18. Outward Rectification of Voltage-Gated K+ Channels Evolved at Least Twice in Life History.

    Directory of Open Access Journals (Sweden)

    Janin Riedelsberger

    Full Text Available Voltage-gated potassium (K+ channels are present in all living systems. Despite high structural similarities in the transmembrane domains (TMD, this K+ channel type segregates into at least two main functional categories-hyperpolarization-activated, inward-rectifying (Kin and depolarization-activated, outward-rectifying (Kout channels. Voltage-gated K+ channels sense the membrane voltage via a voltage-sensing domain that is connected to the conduction pathway of the channel. It has been shown that the voltage-sensing mechanism is the same in Kin and Kout channels, but its performance results in opposite pore conformations. It is not known how the different coupling of voltage-sensor and pore is implemented. Here, we studied sequence and structural data of voltage-gated K+ channels from animals and plants with emphasis on the property of opposite rectification. We identified structural hotspots that alone allow already the distinction between Kin and Kout channels. Among them is a loop between TMD S5 and the pore that is very short in animal Kout, longer in plant and animal Kin and the longest in plant Kout channels. In combination with further structural and phylogenetic analyses this finding suggests that outward-rectification evolved twice and independently in the animal and plant kingdom.

  19. Voltage-Gated Calcium Channel Antagonists and Traumatic Brain Injury

    Directory of Open Access Journals (Sweden)

    Bruce Lyeth


    Full Text Available Traumatic brain injury (TBI is a leading cause of death and disability in the United States. Despite more than 30 years of research, no pharmacological agents have been identified that improve neurological function following TBI. However, several lines of research described in this review provide support for further development of voltage gated calcium channel (VGCC antagonists as potential therapeutic agents. Following TBI, neurons and astrocytes experience a rapid and sometimes enduring increase in intracellular calcium ([Ca2+]i. These fluxes in [Ca2+]i drive not only apoptotic and necrotic cell death, but also can lead to long-term cell dysfunction in surviving cells. In a limited number of in vitro experiments, both L-type and N-type VGCC antagonists successfully reduced calcium loads as well as neuronal and astrocytic cell death following mechanical injury. In rodent models of TBI, administration of VGCC antagonists reduced cell death and improved cognitive function. It is clear that there is a critical need to find effective therapeutics and rational drug delivery strategies for the management and treatment of TBI, and we believe that further investigation of VGCC antagonists should be pursued before ruling out the possibility of successful translation to the clinic.

  20. High frequency relay protection channels on super high voltage lines

    Energy Technology Data Exchange (ETDEWEB)

    Mikutskii, G V


    General aspects of high voltage transmission line design are discussed. The relationships between line voltage and length and line dimensions and power losses are explained. Electrical interference in the line is classified under three headings: interference under normal operating conditions, interference due to insulation faults, and interference due to variations in operating conditions of the high-voltage network.

  1. The temperature dependence of the BK channel activity - kinetics, thermodynamics, and long-range correlations. (United States)

    Wawrzkiewicz-Jałowiecka, Agata; Dworakowska, Beata; Grzywna, Zbigniew J


    Large-conductance, voltage dependent, Ca 2+ -activated potassium channels (BK) are transmembrane proteins that regulate many biological processes by controlling potassium flow across cell membranes. Here, we investigate to what extent temperature (in the range of 17-37°C with ΔT=5°C step) is a regulating parameter of kinetic properties of the channel gating and memory effect in the series of dwell-time series of subsequent channel's states, at membrane depolarization and hyperpolarization. The obtained results indicate that temperature affects strongly the BK channels' gating, but, counterintuitively, it exerts no effect on the long-range correlations, as measured by the Hurst coefficient. Quantitative differences between dependencies of appropriate channel's characteristics on temperature are evident for different regimes of voltage. Examining the characteristics of BK channel activity as a function of temperature allows to estimate the net activation energy (E act ) and changes of thermodynamic parameters (ΔH, ΔS, ΔG) by channel opening. Larger E act corresponds to the channel activity at membrane hyperpolarization. The analysis of entropy and enthalpy changes of closed to open channel's transition suggest the entropy-driven nature of the increase of open state probability during voltage activation and supports the hypothesis about the voltage-dependent geometry of the channel vestibule. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage

    International Nuclear Information System (INIS)

    Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji


    We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.

  3. Hyperpolarization moves S4 sensors inward to open MVP, a methanococcal voltage-gated potassium channel. (United States)

    Sesti, Federico; Rajan, Sindhu; Gonzalez-Colaso, Rosana; Nikolaeva, Natalia; Goldstein, Steve A N


    MVP, a Methanococcus jannaschii voltage-gated potassium channel, was cloned and shown to operate in eukaryotic and prokaryotic cells. Like pacemaker channels, MVP opens on hyperpolarization using S4 voltage sensors like those in classical channels activated by depolarization. The MVP S4 span resembles classical sensors in sequence, charge, topology and movement, traveling inward on hyperpolarization and outward on depolarization (via canaliculi in the protein that bring the extracellular and internal solutions into proximity across a short barrier). Thus, MVP opens with sensors inward indicating a reversal of S4 position and pore state compared to classical channels. Homologous channels in mammals and plants are expected to function similarly.

  4. Disruption of the IS6-AID linker affects voltage-gated calcium channel inactivation and facilitation. (United States)

    Findeisen, Felix; Minor, Daniel L


    Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.

  5. The voltage-gated potassium channel subunit, Kv1.3, is expressed in epithelia

    DEFF Research Database (Denmark)

    Grunnet, Morten; Rasmussen, Hanne B; Hay-Schmidt, Anders


    The Shaker-type voltage-gated potassium channel, Kv1.3, is believed to be restricted in distribution to lymphocytes and neurons. In lymphocytes, this channel has gained intense attention since it has been proven that inhibition of Kv1.3 channels compromise T lymphocyte activation. To investigate...

  6. Intracellular calcium modulation of voltage-gated sodium channels in ventricular myocytes

    NARCIS (Netherlands)

    Casini, Simona; Verkerk, Arie O.; van Borren, Marcel M. G. J.; van Ginneken, Antoni C. G.; Veldkamp, Marieke W.; de Bakker, Jacques M. T.; Tan, Hanno L.


    AIMS: Cardiac voltage-gated sodium channels control action potential (AP) upstroke and cell excitability. Intracellular calcium (Ca(i)(2+)) regulates AP properties by modulating various ion channels. Whether Ca(i)(2+) modulates sodium channels in ventricular myocytes, is unresolved. We studied

  7. Interface Engineering for Precise Threshold Voltage Control in Multilayer-Channel Thin Film Transistors

    KAUST Repository

    Park, Jihoon


    Multilayer channel structure is used to effectively manipulate the threshold voltage of zinc oxide transistors without degrading its field-effect mobility. Transistors operating in enhancement mode with good mobility are fabricated by optimizing the structure of the multilayer channel. The optimization is attributed to the formation of additional channel and suppression of the diffusion of absorbed water molecules and oxygen vacancies.

  8. Interface Engineering for Precise Threshold Voltage Control in Multilayer-Channel Thin Film Transistors

    KAUST Repository

    Park, Jihoon; Alshammari, Fwzah Hamud; Wang, Zhenwei; Alshareef, Husam N.


    Multilayer channel structure is used to effectively manipulate the threshold voltage of zinc oxide transistors without degrading its field-effect mobility. Transistors operating in enhancement mode with good mobility are fabricated by optimizing the structure of the multilayer channel. The optimization is attributed to the formation of additional channel and suppression of the diffusion of absorbed water molecules and oxygen vacancies.

  9. Conotoxins as Tools to Understand the Physiological Function of Voltage-Gated Calcium (CaV Channels

    Directory of Open Access Journals (Sweden)

    David Ramírez


    Full Text Available Voltage-gated calcium (CaV channels are widely expressed and are essential for the completion of multiple physiological processes. Close regulation of their activity by specific inhibitors and agonists become fundamental to understand their role in cellular homeostasis as well as in human tissues and organs. CaV channels are divided into two groups depending on the membrane potential required to activate them: High-voltage activated (HVA, CaV1.1–1.4; CaV2.1–2.3 and Low-voltage activated (LVA, CaV3.1–3.3. HVA channels are highly expressed in brain (neurons, heart, and adrenal medulla (chromaffin cells, among others, and are also classified into subtypes which can be distinguished using pharmacological approaches. Cone snails are marine gastropods that capture their prey by injecting venom, “conopeptides”, which cause paralysis in a few seconds. A subset of conopeptides called conotoxins are relatively small polypeptides, rich in disulfide bonds, that target ion channels, transporters and receptors localized at the neuromuscular system of the animal target. In this review, we describe the structure and properties of conotoxins that selectively block HVA calcium channels. We compare their potency on several HVA channel subtypes, emphasizing neuronal calcium channels. Lastly, we analyze recent advances in the therapeutic use of conotoxins for medical treatments.

  10. The role of voltage-gated potassium channels in the regulation of mouse uterine contractility

    Directory of Open Access Journals (Sweden)

    Abel Peter W


    Full Text Available Abstract Background Uterine smooth muscle cells exhibit ionic currents that appear to be important in the control of uterine contractility, but how these currents might produce the changes in contractile activity seen in pregnant myometrium has not been established. There are conflicting reports concerning the role of voltage-gated potassium (Kv channels and large-conductance, calcium-activated potassium (BK channels in the regulation of uterine contractility. In this study we provide molecular and functional evidence for a role for Kv channels in the regulation of spontaneous contractile activity in mouse myometrium, and also demonstrate a change in Kv channel regulation of contractility in pregnant mouse myometrium. Methods Functional assays which evaluated the effects of channel blockers and various contractile agonists were accomplished by quantifying contractility of isolated uterine smooth muscle obtained from nonpregnant mice as well as mice at various stages of pregnancy. Expression of Kv channel proteins in isolated uterine smooth muscle was evaluated by Western blots. Results The Kv channel blocker 4-aminopyridine (4-AP caused contractions in nonpregnant mouse myometrium (EC50 = 54 micromolar, maximal effect at 300 micromolar but this effect disappeared in pregnant mice; similarly, the Kv4.2/Kv4.3 blocker phrixotoxin-2 caused contractions in nonpregnant, but not pregnant, myometrium. Contractile responses to 4-AP were not dependent upon nerves, as neither tetrodotoxin nor storage of tissues at room temperature significantly altered these responses, nor were responses dependent upon the presence of the endometrium. Spontaneous contractions and contractions in response to 4-AP did not appear to be mediated by BK, as the BK channel-selective blockers iberiotoxin, verruculogen, or tetraethylammonium failed to affect either spontaneous contractions or 4-AP-elicited responses. A number of different Kv channel alpha subunit proteins were

  11. Ca²⁺-dependent K⁺ channels in exocrine salivary glands. (United States)

    Catalán, Marcelo A; Peña-Munzenmayer, Gaspar; Melvin, James E


    In the last 15 years, remarkable progress has been realized in identifying the genes that encode the ion-transporting proteins involved in exocrine gland function, including salivary glands. Among these proteins, Ca(2+)-dependent K(+) channels take part in key functions including membrane potential regulation, fluid movement and K(+) secretion in exocrine glands. Two K(+) channels have been identified in exocrine salivary glands: (1) a Ca(2+)-activated K(+) channel of intermediate single channel conductance encoded by the KCNN4 gene, and (2) a voltage- and Ca(2+)-dependent K(+) channel of large single channel conductance encoded by the KCNMA1 gene. This review focuses on the physiological roles of Ca(2+)-dependent K(+) channels in exocrine salivary glands. We also discuss interesting recent findings on the regulation of Ca(2+)-dependent K(+) channels by protein-protein interactions that may significantly impact exocrine gland physiology. Published by Elsevier Ltd.

  12. Cellular hyper-excitability caused by mutations that alter the activation process of voltage-gated sodium channels

    Directory of Open Access Journals (Sweden)

    Mohamed-Yassine eAMAROUCH


    Full Text Available Voltage-gated sodium channels (Nav are widely expressed as macro-molecular complexes in both excitable and non-excitable tissues. In excitable tissues, the upstroke of the action potential is the result of the passage of a large and rapid influx of sodium ions through these channels. NaV dysfunction has been associated with an increasingly wide range of neurological, muscular and cardiac disorders. The purpose of this review is to summarize the recently identified sodium channel mutations that are linked to hyper-excitability phenotypes and associated with the alteration of the activation process of voltage gated sodium channels. Indeed, several clinical manifestations that demonstrate an alteration of tissue excitability were recently shown to be strongly associated with the presence of mutations that affect the activation process of the voltage-gated sodium channels. These emerging genotype-phenotype correlations have expanded the clinical spectrum of sodium channelopathies to include disorders which feature a hyper-excitability phenotype that may or may not be associated with a cardiomyopathy. The p.I141V mutation in SCN4A and SCN5A, as well as its homologous p.I136V mutation in SCN9A, are interesting examples of mutations that have been linked to inherited hyperexcitability myotonia, exercise-induced polymorphic ventricular arrhythmias and erythromelalgia, respectively. Regardless of which sodium channel isoform is investigated, the substitution of the isoleucine to valine in the locus 141 induces similar modifications in the biophysical properties of the voltage-gated sodium channels by shifting the voltage-dependence of steady state activation towards more negative potentials.

  13. Mapping the membrane-aqueous border for the voltage-sensing domain of a potassium channel. (United States)

    Neale, Edward J; Rong, Honglin; Cockcroft, Christopher J; Sivaprasadarao, Asipu


    Voltage-sensing domains (VSDs) play diverse roles in biology. As integral components, they can detect changes in the membrane potential of a cell and couple these changes to activity of ion channels and enzymes. As independent proteins, homologues of the VSD can function as voltage-dependent proton channels. To sense voltage changes, the positively charged fourth transmembrane segment, S4, must move across the energetically unfavorable hydrophobic core of the bilayer, which presents a barrier to movement of both charged species and protons. To reduce the barrier to S4 movement, it has been suggested that aqueous crevices may penetrate the protein, reducing the extent of total movement. To investigate this hypothesis in a system containing fully functional channels in a native environment with an intact membrane potential, we have determined the contour of the membrane-aqueous border of the VSD of KvAP in Escherichia coli by examining the chemical accessibility of introduced cysteines. The results revealed the contour of the membrane-aqueous border of the VSD in its activated conformation. The water-inaccessible regions of S1 and S2 correspond to the standard width of the membrane bilayer (~28 A), but those of S3 and S4 are considerably shorter (> or = 40%), consistent with aqueous crevices pervading both the extracellular and intracellular ends. One face of S3b and the entire S3a were water-accessible, reducing the water-inaccessible region of S3 to just 10 residues, significantly shorter than for S4. The results suggest a key role for S3 in reducing the distance S4 needs to move to elicit gating.

  14. Voltage-Gated Potassium Channels: A Structural Examination of Selectivity and Gating (United States)

    Kim, Dorothy M.; Nimigean, Crina M.


    Voltage-gated potassium channels play a fundamental role in the generation and propagation of the action potential. The discovery of these channels began with predictions made by early pioneers, and has culminated in their extensive functional and structural characterization by electrophysiological, spectroscopic, and crystallographic studies. With the aid of a variety of crystal structures of these channels, a highly detailed picture emerges of how the voltage-sensing domain reports changes in the membrane electric field and couples this to conformational changes in the activation gate. In addition, high-resolution structural and functional studies of K+ channel pores, such as KcsA and MthK, offer a comprehensive picture on how selectivity is achieved in K+ channels. Here, we illustrate the remarkable features of voltage-gated potassium channels and explain the mechanisms used by these machines with experimental data. PMID:27141052

  15. Gating mechanism of Kv11.1 (hERG) K+ channels without covalent connection between voltage sensor and pore domains. (United States)

    de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco


    Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.

  16. Voltage-sensing domain of voltage-gated proton channel Hv1 shares mechanism of block with pore domains. (United States)

    Hong, Liang; Pathak, Medha M; Kim, Iris H; Ta, Dennis; Tombola, Francesco


    Voltage-gated sodium, potassium, and calcium channels are made of a pore domain (PD) controlled by four voltage-sensing domains (VSDs). The PD contains the ion permeation pathway and the activation gate located on the intracellular side of the membrane. A large number of small molecules are known to inhibit the PD by acting as open channel blockers. The voltage-gated proton channel Hv1 is made of two VSDs and lacks the PD. The location of the activation gate in the VSD is unknown and open channel blockers for VSDs have not yet been identified. Here, we describe a class of small molecules which act as open channel blockers on the Hv1 VSD and find that a highly conserved phenylalanine in the charge transfer center of the VSD plays a key role in blocker binding. We then use one of the blockers to show that Hv1 contains two intracellular and allosterically coupled gates. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Voltage-dependent inward currents in smooth muscle cells of skeletal muscle arterioles (United States)

    Shirokov, Roman E.


    Voltage-dependent inward currents responsible for the depolarizing phase of action potentials were characterized in smooth muscle cells of 4th order arterioles in mouse skeletal muscle. Currents through L-type Ca2+ channels were expected to be dominant; however, action potentials were not eliminated in nominally Ca2+-free bathing solution or by addition of L-type Ca2+ channel blocker nifedipine (10 μM). Instead, Na+ channel blocker tetrodotoxin (TTX, 1 μM) reduced the maximal velocity of the upstroke at low, but not at normal (2 mM), Ca2+ in the bath. The magnitude of TTX-sensitive currents recorded with 140 mM Na+ was about 20 pA/pF. TTX-sensitive currents decreased five-fold when Ca2+ increased from 2 to 10 mM. The currents reduced three-fold in the presence of 10 mM caffeine, but remained unaltered by 1 mM of isobutylmethylxanthine (IBMX). In addition to L-type Ca2+ currents (15 pA/pF in 20 mM Ca2+), we also found Ca2+ currents that are resistant to 10 μM nifedipine (5 pA/pF in 20 mM Ca2+). Based on their biophysical properties, these Ca2+ currents are likely to be through voltage-gated T-type Ca2+ channels. Our results suggest that Na+ and at least two types (T- and L-) of Ca2+ voltage-gated channels contribute to depolarization of smooth muscle cells in skeletal muscle arterioles. Voltage-gated Na+ channels appear to be under a tight control by Ca2+ signaling. PMID:29694371

  18. Limitations of the dual voltage clamp method in assaying conductance and kinetics of gap junction channels

    NARCIS (Netherlands)

    Wilders, R.; Jongsma, H. J.


    The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap

  19. Microscopic origin of gating current fluctuations in a potassium channel voltage sensor. (United States)

    Freites, J Alfredo; Schow, Eric V; White, Stephen H; Tobias, Douglas J


    Voltage-dependent ion channels open and close in response to changes in membrane electrical potential due to the motion of their voltage-sensing domains (VSDs). VSD charge displacements within the membrane electric field are observed in electrophysiology experiments as gating currents preceding ionic conduction. The elementary charge motions that give rise to the gating current cannot be observed directly, but appear as discrete current pulses that generate fluctuations in gating current measurements. Here we report direct observation of gating-charge displacements in an atomistic molecular dynamics simulation of the isolated VSD from the KvAP channel in a hydrated lipid bilayer on the timescale (10-μs) expected for elementary gating charge transitions. The results reveal that gating-charge displacements are associated with the water-catalyzed rearrangement of salt bridges between the S4 arginines and a set of conserved acidic side chains on the S1-S3 transmembrane segments in the hydrated interior of the VSD. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  20. Effects of Voltage-Gated K+ Channel on Cell Proliferation in Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Wei Wang


    Full Text Available Objective. To study the effects and underlying mechanisms of voltage-gated K+ channels on the proliferation of multiple myeloma cells. Methods. RPMI-8226 MM cell line was used for the experiments. Voltage-gated K+ currents and the resting potential were recorded by whole-cell patch-clamp technique. RT-PCR detected Kv channel mRNA expression. Cell viability was analyzed with MTT assay. Cell counting system was employed to monitor cell proliferation. DNA contents and cell volume were analyzed by flow cytometry. Results. Currents recorded in RPMI-8226 cells were confirmed to be voltage-gated K+ channels. A high level of Kv1.3 mRNA was detected but no Kv3.1 mRNA was detected in RPMI-8226 cells. Voltage-gated K+ channel blocker 4-aminopyridine (4-AP (2 mM depolarized the resting potential from −42 ± 1.7 mV to −31.8 ± 2.8 mV (P0.05. Conclusions. In RPMI-8226, voltage-gated K+ channels are involved in proliferation and cell cycle progression its influence on the resting potential and cell volume may be responsible for this process; the inhibitory effect of the voltage-gated K+ channel blocker on RPMI-8226 cell proliferation is a phase-specific event.

  1. Voltage-Gated Sodium Channels: Evolutionary History and Distinctive Sequence Features. (United States)

    Kasimova, M A; Granata, D; Carnevale, V


    Voltage-gated sodium channels (Nav) are responsible for the rising phase of the action potential. Their role in electrical signal transmission is so relevant that their emergence is believed to be one of the crucial factors enabling development of nervous system. The presence of voltage-gated sodium-selective channels in bacteria (BacNav) has raised questions concerning the evolutionary history of the ones in animals. Here we review some of the milestones in the field of Nav phylogenetic analysis and discuss some of the most important sequence features that distinguish these channels from voltage-gated potassium channels and transient receptor potential channels. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. The Voltage-Sensing Domain of Kv7.2 Channels as a Molecular Target for Epilepsy-Causing Mutations and Anticonvulsants (United States)

    Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio


    Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2–Kv7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability. PMID:21687499

  3. The voltage-sensing domain of kv7.2 channels as a molecular target for epilepsy-causing mutations and anticonvulsants

    Directory of Open Access Journals (Sweden)

    Francesco eMiceli


    Full Text Available Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically-determined channelopathies affecting heart rhythm (arrhythmias, neuronal excitability (epilepsy, pain or skeletal muscle contraction (periodic paralysis. Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function.In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2-5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically-determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.

  4. The Voltage-Sensing Domain of K(v)7.2 Channels as a Molecular Target for Epilepsy-Causing Mutations and Anticonvulsants. (United States)

    Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio


    Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K(+) channels encoded by the K(v)7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by K(v)7.2-K(v)7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in K(v)7.2 and K(v)7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of K(v)7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in K(v)7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.

  5. [Mechanism of action of neurotoxins acting on the inactivation of voltage-gated sodium channels]. (United States)

    Benoit, E


    This review focuses on the mechanism(s) of action of neurotoxins acting on the inactivation of voltage-gated Na channels. Na channels are transmembrane proteins which are fundamental for cellular communication. These proteins form pores in the plasma membrane allowing passive ionic movements to occur. Their opening and closing are controlled by gating systems which depend on both membrane potential and time. Na channels have three functional properties, mainly studied using electrophysiological and biochemical techniques, to ensure their role in the generation and propagation of action potentials: 1) a highly selectivity for Na ions, 2) a rapid opening ("activation"), responsible for the depolarizing phase of the action potential, and 3) a late closing ("inactivation") involved in the repolarizing phase of the action potential. As an essential protein for membrane excitability, the Na channel is the specific target of a number of vegetal and animal toxins which, by binding to the channel, alter its activity by affecting one or more of its properties. At least six toxin receptor sites have been identified on the neuronal Na channel on the basis of binding studies. However, only toxins interacting with four of these sites (sites 2, 3, 5 et 6) produce alterations of channel inactivation. The maximal percentage of Na channels modified by the binding of neurotoxins to sites 2 (batrachotoxin and some alkaloids), 3 (alpha-scorpion and sea anemone toxins), 5 (brevetoxins and ciguatoxins) et 6 (delta-conotoxins) is different according to the site considered. However, in all cases, these channels do not inactivate. Moreover, Na channels modified by toxins which bind to sites 2, 5 and 6 activate at membrane potentials more negative than do unmodified channels. The physiological consequences of Na channel modifications, induced by the binding of neurotoxins to sites 2, 3, 5 and 6, are (i) an inhibition of cellular excitability due to an important membrane depolarization (site

  6. The hitchhiker’s guide to the voltage-gated sodium channel galaxy (United States)


    Eukaryotic voltage-gated sodium (Nav) channels contribute to the rising phase of action potentials and served as an early muse for biophysicists laying the foundation for our current understanding of electrical signaling. Given their central role in electrical excitability, it is not surprising that (a) inherited mutations in genes encoding for Nav channels and their accessory subunits have been linked to excitability disorders in brain, muscle, and heart; and (b) Nav channels are targeted by various drugs and naturally occurring toxins. Although the overall architecture and behavior of these channels are likely to be similar to the more well-studied voltage-gated potassium channels, eukaryotic Nav channels lack structural and functional symmetry, a notable difference that has implications for gating and selectivity. Activation of voltage-sensing modules of the first three domains in Nav channels is sufficient to open the channel pore, whereas movement of the domain IV voltage sensor is correlated with inactivation. Also, structure–function studies of eukaryotic Nav channels show that a set of amino acids in the selectivity filter, referred to as DEKA locus, is essential for Na+ selectivity. Structures of prokaryotic Nav channels have also shed new light on mechanisms of drug block. These structures exhibit lateral fenestrations that are large enough to allow drugs or lipophilic molecules to gain access into the inner vestibule, suggesting that this might be the passage for drug entry into a closed channel. In this Review, we will synthesize our current understanding of Nav channel gating mechanisms, ion selectivity and permeation, and modulation by therapeutics and toxins in light of the new structures of the prokaryotic Nav channels that, for the time being, serve as structural models of their eukaryotic counterparts. PMID:26712848

  7. Interactions between charged residues in the transmembrane segments of the voltage-sensing domain in the hERG channel. (United States)

    Zhang, M; Liu, J; Jiang, M; Wu, D-M; Sonawane, K; Guy, H R; Tseng, G-N


    Studies on voltage-gated K channels such as Shaker have shown that positive charges in the voltage-sensor (S4) can form salt bridges with negative charges in the surrounding transmembrane segments in a state-dependent manner, and different charge pairings can stabilize the channels in closed or open states. The goal of this study is to identify such charge interactions in the hERG channel. This knowledge can provide constraints on the spatial relationship among transmembrane segments in the channel's voltage-sensing domain, which are necessary for modeling its structure. We first study the effects of reversing S4's positive charges on channel activation. Reversing positive charges at the outer (K525D) and inner (K538D) ends of S4 markedly accelerates hERG activation, whereas reversing the 4 positive charges in between either has no effect or slows activation. We then use the 'mutant cycle analysis' to test whether D456 (outer end of S2) and D411 (inner end of S1) can pair with K525 and K538, respectively. Other positive charges predicted to be able, or unable, to interact with D456 or D411 are also included in the analysis. The results are consistent with predictions based on the distribution of these charged residues, and confirm that there is functional coupling between D456 and K525 and between D411 and K538.

  8. Structure of Voltage-gated Two-pore Channel TPC1 from Arabidopsis thaliana (United States)

    Guo, Jiangtao; Zeng, Weizhong; Chen, Qingfeng; Lee, Changkeun; Chen, Liping; Yang, Yi; Cang, Chunlei; Ren, Dejian; Jiang, Youxing


    Two-pore channels (TPCs) contain two copies of a Shaker-like six-transmembrane (6-TM) domain in each subunit and are ubiquitously expressed in both animals and plants as organellar cation channels. Here, we present the first crystal structure of a vacuolar two-pore channel from Arabidopsis thaliana, AtTPC1, which functions as a homodimer. AtTPC1 activation requires both voltage and cytosolic Ca2+. Ca2+ binding to the cytosolic EF-hand domain triggers conformational changes coupled to the pair of pore-lining inner helices (IS6 helices) from the first 6-TM domains, whereas membrane potential only activates the second voltage-sensing domain (VSD2) whose conformational changes are coupled to the pair of inner helices (IIS6 helices) from the second 6-TM domains. Luminal Ca2+ or Ba2+ can modulate voltage activation by stabilizing VSD2 in the resting state and shifts voltage activation towards more positive potentials. Our Ba2+ bound AtTPC1 structure reveals a voltage sensor in the resting state, providing hitherto unseen structural insight into the general voltage-gating mechanism among voltage-gated channels. PMID:26689363

  9. Manipulating the voltage dependence of tunneling spin torques

    KAUST Repository

    Manchon, Aurelien


    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  10. The orientation and molecular movement of a k(+) channel voltage-sensing domain. (United States)

    Gandhi, Chris S; Clark, Eliana; Loots, Eli; Pralle, Arnd; Isacoff, Ehud Y


    Voltage-gated channels operate through the action of a voltage-sensing domain (membrane segments S1-S4) that controls the conformation of gates located in the pore domain (membrane segments S5-S6). Recent structural studies on the bacterial K(v)AP potassium channel have led to a new model of voltage sensing in which S4 lies in the lipid at the channel periphery and moves through the membrane as a unit with a portion of S3. Here we describe accessibility probing and disulfide scanning experiments aimed at determining how well the K(v)AP model describes the Drosophila Shaker potassium channel. We find that the S1-S3 helices have one end that is externally exposed, S3 does not undergo a transmembrane motion, and S4 lies in close apposition to the pore domain in the resting and activated state.

  11. Electromagnetic fields (UHF) increase voltage sensitivity of membrane ion channels; possible indication of cell phone effect on living cells. (United States)

    Ketabi, N; Mobasheri, H; Faraji-Dana, R


    The effects of ultra high frequency (UHF) nonionizing electromagnetic fields (EMF) on the channel activities of nanopore forming protein, OmpF porin, were investigated. The voltage clamp technique was used to study the single channel activity of the pore in an artificial bilayer in the presence and absence of the electromagnetic fields at 910 to 990 MHz in real time. Channel activity patterns were used to address the effect of EMF on the dynamic, arrangement and dielectric properties of water molecules, as well as on the hydration state and arrangements of side chains lining the channel barrel. Based on the varied voltage sensitivity of the channel at different temperatures in the presence and absence of EMF, the amount of energy transferred to nano-environments of accessible groups was estimated to address the possible thermal effects of EMF. Our results show that the effects of EMF on channel activities are frequency dependent, with a maximum effect at 930 MHz. The frequency of channel gating and the voltage sensitivity is increased when the channel is exposed to EMF, while its conductance remains unchanged at all frequencies applied. We have not identified any changes in the capacitance and permeability of membrane in the presence of EMF. The effect of the EMF irradiated by cell phones is measured by Specific Absorption Rate (SAR) in artificial model of human head, Phantom. Thus, current approach applied to biological molecules and electrolytes might be considered as complement to evaluate safety of irradiating sources on biological matter at molecular level.

  12. Voltage-gated sodium channel expression and action potential generation in differentiated NG108-15 cells. (United States)

    Liu, Jinxu; Tu, Huiyin; Zhang, Dongze; Zheng, Hong; Li, Yu-Long


    The generation of action potential is required for stimulus-evoked neurotransmitter release in most neurons. Although various voltage-gated ion channels are involved in action potential production, the initiation of the action potential is mainly mediated by voltage-gated Na+ channels. In the present study, differentiation-induced changes of mRNA and protein expression of Na+ channels, Na+ currents, and cell membrane excitability were investigated in NG108-15 cells. Whole-cell patch-clamp results showed that differentiation (9 days) didn't change cell membrane excitability, compared to undifferentiated state. But differentiation (21 days) induced the action potential generation in 45.5% of NG108-15 cells (25/55 cells). In 9-day-differentiated cells, Na+ currents were mildly increased, which was also found in 21-day differentiated cells without action potential. In 21-day differentiated cells with action potential, Na+ currents were significantly enhanced. Western blot data showed that the expression of Na+ channels was increased with differentiated-time dependent manner. Single-cell real-time PCR data demonstrated that the expression of Na+ channel mRNA was increased by 21 days of differentiation in NG108-15 cells. More importantly, the mRNA level of Na+ channels in cells with action potential was higher than that in cells without action potential. Differentiation induces expression of voltage-gated Na+ channels and action potential generation in NG108-15 cells. A high level of the Na+ channel density is required for differentiation-triggered action potential generation.

  13. Investigation of capacitance voltage characteristics of strained Si/SiGe n-channel MODFET varactor (United States)

    Elogail, Y.; Kasper, E.; Gunzer, F.; Shaker, A.; Schulze, J.


    This work is concerned with the investigation of Capacitance-Voltage (CV) behavior of n-channel Si/SiGe MODFET varactors. This investigation provides a valuable insight into the high frequency response of the device under test and its dependence on design parameters; especially regarding the modulation layer doping concentration. The heterostructure under consideration is much more complicated than conventional MOS varactor with respect to non-uniform doping, energy band offsets and the pn-junction in series. Subsequently, CV characterization has never been applied to such MODFET varactor structure. Experimental CV measurements have shown a non-monotonic behavior with a transition point minimum and higher saturation levels on both sides, in contradiction to the conventional high frequency MOS characteristics. This behavior was confirmed qualitatively using simulations. Moreover, we explain some fundamental capacitance properties of the structure, which provide already very interesting perceptions of the MODFET varactor operation, modeling and possible applications using the obtained stimulating results.

  14. Progress in the structural understanding of voltage-gated calcium channel (CaV) function and modulation. (United States)

    Minor, Daniel L; Findeisen, Felix


    Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction, and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium‑dependent inactivation (CDI), and calcium‑dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts.

  15. Molecular determinants of voltage-gated sodium channel regulation by the Nedd4/Nedd4-like proteins

    DEFF Research Database (Denmark)

    Rougier, Jean-Sébastien; van Bemmelen, Miguel X; Bruce, M Christine


    -ubiquitin ligases of the Nedd4 family. We recently reported that cardiac Na(v)1.5 is regulated by Nedd4-2. In this study, we further investigated the molecular determinants of regulation of Na(v) proteins. When expressed in HEK-293 cells and studied using whole cell voltage clamping, the neuronal Na(v)1.2 and Na...... that Nedd4-dependent ubiquitination of Na(v) channels may represent a general mechanism regulating the excitability of neurons and myocytes via modulation of channel density at the plasma membrane....

  16. Shaping charge excitations in chiral edge states with a time-dependent gate voltage (United States)

    Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine


    We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.

  17. Voltage dependency of transmission probability of aperiodic DNA molecule (United States)

    Wiliyanti, V.; Yudiarsah, E.


    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  18. Gating of the two-pore cation channel AtTPC1 in the plant vacuole is based on a single voltage-sensing domain. (United States)

    Jaślan, D; Mueller, T D; Becker, D; Schultz, J; Cuin, T A; Marten, I; Dreyer, I; Schönknecht, G; Hedrich, R


    The two-pore cation channel TPC1 operates as a dimeric channel in animal and plant endomembranes. Each subunit consists of two homologous Shaker-like halves, with 12 transmembrane domains in total (S1-S6, S7-S12). In plants, TPC1 channels reside in the vacuolar membrane, and upon voltage stimulation, give rise to the well-known slow-activating SV currents. Here, we combined bioinformatics, structure modelling, site-directed mutagenesis, and in planta patch clamp studies to elucidate the molecular mechanisms of voltage-dependent channel gating in TPC1 in its native plant background. Structure-function analysis of the Arabidopsis TPC1 channel in planta confirmed that helix S10 operates as the major voltage-sensing site, with Glu450 and Glu478 identified as possible ion-pair partners for voltage-sensing Arg537. The contribution of helix S4 to voltage sensing was found to be negligible. Several conserved negative residues on the luminal site contribute to calcium binding, stabilizing the closed channel. During evolution of plant TPC1s from two separate Shaker-like domains, the voltage-sensing function in the N-terminal Shaker-unit (S1-S4) vanished. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  19. Inter-subunit interactions across the upper voltage sensing-pore domain interface contribute to the concerted pore opening transition of Kv channels.

    Directory of Open Access Journals (Sweden)

    Tzilhav Shem-Ad

    Full Text Available The tight electro-mechanical coupling between the voltage-sensing and pore domains of Kv channels lies at the heart of their fundamental roles in electrical signaling. Structural data have identified two voltage sensor pore inter-domain interaction surfaces, thus providing a framework to explain the molecular basis for the tight coupling of these domains. While the contribution of the intra-subunit lower domain interface to the electro-mechanical coupling that underlies channel opening is relatively well understood, the contribution of the inter-subunit upper interface to channel gating is not yet clear. Relying on energy perturbation and thermodynamic coupling analyses of tandem-dimeric Shaker Kv channels, we show that mutation of upper interface residues from both sides of the voltage sensor-pore domain interface stabilizes the closed channel state. These mutations, however, do not affect slow inactivation gating. We, moreover, find that upper interface residues form a network of state-dependent interactions that stabilize the open channel state. Finally, we note that the observed residue interaction network does not change during slow inactivation gating. The upper voltage sensing-pore interaction surface thus only undergoes conformational rearrangements during channel activation gating. We suggest that inter-subunit interactions across the upper domain interface mediate allosteric communication between channel subunits that contributes to the concerted nature of the late pore opening transition of Kv channels.

  20. Inter-subunit interactions across the upper voltage sensing-pore domain interface contribute to the concerted pore opening transition of Kv channels. (United States)

    Shem-Ad, Tzilhav; Irit, Orr; Yifrach, Ofer


    The tight electro-mechanical coupling between the voltage-sensing and pore domains of Kv channels lies at the heart of their fundamental roles in electrical signaling. Structural data have identified two voltage sensor pore inter-domain interaction surfaces, thus providing a framework to explain the molecular basis for the tight coupling of these domains. While the contribution of the intra-subunit lower domain interface to the electro-mechanical coupling that underlies channel opening is relatively well understood, the contribution of the inter-subunit upper interface to channel gating is not yet clear. Relying on energy perturbation and thermodynamic coupling analyses of tandem-dimeric Shaker Kv channels, we show that mutation of upper interface residues from both sides of the voltage sensor-pore domain interface stabilizes the closed channel state. These mutations, however, do not affect slow inactivation gating. We, moreover, find that upper interface residues form a network of state-dependent interactions that stabilize the open channel state. Finally, we note that the observed residue interaction network does not change during slow inactivation gating. The upper voltage sensing-pore interaction surface thus only undergoes conformational rearrangements during channel activation gating. We suggest that inter-subunit interactions across the upper domain interface mediate allosteric communication between channel subunits that contributes to the concerted nature of the late pore opening transition of Kv channels.

  1. Semi-empirical model for the threshold voltage of a double implanted MOSFET and its temperature dependence

    Energy Technology Data Exchange (ETDEWEB)

    Arora, N D


    A simple and accurate semi-empirical model for the threshold voltage of a small geometry double implanted enhancement type MOSFET, especially useful in a circuit simulation program like SPICE, has been developed. The effect of short channel length and narrow width on the threshold voltage has been taken into account through a geometrical approximation, which involves parameters whose values can be determined from the curve fitting experimental data. A model for the temperature dependence of the threshold voltage for the implanted devices has also been presented. The temperature coefficient of the threshold voltage was found to change with decreasing channel length and width. Experimental results from various device sizes, both short and narrow, show very good agreement with the model. The model has been implemented in SPICE as part of the complete dc model.

  2. Eslicarbazepine and the enhancement of slow inactivation of voltage-gated sodium channels: a comparison with carbamazepine, oxcarbazepine and lacosamide. (United States)

    Hebeisen, Simon; Pires, Nuno; Loureiro, Ana I; Bonifácio, Maria João; Palma, Nuno; Whyment, Andrew; Spanswick, David; Soares-da-Silva, Patrício


    This study aimed at evaluating the effects of eslicarbazepine, carbamazepine (CBZ), oxcarbazepine (OXC) and lacosamide (LCM) on the fast and slow inactivated states of voltage-gated sodium channels (VGSC). The anti-epileptiform activity was evaluated in mouse isolated hippocampal slices. The anticonvulsant effects were evaluated in MES and the 6-Hz psychomotor tests. The whole-cell patch-clamp technique was used to investigate the effects of eslicarbazepine, CBZ, OXC and LCM on sodium channels endogenously expressed in N1E-115 mouse neuroblastoma cells. CBZ and eslicarbazepine exhibit similar concentration dependent suppression of epileptiform activity in hippocampal slices. In N1E-115 mouse neuroblastoma cells, at a concentration of 250 μM, the voltage dependence of the fast inactivation was not influenced by eslicarbazepine, whereas LCM, CBZ and OXC shifted the V0.5 value (mV) by -4.8, -12.0 and -16.6, respectively. Eslicarbazepine- and LCM-treated fast-inactivated channels recovered similarly to control conditions, whereas CBZ- and OXC-treated channels required longer pulses to recover. CBZ, eslicarbazepine and LCM shifted the voltage dependence of the slow inactivation (V0.5, mV) by -4.6, -31.2 and -53.3, respectively. For eslicarbazepine, LCM, CBZ and OXC, the affinity to the slow inactivated state was 5.9, 10.4, 1.7 and 1.8 times higher than to the channels in the resting state, respectively. In conclusion, eslicarbazepine did not share with CBZ and OXC the ability to alter fast inactivation of VGSC. Both eslicarbazepine and LCM reduce VGSC availability through enhancement of slow inactivation, but LCM demonstrated higher interaction with VGSC in the resting state and with fast inactivation gating. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. ERG voltage-gated K+ channels regulate excitability and discharge dynamics of the medial vestibular nucleus neurones. (United States)

    Pessia, Mauro; Servettini, Ilenio; Panichi, Roberto; Guasti, Leonardo; Grassi, Silvarosa; Arcangeli, Annarosa; Wanke, Enzo; Pettorossi, Vito Enrico


    The discharge properties of the medial vestibular nucleus neurones (MVNn) critically depend on the activity of several ion channel types. In this study we show, immunohistochemically, that the voltage-gated K(+) channels ERG1A, ERG1B, ERG2 and ERG3 are highly expressed within the vestibular nuclei of P10 and P60 mice. The role played by these channels in the spike-generating mechanisms of the MVNn and in temporal information processing was investigated electrophysiologically from mouse brain slices, in vitro, by analysing the spontaneous discharge and the response to square-, ramp- and sinusoid-like intracellular DC current injections in extracellular and whole-cell patch-clamp studies. We show that more than half of the recorded MVNn were responsive to ERG channel block (WAY-123,398, E4031), displaying an increase in spontaneous activity and discharge irregularity. The response to step and ramp current injection was also modified by ERG block showing a reduction of first spike latency, enhancement of discharge rate and reduction of the slow spike-frequency adaptation process. ERG channels influence the interspike slope without affecting the spike shape. Moreover, in response to sinusoid-like current, ERG channel block caused frequency-dependent gain enhancement and phase-lead shift. Taken together, the data demonstrate that ERG channels control the excitability of MVNn, their discharge regularity and probably their resonance properties.

  4. Asymmetric functional contributions of acidic and aromatic side chains in sodium channel voltage-sensor domains

    DEFF Research Database (Denmark)

    Pless, Stephan Alexander; Elstone, Fisal D; Niciforovic, Ana P


    largely enigmatic. To this end, natural and unnatural side chain substitutions were made in the S2 hydrophobic core (HC), the extracellular negative charge cluster (ENC), and the intracellular negative charge cluster (INC) of the four VSDs of the skeletal muscle sodium channel isoform (NaV1......Voltage-gated sodium (NaV) channels mediate electrical excitability in animals. Despite strong sequence conservation among the voltage-sensor domains (VSDs) of closely related voltage-gated potassium (KV) and NaV channels, the functional contributions of individual side chains in Nav VSDs remain.......4). The results show that the highly conserved aromatic side chain constituting the S2 HC makes distinct functional contributions in each of the four NaV domains. No obvious cation-pi interaction exists with nearby S4 charges in any domain, and natural and unnatural mutations at these aromatic sites produce...

  5. Structure of a eukaryotic voltage-gated sodium channel at near-atomic resolution. (United States)

    Shen, Huaizong; Zhou, Qiang; Pan, Xiaojing; Li, Zhangqiang; Wu, Jianping; Yan, Nieng


    Voltage-gated sodium (Na v ) channels are responsible for the initiation and propagation of action potentials. They are associated with a variety of channelopathies and are targeted by multiple pharmaceutical drugs and natural toxins. Here, we report the cryogenic electron microscopy structure of a putative Na v channel from American cockroach (designated Na v PaS) at 3.8 angstrom resolution. The voltage-sensing domains (VSDs) of the four repeats exhibit distinct conformations. The entrance to the asymmetric selectivity filter vestibule is guarded by heavily glycosylated and disulfide bond-stabilized extracellular loops. On the cytoplasmic side, a conserved amino-terminal domain is placed below VSD I , and a carboxy-terminal domain binds to the III-IV linker. The structure of Na v PaS establishes an important foundation for understanding function and disease mechanism of Na v and related voltage-gated calcium channels. Copyright © 2017, American Association for the Advancement of Science.

  6. Dual regulation of the native ClC-K2 chloride channel in the distal nephron by voltage and pH. (United States)

    Pinelli, Laurent; Nissant, Antoine; Edwards, Aurélie; Lourdel, Stéphane; Teulon, Jacques; Paulais, Marc


    ClC-K2, a member of the ClC family of Cl(-) channels and transporters, forms the major basolateral Cl(-) conductance in distal nephron epithelial cells and therefore plays a central role in renal Cl(-) absorption. However, its regulation remains largely unknown because of the fact that recombinant ClC-K2 has not yet been studied at the single-channel level. In the present study, we investigate the effects of voltage, pH, Cl(-), and Ca(2+) on native ClC-K2 in the basolateral membrane of intercalated cells from the mouse connecting tubule. The ∼10-pS channel shows a steep voltage dependence such that channel activity increases with membrane depolarization. Intracellular pH (pHi) and extracellular pH (pHo) differentially modulate the voltage dependence curve: alkaline pHi flattens the curve by causing an increase in activity at negative voltages, whereas alkaline pHo shifts the curve toward negative voltages. In addition, pHi, pHo, and extracellular Ca(2+) strongly increase activity, mainly because of an increase in the number of active channels with a comparatively minor effect on channel open probability. Furthermore, voltage alters both the number of active channels and their open probability, whereas intracellular Cl(-) has little influence. We propose that changes in the number of active channels correspond to them entering or leaving an inactivated state, whereas modulation of open probability corresponds to common gating by these channels. We suggest that pH, through the combined effects of pHi and pHo on ClC-K2, might be a key regulator of NaCl absorption and Cl(-)/HCO3 (-) exchange in type B intercalated cells. © 2016 Pinelli et al.

  7. Limitations of the dual voltage clamp method in assaying conductance and kinetics of gap junction channels


    Wilders, R.; Jongsma, H.J.


    The electrical properties of gap junctions in cell pairs are usually studied by means of the dual voltage clamp method. The voltage across the junctional channels, however, cannot be controlled adequately due to an artificial resistance and a natural resistance, both connected in series with the gap junction. The access resistances to the cell interior of the recording pipettes make up the artificial resistance. The natural resistance consists of the cytoplasmic access resistances to the tigh...

  8. Voltage dependence of carbon-based supercapacitors for pseudocapacitance quantification


    Ruiz Ruiz, Vanesa; Roldán Luna, Silvia; Villar Masetto, Isabel; Blanco Rodríguez, Clara; Santamaría Ramírez, Ricardo


    In order to understand the participation of electrical double layer and pseudocapacitance to the overall behavior of supercapacitors, a new approach to the analysis of the electrochemical data is proposed. Both the variation of the specific capacitance values and the dependence of these values with the operating voltage window (varying from 0–0.2 V to 0–1 V) were evaluated and used to quantify the contribution arising from each mechanism of energy storage to the total capacitance of the syste...

  9. Structure-based assessment of disease-related mutations in human voltage-gated sodium channels

    Directory of Open Access Journals (Sweden)

    Weiyun Huang


    Full Text Available ABSTRACT Voltage-gated sodium (Nav channels are essential for the rapid upstroke of action potentials and the propagation of electrical signals in nerves and muscles. Defects of Nav channels are associated with a variety of channelopathies. More than 1000 disease-related mutations have been identified in Nav channels, with Nav1.1 and Nav1.5 each harboring more than 400 mutations. Nav channels represent major targets for a wide array of neurotoxins and drugs. Atomic structures of Nav channels are required to understand their function and disease mechanisms. The recently determined atomic structure of the rabbit voltage-gated calcium (Cav channel Cav1.1 provides a template for homology-based structural modeling of the evolutionarily related Nav channels. In this Resource article, we summarized all the reported disease-related mutations in human Nav channels, generated a homologous model of human Nav1.7, and structurally mapped disease-associated mutations. Before the determination of structures of human Nav channels, the analysis presented here serves as the base framework for mechanistic investigation of Nav channelopathies and for potential structure-based drug discovery.

  10. Structure-based assessment of disease-related mutations in human voltage-gated sodium channels. (United States)

    Huang, Weiyun; Liu, Minhao; Yan, S Frank; Yan, Nieng


    Voltage-gated sodium (Na v ) channels are essential for the rapid upstroke of action potentials and the propagation of electrical signals in nerves and muscles. Defects of Na v channels are associated with a variety of channelopathies. More than 1000 disease-related mutations have been identified in Na v channels, with Na v 1.1 and Na v 1.5 each harboring more than 400 mutations. Na v channels represent major targets for a wide array of neurotoxins and drugs. Atomic structures of Na v channels are required to understand their function and disease mechanisms. The recently determined atomic structure of the rabbit voltage-gated calcium (Ca v ) channel Ca v 1.1 provides a template for homology-based structural modeling of the evolutionarily related Na v channels. In this Resource article, we summarized all the reported disease-related mutations in human Na v channels, generated a homologous model of human Na v 1.7, and structurally mapped disease-associated mutations. Before the determination of structures of human Na v channels, the analysis presented here serves as the base framework for mechanistic investigation of Na v channelopathies and for potential structure-based drug discovery.

  11. Substitutions in the domain III voltage-sensing module enhance the sensitivity of an insect sodium channel to a scorpion beta-toxin. (United States)

    Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke


    Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.

  12. Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel. (United States)

    Wang, Jia-Zeng; Wang, Rui-Zhen


    Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na + /K + -ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K + -battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.

  13. Free energy dissipation of the spontaneous gating of a single voltage-gated potassium channel (United States)

    Wang, Jia-Zeng; Wang, Rui-Zhen


    Potassium channels mainly contribute to the resting potential and re-polarizations, with the potassium electrochemical gradient being maintained by the pump Na+/K+-ATPase. In this paper, we construct a stochastic model mimicking the kinetics of a potassium channel, which integrates temporal evolving of the membrane voltage and the spontaneous gating of the channel. Its stationary probability density functions (PDFs) are found to be singular at the boundaries, which result from the fact that the evolving rates of voltage are greater than the gating rates of the channel. We apply PDFs to calculate the power dissipations of the potassium current, the leakage, and the gating currents. On a physical perspective, the essential role of the system is the K+-battery charging the leakage (L-)battery. A part of power will inevitably be dissipated among the process. So, the efficiency of energy transference is calculated.

  14. Distribution and function of voltage-gated sodium channels in the nervous system. (United States)

    Wang, Jun; Ou, Shao-Wu; Wang, Yun-Jie


    Voltage-gated sodium channels (VGSCs) are the basic ion channels for neuronal excitability, which are crucial for the resting potential and the generation and propagation of action potentials in neurons. To date, at least nine distinct sodium channel isoforms have been detected in the nervous system. Recent studies have identified that voltage-gated sodium channels not only play an essential role in the normal electrophysiological activities of neurons but also have a close relationship with neurological diseases. In this study, the latest research findings regarding the structure, type, distribution, and function of VGSCs in the nervous system and their relationship to neurological diseases, such as epilepsy, neuropathic pain, brain tumors, neural trauma, and multiple sclerosis, are reviewed in detail.

  15. Developmental regulation of voltage-sensitive sodium channels in rat skeletal muscle

    International Nuclear Information System (INIS)

    Sherman, S.J.


    The developmental regulation of the voltage-sensitive Na + channel in rat skeletal muscle was studied in vivo and in vitro. In triceps surae muscle developing in vivo the development of TTX-sensitive Na + channel occurred primarily during the first three postnatal weeks as determined by the specific binding of [ 3 H]saxitoxin. This development proceeded in two separate phases. The first phase occurs independently of continuing motor neuron innervation and accounts for 60% of the adult density of TTX-sensitive Na + channels. The second phase, which begins about day 11, requires innervation. Muscle cells in primary culture were found to have both TTX-sensitive and insensitive Na + channels. The development of the TTX-sensitive channel, in vitro, paralleled the initial innervation-independent phase of development observed in vivo. The density of TTX-sensitive Na + channels in cultured muscle cells was regulated by electrical activity and cytosolic Ca ++ levels. Pharmacological blockade of the spontaneous electrical activity present in these cells lead to a nearly 2-fold increase in the surface density of TTX-sensitive channels. The turnover time of the TTX-sensitive Na + channel was measured by blocking the incorporation of newly synthesized channels with tunicamycin, an inhibitor of N-linked protein glycosylation. The regulation of channel density by electrical activity, cytosolic Ca ++ levels, and agents affecting cyclic neucleotide levels had no effect on the turnover time of the TTX-sensitive Na + channel, indicating that these regulatory agents instead affect the synthesis of the channel

  16. Voltage gated potassium channels expressed in Xenopus laevis(AMPHIBIA oocytes

    Directory of Open Access Journals (Sweden)

    Hedna Chaves


    Full Text Available Heterologous expression has been an important tool for structural and functionalcharacterization of proteins. The study of biophysical properties of ion channels,pumps and transporters has been possible thanks to their expression in Xenopuslaevisoocytes. Here we report the expression of two voltage gated channels, Kv1.1and Shaker, in X. laevisoocytes using a method for oocyte extraction, isolation, cul-ture, and microinjection adapted to the latitude and altitude conditions of Bogotá,Colombia.

  17. Glycosylation of voltage-gated calcium channels in health and disease

    Czech Academy of Sciences Publication Activity Database

    Lazniewska, Joanna; Weiss, Norbert


    Roč. 1859, č. 5 (2017), s. 662-668 ISSN 0005-2736 R&D Projects: GA ČR GA15-13556S; GA MŠk 7AMB15FR015 Institutional support: RVO:61388963 Keywords : calcium channels * voltage-gated calcium channels * N-glycosylation * ancillary subunit * trafficking * stability Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.498, year: 2016

  18. Human neuronal stargazin-like proteins, γ2, γ3 and γ4; an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes.

    Directory of Open Access Journals (Sweden)

    Dolphin Annette C


    Full Text Available Abstract Background Stargazin (γ2 and the closely related γ3, and γ4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA receptor regulatory proteins (TARPs. In this investigation, we examined the distribution patterns of the stargazin-like proteins γ2, γ3, and γ4 in the human central nervous system (CNS. In addition, we investigated whether human γ2 or γ4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. Results The mRNA encoding human γ2 is highly expressed in cerebellum, cerebral cortex, hippocampus and thalamus, whereas γ3 is abundant in cerebral cortex and amygdala and γ4 in the basal ganglia. Immunohistochemical analysis of the cerebellum determined that both γ2 and γ4 are present in the molecular layer, particularly in Purkinje cell bodies and dendrites, but have an inverse expression pattern to one another in the dentate cerebellar nucleus. They are also detected in the interneurons of the granule cell layer though only γ2 is clearly detected in granule cells. The hippocampus stains for γ2 and γ4 throughout the layers of the every CA region and the dentate gyrus, whilst γ3 appears to be localized particularly to the pyramidal and granule cell bodies. When co-expressed in Xenopus oocytes with a CaV2.1/β4 VDCC complex, either in the absence or presence of an α2δ2 subunit, neither γ2 nor γ4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. Conclusion The human γ2, γ3 and γ4 stargazin-like proteins are detected only in the CNS and display differential distributions among brain regions and several cell types in found in the cerebellum and hippocampus. These distribution patterns closely resemble those

  19. The Molecular Basis of Polyunsaturated Fatty Acid Interactions with the Shaker Voltage-Gated Potassium Channel.

    Directory of Open Access Journals (Sweden)

    Samira Yazdi


    Full Text Available Voltage-gated potassium (KV channels are membrane proteins that respond to changes in membrane potential by enabling K+ ion flux across the membrane. Polyunsaturated fatty acids (PUFAs induce channel opening by modulating the voltage-sensitivity, which can provide effective treatment against refractory epilepsy by means of a ketogenic diet. While PUFAs have been reported to influence the gating mechanism by electrostatic interactions to the voltage-sensor domain (VSD, the exact PUFA-protein interactions are still elusive. In this study, we report on the interactions between the Shaker KV channel in open and closed states and a PUFA-enriched lipid bilayer using microsecond molecular dynamics simulations. We determined a putative PUFA binding site in the open state of the channel located at the protein-lipid interface in the vicinity of the extracellular halves of the S3 and S4 helices of the VSD. In particular, the lipophilic PUFA tail covered a wide range of non-specific hydrophobic interactions in the hydrophobic central core of the protein-lipid interface, while the carboxylic head group displayed more specific interactions to polar/charged residues at the extracellular regions of the S3 and S4 helices, encompassing the S3-S4 linker. Moreover, by studying the interactions between saturated fatty acids (SFA and the Shaker KV channel, our study confirmed an increased conformational flexibility in the polyunsaturated carbon tails compared to saturated carbon chains, which may explain the specificity of PUFA action on channel proteins.

  20. Block of voltage-gated potassium channels by Pacific ciguatoxin-1 contributes to increased neuronal excitability in rat sensory neurons

    International Nuclear Information System (INIS)

    Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.


    The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning

  1. G-protein mediates voltage regulation of agonist binding to muscarinic receptors: effects on receptor-Na+ channel interaction

    International Nuclear Information System (INIS)

    Cohen-Armon, M.; Garty, H.; Sokolovsky, M.


    The authors previous experiments in membranes prepared from rat heart and brain led them to suggest that the binding of agonist to the muscarinic receptors and to the Na + channels is a coupled event mediated by guanine nucleotide binding protein(s) [G-protein(s)]. These in vitro findings prompted us to employ synaptoneurosomes from brain stem tissue to examine (i) the binding properties of [ 3 H] acetylcholine at resting potential and under depolarization conditions in the absence and presence of pertussis toxin; (ii) the binding of [ 3 H]batrachotoxin to Na + channel(s) in the presence of the muscarinic agonists; and (iii) muscarinically induced 22 Na + uptake in the presence and absence of tetrodotoxin, which blocks Na + channels. The findings indicate that agonist binding to muscarinic receptors is voltage dependent, that this process is mediated by G-protein(s), and that muscarinic agonists induce opening of Na + channels. The latter process persists even after pertussis toxin treatment, indicating that it is not likely to be mediated by pertussis toxin sensitive G-protein(s). The system with its three interacting components-receptor, G-protein, and Na + channel-is such that at resting potential the muscarinic receptor induces opening of Na + channels; this property may provide a possible physiological mechanism for the depolarization stimulus necessary for autoexcitation or repetitive firing in heart or brain tissues

  2. Integrative Approach with Electrophysiological and Theoretical Methods Reveals a New Role of S4 Positively Charged Residues in PKD2L1 Channel Voltage-Sensing. (United States)

    Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo


    Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.

  3. Activity of Palythoa caribaeorum Venom on Voltage-Gated Ion Channels in Mammalian Superior Cervical Ganglion Neurons

    Directory of Open Access Journals (Sweden)

    Fernando Lazcano-Pérez


    Full Text Available The Zoanthids are an order of cnidarians whose venoms and toxins have been poorly studied. Palythoa caribaeorum is a zoanthid commonly found around the Mexican coastline. In this study, we tested the activity of P. caribaeorum venom on voltage-gated sodium channel (NaV1.7, voltage-gated calcium channel (CaV2.2, the A-type transient outward (IA and delayed rectifier (IDR currents of KV channels of the superior cervical ganglion (SCG neurons of the rat. These results showed that the venom reversibly delays the inactivation process of voltage-gated sodium channels and inhibits voltage-gated calcium and potassium channels in this mammalian model. The compounds responsible for these effects seem to be low molecular weight peptides. Together, these results provide evidence for the potential use of zoanthids as a novel source of cnidarian toxins active on voltage-gated ion channels.

  4. Activity of Palythoa caribaeorum Venom on Voltage-Gated Ion Channels in Mammalian Superior Cervical Ganglion Neurons. (United States)

    Lazcano-Pérez, Fernando; Castro, Héctor; Arenas, Isabel; García, David E; González-Muñoz, Ricardo; Arreguín-Espinosa, Roberto


    The Zoanthids are an order of cnidarians whose venoms and toxins have been poorly studied. Palythoa caribaeorum is a zoanthid commonly found around the Mexican coastline. In this study, we tested the activity of P. caribaeorum venom on voltage-gated sodium channel (NaV1.7), voltage-gated calcium channel (CaV2.2), the A-type transient outward (IA) and delayed rectifier (IDR) currents of KV channels of the superior cervical ganglion (SCG) neurons of the rat. These results showed that the venom reversibly delays the inactivation process of voltage-gated sodium channels and inhibits voltage-gated calcium and potassium channels in this mammalian model. The compounds responsible for these effects seem to be low molecular weight peptides. Together, these results provide evidence for the potential use of zoanthids as a novel source of cnidarian toxins active on voltage-gated ion channels.

  5. Low voltage-activated calcium channels gate transmitter release at the dorsal root ganglion sandwich synapse. (United States)

    Rozanski, Gabriela M; Nath, Arup R; Adams, Michael E; Stanley, Elise F


    A subpopulation of dorsal root ganglion (DRG) neurons are intimately attached in pairs and separated solely by thin satellite glial cell membrane septa. Stimulation of one neuron leads to transglial activation of its pair by a bi-, purinergic/glutamatergic synaptic pathway, a transmission mechanism that we term sandwich synapse (SS) transmission. Release of ATP from the stimulated neuron can be attributed to a classical mechanism involving Ca(2+) entry via voltage-gated calcium channels (CaV) but via an unknown channel type. Specific blockers and toxins ruled out CaV1, 2.1 and 2.2. Transmission was, however, blocked by a moderate depolarization (-50 mV) or low-concentration Ni(2+) (0.1 mM). Transmission persisted using a voltage pulse to -40 mV from a holding potential of -80 mV, confirming the involvement of a low voltage-activated channel type and limiting the candidate channel type to either CaV3.2 or a subpopulation of inactivation- and Ni(2+)-sensitive CaV2.3 channels. Resistance of the neuron calcium current and SS transmission to SNX482 argue against the latter. Hence, we conclude that inter-somatic transmission at the DRG SS is gated by CaV3.2 type calcium channels. The use of CaV3 family channels to gate transmission has important implications for the biological function of the DRG SS as information transfer would be predicted to occur not only in response to action potentials but also to sub-threshold membrane voltage oscillations. Thus, the SS synapse may serve as a homeostatic signalling mechanism between select neurons in the DRG and could play a role in abnormal sensation such as neuropathic pain.

  6. Chronic ciguatoxin treatment induces synaptic scaling through voltage gated sodium channels in cortical neurons. (United States)

    Martín, Víctor; Vale, Carmen; Rubiolo, Juan A; Roel, Maria; Hirama, Masahiro; Yamashita, Shuji; Vieytes, Mercedes R; Botana, Luís M


    Ciguatoxins are sodium channels activators that cause ciguatera, one of the most widespread nonbacterial forms of food poisoning, which presents with long-term neurological alterations. In central neurons, chronic perturbations in activity induce homeostatic synaptic mechanisms that adjust the strength of excitatory synapses and modulate glutamate receptor expression in order to stabilize the overall activity. Immediate early genes, such as Arc and Egr1, are induced in response to activity changes and underlie the trafficking of glutamate receptors during neuronal homeostasis. To better understand the long lasting neurological consequences of ciguatera, it is important to establish the role that chronic changes in activity produced by ciguatoxins represent to central neurons. Here, the effect of a 30 min exposure of 10-13 days in vitro (DIV) cortical neurons to the synthetic ciguatoxin CTX 3C on Arc and Egr1 expression was evaluated using real-time polymerase chain reaction approaches. Since the toxin increased the mRNA levels of both Arc and Egr1, the effect of CTX 3C in NaV channels, membrane potential, firing activity, miniature excitatory postsynaptic currents (mEPSCs), and glutamate receptors expression in cortical neurons after a 24 h exposure was evaluated using electrophysiological and western blot approaches. The data presented here show that CTX 3C induced an upregulation of Arc and Egr1 that was prevented by previous coincubation of the neurons with the NaV channel blocker tetrodotoxin. In addition, chronic CTX 3C caused a concentration-dependent shift in the activation voltage of NaV channels to more negative potentials and produced membrane potential depolarization. Moreover, 24 h treatment of cortical neurons with 5 nM CTX 3C decreased neuronal firing and induced synaptic scaling mechanisms, as evidenced by a decrease in the amplitude of mEPSCs and downregulation in the protein level of glutamate receptors that was also prevented by tetrodotoxin

  7. SGK3 Sensitivity of Voltage Gated K+ Channel Kv1.5 (KCNA5

    Directory of Open Access Journals (Sweden)

    Musaab Ahmed


    Full Text Available Background: The serum & glucocorticoid inducible kinase isoform SGK3 is a powerful regulator of several transporters, ion channels and the Na+/K+ ATPase. Targets of SGK3 include the ubiquitin ligase Nedd4-2, which is in turn a known regulator of the voltage gated K+ channel Kv1.5 (KCNA5. The present study thus explored whether SGK3 modifies the activity of the voltage gated K+ channel KCNA5, which participates in the regulation of diverse functions including atrial cardiac action potential, activity of vascular smooth muscle cells, insulin release and tumour cell proliferation. Methods: cRNA encoding KCNA5 was injected into Xenopus oocytes with and without additional injection of cRNA encoding wild-type SGK3, constitutively active S419DSGK3, inactive K191NSGK3 and/or wild type Nedd4-2. Voltage gated K+ channel activity was quantified utilizing dual electrode voltage clamp. Results: Voltage gated current in KCNA5 expressing Xenopus oocytes was significantly enhanced by wild-type SGK3 and S419DSGK3, but not by K191NSGK3. SGK3 was effective in the presence of ouabain (1 mM and thus did not require Na+/K+ ATPase activity. Coexpression of Nedd4-2 decreased the voltage gated current in KCNA5 expressing Xenopus oocytes, an effect largely reversed by additional coexpression of SGK3. Conclusion: SGK3 is a positive regulator of KCNA5, which is at least partially effective by abrogating the effect of Nedd4-2.

  8. Functionalized Fullerene Targeting Human Voltage-Gated Sodium Channel, hNav1.7. (United States)

    Hilder, Tamsyn A; Robinson, Anna; Chung, Shin-Ho


    Mutations of hNa v 1.7 that cause its activities to be enhanced contribute to severe neuropathic pain. Only a small number of hNa v 1.7 specific inhibitors have been identified, most of which interact with the voltage-sensing domain of the voltage-activated sodium ion channel. In our previous computational study, we demonstrated that a [Lys 6 ]-C 84 fullerene binds tightly (affinity of 46 nM) to Na v Ab, the voltage-gated sodium channel from the bacterium Arcobacter butzleri. Here, we extend this work and, using molecular dynamics simulations, demonstrate that the same [Lys 6 ]-C 84 fullerene binds strongly (2.7 nM) to the pore of a modeled human sodium ion channel hNa v 1.7. In contrast, the fullerene binds only weakly to a mutated model of hNa v 1.7 (I1399D) (14.5 mM) and a model of the skeletal muscle hNa v 1.4 (3.7 mM). Comparison of one representative sequence from each of the nine human sodium channel isoforms shows that only hNa v 1.7 possesses residues that are critical for binding the fullerene derivative and blocking the channel pore.

  9. Highly selective water channel activity measured by voltage clamp: analysis of planar lipid bilayers reconstituted with purified AqpZ. (United States)

    Pohl, P; Saparov, S M; Borgnia, M J; Agre, P


    Aquaporins are membrane channels selectively permeated by water or water plus glycerol. Conflicting reports have described ion conductance associated with some water channels, raising the question of whether ion conductance is a general property of the aquaporin family. To clarify this question, a defined system was developed to simultaneously measure water permeability and ion conductance. The Escherichia coli water channel aquaporin-Z (AqpZ) was studied, because it is a highly stable tetramer. Planar lipid bilayers were formed from unilamellar vesicles containing purified AqpZ. The hydraulic conductivity of bilayers made from the total extract of E. coli lipids increased 3-fold if reconstituted with AqpZ, but electric conductance was unchanged. No channel activity was detected under voltage-clamp conditions, indicating that less than one in 10(9) transport events is electrogenic. Microelectrode measurements were simultaneously undertaken adjacent to the membrane. Changes in sodium concentration profiles accompanying transmembrane water flow permitted calculation of the activation energies: 14 kcal/mol for protein-free lipid bilayers and 4 kcal/mol for lipid bilayers containing AqpZ. Neither the water permeability nor the electric conductivity exhibited voltage dependence. This sensitive system demonstrated that AqpZ is permeated by water but not charged ions and should permit direct analyses of putative electrogenic properties of other aquaporins.

  10. T-type voltage-gated calcium channels regulate the tone of mouse efferent arterioles

    DEFF Research Database (Denmark)

    Poulsen, Christian B; Al-Mashhadi, Rozh H; Cribbs, Leanne L


    Voltage-gated calcium channels are important for the regulation of renal blood flow and the glomerular filtration rate. Excitation-contraction coupling in afferent arterioles is known to require activation of these channels and we studied their role in the regulation of cortical efferent arteriolar...... tone. We used microdissected perfused mouse efferent arterioles and found a transient vasoconstriction in response to depolarization with potassium; an effect abolished by removal of extracellular calcium. The T-type voltage-gated calcium channel antagonists mibefradil and nickel blocked this potassium...... by immunocytochemistry to be located in mouse efferent arterioles, human pre- and postglomerular vasculature, and Ca(v)3.2 in rat glomerular arterioles. Inhibition of endothelial nitric oxide synthase by L-NAME or its deletion by gene knockout changed the potassium-elicited transient constriction to a sustained response...

  11. Intron retention in mRNA encoding ancillary subunit of insect voltage-gated sodium channel modulates channel expression, gating regulation and drug sensitivity.

    Directory of Open Access Journals (Sweden)

    Céline M Bourdin

    Full Text Available Insect voltage-gated sodium (Nav channels are formed by a well-known pore-forming α-subunit encoded by para-like gene and ancillary subunits related to TipE from the mutation "temperature-induced-paralysis locus E." The role of these ancillary subunits in the modulation of biophysical and pharmacological properties of Na(+ currents are not enough documented. The unique neuronal ancillary subunit TipE-homologous protein 1 of Drosophila melanogaster (DmTEH1 strongly enhances the expression of insect Nav channels when heterologously expressed in Xenopus oocytes. Here we report the cloning and functional expression of two neuronal DmTEH1-homologs of the cockroach, Periplaneta americana, PaTEH1A and PaTEH1B, encoded by a single bicistronic gene. In PaTEH1B, the second exon encoding the last 11-amino-acid residues of PaTEH1A is shifted to 3'UTR by the retention of a 96-bp intron-containing coding-message, thus generating a new C-terminal end. We investigated the gating and pharmacological properties of the Drosophila Nav channel variant (DmNav1-1 co-expressed with DmTEH1, PaTEH1A, PaTEH1B or a truncated mutant PaTEH1Δ(270-280 in Xenopus oocytes. PaTEH1B caused a 2.2-fold current density decrease, concomitant with an equivalent α-subunit incorporation decrease in the plasma membrane, compared to PaTEH1A and PaTEH1Δ(270-280. PaTEH1B positively shifted the voltage-dependences of activation and slow inactivation of DmNav1-1 channels to more positive potentials compared to PaTEH1A, suggesting that the C-terminal end of both proteins may influence the function of the voltage-sensor and the pore of Nav channel. Interestingly, our findings showed that the sensitivity of DmNav1-1 channels to lidocaine and to the pyrazoline-type insecticide metabolite DCJW depends on associated TEH1-like subunits. In conclusion, our work demonstrates for the first time that density, gating and pharmacological properties of Nav channels expressed in Xenopus oocytes can be

  12. Functional Importance of L- and P/Q-Type Voltage-Gated Calcium Channels in Human Renal Vasculature

    DEFF Research Database (Denmark)

    Hansen, Pernille B; Poulsen, Christian B; Walter, Steen


    Calcium channel blockers are widely used for treatment of hypertension, because they decrease peripheral vascular resistance through inhibition of voltage-gated calcium channels. Animal studies of renal vasculature have shown expression of several types of calcium channels that are involved......-type subtype (Ca(v) 3.1 and Ca(v) 3.2) voltage-gated calcium channels (Ca(v)s), and quantitative PCR showed highest expression of L-type channels in renal arteries and variable expression between patients of subtypes of calcium channels in intrarenal vessels. Immunohistochemical labeling of kidney sections...

  13. Regulation of Na+ channel inactivation by the DIII and DIV voltage-sensing domains. (United States)

    Hsu, Eric J; Zhu, Wandi; Schubert, Angela R; Voelker, Taylor; Varga, Zoltan; Silva, Jonathan R


    Functional eukaryotic voltage-gated Na + (Na V ) channels comprise four domains (DI-DIV), each containing six membrane-spanning segments (S1-S6). Voltage sensing is accomplished by the first four membrane-spanning segments (S1-S4), which together form a voltage-sensing domain (VSD). A critical Na V channel gating process, inactivation, has previously been linked to activation of the VSDs in DIII and DIV. Here, we probe this interaction by using voltage-clamp fluorometry to observe VSD kinetics in the presence of mutations at locations that have been shown to impair Na V channel inactivation. These locations include the DIII-DIV linker, the DIII S4-S5 linker, and the DIV S4-S5 linker. Our results show that, within the 10-ms timeframe of fast inactivation, the DIV-VSD is the primary regulator of inactivation. However, after longer 100-ms pulses, the DIII-DIV linker slows DIII-VSD deactivation, and the rate of DIII deactivation correlates strongly with the rate of recovery from inactivation. Our results imply that, over the course of an action potential, DIV-VSDs regulate the onset of fast inactivation while DIII-VSDs determine its recovery. © 2017 Hsu et al.

  14. KCNE1 constrains the voltage sensor of Kv7.1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Liora Shamgar

    Full Text Available Kv7 potassium channels whose mutations cause cardiovascular and neurological disorders are members of the superfamily of voltage-gated K(+ channels, comprising a central pore enclosed by four voltage-sensing domains (VSDs and sharing a homologous S4 sensor sequence. The Kv7.1 pore-forming subunit can interact with various KCNE auxiliary subunits to form K(+ channels with very different gating behaviors. In an attempt to characterize the nature of the promiscuous gating of Kv7.1 channels, we performed a tryptophan-scanning mutagenesis of the S4 sensor and analyzed the mutation-induced perturbations in gating free energy. Perturbing the gating energetics of Kv7.1 bias most of the mutant channels towards the closed state, while fewer mutations stabilize the open state or the inactivated state. In the absence of auxiliary subunits, mutations of specific S4 residues mimic the gating phenotypes produced by co-assembly of Kv7.1 with either KCNE1 or KCNE3. Many S4 perturbations compromise the ability of KCNE1 to properly regulate Kv7.1 channel gating. The tryptophan-induced packing perturbations and cysteine engineering studies in S4 suggest that KCNE1 lodges at the inter-VSD S4-S1 interface between two adjacent subunits, a strategic location to exert its striking action on Kv7.1 gating functions.

  15. A novel ZVS high voltage power supply for micro-channel plate photomultiplier tubes

    Energy Technology Data Exchange (ETDEWEB)

    Pei, Chengquan [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China); Tian, Jinshou [Xi’an Institute of Optics and Precision Mechanics, Chinese Academy of Sciences, Xi' an 710119 (China); Liu, Zhen [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China); Qin, Hong [School of Computer Science and Technology, Xi' an University of Science and Technology, Xi' an 710054 (China); Wu, Shengli, E-mail: [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China)


    A novel resonant high voltage power supply (HVPS) with zero voltage switching (ZVS), to reduce the voltage stress on switching devices and improve conversion efficiency, is proposed. The proposed HVPS includes a drive circuit, a transformer, several voltage multiplying circuits, and a regulator circuit. The HVPS contains several secondary windings that can be precisely regulated. The proposed HVPS performed better than the traditional resistor voltage divider, which requires replacing matching resistors resulting in resistor dispersibility in the Micro-Channel Plate (MCP). The equivalent circuit of the proposed HVPS was established and the operational principle analyzed. The entire switching element can achieve ZVS, which was validated by a simulation and experiments. The properties of this HVPS were tested including minimum power loss (240 mW), maximum power loss (1 W) and conversion efficiency (85%). The results of this research are that the proposed HVPS was suitable for driving the micro-channel plate photomultiplier tube (MCP-PMT). It was therefore adopted to test the MCP-PMT, which will be used in Daya Bay reactor neutrino experiment II in China.

  16. A novel ZVS high voltage power supply for micro-channel plate photomultiplier tubes

    International Nuclear Information System (INIS)

    Pei, Chengquan; Tian, Jinshou; Liu, Zhen; Qin, Hong; Wu, Shengli


    A novel resonant high voltage power supply (HVPS) with zero voltage switching (ZVS), to reduce the voltage stress on switching devices and improve conversion efficiency, is proposed. The proposed HVPS includes a drive circuit, a transformer, several voltage multiplying circuits, and a regulator circuit. The HVPS contains several secondary windings that can be precisely regulated. The proposed HVPS performed better than the traditional resistor voltage divider, which requires replacing matching resistors resulting in resistor dispersibility in the Micro-Channel Plate (MCP). The equivalent circuit of the proposed HVPS was established and the operational principle analyzed. The entire switching element can achieve ZVS, which was validated by a simulation and experiments. The properties of this HVPS were tested including minimum power loss (240 mW), maximum power loss (1 W) and conversion efficiency (85%). The results of this research are that the proposed HVPS was suitable for driving the micro-channel plate photomultiplier tube (MCP-PMT). It was therefore adopted to test the MCP-PMT, which will be used in Daya Bay reactor neutrino experiment II in China.


    Directory of Open Access Journals (Sweden)

    Francesco eMiceli


    Full Text Available Voltage-gated ion channels (VGIC are membrane proteins that switch from a closed to open state in response to changes in membrane potential, thus enabling ion fluxes across the cell membranes. The mechanism that regulate the structural rearrangements occurring in VGIC in response to changes in membrane potential still remains one of the most challenging topic of modern biophysics. Na+, Ca2+ and K+ voltage-gated channels are structurally formed by the assembly of four similar domains, each comprising six transmembrane segments. Each domain can be divided in two main regions: the Pore Module (PM and the Voltage-Sensing Module (VSM. The PM (helices S5 and S6 and intervening linker is responsible for gate opening and ion selectivity; by contrast, the VSM, comprising the first four transmembrane helices (S1-S4, undergoes the first conformational changes in response to membrane voltage. In particular, the S4 segment of each domain, which contains several positively charged residues interspersed with hydrophobic amino acids, is located within the membrane electric field and plays an essential role in voltage sensing. In neurons, specific gating properties of each channel subtype underlie a variety of biological events, ranging from the generation and propagation of electrical impulses, to the secretion of neurotransmitters, to the regulation of gene expression. Given the important functional role played by the VSM in neuronal VGICs, it is not surprising that various VSM mutations affecting the gating process of these channels are responsible for human diseases, and that compounds acting on the VSM have emerged as important investigational tools with great therapeutic potential. In the present review we will briefly describe the most recent discoveries concerning how the VSM exerts its function, how genetically inherited diseases caused by mutations occurring in the VSM affects gating in VGICs, and how several classes of drugs and toxins selectively

  18. Molecular pathophysiology and pharmacology of the voltage-sensing module of neuronal ion channels. (United States)

    Miceli, Francesco; Soldovieri, Maria Virginia; Ambrosino, Paolo; De Maria, Michela; Manocchio, Laura; Medoro, Alessandro; Taglialatela, Maurizio


    Voltage-gated ion channels (VGICs) are membrane proteins that switch from a closed to open state in response to changes in membrane potential, thus enabling ion fluxes across the cell membranes. The mechanism that regulate the structural rearrangements occurring in VGICs in response to changes in membrane potential still remains one of the most challenging topic of modern biophysics. Na(+), Ca(2+) and K(+) voltage-gated channels are structurally formed by the assembly of four similar domains, each comprising six transmembrane segments. Each domain can be divided into two main regions: the Pore Module (PM) and the Voltage-Sensing Module (VSM). The PM (helices S5 and S6 and intervening linker) is responsible for gate opening and ion selectivity; by contrast, the VSM, comprising the first four transmembrane helices (S1-S4), undergoes the first conformational changes in response to membrane voltage variations. In particular, the S4 segment of each domain, which contains several positively charged residues interspersed with hydrophobic amino acids, is located within the membrane electric field and plays an essential role in voltage sensing. In neurons, specific gating properties of each channel subtype underlie a variety of biological events, ranging from the generation and propagation of electrical impulses, to the secretion of neurotransmitters and to the regulation of gene expression. Given the important functional role played by the VSM in neuronal VGICs, it is not surprising that various VSM mutations affecting the gating process of these channels are responsible for human diseases, and that compounds acting on the VSM have emerged as important investigational tools with great therapeutic potential. In the present review we will briefly describe the most recent discoveries concerning how the VSM exerts its function, how genetically inherited diseases caused by mutations occurring in the VSM affects gating in VGICs, and how several classes of drugs and toxins

  19. Functional role of voltage gated Ca2+ channels in heart automaticity

    Directory of Open Access Journals (Sweden)

    Pietro eMesirca


    Full Text Available Pacemaker activity of automatic cardiac myocytes controls the heartbeat in everyday life. Cardiac automaticity is under the control of several neurotransmitters and hormones and is constantly regulated by the autonomic nervous system to match the physiological needs of the organism. Several classes of ion channels and proteins involved in intracellular Ca2+ dynamics contribute to pacemaker activity. The functional role of voltage-gated calcium channels (VGCCs in heart automaticity and impulse conduction has been matter of debate for 30 years. However, growing evidence shows that VGCCs are important regulators of the pacemaker mechanisms and play also a major role in atrio-ventricular impulse conduction. Incidentally, studies performed in genetically modified mice lacking L-type Cav1.3 (Cav1.3-/- or T-type Cav3.1 (Cav3.1-/- channels show that genetic inactivation of these channels strongly impacts pacemaking. In cardiac pacemaker cells, VGCCs activate at negative voltages at the beginning of the diastolic depolarization and importantly contribute to this phase by supplying inward current. Loss-of-function of these channels also impairs atrio-ventricular conduction. Furthermore, inactivation of Cav1.3 channels promotes also atrial fibrillation and flutter in knockout mice suggesting that these channels can play a role in stabilizing atrial rhythm. Genomic analysis demonstrated that Cav1.3 and Cav3.1 channels are widely expressed in pacemaker tissue of mice, rabbits and humans. Importantly, human diseases of pacemaker activity such as congenital bradycardia and heart block have been attributed to loss-of-function of Cav1.3 and Cav3.1 channels. In this article, we will review the current knowledge on the role of VGCCs in the generation and regulation of heart rate and rhythm. We will discuss also how loss of Ca2+ entry through VGCCs could influence intracellular Ca2+ handling and promote atrial arrhythmias.

  20. KCNQ1 channel modulation by KCNE proteins via the voltage-sensing domain. (United States)

    Nakajo, Koichi; Kubo, Yoshihiro


    The gating of the KCNQ1 potassium channel is drastically regulated by auxiliary subunit KCNE proteins. KCNE1, for example, slows the activation kinetics of KCNQ1 by two orders of magnitude. Like other voltage-gated ion channels, the opening of KCNQ1 is regulated by the voltage-sensing domain (VSD; S1-S4 segments). Although it has been known that KCNE proteins interact with KCNQ1 via the pore domain, some recent reports suggest that the VSD movement may be altered by KCNE. The altered VSD movement of KCNQ1 by KCNE proteins has been examined by site-directed mutagenesis, the scanning cysteine accessibility method (SCAM), voltage clamp fluorometry (VCF) and gating charge measurements. These accumulated data support the idea that KCNE proteins interact with the VSDs of KCNQ1 and modulate the gating of the KCNQ1 channel. In this review, we will summarize recent findings and current views of the KCNQ1 modulation by KCNE via the VSD. In this context, we discuss our recent findings that KCNE1 may alter physical interactions between the S4 segment (VSD) and the S5 segment (pore domain) of KCNQ1. Based on these findings from ourselves and others, we propose a hypothetical mechanism for how KCNE1 binding alters the VSD movement and the gating of the channel. © 2015 The Authors. The Journal of Physiology © 2015 The Physiological Society.

  1. Voltage-sensing domain mode shift is coupled to the activation gate by the N-terminal tail of hERG channels. (United States)

    Tan, Peter S; Perry, Matthew D; Ng, Chai Ann; Vandenberg, Jamie I; Hill, Adam P


    Human ether-a-go-go-related gene (hERG) potassium channels exhibit unique gating kinetics characterized by unusually slow activation and deactivation. The N terminus of the channel, which contains an amphipathic helix and an unstructured tail, has been shown to be involved in regulation of this slow deactivation. However, the mechanism of how this occurs and the connection between voltage-sensing domain (VSD) return and closing of the gate are unclear. To examine this relationship, we have used voltage-clamp fluorometry to simultaneously measure VSD motion and gate closure in N-terminally truncated constructs. We report that mode shifting of the hERG VSD results in a corresponding shift in the voltage-dependent equilibrium of channel closing and that at negative potentials, coupling of the mode-shifted VSD to the gate defines the rate of channel closure. Deletion of the first 25 aa from the N terminus of hERG does not alter mode shifting of the VSD but uncouples the shift from closure of the cytoplasmic gate. Based on these observations, we propose the N-terminal tail as an adaptor that couples voltage sensor return to gate closure to define slow deactivation gating in hERG channels. Furthermore, because the mode shift occurs on a time scale relevant to the cardiac action potential, we suggest a physiological role for this phenomenon in maximizing current flow through hERG channels during repolarization.

  2. Voltage Gated Calcium Channel Activation by Backpropagating Action Potentials Downregulates NMDAR Function

    Directory of Open Access Journals (Sweden)

    Anne-Kathrin Theis


    Full Text Available The majority of excitatory synapses are located on dendritic spines of cortical glutamatergic neurons. In spines, compartmentalized Ca2+ signals transduce electrical activity into specific long-term biochemical and structural changes. Action potentials (APs propagate back into the dendritic tree and activate voltage gated Ca2+ channels (VGCCs. For spines, this global mode of spine Ca2+ signaling is a direct biochemical feedback of suprathreshold neuronal activity. We previously demonstrated that backpropagating action potentials (bAPs result in long-term enhancement of spine VGCCs. This activity-dependent VGCC plasticity results in a large interspine variability of VGCC Ca2+ influx. Here, we investigate how spine VGCCs affect glutamatergic synaptic transmission. We combined electrophysiology, two-photon Ca2+ imaging and two-photon glutamate uncaging in acute brain slices from rats. T- and R-type VGCCs were the dominant depolarization-associated Ca2+conductances in dendritic spines of excitatory layer 2 neurons and do not affect synaptic excitatory postsynaptic potentials (EPSPs measured at the soma. Using two-photon glutamate uncaging, we compared the properties of glutamatergic synapses of single spines that express different levels of VGCCs. While VGCCs contributed to EPSP mediated Ca2+ influx, the amount of EPSP mediated Ca2+ influx is not determined by spine VGCC expression. On a longer timescale, the activation of VGCCs by bAP bursts results in downregulation of spine NMDAR function.

  3. Coassembly of big conductance Ca2+-activated K+ channels and L-type voltage-gated Ca2+ channels in rat brain

    DEFF Research Database (Denmark)

    Grunnet, Morten; Kaufmann, Walter A


    Based on electrophysiological studies, Ca(2+)-activated K(+) channels and voltage-gated Ca(2+) channels appear to be located in close proximity in neurons. Such colocalization would ensure selective and rapid activation of K(+) channels by local increases in the cytosolic calcium concentration...

  4. Niflumic acid alters gating of HCN2 pacemaker channels by interaction with the outer region of S4 voltage sensing domains. (United States)

    Cheng, Lan; Sanguinetti, Michael C


    Niflumic acid, 2-[[3-(trifluoromethyl)phenyl]amino]pyridine-3-carboxylic acid (NFA), is a nonsteroidal anti-inflammatory drug that also blocks or modifies the gating of many ion channels. Here, we investigated the effects of NFA on hyperpolarization-activated cyclic nucleotide-gated cation (HCN) pacemaker channels expressed in X. laevis oocytes using site-directed mutagenesis and the two-electrode voltage-clamp technique. Extracellular NFA acted rapidly and caused a slowing of activation and deactivation and a hyperpolarizing shift in the voltage dependence of HCN2 channel activation (-24.5 +/- 1.2 mV at 1 mM). Slowed channel gating and reduction of current magnitude was marked in oocytes treated with NFA, while clamped at 0 mV but minimal in oocytes clamped at -100 mV, indicating the drug preferentially interacts with channels in the closed state. NFA at 0.1 to 3 mM shifted the half-point for channel activation in a concentration-dependent manner, with an EC(50) of 0.54 +/- 0.068 mM and a predicted maximum shift of -38 mV. NFA at 1 mM also reduced maximum HCN2 conductance by approximately 20%, presumably by direct block of the pore. The rapid onset and state-dependence of NFA-induced changes in channel gating suggests an interaction with the extracellular region of the S4 transmembrane helix, the primary voltage-sensing domain of HCN2. Neutralization (by mutation to Gln) of any three of the outer four basic charged residues in S4, but not single mutations, abrogated the NFA-induced shift in channel activation. We conclude that NFA alters HCN2 gating by interacting with the extracellular end of the S4 voltage sensor domains.

  5. Voltage-dependent modulation of cardiac ryanodine receptors (RyR2 by protamine.

    Directory of Open Access Journals (Sweden)

    Paula L Diaz-Sylvester

    Full Text Available It has been reported that protamine (>10 microg/ml blocks single skeletal RyR1 channels and inhibits RyR1-mediated Ca2+ release from sarcoplasmic reticulum microsomes. We extended these studies to cardiac RyR2 reconstituted into planar lipid bilayers. We found that protamine (0.02-20 microg/ml added to the cytosolic surface of fully activated RyR2 affected channel activity in a voltage-dependent manner. At membrane voltage (V(m; SR lumen-cytosol = 0 mV, protamine induced conductance transitions to several intermediate states (substates as well as full block of RyR2. At V(m>10 mV, the substate with the highest level of conductance was predominant. Increasing V(m from 0 to +80 mV, decreased the number of transitions and residence of the channel in this substate. The drop in current amplitude (full opening to substate had the same magnitude at 0 and +80 mV despite the approximately 3-fold increase in amplitude of the full opening. This is more similar to rectification of channel conductance induced by other polycations than to the action of selective conductance modifiers (ryanoids, imperatoxin. A distinctive effect of protamine (which might be shared with polylysines and histones but not with non-peptidic polycations is the activation of RyR2 in the presence of nanomolar cytosolic Ca2+ and millimolar Mg2+ levels. Our results suggest that RyRs would be subject to dual modulation (activation and block by polycationic domains of neighboring proteins via electrostatic interactions. Understanding these interactions could be important as such anomalies may be associated with the increased RyR2-mediated Ca2+ leak observed in cardiac diseases.

  6. Independent and cooperative motions of the Kv1.2 channel: voltage sensing and gating. (United States)

    Yeheskel, Adva; Haliloglu, Turkan; Ben-Tal, Nir


    Voltage-gated potassium (Kv) channels, such as Kv1.2, are involved in the generation and propagation of action potentials. The Kv channel is a homotetramer, and each monomer is composed of a voltage-sensing domain (VSD) and a pore domain (PD). We analyzed the fluctuations of a model structure of Kv1.2 using elastic network models. The analysis suggested a network of coupled fluctuations of eight rigid structural units and seven hinges that may control the transition between the active and inactive states of the channel. For the most part, the network is composed of amino acids that are known to affect channel activity. The results suggested allosteric interactions and cooperativity between the subunits in the coupling between the motion of the VSD and the selectivity filter of the PD, in accordance with recent empirical data. There are no direct contacts between the VSDs of the four subunits, and the contacts between these and the PDs are loose, suggesting that the VSDs are capable of functioning independently. Indeed, they manifest many inherent fluctuations that are decoupled from the rest of the structure. In general, the analysis suggests that the two domains contribute to the channel function both individually and cooperatively. Copyright 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  7. H2O2 augments cytosolic calcium in nucleus tractus solitarii neurons via multiple voltage-gated calcium channels. (United States)

    Ostrowski, Tim D; Dantzler, Heather A; Polo-Parada, Luis; Kline, David D


    Reactive oxygen species (ROS) play a profound role in cardiorespiratory function under normal physiological conditions and disease states. ROS can influence neuronal activity by altering various ion channels and transporters. Within the nucleus tractus solitarii (nTS), a vital brainstem area for cardiorespiratory control, hydrogen peroxide (H 2 O 2 ) induces sustained hyperexcitability following an initial depression of neuronal activity. The mechanism(s) associated with the delayed hyperexcitability are unknown. Here we evaluate the effect(s) of H 2 O 2 on cytosolic Ca 2+ (via fura-2 imaging) and voltage-dependent calcium currents in dissociated rat nTS neurons. H 2 O 2 perfusion (200 µM; 1 min) induced a delayed, slow, and moderate increase (~27%) in intracellular Ca 2+ concentration ([Ca 2+ ] i ). The H 2 O 2 -mediated increase in [Ca 2+ ] i prevailed during thapsigargin, excluding the endoplasmic reticulum as a Ca 2+ source. The effect, however, was abolished by removal of extracellular Ca 2+ or the addition of cadmium to the bath solution, suggesting voltage-gated Ca 2+ channels (VGCCs) as targets for H 2 O 2 modulation. Recording of the total voltage-dependent Ca 2+ current confirmed H 2 O 2 enhanced Ca 2+ entry. Blocking VGCC L, N, and P/Q subtypes decreased the number of cells and their calcium currents that respond to H 2 O 2 The number of responder cells to H 2 O 2 also decreased in the presence of dithiothreitol, suggesting the actions of H 2 O 2 were dependent on sulfhydryl oxidation. In summary, here, we have shown that H 2 O 2 increases [Ca 2+ ] i and its Ca 2+ currents, which is dependent on multiple VGCCs likely by oxidation of sulfhydryl groups. These processes presumably contribute to the previously observed delayed hyperexcitability of nTS neurons in in vitro brainstem slices. Copyright © 2017 the American Physiological Society.

  8. 24-channel dual microcontroller-based voltage controller for ion optics remote control (United States)

    Bengtsson, L.


    The design of a 24-channel voltage control instrument for Wenzel Elektronik N1130 NIM modules is described. This instrument is remote controlled from a LabVIEW GUI on a host Windows computer and is intended for ion optics control in electron affinity measurements on negative ions at the CERN-ISOLDE facility. Each channel has a resolution of 12 bits and has a normally distributed noise with a standard deviation of <1 mV. The instrument is designed as a standard 2-unit NIM module where the electronic hardware consists of a printed circuit board with two asynchronously operating microcontrollers.

  9. History-dependent dynamics in a generic model of ion channels - an analytic study

    Directory of Open Access Journals (Sweden)

    Daniel Soudry


    Full Text Available Recent experiments have demonstrated that the timescale of adaptation of single neurons and ion channel populations to stimuli slows down as the length of stimulation increases; in fact, no upper bound on temporal time-scales seems to exist in such systems. Furthermore, patch clamp experiments on single ion channels have hinted at the existence of large, mostly unobservable, inactivation state spaces within a single ion channel. This raises the question of the relation between this multitude of inactivation states and the observed behavior. In this work we propose a minimal model for ion channel dynamics which does not assume any specific structure of the inactivation state space. The model is simple enough to render an analytical study possible. This leads to a clear and concise explanation of the experimentally observed exponential history-dependent relaxation in sodium channels in a voltage clamp setting, and shows that their recovery rate from slow inactivation must be voltage dependent. Furthermore, we predict that history-dependent relaxation cannot be created by overly sparse spiking activity. While the model was created with ion channel populations in mind, its simplicity and genericalness render it a good starting point for modeling similar effects in other systems, and for scaling up to higher levels such as single neurons which are also known to exhibit multiple time scales.

  10. A novel tarantula toxin stabilizes the deactivated voltage sensor of bacterial sodium channel. (United States)

    Tang, Cheng; Zhou, Xi; Nguyen, Phuong Tran; Zhang, Yunxiao; Hu, Zhaotun; Zhang, Changxin; Yarov-Yarovoy, Vladimir; DeCaen, Paul G; Liang, Songping; Liu, Zhonghua


    Voltage-gated sodium channels (Na V s) are activated by transiting the voltage sensor from the deactivated to the activated state. The crystal structures of several bacterial Na V s have captured the voltage sensor module (VSM) in an activated state, but structure of the deactivated voltage sensor remains elusive. In this study, we sought to identify peptide toxins stabilizing the deactivated VSM of bacterial Na V s. We screened fractions from several venoms and characterized a cystine knot toxin called JZTx-27 from the venom of tarantula Chilobrachys jingzhao as a high-affinity antagonist of the prokaryotic Na V s Ns V Ba (nonselective voltage-gated Bacillus alcalophilus ) and NaChBac (bacterial sodium channel from Bacillus halodurans ) (IC 50 = 112 nM and 30 nM, respectively). JZTx-27 was more efficacious at weaker depolarizing voltages and significantly slowed the activation but accelerated the deactivation of Ns V Ba, whereas the local anesthetic drug lidocaine was shown to antagonize Ns V Ba without affecting channel gating. Mutation analysis confirmed that JZTx-27 bound to S3-4 linker of Ns V Ba, with F98 being the critical residue in determining toxin affinity. All electrophysiological data and in silico analysis suggested that JZTx-27 trapped VSM of Ns V Ba in one of the deactivated states. In mammalian Na V s, JZTx-27 preferably inhibited the inactivation of Na V 1.5 by targeting the fourth transmembrane domain. To our knowledge, this is the first report of peptide antagonist for prokaryotic Na V s. More important, we proposed that JZTx-27 stabilized the Ns V Ba VSM in the deactivated state and may be used as a probe to determine the structure of the deactivated VSM of Na V s.-Tang, C., Zhou, X., Nguyen, P. T., Zhang, Y., Hu, Z., Zhang, C., Yarov-Yarovoy, V., DeCaen, P. G., Liang, S., Liu, Z. A novel tarantula toxin stabilizes the deactivated voltage sensor of bacterial sodium channel. © FASEB.

  11. Expression of voltage-activated calcium channels in the early zebrafish embryo. (United States)

    Sanhueza, Dayán; Montoya, Andro; Sierralta, Jimena; Kukuljan, Manuel


    Increases in cytosolic calcium concentrations regulate many cellular processes, including aspects of early development. Calcium release from intracellular stores and calcium entry through non-voltage-gated channels account for signalling in non-excitable cells, whereas voltage-gated calcium channels (CaV) are important in excitable cells. We report the expression of multiple transcripts of CaV, identified by its homology to other species, in the early embryo of the zebrafish, Danio rerio, at stages prior to the differentiation of excitable cells. CaV mRNAs and proteins were detected as early as the 2-cell stages, which indicate that they arise from both maternal and zygotic transcription. Exposure of embryos to pharmacological blockers of CaV does not perturb early development significantly, although late effects are appreciable. These results suggest that CaV may have a role in calcium homeostasis and control of cellular process during early embryonic development.

  12. C-terminal modulatory domain controls coupling of voltage-sensing to pore opening in Cav1.3 L-type Ca(2+) channels. (United States)

    Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg


    Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages

  13. Encephalitis due to antibodies to voltage gated potassium channel (VGKC with cerebellar involvement in a teenager

    Directory of Open Access Journals (Sweden)

    Megan M Langille


    Full Text Available Encephalitis due to antibodies to voltage gated potassium channel (VGKC typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum of this rare condition.

  14. Delayed LGI1 seropositivity in voltage-gated potassium channel (VGKC)-complex antibody limbic encephalitis


    Sweeney, Michael; Galli, Jonathan; McNally, Scott; Tebo, Anne; Haven, Thomas; Thulin, Perla; Clardy, Stacey L


    We utilise a clinical case to highlight why exclusion of voltage-gated potassium channel (VGKC)-complex autoantibody testing in serological evaluation of patients may delay or miss the diagnosis. A 68-year-old man presented with increasing involuntary movements consistent with faciobrachial dystonic seizures (FBDS). Initial evaluation demonstrated VGKC antibody seropositivity with leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-like 2 (CASPR2) seronegativity. Aggress...

  15. Intracellular and non-neuronal targets of voltage-gated potassium channel complex antibodies


    Lang, Bethan; Makuch, Mateusz; Moloney, Teresa; Dettmann, Inga; Mindorf, Swantje; Probst, Christian; Stoecker, Winfried; Buckley, Camilla; Newton, Charles R; Leite, M Isabel; Maddison, Paul; Komorowski, Lars; Adcock, Jane; Vincent, Angela; Waters, Patrick


    Objectives Autoantibodies against the extracellular domains of the voltage-gated potassium channel (VGKC) complex proteins, leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-2 (CASPR2), are found in patients with limbic encephalitis, faciobrachial dystonic seizures, Morvan's syndrome and neuromyotonia. However, in routine testing, VGKC complex antibodies without LGI1 or CASPR2 reactivities (double-negative) are more common than LGI1 or CASPR2 specificities. Therefore, ...

  16. Modulation of voltage-gated channel currents by harmaline and harmane


    Splettstoesser, Frank; Bonnet, Udo; Wiemann, Martin; Bingmann, Dieter; Büsselberg, Dietrich


    Harmala alkaloids are endogenous substances, which are involved in neurodegenerative disorders such as M. Parkinson, but some of them also have neuroprotective effects in the nervous system.While several sites of action at the cellular level (e.g. benzodiazepine receptors, 5-HT and GABAA receptors) have been identified, there is no report on how harmala alkaloids interact with voltage-gated membrane channels.The aim of this study was to investigate the effects of harmaline and harmane on volt...

  17. Encephalitis due to antibodies to voltage gated potassium channel (VGKC) with cerebellar involvement in a teenager. (United States)

    Langille, Megan M; Desai, Jay


    Encephalitis due to antibodies to voltage gated potassium channel (VGKC) typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum of this rare condition.

  18. Encephalitis due to antibodies to voltage gated potassium channel (VGKC) with cerebellar involvement in a teenager


    Langille, Megan M.; Desai, Jay


    Encephalitis due to antibodies to voltage gated potassium channel (VGKC) typically presents with limbic encephalitis and medial temporal lobe involvement on neuroimaging. We describe a case of 13 year girl female with encephalitis due to antibodies to VGKC with signal changes in the cerebellar dentate nuclei bilaterally and clinical features that suggested predominant cerebellar involvement. These have never been reported previously in the literature. Our case expands the phenotypic spectrum ...

  19. alpha-helical structural elements within the voltage-sensing domains of a K(+) channel. (United States)

    Li-Smerin, Y; Hackos, D H; Swartz, K J


    Voltage-gated K(+) channels are tetramers with each subunit containing six (S1-S6) putative membrane spanning segments. The fifth through sixth transmembrane segments (S5-S6) from each of four subunits assemble to form a central pore domain. A growing body of evidence suggests that the first four segments (S1-S4) comprise a domain-like voltage-sensing structure. While the topology of this region is reasonably well defined, the secondary and tertiary structures of these transmembrane segments are not. To explore the secondary structure of the voltage-sensing domains, we used alanine-scanning mutagenesis through the region encompassing the first four transmembrane segments in the drk1 voltage-gated K(+) channel. We examined the mutation-induced perturbation in gating free energy for periodicity characteristic of alpha-helices. Our results are consistent with at least portions of S1, S2, S3, and S4 adopting alpha-helical secondary structure. In addition, both the S1-S2 and S3-S4 linkers exhibited substantial helical character. The distribution of gating perturbations for S1 and S2 suggest that these two helices interact primarily with two environments. In contrast, the distribution of perturbations for S3 and S4 were more complex, suggesting that the latter two helices make more extensive protein contacts, possibly interfacing directly with the shell of the pore domain.

  20. α-Helical Structural Elements within the Voltage-Sensing Domains of a K+ Channel (United States)

    Li-Smerin, Yingying; Hackos, David H.; Swartz, Kenton J.


    Voltage-gated K+ channels are tetramers with each subunit containing six (S1–S6) putative membrane spanning segments. The fifth through sixth transmembrane segments (S5–S6) from each of four subunits assemble to form a central pore domain. A growing body of evidence suggests that the first four segments (S1–S4) comprise a domain-like voltage-sensing structure. While the topology of this region is reasonably well defined, the secondary and tertiary structures of these transmembrane segments are not. To explore the secondary structure of the voltage-sensing domains, we used alanine-scanning mutagenesis through the region encompassing the first four transmembrane segments in the drk1 voltage-gated K+ channel. We examined the mutation-induced perturbation in gating free energy for periodicity characteristic of α-helices. Our results are consistent with at least portions of S1, S2, S3, and S4 adopting α-helical secondary structure. In addition, both the S1–S2 and S3–S4 linkers exhibited substantial helical character. The distribution of gating perturbations for S1 and S2 suggest that these two helices interact primarily with two environments. In contrast, the distribution of perturbations for S3 and S4 were more complex, suggesting that the latter two helices make more extensive protein contacts, possibly interfacing directly with the shell of the pore domain. PMID:10613917

  1. Interaction of a dinoflagellate neurotoxin with voltage-activated ion channels in a marine diatom. (United States)

    Kitchen, Sheila A; Bourdelais, Andrea J; Taylor, Alison R


    The potent neurotoxins produced by the harmful algal bloom species Karenia brevis are activators of sodium voltage-gated channels (VGC) in animals, resulting in altered channel kinetics and membrane hyperexcitability. Recent biophysical and genomic evidence supports widespread presence of homologous sodium (Na + ) and calcium (Ca 2+ ) permeable VGCs in unicellular algae, including marine phytoplankton. We therefore hypothesized that VGCs of these phytoplankton may be an allelopathic target for waterborne neurotoxins produced by K. brevis blooms that could lead to ion channel dysfunction and disruption of signaling in a similar manner to animal Na + VGCs. We examined the interaction of brevetoxin-3 (PbTx-3), a K. brevis neurotoxin, with the Na + /Ca 2+ VGC of the non-toxic diatom Odontella sinensi s using electrophysiology. Single electrode current- and voltage- clamp recordings from O. sinensis in the presence of PbTx-3 were used to examine the toxin's effect on voltage gated Na + /Ca 2+ currents. In silico analysis was used to identify the putative PbTx binding site in the diatoms. We identified Na + /Ca 2+ VCG homologs from the transcriptomes and genomes of 12 diatoms, including three transcripts from O. sinensis and aligned them with site-5 of Na + VGCs, previously identified as the PbTx binding site in animals. Up to 1 µM PbTx had no effect on diatom resting membrane potential or membrane excitability. The kinetics of fast inward Na + /Ca 2+ currents that underlie diatom action potentials were also unaffected. However, the peak inward current was inhibited by 33%, delayed outward current was inhibited by 25%, and reversal potential of the currents shifted positive, indicating a change in permeability of the underlying channels. Sequence analysis showed a lack of conservation of the PbTx binding site in diatom VGC homologs, many of which share molecular features more similar to single-domain bacterial Na + /Ca 2+ VGCs than the 4-domain eukaryote channels

  2. Effect of angiotensin II-induced arterial hypertension on the voltage-dependent contractions of mouse arteries. (United States)

    Fransen, Paul; Van Hove, Cor E; Leloup, Arthur J A; Schrijvers, Dorien M; De Meyer, Guido R Y; De Keulenaer, Gilles W


    Arterial hypertension (AHT) affects the voltage dependency of L-type Ca(2+) channels in cardiomyocytes. We analyzed the effect of angiotensin II (AngII)-induced AHT on L-type Ca(2+) channel-mediated isometric contractions in conduit arteries. AHT was induced in C57Bl6 mice with AngII-filled osmotic mini-pumps (4 weeks). Normotensive mice treated with saline-filled osmotic mini-pumps were used for comparison. Voltage-dependent contractions mediated by L-type Ca(2+) channels were studied in vaso-reactive studies in vitro in isolated aortic and femoral arteries by using extracellular K(+) concentration-response (KDR) experiments. In aortic segments, AngII-induced AHT significantly sensitized isometric contractions induced by elevated extracellular K(+) and depolarization. This sensitization was partly prevented by normalizing blood pressure with hydralazine, suggesting that it was caused by AHT rather than by direct AngII effects on aortic smooth muscle cells. The EC50 for extracellular K(+) obtained in vitro correlated significantly with the rise in arterial blood pressure induced by AngII in vivo. The AHT-induced sensitization persisted when aortic segments were exposed to levcromakalim or to inhibitors of basal nitric oxide release. Consistent with these observations, AngII-treatment also sensitized the vaso-relaxing effects of the L-type Ca(2+) channel blocker diltiazem during K(+)-induced contractions. Unlike aorta, AngII-treatment desensitized the isometric contractions to depolarization in femoral arteries pointing to vascular bed specific responses of arteries to hypertension. AHT affects the voltage-dependent L-type Ca(2+) channel-mediated contraction of conduit arteries. This effect may contribute to the decreased vascular compliance in AHT and explain the efficacy of Ca(2+) channel blockers to reduce vascular stiffness and central blood pressure in AHT.

  3. Caution Is Required in Interpretation of Mutations in the Voltage Sensing Domain of Voltage Gated Channels as Evidence for Gating Mechanisms

    Directory of Open Access Journals (Sweden)

    Alisher M. Kariev


    Full Text Available The gating mechanism of voltage sensitive ion channels is generally considered to be the motion of the S4 transmembrane segment of the voltage sensing domains (VSD. The primary supporting evidence came from R→C mutations on the S4 transmembrane segment of the VSD, followed by reaction with a methanethiosulfonate (MTS reagent. The cys side chain is –SH (reactive form –S−; the arginine side chain is much larger, leaving space big enough to accommodate the MTS sulfonate head group. The cavity created by the mutation has space for up to seven more water molecules than were present in wild type, which could be displaced irreversibly by the MTS reagent. Our quantum calculations show there is major reorientation of three aromatic residues that face into the cavity in response to proton displacement within the VSD. Two phenylalanines reorient sufficiently to shield/unshield the cysteine from the intracellular and extracellular ends, depending on the proton positions, and a tyrosine forms a hydrogen bond to the cysteine sulfur with its side chain –OH. These could produce the results of the experiments that have been interpreted as evidence for physical motion of the S4 segment, without physical motion of the S4 backbone. The computations strongly suggest that the interpretation of cysteine substitution reaction experiments be re-examined in the light of these considerations.

  4. In vivo potency of different ligands on voltage-gated sodium channels. (United States)

    Safrany-Fark, Arpad; Petrovszki, Zita; Kekesi, Gabriella; Liszli, Peter; Benedek, Gyorgy; Keresztes, Csilla; Horvath, Gyongyi


    The Ranvier nodes of thick myelinated nerve fibers contain almost exclusively voltage-gated sodium channels (Navs), while the unmyelinated fibers have several receptors (e.g., cannabinoid, transient receptor potential vanilloid receptor 1), too. Therefore, a nerve which contains only motor fibers can be an appropriate in vivo model for selective influence of Navs. The goals were to evaluate the potency of local anesthetic drugs on such a nerve in vivo; furthermore, to investigate the effects of ligands with different structures (arachidonic acid, anandamide, capsaicin and nisoxetine) that were proved to inhibit Navs in vitro with antinociceptive properties. The marginal mandibular branch of the facial nerve was explored in anesthetized Wistar rats; after its stimulation, the electrical activity of the vibrissae muscles was registered following the perineural injection of different drugs. Lidocaine, bupivacaine and ropivacaine evoked dose-dependent decrease in electromyographic activity, i.e., lidocaine had lower potency than bupivacaine or ropivacaine. QX-314 did not cause any effect by itself, but its co-application with lidocaine produced a prolonged inhibition. Nisoxetine had a very low potency. While anandamide and capsaicin in high doses caused about 50% decrease in the amplitude of action potential, arachidonic acid did not influence the responses. We proved that the classical local anesthetics have high potency on motor nerves, suggesting that this method might be a reliable model for selective targeting of Navs in vivo circumstances. It is proposed that the effects of these endogenous lipids and capsaicin on sensory fibers are not primarily mediated by Navs. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Opposite effects of the S4-S5 linker and PIP2 on voltage-gated channel function: KCNQ1/KCNE1 and other channels

    Directory of Open Access Journals (Sweden)

    Frank S Choveau


    Full Text Available Voltage-gated potassium (Kv channels are tetramers, each subunit presenting six transmembrane segments (S1-S6, with each S1-S4 segments forming a voltage-sensing domain (VSD and the four S5-S6 forming both the conduction pathway and its gate. S4 segments control the opening of the intracellular activation gate in response to changes in membrane potential. Crystal structures of several voltage-gated ion channels in combination with biophysical and mutagenesis studies highlighted the critical role of the S4-S5 linker (S4S5L and of the S6 C-terminal part (S6T in the coupling between the VSD and the activation gate. Several mechanisms have been proposed to describe the coupling at a molecular scale. This review summarizes the mechanisms suggested for various voltage-gated ion channels, including a mechanism that we described for KCNQ1, in which S4S5L is acting like a ligand binding to S6T to stabilize the channel in a closed state. As discussed in this review, this mechanism may explain the reverse response to depolarization in HCN-like channels. As opposed to S4S5L, the phosphoinositide, phosphatidylinositol 4,5-bisphosphate (PIP2, stabilizes KCNQ1 channel in an open state. Many other ion channels (not only voltage-gated require PIP2 to function properly, confirming its crucial importance as an ion channel co-factor. This is highlighted in cases in which an altered regulation of ion channels by PIP2 leads to channelopathies, as observed for KCNQ1. This review summarizes the state of the art on the two regulatory mechanisms that are critical for KCNQ1 and other voltage-gated channels function (PIP2 and S4-S5L, and assesses their potential physiological and pathophysiological roles.

  6. Current-voltage characteristics of quantum-point contacts in the closed-channel regime: Transforming the bias voltage into an energy scale

    DEFF Research Database (Denmark)

    Gloos, K.; Utko, P.; Aagesen, M.


    We investigate the I(V) characteristics (current versus bias voltage) of side-gated quantum-point contacts, defined in GaAs/AlxGa1-xAs heterostructures. These point contacts are operated in the closed-channel regime, that is, at fixed gate voltages below zero-bias pinch-off for conductance. Our....... Such a built-in energy-voltage calibration allows us to distinguish between the different contributions to the electron transport across the pinched-off contact due to thermal activation or quantum tunneling. The first involves the height of the barrier, and the latter also its length. In the model that we...

  7. The topogenic function of S4 promotes membrane insertion of the voltage-sensor domain in the KvAP channel. (United States)

    Mishima, Eriko; Sato, Yoko; Nanatani, Kei; Hoshi, Naomi; Lee, Jong-Kook; Schiller, Nina; von Heijne, Gunnar; Sakaguchi, Masao; Uozumi, Nobuyuki


    Voltage-dependent K + (K V ) channels control K + permeability in response to shifts in the membrane potential. Voltage sensing in K V channels is mediated by the positively charged transmembrane domain S4. The best-characterized K V channel, KvAP, lacks the distinct hydrophilic region corresponding to the S3-S4 extracellular loop that is found in other K + channels. In the present study, we evaluated the topogenic properties of the transmembrane regions within the voltage-sensing domain in KvAP. S3 had low membrane insertion activity, whereas S4 possessed a unique type-I signal anchor (SA-I) function, which enabled it to insert into the membrane by itself. S4 was also found to function as a stop-transfer signal for retention in the membrane. The length and structural nature of the extracellular S3-S4 loop affected the membrane insertion of S3 and S4, suggesting that S3 membrane insertion was dependent on S4. Replacement of charged residues within the transmembrane regions with residues of opposite charge revealed that Asp 72 in S2 and Glu 93 in S3 contributed to membrane insertion of S3 and S4, and increased the stability of S4 in the membrane. These results indicate that the SA-I function of S4, unique among K + channels studied to date, promotes the insertion of S3 into the membrane, and that the charged residues essential for voltage sensing contribute to the membrane-insertion of the voltage sensor domain in KvAP. © 2016 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  8. New Conotoxin SO-3 Targeting N-type Voltage-Sensitive Calcium Channels

    Directory of Open Access Journals (Sweden)

    Lei Wen


    Full Text Available Selective blockers of the N-type voltage-sensitive calcium (CaV channels are useful in the management of severe chronic pain. Here, the structure and function characteristics of a novel N-type CaV channel blocker, SO-3, are reviewed. SO-3 is a 25-amino acid conopeptide originally derived from the venom of Conus striatus, and contains the same 4-loop, 6-cysteine framework (C-C-CC-C-C as O-superfamily conotoxins. The synthetic SO-3 has high analgesic activity similar to ω-conotoxin MVIIA (MVIIA, a selective N-type CaV channel blocker approved in the USA and Europe for the alleviation of persistent pain states. In electrophysiological studies, SO-3 shows more selectivity towards the N-type CaV channels than MVIIA. The dissimilarity between SO-3 and MVIIA in the primary and tertiary structures is further discussed in an attempt to illustrate the difference in selectivity of SO-3 and MVIIA towards N-type CaV channels.

  9. Action of insecticidal N-alkylamides at site 2 of the voltage-sensitive sodium channel

    International Nuclear Information System (INIS)

    Ottea, J.A.; Payne, G.T.; Soderlund, D.M.


    Nine synthetic N-alkylamides were examined as inhibitors of the specific binding of [ 3 H]batrachotoxinin A 20α-benzoate ([ 3 H]BTX-B) to sodium channels and as activators of sodium uptake in mouse brain synaptoneurosomes. In the presence of scorpion (Leiurus quinquestriatus) venom, the six insecticidal analogues were active as both inhibitors of [ 3 H]BTX-B binding and stimulators of sodium uptake. These findings are consistent with an action of these compounds at the alkaloid activator recognition site (site 2) of the voltage-sensitive sodium channel. The three noninsecticidal N-alkylamides also inhibited [ 3 H]BTX-B binding but were ineffective as activators of sodium uptake. Concentration-response studies revealed that some of the insecticidal amides also enhanced sodium uptake through a second, high-affinity interaction that does not involve site 2, but this secondary effect does not appear to be correlated with insecticidal activity. The activities of N-alkylamides as sodium channel activators were influenced by the length of the alkenyl chain and the location of unsaturation within the molecule. These results further define the actions of N-alkylamides on sodium channels and illustrate the significance of the multiple binding domains of the sodium channel as target sites for insect control agents

  10. Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells (United States)

    Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.


    Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

  11. Aging-associated changes in motor axon voltage-gated Na+ channel function in mice

    DEFF Research Database (Denmark)

    Moldovan, Mihai; Rosberg, Mette Romer; Alvarez Herrero, Susana


    the functional impairment. The aim of the present study was to investigate the effect of regular aging on motor axon function with particular emphasis on Nav1.8. We compared tibial nerve conduction and excitability measures by threshold tracking in 12 months (mature) and 20 months (aged) wild-type (WT) mice...... expression was found by immunohistochemistry. The depolarizing excitability features were absent in Nav1.8 null mice, and they were counteracted in WT mice by a Nav1.8 blocker. Our data suggest that alteration in voltage-gated Na+ channel isoform expression contributes to changes in motor axon function...

  12. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels.

    Directory of Open Access Journals (Sweden)

    Ana Laura Sanchez-Sandoval

    Full Text Available Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA and low-voltage (LVA activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.

  13. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels (United States)

    Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel


    Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30–40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers. PMID:29474447

  14. Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels. (United States)

    Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel; Gomora, Juan Carlos


    Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.

  15. Controllable transport of a skyrmion in a ferromagnetic narrow channel with voltage-controlled magnetic anisotropy (United States)

    Wang, Junlin; Xia, Jing; Zhang, Xichao; Zhao, G. P.; Ye, Lei; Wu, Jing; Xu, Yongbing; Zhao, Weisheng; Zou, Zhigang; Zhou, Yan


    Magnetic skyrmions have potential applications in next-generation spintronic devices with ultralow energy consumption. In this work, the current-driven skyrmion motion in a narrow ferromagnetic nanotrack with voltage-controlled magnetic anisotropy (VCMA) is studied numerically. By utilizing the VCMA effect, the transport of skyrmion can be unidirectional in the nanotrack, leading to a one-way information channel. The trajectory of the skyrmion can also be modulated by periodically located VCMA gates, which protects the skyrmion from destruction by touching the track edge. In addition, the location of the skyrmion can be controlled by adjusting the driving pulse length in the presence of the VCMA effect. Our results provide guidelines for practical realization of the skyrmion-based information channel, diode, and skyrmion-based electronic devices such as racetrack memory.

  16. Voltage-gated sodium channels: pharmaceutical targets via anticonvulsants to treat epileptic syndromes. (United States)

    Abdelsayed, Mena; Sokolov, Stanislav


    Epilepsy is a brain disorder characterized by seizures and convulsions. The basis of epilepsy is an increase in neuronal excitability that, in some cases, may be caused by functional defects in neuronal voltage gated sodium channels, Nav1.1 and Nav1.2. The effects of antiepileptic drugs (AEDs) as effective therapies for epilepsy have been characterized by extensive research. Most of the classic AEDs targeting Nav share a common mechanism of action by stabilizing the channel's fast-inactivated state. In contrast, novel AEDs, such as lacosamide, stabilize the slow-inactivated state in neuronal Nav1.1 and Nav1.7 isoforms. This paper reviews the different mechanisms by which this stabilization occurs to determine new methods for treatment.

  17. RING finger protein 121 facilitates the degradation and membrane localization of voltage-gated sodium channels (United States)

    Ogino, Kazutoyo; Low, Sean E.; Yamada, Kenta; Saint-Amant, Louis; Zhou, Weibin; Muto, Akira; Asakawa, Kazuhide; Nakai, Junichi; Kawakami, Koichi; Kuwada, John Y.; Hirata, Hiromi


    Following their synthesis in the endoplasmic reticulum (ER), voltage-gated sodium channels (NaV) are transported to the membranes of excitable cells, where they often cluster, such as at the axon initial segment of neurons. Although the mechanisms by which NaV channels form and maintain clusters have been extensively examined, the processes that govern their transport and degradation have received less attention. Our entry into the study of these processes began with the isolation of a new allele of the zebrafish mutant alligator, which we found to be caused by mutations in the gene encoding really interesting new gene (RING) finger protein 121 (RNF121), an E3-ubiquitin ligase present in the ER and cis-Golgi compartments. Here we demonstrate that RNF121 facilitates two opposing fates of NaV channels: (i) ubiquitin-mediated proteasome degradation and (ii) membrane localization when coexpressed with auxiliary NaVβ subunits. Collectively, these results indicate that RNF121 participates in the quality control of NaV channels during their synthesis and subsequent transport to the membrane. PMID:25691753

  18. Lysine and the Na+/K+ Selectivity in Mammalian Voltage-Gated Sodium Channels. (United States)

    Li, Yang; Liu, Huihui; Xia, Mengdie; Gong, Haipeng


    Voltage-gated sodium (Nav) channels are critical in the generation and transmission of neuronal signals in mammals. The crystal structures of several prokaryotic Nav channels determined in recent years inspire the mechanistic studies on their selection upon the permeable cations (especially between Na+ and K+ ions), a property that is proposed to be mainly determined by residues in the selectivity filter. However, the mechanism of cation selection in mammalian Nav channels lacks direct explanation at atomic level due to the difference in amino acid sequences between mammalian and prokaryotic Nav homologues, especially at the constriction site where the DEKA motif has been identified to determine the Na+/K+ selectivity in mammalian Nav channels but is completely absent in the prokaryotic counterparts. Among the DEKA residues, Lys is of the most importance since its mutation to Arg abolishes the Na+/K+ selectivity. In this work, we modeled the pore domain of mammalian Nav channels by mutating the four residues at the constriction site of a prokaryotic Nav channel (NavRh) to DEKA, and then mechanistically investigated the contribution of Lys in cation selection using molecular dynamics simulations. The DERA mutant was generated as a comparison to understand the loss of ion selectivity caused by the K-to-R mutation. Simulations and free energy calculations on the mutants indicate that Lys facilitates Na+/K+ selection by electrostatically repelling the cation to a highly Na+-selective location sandwiched by the carboxylate groups of Asp and Glu at the constriction site. In contrast, the electrostatic repulsion is substantially weakened when Lys is mutated to Arg, because of two intrinsic properties of the Arg side chain: the planar geometric design and the sparse charge distribution of the guanidine group.

  19. Lysine and the Na+/K+ Selectivity in Mammalian Voltage-Gated Sodium Channels.

    Directory of Open Access Journals (Sweden)

    Yang Li

    Full Text Available Voltage-gated sodium (Nav channels are critical in the generation and transmission of neuronal signals in mammals. The crystal structures of several prokaryotic Nav channels determined in recent years inspire the mechanistic studies on their selection upon the permeable cations (especially between Na+ and K+ ions, a property that is proposed to be mainly determined by residues in the selectivity filter. However, the mechanism of cation selection in mammalian Nav channels lacks direct explanation at atomic level due to the difference in amino acid sequences between mammalian and prokaryotic Nav homologues, especially at the constriction site where the DEKA motif has been identified to determine the Na+/K+ selectivity in mammalian Nav channels but is completely absent in the prokaryotic counterparts. Among the DEKA residues, Lys is of the most importance since its mutation to Arg abolishes the Na+/K+ selectivity. In this work, we modeled the pore domain of mammalian Nav channels by mutating the four residues at the constriction site of a prokaryotic Nav channel (NavRh to DEKA, and then mechanistically investigated the contribution of Lys in cation selection using molecular dynamics simulations. The DERA mutant was generated as a comparison to understand the loss of ion selectivity caused by the K-to-R mutation. Simulations and free energy calculations on the mutants indicate that Lys facilitates Na+/K+ selection by electrostatically repelling the cation to a highly Na+-selective location sandwiched by the carboxylate groups of Asp and Glu at the constriction site. In contrast, the electrostatic repulsion is substantially weakened when Lys is mutated to Arg, because of two intrinsic properties of the Arg side chain: the planar geometric design and the sparse charge distribution of the guanidine group.

  20. RNAi-mediated knockdown of the voltage gated sodium ion channel TcNav causes mortality in Tribolium castaneum. (United States)

    Abd El Halim, Hesham M; Alshukri, Baida M H; Ahmad, Munawar S; Nakasu, Erich Y T; Awwad, Mohammed H; Salama, Elham M; Gatehouse, Angharad M R; Edwards, Martin G


    The voltage-gated sodium ion channel (VGSC) belongs to the largest superfamily of ion channels. Since VGSCs play key roles in physiological processes they are major targets for effective insecticides. RNA interference (RNAi) is widely used to analyse gene function, but recently, it has shown potential to contribute to novel strategies for selectively controlling agricultural insect pests. The current study evaluates the delivery of dsRNA targeted to the sodium ion channel paralytic A (TcNav) gene in Tribolium castaneum as a viable means of controlling this insect pest. Delivery of TcNav dsRNA caused severe developmental arrest with larval mortalities up to 73% post injection of dsRNA. Injected larvae showed significant (p < 0.05) knockdown in gene expression between 30-60%. Expression was also significantly (p < 0.05) reduced in pupae following injection causing 30% and 42% knockdown for early and late pupal stages, respectively. Oral delivery of dsRNA caused dose-dependant mortalities of between 19 and 51.34%; this was accompanied by significant (p < 0.05) knockdown in gene expression following 3 days of continuous feeding. The majority of larvae injected with, or fed, dsRNA died during the final larval stage prior to pupation. This work provides evidence of a viable RNAi-based strategy for insect control.

  1. Affinity purification of the voltage-sensitive sodium channel from electroplax with resins selective for sialic acid

    Energy Technology Data Exchange (ETDEWEB)

    James, W.M.; Emerick, M.C.; Agnew, W.S. (Yale Univ. School of medicine, New Haven, CT (USA))


    The voltage-sensitive sodium channel present in the eel (Electrophorus electricus) has an unusually high content of sialic acid, including {alpha}-(2{yields}8)-linked polysialic acid, not found in other electroplax membrane glycopeptides. Lectins from Limax flavus (LFA) and wheat germ (WGA) proved the most effective of 11 lectin resins tried. The most selective resin was prepared from IgM antibodies against Neisseria meningitidis {alpha}-(2{yields}8)-polysialic acid which were affinity purified and coupled to Sepharose 4B. The sodium channel was found to bind to WGA, LFA, and IgM resins and was readily eluted with the appropriate soluble carbohydrates. Experiments with LFA and IgM resins demonstrated binding and unbinding rates and displacement kinetics, which suggest highly specific binding at multiple sites on the sodium channel protein. In preparative-scale purification of protein previously fractionated by anion-exchange chromatography, without stabilizing TTX, high yields were reproducibly obtained. Further, when detergent extracts were prepared from electroplax membranes fractionated by low-speed sedimentation, a single step over the IgM resin provided a 70-fold purification, yielding specific activities of 3,200 pmol of ({sup 3}H)TTX-binding sites/mg of protein and a single polypeptide of {approximately}285,000 Da on SDS-acrylamide gels. No small peptides were observed after this 5-h isolation. The authors describe a cation-dependent stabilization with millimolar levels of monovalent and micromolar levels of divalent species.

  2. Role of voltage-gated L-type Ca2+ channel isoforms for brain function. (United States)

    Striessnig, J; Koschak, A; Sinnegger-Brauns, M J; Hetzenauer, A; Nguyen, N K; Busquet, P; Pelster, G; Singewald, N


    Voltage-gated LTCCs (L-type Ca2+ channels) are established drug targets for the treatment of cardiovascular diseases. LTCCs are also expressed outside the cardiovascular system. In the brain, LTCCs control synaptic plasticity in neurons, and DHP (dihydropyridine) LTCC blockers such as nifedipine modulate brain function (such as fear memory extinction and depression-like behaviour). Voltage-sensitive Ca2+ channels Cav1 .2 and Cav1.3 are the predominant brain LTCCs. As DHPs and other classes of organic LTCC blockers inhibit both isoforms, their pharmacological distinction is impossible and their individual contributions to defined brain functions remain largely unknown. Here, we summarize our recent experiments with two genetically modified mouse strains, which we generated to explore the individual biophysical features of Cav1.2 and Cav1.3 LTCCs and to determine their relative contributions to various physiological peripheral and neuronal functions. The results described here also allow predictions about the pharmacotherapeutic potential of isoform-selective LTCC modulators.

  3. Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites


    Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.


    We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...

  4. The role of entropic potential in voltage activation and K+ transport through Kv 1.2 channels (United States)

    Wawrzkiewicz-Jałowiecka, Agata; Grzywna, Zbigniew J.


    We analyze the entropic effects of inner pore geometry changes of Kv 1.2 channel during membrane depolarization and their implications for the rate of transmembrane transport of potassium ions. We base this on the idea that spatial confinements within the channel pore give rise to entropic barriers which can both effectively affect the stability of open macroconformation and influence channel's ability to conduct the potassium ions through the membrane. First, we calculate the differences in entropy between voltage-activated and resting states of the channel. As a template, we take a set of structures of channel pore in an open state at different membrane potentials generated in our previous research. The obtained results indicate that tendency to occupy open states at membrane depolarization is entropy facilitated. Second, we describe the differences in rates of K+ transport through the channel pore at different voltages based on the results of appropriate random walk simulations in entropic and electric potentials. The simulated single channel currents (I) suggest that the geometry changes during membrane depolarization are an important factor contributing to the observed flow of potassium ions through the channel. Nevertheless, the charge distribution within the channel pore (especially at the extracellular entrance) seems most prominent for the observed I/Imax relation at a qualitative level at analyzed voltages.

  5. Post-translational modifications of voltage-gated sodium channels in chronic pain syndromes.

    Directory of Open Access Journals (Sweden)

    Cédric James Laedermann


    Full Text Available In the peripheral sensory nervous system the neuronal expression of voltage-gated sodium channels (Navs is a very important for the transmission of nociceptive information since they give rise to the upstroke of the action potential. Navs are composed of 9 different isoforms with distinct biophysical properties. Studying the mutations associated with the increase or absence of pain sensitivity in humans, as well as other expression studies, have highlighted Nav1.7, Nav1.8 and Nav1.9 as being the most important contributors to the control of nociceptive neuronal electrogenesis. Modulating their expression and/or function can impact the shape of the action potential and consequently modify pain transmission, a process that is observed in persistent pain conditions.Post-translational modification (PTM of Navs is a well-known process that modifies their expression and function. In chronic pain syndromes, the release of inflammatory molecules into the direct environment of dorsal root ganglia (DRG sensory neurons leads to an abnormal activation of enzymes that induce Navs PTM. The addition of small molecules, i.e. peptides, phosphoryl groups, ubiquitin moieties and/or carbohydrates, can modify the function of Navs in two different ways: via direct physical interference with the subunit of Nav gating, or via the control of Nav trafficking. Both mechanisms have a profound impact on neuronal excitability. In this review we will discuss the role of Protein Kinase A, B and C, Mitogen Activated Protein Kinases and Ca++/Calmodulin-dependent Kinase II in peripheral chronic pain syndromes. We will also discuss more recent findings that the ubiquitination of Nav1.7 by Nedd4-2 and the effect of methylglyoxal on Nav1.8 are also implicated in the development of experimental neuropathic pain. We will address the potential roles of other PTMs in chronic pain and highlight the need for further investigation of PTMs of Navs in order to develop new pharmacological

  6. A two-dimensional analytical model for channel potential and threshold voltage of short channel dual material gate lightly doped drain MOSFET

    International Nuclear Information System (INIS)

    Tripathi Shweta


    An analytical model for the channel potential and the threshold voltage of the short channel dual-material-gate lightly doped drain (DMG-LDD) metal—oxide—semiconductor field-effect transistor (MOSFET) is presented using the parabolic approximation method. The proposed model takes into account the effects of the LDD region length, the LDD region doping, the lengths of the gate materials and their respective work functions, along with all the major geometrical parameters of the MOSFET. The impact of the LDD region length, the LDD region doping, and the channel length on the channel potential is studied in detail. Furthermore, the threshold voltage of the device is calculated using the minimum middle channel potential, and the result obtained is compared with the DMG MOSFET threshold voltage to show the improvement in the threshold voltage roll-off. It is shown that the DMG-LDD MOSFET structure alleviates the problem of short channel effects (SCEs) and the drain induced barrier lowering (DIBL) more efficiently. The proposed model is verified by comparing the theoretical results with the simulated data obtained by using the commercially available ATLAS™ 2D device simulator. (interdisciplinary physics and related areas of science and technology)

  7. A two-dimensional analytical model for channel potential and threshold voltage of short channel dual material gate lightly doped drain MOSFET (United States)

    Shweta, Tripathi


    An analytical model for the channel potential and the threshold voltage of the short channel dual-material-gate lightly doped drain (DMG-LDD) metal—oxide—semiconductor field-effect transistor (MOSFET) is presented using the parabolic approximation method. The proposed model takes into account the effects of the LDD region length, the LDD region doping, the lengths of the gate materials and their respective work functions, along with all the major geometrical parameters of the MOSFET. The impact of the LDD region length, the LDD region doping, and the channel length on the channel potential is studied in detail. Furthermore, the threshold voltage of the device is calculated using the minimum middle channel potential, and the result obtained is compared with the DMG MOSFET threshold voltage to show the improvement in the threshold voltage roll-off. It is shown that the DMG-LDD MOSFET structure alleviates the problem of short channel effects (SCEs) and the drain induced barrier lowering (DIBL) more efficiently. The proposed model is verified by comparing the theoretical results with the simulated data obtained by using the commercially available ATLAS™ 2D device simulator.

  8. Vector spin modeling for magnetic tunnel junctions with voltage dependent effects

    International Nuclear Information System (INIS)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.


    Integration and co-design of CMOS and spin transfer devices requires accurate vector spin conduction modeling of magnetic tunnel junction (MTJ) devices. A physically realistic model of the MTJ should comprehend the spin torque dynamics of nanomagnet interacting with an injected vector spin current and the voltage dependent spin torque. Vector spin modeling allows for calculation of 3 component spin currents and potentials along with the charge currents/potentials in non-collinear magnetic systems. Here, we show 4-component vector spin conduction modeling of magnetic tunnel junction devices coupled with spin transfer torque in the nanomagnet. Nanomagnet dynamics, voltage dependent spin transport, and thermal noise are comprehended in a self-consistent fashion. We show comparison of the model with experimental magnetoresistance (MR) of MTJs and voltage degradation of MR with voltage. Proposed model enables MTJ circuit design that comprehends voltage dependent spin torque effects, switching error rates, spin degradation, and back hopping effects

  9. Functional and pharmacological consequences of the distribution of voltage-gated calcium channels in the renal blood vessels

    DEFF Research Database (Denmark)

    Hansen, P B L


    Calcium channel blockers are widely used to treat hypertension because they inhibit voltage-gated calcium channels that mediate transmembrane calcium influx in, for example, vascular smooth muscle and cardiomyocytes. The calcium channel family consists of several subfamilies, of which the L......-type is usually associated with vascular contractility. However, the L-, T- and P-/Q-types of calcium channels are present in the renal vasculature and are differentially involved in controlling vascular contractility, thereby contributing to regulation of kidney function and blood pressure. In the preglomerular...... vascular bed, all the three channel families are present. However, the T-type channel is the only channel in cortical efferent arterioles which is in contrast to the juxtamedullary efferent arteriole, and that leads to diverse functional effects of L- and T-type channel inhibition. Furthermore...

  10. Antibodies to voltage-gated potassium and calcium channels in epilepsy. (United States)

    Majoie, H J Marian; de Baets, Mark; Renier, Willy; Lang, Bethan; Vincent, Angela


    To determine the prevalence of antibodies to ion channels in patients with long standing epilepsy. Although the CNS is thought to be protected from circulating antibodies by the blood brain barrier, glutamate receptor antibodies have been reported in Rasmussen's encephalitis, glutamic acid decarboxylase (GAD) antibodies have been found in a few patients with epilepsy, and antibodies to voltage-gated potassium channels (VGKC) have been found in a non-paraneoplastic form of limbic encephalitis (with amnesia and seizures) that responds to immunosuppressive therapy. We retrospectively screened sera from female epilepsy patients (n=106) for autoantibodies to VGKC (Kv 1.1, 1.2 or 1.6), voltage-gated calcium channels (VGCC) (P/Q-type), and GAD. All positive results, based on the values of control data [McKnight, K., Jiang, Y., et al. (2005). Serum antibodies in epilepsy and seizure-associated disorders. Neurology 65, 1730-1735], were retested at lower serum concentrations, and results compared with previously published control data. Demographics, medical history, and epilepsy related information was gathered. The studied group consisted predominantly of patients with long standing drug resistant epilepsy. VGKC antibodies were raised (>100 pM) in six patients. VGCC antibodies (>45 pM) were slightly raised in only one patient. GAD antibodies were VGKC antibodies differed from previously described patients with limbic encephalitis-like syndrome, and were not different with respect to seizure type, age at first seizure, duration of epilepsy, or use of anti-epileptic drugs from the VGKC antibody negative patients. The results demonstrate that antibodies to VGKC are present in 6% of patients with typical long-standing epilepsy, but whether these antibodies are pathogenic or secondary to the primary disease process needs to be determined.

  11. A localized interaction surface for voltage-sensing domains on the pore domain of a K+ channel. (United States)

    Li-Smerin, Y; Hackos, D H; Swartz, K J


    Voltage-gated K+ channels contain a central pore domain and four surrounding voltage-sensing domains. How and where changes in the structure of the voltage-sensing domains couple to the pore domain so as to gate ion conduction is not understood. The crystal structure of KcsA, a bacterial K+ channel homologous to the pore domain of voltage-gated K+ channels, provides a starting point for addressing this question. Guided by this structure, we used tryptophan-scanning mutagenesis on the transmembrane shell of the pore domain in the Shaker voltage-gated K+ channel to localize potential protein-protein and protein-lipid interfaces. Some mutants cause only minor changes in gating and when mapped onto the KcsA structure cluster away from the interface between pore domain subunits. In contrast, mutants producing large changes in gating tend to cluster near this interface. These results imply that voltage-sensing domains interact with localized regions near the interface between adjacent pore domain subunits.

  12. Apo calmodulin binding to the L-type voltage-gated calcium channel Cav1.2 IQ peptide

    International Nuclear Information System (INIS)

    Lian Luyun; Myatt, Daniel; Kitmitto, Ashraf


    The influx of calcium through the L-type voltage-gated calcium channels (LTCCs) is the trigger for the process of calcium-induced calcium release (CICR) from the sarcoplasmic recticulum, an essential step for cardiac contraction. There are two feedback mechanisms that regulate LTCC activity: calcium-dependent inactivation (CDI) and calcium-dependent facilitation (CDF), both of which are mediated by calmodulin (CaM) binding. The IQ domain (aa 1645-1668) housed within the cytoplasmic domain of the LTCC Ca v 1.2 subunit has been shown to bind both calcium-loaded (Ca 2+ CaM ) and calcium-free CaM (apoCaM). Here, we provide new data for the structural basis for the interaction of apoCaM with the IQ peptide using NMR, revealing that the apoCaM C-lobe residues are most significantly perturbed upon complex formation. In addition, we have employed transmission electron microscopy of purified LTCC complexes which shows that both apoCaM and Ca 2+ CaM can bind to the intact channel

  13. Complex N-Glycans Influence the Spatial Arrangement of Voltage Gated Potassium Channels in Membranes of Neuronal-Derived Cells.

    Directory of Open Access Journals (Sweden)

    M Kristen Hall

    Full Text Available The intrinsic electrical properties of a neuron depend on expression of voltage gated potassium (Kv channel isoforms, as well as their distribution and density in the plasma membrane. Recently, we showed that N-glycosylation site occupancy of Kv3.1b modulated its placement in the cell body and neurites of a neuronal-derived cell line, B35 neuroblastoma cells. To extrapolate this mechanism to other N-glycosylated Kv channels, we evaluated the impact of N-glycosylation occupancy of Kv3.1a and Kv1.1 channels. Western blots revealed that wild type Kv3.1a and Kv1.1 α-subunits had complex and oligomannose N-glycans, respectively, and that abolishment of the N-glycosylation site(s generated Kv proteins without N-glycans. Total internal reflection fluorescence microscopy images revealed that N-glycans of Kv3.1a contributed to its placement in the cell membrane while N-glycans had no effect on the distribution of Kv1.1. Based on particle analysis of EGFP-Kv proteins in the adhered membrane, glycosylated forms of Kv3.1a, Kv1.1, and Kv3.1b had differences in the number, size or density of Kv protein clusters in the cell membrane of neurites and cell body of B35 cells. Differences were also observed between the unglycosylated forms of the Kv proteins. Cell dissociation assays revealed that cell-cell adhesion was increased by the presence of complex N-glycans of Kv3.1a, like Kv3.1b, whereas cell adhesion was similar in the oligomannose and unglycosylated Kv1.1 subunit containing B35 cells. Our findings provide direct evidence that N-glycans of Kv3.1 splice variants contribute to the placement of these glycoproteins in the plasma membrane of neuronal-derived cells while those of Kv1.1 were absent. Further when the cell membrane distribution of the Kv channel was modified by N-glycans then the cell-cell adhesion properties were altered. Our study demonstrates that N-glycosylation of Kv3.1a, like Kv3.1b, provides a mechanism for the distribution of these

  14. Trafficking regulates the subcellular distribution of voltage-gated sodium channels in primary sensory neurons. (United States)

    Bao, Lan


    Voltage-gated sodium channels (Navs) comprise at least nine pore-forming α subunits. Of these, Nav1.6, Nav1.7, Nav1.8 and Nav1.9 are the most frequently studied in primary sensory neurons located in the dorsal root ganglion and are mainly localized to the cytoplasm. A large pool of intracellular Navs raises the possibility that changes in Nav trafficking could alter channel function. The molecular mediators of Nav trafficking mainly consist of signals within the Navs themselves, interacting proteins and extracellular factors. The surface expression of Navs is achieved by escape from the endoplasmic reticulum and proteasome degradation, forward trafficking and plasma membrane anchoring, and it is also regulated by channel phosphorylation and ubiquitination in primary sensory neurons. Axonal transport and localization of Navs in afferent fibers involves the motor protein KIF5B and scaffold proteins, including contactin and PDZ domain containing 2. Localization of Nav1.6 to the nodes of Ranvier in myelinated fibers of primary sensory neurons requires node formation and the submembrane cytoskeletal protein complex. These findings inform our understanding of the molecular and cellular mechanisms underlying Nav trafficking in primary sensory neurons.

  15. Differential distribution of voltage-gated channels in myelinated and unmyelinated baroreceptor afferents. (United States)

    Schild, John H; Kunze, Diana L


    Voltage gated ion channels (VGC) make possible the frequency coding of arterial pressure and the neurotransmission of this information along myelinated and unmyelinated fiber pathways. Although many of the same VGC isoforms are expressed in both fiber types, it is the relative expression of each that defines the unique discharge properties of myelinated A-type and unmyelinated C-type baroreceptors. For example, the fast inward Na⁺ current is a major determinant of the action potential threshold and the regenerative transmembrane current needed to sustain repetitive discharge. In A-type baroreceptors the TTX-sensitive Na(v)1.7 VGC contributes to the whole cell Na⁺ current. Na(v)1.7 is expressed at a lower density in C-type neurons and in conjunction with TTX-insensitive Na(v)1.8 and Na(v)1.9 VGC. As a result, action potentials of A-type neurons have firing thresholds that are 15-20 mV more negative and upstroke velocities that are 5-10 times faster than unmyelinated C-type neurons. A more depolarized threshold in conjunction with a broader complement of non-inactivating K(V) VGC subtypes produces C-type action potentials that are 3-4 times longer in duration than A-type neurons and at markedly lower levels of cell excitability. Unmyelinated baroreceptors also express KCa1.1 which provides approximately 25% of the total outward K⁺ current. KCa1.1 plays a critically important role in shaping the action potential profile of C-type neurons and strongly impacts neuronal excitability. A-type neurons do not functionally express the KCa1.1 channel despite having a whole cell Ca(V) current quite similar to that of C-type neurons. As a result, A-type neurons do not have the frequency-dependent braking forces of KCa1.1. Lack of a KCa current and only a limited complement of non-inactivating K(V) VGC in addition to a hyperpolarization activated HCN1 current that is nearly 10 times larger than in C-type neurons leads to elevated levels of discharge in A-type neurons, a

  16. Guanidinium Toxins and Their Interactions with Voltage-Gated Sodium Ion Channels

    Directory of Open Access Journals (Sweden)

    Lorena M. Durán-Riveroll


    Full Text Available Guanidinium toxins, such as saxitoxin (STX, tetrodotoxin (TTX and their analogs, are naturally occurring alkaloids with divergent evolutionary origins and biogeographical distribution, but which share the common chemical feature of guanidinium moieties. These guanidinium groups confer high biological activity with high affinity and ion flux blockage capacity for voltage-gated sodium channels (NaV. Members of the STX group, known collectively as paralytic shellfish toxins (PSTs, are produced among three genera of marine dinoflagellates and about a dozen genera of primarily freshwater or brackish water cyanobacteria. In contrast, toxins of the TTX group occur mainly in macrozoa, particularly among puffer fish, several species of marine invertebrates and a few terrestrial amphibians. In the case of TTX and analogs, most evidence suggests that symbiotic bacteria are the origin of the toxins, although endogenous biosynthesis independent from bacteria has not been excluded. The evolutionary origin of the biosynthetic genes for STX and analogs in dinoflagellates and cyanobacteria remains elusive. These highly potent molecules have been the subject of intensive research since the latter half of the past century; first to study the mode of action of their toxigenicity, and later as tools to characterize the role and structure of NaV channels, and finally as therapeutics. Their pharmacological activities have provided encouragement for their use as therapeutants for ion channel-related pathologies, such as pain control. The functional role in aquatic and terrestrial ecosystems for both groups of toxins is unproven, although plausible mechanisms of ion channel regulation and chemical defense are often invoked. Molecular approaches and the development of improved detection methods will yield deeper understanding of their physiological and ecological roles. This knowledge will facilitate their further biotechnological exploitation and point the way towards

  17. Differential distribution of voltage-gated ion channels in cortical neurons: implications for epilepsy. (United States)

    Child, Nicholas D; Benarroch, Eduardo E


    Neurons contain different functional somatodendritic and axonal domains, each with a characteristic distribution of voltage-gated ion channels, synaptic inputs, and function. The dendritic tree of a cortical pyramidal neuron has 2 distinct domains, the basal and the apical dendrites, both containing dendritic spines; the different domains of the axon are the axonal initial segment (AIS), axon proper (which in myelinated axons includes the node of Ranvier, paranodes, juxtaparanodes, and internodes), and the axon terminals. In the cerebral cortex, the dendritic spines of the pyramidal neurons receive most of the excitatory synapses; distinct populations of γ-aminobutyric acid (GABA)ergic interneurons target specific cellular domains and thus exert different influences on pyramidal neurons. The multiple synaptic inputs reaching the somatodendritic region and generating excitatory postsynaptic potentials (EPSPs) and inhibitory postsynaptic potentials (IPSPs) sum and elicit changes in membrane potential at the AIS, the site of initiation of the action potential.

  18. High Grade Glioma Mimicking Voltage Gated Potassium Channel Complex Associated Antibody Limbic Encephalitis

    Directory of Open Access Journals (Sweden)

    Dilan Athauda


    Full Text Available Though raised titres of voltage gated potassium channel (VGKC complex antibodies have been occasionally associated with extracranial tumours, mainly presenting as Morvan's Syndrome or neuromyotonia, they have not yet been reported to be associated with an intracranial malignancy. This is especially important as misdiagnosis of these conditions and delay of the appropriate treatment can have important prognostic implications. We describe a patient with a high grade glioma presenting with clinical, radiological, and serological features consistent with the diagnosis of VGKC antibody associated limbic encephalitis (LE. This is the first association between a primary brain tumour and high titre of VGKC complex antibodies. Clinicoradiological progression despite effective immunosuppressive treatment should prompt clinicians to look for alternative diagnoses. Further studies to elucidate a possible association between VGKC complex and other surface antigen antibodies with primary brain tumours should be carried out.

  19. High grade glioma mimicking voltage gated potassium channel complex associated antibody limbic encephalitis. (United States)

    Athauda, Dilan; Delamont, R S; Pablo-Fernandez, E De


    Though raised titres of voltage gated potassium channel (VGKC) complex antibodies have been occasionally associated with extracranial tumours, mainly presenting as Morvan's Syndrome or neuromyotonia, they have not yet been reported to be associated with an intracranial malignancy. This is especially important as misdiagnosis of these conditions and delay of the appropriate treatment can have important prognostic implications. We describe a patient with a high grade glioma presenting with clinical, radiological, and serological features consistent with the diagnosis of VGKC antibody associated limbic encephalitis (LE). This is the first association between a primary brain tumour and high titre of VGKC complex antibodies. Clinicoradiological progression despite effective immunosuppressive treatment should prompt clinicians to look for alternative diagnoses. Further studies to elucidate a possible association between VGKC complex and other surface antigen antibodies with primary brain tumours should be carried out.

  20. Presence of voltage-gated potassium channel complex antibody in a case of genetic prion disease. (United States)

    Jammoul, Adham; Lederman, Richard J; Tavee, Jinny; Li, Yuebing


    Voltage-gated potassium channel (VGKC) complex antibody-mediated encephalitis is a recently recognised entity which has been reported to mimic the clinical presentation of Creutzfeldt-Jakob disease (CJD). Testing for the presence of this neuronal surface autoantibody in patients presenting with subacute encephalopathy is therefore crucial as it may both revoke the bleak diagnosis of prion disease and allow institution of potentially life-saving immunotherapy. Tempering this optimistic view is the rare instance when a positive VGKC complex antibody titre occurs in a definite case of prion disease. We present a pathologically and genetically confirmed case of CJD with elevated serum VGKC complex antibody titres. This case highlights the importance of interpreting the result of a positive VGKC complex antibody with caution and in the context of the overall clinical manifestation. 2014 BMJ Publishing Group Ltd.

  1. Study on temperature dependence of output voltage of electrochemical detector for environmental neutrinos

    International Nuclear Information System (INIS)

    Halim, Md Abdul; Ishibashi, Kenji; Arima, Hidehiko; Terao, Norichika


    An electrochemical detector with biological material has been applied for the detection of neutrinos on the basis of a new hypothesis. The detector consisted of two electrodes with raw silk and purified water, and gave an appreciable output voltage. The reproducibility of the experimental results was as good as 99.4% at temperature of 300 K. The temperature dependence of the voltage of the detector was studied at 280, 290, 300 and 310 K. Among them, the detector at 310 K produced the highest output voltage and reached 104 mV in 16 days, whereas that at 280 K generated the lowest voltage and it was as low as 1.2 mV in 16 days. The detectors working at 290 and 300 K produced the voltages 18 and 57 mV in 16 days, respectively. The output voltages of the detector increased with temperature and were in good agreement in spite of the history of temperature. The internal resistance and electromotive force (internal voltage) of the experimental detector were obtained at each temperature by individual analysis and least square fitting method. It was found that the electromotive force was almost constant for these temperatures while the internal resistance showed a large dependence on temperature. The reduction of the output voltage with temperature is dominated by this behavior of internal resistance. (author)

  2. Monitoring operating temperature and supply voltage in achieving high system dependability

    NARCIS (Netherlands)

    Khan, M.A.; Kerkhoff, Hans G.


    System dependability being a set of number of attributes, of which the important reliability, heavily depends on operating temperature and supply voltage. Any change beyond the designed specifications may change the system performance and could result in system reliability and hence dependability

  3. Cardiac voltage gated calcium channels and their regulation by β-adrenergic signaling. (United States)

    Kumari, Neema; Gaur, Himanshu; Bhargava, Anamika


    Voltage-gated calcium channels (VGCCs) are the predominant source of calcium influx in the heart leading to calcium-induced calcium release and ultimately excitation-contraction coupling. In the heart, VGCCs are modulated by the β-adrenergic signaling. Signaling through β-adrenergic receptors (βARs) and modulation of VGCCs by β-adrenergic signaling in the heart are critical signaling and changes to these have been significantly implicated in heart failure. However, data related to calcium channel dysfunction in heart failure is divergent and contradictory ranging from reduced function to no change in the calcium current. Many recent studies have highlighted the importance of functional and spatial microdomains in the heart and that may be the key to answer several puzzling questions. In this review, we have briefly discussed the types of VGCCs found in heart tissues, their structure, and significance in the normal and pathological condition of the heart. More importantly, we have reviewed the modulation of VGCCs by βARs in normal and pathological conditions incorporating functional and structural aspects. There are different types of βARs, each having their own significance in the functioning of the heart. Finally, we emphasize the importance of location of proteins as it relates to their function and modulation by co-signaling molecules. Its implication on the studies of heart failure is speculated. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Conotoxins Targeting Neuronal Voltage-Gated Sodium Channel Subtypes: Potential Analgesics?

    Directory of Open Access Journals (Sweden)

    Jeffrey R. McArthur


    Full Text Available Voltage-gated sodium channels (VGSC are the primary mediators of electrical signal amplification and propagation in excitable cells. VGSC subtypes are diverse, with different biophysical and pharmacological properties, and varied tissue distribution. Altered VGSC expression and/or increased VGSC activity in sensory neurons is characteristic of inflammatory and neuropathic pain states. Therefore, VGSC modulators could be used in prospective analgesic compounds. VGSCs have specific binding sites for four conotoxin families: μ-, μO-, δ- and ί-conotoxins. Various studies have identified that the binding site of these peptide toxins is restricted to well-defined areas or domains. To date, only the μ- and μO-family exhibit analgesic properties in animal pain models. This review will focus on conotoxins from the μ- and μO-families that act on neuronal VGSCs. Examples of how these conotoxins target various pharmacologically important neuronal ion channels, as well as potential problems with the development of drugs from conotoxins, will be discussed.

  5. Voltage-Gated Sodium Channel β1/β1B Subunits Regulate Cardiac Physiology and Pathophysiology

    Directory of Open Access Journals (Sweden)

    Nnamdi Edokobi


    Full Text Available Cardiac myocyte contraction is initiated by a set of intricately orchestrated electrical impulses, collectively known as action potentials (APs. Voltage-gated sodium channels (NaVs are responsible for the upstroke and propagation of APs in excitable cells, including cardiomyocytes. NaVs consist of a single, pore-forming α subunit and two different β subunits. The β subunits are multifunctional cell adhesion molecules and channel modulators that have cell type and subcellular domain specific functional effects. Variants in SCN1B, the gene encoding the Nav-β1 and -β1B subunits, are linked to atrial and ventricular arrhythmias, e.g., Brugada syndrome, as well as to the early infantile epileptic encephalopathy Dravet syndrome, all of which put patients at risk for sudden death. Evidence over the past two decades has demonstrated that Nav-β1/β1B subunits play critical roles in cardiac myocyte physiology, in which they regulate tetrodotoxin-resistant and -sensitive sodium currents, potassium currents, and calcium handling, and that Nav-β1/β1B subunit dysfunction generates substrates for arrhythmias. This review will highlight the role of Nav-β1/β1B subunits in cardiac physiology and pathophysiology.

  6. Substrate bias voltage and deposition temperature dependence on ...

    Indian Academy of Sciences (India)

    Thin films or a coating of any sort prior to its application into real world has to be studied for the dependence of ..... For line focusing, incident beam mask was employed with ..... org/content/avs/journal/jvst/11/4/10.1116/1.1312732. Thornton J A ...

  7. Zinc-dependent multi-conductance channel activity in mitochondria isolated from ischemic brain. (United States)

    Bonanni, Laura; Chachar, Mushtaque; Jover-Mengual, Teresa; Li, Hongmei; Jones, Adrienne; Yokota, Hidenori; Ofengeim, Dimitry; Flannery, Richard J; Miyawaki, Takahiro; Cho, Chang-Hoon; Polster, Brian M; Pypaert, Marc; Hardwick, J Marie; Sensi, Stefano L; Zukin, R Suzanne; Jonas, Elizabeth A


    Transient global ischemia is a neuronal insult that induces delayed cell death. A hallmark event in the early post-ischemic period is enhanced permeability of mitochondrial membranes. The precise mechanisms by which mitochondrial function is disrupted are, as yet, unclear. Here we show that global ischemia promotes alterations in mitochondrial membrane contact points, a rise in intramitochondrial Zn2+, and activation of large, multi-conductance channels in mitochondrial outer membranes by 1 h after insult. Mitochondrial channel activity was associated with enhanced protease activity and proteolytic cleavage of BCL-xL to generate its pro-death counterpart, deltaN-BCL-xL. The findings implicate deltaN-BCL-xL in large, multi-conductance channel activity. Consistent with this, large channel activity was mimicked by introduction of recombinant deltaN-BCL-xL to control mitochondria and blocked by introduction of a functional BCL-xL antibody to post-ischemic mitochondria via the patch pipette. Channel activity was also inhibited by nicotinamide adenine dinucleotide, indicative of a role for the voltage-dependent anion channel (VDAC) of the outer mitochondrial membrane. In vivo administration of the membrane-impermeant Zn2+ chelator CaEDTA before ischemia or in vitro application of the membrane-permeant Zn2+ chelator tetrakis-(2-pyridylmethyl) ethylenediamine attenuated channel activity, suggesting a requirement for Zn2+. These findings reveal a novel mechanism by which ischemic insults disrupt the functional integrity of the outer mitochondrial membrane and implicate deltaN-BCL-xL and VDAC in the large, Zn2+-dependent mitochondrial channels observed in post-ischemic hippocampal mitochondria.

  8. Functional interactions at the interface between voltage-sensing and pore domains in the Shaker K(v) channel. (United States)

    Soler-Llavina, Gilberto J; Chang, Tsg-Hui; Swartz, Kenton J


    Voltage-activated potassium (K(v)) channels contain a central pore domain that is partially surrounded by four voltage-sensing domains. Recent X-ray structures suggest that the two domains lack extensive protein-protein contacts within presumed transmembrane regions, but whether this is the case for functional channels embedded in lipid membranes remains to be tested. We investigated domain interactions in the Shaker K(v) channel by systematically mutating the pore domain and assessing tolerance by examining channel maturation, S4 gating charge movement, and channel opening. When mapped onto the X-ray structure of the K(v)1.2 channel the large number of permissive mutations support the notion of relatively independent domains, consistent with crystallographic studies. Inspection of the maps also identifies portions of the interface where residues are sensitive to mutation, an external cluster where mutations hinder voltage sensor activation, and an internal cluster where domain interactions between S4 and S5 helices from adjacent subunits appear crucial for the concerted opening transition.

  9. Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles (United States)

    Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim


    In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

  10. Mutations in the voltage-sensing domain affect the alternative ion permeation pathway in the TRPM3 channel. (United States)

    Held, Katharina; Gruss, Fabian; Aloi, Vincenzo Davide; Janssens, Annelies; Ulens, Chris; Voets, Thomas; Vriens, Joris


    Mutagenesis at positively charged amino acids (arginines and lysines) (R1-R4) in the voltage-sensor domain (transmembrane segment (S) 4) of voltage-gated Na + , K + and Ca 2+ channels can lead to an alternative ion permeation pathway distinct from the central pore. Recently, a non-canonical ion permeation pathway was described in TRPM3, a member of the transient receptor potential (TRP) superfamily. The non-canonical pore exists in the native TRPM3 channel and can be activated by co-stimulation of the endogenous agonist pregnenolone sulphate and the antifungal drug clotrimazole or by stimulation of the synthetic agonist CIM0216. Alignment of the voltage sensor of Shaker K + channels with the entire TRPM3 sequence revealed the highest degree of similarity in the putative S4 region of TRPM3, and suggested that only one single gating charge arginine (R2) in the putative S4 region is conserved. Mutagenesis studies in the voltage-sensing domain of TRPM3 revealed several residues in the voltage sensor (S4) as well as in S1 and S3 that are crucial for the occurrence of the non-canonical inward currents. In conclusion, this study provides evidence for the involvement of the voltage-sensing domain of TRPM3 in the formation of an alternative ion permeation pathway. Transient receptor potential (TRP) channels are cationic channels involved in a broad array of functions, including homeostasis, motility and sensory functions. TRP channel subunits consist of six transmembrane segments (S1-S6), and form tetrameric channels with a central pore formed by the region encompassing S5 and S6. Recently, evidence was provided for the existence of an alternative ion permeation pathway in TRPM3, which allows large inward currents upon hyperpolarization independently of the central pore. However, very little knowledge is available concerning the localization of this alternative pathway in the native TRPM3 channel protein. Guided by sequence homology with Shaker K + channels, in which

  11. Reversible voltage dependent transition of abnormal and normal bipolar resistive switching. (United States)

    Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu


    Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

  12. Pulse-voltage fast generator

    International Nuclear Information System (INIS)

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.


    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  13. Distribution of TTX-sensitive voltage-gated sodium channels in primary sensory endings of mammalian muscle spindles. (United States)

    Carrasco, Dario I; Vincent, Jacob A; Cope, Timothy C


    Knowledge of the molecular mechanisms underlying signaling of mechanical stimuli by muscle spindles remains incomplete. In particular, the ionic conductances that sustain tonic firing during static muscle stretch are unknown. We hypothesized that tonic firing by spindle afferents depends on sodium persistent inward current (INaP) and tested for the necessary presence of the appropriate voltage-gated sodium (NaV) channels in primary sensory endings. The NaV 1.6 isoform was selected for both its capacity to produce INaP and for its presence in other mechanosensors that fire tonically. The present study shows that NaV 1.6 immunoreactivity (IR) is concentrated in heminodes, presumably where tonic firing is generated, and we were surprised to find NaV 1.6 IR strongly expressed also in the sensory terminals, where mechanotransduction occurs. This spatial pattern of NaV 1.6 IR distribution was consistent for three mammalian species (rat, cat, and mouse), as was tonic firing by primary spindle afferents. These findings meet some of the conditions needed to establish participation of INaP in tonic firing by primary sensory endings. The study was extended to two additional NaV isoforms, selected for their sensitivity to TTX, excluding TTX-resistant NaV channels, which alone are insufficient to support firing by primary spindle endings. Positive immunoreactivity was found for NaV 1.1 , predominantly in sensory terminals together with NaV 1.6 and for NaV 1.7 , mainly in preterminal axons. Differential distribution in primary sensory endings suggests specialized roles for these three NaV isoforms in the process of mechanosensory signaling by muscle spindles. NEW & NOTEWORTHY The molecular mechanisms underlying mechanosensory signaling responsible for proprioceptive functions are not completely elucidated. This study provides the first evidence that voltage-gated sodium channels (NaVs) are expressed in the spindle primary sensory ending, where NaVs are found at every site

  14. First direct electron microscopic visualization of a tight spatial coupling between GABAA-receptors and voltage-sensitive calcium channels

    DEFF Research Database (Denmark)

    Hansen, Gert Helge; Belhage, B; Schousboe, A


    Using cerebellar granule neurons in culture it was demonstrated that exposure of the cells to the GABAA receptor agonist 4,5,6,7-tetrahydroisoxazolo[5,4-c]pyridin-3-ol (THIP) leads to an increase in the number of voltage-gated calcium channels as revealed by quantitative preembedding indirect imm...

  15. Reversible Dementia: Two Nursing Home Patients With Voltage-Gated Potassium Channel Antibody-Associated Limbic Encephalitis

    NARCIS (Netherlands)

    Reintjes, W.; Romijn, M.D.M.; den Hollander, D.; ter Bruggen, J.P.; van Marum, R.J.


    Voltage-gated potassium channel antibody-associated limbic encephalitis (VGKC-LE) is a rare disease that is a diagnostic and therapeutic challenge for medical practitioners. Two patients with VGKC-LE, both developing dementia are presented. Following treatment, both patients showed remarkable

  16. Bromodomain-containing Protein 4 Activates Voltage-gated Sodium Channel 1.7 Transcription in Dorsal Root Ganglia Neurons to Mediate Thermal Hyperalgesia in Rats. (United States)

    Hsieh, Ming-Chun; Ho, Yu-Cheng; Lai, Cheng-Yuan; Wang, Hsueh-Hsiao; Lee, An-Sheng; Cheng, Jen-Kun; Chau, Yat-Pang; Peng, Hsien-Yu


    Bromodomain-containing protein 4 binds acetylated promoter histones and promotes transcription; however, the role of bromodomain-containing protein 4 in inflammatory hyperalgesia remains unclear. Male Sprague-Dawley rats received hind paw injections of complete Freund's adjuvant to induce hyperalgesia. The dorsal root ganglia were examined to detect changes in bromodomain-containing protein 4 expression and the activation of genes involved in the expression of voltage-gated sodium channel 1.7, which is a key pain-related ion channel. The intraplantar complete Freund's adjuvant injections resulted in thermal hyperalgesia (4.0 ± 1.5 s; n = 7). The immunohistochemistry and immunoblotting results demonstrated an increase in the bromodomain-containing protein 4-expressing dorsal root ganglia neurons (3.78 ± 0.38 fold; n = 7) and bromodomain-containing protein 4 protein levels (2.62 ± 0.39 fold; n = 6). After the complete Freund's adjuvant injection, histone H3 protein acetylation was enhanced in the voltage-gated sodium channel 1.7 promoter, and cyclin-dependent kinase 9 and phosphorylation of RNA polymerase II were recruited to this area. Furthermore, the voltage-gated sodium channel 1.7-mediated currents were enhanced in neurons of the complete Freund's adjuvant rats (55 ± 11 vs. 19 ± 9 pA/pF; n = 4 to 6 neurons). Using bromodomain-containing protein 4-targeted antisense small interfering RNA to the complete Freund's adjuvant-treated rats, the authors demonstrated a reduction in the expression of bromodomain-containing protein 4 (0.68 ± 0.16 fold; n = 7), a reduction in thermal hyperalgesia (7.5 ± 1.5 s; n = 7), and a reduction in the increased voltage-gated sodium channel 1.7 currents (21 ± 4 pA/pF; n = 4 to 6 neurons). Complete Freund's adjuvant triggers enhanced bromodomain-containing protein 4 expression, ultimately leading to the enhanced excitability of nociceptive neurons and thermal hyperalgesia. This effect is

  17. External pH modulates EAG superfamily K+ channels through EAG-specific acidic residues in the voltage sensor (United States)

    Kazmierczak, Marcin; Zhang, Xiaofei; Chen, Bihan; Mulkey, Daniel K.; Shi, Yingtang; Wagner, Paul G.; Pivaroff-Ward, Kendra; Sassic, Jessica K.; Bayliss, Douglas A.


    The Ether-a-go-go (EAG) superfamily of voltage-gated K+ channels consists of three functionally distinct gene families (Eag, Elk, and Erg) encoding a diverse set of low-threshold K+ currents that regulate excitability in neurons and muscle. Previous studies indicate that external acidification inhibits activation of three EAG superfamily K+ channels, Kv10.1 (Eag1), Kv11.1 (Erg1), and Kv12.1 (Elk1). We show here that Kv10.2, Kv12.2, and Kv12.3 are similarly inhibited by external protons, suggesting that high sensitivity to physiological pH changes is a general property of EAG superfamily channels. External acidification depolarizes the conductance–voltage (GV) curves of these channels, reducing low threshold activation. We explored the mechanism of this high pH sensitivity in Kv12.1, Kv10.2, and Kv11.1. We first examined the role of acidic voltage sensor residues that mediate divalent cation block of voltage activation in EAG superfamily channels because protons reduce the sensitivity of Kv12.1 to Zn2+. Low pH similarly reduces Mg2+ sensitivity of Kv10.1, and we found that the pH sensitivity of Kv11.1 was greatly attenuated at 1 mM Ca2+. Individual neutralizations of a pair of EAG-specific acidic residues that have previously been implicated in divalent block of diverse EAG superfamily channels greatly reduced the pH response in Kv12.1, Kv10.2, and Kv11.1. Our results therefore suggest a common mechanism for pH-sensitive voltage activation in EAG superfamily channels. The EAG-specific acidic residues may form the proton-binding site or alternatively are required to hold the voltage sensor in a pH-sensitive conformation. The high pH sensitivity of EAG superfamily channels suggests that they could contribute to pH-sensitive K+ currents observed in vivo. PMID:23712551

  18. External pH modulates EAG superfamily K+ channels through EAG-specific acidic residues in the voltage sensor. (United States)

    Kazmierczak, Marcin; Zhang, Xiaofei; Chen, Bihan; Mulkey, Daniel K; Shi, Yingtang; Wagner, Paul G; Pivaroff-Ward, Kendra; Sassic, Jessica K; Bayliss, Douglas A; Jegla, Timothy


    The Ether-a-go-go (EAG) superfamily of voltage-gated K(+) channels consists of three functionally distinct gene families (Eag, Elk, and Erg) encoding a diverse set of low-threshold K(+) currents that regulate excitability in neurons and muscle. Previous studies indicate that external acidification inhibits activation of three EAG superfamily K(+) channels, Kv10.1 (Eag1), Kv11.1 (Erg1), and Kv12.1 (Elk1). We show here that Kv10.2, Kv12.2, and Kv12.3 are similarly inhibited by external protons, suggesting that high sensitivity to physiological pH changes is a general property of EAG superfamily channels. External acidification depolarizes the conductance-voltage (GV) curves of these channels, reducing low threshold activation. We explored the mechanism of this high pH sensitivity in Kv12.1, Kv10.2, and Kv11.1. We first examined the role of acidic voltage sensor residues that mediate divalent cation block of voltage activation in EAG superfamily channels because protons reduce the sensitivity of Kv12.1 to Zn(2+). Low pH similarly reduces Mg(2+) sensitivity of Kv10.1, and we found that the pH sensitivity of Kv11.1 was greatly attenuated at 1 mM Ca(2+). Individual neutralizations of a pair of EAG-specific acidic residues that have previously been implicated in divalent block of diverse EAG superfamily channels greatly reduced the pH response in Kv12.1, Kv10.2, and Kv11.1. Our results therefore suggest a common mechanism for pH-sensitive voltage activation in EAG superfamily channels. The EAG-specific acidic residues may form the proton-binding site or alternatively are required to hold the voltage sensor in a pH-sensitive conformation. The high pH sensitivity of EAG superfamily channels suggests that they could contribute to pH-sensitive K(+) currents observed in vivo.

  19. The Sensorless Pore Module of Voltage-gated K+ Channel Family 7 Embodies the Target Site for the Anticonvulsant Retigabine. (United States)

    Syeda, Ruhma; Santos, Jose S; Montal, Mauricio


    KCNQ (voltage-gated K(+) channel family 7 (Kv7)) channels control cellular excitability and underlie the K(+) current sensitive to muscarinic receptor signaling (the M current) in sympathetic neurons. Here we show that the novel anti-epileptic drug retigabine (RTG) modulates channel function of pore-only modules (PMs) of the human Kv7.2 and Kv7.3 homomeric channels and of Kv7.2/3 heteromeric channels by prolonging the residence time in the open state. In addition, the Kv7 channel PMs are shown to recapitulate the single-channel permeation and pharmacological specificity characteristics of the corresponding full-length proteins in their native cellular context. A mutation (W265L) in the reconstituted Kv7.3 PM renders the channel insensitive to RTG and favors the conductive conformation of the PM, in agreement to what is observed when the Kv7.3 mutant is heterologously expressed. On the basis of the new findings and homology models of the closed and open conformations of the Kv7.3 PM, we propose a structural mechanism for the gating of the Kv7.3 PM and for the site of action of RTG as a Kv7.2/Kv7.3 K(+) current activator. The results validate the modular design of human Kv channels and highlight the PM as a high-fidelity target for drug screening of Kv channels. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Ozone synthesis improves by increasing number density of plasma channels and lower voltage in a nonthermal plasma (United States)

    Arif Malik, Muhammad; Hughes, David


    Improvements in ozone synthesis from air and oxygen by increasing the number density of plasma channels and lower voltage for the same specific input energy (SIE) were explored in a nonthermal plasma based on a sliding discharge. The number of plasma channels and energy per pulse increased in direct proportion to the increase in the effective length of the anode (the high voltage electrode). Decreasing the discharge gap increased the energy per pulse for the same length and allowed the installation of more electrode pairs in the same space. It allowed the increase of the number of plasma channels in the same space to achieve the same SIE at a lower peak voltage with less energy per plasma channel. The ozone concentration gradually increased to ~1500 ppmv (140 to 50 g kWh-1) from air and to ~6000 ppmv (400 to 200 g kWh-1) from oxygen with a gradual increase in the SIE to ~200 J L-1, irrespective of the variations in electrode geometry, applied voltage or flow rate of the feed gas. A gradual increase in SIE beyond 200 J L-1 gradually increased the ozone concentration to a certain maximum value followed by a decline, but the rate of increase and the maximum value was higher for the greater number of plasma channels and lower peak voltage combination. The maximum ozone concentration was ~5000 ppmv (~30 g kWh-1) from air and ~22 000 ppmv (~80 g kWh-1) from oxygen. The results are explained on the basis of characteristics of the plasma and ozone synthesis mechanism.

  1. Localization and Molecular Determinants of the Hanatoxin Receptors on the Voltage-Sensing Domains of a K+ Channel (United States)

    Li-Smerin, Yingying; Swartz, Kenton J.


    Hanatoxin inhibits voltage-gated K+ channels by modifying the energetics of activation. We studied the molecular determinants and physical location of the Hanatoxin receptors on the drk1 voltage-gated K+ channel. First, we made multiple substitutions at three previously identified positions in the COOH terminus of S3 to examine whether these residues interact intimately with the toxin. We also examined a region encompassing S1–S3 using alanine-scanning mutagenesis to identify additional determinants of the toxin receptors. Finally, guided by the structure of the KcsA K+ channel, we explored whether the toxin interacts with the peripheral extracellular surface of the pore domain in the drk1 K+ channel. Our results argue for an intimate interaction between the toxin and the COOH terminus of S3 and suggest that the Hanatoxin receptors are confined within the voltage-sensing domains of the channel, at least 20–25 Å away from the central pore axis. PMID:10828242

  2. NMR investigation of the isolated second voltage-sensing domain of human Nav1.4 channel. (United States)

    Paramonov, A S; Lyukmanova, E N; Myshkin, M Yu; Shulepko, M A; Kulbatskii, D S; Petrosian, N S; Chugunov, A O; Dolgikh, D A; Kirpichnikov, M P; Arseniev, A S; Shenkarev, Z O


    Voltage-gated Na + channels are essential for the functioning of cardiovascular, muscular, and nervous systems. The α-subunit of eukaryotic Na + channel consists of ~2000 amino acid residues and encloses 24 transmembrane (TM) helices, which form five membrane domains: four voltage-sensing (VSD) and one pore domain. The structural complexity significantly impedes recombinant production and structural studies of full-sized Na + channels. Modular organization of voltage-gated channels gives an idea for studying of the isolated second VSD of human skeletal muscle Nav1.4 channel (VSD-II). Several variants of VSD-II (~150a.a., four TM helices) with different N- and C-termini were produced by cell-free expression. Screening of membrane mimetics revealed low stability of VSD-II samples in media containing phospholipids (bicelles, nanodiscs) associated with the aggregation of electrically neutral domain molecules. The almost complete resonance assignment of 13 C, 15 N-labeled VSD-II was obtained in LPPG micelles. The secondary structure of VSD-II showed similarity with the structures of bacterial Na + channels. The fragment of S4 TM helix between the first and second conserved Arg residues probably adopts 3 10 -helical conformation. Water accessibility of S3 helix, observed by the Mn 2+ titration, pointed to the formation of water-filled crevices in the micelle embedded VSD-II. 15 N relaxation data revealed characteristic pattern of μs-ms time scale motions in the VSD-II regions sharing expected interhelical contacts. VSD-II demonstrated enhanced mobility at ps-ns time scale as compared to isolated VSDs of K + channels. These results validate structural studies of isolated VSDs of Na + channels and show possible pitfalls in application of this 'divide and conquer' approach. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Functional and pharmacological consequences of the distribution of voltage-gated calcium channels in the renal blood vessels. (United States)

    Hansen, P B L


    Calcium channel blockers are widely used to treat hypertension because they inhibit voltage-gated calcium channels that mediate transmembrane calcium influx in, for example, vascular smooth muscle and cardiomyocytes. The calcium channel family consists of several subfamilies, of which the L-type is usually associated with vascular contractility. However, the L-, T- and P-/Q-types of calcium channels are present in the renal vasculature and are differentially involved in controlling vascular contractility, thereby contributing to regulation of kidney function and blood pressure. In the preglomerular vascular bed, all the three channel families are present. However, the T-type channel is the only channel in cortical efferent arterioles which is in contrast to the juxtamedullary efferent arteriole, and that leads to diverse functional effects of L- and T-type channel inhibition. Furthermore, by different mechanisms, T-type channels may contribute to both constriction and dilation of the arterioles. Finally, P-/Q-type channels are involved in the regulation of human intrarenal arterial contractility. The calcium blockers used in the clinic affect not only L-type but also P-/Q- and T-type channels. Therefore, the distinct effect obtained by inhibiting a given subtype or set of channels under experimental settings should be considered when choosing a calcium blocker for treatment. T-type channels seem to be crucial for regulating the GFR and the filtration fraction. Use of blockers is expected to lead to preferential efferent vasodilation, reduction of glomerular pressure and proteinuria. Therefore, renovascular T-type channels might provide novel therapeutic targets, and may have superior renoprotective effects compared to conventional calcium blockers. Acta Physiologica © 2013 Scandinavian Physiological Society.

  4. Voltage-gated potassium channel-complex autoimmunity and associated clinical syndromes. (United States)

    Irani, Sarosh R; Vincent, Angela


    Voltage-gated potassium channel (VGKC)-complex antibodies are defined by the radioimmunoprecipitation of Kv1 potassium channel subunits from brain tissue extracts and were initially discovered in patients with peripheral nerve hyperexcitability (PNH). Subsequently, they were found in patients with PNH plus psychosis, insomnia, and dysautonomia, collectively termed Morvan's syndrome (MoS), and in a limbic encephalopathy (LE) with prominent amnesia and frequent seizures. Most recently, they have been described in patients with pure epilepsies, especially in patients with the novel and distinctive semiology termed faciobrachial dystonic seizures (FBDS). In each of these conditions, there is a close correlation between clinical measures and antibody levels. The VGKC-complex is a group of proteins that are strongly associated in situ and after extraction in mild detergent. Two major targets of the autoantibodies are leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein 2 (CASPR2). The patients with PNH or MoS are most likely to have CASPR2 antibodies, whereas LGI1 antibodies are found characteristically in patients with FBDS and LE. Crucially, each of these conditions has a good response to immunotherapies, often corticosteroids and plasma exchange, although optimal regimes require further study. VGKC-complex antibodies have also been described in neuropathic pain syndromes, chronic epilepsies, a polyradiculopathy in porcine abattoir workers, and some children with status epilepticus. Increasingly, however, the antigenic targets in these patients are not defined and in some cases the antibodies may be secondary rather than the primary cause. Future serologic studies should define all the antigenic components of the VGKC-complex, and further inform mechanisms of antibody pathogenicity and related inflammation. © 2016 Elsevier B.V. All rights reserved.

  5. Direct evidence that scorpion α-toxins (site-3 modulate sodium channel inactivation by hindrance of voltage-sensor movements.

    Directory of Open Access Journals (Sweden)

    Zhongming Ma

    Full Text Available The position of the voltage-sensing transmembrane segment, S4, in voltage-gated ion channels as a function of voltage remains incompletely elucidated. Site-3 toxins bind primarily to the extracellular loops connecting transmembrane helical segments S1-S2 and S3-S4 in Domain 4 (D4 and S5-S6 in Domain 1 (D1 and slow fast-inactivation of voltage-gated sodium channels. As S4 of the human skeletal muscle voltage-gated sodium channel, hNav1.4, moves in response to depolarization from the resting to the inactivated state, two D4S4 reporters (R2C and R3C, Arg1451Cys and Arg1454Cys, respectively move from internal to external positions as deduced by reactivity to internally or externally applied sulfhydryl group reagents, methane thiosulfonates (MTS. The changes in reporter reactivity, when cycling rapidly between hyperpolarized and depolarized voltages, enabled determination of the positions of the D4 voltage-sensor and of its rate of movement. Scorpion α-toxin binding impedes D4S4 segment movement during inactivation since the modification rates of R3C in hNav1.4 with methanethiosulfonate (CH3SO2SCH2CH2R, where R = -N(CH33 (+ trimethylammonium, MTSET and benzophenone-4-carboxamidocysteine methanethiosulfonate (BPMTS were slowed ~10-fold in toxin-modified channels. Based upon the different size, hydrophobicity and charge of the two reagents it is unlikely that the change in reactivity is due to direct or indirect blockage of access of this site to reagent in the presence of toxin (Tx, but rather is the result of inability of this segment to move outward to the normal extent and at the normal rate in the toxin-modified channel. Measurements of availability of R3C to internally applied reagent show decreased access (slower rates of thiol reaction providing further evidence for encumbered D4S4 movement in the presence of toxins consistent with the assignment of at least part of the toxin binding site to the region of D4S4 region of the voltage

  6. Supratentorial white matter blurring associated with voltage-gated potassium channel-complex limbic encephalitis

    Energy Technology Data Exchange (ETDEWEB)

    Urbach, H.; Mader, I. [University Medical Center Freiburg, Department of Neuroradiology, Freiburg (Germany); Rauer, S.; Baumgartner, A. [University Medical Center Freiburg, Department of Neurology, Freiburg (Germany); Paus, S. [University Medical Center, Department of Neurology, Bonn (Germany); Wagner, J. [University Medical Center, Department of Epileptology, Bonn (Germany); Malter, M.P. [University of Cologne, Department of Neurology, Cologne (Germany); Pruess, H. [Charite - Universitaetsmedizin Berlin, Department of Neurology, Berlin (Germany); Lewerenz, J.; Kassubek, J. [Ulm University, Department of Neurology, Ulm (Germany); Hegen, H.; Auer, M.; Deisenhammer, F. [University Innsbruck, Department of Neurology, Innsbruck (Austria); Ufer, F. [University Medical Center, Department of Neurology, Hamburg (Germany); Bien, C.G. [Epilepsy Centre Bethel, Bielefeld-Bethel (Germany)


    Limbic encephalitis (LE) associated with voltage-gated potassium channel-complex antibodies (VGKC-LE) is frequently non-paraneoplastic and associated with marked improvement following corticosteroid therapy. Mesial temporal lobe abnormalities are present in around 80 % of patients. If associated or preceded by faciobrachial dystonic seizures, basal ganglia signal changes may occur. In some patients, blurring of the supratentorial white matter on T2-weighted images (SWMB) may be seen. The purpose of this study was to evaluate the incidence of SWMB and whether it is specific for VGKC-LE. Two experienced neuroradiologists independently evaluated signal abnormalities on FLAIR MRI in 79 patients with LE while unaware on the antibody type. SWMB was independently assessed as present in 10 of 36 (28 %) compared to 2 (5 %) of 43 non-VGKC patients (p = 0.009). It was not related to the presence of LGI1 or CASPR2 proteins of VGKC antibodies. MRI showed increased temporomesial FLAIR signal in 22 (61 %) VGKC compared to 14 (33 %) non-VGKC patients (p = 0.013), and extratemporomesial structures were affected in one VGKC (3 %) compared to 11 (26 %) non-VGKC patients (p = 0.005). SWMB is a newly described MRI sign rather specific for VGKC-LE. (orig.)

  7. Afterdischarges following M waves in patients with voltage-gated potassium channels antibodies

    Directory of Open Access Journals (Sweden)

    Jingwen Niu

    Full Text Available Objective: To explore the correlation between afterdischarges in motor nerve conduction studies and clinical motor hyperexcitability in patients with voltage-gated potassium channels (VGKC antibodies. Methods: Six patients with positive serum antibodies to contactin-associated protein-like 2 (CASPR2 or/and leucine-rich glioma-inactivated protein 1 (LGI1 were recruited, including 5 with autoimmune encephalitis, and 1 with cramp-fasciculation syndrome. Electromyography (EMG, nerve conduction studies (NCS and F waves were performed, and afterdischarges were assessed. One patient was followed up. Results: Five patients had clinical evidence of peripheral motor nerve hyperexcitability (myokymia or cramp, and four of them had abnormal spontaneous firing in concentric needle electromyography (EMG. Prolonged afterdischarges following normal M waves were present in all six patients, including the two patients who had no EMG evidence of peripheral nerve hyperexcitability (PNH. Afterdischarges disappeared after treatment with intravenous immunoglobulin (IVIG. Conclusion: The afterdischarges in motor nerve conduction study might be a sensitive indicator of peripheral motor nerve hyperexcitability in patients with VGKC antibodies. Significance: Afterdischarges in motor nerve conduction study might be more sensitive than needle electromyography for detecting peripheral motor nerve hyperexcitability, and could disappear gradually in accordance with clinical improvement and reduction of antibodies. Keywords: Afterdischarges, VGKC, Autoimmune encephalitis, Peripheral nerve hyperexcitability, F wave, M wave

  8. Voltage-Gated Potassium Channel Antibody Paraneoplastic Limbic Encephalitis Associated with Acute Myeloid Leukemia

    Directory of Open Access Journals (Sweden)

    Marion Alcantara


    Full Text Available Among paraneoplastic syndromes (PNS associated with malignant hemopathies, there are few reports of PNS of the central nervous system and most of them are associated with lymphomas. Limbic encephalitis is a rare neurological syndrome classically diagnosed in the context of PNS. We report the case of a 81-year-old man who presented with a relapsed acute myeloid leukemia (AML with minimal maturation. He was admitted for confusion with unfavorable evolution as he presented a rapidly progressive dementia resulting in death. A brain magnetic resonance imaging, performed 2 months after the onset, was considered normal. An electroencephalogram showed non-specific bilateral slow waves. We received the results of the blood screening of neuronal autoantibodies after the patient's death and detected the presence of anti-voltage-gated potassium channel (VGKC antibodies at 102 pmol/l (normal at <30 pmol/l. Other etiologic studies, including the screening for another cause of rapidly progressive dementia, were negative. To our knowledge, this is the first case of anti-VGKC paraneoplastic limbic encephalitis related to AML.

  9. Delayed LGI1 seropositivity in voltage-gated potassium channel (VGKC)-complex antibody limbic encephalitis. (United States)

    Sweeney, Michael; Galli, Jonathan; McNally, Scott; Tebo, Anne; Haven, Thomas; Thulin, Perla; Clardy, Stacey L


    We utilise a clinical case to highlight why exclusion of voltage-gated potassium channel (VGKC)-complex autoantibody testing in serological evaluation of patients may delay or miss the diagnosis. A 68-year-old man presented with increasing involuntary movements consistent with faciobrachial dystonic seizures (FBDS). Initial evaluation demonstrated VGKC antibody seropositivity with leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-like 2 (CASPR2) seronegativity. Aggressive immunotherapy with methylprednisolone and plasmapheresis was started early in the course of his presentation. Following treatment with immunotherapy, the patient demonstrated clinical improvement. Repeat serum evaluation 4 months posthospitalisation remained seropositive for VGKC-complex antibodies, with development of LGI1 autoantibody seropositivity. VGKC-complex and LGI1 antibodies remained positive 12 months posthospitalisation. Our findings suggest that clinical symptoms can predate the detection of the antibody. We conclude that when suspicion for autoimmune encephalitis is high in the setting of VGKC autoantibody positivity, regardless of LGI1 or CASPR2 seropositivity, early immunotherapy and repeat testing should be considered. 2017 BMJ Publishing Group Ltd.

  10. The value of LGI1, Caspr2 and voltage-gated potassium channel antibodies in encephalitis. (United States)

    van Sonderen, Agnes; Petit-Pedrol, Mar; Dalmau, Josep; Titulaer, Maarten J


    The discovery, in 2010, of autoantibodies against the extracellular proteins LGI1 and Caspr2 facilitated a change of view regarding the clinical importance of voltage-gated potassium channel (VGKC) antibodies. Currently, these antibodies are all classified as VGKC-complex antibodies, and are commonly considered to have a similar clinical value. However, studies from the past few years show that the immune responses mediated by these antibodies have differing clinical relevance. Here, we review the clinical importance of these immune responses in three settings: patients with anti-LGI1 antibodies, patients with anti-Caspr2 antibodies, and patients with antibodies against the VGKC complex that lack LGI1 and Caspr2 specificity. Antibodies against LGI1 and Caspr2 are associated with different but well-defined syndromes, whereas the clinical importance of VGKC-complex antibodies without LGI1 and Caspr2 specificity is questionable. We describe each of these syndromes, discuss the function of the target antigens and review the limited paediatric literature on the topic. The findings emphasize the importance of defining these disorders according to the molecular identity of the targets (LGI1 or Caspr2), and caution against the use of VGKC-complex antibodies for the diagnosis and treatment of patients without further definition of the antigen.

  11. Voltage-Gated Potassium Channel Antibodies in Slow-Progression Motor Neuron Disease. (United States)

    Godani, Massimiliano; Zoccarato, Marco; Beronio, Alessandro; Zuliani, Luigi; Benedetti, Luana; Giometto, Bruno; Del Sette, Massimo; Raggio, Elisa; Baldi, Roberta; Vincent, Angela


    The spectrum of autoimmune neurological diseases associated with voltage-gated potassium channel (VGKC)-complex antibodies (Abs) ranges from peripheral nerve disorders to limbic encephalitis. Recently, low titers of VGKC-complex Abs have also been reported in neurodegenerative disorders, but their clinical relevance is unknown. The aim of the study was to explore the prevalence of VGKC-complex Abs in slow-progression motor neuron disease (MND). We compared 11 patients affected by slow-progression MND with 9 patients presenting typical progression illness. Sera were tested for VGKC-complex Abs by radioimmunoassay. The distribution of VGKC-complex Abs was analyzed with the Mann-Whitney U test. The statistical analysis showed a significant difference between the mean values in the study and control groups. A case with long-survival MND harboring VGKC-complex Abs and treated with intravenous immunoglobulins is described. Although VGKC-complex Abs are not likely to be pathogenic, these results could reflect the coexistence of an immunological activation in patients with slow disease progression. © 2016 S. Karger AG, Basel.

  12. Supratentorial white matter blurring associated with voltage-gated potassium channel-complex limbic encephalitis

    International Nuclear Information System (INIS)

    Urbach, H.; Mader, I.; Rauer, S.; Baumgartner, A.; Paus, S.; Wagner, J.; Malter, M.P.; Pruess, H.; Lewerenz, J.; Kassubek, J.; Hegen, H.; Auer, M.; Deisenhammer, F.; Ufer, F.; Bien, C.G.


    Limbic encephalitis (LE) associated with voltage-gated potassium channel-complex antibodies (VGKC-LE) is frequently non-paraneoplastic and associated with marked improvement following corticosteroid therapy. Mesial temporal lobe abnormalities are present in around 80 % of patients. If associated or preceded by faciobrachial dystonic seizures, basal ganglia signal changes may occur. In some patients, blurring of the supratentorial white matter on T2-weighted images (SWMB) may be seen. The purpose of this study was to evaluate the incidence of SWMB and whether it is specific for VGKC-LE. Two experienced neuroradiologists independently evaluated signal abnormalities on FLAIR MRI in 79 patients with LE while unaware on the antibody type. SWMB was independently assessed as present in 10 of 36 (28 %) compared to 2 (5 %) of 43 non-VGKC patients (p = 0.009). It was not related to the presence of LGI1 or CASPR2 proteins of VGKC antibodies. MRI showed increased temporomesial FLAIR signal in 22 (61 %) VGKC compared to 14 (33 %) non-VGKC patients (p = 0.013), and extratemporomesial structures were affected in one VGKC (3 %) compared to 11 (26 %) non-VGKC patients (p = 0.005). SWMB is a newly described MRI sign rather specific for VGKC-LE. (orig.)

  13. [Voltage-Gated Potassium Channel-Complex Antibodies Associated Encephalopathy and Related Diseases]. (United States)

    Watanabe, Osamu


    Voltage-gated potassium channel (VGKC) complex antibodies are auto-antibodies, initially identified in acquired neuromyotonia (aNMT; Isaacs' syndrome), which cause muscle cramps and difficulty in opening the palm of the hands. Subsequently, these antibodies were found in patients presenting with aNMT along with psychosis, insomnia, and dysautonomia, collectively termed Morvan's syndrome (MoS), and in a limbic encephalopathy (LE) patient with prominent amnesia and frequent seizures. Typical LE cases have a distinctive adult-onset, frequent, brief dystonic seizure semiology that predominantly affects the arms and ipsilateral face. It has now been termed faciobrachial dystonic seizures (FBDS). The VGKC complex is a group of proteins that are strongly associated in situ and after extraction in the mild detergent digitonin. Recent studies indicated that the VGKC complex antibodies are mainly directed toward associated proteins (for example LGI1, Caspr2) that complex with VGKCs themselves. Patients with aNMT or MoS are most likely to have Caspr2 antibodies, whereas LGI1 antibodies are found characteristically in patients with FBDS and LE. We systematically identified and quantified autoantibodies in patient sera with VGKC-complex antibody associated encephalopathy and showed the relationship between individual antibodies and patient's symptoms. Furthermore, we revealed how autoantibodies disrupt the physiological functions of target proteins. LGI1 antibodies neutralize the interaction between LGI1 and ADAM22, reducing the synaptic AMPA receptors.

  14. Clinical utility of seropositive voltage-gated potassium channel-complex antibody. (United States)

    Jammoul, Adham; Shayya, Luay; Mente, Karin; Li, Jianbo; Rae-Grant, Alexander; Li, Yuebing


    Antibodies against voltage-gated potassium channel (VGKC)-complex are implicated in the pathogenesis of acquired neuromyotonia, limbic encephalitis, faciobrachial dystonic seizure, and Morvan syndrome. Outside these entities, the clinical value of VGKC-complex antibodies remains unclear. We conducted a single-center review of patients positive for VGKC-complex antibodies over an 8-year period. Among 114 patients positive for VGKC-complex antibody, 11 (9.6%) carrying the diagnosis of limbic encephalitis (n = 9) or neuromyotonia (n = 2) constituted the classic group, and the remaining 103 cases of various neurologic and non-neurologic disorders comprised the nonclassic group. The median titer for the classic group was higher than the nonclassic group ( p 0.25 nM) VGKC-complex antibody levels ( p VGKC-complex antibody titers are more likely found in patients with classically associated syndromes and other autoimmune conditions. Low-level VGKC-complex antibodies can be detected in nonspecific and mostly nonautoimmune disorders. The presence of VGKC-complex antibody, rather than its level, may serve as a marker of malignancy.

  15. Supratentorial white matter blurring associated with voltage-gated potassium channel-complex limbic encephalitis. (United States)

    Urbach, H; Rauer, S; Mader, I; Paus, S; Wagner, J; Malter, M P; Prüss, H; Lewerenz, J; Kassubek, J; Hegen, H; Auer, M; Deisenhammer, F; Ufer, F; Bien, C G; Baumgartner, A


    Limbic encephalitis (LE) associated with voltage-gated potassium channel-complex antibodies (VGKC-LE) is frequently non-paraneoplastic and associated with marked improvement following corticosteroid therapy. Mesial temporal lobe abnormalities are present in around 80 % of patients. If associated or preceded by faciobrachial dystonic seizures, basal ganglia signal changes may occur. In some patients, blurring of the supratentorial white matter on T2-weighted images (SWMB) may be seen. The purpose of this study was to evaluate the incidence of SWMB and whether it is specific for VGKC-LE. Two experienced neuroradiologists independently evaluated signal abnormalities on FLAIR MRI in 79 patients with LE while unaware on the antibody type. SWMB was independently assessed as present in 10 of 36 (28 %) compared to 2 (5 %) of 43 non-VGKC patients (p = 0.009). It was not related to the presence of LGI1 or CASPR2 proteins of VGKC antibodies. MRI showed increased temporomesial FLAIR signal in 22 (61 %) VGKC compared to 14 (33 %) non-VGKC patients (p = 0.013), and extratemporomesial structures were affected in one VGKC (3 %) compared to 11 (26 %) non-VGKC patients (p = 0.005). SWMB is a newly described MRI sign rather specific for VGKC-LE.

  16. NMR structural and dynamical investigation of the isolated voltage-sensing domain of the potassium channel KvAP: implications for voltage gating. (United States)

    Shenkarev, Zakhar O; Paramonov, Alexander S; Lyukmanova, Ekaterina N; Shingarova, Lyudmila N; Yakimov, Sergei A; Dubinnyi, Maxim A; Chupin, Vladimir V; Kirpichnikov, Mikhail P; Blommers, Marcel J J; Arseniev, Alexander S


    The structure and dynamics of the isolated voltage-sensing domain (VSD) of the archaeal potassium channel KvAP was studied by high-resolution NMR. The almost complete backbone resonance assignment and partial side-chain assignment of the (2)H,(13)C,(15)N-labeled VSD were obtained for the protein domain solubilized in DPC/LDAO (2:1) mixed micelles. Secondary and tertiary structures of the VSD were characterized using secondary chemical shifts and NOE contacts. These data indicate that the spatial structure of the VSD solubilized in micelles corresponds to the structure of the domain in an open state of the channel. NOE contacts and secondary chemical shifts of amide protons indicate the presence of tightly bound water molecule as well as hydrogen bond formation involving an interhelical salt bridge (Asp62-R133) that stabilizes the overall structure of the domain. The backbone dynamics of the VSD was studied using (15)N relaxation measurements. The loop regions S1-S2 and S2-S3 were found mobile, while the S3-S4 loop (voltage-sensor paddle) was found stable at the ps-ns time scale. The moieties of S1, S2, S3, and S4 helices sharing interhelical contacts (at the level of the Asp62-R133 salt bridge) were observed in conformational exchange on the micros-ms time scale. Similar exchange-induced broadening of characteristic resonances was observed for the VSD solubilized in the membrane of lipid-protein nanodiscs composed of DMPC, DMPG, and POPC/DOPG lipids. Apparently, the observed interhelical motions represent an inherent property of the VSD of the KvAP channel and can play an important role in the voltage gating.

  17. Mono-Heteromeric Configurations of Gap Junction Channels Formed by Connexin43 and Connexin45 Reduce Unitary Conductance and Determine both Voltage Gating and Metabolic Flux Asymmetry

    Directory of Open Access Journals (Sweden)

    Guoqiang Zhong


    Full Text Available In cardiac tissues, the expression of multiple connexins (Cx40, Cx43, Cx45, and Cx30.2 is a requirement for proper development and function. Gap junctions formed by these connexins have distinct permeability and gating mechanisms. Since a single cell can express more than one connexin isoform, the formation of hetero-multimeric gap junction channels provides a tissue with an enormous repertoire of combinations to modulate intercellular communication. To study further the perm-selectivity and gating properties of channels containing Cx43 and Cx45, we studied two monoheteromeric combinations in which a HeLa cell co-transfected with Cx43 and Cx45 was paired with a cell expressing only one of these connexins. Macroscopic measurements of total conductance between cell pairs indicated a drastic reduction in total conductance for mono-heteromeric channels. In terms of Vj dependent gating, Cx43 homomeric connexons facing heteromeric connexons only responded weakly to voltage negativity. Cx45 homomeric connexons exhibited no change in Vj gating when facing heteromeric connexons. The distributions of unitary conductances (γj for both mono-heteromeric channels were smaller than predicted, and both showed low permeability to the fluorescent dyes Lucifer yellow and Rhodamine123. For both mono-heteromeric channels, we observed flux asymmetry regardless of dye charge: flux was higher in the direction of the heteromeric connexon for MhetCx45 and in the direction of the homomeric Cx43 connexon for MhetCx43. Thus, our data suggest that co-expression of Cx45 and Cx43 induces the formation of heteromeric connexons with greatly reduced permeability and unitary conductance. Furthermore, it increases the asymmetry for voltage gating for opposing connexons, and it favors asymmetric flux of molecules across the junction that depends primarily on the size (not the charge of the crossing molecules.

  18. Mono-Heteromeric Configurations of Gap Junction Channels Formed by Connexin43 and Connexin45 Reduce Unitary Conductance and Determine both Voltage Gating and Metabolic Flux Asymmetry (United States)

    Zhong, Guoqiang; Akoum, Nazem; Appadurai, Daniel A.; Hayrapetyan, Volodya; Ahmed, Osman; Martinez, Agustin D.; Beyer, Eric C.; Moreno, Alonso P.


    In cardiac tissues, the expression of multiple connexins (Cx40, Cx43, Cx45, and Cx30.2) is a requirement for proper development and function. Gap junctions formed by these connexins have distinct permeability and gating mechanisms. Since a single cell can express more than one connexin isoform, the formation of hetero-multimeric gap junction channels provides a tissue with an enormous repertoire of combinations to modulate intercellular communication. To study further the perm-selectivity and gating properties of channels containing Cx43 and Cx45, we studied two monoheteromeric combinations in which a HeLa cell co-transfected with Cx43 and Cx45 was paired with a cell expressing only one of these connexins. Macroscopic measurements of total conductance between cell pairs indicated a drastic reduction in total conductance for mono-heteromeric channels. In terms of Vj dependent gating, Cx43 homomeric connexons facing heteromeric connexons only responded weakly to voltage negativity. Cx45 homomeric connexons exhibited no change in Vj gating when facing heteromeric connexons. The distributions of unitary conductances (γj) for both mono-heteromeric channels were smaller than predicted, and both showed low permeability to the fluorescent dyes Lucifer yellow and Rhodamine123. For both mono-heteromeric channels, we observed flux asymmetry regardless of dye charge: flux was higher in the direction of the heteromeric connexon for MhetCx45 and in the direction of the homomeric Cx43 connexon for MhetCx43. Thus, our data suggest that co-expression of Cx45 and Cx43 induces the formation of heteromeric connexons with greatly reduced permeability and unitary conductance. Furthermore, it increases the asymmetry for voltage gating for opposing connexons, and it favors asymmetric flux of molecules across the junction that depends primarily on the size (not the charge) of the crossing molecules. PMID:28611680

  19. S1 constrains S4 in the voltage sensor domain of Kv7.1 K+ channels.

    Directory of Open Access Journals (Sweden)

    Yoni Haitin

    Full Text Available Voltage-gated K(+ channels comprise a central pore enclosed by four voltage-sensing domains (VSDs. While movement of the S4 helix is known to couple to channel gate opening and closing, the nature of S4 motion is unclear. Here, we substituted S4 residues of Kv7.1 channels by cysteine and recorded whole-cell mutant channel currents in Xenopus oocytes using the two-electrode voltage-clamp technique. In the closed state, disulfide and metal bridges constrain residue S225 (S4 nearby C136 (S1 within the same VSD. In the open state, two neighboring I227 (S4 are constrained at proximity while residue R228 (S4 is confined close to C136 (S1 of an adjacent VSD. Structural modeling predicts that in the closed to open transition, an axial rotation (approximately 190 degrees and outward translation of S4 (approximately 12 A is accompanied by VSD rocking. This large sensor motion changes the intra-VSD S1-S4 interaction to an inter-VSD S1-S4 interaction. These constraints provide a ground for cooperative subunit interactions and suggest a key role of the S1 segment in steering S4 motion during Kv7.1 gating.

  20. Evidence for functional diversity between the voltage-gated proton channel Hv1 and its closest related protein HVRP1.

    Directory of Open Access Journals (Sweden)

    Iris H Kim

    Full Text Available The Hv1 channel and voltage-sensitive phosphatases share with voltage-gated sodium, potassium, and calcium channels the ability to detect changes in membrane potential through voltage-sensing domains (VSDs. However, they lack the pore domain typical of these other channels. NaV, KV, and CaV proteins can be found in neurons and muscles, where they play important roles in electrical excitability. In contrast, VSD-containing proteins lacking a pore domain are found in non-excitable cells and are not involved in neuronal signaling. Here, we report the identification of HVRP1, a protein related to the Hv1 channel (from which the name Hv1 Related Protein 1 is derived, which we find to be expressed primarily in the central nervous system, and particularly in the cerebellum. Within the cerebellar tissue, HVRP1 is specifically expressed in granule neurons, as determined by in situ hybridization and immunohistochemistry. Analysis of subcellular distribution via electron microscopy and immunogold labeling reveals that the protein localizes on the post-synaptic side of contacts between glutamatergic mossy fibers and the granule cells. We also find that, despite the similarities in amino acid sequence and structural organization between Hv1 and HVRP1, the two proteins have distinct functional properties. The high conservation of HVRP1 in vertebrates and its cellular and subcellular localizations suggest an important function in the nervous system.

  1. A voltage-gated calcium channel regulates lysosomal fusion with endosomes and autophagosomes and is required for neuronal homeostasis.

    Directory of Open Access Journals (Sweden)

    Xuejun Tian


    Full Text Available Autophagy helps deliver sequestered intracellular cargo to lysosomes for proteolytic degradation and thereby maintains cellular homeostasis by preventing accumulation of toxic substances in cells. In a forward mosaic screen in Drosophila designed to identify genes required for neuronal function and maintenance, we identified multiple cacophony (cac mutant alleles. They exhibit an age-dependent accumulation of autophagic vacuoles (AVs in photoreceptor terminals and eventually a degeneration of the terminals and surrounding glia. cac encodes an α1 subunit of a Drosophila voltage-gated calcium channel (VGCC that is required for synaptic vesicle fusion with the plasma membrane and neurotransmitter release. Here, we show that cac mutant photoreceptor terminals accumulate AV-lysosomal fusion intermediates, suggesting that Cac is necessary for the fusion of AVs with lysosomes, a poorly defined process. Loss of another subunit of the VGCC, α2δ or straightjacket (stj, causes phenotypes very similar to those caused by the loss of cac, indicating that the VGCC is required for AV-lysosomal fusion. The role of VGCC in AV-lysosomal fusion is evolutionarily conserved, as the loss of the mouse homologues, Cacna1a and Cacna2d2, also leads to autophagic defects in mice. Moreover, we find that CACNA1A is localized to the lysosomes and that loss of lysosomal Cacna1a in cerebellar cultured neurons leads to a failure of lysosomes to fuse with endosomes and autophagosomes. Finally, we show that the lysosomal CACNA1A but not the plasma-membrane resident CACNA1A is required for lysosomal fusion. In summary, we present a model in which the VGCC plays a role in autophagy by regulating the fusion of AVs with lysosomes through its calcium channel activity and hence functions in maintaining neuronal homeostasis.

  2. L-Type Voltage-Gated Ca2+ Channels Regulate Synaptic-Activity-Triggered Recycling Endosome Fusion in Neuronal Dendrites

    Directory of Open Access Journals (Sweden)

    Brian G. Hiester


    Full Text Available The repertoire and abundance of proteins displayed on the surface of neuronal dendrites are tuned by regulated fusion of recycling endosomes (REs with the dendritic plasma membrane. While this process is critical for neuronal function and plasticity, how synaptic activity drives RE fusion remains unexplored. We demonstrate a multistep fusion mechanism that requires Ca2+ from distinct sources. NMDA receptor Ca2+ initiates RE fusion with the plasma membrane, while L-type voltage-gated Ca2+ channels (L-VGCCs regulate whether fused REs collapse into the membrane or reform without transferring their cargo to the cell surface. Accordingly, NMDA receptor activation triggered AMPA-type glutamate receptor trafficking to the dendritic surface in an L-VGCC-dependent manner. Conversely, potentiating L-VGCCs enhanced AMPA receptor surface expression only when NMDA receptors were also active. Thus L-VGCCs play a role in tuning activity-triggered surface expression of key synaptic proteins by gating the mode of RE fusion.

  3. The CaV2.3 R-type voltage-gated Ca2+ channel in mouse sleep architecture. (United States)

    Siwek, Magdalena Elisabeth; Müller, Ralf; Henseler, Christina; Broich, Karl; Papazoglou, Anna; Weiergräber, Marco


    Voltage-gated Ca(2+) channels (VGCCs) are key elements in mediating thalamocortical rhythmicity. Low-voltage activated (LVA) CaV 3 T-type Ca(2+) channels have been related to thalamic rebound burst firing and to generation of non-rapid eye movement (NREM) sleep. High-voltage activated (HVA) CaV 1 L-type Ca(2+) channels, on the opposite, favor the tonic mode of action associated with higher levels of vigilance. However, the role of the HVA Non-L-type CaV2.3 Ca(2+) channels, which are predominantly expressed in the reticular thalamic nucleus (RTN), still remains unclear. Recently, CaV2.3(-/-) mice were reported to exhibit altered spike-wave discharge (SWD)/absence seizure susceptibility supported by the observation that CaV2.3 mediated Ca(2+) influx into RTN neurons can trigger small-conductance Ca(2+)-activated K(+)-channel type 2 (SK2) currents capable of maintaining thalamic burst activity. Based on these studies we investigated the role of CaV2.3 R-type Ca(2+) channels in rodent sleep. The role of CaV2.3 Ca(2+) channels was analyzed in CaV2.3(-/-) mice and controls in both spontaneous and artificial urethane-induced sleep, using implantable video-EEG radiotelemetry. Data were analyzed for alterations in sleep architecture using sleep staging software and time-frequency analysis. CaV2.3 deficient mice exhibited reduced wake duration and increased slow-wave sleep (SWS). Whereas mean sleep stage durations remained unchanged, the total number of SWS epochs was increased in CaV2.3(-/-) mice. Additional changes were observed for sleep stage transitions and EEG amplitudes. Furthermore, urethane-induced SWS mimicked spontaneous sleep results obtained from CaV2.3 deficient mice. Quantitative Real-time PCR did not reveal changes in thalamic CaV3 T-type Ca(2+) channel expression. The detailed mechanisms of SWS increase in CaV2.3(-/-) mice remain to be determined. Low-voltage activated CaV2.3 R-type Ca(2+) channels in the thalamocortical loop and extra

  4. Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process (United States)

    Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.


    Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

  5. Computational Tools for Interpreting Ion Channel pH-Dependence.

    Directory of Open Access Journals (Sweden)

    Ivan Sazanavets

    Full Text Available Activity in many biological systems is mediated by pH, involving proton titratable groups with pKas in the relevant pH range. Experimental analysis of pH-dependence in proteins focusses on particular sidechains, often with mutagenesis of histidine, due to its pKa near to neutral pH. The key question for algorithms that predict pKas is whether they are sufficiently accurate to effectively narrow the search for molecular determinants of pH-dependence. Through analysis of inwardly rectifying potassium (Kir channels and acid-sensing ion channels (ASICs, mutational effects on pH-dependence are probed, distinguishing between groups described as pH-coupled or pH-sensor. Whereas mutation can lead to a shift in transition pH between open and closed forms for either type of group, only for pH-sensor groups does mutation modulate the amplitude of the transition. It is shown that a hybrid Finite Difference Poisson-Boltzmann (FDPB - Debye-Hückel continuum electrostatic model can filter mutation candidates, providing enrichment for key pH-coupled and pH-sensor residues in both ASICs and Kir channels, in comparison with application of FDPB alone.

  6. Computational Tools for Interpreting Ion Channel pH-Dependence. (United States)

    Sazanavets, Ivan; Warwicker, Jim


    Activity in many biological systems is mediated by pH, involving proton titratable groups with pKas in the relevant pH range. Experimental analysis of pH-dependence in proteins focusses on particular sidechains, often with mutagenesis of histidine, due to its pKa near to neutral pH. The key question for algorithms that predict pKas is whether they are sufficiently accurate to effectively narrow the search for molecular determinants of pH-dependence. Through analysis of inwardly rectifying potassium (Kir) channels and acid-sensing ion channels (ASICs), mutational effects on pH-dependence are probed, distinguishing between groups described as pH-coupled or pH-sensor. Whereas mutation can lead to a shift in transition pH between open and closed forms for either type of group, only for pH-sensor groups does mutation modulate the amplitude of the transition. It is shown that a hybrid Finite Difference Poisson-Boltzmann (FDPB) - Debye-Hückel continuum electrostatic model can filter mutation candidates, providing enrichment for key pH-coupled and pH-sensor residues in both ASICs and Kir channels, in comparison with application of FDPB alone.

  7. [Current Perspective on Voltage-gated Potassium Channel Complex Antibody Associated Diseases]. (United States)

    Watanabe, Osamu


    Voltage-gated potassium channel (VGKC) complex auto-antibodies were initially identified in Isaacs' syndrome (IS), which is characterized by muscle cramps and neuromyotonia. These antibodies were subsequently identified in patients with Morvan's syndrome (MoS), which includes IS in conjunction with psychosis, insomnia, and dysautonomia. The antibodies have also been detected in a patient with limbic encephalopathy (LE) presenting with prominent amnesia and frequent seizures. Typical cases of LE have adult-onset, with frequent, brief dystonic seizures that predominantly affect the arms and ipsilateral face, and has recently been termed faciobrachial dystonic seizures. Autoantibodies against the extracellular domains of VGKC complex proteins, leucine-rich glioma-inactivated 1 (LGI1), and contactin-associated protein-2 (Caspr2), occur in patients with IS, MoS, and LE. However, routine testing has detected VGKC complex antibodies without LGI1 or Caspr2 reactivities (double-negative) in patients with other diseases, such as Creutzfeldt-Jakob disease and amyotrophic lateral sclerosis. Furthermore, double-negative VGKC complex antibodies are often directed against cytosolic epitopes of Kv1 subunits. Therefore, these antibodies should no longer be classified as neuronal-surface antibodies and lacking pathogenic potential. Novel information has been generated regarding autoantibody disruption of the physiological functions of target proteins. LGI1 antibodies neutralize the interaction between LGI1 and ADAM22, thereby reducing the synaptic AMPA receptors. It may be that the main action is on inhibitory neurons, explaining why the loss of AMPA receptors causes amnesia, neuronal excitability and seizures.

  8. Characterization of the voltage-gated sodium channel of the Asian citrus psyllid, Diaphorina citri. (United States)

    Liu, Bin; Coy, Monique R; Wang, Jin-Jun; Stelinski, Lukasz L


    The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important insect pest of citrus. It is the vector of 'Candidatus' Liberibacter asiaticus, a phloem-limited bacterium that infects citrus, resulting in the disease Huanglongbing (HLB). Disease management relies heavily on suppression of D. citri populations with insecticides, including pyrethroids. In recent annual surveys to monitor insecticide resistance, reduced susceptibility to fenpropathrin was identified in several field populations of D. citri. The primary target of pyrethroids is the voltage-gated sodium channel (VGSC). The VGSC is prone to target-site insensitivity because of mutations that either reduce pyrethroid binding and/or alter gating kinetics. These mutations, known as knockdown resistance or kdr, have been reported in a wide diversity of arthropod species. Alternative splicing, in combination with kdr mutations, has been also associated with reduced pyrethroid efficacy. Here we report the molecular characterization of the VGSC in D. citri along with a survey of alternative splicing across developmental stages of this species. Previous studies demonstrated that D. citri has an exquisite enzymatic arsenal to detoxify insecticides resulting in reduced efficacy. The results from the current investigation demonstrate that target-site insensitivity is also a potential basis for insecticide resistance to pyrethroids in D. citri. The VGSC sequence and its molecular characterization should facilitate early elucidation of the underlying cause of an established case of resistance to pyrethroids. This is the first characterization of a VGSC from a hemipteran to this level of detail, with the majority of the previous studies on dipterans and lepidopterans. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  9. Voltage-Gated Potassium Channel Autoimmunity Mimicking Creutzfeldt-Jakob Disease (United States)

    Geschwind, Michael D.; Tan, K. Meng; Lennon, Vanda A.; Barajas, Ramon F.; Haman, Aissa; Klein, Christopher J.; Josephson, S. Andrew; Pittock, Sean J.


    Background Rapidly progressive dementia has a variety of causes, including Creutzfeldt-Jakob disease (CJD) and neuronal voltage-gated potassium channel (VGKC) autoantibody–associated encephalopathy. Objective To describe patients thought initially to have CJD but found subsequently to have immunotherapy-responsive VGKC autoimmunity. Design Observational, prospective case series. Setting Department of Neurology, Mayo Clinic, and the Memory and Aging Center, University of California, San Francisco. Patients A clinical serologic cohort of 15 patients referred for paraneoplastic autoantibody evaluation. Seven patients were evaluated clinically by at least one of us. Clinical information for the remaining patients was obtained by physician interview or medical record review. Main Outcome Measures Clinical features, magnetic resonance imaging abnormalities, electroencephalographic patterns, cerebrospinal fluid analyses, and responses to immunomodulatory therapy. Results All the patients presented subacutely with neurologic manifestations, including rapidly progressive dementia, myoclonus, extrapyramidal dysfunction, visual hallucinations, psychiatric disturbance, and seizures; most (60%) satisfied World Health Organization diagnostic criteria for CJD. Magnetic resonance imaging abnormalities included cerebral cortical diffusion-weighted imaging hyperintensities. Electroencephalographic abnormalities included diffuse slowing, frontal intermittent rhythmic delta activity, and focal epileptogenic activity but not periodic sharp wave complexes. Cerebrospinal fluid 14-3-3 protein or neuron-specific enolase levels were elevated in 5 of 8 patients. Hyponatremia was common (60%). Neoplasia was confirmed histologically in 5 patients (33%) and was suspected in another 5. Most patients’ conditions (92%) improved after immunomodulatory therapy. Conclusions Clinical, radiologic, electrophysiologic, and laboratory findings in VGKC autoantibody–associated encephalopathy may be

  10. Common molecular determinants of tarantula huwentoxin-IV inhibition of Na+ channel voltage sensors in domains II and IV. (United States)

    Xiao, Yucheng; Jackson, James O; Liang, Songping; Cummins, Theodore R


    The voltage sensors of domains II and IV of sodium channels are important determinants of activation and inactivation, respectively. Animal toxins that alter electrophysiological excitability of muscles and neurons often modify sodium channel activation by selectively interacting with domain II and inactivation by selectively interacting with domain IV. This suggests that there may be substantial differences between the toxin-binding sites in these two important domains. Here we explore the ability of the tarantula huwentoxin-IV (HWTX-IV) to inhibit the activity of the domain II and IV voltage sensors. HWTX-IV is specific for domain II, and we identify five residues in the S1-S2 (Glu-753) and S3-S4 (Glu-811, Leu-814, Asp-816, and Glu-818) regions of domain II that are crucial for inhibition of activation by HWTX-IV. These data indicate that a single residue in the S3-S4 linker (Glu-818 in hNav1.7) is crucial for allowing HWTX-IV to interact with the other key residues and trap the voltage sensor in the closed configuration. Mutagenesis analysis indicates that the five corresponding residues in domain IV are all critical for endowing HWTX-IV with the ability to inhibit fast inactivation. Our data suggest that the toxin-binding motif in domain II is conserved in domain IV. Increasing our understanding of the molecular determinants of toxin interactions with voltage-gated sodium channels may permit development of enhanced isoform-specific voltage-gating modifiers.

  11. Substituted 4-phenyl-2-aminoimidazoles and 4-phenyl-4,5-dihydro-2-aminoimidazoles as voltage-gated sodium channel modulators. (United States)

    Zidar, Nace; Jakopin, Žiga; Madge, David J; Chan, Fiona; Tytgat, Jan; Peigneur, Steve; Dolenc, Marija Sollner; Tomašić, Tihomir; Ilaš, Janez; Mašič, Lucija Peterlin; Kikelj, Danijel


    Voltage-gated sodium channels play an integral part in neurotransmission and their dysfunction is frequently a cause of various neurological disorders. On the basis of the structure of marine alkaloid clathrodin, twenty eight new analogs were designed, synthesized and tested for their ability to block human NaV1.3, NaV1.4 and NaV1.7 channels, as well as for their selectivity against human cardiac isoform NaV1.5, using automated patch clamp electrophysiological assay. Several compounds exhibited promising activities on different NaV channel isoforms in the medium micromolar range and some of the compounds showed also moderate isoform selectivities. The most promising results were obtained for the NaV1.3 channel, for which four compounds were found to possess IC₅₀ values lower than 15 μM. All of the active compounds bind to the open-inactivated states of the channels and therefore act as state-dependent modulators. The obtained results validate the approach of using natural products driven chemistry for drug discovery starting points and represent a good foundation for future design of selective NaV modulators. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  12. Simple and accurate model for voltage-dependent resistance of metallic carbon nanotube interconnects: An ab initio study

    International Nuclear Information System (INIS)

    Yamacli, Serhan; Avci, Mutlu


    In this work, development of a voltage dependent resistance model for metallic carbon nanotubes is aimed. Firstly, the resistance of metallic carbon nanotube interconnects are obtained from ab initio simulations and then the voltage dependence of the resistance is modeled through regression. Self-consistent non-equilibrium Green's function formalism combined with density functional theory is used for calculating the voltage dependent resistance of metallic carbon nanotubes. It is shown that voltage dependent resistances of carbon nanotubes can be accurately modeled as a polynomial function which enables rapid integration of carbon nanotube interconnect models into electronic design automation tools.

  13. Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena (United States)

    White, William E.


    Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

  14. Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder


    Cyrus S.H. Ho; Roger C.M. Ho; Amy M.L. Quek


    Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn) toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC) complex limbic ence...

  15. Leucine-rich glioma inactivated-1 and voltage gated potassium channel autoimmune encephalitis associated with ischemic stroke; A Case Report

    Directory of Open Access Journals (Sweden)

    Marisa Patryce McGinley


    Full Text Available Autoimmune encephalitis is associated with a wide variety of antibodies and clinical presentations. Voltage gated potassium channel (VGKC antibodies are a cause of autoimmune non-paraneoplastic encephalitis characterized by memory impairment, psychiatric symptoms, and seizures. We present a case of VGKC encephalitis likely preceding an ischemic stroke. Reports of autoimmune encephalitis associated with ischemic stroke are rare. Several hypothesizes linking these two disease processes are proposed.

  16. Analytical drift-current threshold voltage model of long-channel double-gate MOSFETs

    International Nuclear Information System (INIS)

    Shih, Chun-Hsing; Wang, Jhong-Sheng


    This paper presents a new, physical threshold voltage model to solve the ambiguity in determining the threshold voltage of double-gate (DG) MOSFETs. To avoid the difficulties of the conventional 2ψ B model in nearly undoped DG MOSFETs, this study proposes to define the on–off switching based on the actual roles of the drift and diffusion components in the total drain current. The drift current strongly enhances beyond the threshold voltage, while the diffusion current plays a major role in the subthreshold. The threshold voltage is defined as the drift component that exceeds the diffusion counterpart. From the solutions of Poisson's equation, the drift and diffusion currents of DG MOSFETs are separately formulated to derive the analytical expressions of the threshold voltage and associated threshold current. This model provides a comprehensive description of the switching behavior of DG MOSFET devices, and offers a physical onset threshold current to determine the threshold voltage in practical extraction

  17. Beta-Estradiol Regulates Voltage-Gated Calcium Channels and Estrogen Receptors in Telocytes from Human Myometrium

    Directory of Open Access Journals (Sweden)

    Adela Banciu


    Full Text Available Voltage-gated calcium channels and estrogen receptors are essential players in uterine physiology, and their association with different calcium signaling pathways contributes to healthy and pathological conditions of the uterine myometrium. Among the properties of the various cell subtypes present in human uterine myometrium, there is increasing evidence that calcium oscillations in telocytes (TCs contribute to contractile activity and pregnancy. Our study aimed to evaluate the effects of beta-estradiol on voltage-gated calcium channels and estrogen receptors in TCs from human uterine myometrium and to understand their role in pregnancy. For this purpose, we employed patch-clamp recordings, ratiometric Fura-2-based calcium imaging analysis, and qRT-PCR techniques for the analysis of cultured human myometrial TCs derived from pregnant and non-pregnant uterine samples. In human myometrial TCs from both non-pregnant and pregnant uterus, we evidenced by qRT-PCR the presence of genes encoding for voltage-gated calcium channels (Cav3.1, Ca3.2, Cav3.3, Cav2.1, estrogen receptors (ESR1, ESR2, GPR30, and nuclear receptor coactivator 3 (NCOA3. Pregnancy significantly upregulated Cav3.1 and downregulated Cav3.2, Cav3.3, ESR1, ESR2, and NCOA3, compared to the non-pregnant condition. Beta-estradiol treatment (24 h, 10, 100, 1000 nM downregulated Cav3.2, Cav3.3, Cav1.2, ESR1, ESR2, GRP30, and NCOA3 in TCs from human pregnant uterine myometrium. We also confirmed the functional expression of voltage-gated calcium channels by patch-clamp recordings and calcium imaging analysis of TCs from pregnant human myometrium by perfusing with BAY K8644, which induced calcium influx through these channels. Additionally, we demonstrated that beta-estradiol (1000 nM antagonized the effect of BAY K8644 (2.5 or 5 µM in the same preparations. In conclusion, we evidenced the presence of voltage-gated calcium channels and estrogen receptors in TCs from non-pregnant and pregnant

  18. Beta-Estradiol Regulates Voltage-Gated Calcium Channels and Estrogen Receptors in Telocytes from Human Myometrium. (United States)

    Banciu, Adela; Banciu, Daniel Dumitru; Mustaciosu, Cosmin Catalin; Radu, Mihai; Cretoiu, Dragos; Xiao, Junjie; Cretoiu, Sanda Maria; Suciu, Nicolae; Radu, Beatrice Mihaela


    Voltage-gated calcium channels and estrogen receptors are essential players in uterine physiology, and their association with different calcium signaling pathways contributes to healthy and pathological conditions of the uterine myometrium. Among the properties of the various cell subtypes present in human uterine myometrium, there is increasing evidence that calcium oscillations in telocytes (TCs) contribute to contractile activity and pregnancy. Our study aimed to evaluate the effects of beta-estradiol on voltage-gated calcium channels and estrogen receptors in TCs from human uterine myometrium and to understand their role in pregnancy. For this purpose, we employed patch-clamp recordings, ratiometric Fura-2-based calcium imaging analysis, and qRT-PCR techniques for the analysis of cultured human myometrial TCs derived from pregnant and non-pregnant uterine samples. In human myometrial TCs from both non-pregnant and pregnant uterus, we evidenced by qRT-PCR the presence of genes encoding for voltage-gated calcium channels (Cav3.1, Ca3.2, Cav3.3, Cav2.1), estrogen receptors (ESR1, ESR2, GPR30), and nuclear receptor coactivator 3 (NCOA3). Pregnancy significantly upregulated Cav3.1 and downregulated Cav3.2, Cav3.3, ESR1, ESR2, and NCOA3, compared to the non-pregnant condition. Beta-estradiol treatment (24 h, 10, 100, 1000 nM) downregulated Cav3.2, Cav3.3, Cav1.2, ESR1, ESR2, GRP30, and NCOA3 in TCs from human pregnant uterine myometrium. We also confirmed the functional expression of voltage-gated calcium channels by patch-clamp recordings and calcium imaging analysis of TCs from pregnant human myometrium by perfusing with BAY K8644, which induced calcium influx through these channels. Additionally, we demonstrated that beta-estradiol (1000 nM) antagonized the effect of BAY K8644 (2.5 or 5 µM) in the same preparations. In conclusion, we evidenced the presence of voltage-gated calcium channels and estrogen receptors in TCs from non-pregnant and pregnant human uterine

  19. GABA(A) Increases Calcium in Subventricular Zone Astrocyte-Like Cells Through L- and T-Type Voltage-Gated Calcium Channels

    DEFF Research Database (Denmark)

    Young, Stephanie Z; Platel, Jean-Claude; Nielsen, Jakob V


    In the adult neurogenic subventricular zone (SVZ), the behavior of astrocyte-like cells and some of their functions depend on changes in intracellular Ca(2+) levels and tonic GABA(A) receptor activation. However, it is unknown whether, and if so how, GABA(A) receptor activity regulates...... intracellular Ca(2+) dynamics in SVZ astrocytes. To monitor Ca(2+) activity selectively in astrocyte-like cells, we used two lines of transgenic mice expressing either GFP fused to a Gq-coupled receptor or DsRed under the human glial fibrillary acidic protein (hGFAP) promoter. GABA(A) receptor activation...... induced Ca(2+) increases in 40-50% of SVZ astrocytes. GABA(A)-induced Ca(2+) increases were prevented with nifedipine and mibefradil, blockers of L- and T-type voltage-gated calcium channels (VGCC). The L-type Ca(2+) channel activator BayK 8644 increased the percentage of GABA(A)-responding astrocyte...

  20. Low operating voltage n-channel organic field effect transistors using lithium fluoride/PMMA bilayer gate dielectric

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, S.; Dhar, A., E-mail:


    Highlights: • Alternative to chemically crosslinking of PMMA to achieve low leakage in provided. • Effect of LiF in reducing gate leakage through the OFET device is studied. • Effect of gate leakage on transistor performance has been investigated. • Low voltage operable and low temperature processed n-channel OFETs were fabricated. - Abstract: We report low temperature processed, low voltage operable n-channel organic field effect transistors (OFETs) using N,N′-Dioctyl-3,4,9,10-perylenedicarboximide (PTCDI-C{sub 8}) organic semiconductor and poly(methylmethacrylate) (PMMA)/lithium fluoride (LiF) bilayer gate dielectric. We have studied the role of LiF buffer dielectric in effectively reducing the gate leakage through the device and thus obtaining superior performance in contrast to the single layer PMMA dielectric devices. The bilayer OFET devices had a low threshold voltage (V{sub t}) of the order of 5.3 V. The typical values of saturation electron mobility (μ{sub s}), on/off ratio and inverse sub-threshold slope (S) for the range of devices made were estimated to be 2.8 × 10{sup −3} cm{sup 2}/V s, 385, and 3.8 V/decade respectively. Our work thus provides a potential substitution for much complicated process of chemically crosslinking PMMA to achieve low leakage, high capacitance, and thus low operating voltage OFETs.

  1. Molecular cloning and analysis of zebrafish voltage-gated sodium channel beta subunit genes: implications for the evolution of electrical signaling in vertebrates

    Directory of Open Access Journals (Sweden)

    Zhong Tao P


    Full Text Available Abstract Background Action potential generation in excitable cells such as myocytes and neurons critically depends on voltage-gated sodium channels. In mammals, sodium channels exist as macromolecular complexes that include a pore-forming alpha subunit and 1 or more modulatory beta subunits. Although alpha subunit genes have been cloned from diverse metazoans including flies, jellyfish, and humans, beta subunits have not previously been identified in any non-mammalian species. To gain further insight into the evolution of electrical signaling in vertebrates, we investigated beta subunit genes in the teleost Danio rerio (zebrafish. Results We identified and cloned single zebrafish gene homologs for beta1-beta3 (zbeta1-zbeta3 and duplicate genes for beta4 (zbeta4.1, zbeta4.2. Sodium channel beta subunit loci are similarly organized in fish and mammalian genomes. Unlike their mammalian counterparts, zbeta1 and zbeta2 subunit genes display extensive alternative splicing. Zebrafish beta subunit genes and their splice variants are differentially-expressed in excitable tissues, indicating tissue-specific regulation of zbeta1-4 expression and splicing. Co-expression of the genes encoding zbeta1 and the zebrafish sodium channel alpha subunit Nav1.5 in Chinese Hamster Ovary cells increased sodium current and altered channel gating, demonstrating functional interactions between zebrafish alpha and beta subunits. Analysis of the synteny and phylogeny of mammalian, teleost, amphibian, and avian beta subunit and related genes indicated that all extant vertebrate beta subunits are orthologous, that beta2/beta4 and beta1/beta3 share common ancestry, and that beta subunits are closely related to other proteins sharing the V-type immunoglobulin domain structure. Vertebrate sodium channel beta subunit genes were not identified in the genomes of invertebrate chordates and are unrelated to known subunits of the para sodium channel in Drosophila. Conclusion The

  2. Clinical features of neuromuscular disorders in patients with N-type voltage-gated calcium channel antibodies

    Directory of Open Access Journals (Sweden)

    Andreas Totzeck


    Full Text Available Neuromuscular junction disorders affect the pre- or postsynaptic nerve to muscle transmission due to autoimmune antibodies. Members of the group like myasthenia gravis and Lambert-Eaton syndrome have pathophysiologically distinct characteristics. However, in practice, distinction may be difficult. We present a series of three patients with a myasthenic syndrome, dropped-head syndrome, bulbar and respiratory muscle weakness and positive testing for anti-N-type voltage-gated calcium channel antibodies. In two cases anti-acetylcholin receptor antibodies were elevated, anti-P/Q-type voltage-gated calcium channel antibodies were negative. All patients initially responded to pyridostigmine with a non-response in the course of the disease. While one patient recovered well after treatment with intravenous immunoglobulins, 3,4-diaminopyridine, steroids and later on immunosuppression with mycophenolate mofetil, a second died after restriction of treatment due to unfavorable cancer diagnosis, the third patient declined treatment. Although new antibodies causing neuromuscular disorders were discovered, clinical distinction has not yet been made. Our patients showed features of pre- and postsynaptic myasthenic syndrome as well as severe dropped-head syndrome and bulbar and axial muscle weakness, but only anti-N-type voltage-gated calcium channel antibodies were positive. When administered, one patient benefited from 3,4-diaminopyridine. We suggest that this overlap-syndrome should be considered especially in patients with assumed seronegative myasthenia gravis and lack of improvement under standard therapy.

  3. Time scales of bias voltage effects in FE/MgO-based magnetic tunnel junctions with voltage-dependent perpendicular anisotropy

    International Nuclear Information System (INIS)

    Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.


    Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height

  4. Voltage-Gated Potassium Channels Kv1.3--Potentially New Molecular Target in Cancer Diagnostics and Therapy. (United States)

    Teisseyre, Andrzej; Gąsiorowska, Justyna; Michalak, Krystyna


    Voltage-gated potassium channels, Kv1.3, which were discovered in 1984, are integral membrane proteins which are activated ("open") upon change of the cell membrane potential, enabling a passive flux of potassium ions across the cell membrane. The channels are expressed in many different tissues, both normal and cancer. Since 2005 it has been known that the channels are expressed not only in the plasma membrane, but also in the inner mitochondrial membrane. The activity of Kv1.3 channels plays an important role, among others, in setting the cell resting membrane potential, cell proliferation, apoptosis and volume regulation. For some years, these channels have been considered a potentially new molecular target in both the diagnostics and therapy of some cancer diseases. This review article focuses on: 1) changes of expression of the channels in cancer disorders with special regard to correlations between the channels' expression and stage of the disease, 2) influence of inhibitors of Kv1.3 channels on proliferation and apoptosis of cancer cells, 3) possible future applications of Kv1.3 channels' inhibitors in therapy of some cancer diseases. In the last section, the results of studies performed in our Laboratory of Bioelectricity on the influence of selected biologically active plant-derived compounds from the groups of flavonoids and stilbenes and their natural and synthetic derivatives on the activity of Kv1.3 channels in normal and cancer cells are reviewed. A possible application of some compounds from these groups to support therapy of cancer diseases, such as breast, colon and lymph node cancer, and melanoma or chronic lymphocytic leukemia (B-CLL), is announced.

  5. Josephson tunneling current in the presence of a time-dependent voltage

    International Nuclear Information System (INIS)

    Harris, R.E.


    The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

  6. A low-voltage flash memory cell utilizing the gate-injection program/erase method with a recessed channel structure

    International Nuclear Information System (INIS)

    Wu Dake; Huang Ru; Wang Pengfei; Tang Poren; Wang Yangyuan


    In this paper, a low-voltage recessed channel SONOS flash memory using the gate-injection program/erase method is proposed and investigated for NAND application. It is shown that the proposed flash memory can achieve 8 V lower programming voltage compared with planar flash memory, due to the effective capacitance coupling and the electric-field enhancement by combining the recessed channel structure and the gate-injection program/erase method. In addition, more than 30% larger threshold voltage window and improved short channel effects can be obtained in the proposed flash memory

  7. Studies of alpha-helicity and intersegmental interactions in voltage-gated Na+ channels: S2D4.

    Directory of Open Access Journals (Sweden)

    Zhongming Ma


    Full Text Available Much data, including crystallographic, support structural models of sodium and potassium channels consisting of S1-S4 transmembrane segments (the "voltage-sensing domain" clustered around a central pore-forming region (S5-S6 segments and the intervening loop. Voltage gated sodium channels have four non-identical domains which differentiates them from the homotetrameric potassium channels that form the basis for current structural models. Since potassium and sodium channels also exhibit many different functional characteristics and the fourth domain (D4 of sodium channels differs in function from other domains (D1-D3, we have explored its structure in order to determine whether segments in D4 of sodium channels differ significantly from that determined for potassium channels. We have probed the secondary and tertiary structure and the role of the individual amino acid residues of the S2D4 of Na(v1.4 by employing cysteine-scanning mutagenesis (with tryptophan and glutamine substituted for native cysteine. A Fourier transform power spectrum of perturbations in free energy of steady-state inactivation gating (using midpoint potentials and slopes of Boltzmann equation fits of channel availability, h(infinity-V plots indicates a substantial amount of alpha-helical structure in S2D4 (peak at 106 degrees, alpha-Periodicity Index (alpha-PI of 3.10, This conclusion is supported by alpha-PI values of 3.28 and 2.84 for the perturbations in rate constants of entry into (beta and exit from (alpha fast inactivation at 0 mV for mutant channels relative to WT channels assuming a simple two-state model for transition from the open to inactivated state. The results of cysteine substitution at the two most sensitive sites of the S2D4 alpha-helix (N1382 and E1392C support the existence of electrostatic network interactions between S2 and other transmembrane segments within Na(v1.4D4 similar to but not identical to those proposed for K+ channels.

  8. Single amino acids in the carboxyl terminal domain of aquaporin-1 contribute to cGMP-dependent ion channel activation

    Directory of Open Access Journals (Sweden)

    Yool Andrea J


    Full Text Available Abstract Background Aquaporin-1 (AQP1 functions as an osmotic water channel and a gated cation channel. Activation of the AQP1 ion conductance by intracellular cGMP was hypothesized to involve the carboxyl (C- terminus, based on amino acid sequence alignments with cyclic-nucleotide-gated channels and cGMP-selective phosphodiesterases. Results Voltage clamp analyses of human AQP1 channels expressed in Xenopus oocytes demonstrated that the nitric oxide donor, sodium nitroprusside (SNP; 3–14 mM activated the ionic conductance response in a dose-dependent manner. Block of soluble guanylate cyclase prevented the response. Enzyme immunoassays confirmed a linear dose-dependent relationship between SNP and the resulting intracellular cGMP levels (up to 1700 fmol cGMP /oocyte at 14 mM SNP. Results here are the first to show that the efficacy of ion channel activation is decreased by mutations of AQP1 at conserved residues in the C-terminal domain (aspartate D237 and lysine K243. Conclusions These data support the idea that the limited amino acid sequence similarities found between three diverse classes of cGMP-binding proteins are significant to the function of AQP1 as a cGMP-gated ion channel, and provide direct evidence for the involvement of the AQP1 C-terminal domain in cGMP-mediated ion channel activation.

  9. Intracellular and non-neuronal targets of voltage-gated potassium channel complex antibodies. (United States)

    Lang, Bethan; Makuch, Mateusz; Moloney, Teresa; Dettmann, Inga; Mindorf, Swantje; Probst, Christian; Stoecker, Winfried; Buckley, Camilla; Newton, Charles R; Leite, M Isabel; Maddison, Paul; Komorowski, Lars; Adcock, Jane; Vincent, Angela; Waters, Patrick; Irani, Sarosh R


    Autoantibodies against the extracellular domains of the voltage-gated potassium channel (VGKC) complex proteins, leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein-2 (CASPR2), are found in patients with limbic encephalitis, faciobrachial dystonic seizures, Morvan's syndrome and neuromyotonia. However, in routine testing, VGKC complex antibodies without LGI1 or CASPR2 reactivities (double-negative) are more common than LGI1 or CASPR2 specificities. Therefore, the target(s) and clinical associations of double-negative antibodies need to be determined. Sera (n=1131) from several clinically defined cohorts were tested for IgG radioimmunoprecipitation of radioiodinated α-dendrotoxin ( 125 I-αDTX)-labelled VGKC complexes from mammalian brain extracts. Positive samples were systematically tested for live hippocampal neuron reactivity, IgG precipitation of 125 I-αDTX and 125 I-αDTX-labelled Kv1 subunits, and by cell-based assays which expressed Kv1 subunits, LGI1 and CASPR2. VGKC complex antibodies were found in 162 of 1131 (14%) sera. 90 of these (56%) had antibodies targeting the extracellular domains of LGI1 or CASPR2. Of the remaining 72 double-negative sera, 10 (14%) immunoprecipitated 125 I-αDTX itself, and 27 (38%) bound to solubilised co-expressed Kv1.1/1.2/1.6 subunits and/or Kv1.2 subunits alone, at levels proportionate to VGKC complex antibody levels (r=0.57, p=0.0017). The sera with LGI1 and CASPR2 antibodies immunoprecipitated neither preparation. None of the 27 Kv1-precipitating samples bound live hippocampal neurons or Kv1 extracellular domains, but 16 (59%) bound to permeabilised Kv1-expressing human embryonic kidney 293T cells. These intracellular Kv1 antibodies mainly associated with non-immune disease aetiologies, poor longitudinal clinical-serological correlations and a limited immunotherapy response. Double-negative VGKC complex antibodies are often directed against cytosolic epitopes of Kv1 subunits and occasionally against

  10. Analytical Model for Voltage-Dependent Photo and Dark Currents in Bulk Heterojunction Organic Solar Cells

    Directory of Open Access Journals (Sweden)

    Mesbahus Saleheen


    Full Text Available A physics-based explicit mathematical model for the external voltage-dependent forward dark current in bulk heterojunction (BHJ organic solar cells is developed by considering Shockley-Read-Hall (SRH recombination and solving the continuity equations for both electrons and holes. An analytical model for the external voltage-dependent photocurrent in BHJ organic solar cells is also proposed by incorporating exponential photon absorption, dissociation efficiency of bound electron-hole pairs (EHPs, carrier trapping, and carrier drift and diffusion in the photon absorption layer. Modified Braun’s model is used to compute the electric field-dependent dissociation efficiency of the bound EHPs. The overall net current is calculated considering the actual solar spectrum. The mathematical models are verified by comparing the model calculations with various published experimental results. We analyze the effects of the contact properties, blend compositions, charge carrier transport properties (carrier mobility and lifetime, and cell design on the current-voltage characteristics. The power conversion efficiency of BHJ organic solar cells mostly depends on electron transport properties of the acceptor layer. The results of this paper indicate that improvement of charge carrier transport (both mobility and lifetime and dissociation of bound EHPs in organic blend are critically important to increase the power conversion efficiency of the BHJ solar cells.

  11. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    International Nuclear Information System (INIS)

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.


    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  12. Interplay between tip-induced band bending and voltage-dependent surface corrugation on GaAs(110) surfaces

    NARCIS (Netherlands)

    Raad, de G.J.; Bruls, D.M.; Koenraad, P.M.; Wolter, J.H.


    Atomically resolved, voltage-dependent scanning tunneling microscopy (STM) images of GaAs(110) are compared to the results of a one-dimensional model used to calculate the amount of tip-induced band bending for a tunneling junction between a metal and a semiconductor. The voltage-dependent changes

  13. 4-Aminopyridine: a pan voltage-gated potassium channel inhibitor that enhances K7.4 currents and inhibits noradrenaline-mediated contraction of rat mesenteric small arteries

    DEFF Research Database (Denmark)

    Khammy, Makhala M; Kim, Sukhan; Bentzen, Bo H


    has not been systematically studied. The aim of this study was to investigate the pharmacological activity of 4-AP on Kv7.4 and Kv7.5 channels and characterize the effect of 4-AP on rat resistance arteries. EXPERIMENTAL APPROACH: Voltage clamp experiments were performed on Xenopus laevis oocytes......BACKGROUND AND PURPOSE: Kv7.4 and Kv7.5 channels are regulators of vascular tone. 4-Aminopyridine (4-AP) is considered a broad inhibitor of voltage-gated potassium (KV) channels, with little inhibitory effect on Kv7 family members at mmol concentrations. However, the effect of 4-AP on Kv7 channels...

  14. The Voltage-Gated Potassium Channel Subfamily KQT Member 4 (KCNQ4) Displays Parallel Evolution in Echolocating Bats (United States)

    Liu, Yang; Han, Naijian; Franchini, Lucía F.; Xu, Huihui; Pisciottano, Francisco; Elgoyhen, Ana Belén; Rajan, Koilmani Emmanuvel; Zhang, Shuyi


    Bats are the only mammals that use highly developed laryngeal echolocation, a sensory mechanism based on the ability to emit laryngeal sounds and interpret the returning echoes to identify objects. Although this capability allows bats to orientate and hunt in complete darkness, endowing them with great survival advantages, the genetic bases underlying the evolution of bat echolocation are still largely unknown. Echolocation requires high-frequency hearing that in mammals is largely dependent on somatic electromotility of outer hair cells. Then, understanding the molecular evolution of outer hair cell genes might help to unravel the evolutionary history of echolocation. In this work, we analyzed the molecular evolution of two key outer hair cell genes: the voltage-gated potassium channel gene KCNQ4 and CHRNA10, the gene encoding the α10 nicotinic acetylcholine receptor subunit. We reconstructed the phylogeny of bats based on KCNQ4 and CHRNA10 protein and nucleotide sequences. A phylogenetic tree built using KCNQ4 amino acid sequences showed that two paraphyletic clades of laryngeal echolocating bats grouped together, with eight shared substitutions among particular lineages. In addition, our analyses indicated that two of these parallel substitutions, M388I and P406S, were probably fixed under positive selection and could have had a strong functional impact on KCNQ4. Moreover, our results indicated that KCNQ4 evolved under positive selection in the ancestral lineage leading to mammals, suggesting that this gene might have been important for the evolution of mammalian hearing. On the other hand, we found that CHRNA10, a gene that evolved adaptively in the mammalian lineage, was under strong purifying selection in bats. Thus, the CHRNA10 amino acid tree did not show echolocating bat monophyly and reproduced the bat species tree. These results suggest that only a subset of hearing genes could underlie the evolution of echolocation. The present work continues to

  15. Effect of voltage-gated sodium channels blockers on motility and viability of human sperm in vitro

    Directory of Open Access Journals (Sweden)

    Hammad Ahmad Gakhar


    Full Text Available Objective: To test the effect of voltage-gated sodium channels (VGSCs blockers on the motility and viability of human sperm in-vitro and to evaluate the tested compounds as potential contact spermicidal.Methods: Sperm samples were obtained from healthy nonsmoking volunteers of age 25-30 years who had not taken any drug 3 months before and during the course of the study. The effect of VGSCs blockers evaluated from two pharmacological classes including antiarrhythmic (amiodarone, procainamide and disopyramide and antiepileptic (carbamazepine, oxcarbazepine, phenytoin, and lamotrigine drugs. They were tested on the in-vitro motility and viability of human sperm using Computer Assisted Semen Analyzer.Results: All tested drugs except oxcarbazepine showed dose dependent inhibition of total motility with significant reduction (P<0.05 at the maximum concentration of 200 μΜ when compared with the control. The concentrations of drugs that reduced total sperm motility to 50% of control (half maximal inhibitory concentration were 2.76, 14.16 and 20.29 μΜ for phenytoin, lamotrigine and carbamazepine, respectively; and 2.53, 5.32 and 0.37 μΜ for amiodarone, procainamide and disopyramide, respectively. The anti-motility effects were reversible to various degrees. There was statistically insignificant difference in the inhibition of sperm viability among amiodarone, procainamide and disopyramide. Phenytoin demonstrated the most potent spermicidal action.Conclusions: VGSCs blockers have significant adverse effects on in-vitro motility of human spermatozoa. So in-vivo studies are required to determine their potential toxicological effects on human semen quality, which is an important factor regarding fertility. Moreover, these drugs have the potential to be developed into contact spermicidal.

  16. Knockdown resistance (kdr) of the voltage-gated sodium channel gene of Aedes aegypti population in Denpasar, Bali, Indonesia. (United States)

    Hamid, Penny Humaidah; Prastowo, Joko; Widyasari, Anis; Taubert, Anja; Hermosilla, Carlos


    Aedes aegypti is the main vector of several arthropod-borne viral infections in the tropics profoundly affecting humans, such as dengue fever (DF), West Nile (WN), chikungunya and more recently Zika. Eradication of Aedes still largely depends on insecticides, which is the most cost-effective strategy, and often inefficient due to resistance development in exposed Aedes populations. We here conducted a study of Ae. aegypti resistance towards several insecticides regularly used in the city of Denpasar, Bali, Indonesia. Aedes aegypti egg samples were collected with ovitraps and thereafter hatched in the insectary of the Gadjah Mada University. The F0 generation was used for all bioassay-related experiments and knockdown resistance (kdr) assays. Results clearly showed resistance development of Ae. aegypti against tested insecticides. Mortalities of Ae. aegypti were less than 90% with highest resistance observed against 0.75% permethrin. Mosquitoes from the southern parts of Denpasar presented high level of resistance pattern in comparison to those from the western and northern parts of Denpasar. Kdr analysis of voltage-gated sodium channel (Vgsc) gene showed significant association to S989P and V1016G mutations linked to resistance phenotypes against 0.75% permethrin. Conversely, Ae. aegypti F1534C gene mutation did not result in any significant correlation to resistance development. Periodically surveillance of insecticide resistances in Ae. aegypti mosquitoes will help local public health authorities to set better goals and allow proper evaluation of on-going mosquito control strategies. Initial detection of insecticide resistance will contribute to conduct proper actions in delaying mosquito resistance development such as insecticide rotation or combination of compounds in order to prolong chemical efficacy in combating Ae. aegypti vectors in Indonesia.

  17. A molecular switch between the outer and the inner vestibule of the voltage-gated Na+ channel

    International Nuclear Information System (INIS)

    Zarrabi, T.


    Na+ channels permit rapid transmission of depolarizing impulses throughout cells and cell networks, and are essential to the proper function of skeletal muscle, the heart and the nervous system. The selectivity filter of the channel is considered to be formed by the amino acids D400, E755, K1237, and A1529 ('DEKA' motif) which are located at the innermost turn of the P-loops connecting S5 and S6 segments of each domain. The inner vestibule is believed to be lined by four S6 helices, one from each domain. Comparison of crystal structures of K+ channels in open and closed states as well as electron paramagnetic resonance spectroscopic studies suggest that the activation gate of voltage-gated ion channels is located at the inner part of the S6 segments. This may also hold true for voltage-gated Na+ channels because mutations in S6 segments alter activation gating. The gate for fast inactivation of the channel has been mapped to the intracellular linker between domains III and IV. This intracellular loop is currently considered to produce channel inactivation by transiently occluding the intracellular vestibule of the channel. The time constants of entry into and recovery from fast inactivation are on the order of milliseconds. Apart from 'fast inactivation' a number of slower inactivated states have been described. During very long depolarizations, on the order of several minutes, rNaV1.4 channels enter a very stable inactivated state which we refer to as 'ultra-slow' inactivation (IUS). In these channels the likelihood of entry into IUS is substantially increased by a mutation in the selectivity filter, K1237E. IUS can be modulated by molecules binding to the outer vestibule, suggesting that a conformational change of the outer vestibule gives rise to this kinetic state. On the other hand, the local anesthetic drug lidocaine, which binds to the internal part of the channel pore, inhibits entry into IUS by a 'foot-in-the-door' mechanism indicating that a

  18. Follicle-stimulating hormone receptor-mediated uptake of 45Ca2+ by proteoliposomes and cultured rat sertoli cells: Evidence for involvement of voltage-activated and voltage-independent calcium channels

    International Nuclear Information System (INIS)

    Grasso, P.; Reichert, L.E. Jr.


    We have previously reported incorporation into liposomes of Triton X-100-solubilized FSH receptor-G-protein complexes derived from purified bovine calf testis membranes. In the present study we have used this model system to show that FSH induces flux of 45Ca2+ into such proteoliposomes in a hormone-specific concentration-dependent manner. FSH, inactivated by boiling, had no stimulatory effect on 45Ca2+ flux, nor did isolated alpha- or beta-subunits of FSH. Addition of GTP (or its analogs 5'-guanylylimidodiphosphate and guanosine-5'-O-[3-thiotriphosphate]) or sodium fluoride (in the presence or absence of GTP or its analogs) failed to induce 45Ca2+ flux into proteoliposomes, suggesting that the uptake of 45Ca2+ was receptor, and not G-protein, related. Voltage-independent (ruthenium red and gadolinium chloride) and voltage-activated (methyoxyverapamil and nifedipine) calcium channel-blocking agents reduced FSH-stimulated 45Ca2+ flux into proteoliposomes to control levels. FSH also induced uptake of 45Ca2+ by cultured rat Sertoli cells. Ruthenium red and gadolinium chloride had no effect on basal levels of 45Ca2+ uptake or estradiol secretion by cultured rat Sertoli cells, nor did methoxyverapamil or nifedipine. All four calcium channel blockers, however, were able to reduce FSH-induced 45Ca2+ uptake to basal levels and FSH-stimulated conversion of androstenedione to estradiol by up to 50%, indicating an involvement of Ca2+ in FSH-stimulated steroidogenesis. Our results suggest that the well documented changes in intracellular calcium levels consequent to FSH binding may be due, at least in part, to an influx of calcium through FSH receptor-regulated calcium channels

  19. Two-dimensional threshold voltage model and design considerations for gate electrode work function engineered recessed channel nanoscale MOSFET: I

    International Nuclear Information System (INIS)

    Chaujar, Rishu; Kaur, Ravneet; Gupta, Mridula; Gupta, R S; Saxena, Manoj


    This paper discusses a threshold voltage model for novel device structure: gate electrode work function engineered recessed channel (GEWE-RC) nanoscale MOSFET, which combines the advantages of both RC and GEWE structures. In part I, the model accurately predicts (a) surface potential, (b) threshold voltage and (c) sub-threshold slope for single material gate recessed channel (SMG-RC) and GEWE-RC structures. Part II focuses on the development of compact analytical drain current model taking into account the transition regimes from sub-threshold to saturation. Furthermore, the drain conductance evaluation has also been obtained, reflecting relevance of the proposed device for analogue design. The analysis takes into account the effect of gate length and groove depth in order to develop a compact model suitable for device design. The analytical results predicted by the model confirm well with the simulated results. Results in part I also provide valuable design insights in the performance of nanoscale GEWE-RC MOSFET with optimum threshold voltage and negative junction depth (NJD), and hence serves as a tool to optimize important device and technological parameters for 40 nm technology

  20. Mechanism of μ-conotoxin PIIIA binding to the voltage-gated Na+ channel NaV1.4.

    Directory of Open Access Journals (Sweden)

    Rong Chen

    Full Text Available Several subtypes of voltage-gated Na+ (NaV channels are important targets for pain management. μ-Conotoxins isolated from venoms of cone snails are potent and specific blockers of different NaV channel isoforms. The inhibitory effect of μ-conotoxins on NaV channels has been examined extensively, but the mechanism of toxin specificity has not been understood in detail. Here the known structure of μ-conotoxin PIIIA and a model of the skeletal muscle channel NaV1.4 are used to elucidate elements that contribute to the structural basis of μ-conotoxin binding and specificity. The model of NaV1.4 is constructed based on the crystal structure of the bacterial NaV channel, NaVAb. Six different binding modes, in which the side chain of each of the basic residues carried by the toxin protrudes into the selectivity filter of NaV1.4, are examined in atomic detail using molecular dynamics simulations with explicit solvent. The dissociation constants (Kd computed for two selected binding modes in which Lys9 or Arg14 from the toxin protrudes into the filter of the channel are within 2 fold; both values in close proximity to those determined from dose response data for the block of NaV currents. To explore the mechanism of PIIIA specificity, a double mutant of NaV1.4 mimicking NaV channels resistant to μ-conotoxins and tetrodotoxin is constructed and the binding of PIIIA to this mutant channel examined. The double mutation causes the affinity of PIIIA to reduce by two orders of magnitude.

  1. Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements. (United States)

    Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas


    Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

  2. Apo states of calmodulin and CaBP1 control CaV1 voltage-gated calcium channel function through direct competition for the IQ domain. (United States)

    Findeisen, Felix; Rumpf, Christine H; Minor, Daniel L


    In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation and limits calcium entry, whereas CaBP1 blocks calcium-dependent inactivation (CDI) and allows sustained calcium influx. Here, we combine isothermal titration calorimetry with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca(2+)/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium-binding properties. The observation that the apo forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Predictive 3D modelling of the interactions of pyrethroids with the voltage-gated sodium channels of ticks and mites. (United States)

    O'Reilly, Andrias O; Williamson, Martin S; González-Cabrera, Joel; Turberg, Andreas; Field, Linda M; Wallace, B A; Davies, T G Emyr


    The pyrethroid insecticides are a very successful group of compounds that target invertebrate voltage-gated sodium channels and are widely used in the control of insects, ticks and mites. It is well established that some pyrethroids are good insecticides whereas others are more effective as acaricides. This species specificity is advantageous for controlling particular pest(s) in the presence of another non-target invertebrate, for example controlling the Varroa mite in honeybee colonies. We applied in silico techniques to compare the voltage-gated sodium channels of insects versus ticks and mites and their interactions with a range of pyrethroids and DDT analogues. We identified a single amino acid difference within the pyrethroid binding pocket of ticks/mites that may have significant impact on the effectiveness of pyrethroids as acaricides. Other individual amino acid differences within the binding pocket in distinct tick and mite species may provide a basis for future acaricidal selectivity. Three-dimensional modelling of the pyrethroid/DDT receptor site has led to a new hypothesis to explain the preferential binding of acaricidal pyrethroids to the sodium channels of ticks/mites. This is important for understanding pyrethroid selectivity and the potential effects of mutations that can give rise to resistance to pyrethroids in commercially-important pest species. © 2013 Society of Chemical Industry.

  4. Effects of (−-Gallocatechin-3-Gallate on Tetrodotoxin-Resistant Voltage-Gated Sodium Channels in Rat Dorsal Root Ganglion Neurons

    Directory of Open Access Journals (Sweden)

    Jian-Min Jiang


    Full Text Available The (−-gallocatechin-3-gallate (GCG concentration in some tea beverages can account for as much as 50% of the total catechins. It has been shown that catechins have analgesic properties. Voltage-gated sodium channels (Nav mediate neuronal action potentials. Tetrodotoxin inhibits all Nav isoforms, but Nav1.8 and Nav1.9 are relatively tetrodotoxin-resistant compared to other isoforms and functionally linked to nociception. In this study, the effects of GCG on tetrodotoxin-resistant Na+ currents were investigated in rat primary cultures of dorsal root ganglion neurons via the whole-cell patch-clamp technique. We found that 1 μM GCG reduced the amplitudes of peak current density of tetrodotoxin-resistant Na+ currents significantly. Furthermore, the inhibition was accompanied by a depolarizing shift of the activation voltage and a hyperpolarizing shift of steady-state inactivation voltage. The percentage block of GCG (1 μM on tetrodotoxin-resistant Na+ current was 45.1% ± 1.1% in 10 min. In addition, GCG did not produce frequency-dependent block of tetrodotoxin-resistant Na+ currents at stimulation frequencies of 1 Hz, 2 Hz and 5 Hz. On the basis of these findings, we propose that GCG may be a potential analgesic agent.

  5. Molecular Basis of Paraltyic Neurotoxin Action on Voltage-Sensitive Sodium Channels (United States)


    of 9,700 daltons isolated from the coral Goni2oora gy. (1). The toxin enhances neurally mediated contraction of blood vessels and taenia coli of the...sites on the solium channel and to identify the site of GPT action within the structure of the sodium channel protein. 2. Site of Action of Brvyetoxin

  6. Cellular elements for seeing in the dark: voltage-dependent conductances in cockroach photoreceptors

    Directory of Open Access Journals (Sweden)

    Salmela Iikka


    Full Text Available Abstract Background The importance of voltage-dependent conductances in sensory information processing is well-established in insect photoreceptors. Here we present the characterization of electrical properties in photoreceptors of the cockroach (Periplaneta americana, a nocturnal insect with a visual system adapted for dim light. Results Whole-cell patch-clamped photoreceptors had high capacitances and input resistances, indicating large photosensitive rhabdomeres suitable for efficient photon capture and amplification of small photocurrents at low light levels. Two voltage-dependent potassium conductances were found in the photoreceptors: a delayed rectifier type (KDR and a fast transient inactivating type (KA. Activation of KDR occurred during physiological voltage responses induced by light stimulation, whereas KA was nearly fully inactivated already at the dark resting potential. In addition, hyperpolarization of photoreceptors activated a small-amplitude inward-rectifying (IR current mediated at least partially by chloride. Computer simulations showed that KDR shapes light responses by opposing the light-induced depolarization and speeding up the membrane time constant, whereas KA and IR have a negligible role in the majority of cells. However, larger KA conductances were found in smaller and rapidly adapting photoreceptors, where KA could have a functional role. Conclusions The relative expression of KA and KDR in cockroach photoreceptors was opposite to the previously hypothesized framework for dark-active insects, necessitating further comparative work on the conductances. In general, the varying deployment of stereotypical K+ conductances in insect photoreceptors highlights their functional flexibility in neural coding.

  7. Lack of direct evidence for a functional role of voltage-operated calcium channels in juxtaglomerular cells

    DEFF Research Database (Denmark)

    Kurtz, A; Skott, O; Chegini, S


    in patch-clamped nor in intact Furaester-loaded cells. Moreover, basal renin secretion from a preparation enriched in mouse juxtaglomerular cells and from rat glomeruli with attached juxtaglomerular cells was not inhibited when extracellular potassium was isoosmotically increased to 56 mmol/l. In mouse...... kidney slices, however, depolarizing potassium concentrations caused a delayed inhibition at 56 mmol/l and a delayed stimulation of renin secretion at 110 mmol/l. Taken together, our study does not provide direct evidence for a role of voltage-activated calcium channels in the regulation of calcium...

  8. Design and implementation of channel estimation for low-voltage power line communication systems based on OFDM

    International Nuclear Information System (INIS)

    Zhao Huidong; Hei Yong; Qiao Shushan; Ye Tianchun


    An optimized channel estimation algorithm based on a time-spread structure in OFDM low-voltage power line communication (PLC) systems is proposed to achieve a lower bit error rate (BER). This paper optimizes the best maximum multi-path delay of the linear minimum mean square error (LMMSE) algorithm in time-domain spread OFDM systems. Simulation results indicate that the BER of the improved method is lower than that of conventional LMMSE algorithm, especially when the signal-to-noise ratio (SNR) is lower than 0 dB. Both the LMMSE algorithm and the proposed algorithm are implemented and fabricated in CSMC 0.18 μm technology. This paper analyzes and compares the hardware complexity and performance of the two algorithms. Measurements indicate that the proposed channel estimator has better performance than the conventional estimator.


    The mechanisms underlying the acute neurophysiological and behavioral effects of volatile organic compounds (VOCs) remain to be elucidated. However, the function of neuronal ion channels is perturbed by VOCs. The present study examined effects of toluene (TOL), trichloroethylene ...

  10. Differential expression of the Kv1 voltage-gated potassium channel family in the rat nephron. (United States)

    Carrisoza-Gaytán, Rolando; Salvador, Carolina; Diaz-Bello, Beatriz; Escobar, Laura I


    Several potassium (K(+)) channels contribute to maintaining the resting membrane potential of renal epithelial cells. Apart from buffering the cell membrane potential and cell volume, K(+) channels allow sodium reabsorption in the proximal tubule (PT), K(+) recycling and K(+) reabsorption in the thick ascending limb (TAL) and K(+) secretion and K(+) reabsorption in the distal convoluted tubule (DCT), connecting tubule (CNT) and collecting duct. Previously, we identified Kv.1.1, Kv1.3 and Kv1.6 channels in collecting ducts of the rat inner medulla. We also detected intracellular Kv1.3 channel in the acid secretory intercalated cells, which is trafficked to the apical membrane in response to dietary K(+) to function as a secretory K(+) channel. In this work we sought to characterize the expression of all members of the Kv1 family in the rat nephron. mRNA and protein expression were detected for all Kv1 channels. Immunoblots identified differential expression of each Kv1 in the cortex, outer and inner medulla. Immunofluorescence labeling detected Kv1.5 in Bowman´s capsule and endothelial cells and Kv1.7 in podocytes, endothelial cells and macula densa in glomeruli; Kv1.4, Kv1.5 and Kv1.7 in PT; Kv1.2, Kv1.4 and Kv1.6 in TAL; Kv1.1, Kv1.4 and Kv1.6 in DCT and CNT and Kv1.3 in DCT, and all the Kv1 family in the cortical and medullary collecting ducts. Recently, some hereditary renal syndromes have been attributed to mutations in K(+) channels. Our results expand the repertoire of K(+) channels that contribute to K(+) homeostasis to include the Kv1 family.

  11. Homogeneous distribution of large-conductance calcium-dependent potassium channels on soma and apical dendrite of rat neocortical layer 5 pyramidal neurons. (United States)

    Benhassine, Narimane; Berger, Thomas


    Voltage-gated conductances on dendrites of layer 5 pyramidal neurons participate in synaptic integration and output generation. We investigated the properties and the distribution of large-conductance calcium-activated potassium channels (BK channels) in this cell type using excised patches in acute slice preparations of rat somatosensory cortex. BK channels were characterized by their large conductance and sensitivity to the specific blockers paxilline and iberiotoxin. BK channels showed a pronounced calcium-dependence with a maximal opening probability of 0.69 at 10 microm and 0.42 at 3 microm free calcium. Their opening probability and transition time constants between open and closed states are voltage-dependent. At depolarized potentials, BK channel gating is described by two open and one closed states. Depolarization increases the opening probability due to a prolongation of the open time constant and a shortening of the closed time constant. Calcium-dependence and biophysical properties of somatic and dendritic BK channels were identical. The presence of BK channels on the apical dendrite of layer 5 pyramidal neurons was shown by immunofluorescence. Patch-clamp recordings revealed a homogeneous density of BK channels on the soma and along the apical dendrite up to 850 microm with a mean density of 1.9 channels per microm(2). BK channels are expressed either isolated or in clusters containing up to four channels. This study shows the presence of BK channels on dendrites. Their activation might modulate the shape of sodium and calcium action potentials, their propagation along the dendrite, and thereby the electrotonic distance between the somatic and dendritic action potential initiation zones.

  12. Mitochondria-derived superoxide and voltage-gated sodium channels in baroreceptor neurons from chronic heart-failure rats. (United States)

    Tu, Huiyin; Liu, Jinxu; Zhu, Zhen; Zhang, Libin; Pipinos, Iraklis I; Li, Yu-Long


    Our previous study has shown that chronic heart failure (CHF) reduces expression and activation of voltage-gated sodium (Na(v)) channels in baroreceptor neurons, which are involved in the blunted baroreceptor neuron excitability and contribute to the impairment of baroreflex in the CHF state. The present study examined the role of mitochondria-derived superoxide in the reduced Na(v) channel function in coronary artery ligation-induced CHF rats. CHF decreased the protein expression and activity of mitochondrial complex enzymes and manganese SOD (MnSOD) and elevated the mitochondria-derived superoxide level in the nodose neurons compared with those in sham nodose neurons. Adenoviral MnSOD (Ad.MnSOD) gene transfection (50 multiplicity of infection) into the nodose neurons normalized the MnSOD expression and reduced the elevation of mitochondrial superoxide in the nodose neurons from CHF rats. Ad.MnSOD also partially reversed the reduced protein expression and current density of the Na(v) channels and the suppressed cell excitability (the number of action potential and the current threshold for inducing action potential) in aortic baroreceptor neurons from CHF rats. Data from the present study indicate that mitochondrial dysfunction, including decreased protein expression and activity of mitochondrial complex enzymes and MnSOD and elevated mitochondria-derived superoxide, contributes to the reduced Na(v) channel activation and cell excitability in the aortic baroreceptor neurons in CHF rats.

  13. Mining the Virgin Land of Neurotoxicology: A Novel Paradigm of Neurotoxic Peptides Action on Glycosylated Voltage-Gated Sodium Channels

    Directory of Open Access Journals (Sweden)

    Zhirui Liu


    Full Text Available Voltage-gated sodium channels (VGSCs are important membrane protein carrying on the molecular basis for action potentials (AP in neuronal firings. Even though the structure-function studies were the most pursued spots, the posttranslation modification processes, such as glycosylation, phosphorylation, and alternative splicing associating with channel functions captured less eyesights. The accumulative research suggested an interaction between the sialic acids chains and ion-permeable pores, giving rise to subtle but significant impacts on channel gating. Sodium channel-specific neurotoxic toxins, a family of long-chain polypeptides originated from venomous animals, are found to potentially share the binding sites adjacent to glycosylated region on VGSCs. Thus, an interaction between toxin and glycosylated VGSC might hopefully join the campaign to approach the role of glycosylation in modulating VGSCs-involved neuronal network activity. This paper will cover the state-of-the-art advances of researches on glycosylation-mediated VGSCs function and the possible underlying mechanisms of interactions between toxin and glycosylated VGSCs, which may therefore, fulfill the knowledge in identifying the pharmacological targets and therapeutic values of VGSCs.

  14. Activation of CRH receptor type 1 expressed on glutamatergic neurons increases excitability of CA1 pyramidal neurons by the modulation of voltage-gated ion channels

    Directory of Open Access Journals (Sweden)

    Stephan eKratzer


    Full Text Available Corticotropin-releasing hormone (CRH plays an important role in a substantial number of patients with stress-related mental disorders, such as anxiety disorders and depression. CRH has been shown to increase neuronal excitability in the hippocampus, but the underlying mechanisms are poorly understood. The effects of CRH on neuronal excitability were investigated in acute hippocampal brain slices. Population spikes (PS and field excitatory postsynaptic potentials (fEPSP were evoked by stimulating Schaffer-collaterals and recorded simultaneously from the somatic and dendritic region of CA1 pyramidal neurons. CRH was found to increase PS amplitudes (mean  Standard error of the mean; 231.8  31.2% of control; n=10 while neither affecting fEPSPs (104.3 ± 4.2%; n=10 nor long-term potentiation (LTP. However, when Schaffer-collaterals were excited via action potentials (APs generated by stimulation of CA3 pyramidal neurons, CRH increased fEPSP amplitudes (119.8 ± 3.6%; n=8 and the magnitude of LTP in the CA1 region. Experiments in slices from transgenic mice revealed that the effect on PS amplitude is mediated exclusively by CRH receptor 1 (CRHR1 expressed on glutamatergic neurons. The effects of CRH on PS were dependent on phosphatase-2B, L- and T-type calcium channels and voltage-gated potassium channels but independent on intracellular Ca2+-elevation. In patch-clamp experiments, CRH increased the frequency and decay times of APs and decreased currents through A-type and delayed-rectifier potassium channels. These results suggest that CRH does not affect synaptic transmission per se, but modulates voltage-gated ion currents important for the generation of APs and hence elevates by this route overall neuronal activity.

  15. Analysis and Comparison of Voltage Dependent Charging Strategies for Single-Phase Electric Vehicles in an Unbalanced Danish Distribution Grid

    DEFF Research Database (Denmark)

    Álvarez, Jorge Nájera; Knezovic, Katarina; Marinelli, Mattia


    This paper studies four voltage dependent solutions for modulating the charging of multiple Electric Vehicles (EVs) in a real Danish network. Uncontrolled EV charging, especially in grid with high EV penetration, can result in overloaded lines and transformers, low-voltages and other performance...

  16. Apo-states of calmodulin and CaBP1 control CaV1 voltage-gated calcium channel function through direct competition for the IQ domain (United States)

    Findeisen, Felix; Rumpf, Christine; Minor, Daniel L.


    In neurons, binding of calmodulin (CaM) or calcium-binding protein 1 (CaBP1) to the CaV1 (L-type) voltage-gated calcium channel IQ domain endows the channel with diametrically opposed properties. CaM causes calcium-dependent inactivation (CDI) and limits calcium entry, whereas CaBP1 blocks CDI and allows sustained calcium influx. Here, we combine isothermal titration calorimetry (ITC) with cell-based functional measurements and mathematical modeling to show that these calcium sensors behave in a competitive manner that is explained quantitatively by their apo-state binding affinities for the IQ domain. This competition can be completely blocked by covalent tethering of CaM to the channel. Further, we show that Ca2+/CaM has a sub-picomolar affinity for the IQ domain that is achieved without drastic alteration of calcium binding properties. The observation that the apo-forms of CaM and CaBP1 compete with each other demonstrates a simple mechanism for direct modulation of CaV1 function and suggests a means by which excitable cells may dynamically tune CaV activity. PMID:23811053

  17. Excessive blinking and ataxia in a child with occult neuroblastoma and voltage-gated potassium channel antibodies.

    LENUS (Irish Health Repository)

    Allen, Nicholas M


    A previously healthy 9-year-old girl presented with a 10-day history of slowly progressive unsteadiness, slurred speech, and behavior change. On examination there was cerebellar ataxia and dysarthria, excessive blinking, subtle perioral myoclonus, and labile mood. The finding of oligoclonal bands in the cerebrospinal fluid prompted paraneoplastic serological evaluation and search for an occult neural crest tumor. Antineuronal nuclear autoantibody type 1 (anti-Hu) and voltage-gated potassium channel complex antibodies were detected in serum. Metaiodobenzylguanidine scan and computed tomography scan of the abdomen showed a localized abdominal mass in the region of the porta hepatis. A diagnosis of occult neuroblastoma was made. Resection of the stage 1 neuroblastoma and treatment with pulsed corticosteroids resulted in resolution of all symptoms and signs. Excessive blinking has rarely been described with neuroblastoma, and, when it is not an isolated finding, it may be a useful clue to this paraneoplastic syndrome. Although voltage-gated potassium channel complex autoimmunity has not been described previously in the setting of neuroblastoma, it is associated with a spectrum of paraneoplastic neurologic manifestations in adults, including peripheral nerve hyperexcitability disorders.

  18. Bickerstaff's encephalitis and Miller Fisher syndrome associated with voltage-gated potassium channel and novel anti-neuronal antibodies. (United States)

    Tüzün, E; Kürtüncü, M; Lang, B; Içöz, S; Akman-Demir, G; Eraksoy, M; Vincent, A


    GQ1b antibody (GQ1b-Ab) is detected in approximately two-thirds of sera of patients with Bickerstaffs encephalitis (BE). Whilst some of the remaining patients have antibodies to other gangliosides, many patients with BE are reported to be seronegative. Voltage-gated potassium channel antibody (VGKC-Ab) at high titer was detected during the diagnostic work-up of one patient with BE. Sera of an additional patient with BE and nine patients with Miller Fisher syndrome (MF) (all GQ1b-Ab positive) were investigated for VGKC-Ab and other anti-neuronal antibodies by radioimmunoprecipitation using 125I-dendrotoxin-VGKC and immunohistochemistry, respectively. Two patients with MF exhibited moderate titer VGKC-Abs. Regardless of positivity for VGKC or GQ1b antibodies, serum IgG of all patients with BE and MF reacted with the molecular layer and Purkinje cells of the cerebellum in a distinctive pattern. Voltage-gated potassium channel antibodies might be involved in some cases of BE or MF. The common staining pattern despite different antibody results suggests that there might be other, as yet unidentified, antibodies associated with BE and MF.

  19. Does Autoimmunity have a Role in Myoclonic Astatic Epilepsy? A Case Report of Voltage Gated Potassium Channel Mediated Seizures. (United States)

    Sirsi, Deepa; Dolce, Alison; Greenberg, Benjamin M; Thodeson, Drew


    There is expanding knowledge about the phenotypic variability of patients with voltage gated potassium channel complex (VGKC) antibody mediated neurologic disorders. The phenotypes are diverse and involve disorders of the central and peripheral nervous systems. The central nervous system manifestations described in the literature include limbic encephalitis, status epilepticus, and acute encephalitis. We report a 4.5 year-old boy who presented with intractable Myoclonic Astatic Epilepsy (MAE) or Doose syndrome and positive VGKC antibodies in serum. Treatment with steroids led to resolution of seizures and electrographic normalization. This case widens the spectrum of etiologies for MAE to include autoimmunity, in particular VGKC auto-antibodies and CNS inflammation, as a primary or contributing factor. There is an evolving understanding of voltage gated potassium channel complex mediated autoimmunity in children and the role of inflammation and autoimmunity in MAE and other intractable pediatric epilepsy syndromes remains to be fully defined. A high index of suspicion is required for diagnosis and appropriate management of antibody mediated epilepsy syndromes.

  20. Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures (United States)

    Cui, B. S.; Guo, X. B.; Wu, K.; Li, D.; Zuo, Y. L.; Xi, L.


    Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe65Co35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (~4 GPa for PI as compared to ~180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work.

  1. Thickness dependence of voltage-driven magnetization switching in FeCo/PI/piezoelectric actuator heterostructures

    International Nuclear Information System (INIS)

    Cui, B S; Guo, X B; Wu, K; Li, D; Zuo, Y L; Xi, L


    Strain mediated magnetization switching of ferromagnetic/substrate/piezoelectric actuator heterostructures has become a hot issue due to the advantage of low-power consumption. In this work, Fe 65 Co 35 thin films were deposited on a flexible polyamides (PI) substrate, which has quite low Young’s module (∼4 GPa for PI as compared to ∼180 GPa for Si) and benefits from complete transfer of the strain from the piezoelectric actuator to magnetic thin films. A complete 90° transition of the magnetic easy axis was realized in 50 nm thick FeCo films under the voltage of 70 V, while a less than 90° rotation angle of the magnetic easy axis direction was observed in other samples, which was ascribed to the distribution of the anisotropy field and/or the orthogonal misalignment between stress induced anisotropy and original uniaxial anisotropy. A model considering two uniaxial anisotropies with orthogonal arrangement was used to quantitatively understand the observed results and the linear-like voltage dependent anisotropy field, especially for 10 nm FeCo films, in which the switching mechanism along the easy axis direction can be explained by the domain wall depinning model. It indicates that the magnetic domain-wall movement velocity may be controlled by strain through tuning the energy barrier of the pinning in heterostructures. Moreover, voltage-driven 90° magnetization switching with low-power consumption was achieved in this work. (paper)

  2. Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP (United States)

    Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.


    In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128

  3. Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing (United States)

    Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.


    Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the

  4. Studies on the interaction between marine polyether toxins and the voltage sensitive sodium channel

    International Nuclear Information System (INIS)

    Tachibana, Kazuo; Konoki, Keichi; Fukuzawa, Seketsu


    An analysis was made on three-dimensional structure of membrane proteins by prolonging the activated state of membrane protein using external factors like natural toxins having a strong affinity to the activated state. In addition, this study aimed to clarify the structural basis for the activation of membrane proteins. First, functional analysis was made for the complex of potential-dependent Na channel and brevetoxin, marine polycyclic toxin. Then, its binding site was determined using photo-affinity labeling. Next, an investigation was made on intracellular target molecule of ritteragine B, a cytotoxic steroidal alkaloid isolated from Retterella tokioka Kott in 1992. This molecule was used to elucidate the mechanism of cell growth. It was suggested that the cytotoxity of ritteragine was not due to non-specific interaction with cell membrane, but due to an inhibition of some physiological activity through interaction with its target molecule. Furthermore, functional mechanism of norzoanthamine, a marine anti-osteoporosis alkaloid isolated from Zoanthus sp. was investigated using ovariectomized mouse as a postomenopausal osteoporosis model. It was demonstrated that the marine alkaloid is strongly inhibitory to lowering of bone weight and strength. To elucidate the physiological effects of zoanthamine in molecular level, construction of in vitro experimental system was made using human epithelial osteoblast, Saos-2, in which production of TGF-β has been demonstrated. When added with norzoanthamine to the model system, stimulative effects on its cell growth and adhesion were observed, indicating the expression of its target molecule. Additionally, functional analysis was made on okadaic acid binding protein, OABP-2. It has been reported that okadaic acid, a marine polyether toxin isolated from Halichondria okadai was strongly cytotoxic because of protein phosphatase activity. Since okadaic acid has been demonstrated to be also toxic to the host, sponge, it has been

  5. The shaping of two distinct dendritic spikes by A-type voltage-gated K+ channels

    Directory of Open Access Journals (Sweden)

    Sungchil eYang


    Full Text Available Dendritic ion channels have been a subject of intense research in neuroscience because active ion channels in dendrites shape input signals. Ca2+-permeable channels including NMDA receptors (NMDARs have been implicated in supralinear dendritic integration, and the IA conductance in sublinear integration. Despite their essential roles in dendritic integration, it has remained uncertain whether these conductances coordinate with, or counteract, each other in the process of dendritic integration. To address this question, experiments were designed in hippocampal CA1 neurons with a recent 3D digital holography system that has shown excellent performance for spatial photoactivation. The results demonstrated a role of IA as a key contributor to two distinct dendritic spikes, low- and high-threshold Ca2+ spikes, through a preferential action of IA on Ca2+-permeable channel-mediated currents, over fast AMPAR-mediated currents. It is likely that the rapid kinetics of IA provides feed-forward inhibition to counteract the delayed Ca2+ channel-mediated dendritic excitability. This research reveals one dynamic ionic mechanism of dendritic integration, and may contribute to a new understanding of neuronal hyperexcitability embedded in several neural diseases such as epilepsy, fragile X syndrome and Alzheimer's disease.

  6. Nanosecond pulsed electric fields depolarize transmembrane potential via voltage-gated K+, Ca2+ and TRPM8 channels in U87 glioblastoma cells. (United States)

    Burke, Ryan C; Bardet, Sylvia M; Carr, Lynn; Romanenko, Sergii; Arnaud-Cormos, Delia; Leveque, Philippe; O'Connor, Rodney P


    Nanosecond pulsed electric fields (nsPEFs) have a variety of applications in the biomedical and biotechnology industries. Cancer treatment has been at the forefront of investigations thus far as nsPEFs permeabilize cellular and intracellular membranes leading to apoptosis and necrosis. nsPEFs may also influence ion channel gating and have the potential to modulate cell physiology without poration of the membrane. This phenomenon was explored using live cell imaging and a sensitive fluorescent probe of transmembrane voltage in the human glioblastoma cell line, U87 MG, known to express a number of voltage-gated ion channels. The specific ion channels involved in the nsPEF response were screened using a membrane potential imaging approach and a combination of pharmacological antagonists and ion substitutions. It was found that a single 10ns pulsed electric field of 34kV/cm depolarizes the transmembrane potential of cells by acting on specific voltage-sensitive ion channels; namely the voltage and Ca2 + gated BK potassium channel, L- and T-type calcium channels, and the TRPM8 transient receptor potential channel. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Development of three channel linear bipolar high voltage amplifier (±2 KV) for electrostatic steerer

    International Nuclear Information System (INIS)

    Rajesh Kumar; Mukesh Kumar; Suman, S.K.; Safvan, C.P.; Mandal, A.


    Electrostatic steerers and scanners are planned for low energy ion beam facilities at IUAC to steer and scan the ion beam on target. The power supplies for electrostatic steerers are high voltage bipolar DC amplifiers and for scanners are bipolar AC amplifiers. To fulfil the requirements a common unit has been designed and assembled for AC and DC applications. It can be used with electrostatic devices in scanning, steering and sweeping of low energy ion beams at high frequencies to attain uniform implantation. The unit consist of three independent limited bandwidth high voltage, linear bipolar amplifiers (for X-axis, Y-axis and Y1-dog leg plates). The unit has been provided with both local and remote control. (author)

  8. Antibodies to voltage-gated potassium and calcium channels in epilepsy.

    NARCIS (Netherlands)

    Majoie, H.J.; Baets, M.H.V. de; Renier, W.O.; Lang, B.; Vincent, A.


    OBJECTIVE: To determine the prevalence of antibodies to ion channels in patients with long standing epilepsy. BACKGROUND: Although the CNS is thought to be protected from circulating antibodies by the blood brain barrier, glutamate receptor antibodies have been reported in Rasmussen's encephalitis,

  9. Blockade of the voltage-gated potassium channel Kv1.3 inhibits immune responses in vivo. (United States)

    Koo, G C; Blake, J T; Talento, A; Nguyen, M; Lin, S; Sirotina, A; Shah, K; Mulvany, K; Hora, D; Cunningham, P; Wunderler, D L; McManus, O B; Slaughter, R; Bugianesi, R; Felix, J; Garcia, M; Williamson, J; Kaczorowski, G; Sigal, N H; Springer, M S; Feeney, W


    The voltage activated K+ channel (Kv1.3) has recently been identified as the molecule that sets the resting membrane potential of peripheral human T lymphoid cells. In vitro studies indicate that blockage of Kv1.3 inhibits T cell activation, suggesting that Kv1.3 may be a target for immunosuppression. However, despite the in vitro evidence, there has been no in vivo demonstration that blockade of Kv1.3 will attenuate an immune response. The difficulty is due to species differences, as the channel does not set the membrane potential in rodent peripheral T cells. In this study, we show that the channel is present on peripheral T cells of miniswine. Using the peptidyl Kv1.3 inhibitor, margatoxin, we demonstrate that Kv1.3 also regulates the resting membrane potential, and that blockade of Kv1.3 inhibits, in vivo, both a delayed-type hypersensitivity reaction and an Ab response to an allogeneic challenge. In addition, prolonged Kv1.3 blockade causes reduced thymic cellularity and inhibits the thymic development of T cell subsets. These results provide in vivo evidence that Kv1.3 is a novel target for immunomodulation.

  10. Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

    International Nuclear Information System (INIS)

    Miah, M. Idrish


    The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V AH ) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V AH on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V AH depends on the doping density. The results are discussed

  11. Quadratic dependence of the spin-induced Hall voltage on longitudinal electric field

    Energy Technology Data Exchange (ETDEWEB)

    Miah, M. Idrish [Nanoscale Science and Technology Centre, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); School of Biomolecular and Physical Sciences, Griffith University, Nathan, Brisbane, QLD 4111 (Australia); Department of Physics, University of Chittagong, Chittagong 4331 (Bangladesh)], E-mail:


    The effect of optically induced spins in semiconductors in the low electric field is investigated. Here we report an experiment which investigates the effect of a longitudinal electric field (E) on the spin-polarized carriers generated by a circularly polarized light in semiconductors. Our experiment observes the effect as a spin-induced anomalous Hall voltage (V{sub AH}) resulting from spin-carrier electrons accumulating at the transverse edges of the sample. Unlike the ordinary Hall effect, a quadratic dependence of V{sub AH} on E is observed, which agrees with the results of the recent theoretical investigations. It is also found that V{sub AH} depends on the doping density. The results are discussed.

  12. Exponential dependence of potential barrier height on biased voltages of inorganic/organic static induction transistor

    International Nuclear Information System (INIS)

    Zhang Yong; Yang Jianhong; Cai Xueyuan; Wang Zaixing


    The exponential dependence of the potential barrier height φ c on the biased voltages of the inorganic/organic static induction transistor (SIT/OSIT) through a normalized approach in the low-current regime is presented. It shows a more accurate description than the linear expression of the potential barrier height. Through the verification of the numerical calculated and experimental results, the exponential dependence of φ c on the applied biases can be used to derive the I-V characteristics. For both SIT and OSIT, the calculated results, using the presented relationship, are agreeable with the experimental results. Compared to the previous linear relationship, the exponential description of φ c can contribute effectively to reduce the error between the theoretical and experimental results of the I-V characteristics. (semiconductor devices)

  13. Temperature dependence of the radiation induced change of depletion voltage in silicon PIN detectors

    International Nuclear Information System (INIS)

    Ziock, H.J.; Holzscheiter, K.; Morgan, A.; Palounek, A.P.T.; Ellison, J.; Heinson, A.P.; Mason, M.; Wimpenny, S.J.; Barberis, E.; Cartiglia, N.; Grillo, A.; O'Shaughnessy, K.; Rahn, J.; Rinaldi, P.; Rowe, W.A.; Sadrozinski, H.F.W.; Seiden, A.; Spencer, E.; Webster, A.; Wichmann, R.; Wilder, M.; Coupal, D.; Pal, T.


    The silicon microstrip detectors that will be used in the SDC experiment at the Superconducting Super Collider (SSC) will be exposed to very large fluences of charged particles, neutrons, and gammas. The authors present a study of how temperature affects the change in the depletion voltage of silicon PIN detectors damaged by radiation. They study the initial radiation damage and the short-term and long-term annealing of that damage as a function of temperature in the range from -10 degrees C to +50 degrees C, and as a function of 800 MeV proton fluence up to 1.5 x 10 14 p/cm 2 . They express the pronounced temperature dependencies in a simple model in terms of two annealing time constants which depend exponentially on the temperature

  14. Channel formation by the binding component of Clostridium botulinum C2 toxin: glutamate 307 of C2II affects channel properties in vitro and pH-dependent C2I translocation in vivo. (United States)

    Blöcker, Dagmar; Bachmeyer, Christoph; Benz, Roland; Aktories, Klaus; Barth, Holger


    The binding component (C2II) of the binary Clostridium botulinum C2 toxin mediates transport of the actin ADP-ribosylating enzyme component (C2I) into the cytosol of target cells. C2II (80 kDa) is activated by trypsin cleavage, and proteolytically activated C2II (60 kDa) oligomerizes to heptamers in solution. Activated C2II forms channels in lipid bilayer membranes which are highly cation selective and voltage-gated. A role for this channel in C2I translocation across the cell membrane into the cytosol is discussed. Amino acid residues 303-331 of C2II contain a conserved pattern of alternating hydrophobic and hydrophilic residues, which likely facilitates membrane insertion and channel formation by creating two antiparallel beta-strands. Some of the residues are in strategic positions within the putative C2II channel, in particular, glutamate 307 (E307) localized in its center and glycine 316 (G316) localized on the trans side of the membrane. Here, single-lysine substitutions of these amino acids and the double mutant E307K/G316K of C2II were analyzed in vivo and in artificial lipid bilayer experiments. The pH dependence of C2I transport across cellular membranes was altered, and a pH of properties of C2II were substantially changed by the mutations, as evidenced by reduced cation selectivity. Interestingly, the voltage dependence of wild-type C2II was completely lost for the E307K mutant, which means that E307 is responsible for voltage gating. Chloroquine blocked the E307K mutant channel and intoxication of Vero cells by mutant C2II and C2I, indicating that chloroquine binding does not involve E307. Overall, the voltage gating and cation selectivity of the C2II channel do not play an important role in translocation of C2I into the cytosol.

  15. Construction and validation of a homology model of the human voltage-gated proton channel hHV1. (United States)

    Kulleperuma, Kethika; Smith, Susan M E; Morgan, Deri; Musset, Boris; Holyoake, John; Chakrabarti, Nilmadhab; Cherny, Vladimir V; DeCoursey, Thomas E; Pomès, Régis


    The topological similarity of voltage-gated proton channels (H(V)1s) to the voltage-sensing domain (VSD) of other voltage-gated ion channels raises the central question of whether H(V)1s have a similar structure. We present the construction and validation of a homology model of the human H(V)1 (hH(V)1). Multiple structural alignment was used to construct structural models of the open (proton-conducting) state of hH(V)1 by exploiting the homology of hH(V)1 with VSDs of K(+) and Na(+) channels of known three-dimensional structure. The comparative assessment of structural stability of the homology models and their VSD templates was performed using massively repeated molecular dynamics simulations in which the proteins were allowed to relax from their initial conformation in an explicit membrane mimetic. The analysis of structural deviations from the initial conformation based on up to 125 repeats of 100-ns simulations for each system reveals structural features consistently retained in the homology models and leads to a consensus structural model for hH(V)1 in which well-defined external and internal salt-bridge networks stabilize the open state. The structural and electrostatic properties of this open-state model are compatible with proton translocation and offer an explanation for the reversal of charge selectivity in neutral mutants of Asp(112). Furthermore, these structural properties are consistent with experimental accessibility data, providing a valuable basis for further structural and functional studies of hH(V)1. Each Arg residue in the S4 helix of hH(V)1 was replaced by His to test accessibility using Zn(2+) as a probe. The two outermost Arg residues in S4 were accessible to external solution, whereas the innermost one was accessible only to the internal solution. Both modeling and experimental data indicate that in the open state, Arg(211), the third Arg residue in the S4 helix in hH(V)1, remains accessible to the internal solution and is located near the

  16. Activation of voltage-gated KCNQ/Kv7 channels by anticonvulsant retigabine attenuates mechanical allodynia of inflammatory temporomandibular joint in rats

    Directory of Open Access Journals (Sweden)

    Xu Wen


    Full Text Available Abstract Background Temporomandibular disorders (TMDs are characterized by persistent orofacial pain and have diverse etiologic factors that are not well understood. It is thought that central sensitization leads to neuronal hyperexcitability and contributes to hyperalgesia and spontaneous pain. Nonsteroidal anti-inflammatory drugs (NSAIDs are currently the first choice of drug to relieve TMD pain. NSAIDS were shown to exhibit anticonvulsant properties and suppress cortical neuron activities by enhancing neuronal voltage-gated potassium KCNQ/Kv7 channels (M-current, suggesting that specific activation of M-current might be beneficial for TMD pain. Results In this study, we selected a new anticonvulsant drug retigabine that specifically activates M-current, and investigated the effect of retigabine on inflammation of the temporomandibular joint (TMJ induced by complete Freund's adjuvant (CFA in rats. The results show that the head withdrawal threshold for escape from mechanical stimulation applied to facial skin over the TMJ in inflamed rats was significantly lower than that in control rats. Administration of centrally acting M-channel opener retigabine (2.5 and 7.5 mg/kg can dose-dependently raise the head withdrawal threshold of mechanical allodynia, and this analgesic effect can be reversed by the specific KCNQ channel blocker XE991 (3 mg/kg. Food intake is known to be negatively associated with TMJ inflammation. Food intake was increased significantly by the administration of retigabine (2.5 and 7.5 mg/kg, and this effect was reversed by XE991 (3 mg/kg. Furthermore, intracerebralventricular injection of retigabine further confirmed the analgesic effect of central retigabine on inflammatory TMJ. Conclusions Our findings indicate that central sensitization is involved in inflammatory TMJ pain and pharmacological intervention for controlling central hyperexcitability by activation of neuronal KCNQ/M-channels may have therapeutic potential for

  17. Application of Stochastic Automata Networks for Creation of Continuous Time Markov Chain Models of Voltage Gating of Gap Junction Channels

    Directory of Open Access Journals (Sweden)

    Mindaugas Snipas


    Full Text Available The primary goal of this work was to study advantages of numerical methods used for the creation of continuous time Markov chain models (CTMC of voltage gating of gap junction (GJ channels composed of connexin protein. This task was accomplished by describing gating of GJs using the formalism of the stochastic automata networks (SANs, which allowed for very efficient building and storing of infinitesimal generator of the CTMC that allowed to produce matrices of the models containing a distinct block structure. All of that allowed us to develop efficient numerical methods for a steady-state solution of CTMC models. This allowed us to accelerate CPU time, which is necessary to solve CTMC models, ∼20 times.

  18. The voltage-gated proton channel Hv1 is expressed in pancreatic islet β-cells and regulates insulin secretion

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Qing [Department of Biophysics, School of Physics Science, The Key Laboratory of Bioactive Materials, Ministry of Education, Nankai University, Tianjin 300071 (China); Che, Yongzhe [School of Medicine, Nankai University, Tianjin 300071 (China); Li, Qiang; Zhang, Shangrong [Department of Biophysics, School of Physics Science, The Key Laboratory of Bioactive Materials, Ministry of Education, Nankai University, Tianjin 300071 (China); Gao, Ying-Tang [Key Laboratory of Artificial Cell, Third Central Clinical College of Tianjin Medical University, Tianjin 300170 (China); Wang, Yifan; Wang, Xudong; Xi, Wang; Zuo, Weiyan [Department of Biophysics, School of Physics Science, The Key Laboratory of Bioactive Materials, Ministry of Education, Nankai University, Tianjin 300071 (China); Li, Shu Jie, E-mail: [Department of Biophysics, School of Physics Science, The Key Laboratory of Bioactive Materials, Ministry of Education, Nankai University, Tianjin 300071 (China)


    The voltage-gated proton channel Hv1 is a potent acid extruder that participates in the extrusion of the intracellular acid. Here, we showed for the first time, Hv1 is highly expressed in mouse and human pancreatic islet β-cells, as well as β-cell lines. Imaging studies demonstrated that Hv1 resides in insulin-containing granules in β-cells. Knockdown of Hv1 with RNA interference significantly reduces glucose- and K{sup +}-induced insulin secretion in isolated islets and INS-1 (832/13) β-cells and has an impairment on glucose- and K{sup +}-induced intracellular Ca{sup 2+} homeostasis. Our data demonstrated that the expression of Hv1 in pancreatic islet β-cells regulates insulin secretion through regulating Ca{sup 2+} homeostasis.

  19. Application of Stochastic Automata Networks for Creation of Continuous Time Markov Chain Models of Voltage Gating of Gap Junction Channels (United States)

    Pranevicius, Henrikas; Pranevicius, Mindaugas; Pranevicius, Osvaldas; Bukauskas, Feliksas F.


    The primary goal of this work was to study advantages of numerical methods used for the creation of continuous time Markov chain models (CTMC) of voltage gating of gap junction (GJ) channels composed of connexin protein. This task was accomplished by describing gating of GJs using the formalism of the stochastic automata networks (SANs), which allowed for very efficient building and storing of infinitesimal generator of the CTMC that allowed to produce matrices of the models containing a distinct block structure. All of that allowed us to develop efficient numerical methods for a steady-state solution of CTMC models. This allowed us to accelerate CPU time, which is necessary to solve CTMC models, ∼20 times. PMID:25705700

  20. Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder

    Directory of Open Access Journals (Sweden)

    Cyrus S.H. Ho


    Full Text Available Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC complex limbic encephalitis in view of previous positive autoantibodies. His failure to respond to immunotherapy prompted testing for heavy metal poisoning, which was positive for Mn. This is the first report to examine an association between Mn and VGKC antibodies and the effects of Mn on functional brain activity using functional near-infrared spectroscopy (fNIRS.

  1. Autoimmune encephalitis associated with voltage-gated potassium channels-complex and leucine-rich glioma-inactivated 1 antibodies

    DEFF Research Database (Denmark)

    Celicanin, Marko; Blaabjerg, M; Maersk-Moller, C


    BACKGROUND AND PURPOSE: The aim of this study was to describe clinical and paraclinical characteristics of all Danish patients who tested positive for anti-voltage-gated potassium channels (VGKC)-complex, anti-leucine-rich glioma-inactivated 1 (LGI1) and anti-contactin-associated protein-2......, electroencephalography and (18) F-fluorodeoxyglucose positron emission tomography scans were re-evaluated by experts in the field. RESULTS: A total of 28/192 patients tested positive for VGKC-complex antibodies by radioimmunoassay and indirect immunofluorescence; 17 had antibodies to LGI1 and 6/7 of the available....... CONCLUSIONS: Patients diagnosed with anti-LGI1 autoimmune encephalitis increased significantly from 2009 to 2014, probably due to increased awareness. In contrast to seropositive anti-VGKC-complex patients, all anti-LGI1-positive patients presented with a classical limbic encephalitis. The majority...

  2. Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder. (United States)

    Ho, Cyrus S H; Ho, Roger C M; Quek, Amy M L


    Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn) toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC) complex limbic encephalitis in view of previous positive autoantibodies. His failure to respond to immunotherapy prompted testing for heavy metal poisoning, which was positive for Mn. This is the first report to examine an association between Mn and VGKC antibodies and the effects of Mn on functional brain activity using functional near-infrared spectroscopy (fNIRS).

  3. Persistent anterograde amnesia following limbic encephalitis associated with antibodies to the voltage-gated potassium channel complex. (United States)

    Butler, Christopher R; Miller, Thomas D; Kaur, Manveer S; Baker, Ian W; Boothroyd, Georgie D; Illman, Nathan A; Rosenthal, Clive R; Vincent, Angela; Buckley, Camilla J


    Limbic encephalitis (LE) associated with antibodies to the voltage-gated potassium channel complex (VGKC) is a potentially reversible cause of cognitive impairment. Despite the prominence of cognitive dysfunction in this syndrome, little is known about patients' neuropsychological profile at presentation or their long-term cognitive outcome. We used a comprehensive neuropsychological test battery to evaluate cognitive function longitudinally in 19 patients with VGKC-LE. Before immunotherapy, the group had significant impairment of memory, processing speed and executive function, whereas language and perceptual organisation were intact. At follow-up, cognitive impairment was restricted to the memory domain, with processing speed and executive function having returned to the normal range. Residual memory function was predicted by the antibody titre at presentation. The results show that, despite broad cognitive dysfunction in the acute phase, patients with VGKC-LE often make a substantial recovery with immunotherapy but may be left with permanent anterograde amnesia.

  4. Chronic Manganese Toxicity Associated with Voltage-Gated Potassium Channel Complex Antibodies in a Relapsing Neuropsychiatric Disorder (United States)

    Ho, Cyrus S.H.; Quek, Amy M.L.


    Heavy metal poisoning is a rare but important cause of encephalopathy. Manganese (Mn) toxicity is especially rare in the modern world, and clinicians’ lack of recognition of its neuropsychiatric manifestations can lead to misdiagnosis and mismanagement. We describe the case of a man who presented with recurrent episodes of confusion, psychosis, dystonic limb movement and cognitive impairment and was initially diagnosed with anti-voltage-gated potassium channel (VGKC) complex limbic encephalitis in view of previous positive autoantibodies. His failure to respond to immunotherapy prompted testing for heavy metal poisoning, which was positive for Mn. This is the first report to examine an association between Mn and VGKC antibodies and the effects of Mn on functional brain activity using functional near-infrared spectroscopy (fNIRS). PMID:29669989

  5. Reversible dementia: two nursing home patients with voltage-gated potassium channel antibody-associated limbic encephalitis. (United States)

    Reintjes, Wesley; Romijn, Marloes D M; Hollander, Daan; Ter Bruggen, Jan P; van Marum, Rob J


    Voltage-gated potassium channel antibody-associated limbic encephalitis (VGKC-LE) is a rare disease that is a diagnostic and therapeutic challenge for medical practitioners. Two patients with VGKC-LE, both developing dementia are presented. Following treatment, both patients showed remarkable cognitive and functional improvement enabling them to leave the psychogeriatric nursing homes they both were admitted to. Patients with VGKC-LE can have a major cognitive and functional improvement even after a diagnostic delay of more than 1 year. Medical practitioners who treat patients with unexplained cognitive decline, epileptic seizures, or psychiatric symptoms should be aware of LE as an underlying rare cause. Copyright © 2015 AMDA – The Society for Post-Acute and Long-Term Care Medicine. Published by Elsevier Inc. All rights reserved.

  6. Structure-function of proteins interacting with the alpha1 pore-forming subunit of high voltage-activated calcium channel

    Directory of Open Access Journals (Sweden)

    Alan eNeely


    Full Text Available Openings of high-voltage-activated calcium channels lead to a transient increase in calcium concentration that in turn activate a plethora of cellular functions, including muscle contraction, secretion and gene transcription. To coordinate all these responses calcium channels form supramolecular assemblies containing effectors and regulatory proteins that couple calcium influx to the downstream signal cascades and to feedback elements. According to the original biochemical characterization of skeletal muscle Dihydropyridine receptors, high-voltage-activated calcium channels are multi-subunit protein complexes consisting of a pore-forming subunit (α1 associated with four additional polypeptide chains β, α2, δ and γ, often referred to as accessory subunits. Twenty-five years after the first purification of a high-voltage calcium channel, the concept of a flexible stoichiometry to expand the repertoire of mechanisms that regulate calcium channel influx has emerged. Several other proteins have been identified that associate directly with the α1-subunit, including calmodulin and multiple members of the small and large GTPase family. Some of these proteins only interact with a subset of α1-subunits and during specific stages of biogenesis. More strikingly, most of the α1-subunit interacting proteins, such as the β-subunit and small GTPases, regulate both gating and trafficking through a variety of mechanisms. Modulation of channel activity covers almost all biophysical properties of the channel. Likewise, regulation of the number of channels in the plasma membrane is performed by altering the release of the α1-subunit from the endoplasmic reticulum, by reducing its degradation or enhancing its recycling back to the cell surface. In this review, we discuss the structural basis, interplay and functional role of selected proteins that interact with the central pore-forming subunit of high-voltage-activated calcium channels.

  7. Pyrethroid resistance in Sitophilus zeamais is associated with a mutation (T929I) in the voltage-gated sodium channel. (United States)

    Araújo, Rúbia A; Williamson, Martin S; Bass, Christopher; Field, Linda M; Duce, Ian R


    The maize weevil, Sitophilus zeamais, is the most important pest affecting stored grain in Brazil and its control relies heavily on the use of insecticides. The intensive use of compounds such as the pyrethroids has led to the emergence of resistance, and previous studies have suggested that resistance to both pyrethroids and 1,1,1-trichloro-2,2-bis(p-chlorophenyl)ethane (DDT) may result from reduced sensitivity of the insecticide target, the voltage-gated sodium channel. To identify the molecular mechanisms underlying pyrethroid resistance in S. zeamais, the domain II region of the voltage-gated sodium channel (para-orthologue) gene was amplified by PCR and sequenced from susceptible and resistant laboratory S. zeamais strains that were selected with a discriminating dose of DDT. A single point mutation, T929I, was found in the para gene of the resistant S. zeamais populations and its presence in individual weevils was strongly associated with survival after DDT exposure. This is the first identification of a target-site resistance mutation in S. zeamais and unusually it is a super-kdr type mutation occurring in the absence of the more common kdr (L1014F) substitution. A high-throughput assay based on TaqMan single nucleotide polymorphism genotyping was developed for sensitive detection of the mutation and used to screen field-collected strains of S. zeamais. This showed that the mutation is present at low frequency in field populations and is a useful tool for informing control strategies. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society.

  8. Estradiol upregulates voltage-gated sodium channel 1.7 in trigeminal ganglion contributing to hyperalgesia of inflamed TMJ.

    Directory of Open Access Journals (Sweden)

    Rui-Yun Bi

    Full Text Available Temporomandibular disorders (TMDs have the highest prevalence in women of reproductive age. The role of estrogen in TMDs and especially in TMDs related pain is not fully elucidated. Voltage-gated sodium channel 1.7 (Nav1.7 plays a prominent role in pain perception and Nav1.7 in trigeminal ganglion (TG is involved in the hyperalgesia of inflamed Temporomandibular joint (TMJ. Whether estrogen could upregulate trigeminal ganglionic Nav1.7 expression to enhance hyperalgesia of inflamed TMJ remains to be explored.Estrous cycle and plasma levels of 17β-estradiol in female rats were evaluated with vaginal smear and enzyme linked immunosorbent assay, respectively. Female rats were ovariectomized and treated with 17β-estradiol at 0 μg, 20 μg and 80 μg, respectively, for 10 days. TMJ inflammation was induced using complete Freund's adjuvant. Head withdrawal thresholds and food intake were measured to evaluate the TMJ nociceptive responses. The expression of Nav1.7 in TG was examined using real-time PCR and western blot. The activity of Nav1.7 promoter was examined using luciferase reporter assay. The locations of estrogen receptors (ERα and ERβ, the G protein coupled estrogen receptor (GPR30, and Nav1.7 in TG were examined using immunohistofluorescence.Upregulation of Nav1.7 in TG and decrease in head withdrawal threshold were observed with the highest plasma 17β-estradiol in the proestrus of female rats. Ovariectomized rats treated with 80 μg 17β-estradiol showed upregulation of Nav1.7 in TG and decrease in head withdrawal threshold as compared with that of the control or ovariectomized rats treated with 0 μg or 20 μg. Moreover, 17β-estradiol dose-dependently potentiated TMJ inflammation-induced upregulation of Nav1.7 in TG and also enhanced TMJ inflammation-induced decrease of head withdrawal threshold in ovariectomized rats. In addition, the estrogen receptor antagonist, ICI 182,780, partially blocked the 17β-estradiol effect on Nav1

  9. Arginine side chain interactions and the role of arginine as a gating charge carrier in voltage sensitive ion channels (United States)

    Armstrong, Craig T.; Mason, Philip E.; Anderson, J. L. Ross; Dempsey, Christopher E.


    Gating charges in voltage-sensing domains (VSD) of voltage-sensitive ion channels and enzymes are carried on arginine side chains rather than lysine. This arginine preference may result from the unique hydration properties of the side chain guanidinium group which facilitates its movement through a hydrophobic plug that seals the center of the VSD, as suggested by molecular dynamics simulations. To test for side chain interactions implicit in this model we inspected interactions of the side chains of arginine and lysine with each of the 19 non-glycine amino acids in proteins in the protein data bank. The arginine guanidinium interacts with non-polar aromatic and aliphatic side chains above and below the guanidinium plane while hydrogen bonding with polar side chains is restricted to in-plane positions. In contrast, non-polar side chains interact largely with the aliphatic part of the lysine side chain. The hydration properties of arginine and lysine are strongly reflected in their respective interactions with non-polar and polar side chains as observed in protein structures and in molecular dynamics simulations, and likely underlie the preference for arginine as a mobile charge carrier in VSD.

  10. On the profile of frequency and voltage dependent interface states and series resistance in MIS structures

    Energy Technology Data Exchange (ETDEWEB)

    Doekme, Ilbilge [Science Education Department, Faculty of Kirsehir Education, Gazi University, Kirsehir (Turkey)]. E-mail:; Altindal, Semsettin [Physics Department, Faculty of Arts and Sciences, Gazi University, 06500, Teknikokullar, Ankara (Turkey)


    The variation in the capacitance-voltage (C-V) and conductance-voltage (G/{omega}-V) characteristics of Au/SiO{sub 2}/n-Si metal-insulator-semiconductor (MIS) structure have been systematically investigated as a function of frequencies in the frequency range 0.5 kHz-10 MHz at room temperature. In addition, the forward and reverse bias current-voltage (I-V) characteristics of this structure were measured at room temperature. The high value of ideality factor was attributed to the high density of interface states localized at Si/SiO{sub 2} interface and interfacial oxide layer. The density of interface states (N{sub ss}) and the series resistance (R{sub ss}) were calculated from I-V and C-V measurements using different methods and the effect of them on C-V and G/{omega}-V characteristics were deeply researched. At the same energy position near the top of valance band, the calculated N{sub ss} values, obtained without taking into account the series resistance of the devices almost one order of magnitude larger than N{sub ss} values obtained by taking into account R{sub ss} values. It is found that the C-V and G/{omega}-V curves exhibit a peak at low frequencies and the peak values of C and G/{omega} decrease with increasing frequency. Also, the plots of R {sub s} as a function of bias give two peaks in the certain voltage range at low frequencies. These observations indicate that at low frequencies, the charges at interface states can easily follow an AC signal and the number of them increases with decreasing frequency. The I-V, C-V and G/{omega}-V characteristics of the MIS structure are affected not only with R {sub s} but also N {sub ss}. Experimental results show that both the R{sub s} and C{sub o} values should be taken into account in determining frequency-dependent electrical characteristics.

  11. Fluctuation-Coupling of Cathode Cavity Pressure and Arc Voltage in a dc Plasma Torch with a Long Inter-Electrode Channel at Reduced Pressure

    International Nuclear Information System (INIS)

    Cao Jin-Wen; Huang He-Ji; Pan Wen-Xia


    Fluctuations of cathode cavity pressure and arc voltage are observed experimentally in a dc plasma torch with a long inter-electrode channel. The results show that they have the same frequency of around 4 kHz under typical experimental conditions. The observed phase difference between the pressure and the voltage, which is influenced by the path length between the pressure sensor and the cathode cavity, varies with different input powers. Combined with numerical simulation, the position of the pressure perturbation origin is estimated, and the results show that it is located at 0.01–0.05 m upstream of the inter-electrode channel outlet

  12. Channel layer thickness dependence of In-Ti-Zn-O thin-film transistors fabricated using pulsed laser deposition

    International Nuclear Information System (INIS)

    Zhang, Q.; Shan, F. K.; Liu, G. X.; Liu, A.; Lee, W. J.; Shin, B. C.


    Amorphous indium-titanium-zinc-oxide (ITZO) thin-film transistors (TFTs) with various channel thicknesses were fabricated at room temperature by using pulsed laser deposition. The channel layer thickness (CLT) dependence of the TFTs was investigated. All the ITZO thin films were amorphous, and the surface roughnesses decreased slightly first and then increased with increasing CLT. With increasing CLT from 35 to 140 nm, the on/off current ratio and the field-effect mobility increased, and the subthreshold swing decreased. The TFT with a CLT of 210 nm exhibited the worst performance, while the ITZO TFT with a CLT of 140 nm exhibited the best performance with a subthreshold voltage of 2.86 V, a mobility of 53.9 cm 2 V -1 s -1 , a subthreshold swing of 0.29 V/decade and an on/off current ratio of 10 9 .

  13. Frequency Dependence of Measured Massive MIMO Channel Properties

    DEFF Research Database (Denmark)

    Oliveras Martínez, Àlex; Carvalho, Elisabeth De; Nielsen, Jesper Ødum


    A multi-user massive MIMO measurement campaign is conducted to study the channel propagation characteristics (e.g. user correlation, sum of eigenvalues and condition number), focusing on the stability over frequencies and the impact of the array aperture. We use 3 arrays with 64 antennas (6m linear...... array, 2m linear array and 25cm by 28cm squared 2D array) serving 8 users holding a handset with 2 antennas. The study of the measurements shows that the propagation characteristics of the channel are stable for all the measured frequencies. We also observe that user proximity and user handgrip...... stabilize the studied properties of the channel across the frequencies, and in such case the larger the aperture of the array the more stable the properties. The number of base station antennas improves the propagation characteristics of the channel and stabilizes the properties in the frequency domain....

  14. rf power dependence of subharmonic voltage spectra of two-dimensional Josephson-junction arrays

    International Nuclear Information System (INIS)

    Hebboul, S.E.; Garland, J.C.


    We have measured the rf-bias-current de