
Sample records for chain reaction technique

  1. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique


    İLHAK, O. İrfan; ARSLAN, Ali


    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

  2. Identifikasi Cendawan Endofit Menggunakan Teknik Polymerase Chain Reaction (Detection of Endophytic Fungi Using Polymerase Chain Reaction Technique

    Directory of Open Access Journals (Sweden)

    Tuti Susanti Legiastuti


    Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction

  3. Chain reaction

    International Nuclear Information System (INIS)

    Balogh, Brian.


    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  4. Polyneutron Chain Reactions

    International Nuclear Information System (INIS)

    John C. Fisher


    Although helium atoms do not form molecules, a sufficiently large number will bind into a stable liquid droplet. A comparable situation is expected for neutrons, with a sufficiently large number binding into a stable droplet of neutron matter. Such polyneutron droplets can be viewed as isotopes of an element with nuclear charge Z=0, tentatively denoted neutrium, symbol Nt. Because of the relatively weak binding of neutrons compared with that of a mix of neutrons and protons, the minimum number of neutrons required for stability of a droplet is fairly large. Early estimates of ∼60 may be reduced to a dozen or so by the BCS pairing interaction. The Nt entries with N≥12 are new to the table of isotopes. Because all of them are beta-unstable, none is expected to persist as a free particle. Yet, some may occasionally be produced by means to be described below, and it is of interest to examine their decay chains and their interactions with charged nuclei to ascertain how their presence might be revealed. Although these reactions are interesting, they cannot be taken seriously without identifying a source for the initial Nt isotope that begins the chain. Here, we consider possible interactions between 16 O and A Nt. Although there is no strong interaction between them, we can expect a very weak residual attraction that can form a loosely bound 16 O A Nt nuclear molecule. This is not a compound nucleus in the usual sense because, considered as fluids, the 16 O and A Nt droplets are immiscible. For a droplet with fewer than about 60 neutrons, beta decay of A Nt is prevented by the buildup of Coulomb energy associated with transforming A Nt into A H in close proximity to 16 O. Thus, it is possible that 16 O A Nt molecules can persist indefinitely and that a few of them may be present in ordinary water as supermassive oxygen nuclei. Because the binding of these molecules is weak, the A Nt component can tunnel to an adjacent nucleus, and if the adjacent nucleus is 18 O, a

  5. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels


    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...

  6. Comparison of polymerase chain reaction and Warthin-Starry techniques to detect Leptospira spp. in kidneys of slaughtered cattle

    Directory of Open Access Journals (Sweden)

    Shahrzad Azizi


    Full Text Available Leptospirosis is a worldwide zoonotic disease that is caused by Gram-negative spirochaetes, Leptospira species. Affected animals excrete the organism in the urine into the environment and act as a source of infection. Cattle are maintenance hosts for some serovars of leptospirosis and are important in the transmission of the infection to humans. At post mortem examination, affected cattle show white spots in their kidneys but these are not specific for leptospirosis. Sometimes it is necessary that leptospirosis be diagnosed in the carcass. Different direct methods, including polymerase chain reaction (PCR, Warthin-Starry silver stain (WS, immunofluorescence (IF and immunohistochemistry (IHC can be used in order to diagnose leptospirosis in the affected tissues, such as kidney. The main advantage of the WS technique is direct visualisation of the bacteria in the tissue samples. Silver staining is useful for retrospective studies on formalin-fixed and paraffin-embedded samples but little information is available on the sensitivity and specificity of the technique. The present study aimed to find a simple and inexpensive method that can be used in any laboratory and that also, if clinical samples are not available, can detect Leptospira in tissue samples post mortem. This study was performed on 19 paraffin-embedded kidneys of slaughtered cows that grossly had focal to multifocal white spots. Leptospirosis was confirmed in these samples with PCR based on the LipL32 gene. Out of 19 PCR positive kidneys, Leptospira was identified in 13 stained samples by WS. The kidneys revealed different grades of interstitial nephritis. No relationship was found between severity of lesions and presence of leptospires in the kidneys. The PCR results on the urine and blood were consistent with matching WS stained kidneys. Out of 13 kidneys that were positive with silver staining, 7 matching blood and 10 matching urine samples were confirmed positive for leptospirosis

  7. Detection of Phakopsora pachyrhizi fungus by Polymerase Chain Reaction technique (PCR) after soy grains treatment by electron beams

    International Nuclear Information System (INIS)

    Fanaro, G.B.; Aquino, S.; Guedes, R.L.; Crede, R.G.; Sabundjian, I.T.; Ruiz, M.O.; Villavicencio, A.L.C.H.


    Today Brazil, as the largest soy exporter in the world, has undergone the consequences of the contamination of these crops by the Asian dust fungus, being harmed since the plantation up to the harvest, with losses in its productivity ranging 10-80%. As it is a new disease in the Americas, there are not any resistant species to this fungus attack. The grains contamination harms the exportation for countries which do not want to have their crops contaminated, affecting therefore the international commerce and agro-business relationship with those countries Brazil has trade with. The Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is of difficult control, since occurs through the wind dispersion. The P. pachyrhizi is an Asian fungus and was recently found in South Africa, Paraguay, Argentina and Brazil. As an alternative process to minimize these losses is the process to preserve the grains by radiation, the use of the electron accelerator was indicated, since its advantage for the grains exportation industry is fundamental. Besides the possibility of being disconnected when not in use, this source does not need to be recharged, is easily available and has high dose rate, streamlining the process and reducing logistics costs. The present work aims to identify, by the Polymerase Chain Reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soy grains, at doses 1 and 2 kGy, at the IPEN-CNEN electron Accelerator, a Dynamitron Machine (Radiation Dynamics Co. model JOB, New York, USA), with 1.5 MeV power and 2.5 mA electrical current. (author)

  8. Determining Annealing Temperatures for Polymerase Chain Reaction (United States)

    Porta, Angela R.; Enners, Edward


    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  9. Supply chain reaction

    International Nuclear Information System (INIS)

    Snieckus, Darius


    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  10. Fusion chain reaction - a chain reaction with charged particles

    International Nuclear Information System (INIS)

    Peres, A.; Shvarts, D.


    When a DT-plasma is compressed to very high density, the particles resulting from nuclear reactions give their energy mostly to D and T ions, by nuclear collisions, rather than to electrons as usual. Fusion can thus proceed as a chain reaction, without the need of thermonuclear temperatures. In this paper, we derive relations for the suprathermal ion population created by a fusion reaction. Numerical integration of these equations shows that a chain reaction can proceed in a cold infinite DT-plasma at densities above 8.4x10 27 -3 . Seeding the plasma with a small amount of 6 Li reduces the critical density to 7.2x10 27 -3 (140000times the normal solid density). (author)

  11. Estimation of the reaction efficiency in polymerase chain reaction

    NARCIS (Netherlands)

    Lalam, N.


    Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has

  12. The first nuclear chain reaction

    International Nuclear Information System (INIS)

    Zinn, W.H.


    The author offers his recollections of the experimental efforts beginning in 1939 which culminated in the Chain Reaction in the squash court on December 2, 1942. Recalled are Columbia University experiments which did much to establish the feasibility of the chain in natural uranium and which stimulated the creation of the Manhattan District. The Columbia group moved to the University of Chicago, where, in early summer of 1942, construction and analysis of a number of subcritical reactors (piles) gave assurance with a high probability that only a reasonable amount of uranium and moderator would be required

  13. Thermally multiplexed polymerase chain reaction. (United States)

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R


    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

  14. Detection of mycoplasmas in urethral swabs from HIV-1 infected patients and control individuals using culture techniques and polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    CUNHA Regina Ayr Florio da


    Full Text Available The objective of the present study was to determine the prevalence of certain mycoplasma species, i.e., Mycoplasma hominis, Ureaplasma urealyticum and Mycoplasma penetrans, in urethral swabs from HIV-1 infected patients compared to swabs from a control group. Mycoplasmas were detected by routine culture techniques and by the Polymerase Chain Reaction (PCR technique, using 16SrRNA generic primers of conserved region and Mycoplasma penetrans specific primers. The positivity rates obtained with the two methods were comparable. Nevertheless, PCR was more sensitive, while the culture techniques allowed the quantification of the isolates. The results showed no significant difference (p < 0.05 in positivity rates between the methods used for mycoplasma detection.

  15. Chain chemical reactions during matrix devitrification

    International Nuclear Information System (INIS)

    Barkalov, I.M.


    Investigation results of chain reaction mechanisms, proceeding at devitrification of glass-like matrices under the effect of γ-irradiation are summarized. Peculiarities of kinetics and mechanism of chain reactions proceeding at devitrification are considered: hydrocarbon chlorination, polymerization of vinyl monomers, copolymerization and graft polymerization. Possible application aspects of the chain reaction conducting during matrix devitrification are also considered

  16. Identification of bovine material in porcine spray-dried blood derivatives using the Polymerase Chain Reaction technique

    Directory of Open Access Journals (Sweden)

    Sánchez A.


    Full Text Available Due to the widely supported theory of bovine spongiform encephalopathy (BSE spread in cattle by contaminated animal feeds, screening of feed products has become essential. For many years, manufacturers have used blood and plasma proteins as high quality ingredients of foods for both pets and farm animals. However, in Europe, the Commission Regulation 1234/2003/EC temporally bans the use of processed animal proteins, including blood-derivative products, in feedstuffs for all farm animals which are fattened or bred for the production of food. This regulation has some exceptions, such as the use of non ruminant blood products into the feed of farm fish. Authorization of the re-introduction of these proteins into animal feed formulations, especially non ruminant proteins into the feed for non ruminant farm animals, is expected when adequate control methods to discriminate ruminant proteins exist. Currently, the number of validated methods to differentiate the species of origin for most of the animal by-products is limited. Here we report the development of a rapid and sensitive polymerase chain reaction (PCR-based assay, which allows detection of bovine or porcine specific mitochondrial DNAfrom spray-dried blood derivate products (plasma, whole blood and red cells, as a marker for bovine contamination in porcine products. Sample extracts, suitable for PCR, were easily and quickly obtained with the commercial PrepManTM Ultra reagent (Applied Biosystems. To confirm the porcine origin of the samples, primers targeting a specific region of 134 bp of the porcine cytochrome b coding sequence were designed (cytbporc1-F and cytbporc2-R. Previously published PCR primers (L8129 and H8357, specific for a 271 bp fragment of the bovine mitochondrial ATPase 8-ATPase 6 genes, were chosen to accomplish amplification of bovine DNA. The limit of detection (LOD of the bovine PCR assay was at least of 0.05% (v/v of bovine inclusion in spray-dried porcine plasma or red

  17. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls


    Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol


    Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...

  18. [The implementation of polymerase chain reaction technique: the real time to reveal and differentiate the viruses of human papilloma of high carcinogenic risk]. (United States)

    Andosova, L D; Kontorshchikova, K N; Blatova, O L; Kudel'kina, S Iu; Kuznetsova, I A; Belov, A V; Baĭkova, R A


    The polymerase chain reaction technique was applied in "real time" format to evaluate the occurrence rate and infection ratio of various genotypes of human papilloma of high carcinogenic risk in virus-positive women and contact persons. The examination sampling consisted of 738 women aged of 17-50 years. The examination results permitted to establish high percentage of infection of 546 patients (74%) by carcinogenic papilloma viruses. The analysis of detection rate of various genotypes of human papilloma of high carcinogenic risk established that the 56th and 16th types of high carcinogenic risk are revealed more often than others--in 33% and 15.4% correspondingly. In males, first place in occurrence rate is for those types of virus of human papilloma: the 56th n = 10 (33.3%), 16th n = 3 (10%), 45th n = 3 (10%), 51th n = 3 (10%). The rest of genotypes are detected in 3-7% cases.

  19. Comparison of group B streptococci colonization in vaginal and rectal specimens by culture method and polymerase chain reaction technique

    Directory of Open Access Journals (Sweden)

    Shahrokh Bidgani


    Conclusion: The frequency of GBS culture from rectal samples was higher than vaginal samples. However, the detection percentage of GBS using PCR from vaginal samples was higher than rectal samples. By contrast, the culture is a time-consuming method requiring at least 48 hours for GBS fully identification but PCR is a sensitive and rapid technique in detection of GBS, with the result was acquired during 3 hours.

  20. Assessment of litter prevalence of Mycoplasma hyopneumoniae in preweaned piglets utilizing an antemortem tracheobronchial mucus collection technique and a real-time polymerase chain reaction assay. (United States)

    Vangroenweghe, Frédéric; Karriker, Locke; Main, Rodger; Christianson, Eric; Marsteller, Thomas; Hammen, Kristin; Bates, Jessica; Thomas, Paul; Ellingson, Josh; Harmon, Karen; Abate, Sarah; Crawford, Kimberly


    The swine industry currently lacks validated antemortem methods of detecting baseline herd prevalence of Mycoplasma hyopneumoniae. The focus of our study was to evaluate alternative antemortem detection techniques and to determine baseline litter prevalence in preweaned pig populations utilizing the selected technique and a real-time polymerase chain reaction (qPCR) assay. Preliminary data was analyzed on weaned piglets with evidence of respiratory disease (n = 32). Five sample types (antemortem nasal swab, tracheobronchial mucus, postmortem deep airway swab, bronchoalveolar lavage, and lung tissue) were collected from each pig. Individual samples were tested for M. hyopneumoniae using qPCR. Compared to nasal swabs, tracheobronchial mucus demonstrated higher test sensitivity (P hyopneumoniae. Two out of 180 litters revealed a positive result (1.1%). Individual qPCR assays were run on the samples collected from sow farm 4. Five out of 30 samples revealed a positive result (16.7%). Tracheobronchial mucus collection in combination with qPCR is a sensitive antemortem sampling technique that can be used to estimate the prevalence of M. hyopneumoniae in preweaned pigs, thus providing insight into the infection dynamics across the entire farrow-to-finish process. © 2015 The Author(s).

  1. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR technique among various cell types of bulls

    Directory of Open Access Journals (Sweden)

    Carroll Bernie


    Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic

  2. Detection of Hepatitis B Virus (HBV) in Blood Serum By Means of PCR (Polymerase Chain Reaction) Technique

    International Nuclear Information System (INIS)

    Lina, M.; Dadang, S.; Suhadi, F.


    Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer

  3. Pathogen detection by the polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)


    In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

  4. The chain re-action

    CERN Multimedia


    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  5. Nuclear chain reaction: forty years later

    International Nuclear Information System (INIS)

    Sachs, R.G.


    The proceedings from a 1982 symposium 40 years after the first controlled nuclear chain reaction took place in Chicago covers four sessions and public discussion. The session covered the history of the chain reaction; peaceful uses in technology, medicine, and biological science; peaceful uses in power generation; and nuclear weapons control. Among the speakers were Eugene Wigner, Glenn Seaborg, Alvin Weinberg, and others who participated in the first chain reaction experiments. The proceedings reflect differences of opinion among the scientists as well as the general public. References, slides, and tables used to illustrate the individual talks are included with the papers

  6. Determination of haemolytic and non haemolytic genes profiles of Bacillus cereus strains isolated from food samples by polymerase chain reaction (pcr) technique (United States)

    Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah


    The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.

  7. Detection of Leptospira in Rats Trapped from Households in Phraroj Village, Muang Sam Sip District, Ubon Ratchathani Province Using Polymerase Chain Reaction Technique. (United States)

    Wongbutdee, Jaruwan; Jittimanee, Jutharat


    Leptospirosis, a zoonotic disease caused by Leptospira, has been a health problem in Thailand for several years. Rats are a major reservoir host for Leptospira, and the people who are usually in contact with environments contaminated with rats' urine are at risk of infection. The prevalence rate of Leptospira infection in rats may result in the spread of leptospirosis in humans. This study aimed to determine the prevalence rate ofLeptospira infection in a total of 28 rats and develop a spatial database for leptospirosis surveillance in Phraroj village in Muang Sam Sip District, Ubon Ratchathani Province. The positions of the households and the rat-trapping area were tagged by using of a Global Positioning System (GPS). DNA samples were isolated fromn rats' kidneys. The polymerase chain reaction (PCR) technique was used for the detection of 16s rRNA and LipL32 genes specific to genus and pathogenic Leptospira respectively. All of the data were used to develop a geo-data base by the connection of spatial data and attributed data to be used for query and retrieval. A map of the positions of the households and the rat-trapping area in Phraroj village was created. No rats were found to be infected in the Leptospira survey. There was no trapped rat infected with Leptospira in Phraroj village. This result may involve unreported leptospirosis in patients in this village. The Leptospira survey in rats and the geo-database will be used as a primary resource to support and make decisions about surveillance, prevention, and control of leptospirosis.

  8. [Establishment of a novel HLA genotyping method for preimplantation genetic diagnonis using multiple displacement amplification-polymerase chain reaction-sequencing based technique]. (United States)

    Zhang, Yinfeng; Luo, Haining; Zhang, Yunshan


    To establish a novel HLA genotyping method for preimplantation genetic diagnonis (PGD) using multiple displacement amplification-polymerase chain reaction-sequencing based technique (MDA-PCR-SBT). Peripheral blood samples and 76 1PN, 2PN, 3PN discarded embryos from 9 couples were collected. The alleles of HLA-A, B, DR loci were detected from the MDA product with the PCR-SBT method. The HLA genotypes of the parental peripheral blood samples were analyzed with the same protocol. The genotypes of specific HLA region were evaluated for distinguishing the segregation of haplotypes among the family members, and primary HLA matching was performed between the embryos. The 76 embryos were subjected to MDA and 74 (97.4%) were successfully amplified. For the 34 embryos from the single blastomere group, the amplification rate was 94.1%, and for the 40 embryos in the two blastomeres group, the rate was 100%. The dropout rates for DQ allele and DR allele were 1.3% and 0, respectively. The positive rate for MDA in the single blastomere group was 100%, with the dropout rates for DQ allele and DR allele being 1.5% and 0, respectively. The positive rate of MDA for the two blastomere group was 100%, with the dropout rates for both DQ and DR alleles being 0. The recombination rate of fetal HLA was 20.2% (30/148). Due to the improper classification and abnormal fertilized embryos, the proportion of matched embryos HLA was 20.3% (15/74),which was lower than the theoretical value of 25%. PGD with HLA matching can facilitate creation of a HLA-identical donor (saviour child) for umbilical cord blood or bone marrow stem cells for its affected sibling with a genetic disease. Therefore, preimplantation HLA matching may provide a tool for couples desiring to conceive a potential donor progeny for transplantation for its sibling with a life-threatening disorder.

  9. Nuclear fission, chain reaction and criticality

    International Nuclear Information System (INIS)

    Reuss, Paul


    Criticality is, notably for nuclear reactors, the status which separates the case of a fission chain reaction which inexorably decays, from that of a reaction which grows faster and faster until a counter-reaction occurs. If this status is an objective in nuclear reactors, it must not be reached or exceeded in any case in other types of installations in which fissile materials are handled (fabrication, transports, nuclear fuel processing). The author proposes an insight into this notion of criticality, discusses elements of neutron science which allow the multiplication factor to be assessed, analyses accidental scenarios which may happen, and presents associated experiments and computation codes

  10. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K


    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...


    Wigner, E.P.; Weinberg, A.M.


    A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

  12. Competing irreversible cooperative reactions on polymer chains

    International Nuclear Information System (INIS)

    Evans, J.W.; Hoffman, D.K.; Burgess, D.R.


    We analyze model processes involving competition between several irreversible reactions at the sites of a 1D, infinite, uniform polymer chain. These reactions can be cooperative, i.e., the corresponding rates depend on the state of the surrounding sites. An infinite hierarchy of rate equations is readily derived for the probabilities of various subconfigurations. By exploiting a shielding property of suitable blocks of unreacted sites, we show how exact hierarchy truncation and solution is sometimes possible. The behavior of solutions is illustrated in several cases by plotting families of ''reaction trajectories'' for varying ratios of reactant concentrations. As a specific application, we consider competition between coordination of ZnCl 2 to pairs of oxygen atoms and to single oxygen atoms in poly(propylene oxide). The observed glass transition temperature behavior is eludicated

  13. Dembo polymerase chain reaction technique for detection of bovine abortion, diarrhea, and respiratory disease complex infectious agents in potential vectors and reservoirs. (United States)

    Rahpaya, Sayed Samim; Tsuchiaka, Shinobu; Kishimoto, Mai; Oba, Mami; Katayama, Yukie; Nunomura, Yuka; Kokawa, Saki; Kimura, Takashi; Kobayashi, Atsushi; Kirino, Yumi; Okabayashi, Tamaki; Nonaka, Nariaki; Mekata, Hirohisa; Aoki, Hiroshi; Shiokawa, Mai; Umetsu, Moeko; Morita, Tatsushi; Hasebe, Ayako; Otsu, Keiko; Asai, Tetsuo; Yamaguchi, Tomohiro; Makino, Shinji; Murata, Yoshiteru; Abi, Ahmad Jan; Omatsu, Tsutomu; Mizutani, Tetsuya


    Bovine abortion, diarrhea, and respiratory disease complexes, caused by infectious agents, result in high and significant economic losses for the cattle industry. These pathogens are likely transmitted by various vectors and reservoirs including insects, birds, and rodents. However, experimental data supporting this possibility are scarce. We collected 117 samples and screened them for 44 bovine abortive, diarrheal, and respiratory disease complex pathogens by using Dembo polymerase chain reaction (PCR), which is based on TaqMan real-time PCR. Fifty-seven samples were positive for at least one pathogen, including bovine viral diarrhea virus, bovine enterovirus, Salmonella enterica ser. Dublin, Salmonella enterica ser. Typhimurium, and Neospora caninum ; some samples were positive for multiple pathogens. Bovine viral diarrhea virus and bovine enterovirus were the most frequently detected pathogens, especially in flies, suggesting an important role of flies in the transmission of these viruses. Additionally, we detected the N. caninum genome from a cockroach sample for the first time. Our data suggest that insects (particularly flies), birds, and rodents are potential vectors and reservoirs of abortion, diarrhea, and respiratory infectious agents, and that they may transmit more than one pathogen at the same time.

  14. Transformational leadership: a cascading chain reaction. (United States)

    Murphy, Lorraine


    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment.

  15. Use of competitive polymerase chain reaction to determine HIV-1 levels in response to antiviral treatments

    NARCIS (Netherlands)

    Bruisten, S. M.; Koppelman, M. H.; Roos, M. T.; Loeliger, A. E.; Reiss, P.; Boucher, C. A.; Huisman, H. G.


    OBJECTIVE: To develop a competitive polymerase chain reaction technique with which to evaluate the usefulness of HIV-1 level as a marker of response to antiviral treatment. DESIGN: HIV-1 sequences were assessed by competitive polymerase chain reaction in four subjects participating in a double-blind

  16. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Mania, Hubert


    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  17. Polymerase chain reaction methods (PCR in agrobiotechnology

    Directory of Open Access Journals (Sweden)

    Taški-Ajduković Ksenija


    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  18. Model Checking Markov Chains: Techniques and Tools

    NARCIS (Netherlands)

    Zapreev, I.S.


    This dissertation deals with four important aspects of model checking Markov chains: the development of efficient model-checking tools, the improvement of model-checking algorithms, the efficiency of the state-space reduction techniques, and the development of simulation-based model-checking

  19. Development of reliable techniques for the differential diagnosis of avian tumor viruses by immunohistochemistry and polymerase chain reaction from formalin-fixed paraffin-embedded tissue sections (United States)

    In the past, several techniques have been developed as diagnostic tools for the differential diagnosis of tumours produced by Marek’s disease virus (MDV) from those induced by avian leukosis virus (ALV) and reticuloendotheliosis virus (REV). However, most current techniques are unreliable using form...

  20. Polymerase chain reaction to search for Herpes viruses in uveitic ...

    African Journals Online (AJOL)

    Objective: To analyse aqueous polymerase chain reaction (PCR) results in patients diagnosed with undifferentiated uveitis ... Cite as: Laaks D, Smit DP, Harvey J. Polymerase chain reaction to search for Herpes viruses in uveitic and healthy eyes: a South African ... may be mild and patients do not seek medical attention.

  1. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  2. Method of identification of unbranched chain reaction with cross termination of chain

    International Nuclear Information System (INIS)

    Poluehktov, V.A.; Begishev, I.R.


    Gas-phase chlorination of unsymmetrical difluoroethane initiated by gamma quanta of Co 60 has been studied. At decreased temperatures the only hydrogen is replaced by a chlorine atom. Over a wide range of ratios of the initial reagents, the reaction occurs with a chain rupture. An analysis of the kinetics of such a reaction provides a method for identification of an unbranched chain reaction with a cross-rupture of the chain

  3. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M


    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  4. A novel rapid genotyping technique for Collie eye anomaly: SYBR Green-based real-time polymerase chain reaction method applicable to blood and saliva specimens on Flinders Technology Associates filter paper. (United States)

    Chang, Hye-Sook; Mizukami, Keijiro; Yabuki, Akira; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Arai, Toshiro; Yamato, Osamu


    Collie eye anomaly (CEA) is a canine inherited ocular disease that shows a wide variety of manifestations and severity of clinical lesions. Recently, a CEA-associated mutation was reported, and a DNA test that uses conventional polymerase chain reaction (PCR) has now become available. The objective of the current study was to develop a novel rapid genotyping technique by using SYBR Green-based real-time PCR for future large-scale surveys as a key part in the strategy to eradicate CEA by selective breeding. First, a SYBR Green-based real-time PCR assay for genotyping of CEA was developed and evaluated by using purified DNA samples from normal, carrier, and affected Border Collies in which genotypes had previously been determined by conventional PCR. This real-time PCR assay demonstrated appropriate amplifications in all genotypes, and the results were consistent with those of conventional PCR. Second, the availability of Flinders Technology Associates filter paper (FTA card) as DNA templates for the real-time PCR assay was evaluated by using blood and saliva specimens to determine suitability for CEA screening. DNA-containing solution prepared from a disc of blood- or saliva-spotted FTA cards was available directly as templates for the real-time PCR assay when the volume of solution was 2.5% of the PCR mixture. In conclusion, SYBR Green-based real-time PCR combined with FTA cards is a rapid genotyping technique for CEA that can markedly shorten the overall time required for genotyping as well as simplify the sample preparation. Therefore, this newly developed technique suits large-scale screening in breeding populations of Collie-related breeds.

  5. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)



    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  6. The application of polymerase chain reaction-denaturing gradient ...

    African Journals Online (AJOL)



    May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.

  7. Polymerase chain reaction: A molecular diagnostic tool in periodontology (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam


    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  8. Early detection of typhoid by polymerase chain reaction

    International Nuclear Information System (INIS)

    Haque, A.; Qureshi, Javed A.; Ahmed, J.


    Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

  9. Theory and applications of the polymerase chain reaction. (United States)

    Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A


    The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

  10. Effect of gamma radiation on the growth of Aspergillus Flavus aflatoxins producer and on the use of polymerase chain reaction technique (PCR) in samples of maize grains artificially inoculated

    International Nuclear Information System (INIS)

    Aquino, Simone


    The aim of this present study was to verify the effects of gamma radiation on the growth of Aspergillus flavus Link aflatoxins producer; to demonstrate the application of Polymerase Chain Reaction (PCR) technique in the diagnostic of A. Flavus, as well to verify the effect of radiation in the profile of DNA bands. Twenty samples of grains maize with 200 g each were individually irradiated with 20 kGy, to eliminate the microbial contamination. In following, the samples were inoculated with an toxigenic A. flavus (1x10 6 spores/ml), incubated for 15 days at 25 deg C with a relative humidity of around 97,5% and irradiated with 0, 2; 5 and 10 kGy. The samples, 5 to each dose of irradiation, were individually analyzed for the number of fungal cells, water activity, viability test (fluorescein diacetate and ethidium bromide), PCR and aflatoxins (AFB) detection. The results showed that the doses used were effective in reducing the number of Colony Forming Units (CFU/g) mainly the doses of 5 and 10 kGy. In addition, the viability test showed a decrease of viable cells with increase of irradiation doses. The reduction of AFB 1 and AFB-2, was more efficient with the use of 2 kGy in comparison with the dose of 5 kGy, while the dose of 10 kGy, degraded the aflatoxins. Thereby, it was observed that AFB2 showed to be more radiosensitive. The use of PCR technique showed the presence of DNA bands, in all samples. (author)

  11. Comparison of polymerase chain reaction (PCR) and loop-mediated ...

    African Journals Online (AJOL)

    Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...

  12. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies. (United States)

    Lorenz, Todd C


    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  13. Critical analysis: use of polymerase chain reaction to diagnose leprosy

    Directory of Open Access Journals (Sweden)

    Flaviane Granero Maltempe

    Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.

  14. Multi-template polymerase chain reaction. (United States)

    Kalle, Elena; Kubista, Mikael; Rensing, Christopher


    PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  15. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle


    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  16. The role of chain carriers in fusion reaction kinetics

    International Nuclear Information System (INIS)

    Harms, A.A.; Krenciglowa, E.M.


    The role of chain carriers as contributors to multiplicative closed cycles in advanced fusion fuels is examined. Emphasis is placed on rate processes which can be used to characterize critical/supercritical/subcritical tendencies of arbitrary closed fusion cycles. Temporal trajectories for the chain carriers which describe both increasing and decreasing multiplicative processes have been found to exist and identified according to their fusion fuel cycle characteristics. Practical criteria to ensure the attainment of steady-state fusion reaction processes have been formulated in terms of fusion reaction rate relationships. (author)

  17. Tangled nonlinear driven chain reactions of all optical singularities (United States)

    Vasil'ev, V. I.; Soskin, M. S.


    Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

  18. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)


    Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...

  19. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna


    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  20. A Double Polymerase Chain Reaction Method for Detecting African ...

    African Journals Online (AJOL)

    Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.

  1. Role of Polymerase Chain Reaction (PCR) in the detection of ...

    African Journals Online (AJOL)

    Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...

  2. Polymerase Chain Reaction (PCR) provides a superior tool for the ...

    African Journals Online (AJOL)

    Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...

  3. Polymerase chain reaction for the detection of Mycobacterium leprae

    NARCIS (Netherlands)

    Hartskeerl, R. A.; de Wit, M. Y.; Klatser, P. R.


    A polymerase chain reaction (PCR) using heat-stable Taq polymerase is described for the specific detection of Mycobacterium leprae, the causative agent of leprosy. A set of primers was selected on the basis of the nucleotide sequence of a gene encoding the 36 kDa antigen of M. leprae. With this set

  4. Polymerase chain reaction versus enzyme-linked immunosorbent ...

    African Journals Online (AJOL)

    Polymerase chain reaction versus enzyme-linked immunosorbent assay in detection of Chlamydia trachomatis infection among gynaecological patients in southwestern Nigeria. ... Socio-demographic bio-data and gynaecological history were obtained with questionnaire; data was analyzed using SPSS version 20.0.


    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...


    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  7. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi


    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  8. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend


    the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

  9. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend


    the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples......Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... not detect Chlamydia trachomatis after sufficient antibiotic treatment of the chlamydial infections....

  10. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe


    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his s...... citation network. The effect is discussed using innovation decision process theory as a point of departure to identify the factors that created a bandwagon effect leading to the reported observations....... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  11. Brucella contamination in raw milk by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili


    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

  12. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid (United States)

    Nasarabadi, Shanavaz [Livermore, CA


    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  13. Supply chain management under fuzziness recent developments and techniques

    CERN Document Server

    Öztayşi, Başar


    Supply Chain Management Under Fuzziness presents recently developed fuzzy models and techniques for supply chain management. These include: fuzzy PROMETHEE, fuzzy AHP, fuzzy ANP, fuzzy VIKOR, fuzzy DEMATEL, fuzzy clustering, fuzzy linear programming, and fuzzy inference systems. The book covers both practical applications and new developments concerning these methods. This book offers an excellent resource for researchers and practitioners in supply chain management and logistics, and will provide them with new suggestions and directions for future research. Moreover, it will support graduate students in their university courses, such as specialized courses on supply chains and logistics, as well as related courses in the fields of industrial engineering, engineering management and business administration.

  14. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin


    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  15. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries. (United States)

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  16. A nonsense mutation causing decreased levels of insulin receptor mRNA: Detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction

    International Nuclear Information System (INIS)

    Kadowaki, T.; Kadowaki, H.; Taylor, S.I.


    Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. The authors have studied a patient with leprechaunism (leprechaun/Minn-1), a genetic syndrome associated with intrauterine growth retardation and extreme insulin resistance. Genomic DNA from the patient was amplified by the polymerase chain reaction catalyzed by Thermus aquaticus (Taq) DNA polymerase, and the amplified DNA was directly sequenced. A nonsense mutations was identified at codon 897 in exon 14 in the paternal allele of the patient's insulin receptor gene. Levels of insulin receptor mRNA are decreased to <10% of normal in Epstein-Barr virus-transformed lymphoblasts and cultured skin fibroblasts from this patient. Thus, this nonsense mutation appears to cause a decrease in the levels of insulin receptor mRNA. In addition, they have obtained indirect evidence that the patient's maternal allele of the insulin receptor gene contains a cis-acting dominant mutation that also decreases the level of mRNA, but by a different mechanism. The nucleotide sequence of the entire protein-coding domain and the sequences of the intron-exon boundaries for all 22 exons of the maternal allele were normal. Presumably, the mutation in the maternal allele maps elsewhere in the insulin receptor gene. Thus, they conclude that the patient is a compound heterozygote for two cis-acting dominant mutations in the insulin receptor gene: (i) a nonsense mutation in the paternal allel that reduces the level of insulin receptor mRNA and (ii) an as yet unidentified mutation in the maternal allele that either decreases the rate of transcription or decreases the stability of the mRNA

  17. Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

    International Nuclear Information System (INIS)

    Leone, S.R.


    Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C 2 H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH 3 ; and ammonia, which produces NH 2 . In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

  18. Exploiting Fission Chain Reaction Dynamics to Image Fissile Materials (United States)

    Chapman, Peter Henry

    Radiation imaging is one potential method to verify nuclear weapons dismantlement. The neutron coded aperture imager (NCAI), jointly developed by Oak Ridge National Laboratory (ORNL) and Sandia National Laboratories (SNL), is capable of imaging sources of fast (e.g., fission spectrum) neutrons using an array of organic scintillators. This work presents a method developed to discriminate between non-multiplying (i.e., non-fissile) neutron sources and multiplying (i.e., fissile) neutron sources using the NCAI. This method exploits the dynamics of fission chain-reactions; it applies time-correlated pulse-height (TCPH) analysis to identify neutrons in fission chain reactions. TCPH analyzes the neutron energy deposited in the organic scintillator vs. the apparent neutron time-of-flight. Energy deposition is estimated from light output, and time-of-flight is estimated from the time between the neutron interaction and the immediately preceding gamma interaction. Neutrons that deposit more energy than can be accounted for by their apparent time-of-flight are identified as fission chain-reaction neutrons, and the image is reconstructed using only these neutron detection events. This analysis was applied to measurements of weapons-grade plutonium (WGPu) metal and 252Cf performed at the Nevada National Security Site (NNSS) Device Assembly Facility (DAF) in July 2015. The results demonstrate it is possible to eliminate the non-fissile 252Cf source from the image while preserving the fissileWGPu source. TCPH analysis was also applied to additional scenes in which theWGPu and 252Cf sources were measured individually. The results of these separate measurements further demonstrate the ability to remove the non-fissile 252Cf source and retain the fissileWGPu source. Simulations performed using MCNPX-PoliMi indicate that in a one hour measurement, solid spheres ofWGPu are retained at a 1sigma level for neutron multiplications M -˜ 3.0 and above, while hollowWGPu spheres are

  19. Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction. (United States)

    Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q


    The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.

  20. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study. (United States)

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T


    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  1. Polymerase chain reaction: Theory, practice and application: A review

    Directory of Open Access Journals (Sweden)

    S E Atawodi


    Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

  2. Development of the polymerase chain reaction for diagnosis of chancroid. (United States)

    Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R


    The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

  3. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes. (United States)

    Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry


    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

  4. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed


    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  5. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia. (United States)

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti


    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  6. Markov chain aggregation and its applications to combinatorial reaction networks. (United States)

    Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz


    We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.

  7. Detection of clonal immunoglobulin heavy chain gene rearrangements by the polymerase chain reaction and capillary gel electrophoresis. (United States)

    Fan, Hongxin; Robetorye, Ryan S


    Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.


    Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A


    Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

  9. Renormalization group decimation technique for disordered binary harmonic chains

    International Nuclear Information System (INIS)

    Wiecko, C.; Roman, E.


    The density of states of disordered binary harmonic chains is calculated using the Renormalization Group Decimation technique on the displacements of the masses from their equilibrium positions. The results are compared with numerical simulation data and with those obtained with the current method of Goncalves da Silva and Koiller. The advantage of our procedure over other methods is discussed. (author)

  10. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng


    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  11. Hybridization chain reaction: a versatile molecular tool for biosensing, bioimaging, and biomedicine. (United States)

    Bi, Sai; Yue, Shuzhen; Zhang, Shusheng


    Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.

  12. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

    DEFF Research Database (Denmark)

    Blair, D.; Waycott, M.; Byrne, L.


    This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...

  13. Detecting beef meatball contamination with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hoda A.


    Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.

  14. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah


    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  15. A polymerase chain reaction strategy for the diagnosis of camelpox. (United States)

    Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar


    Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

  16. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)


    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  17. Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

    Directory of Open Access Journals (Sweden)

    Anupam Berwal


    Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

  18. A primer on on-demand polymerase chain reaction technology. (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise


    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  19. Evidence of simian retrovirus type D by polymerase chain reaction. (United States)

    Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A


    Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Reverse transcription and polymerase chain reaction: principles and applications in dentistry. (United States)

    Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth


    Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

  1. Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

    Directory of Open Access Journals (Sweden)

    Wen-Pin Chou


    Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

  2. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto


    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.


    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha


    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  4. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S


    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  5. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review. (United States)

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio


    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.

  6. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .


    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  7. The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers

    International Nuclear Information System (INIS)

    Sun Jiazhen


    Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher T g and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type

  8. Identification of duck plague virus by polymerase chain reaction (United States)

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.


    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  9. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)

    RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...

  10. The effect of composition of mixture on rate of radiation initiation of chain reactions

    International Nuclear Information System (INIS)

    Poluehktov, V.A.; Begishev, I.R.; Podkhalyuzin, A.T.; Babkina, Eh.I.; Morozov, V.A.; Shapovalov, V.V.


    The effect of the composition of starting components on the rate of a number of chain liquid-phase reactions initiated by γ-quanta of Co 60 has been investigated at constant temperature and dosage rate. In regard to 1,1-difluoroethane chlorination, cyclohexene phosphorylation and adamantane alkylation with hexafluoropropylene reactions, abnormal effect of the reagent compositions on reaction rates has been discovered. The possible radical - starting molecule complexing reaction and molecular complexing from the starting components have been considered

  11. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng; Qu, Chengke; He, Junpo


    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b

  12. Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    JANNOTTI-PASSOS Liana Konovaloff


    Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

  13. Detection and RFLP Analysis of Canine Parvovirus (CPV) DNA by Polymerase Chain Reaction (PCR) in a Dog


    ÖZKUL, Aykut


    In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...

  14. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    Directory of Open Access Journals (Sweden)

    PD Andrade


    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  15. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats. (United States)

    Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S


    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  16. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.


    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  17. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk. (United States)

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A


    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  18. Transcrição reversa na determinação da expressão do mRNA para a enzima conversora de angiotensina testicular em animais tratados com zinco Assessment of the reverse transcriptase polymerase chain reaction technique in the determination of the mRNA expression for the testicular angiotensin-converting enzyme in zinc treated rats

    Directory of Open Access Journals (Sweden)

    Gilberto Simeone Henriques


    , primer concentration, hybridization temperature and number of denaturation, hybridization and extension cycles were evaluated. For this purpose, samples of testis from Wistar rats fed a zinc containing diet were used to extract total RNA using the phenol-chloroform-isothiocyanate reaction. Stable cDNA was then generated by the reverse transcription reaction. Using specific primers, the gene of interest (testicular isoform of the angiotensin-converting enzyme and the housekeeping gene for the expression of Glyceraldehyde-3-Phosphate Dehydrogenase were amplified. The samples were then submitted to gel eletrophoresis in agarose gel, stained with ethide bromide and visualized in a UV chamber. RESULTS: The results showed that the best reaction conditions for the chain reaction by the testicular isoform polymerase of the angiotensin-converting enzyme and for Glyceraldehyde-3-Phosphate Dehydrogenase were: (1 initial cDNA concentration of 2 µg, (2 primer concentration of 200nM, (3 hybridization temperature between 57.5ºC and 60.1ºC and (4 33 cycles. CONCLUSION: It was concluded that this optimization minimized interference of the technique, contributing to the production of true, comparative data for the testicular angiotensin- converting enzyme gene expression.

  19. Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

    International Nuclear Information System (INIS)

    Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.


    The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

  20. Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences


    The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

  1. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  2. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    International Nuclear Information System (INIS)

    Garrison, W.M.


    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

  3. Investigating radical cation chain processes in the electrocatalytic Diels-Alder reaction. (United States)

    Imada, Yasushi; Okada, Yohei; Chiba, Kazuhiro


    Single electron transfer (SET)-triggered radical ion-based reactions have proven to be powerful options in synthetic organic chemistry. Although unique chain processes have been proposed in various photo- and electrochemical radical ion-based transformations, the turnover number, also referred to as catalytic efficiency, remains unclear in most cases. Herein, we disclose our investigations of radical cation chain processes in the electrocatalytic Diels-Alder reaction, leading to a scalable synthesis. A gram-scale synthesis was achieved with high current efficiency of up to 8000%. The reaction monitoring profiles showed sigmoidal curves with induction periods, suggesting the involvement of intermediate(s) in the rate determining step.

  4. Polymerase Chain Reaction (PCR) Detection Of The Genome Of ...

    African Journals Online (AJOL)

    ... cycling of virus between argasid soft ticks (Ornithodoros moubata complex) and wild ... The technique consists essentially of the enzymatic synthesis of millions of ... hybridization of specific DNA primers to the template and extension of the ...

  5. Cost analysis of real-time polymerase chain reaction microbiological diagnosis in patients with septic shock. (United States)

    Alvarez, J; Mar, J; Varela-Ledo, E; Garea, M; Matinez-Lamas, L; Rodriguez, J; Regueiro, B


    Antibiotic treatment for septic shock is generally prescribed on an empirical basis using broad-spectrum antibiotics. Molecular diagnostic techniques can detect the presence of microbial DNA in blood within a few hours and facilitate early, targeted treatment. The aim of this study was to evaluate the economic impact of a real-time polymerase chain reaction technique, LightCycler SeptiFast (LSC), in patients with sepsis. A cost-minimisation study was carried out in patients admitted with a diagnosis of severe sepsis or septic shock to the intensive care unit of a university hospital. The stay in the intensive care unit, hospital admission, 28-day and six-month mortality, and the economic cost of the clinical process were also evaluated. The study involved 48 patients in the LSC group and 54 patients in the control group. The total cost was €42,198 in the control group versus €32,228 in the LCS group with statistically significant differences (P average net saving of €9970 per patient. The mortality rate was similar in both groups. The main finding of this study was the significant economic saving afforded by the use of the LCS technique, due to the shortening of intensive care unit stay and the use of fewer antibiotics.

  6. Effect of gamma radiation on the growth of Aspergillus Flavus aflatoxins producer and on the use of polymerase chain reaction technique (PCR) in samples of maize grains artificially inoculated; Efeitos da radiacao gama no crescimento de Aspergillus flavus produtor de aflatoxinas e no emprego da tecnica da Reacao em Cadeia da Polimerase (RCP) em amostras de graos de milho inoculadas artificialmente

    Energy Technology Data Exchange (ETDEWEB)

    Aquino, Simone


    The aim of this present study was to verify the effects of gamma radiation on the growth of Aspergillus flavus Link aflatoxins producer; to demonstrate the application of Polymerase Chain Reaction (PCR) technique in the diagnostic of A. Flavus, as well to verify the effect of radiation in the profile of DNA bands. Twenty samples of grains maize with 200 g each were individually irradiated with 20 kGy, to eliminate the microbial contamination. In following, the samples were inoculated with an toxigenic A. flavus (1x10{sup 6} spores/ml), incubated for 15 days at 25 deg C with a relative humidity of around 97,5% and irradiated with 0, 2; 5 and 10 kGy. The samples, 5 to each dose of irradiation, were individually analyzed for the number of fungal cells, water activity, viability test (fluorescein diacetate and ethidium bromide), PCR and aflatoxins (AFB) detection. The results showed that the doses used were effective in reducing the number of Colony Forming Units (CFU/g) mainly the doses of 5 and 10 kGy. In addition, the viability test showed a decrease of viable cells with increase of irradiation doses. The reduction of AFB{sub 1} and AFB-2, was more efficient with the use of 2 kGy in comparison with the dose of 5 kGy, while the dose of 10 kGy, degraded the aflatoxins. Thereby, it was observed that AFB2 showed to be more radiosensitive. The use of PCR technique showed the presence of DNA bands, in all samples. (author)

  7. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.


    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  8. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction. (United States)

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo


    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  9. DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

    International Nuclear Information System (INIS)

    East, L.V.


    A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms

  10. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis. (United States)

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W


    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  11. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    International Nuclear Information System (INIS)

    Lina MR; Dadang S; Budiman Bela


    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  12. Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Stephen Duffett


    Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.

  13. Maedi in slaughtered sheep: a pathology and polymerase chain reaction study in southwestern Iran. (United States)

    Azizi, Shahrzad; Tajbakhsh, Elahe; Fathi, Farzad; Oryan, Ahmad; Momtaz, Hassan; Goodarzi, Mehdi


    Maedi-visna (MV) is an important slow viral disease of sheep leading to a progressive lymphoproliferative disease. It affects multiple organs primarily the lungs, where it causes interstitial pneumonia (maedi). In this study, the lungs of 1,000 sheep carcasses were grossly inspected and those suspected to have maedi were studied at histopathological and molecular levels. A polymerase chain reaction (PCR) technique that amplified a 291-base pair DNA in the long terminal repeat (LTR) sequence of MV provirus was conducted on all the 50 suspected lungs together with 10 normal appearing lungs as controls. Amplicons of the expected size were detected in 11 (n=11/50) suspected sheep, and one of the 10 control sheep. Histopathologic study of the pulmonary lesions of all 11 (n=11/11) positive sheep showed MV lesions, including hyperplasia of the perivascular and peribronchiolar lymphoid cells, interstitial lymphoplasmacytic infiltration and smooth muscle hyperplasia and the histopathologic findings were correlated with PCR results. In contrast, the tissue sections of control animals were almost normal at histopathological level; however, PCR technique demonstrated that one of them was affected by maedi. This study showed that the LTR-PCR had high specificity and sensitivity in diagnosis of this viral infection. This study is the first to evaluate the prevalence of MV virus infection in sheep in Iran.

  14. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Cobbs Gary


    Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the

  15. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction. (United States)

    Cobbs, Gary


    Numerous models for use in interpreting quantitative PCR (qPCR) data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the literature. They also give better estimates of

  16. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Directory of Open Access Journals (Sweden)

    Luiz Tadeu M Figueiredo


    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  17. Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates. (United States)

    Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M


    This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

  18. Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

    National Research Council Canada - National Science Library

    McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L


    ...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...

  19. Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

    DEFF Research Database (Denmark)

    Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang


    Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

  20. False-negative HIV-1 polymerase chain reaction in a 15-month-old ...

    African Journals Online (AJOL)

    Corresponding author: S Korsman ( Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. ... mismatches relative to the consensus are shown as coloured blocks. Nucleic acid numbering relative to consensus C gag p24 is ...

  1. Evaluation of a new HTLV-I/II polymerase chain reaction

    NARCIS (Netherlands)

    Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.


    AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA

  2. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.


    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal

  3. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

    NARCIS (Netherlands)

    Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.


    Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

  4. Rapid and specific identification of Yersinia pestis by using a nested polymerase chain reaction procedure.


    Campbell, J; Lowe, J; Walz, S; Ezzell, J


    We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.

  5. Animal DNA identification in food products and animal feed by real time polymerase chain reaction method

    Directory of Open Access Journals (Sweden)

    Людмила Мар’янівна Іщенко


    Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer 

  6. Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens

    NARCIS (Netherlands)

    de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.


    The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent

  7. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory (United States)

    Elkins, Kelly M.


    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  8. Real-time TaqMan polymerase chain reaction to quantify the effects ...

    African Journals Online (AJOL)

    TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...

  9. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati. (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y


    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  10. Polymerase chain Reaction in molecular biotechnology; appropriate technology for developing countries

    NARCIS (Netherlands)

    Felice, A. E.; Alshinawi, C.


    The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and

  11. Spread and epidemiology of Clostridium difficile polymerase chain reaction ribotype 027/toxinotype III in The Netherlands

    NARCIS (Netherlands)

    Goorhuis, A.; van der Kooi, T.; Vaessen, N.; Dekker, F. W.; van den Berg, R.; Harmanus, C.; van den Hof, S.; Notermans, D. W.; Kuijper, E. J.


    After reports of emerging outbreaks in Canada and the United States, Clostridium difficile-associated disease (CDAD) due to polymerase chain reaction ribotype 027 was detected in 2 medium-to-large hospitals in The Netherlands in 2005. National surveillance was initiated to investigate the spread and

  12. Emergence of Clostridium difficile infection due to a new hypervirulent strain, polymerase chain reaction ribotype 078

    NARCIS (Netherlands)

    Goorhuis, Abraham; Bakker, Dennis; Corver, Jeroen; Debast, Sylvia B.; Harmanus, Celine; Notermans, Daan W.; Bergwerff, Aldert A.; Dekker, Frido W.; Kuijper, Ed J.


    Since 2005, an increase in the prevalence of Clostridium difficile infection (CDI) due to polymerase chain reaction ribotype 078 has been noticed in The Netherlands. This strain has also been identified as the predominant strain in pigs and calves. CDI caused by type 078 was studied in relation to

  13. Case Report:False-negative HIV-1 polymerase chain reaction in a ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) testing is the gold standard for determining the HIV status in children <18 months of age. However, when clinical manifestations are not consistent with laboratory results, additional investigation is required. We report a 15-month-old HIV-exposed boy referred to our hospital after he had ...

  14. Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

    NARCIS (Netherlands)

    Hatta, Mochammad; Smits, Henk L.


    A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,


    NARCIS (Netherlands)

    Cornelissen, M. T.; van den Tweel, J. G.; Struyk, A. P.; Jebbink, M. F.; Briët, M.; van der Noordaa, J.; ter Schegget, J. T.


    The localization of human papillomavirus type 16 (HPV-16) DNA throughout the cervix uteri of women with cervical intraepithelial neoplasia (CIN) was studied by utilizing the polymerase chain reaction technique directly on histologically defined sections of paraffin-embedded cervical tissue obtained

  16. On fusion/fission chain reactions in the Fleischmann-Pons cold fusion experiment

    International Nuclear Information System (INIS)

    Anghaie, S.; Froelich, P.; Monkhorst, H.J.


    In this paper the possibility of fusion/fission chain reactions following d-d source reactions in electrochemical cold fusion experiments have been investigated. The recycling factors for the charged particles in fusion reactions with consumable nuclei deuteron, 6 Li nd 7 Li, are estimated. It is concluded that, based on the established nuclear fusion cross sections and electronic stopping power, the recycling factor is four to five orders of magnitude less than required for close to critical conditions. It is argued that the cross generation of charged particles by neutrons does not play a significant role in this process, even if increased densities at the surface of electrodes do occur

  17. Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil. (United States)

    Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H


    A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

  18. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo


    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  19. Trends and advances in food analysis by real-time polymerase chain reaction. (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin


    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  20. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics (United States)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David


    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  1. Introduction of a dermatophyte polymerase chain reaction assay to the diagnostic mycology service in Scotland. (United States)

    Alexander, C L; Shankland, G S; Carman, W; Williams, C


    Dermatophytes are the major cause of superficial mycoses in samples submitted to Clinical Mycology, Glasgow. The most prevalent species is Trichophyton rubrum as identified classically by microscopy and culture. Recent advances in polymerase chain reaction (PCR) technology were examined for the feasibility of introducing a T. rubrum real-time PCR assay into a routine diagnostic service. To improve the diagnostic mycology service by the introduction of a real-time PCR test for T. rubrum. The DNA from 4972 nail and skin samples was obtained using the Qiagen QIAsymphony automated extractor. This DNA was subjected to real-time PCR using T. rubrum-specific primers and a probe. During phase 1 of the study, 862 samples were analysed; 446 of 470 specimens that grew T. rubrum were detected by PCR. Out of 4110 samples analysed during phase 2, 753 T. rubrum infections were diagnosed and reported within 72 h. A total of 3357 samples were negative for a fungal infection by PCR and microscopy; these were also reported within 72 h. A vast reduction in the turnaround times can be achieved using this technique as opposed to classical methods. Samples which are PCR negative but microscopy positive are still subjected to culture. Screening samples for their suitability for PCR prior to processing eliminates the application of PCR for T. rubrum on inappropriate samples such those from the scalp or pityriasis versicolor. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

  2. Polymerase chain reaction detection of retinoblastoma gene deletions in paraffin-embedded mouse lung adenocarcinomas

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.


    A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

  3. Pouched Rats’ Detection of Tuberculosis in Human Sputum: Comparison to Culturing and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Amanda Mahoney


    Full Text Available Setting. Tanzania. Objective. To compare microscopy as conducted in direct observation of treatment, short course centers to pouched rats as detectors of Mycobacterium tuberculosis. Design. Ten pouched rats were trained to detect tuberculosis in sputum using operant conditioning techniques. The rats evaluated 910 samples previously evaluated by smear microscopy. All samples were also evaluated through culturing and multiplex polymerase chain reaction was performed on culture growths to classify the bacteria. Results. The patientwise sensitivity of microscopy was 58.0%, and the patient-wise specificity was 97.3%. Used as a group of 10 with a cutoff (defined as the number of rat indications to classify a sample as positive for Mycobacterium tuberculosis of 1, the rats increased new case detection by 46.8% relative to microscopy alone. The average samplewise sensitivity of the individual rats was 68.4% (range 61.1–73.8%, and the mean specificity was 87.3% (range 84.7–90.3%. Conclusion. These results suggest that pouched rats are a valuable adjunct to, and may be a viable substitute for, sputum smear microscopy as a tuberculosis diagnostic in resource-poor countries.

  4. Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis. (United States)

    Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay


    Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.

  5. Real-Time Polymerase Chain Reaction Quantification of Phytophthora capsici in Different Pepper Genotypes. (United States)

    Silvar, C; Díaz, J; Merino, F


    ABSTRACT Reliable and sensitive quantification of Phytophthora capsici in pepper plants is of crucial importance in managing the multiple syndromes caused by this pathogen. A real-time polymerase chain reaction (PCR) assay was developed for the determination of P. capsici in pepper tissues. DNA levels of a highly virulent and a less virulent isolate were measured in different pepper genotypes with varying degrees of resistance. Using SYBR Green and specific primers for P. capsici, the minimal amount of pathogen DNA quantified was 10 pg. Pathogen DNA was recorded as early as 8 h postinoculation. Thereafter, the increase was rapid in susceptible cultivars and slower in resistant ones. The amount of pathogen DNA quantified in each pepper genotype correlated with susceptibility to Phytophthora root rot. Likewise, there was a relationship between the virulence of the pathogen and the degree of colonization. Differences also were found in oomycete amount among pepper tissues, with maximal pathogen biomass occurring in stems. The real-time PCR technique developed in this study was sensitive and robust enough to assess both pathogen development and resistance to Phytophthora root rot in different pepper genotypes.

  6. Chain reaction

    International Nuclear Information System (INIS)

    Newby-Fraser, A.R.


    This book covers a review of twenty years of nuclear research and development by the South Africa Atomic Energy Board. A wide spectrum of topics is covered, for example, uranium mining and production, the construction of the Safari-1 reactor as well as the Koeberg-1 reactor, and the irradiation of food and medical supplies

  7. Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species. (United States)

    Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein


    The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

  8. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan


    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......Hypochlorous acid (HOCl) is a potent oxidant, which is produced in vivo by activated phagocytes. This compound is an important antibacterial agent, but excessive or misplaced production has been implicated in a number of human diseases, including atherosclerosis, arthritis, and some cancers....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

  9. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Vinay, E-mail:; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)


    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  10. Supply chain simulation tools and techniques: a survey

    NARCIS (Netherlands)

    Kleijnen, J.P.C.


    The main contribution of this paper is twofold: it surveys different types of simulation for supply chain management; it discusses several methodological issues. These different types of simulation are spreadsheet simulation, system dynamics, discrete-event simulation and business games. Which

  11. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.


    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  12. Synthesis and Intramolecular [4+2] Cycloaddition Reactions of 4-Pyridazinecarbonitriles with Alkyne Side Chains

    Directory of Open Access Journals (Sweden)

    Norbert Haider


    Full Text Available The preparation of a series of new 3-(alkynyl-X-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2] cycloaddition reaction.

  13. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    Directory of Open Access Journals (Sweden)

    V.K. Jain


    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  14. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    Directory of Open Access Journals (Sweden)

    Laurent Dacheux


    Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

  15. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection. (United States)

    Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve


    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  16. Introduction;Commemorating the first self-sustaining nuclear chain reaction on 2 December 1942

    Energy Technology Data Exchange (ETDEWEB)

    Eklund, S [International Atomic Energy Agency, Vienna (Austria)


    On the occasion of the 20th anniversary of the conducting of the first self-sustaining nuclear chain reaction and following development of nuclear reactors, the article reviews the work and scientific development behind this achievement. The impact of atomic energy on economics, benefits of nuclear reactors for electricity production and the by-product - radio isotopes, used in different areas such as industry, medicine, agriculture etc. are pointed out

  17. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction


    Harmey, Judith H.; Harmey, Matthew A.


    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  18. Polymerase chain reaction for detection of invasive Shigella flexneri in food.


    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E


    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...

  19. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J


    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  20. MODESTY, Statistical Reaction Cross-Sections and Particle Spectra in Decay Chain

    International Nuclear Information System (INIS)

    Mattes, W.


    1 - Nature of the physical problem solved: Code MODESTY calculates all energetically possible reaction cross sections and particle spectra within a nuclear decay chain. 2 - Method of solution: It is based on the statistical nuclear model following the method of Uhl (reference 1) where the optical model is used in the calculation of partial widths and the Blatt-Weisskopf single particle model for gamma rays

  1. Theoretical study of chain transfer to solvent reactions of alkyl acrylates. (United States)

    Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud


    This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.


    Directory of Open Access Journals (Sweden)

    Honcharova S.Y.


    Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

  3. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    International Nuclear Information System (INIS)

    Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.


    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  4. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman


    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  5. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.


    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  6. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction (United States)

    Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.


    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  7. Polymerase chain reaction-based denaturing gradient gel electrophoresis in the evaluation of oral microbiota. (United States)

    Li, Y; Saxena, D; Barnes, V M; Trivedi, H M; Ge, Y; Xu, T


    Clinical evaluation of oral microbial reduction after a standard prophylactic treatment has traditionally been based on bacterial cultivation methods. However, not all microbes in saliva or dental plaque can be cultivated. Polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE) is a cultivation-independent molecular fingerprinting technique that allows the assessment of the predominant bacterial species present in the oral cavity. This study sought to evaluate the oral microbial changes that occurred after a standard prophylactic treatment with a conventional oral care product using PCR-DGGE. Twelve healthy adults participated in the study. Pooled plaque samples were collected at baseline, 24 h after prophylaxis (T1), and 4 days after toothbrushing with fluoride toothpaste (T4). The total microbial genomic DNA of the plaque was isolated. PCR was performed with a set of universal bacterial 16S rDNA primers. The PCR-amplified 16S rDNA fragments were separated by DGGE. The effects of the treatment and of dental brushing were assessed by comparing the PCR-DGGE fingerprinting profiles. The mean numbers of detected PCR amplicons were 22.3 +/- 6.1 for the baseline group, 13.0 +/- 3.1 for the T1 group, and 13.5 +/- 4.3 for the T4 group; the differences among the three groups were statistically significant (P < 0.01). The study also found a significant difference in the mean similarities of microbial profiles between the baseline and the treatment groups (P < 0.001). PCR-based DGGE has been shown to be an excellent means of rapidly and accurately assessing oral microbial changes in this clinical study.

  8. Evaluation of the LTQ-Orbitrap mass spectrometer for the analysis of polymerase chain reaction products. (United States)

    Manduzio, Hélène; Ezan, Eric; Fenaille, François


    We have investigated the potential and robustness of the off-line coupling of polymerase chain reaction (PCR) with electrospray ionization mass spectrometry (ESI-MS), for further applications in the screening of single-nucleotide polymorphisms (SNPs). This was based on recently reported data demonstrating that anion-exchange solid-phase extraction was the most efficient technique for efficiently desalting PCR products, with a recovery of ∼70%. Results showed that this purification approach efficiently removes almost all the chemicals commonly added to PCR buffers. ESI-MS analysis of a model 114-bp PCR product performed on the LTQ-Orbitrap instrument demonstrated that detection limits in the nM range along with an average mass measurement uncertainty of 9.15 ± 7.11 ppm can be routinely obtained using an external calibration. The PCR/ESI-MS platform was able to detect just a few copies of a targeted oligonucleotide. However, it was shown that if two PCR products are present in a mixture in a ratio higher than 10 to 1, the lower abundance one might not be reproducibly detected. Applications to SNPs demonstrated that an LTQ-Orbitrap with a resolution of 30 000 (at m/z 400) easily identified a single (A ↔ G) switch, i.e. a 16 Da difference, in binary mixtures of ∼ 35 kDa PCR products. Complementary experiments also showed that the combination of endonucleases and ESI-MS could be used to confirm base composition and sequence, and thus to screen for unknown polymorphisms in specific sequences. For example, a single (T ↔ A) switch (9 Da mass difference) was successfully identified in a 114-bp PCR product. Copyright © 2010 John Wiley & Sons, Ltd.

  9. Bounding spectral gaps of Markov chains: a novel exact multi-decomposition technique

    International Nuclear Information System (INIS)

    Destainville, N


    We propose an exact technique to calculate lower bounds of spectral gaps of discrete time reversible Markov chains on finite state sets. Spectral gaps are a common tool for evaluating convergence rates of Markov chains. As an illustration, we successfully use this technique to evaluate the 'absorption time' of the 'Backgammon model', a paradigmatic model for glassy dynamics. We also discuss the application of this technique to the 'contingency table problem', a notoriously difficult problem from probability theory. The interest of this technique is that it connects spectral gaps, which are quantities related to dynamics, with static quantities, calculated at equilibrium

  10. Bounding spectral gaps of Markov chains: a novel exact multi-decomposition technique

    Energy Technology Data Exchange (ETDEWEB)

    Destainville, N [Laboratoire de Physique Theorique - IRSAMC, CNRS/Universite Paul Sabatier, 118, route de Narbonne, 31062 Toulouse Cedex 04 (France)


    We propose an exact technique to calculate lower bounds of spectral gaps of discrete time reversible Markov chains on finite state sets. Spectral gaps are a common tool for evaluating convergence rates of Markov chains. As an illustration, we successfully use this technique to evaluate the 'absorption time' of the 'Backgammon model', a paradigmatic model for glassy dynamics. We also discuss the application of this technique to the 'contingency table problem', a notoriously difficult problem from probability theory. The interest of this technique is that it connects spectral gaps, which are quantities related to dynamics, with static quantities, calculated at equilibrium.

  11. Kinetics of the Br2-CH3CHO Photochemical Chain Reaction (United States)

    Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.


    Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

  12. Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes (United States)

    Denisov, E. T.; Shestakov, A. F.


    Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

  13. Standardization and application of real-time polymerase chain reaction for rapid detection of bluetongue virus

    Directory of Open Access Journals (Sweden)

    I. Karthika Lakshmi


    Full Text Available Aim: The present study was designed to standardize real-time polymerase chain reaction (PCR for detecting the bluetongue virus from blood samples of sheep collected during outbreaks of bluetongue disease in the year 2014 in Andhra Pradesh and Telangana states of India. Materials and Methods: A 10-fold serial dilution of Plasmid PUC59 with bluetongue virus (BTV NS3 insert was used to plot the standard curve. BHK-21 and KC cells were used for in vitro propagation of virus BTV-9 at a TCID50/ml of 105 ml and RNA was isolated by the Trizol method. Both reverse transcription -PCR and real-time PCR using TaqMan probe were carried out with RNA extracted from virus-spiked culture medium and blood to compare the sensitivity by means of finding out the limit of detection (LoD. The results were verified by inoculating the detected and undetected dilutions onto cell cultures with further cytological (cytopathic effect and molecular confirmation (by BTV-NS1 group-specific PCR. The standardized technique was then applied to field samples (blood for detecting BTV. Results: The slope of the standard curve obtained was -3.23, and the efficiency was 103%. The LoD with RT-PCR was 8.269Ex103 number of copies of plasmid, whereas it was 13 with real-time PCR for plasmid dilutions. Similarly, LoD was determined for virus-spiked culture medium, and blood with both the types of PCR and the values were 103 TCID 50/ml and 104 TCID 50/ml with RT-PCR and 10° TCID 50/ml and 102 TCID 50/ml with real-time PCR, respectively. The standardized technique was applied to blood samples collected from BTV suspected animals; 10 among 20 samples were found positive with Cq values ranging from 27 to 39. The Cq value exhibiting samples were further processed in cell cultures and were confirmed to be BT positive. Likewise, Cq undetected samples on processing in cell cultures turned out to be BTV negative. Conclusion: Real-time PCR was found to be a very sensitive as well as reliable method


    Directory of Open Access Journals (Sweden)

    Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.


    Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms.  Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354.  The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.

  15. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia]. (United States)

    Harano, K; Harano, T; Kushida, Y; Ueda, S


    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  16. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction (United States)

    Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka


    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

  17. A New Technique for SET Pulse Width Measurement in Chains of Inverters Using Pulsed Laser Irradiation

    International Nuclear Information System (INIS)

    Ferlet-Cavrois, V.; Fel, N.; Gaillardin, M.; Baggio, J.; Girard, S.; Flament, O.; Paillet, P.; McMorrow, D.; Melinger, J. S.; Kobayashi, D.; Hirose, K.; Saito, H.; Pouget, V.; Essely, F.; Schwank, J. R.; Flores, R. S.; Dodd, P. E.; Shaneyfelt, M. R.


    A new technique is developed to measure precisely and accurately the width of propagating voltage transients induced by irradiation of inverter chains. The technique is based on measurement of the supply current in a detection inverter, and permits a direct determination of the transient width with a 50 GHz bandwidth. (authors)

  18. New technique of uterine body carcinoma brachytherapy. Pt. 1. Radium chain

    Energy Technology Data Exchange (ETDEWEB)

    Rattka, P.; Jedrus, S. (Instytut Onkologii, Gliwice (Poland))


    A simple technique of uterine cavity tamponade with radium charges arranged in a chain has been evolved, establishing at the same time an optimal dose on the basis of computer calculations. Own experiences with the use of this technique in 31 patients are presented.

  19. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  20. Evaluation of the polymerase chain reaction in the diagnosis of cutaneous leishmaniasis due to Leishmania major: a comparison with direct microscopy of smears and sections from lesions

    DEFF Research Database (Denmark)

    Andresen, K; Gaafar, A; El-Hassan, A M


    We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....

  1. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    International Nuclear Information System (INIS)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping


    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling

  2. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction. (United States)

    Guthrie, J N; Moriarty, D J; Blackall, L L


    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  3. Comparison of isoelectric focusing and polymerase chain reaction for the detection of β-lactamases

    Directory of Open Access Journals (Sweden)

    Sharma J


    Full Text Available Extended spectrum β-lactamases (ESBLs have been observed in virtually all the species of family Enterobacteriaceae. Threat posed by antibiotic resistance because of ESBLs is more serious as a number of technical problems are associated with the detection of these enzymes. Although a number of detection methods have been designed for ESBLs, every method has its own benefits and shortcomings as well. In earlier days, isoelectric focusing (IEF was used as the gold standard for ESBL detection. This study was undertaken to compare IEF with polymerase chain reaction, a method which has been extensively used for ESBL detection these days.

  4. Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats. (United States)

    Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo


    Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

  5. Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans. (United States)

    Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck


    Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

  6. Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR). (United States)

    Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D


    A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

  7. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J


    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  8. Acyl chains of phospholipase D transphosphatidylation products in Arabidopsis cells: a study using multiple reaction monitoring mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Dominique Rainteau

    Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.

  9. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO


    reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...

  10. Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood. (United States)

    Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F


    Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

  11. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini


    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  12. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    Sudrajat, Dadang; R, Maria Lina; Suhadi, F.


    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  13. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions (United States)

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory


    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  14. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom


    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  15. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana


    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  16. Multifunctional Nanomaterials Utilizing Hybridization Chain Reaction for Molecular Diagnostics and Bioanalytical Applications (United States)

    Rana, Md. Muhit

    DNA nanotechnology has shown great promise in molecular diagnostic, bioanalytical and biomedical applications. The great challenge of detecting target analytes, biomarkers and small molecules, in molecular diagnostics is low yield sensitivity. To address this challenge, different nanomaterials have been used for a long time and to date there is no such cost-effective bioanalytical technique which can detect these target biomarkers (DNA, RNA, circulating DNA/miRNA) or environmental heavy metal ions (Hg2+ and Ag+) in a cost-effective and efficient manner. Herein, we initially discuss two possible bioanalytical detection methods- a) colorimetric and b) fluorometric assays which are very popular nowadays due to their distinctive spectroscopic properties. Finally, we report the promising colorimetric assay using a novel DNA based amplification strategy know as hybridization chain reaction (HCR) for potential application in the visual detection of low copies of biomarkers (miRNAs as little as 20 femtomole in an RNA pool and cell extracts in seven different combinations and Ebola virus DNA as low as 400 attomoles in liquid biopsy mimics in sixteen different combinations), environmental and biological heavy metal ions (mercury and silver concentrations as low as 10 pM in water, soil and urine samples) and also successfully applied to a molecular logic gate operation to distinguish OR and AND logic gates. No results showed any false-positive or false-negative information. On the other hand, we also discuss the future possibilities of HCR amplification technology, which is very promising for fluorometric bioanalysis. The HCR based nanoprobe technology has numerous remarkable advantages over other methods. It is re-programmable, simple, inexpensive, easy to assemble and operate and can be performed with visual and spectroscopic read-outs upon recognition of the target analytes. This rapid, specific and sensitive approach for biomarkers and heavy metal ion detection generates

  17. Effects of medium-chain triacylglycerols on Maillard reaction in bread baking. (United States)

    Toyosaki, Toshiyuki


    To investigate the relationship between the fatty acid composition of medium-chain triacylglycerols (MCTs) and the Maillard reaction induced during bread baking, a comparison with various fatty acids was conducted. Saturated fatty acids had a remarkable inhibitory effect on the amount of advanced glycation end products (AGEs) generated from the Maillard reaction in bread baking compared to unsaturated fatty acids. The amount of AGEs produced by each fatty acid (mg kg -1 ) was as follows: C18:0, 18.7; C12:0, 35.2; C16:0, 21.4; C18:0, 38.2; C18:1, 68.7; C18:2, 80.1; C20:4, 80.8; C22:4, 89.8. Saturated fatty acids were possibly involved in the Maillard reaction and, as a result, acted to inhibit it. In the case of unsaturated fatty acids, amounts of AGEs during the Maillard reaction in baking tended to increase as the degree of unsaturation increased. In other words, there was a positive correlation between the degree of unsaturation and the amount of AGEs. It was also confirmed that the air pore distribution in baked bread was closely related to AGEs. These results led us to conclude that the fatty acid composition of the added lipids also influences properties that determine the tastiness of bread. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  18. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.


    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  19. Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis. (United States)

    Shoughy, Samir S; Alkatan, Hind M; Al-Abdullah, Abdulelah A; El-Khani, Albarah; de Groot-Mijnes, Jolanda Df; Tabbara, Khalid F


    Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis. A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and rubella virus. There were six male and six female patients. The mean age was 43 years, with an age range of 11-82 years. All 12 cases presented with unilateral anterior uveitis. In four (33%) patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein-Barr virus. Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis.


    Directory of Open Access Journals (Sweden)

    Sefrita Tri Utami


    Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR

  1. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    International Nuclear Information System (INIS)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.


    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

  2. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.


    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E


    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  3. Reaction of oxygen with the respiratory chain in cells and tissues. (United States)

    Chance, B


    This paper considers the way in which the oxygen reaction described by Dr. Nicholls and the ADP control reactions described by Dr. Racker could cooperate to establish a purposeful metabolic control phenomenon in vivo. This has required an examination of the kinetic properties of the respiratory chain with particular reference to methods for determinations of oxygen affinity (K(m)). The constant parameter for tissue respiration is k(1), the velocity constant for the reaction of oxygen with cytochrome oxidase. Not only is this quantity a constant for a particular tissue or mitochondria; it appears to vary little over a wide range of biological material, and for practical purposes a value of 5 x 10(7) at 25 degrees close to our original value (20) is found to apply with adequate accuracy for calculation of K(m) for mammalia. The quantity which will depend upon the tissue and its metabolic state is the value of K(m) itself, and K(m) may be as large as 0.5 microM and may fall to 0.05 microM or less in resting, controlled, or inhibited states. The control characteristic for ADP may depend upon the electron flux due to the cytochrome chain (40); less ADP is required to activate the slower electron transport at lower temperatures than at higher temperatures. The affinity constants for ADP control appear to be less dependent upon substrate supplied to the system. The balance of ADP and oxygen control in vivo is amply demonstrated experimentally and is dependent on the oxygen concentration as follows. In the presence of excess oxygen, control may be due to the ADP or phosphate (or substrate), and the kinetics of oxygen utilization will be independent of the oxygen concentration. As the oxygen concentration is diminished, hemoglobin becomes disoxygenated, deep gradients of oxygen concentration develop in the tissue, and eventually cytochrome oxidase becomes partially and then completely reduced. DPN at this point will become reduced and the electron flow diminished. The rate

  4. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes


    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  5. Polymerase Chain Reaction targeting insertion sequence IS6110 for the diagnosis of pulmonary tuberculosis among Sudanese children and young adults

    Directory of Open Access Journals (Sweden)

    Ahmed L Osman


    All children participating in the study were subjected to the Mantoux test after obtaining appropriate consent injected by 5 tuberculin units of tuberculin purified protein derivative, and the results were recorded after three days. Specimens were decontaminated and inoculated on Lowenstein–Jensen media according to the modified Petroff's method. Two smears were prepared and stained by Ziehl–Neelsen stain and Auramine fluorescent dye; bacterial DNA was extracted from each specimen by using phenol chloroform method, and then the Polymerase Chain Reaction technique was adopted to detect Insertion Sequence IS6110 gene of MTB in these specimens. This study showed that the positive results for TST, ZN, Auramine, Culture and PCR were 86 (43.7%, 16 (8.1%, 22 (11.2%, 32 (16.2% and 35(17.8%, respectively. The study concluded that the PCR technique is the most sensitive and specific technique for a quick identification of MTB in gastric lavage and sputum from children who are unable to expectorate a good quality sputum sample or who are diagnosed as negative using conventional diagnostic methods.

  6. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria


    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  7. Identification of aflatoxigenic fungi using polymerase chain reaction-based assay

    Directory of Open Access Journals (Sweden)

    Šošo Vladislava M.


    Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009

  8. Detection of clonal T-cell receptor beta and gamma chain gene rearrangement by polymerase chain reaction and capillary gel electrophoresis. (United States)

    Fan, Hongxin; Robetorye, Ryan S


    Although established diagnostic criteria exist for mature T-cell neoplasms, a definitive diagnosis of a T-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because T-cell malignancies contain identically rearranged T-cell receptor gamma (TCRG) and/or beta (TCRB) genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal T-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal TCRB and TCRG gene rearrangements (TCRB and TCRG PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol for the TCRB assay involves the use of three separate multiplex master mix tubes. Tubes A and B target the framework regions within the variable and joining regions of the TCRB gene, and Tube C targets the diversity and joining regions of the TCRB gene. The core protocol for the TCRG assay utilizes two multiplex master mix tubes (Tubes A and B) that target the variable and joining regions of the TCRG gene. Use of the five BIOMED-2 TCRB and TCRG PCR multiplex tubes in parallel can detect approximately 94% of clonal TCR gene rearrangements.

  9. Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections. (United States)

    Siqueira, José F; Rôças, Isabela N


    Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and

  10. Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma. (United States)

    Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels


    Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

  11. Analytic study of the chain dark decomposition reaction of iodides - atomic iodine donors - in the active medium of a pulsed chemical oxygen-iodine laser: 1. Criteria for the development of the branching chain dark decomposition reaction of iodides

    International Nuclear Information System (INIS)

    Andreeva, Tamara L; Kuznetsova, S V; Maslov, Aleksandr I; Sorokin, Vadim N


    The scheme of chemical processes proceeding in the active medium of a pulsed chemical oxygen-iodine laser (COIL) is analysed. Based on the analysis performed, the complete system of differential equations corresponding to this scheme is replaced by a simplified system of equations describing in dimensionless variables the chain dark decomposition of iodides - atomic iodine donors, in the COIL active medium. The procedure solving this system is described, the basic parameters determining the development of the chain reaction are found and its specific time intervals are determined. The initial stage of the reaction is analysed and criteria for the development of the branching chain decomposition reaction of iodide in the COIL active medium are determined. (active media)

  12. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.


    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  13. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P


    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  14. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R


    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  15. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina


    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  16. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. (United States)

    Ririe, K M; Rasmussen, R P; Wittwer, C T


    A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

  17. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J


    was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  18. A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

    Directory of Open Access Journals (Sweden)

    Elisa Morganti


    Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

  19. Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis. (United States)

    Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette


    Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

  20. Chain reaction. History of the atomic bomb; Kettenreaktion. Die Geschichte der Atombombe

    Energy Technology Data Exchange (ETDEWEB)

    Mania, Hubert


    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  1. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng


    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

  2. Specific Identification of Biomphalaria tenagophila and Biomphalaria occidentalis Populations by the Low Stringency Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Edina Rodrigues Pires


    Full Text Available Although Biomphalaria occidentalis and B. tenagophila are indistinguishable on the basis of shell morphology and the majority of their genital organs, only the latter is susceptible to infection with Schistosoma mansoni. Thus, the identification of these species is fundamental to epidemiological studies of schistosomiasis. Here we describe a simple and rapid method for differentiating B. tenagophila from B. occidentalis based on low stringency polymerase chain reaction and using a pair of primers specific for the amplification of the 18S rRNA gene. Analysis of the low stringency product profiles of populations of these snails from different geographical regions confirmed this approach as being applicable to the identification of B. tenagophila and B. occidentalis in cases where classical morphology is inconclusive

  3. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi


    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  4. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard


    Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...... before or after the initial culture-positive sample. We repeated the process for those with ≥2 samples within 28 days. The primary outcome was PCR-negative, smear-positive patients. Results. We included 53 533 sputum samples from 20 928 individuals; 1636 had culture-confirmed tuberculosis. Of these, 856...

  5. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.


    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  6. Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS


    Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber

  7. Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid. (United States)

    Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François


    To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.

  8. Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy. (United States)

    Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin


    A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    International Nuclear Information System (INIS)

    Liu Dayu; Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei; Zhou Xiaomian


    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

  10. Reaction pathway towards formation of cobalt single chain magnets and nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Balaji, G.; Desilva, Rohini M.; Palshin, V. [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States); Desilva, N. [Department of Chemistry, Louisiana State University, Baton Rouge, LA 70803 (United States); Palmer, G. [Department of Biochemistry and Cell Biology, Rice University, MS 140, 6100 Main street, Houston, TX 77251 (United States); Kumar, Challa S.S.R., E-mail: ckumar1@lsu.ed [Center for Advanced Microstructures and Devices, Louisiana State University, 6980 Jefferson Highway, Baton Rouge, LA 70806 (United States)


    With the advent of molecular magnets the quest for suitable high density magnetic storage materials has fuelled further research in this area. Here in this report, we present a detailed mechanistic investigation of thermal decomposition of cyclopentadienyl cobalt [CoCp(CO){sub 2}] precursor where Cp is the cyclopentadienyl moiety. The reaction revealed the formation of cobalt nanoparticles (Co-NPs) through an isolable reaction intermediate characterized as a Single Chain Magnet (SCM), [Co(Cp){sub 2}]{sub 2}CoCl{sub 4} (1). The SQUID magnetic measurements showed the presence of very strong antiferromagnetic interactions between Co{sup 2+} ions. The zero-field cooled (ZFC) and field cooled (FC) magnetization curves branch out below 5 K and there is evidence for frequency dependent complex susceptibility along with a maximum observed around 2.5 K. The optical studies indicated that the Co{sup 2+} d-d transition is influenced by the polarity of the solvents. The cobalt nanoparticles (Co-NPs) were obtained, either directly from 1 or from its precursor. They are spherical in shape with a mean size 15 nm, have fcc crystal structure and were found to be ferromagnetic at room temperature.

  11. Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis. (United States)

    Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava


    Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei


    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  13. Electrochemical detection of C-reactive protein using Copper nanoparticles and hybridization chain reaction amplifying signal. (United States)

    Zhang, Junjun; Zhang, Wenjuan; Guo, Jinjin; Wang, Junchun; Zhang, Yuzhong


    In this study, a sandwich-type electrochemical immunosensor for the detection of C-reactive protein (CRP) is described. In design, Copper nanoparticles (Cu NPs) were used for signal tag and hybridization chain reaction (HCR)amplified output signal. The immunosensor fabrication involved three steps: (i) primary antibodies (Ab 1 ) were immobilized on the surface of gold nanoparticles (Au NPs); (ii) the sandwich-type structure formation contained "primary antibodies-antigen-secondary antibodies conjugated with primer (Ab 2 -S 0 )"; and (iii) long DNA concatemers intercalating amounts of Cu NPs was linked to the sandwich-type structure via hybridization reaction. Differential pulse voltammetry (DPV) was used to record the response signal of the immunosensor in phosphate-buffered saline (PBS). Under optimal conditions, the anodic peak currents of Cu NPs at the peak potential of about 0.08V(VS.SCE) were linear with the logarithm of CRP concentration in the range of 1.0 fg mL -1 to 100 ng mL -1 with a detection limit of 0.33 fg mL -1 (at signal/noise [S/N] = 3). In addition, the practical application of immunosensor was evaluated by analyzing CRP in real human serum samples, the recoveries obtained were within 95.3%-103.8%, indicating the immunosensor possessed potential application ability for practical disease diagnosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction. (United States)

    Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František


    The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. The generation of radiolabeled DNA and RNA probes with polymerase chain reaction

    International Nuclear Information System (INIS)

    Schowalter, D.B.; Sommer, S.S.


    By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence

  16. Real-time ligation chain reaction for DNA quantification and identification on the FO-SPR. (United States)

    Knez, Karel; Spasic, Dragana; Delport, Filip; Lammertyn, Jeroen


    Different assays have been developed in the past years to meet point-of-care diagnostic tests requirements for fast and sensitive quantification and identification of targets. In this paper, we developed the ligation chain reaction (LCR) assay on the Fiber Optic Surface Plasmon Resonance (FO-SPR) platform, which enabled simultaneous quantification and cycle-to-cycle identification of DNA during amplification. The newly developed assay incorporated FO-SPR DNA melting assay, previously developed by our group. This required establishment of several assay parameters, including buffer ionic strength and thermal ramping speed as these parameters both influence the ligation enzyme performance and the hybridization yield of the gold nanoparticles (Au NPs) on the FO-SPR sensor. Quantification and identification of DNA targets was achieved over a wide concentration range with a calibration curve spanning 7 orders of magnitude and LOD of 13.75 fM. Moreover, the FO-SPR LCR assay could discriminate single nucleotide polymorphism (SNPs) without any post reaction analysis, featuring thus all the essential requirements of POC tests. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction. (United States)

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P


    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  18. Immunomagnetic separation combined with polymerase chain reaction for the detection of Alicyclobacillus acidoterrestris in apple juice.

    Directory of Open Access Journals (Sweden)

    Zhouli Wang

    Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.

  19. Polymerase chain reaction of peripheral blood as a tool for the diagnosis of visceral leishmaniasis in children

    Directory of Open Access Journals (Sweden)

    Thiago Leite Fraga


    Full Text Available The diagnosis of visceral leishmaniasis (VL generally requires the use of invasive tests for the collection of infected tissue (aspirates of bone marrow, spleen, liver or lymph nodes. This difficulty has led to the search for safer and less painful techniques to confirm the occurrence of the disease in children. Polymerase chain reaction (PCR is a method that is advantageous in that it allows the use of peripheral blood samples for diagnosis. This paper reports the utilisation of PCR on peripheral blood samples to diagnose VL in 45 children in Mato Grosso do Sul, Brazil. This technique is compared with methods carried out using tissue collected by invasive procedures, including direct microscopy, culture and detection of Leishmania DNA by PCR in bone marrow aspirates. The results show that PCR of peripheral blood provides great sensitivity (95.6% that is similar to that from the PCR of bone marrow aspirates (91.1% and higher than that achieved with microscopy (80% or culture (26.7% methods. PCR of peripheral blood proved to be a suitable tool for the diagnosis of VL in children because it is highly sensitive and safe, with tissue collection being less invasive than in traditional tests.

  20. Genetic variability in Brazilian populations of Biomphalaria straminea complex detected by simple sequence repeat anchored polymerase chain reaction amplification

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L


    Full Text Available Biomphalaria glabrata, B. tenagophila and B. straminea are intermediate hosts of Schistosoma mansoni, in Brazil. The latter is of epidemiological importance in the northwest of Brazil and, due to morphological similarities, has been grouped with B. intermedia and B. kuhniana in a complex named B. straminea. In the current work, we have standardized the simple sequence repeat anchored polymerase chain reaction (SSR-PCR technique, using the primers (CA8RY and K7, to study the genetic variability of these species. The similarity level was calculated using the Dice coefficient and genetic distance using the Nei and Li coefficient. The trees were obtained by the UPGMA and neighbor-joining methods. We have observed that the most related individuals belong to the same species and locality and that individuals from different localities, but of the same species, present clear heterogeneity. The trees generated using both methods showed similar topologies. The SSR-PCR technique was shown to be very efficient in intrapopulational and intraspecific studies of the B. straminea complex snails.

  1. New paradigm for simplified combustion modeling of energetic solids: Branched chain gas reaction

    Energy Technology Data Exchange (ETDEWEB)

    Brewster, M.Q.; Ward, M.J. [Univ. of Illinois, Urbana, IL (United States); Son, S.F. [Los Alamos National Lab., NM (United States)


    Two combustion models with simple but rational chemistry are compared: the classical high gas activation energy (E{sub g}/RT {much_gt} 1) Denison-Baum-Williams (DBW) model, and a new low gas activation energy (E{sub g}/RT {much_lt} 1) model recently proposed by Ward, Son, and Brewster (WSB). Both models make the same simplifying assumptions of constant properties, Lewis number unity, single-step, second order gas phase reaction, and single-step, zero order, high activation energy condensed phase decomposition. The only difference is in the gas reaction activation energy E{sub g} which is asymptotically large for DBW and vanishingly small for WSB. For realistic parameters the DBW model predicts a nearly constant temperature sensitivity {sigma}{sub p} and a pressure exponent n approaching 1. The WSB model predicts generally observed values of n = 0.7 to 0.9 and {sigma}{sub p}(T{sub o},P) with the generally observed variations with temperature (increasing) and pressure (decreasing). The WSB temperature profile also matches measured profiles better. Comparisons with experimental data are made using HMX as an illustrative example (for which WSB predictions for {sigma}{sub p}(T{sub o},P) are currently more accurate than even complex chemistry models). WSB has also shown good agreement with NC/NG double base propellant and HNF, suggesting that at the simplest level of combustion modeling, a vanishingly small gas activation energy is more realistic than an asymptotically large one. The authors conclude from this that the important (regression rate determining) gas reaction zone near the surface has more the character of chain branching than thermal decomposition.

  2. Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction. (United States)

    Faggioli, F; Pasquini, G; Barba, M


    The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

  3. Chemical reaction on solid surface observed through isotope tracer technique

    International Nuclear Information System (INIS)

    Tanaka, Ken-ichi


    In order to know the role of atoms and ions on solid surfaces as the partners participating in elementary processes, the literatures related to the isomerization and hydrogen exchanging reaction of olefines, the hydrogenation of olefines, the metathesis reaction and homologation of olefines based on solid catalysts were reviewed. Various olefines, of which the hydrogen atoms were substituted with deuterium at desired positions, were reacted using various solid catalysts such as ZnO, K 2 CO 3 on C, MoS 2 (single crystal and powder) and molybdenum oxide (with various carriers), and the infra-red spectra of adsorbed olefines on catalysts, the isotope composition of reaction products and the production rate of the reaction products were measured. From the results, the bonding mode of reactant with the atoms and ions on solid surfaces, and the mechanism of the elementary process were considered. The author emphasized that the mechanism of the chemical reaction on solid surfaces and the role of active points or catalysts can be made clear to the considerable extent by combining isotopes suitably. (Yoshitake, I.)

  4. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction. (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun


    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application. (United States)

    Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon


    Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.

  6. Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism

    Directory of Open Access Journals (Sweden)

    Gildo Almeida da Silva

    Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.

  7. Rapid genomic fingerprinting of Lactococcus lactis strains by arbitrarily primed polymerase chain reaction with 32P and fluorescent labels.


    Cancilla, M R; Powell, I B; Hillier, A J; Davidson, B E


    Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for obtaining genomic fingerprints of strains of Lactococcus lactis. Closely related strains produced almost identical fingerprints. Fingerprints of other strains showed only some similarities.

  8. An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

    NARCIS (Netherlands)

    Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

    The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30

  9. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld


    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....

  10. Whole Blood Polymerase Chain Reaction in a Neonate with Disseminated Herpes Simplex Virus Infection and Liver Failure

    Directory of Open Access Journals (Sweden)

    Jennifer A. Scoble


    Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.

  11. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma... (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... tracheal swabs in PBS or 1 mL of broth culture by a non-phenolic procedure. Centrifuge samples at 14,000 x...

  12. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma... (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  13. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan


    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  14. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.


    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  15. An efficient interpolation technique for jump proposals in reversible-jump Markov chain Monte Carlo calculations (United States)

    Farr, W. M.; Mandel, I.; Stevens, D.


    Selection among alternative theoretical models given an observed dataset is an important challenge in many areas of physics and astronomy. Reversible-jump Markov chain Monte Carlo (RJMCMC) is an extremely powerful technique for performing Bayesian model selection, but it suffers from a fundamental difficulty and it requires jumps between model parameter spaces, but cannot efficiently explore both parameter spaces at once. Thus, a naive jump between parameter spaces is unlikely to be accepted in the Markov chain Monte Carlo (MCMC) algorithm and convergence is correspondingly slow. Here, we demonstrate an interpolation technique that uses samples from single-model MCMCs to propose intermodel jumps from an approximation to the single-model posterior of the target parameter space. The interpolation technique, based on a kD-tree data structure, is adaptive and efficient in modest dimensionality. We show that our technique leads to improved convergence over naive jumps in an RJMCMC, and compare it to other proposals in the literature to improve the convergence of RJMCMCs. We also demonstrate the use of the same interpolation technique as a way to construct efficient ‘global’ proposal distributions for single-model MCMCs without prior knowledge of the structure of the posterior distribution, and discuss improvements that permit the method to be used in higher dimensional spaces efficiently. PMID:26543580

  16. Report on waterborne diseases: The polymerase chain reaction for the identification of enteric viruses in water; Rapporto sulle malattie infettive di origine idricamerizzazione a catena per l`identificazione dei virus enterici nell`acqua

    Energy Technology Data Exchange (ETDEWEB)

    Muscillo, M; La Rosa, G [Istituto Superiore di Sanita, Rome (Italy). Lab. di Igiene Ambientale


    A variety of human infectious diseases are associated with the pollution of water by enteric viruses. The epidemiological data on cases associated with drinking and recreational water show Norwalk, hepatitis A and E viruses, rotavirus and enteroviruses as the etiological agents. The polymerase chain reaction (PCR) is certainly the most reliable technique available for the rapid identification of these viruses in water samples.

  17. Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions (United States)

    Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.


    It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

  18. Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol

    Directory of Open Access Journals (Sweden)

    Elisabetta Di Giannatale


    Full Text Available A polymerase chain reaction protocol consisting of a multiplex to identify the cpa, cpb1, cpetx, cpi genes and a duplex to identify the cpe and cpb2 genes encoding for a, b1, e, i, enterotoxin and b2 toxins, respectively, was applied to DNA extracted from two collections of Clostridium perfringens strains. The first collection involved 19 isolates from rabbits. The second collection of 41 isolates came from routine necropsies. The cpa gene alone, or in association with the cpb2 gene, was detected in all DNA samples examined. The cpa gene, together with cpb2 gene, were detected in seven of the rabbit C. perfringens strains (36.8% and in nine isolates from necropsies (21.9%. The cpa gene was found in 63.2% of rabbit strains and 76.9% of strains from other animal species. In rabbits, the pathological lesions associated with C. perfringens detection were predominantly forms of non-inflammatory enteropathies. In other species, C. perfringens was mainly associated with congestive-haemorrhagic enteropathy, but also with fatal traumatic lesions, degenerative diseases and organs with post-mortem autolysis. No clear correlation was observed between detection of b2 toxin gene and species-specific pathological features.

  19. Detection of potentially cariogenic strains of Streptococcus mutans using the polymerase chain reaction. (United States)

    Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C


    Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.

  20. Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction. (United States)

    Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong


    The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

  1. Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

    Directory of Open Access Journals (Sweden)

    Lei Zhang


    Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

  2. Isolation and polymerase chain reaction-based identification of Riemerella anatipestifer from ducks in Kerala, India

    Directory of Open Access Journals (Sweden)

    Manju Soman


    Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.

  3. Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays. (United States)

    Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua


    Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Directory of Open Access Journals (Sweden)

    Daniela Camargos Costa


    Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  5. Performance of an HF chain-reaction laser with high initiation efficiency

    International Nuclear Information System (INIS)

    Whittier, J.S.; Kerber, R.L.


    Output-pulse observations are presented for a transverse electrically initiated, helium-diluted HF laser pumped by the H 2 + F 2 chain reaction. Performance of this laser is studied over a wide range of the gas composition and for initial pressures between 0.1 and 0.5 atm. The gas mixture was stabilized by premixing O 2 , F 2 , and He and flowing this mixture into a cold trap (84 0 K) before mixing with H 2 . Optimum conversion of electrical-initiation energy into laser energy was found for a 240-torr mixture with a mole ratio 1 F 2 :0.23 H 2 :0.08 O 2 :12 He which, when initiated with a 25-kV, 333-pF discharge, gave a pulse energy of 0.150 J. This corresponds to a ratio of laser output energy to electrical input energy of 144 percent. After unnecessary losses are taken into account, this ratio becomes 160 percent. (U.S.)

  6. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Natália Malaguti


    Full Text Available Bacterial vaginosis (BV is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%, and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

  7. Continuous Excretion of Leptospira borgpetersenii Ballum in Mice Assessed by Viability Quantitative Polymerase Chain Reaction. (United States)

    Soupé-Gilbert, Marie-Estelle; Bierque, Emilie; Geroult, Sophie; Teurlai, Magali; Goarant, Cyrille


    Rodents are the main reservoir animals of leptospirosis. In this study, we characterized and quantified the urinary excretion dynamics of Leptospira by Mus musculus infected with 2 × 10 8 virulent Leptospira borgpetersenii serogroup Ballum. Each micturition was collected separately in metabolic cages, at 12 time points from 7 to 117 days post-infection (dpi). We detected Leptospira in all urine samples collected (up to 8 per time point per mouse) proving that Leptospira excretion is continuous with ca. 90% live L. borgpetersenii Ballum, revealed by viability quantitative polymerase chain reaction. Microscopic visualization by Live/Dead fluorescence confirmed this high proportion of live bacteria and demonstrated that L. borgpetersenii Ballum are excreted, at least partly, as bacterial aggregates. We observed two distinct phases in the excretion dynamics, first an increase in Leptospira concentration shed in the urine between 7 and 63 dpi followed by a plateau phase from 63 dpi onward, with up to 3 × 10 7 Leptospira per mL of urine. These two phases seem to correspond to progressive colonization of renal tubules first, then to stable cell survival and maintenance in kidneys. Therefore, chronically infected adult mice are able to contaminate the environment via urine at each micturition event throughout their lifetime. Because Leptospira excretion reached its maximum 2 months after infection, older rodents have a greater risk of contaminating their surrounding environment.

  8. Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Trisadee Khamlor


    Full Text Available Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP gene and sex-determining region Y (SRY were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99% comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05. The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90% as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, <10% in Y-sorted semen and close to 50% in the unsorted semen. The multiplex real-time PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.

  9. Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study (United States)

    Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun


    Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431

  10. Detecting of Mycoplasma genitalium in male patients with urethritis symptoms in Turkey by polymerase chain reaction

    International Nuclear Information System (INIS)

    Dolapci, Istar; Tekeli, Alper; Ozsan, Murat; Elhan, Atilla; Yaman, Onder; Ergin, Sureyya


    The aim of this study was to investigate the incidence of Mycoplasma genitalium in the urine samples of 63 male patients who had urethritis symptoms. Along with Neisseria gonorrhoeae (N. gonorrhoeae) and Chlamydia trachomatis (C. trachomatis). We also investigated Mycoplasma hominis (M. hominis) and Ureaplasma urealyticum (U. urealyticum), both of which are known to cause urethritis. Microorganisms were investigated in urine samples of the patients with polymerase chain reaction. The study was conducted between September 2003 - February 2004 at the Department of Microbiology and Clinical Microbiology Ankara University School of Medicine, Ankara, Turkey. A total of 63 urine samples were analyzed and 6 (9.52%) patients had N. gonorrhoeae, 4 (6.34%) had C. trachomatis, while 4 (6.34%) urines were positive in terms of M. genitalium. Nevertheless, 3 (4.76%) patients had U. urealyticum and 2 (3.17%) patients had M. hominis. One urine sample was positive in terms of both N. gonorrhoeae and U. urealyticum, and another urine sample was positive in terms of both M. hominis and U. urealyticum. The results were compared with the control group and found no statistically significant difference. Mycoplasma species are found in normal flora of urogenital system and also as an agent of urogenital infection. In our study, we found low microorganism rates when compared with Europe and America. This difference may be due to the conservative sexual behavior in Turkey. (author)

  11. Polymerase chain reaction for detection of invasive Shigella flexneri in food. (United States)

    Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E


    The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

  12. AFM Imaging of Hybridization Chain Reaction Mediated Signal Transmission between Two DNA Origami Structures. (United States)

    Helmig, Sarah; Gothelf, Kurt Vesterager


    Signal transfer is central to the controlled exchange of information in biology and advanced technologies. Therefore, the development of reliable, long-range signal transfer systems for artificial nanoscale assemblies is of great scientific interest. We have designed such a system for the signal transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins, one of which is immobilized at specific points along tracks on DNA origami structures, are polymerized to form a continuous DNA duplex, which is visible using atomic force microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred more than 200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another and, therefore, has the potential to be applied to larger multi-component DNA assemblies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Detection of periodontal bacteria in thrombi of patients with acute myocardial infarction by polymerase chain reaction. (United States)

    Ohki, Takahiro; Itabashi, Yuji; Kohno, Takashi; Yoshizawa, Akihiro; Nishikubo, Shuichi; Watanabe, Shinya; Yamane, Genyuki; Ishihara, Kazuyuki


    Numerous reports have demonstrated that periodontal bacteria are present in plaques from atherosclerotic arteries. Although periodontitis has recently been recognized as a risk factor for coronary artery disease, the direct relationship between periodontal bacteria and coronary artery disease has not yet been clarified. It has been suggested that these bacteria might contribute to inflammation and plaque instability. We assumed that if periodontal bacteria induce inflammation of plaque, the bacteria would be released into the bloodstream when vulnerable plaque ruptures. To determine whether periodontal bacteria are present in thrombi at the site of acute myocardial infarction, we tried to detect periodontal bacteria in thrombi of patients with acute myocardial infarction by polymerase chain reaction (PCR). We studied 81 consecutive adults with ST-segment elevation acute myocardial infarction who underwent primary percutaneous coronary intervention (PCI). All patients underwent removal of thrombus with aspiration catheters at the beginning of percutaneous coronary intervention, and a small sample of thrombus was obtained for PCR. The detection rates of periodontal bacteria by PCR were 19.7% for Aggregatibacter actinomycetemcomitans, 3.4% for Porphyromonas gingivalis, and 2.3% for Treponema denticola. Three species of periodontal bacteria were detected in the thrombi of patients with acute myocardial infarction. This raises the possibility that such bacteria are latently present in plaque and also suggests that these bacteria might have a role in plaque inflammation and instability. Copyright © 2012 Mosby, Inc. All rights reserved.

  14. Polymerase chain reaction as a tool for developing stress protein probes

    Energy Technology Data Exchange (ETDEWEB)

    Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)


    Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.

  15. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis. (United States)

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T


    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

  16. Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction. (United States)

    Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip


    Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  17. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction. (United States)

    Focke, Felix; Haase, Ilka; Fischer, Markus


    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  18. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas


    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  19. Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler

    Directory of Open Access Journals (Sweden)

    Chan-Young Park


    Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.

  20. Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Lai-yu Kwok

    Full Text Available The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

  1. An exonuclease-assisted amplification electrochemical aptasensor for Hg(2+) detection based on hybridization chain reaction. (United States)

    Bao, Ting; Wen, Wei; Zhang, Xiuhua; Xia, Qinghua; Wang, Shengfu


    In this work, a novel electrochemical aptasensor was developed for Hg(2+) detection based on exonuclease-assisted target recycling and hybridization chain reaction (HCR) dual signal amplification strategy. The presence of Hg(2+) induced the T-rich DNA partly folded into duplex-like structure via the Hg(2+) mediated T-Hg(2+)-T base pairs, which triggered the activity of exonuclease III (Exo III). Exo III selectively digested the double-strand DNA containing multiple T-Hg(2+)-T base pairs from its 3'-end, the released Hg(2+) participated analyte recycle. With each digestion cycle, a digestion product named as help DNA was obtained, which acted as a linkage between the capture DNA and auxiliary DNA. The presence of help DNA and two auxiliary DNA collectively facilitated successful HCR process and formed long double-stranded DNA. [Ru(NH3)6](3+) was used as redox indicator, which electrostatically bound to the double strands and produced an electrochemical signal. Exo III-assisted target recycling and HCR dual amplification significantly improved the sensitivity for Hg(2+) with a detection limit of 0.12 pM (S/N=3). Furthermore, the proposed aptasensor had a promising potential for the application of Hg(2+) detection in real aquatic sample analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Clinical value of polymerase chain reaction in detecting group B streptococcus during labor. (United States)

    Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne


    To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.

  3. Clonality assessment of lymphoproliferative lesions using the polymerase chain reaction: An analysis of two methods

    Directory of Open Access Journals (Sweden)

    Nikhil Moorchung


    Full Text Available Background: Lymphoid malignancies are a heterogeneous group of disorders which may be difficult to differentiate from reactive proliferations even after immunohistochemistry. Polymerase chain reaction (PCR is believed to be a good adjunct tool for diagnosis. Materials and Methods: We examined 24 cases of neoplastic and non-neoplastic lymphoproliferative lesions in this study and evaluated the PCR as an additional tool in the confirmation of the diagnosis. Two different PCR methodologies were evaluated. Results: In the evaluation of the T-cell PCR, it was seen that the correlation using both the commercial kits and the custom-synthesized primers was highly significant at a P value of 0.05. Conclusions: Both the methods showed an excellent concordance for T-cell γ gene rearrangements, However, the same was not seen in the B-cell receptor rearrangements. This may be because of the small sample size or the inability of consensus V primers to recognize complementary DNA sequences in all of the V segments.

  4. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan


    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  5. Evaluation of multiplex polymerase chain reaction as an alternative to conventional antibiotic sensitivity test

    Directory of Open Access Journals (Sweden)

    K. Rathore


    Full Text Available Aim: This study was designed to evaluate the potential of the use of multiplex polymerase chain reaction (PCR as an alternative to conventional antibiotic sensitivity test. Materials and Methods: Isolates of Staphylococcus aureus (total = 36 from clinical cases presented to Teaching Veterinary Clinical Complex of College of Veterinary and Animal Sciences (CVAS, Navania, Udaipur, were characterized by morphological, cultural, and biochemical methods. Then, the isolates were further subjected to molecular characterization by PCR targeting S. aureus-specific sequence (107 bp. Phenotypic antibiotic sensitivity pattern was analyzed by Kirby Bauer disc diffusion method against 11 commonly used antibiotics in veterinary medicine in and around Udaipur region. The genotypic antibiotic sensitivity pattern was studied against methicillin, aminoglycosides, and tetracycline targeting the gene mecA, aacA-aphD, and tetK by multiplex PCR. Results: There was 100% correlation between the phenotype and genotype of aminoglycoside resistance, more than 90% correlation for methicillin resistance, and 58.3% in the case tetracycline resistance. Conclusion: As there is a good correlation between phenotype and genotype of antibiotic resistance, multiplex PCR can be used as an alternative to the conventional antibiotic susceptibility testing, as it can give a rapid and true prediction of antibiotic sensitivity pattern.

  6. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet


    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  7. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    International Nuclear Information System (INIS)

    Tang Yabing; Xing Da; Zhu Debin; Liu Jinfeng


    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

  8. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang


    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  9. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong


    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  10. Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer (United States)

    Madadelahi, M.; Kalan, K.; Shamloo, A.


    Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.

  11. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton


    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  12. Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay. (United States)

    Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A


    ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.

  13. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)


    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  14. Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing (United States)

    White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter


    Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

  15. Five years' experience of classical swine fever polymerase chain reaction ring trials in France. (United States)

    Po, F; Le Dimna, M; Le Potier, M F


    Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.

  16. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction. (United States)

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid


    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  17. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Samira Mohammadi


    Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  18. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction. (United States)

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M


    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  19. A polymerase chain reaction assay for detection of virulent and attenuated strains of duck plague virus. (United States)

    Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi


    Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.

  20. Analysis of hepcidin expression: in situ hybridization and quantitative polymerase chain reaction from paraffin sections. (United States)

    Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi


    To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  1. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema. (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal


    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  2. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes


    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  3. Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias


    Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours....... The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm...

  4. Detection of retinoblastoma gene deletions in spontaneous and radiation-induced mouse lung adenocarcinomas by polymerase chain reaction

    International Nuclear Information System (INIS)

    Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.


    A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma gene using histological sections from radiation-induced and spontaneous tumors as the DNA source. Six mouse Rb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mouse Rb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (5.69 Gy 60 Co γ rays or 0.6 Gy JANUS neutrons, which have been found to have approximately equal radiobiological effectiveness) were analyzed for mouse Rb deletions. Tumors in 6 neutron-irradiated mice had no mouse Rb deletions. However, 1 of 6 tumors from γ-irradiated mice (17%) and 6 of 18 spontaneous tumors from unirradiated mice (33%) showed a deletion in one or both mouse Rb alleles. All deletions detected were in the 5' region of the mouse Rb gene. 36 refs., 2 figs., 2 tabs

  5. Pathology and polymerase chain reaction detection of ovine progressive pneumonia (maedi) cases in slaughtered sheep in India. (United States)

    Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa


    The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at -20°C for PCR confirmation. Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV.

  6. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep (United States)

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon


    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  7. Helicobacter-negative gastritis: polymerase chain reaction for Helicobacter DNA is a valuable tool to elucidate the diagnosis. (United States)

    Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G


    Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P gastritis. © 2016 John Wiley & Sons Ltd.

  8. On-site identification of meat species in processed foods by a rapid real-time polymerase chain reaction system. (United States)

    Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori


    Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Pathology and polymerase chain reaction detection of ovine progressive pneumonia (maedi cases in slaughtered sheep in India

    Directory of Open Access Journals (Sweden)

    Rahul Singh


    Full Text Available Aim: The small ruminant lentiviruses are known to cause maedi-visna (MV and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR. In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. Materials and Methods: A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at -20°C for PCR confirmation. Results: Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. Conclusion: This study suggests the low occurrence of MV virus (MVV infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV.

  10. Pathology and polymerase chain reaction detection of ovine progressive pneumonia (maedi) cases in slaughtered sheep in India (United States)

    Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa


    Aim: The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. Materials and Methods: A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at −20°C for PCR confirmation. Results: Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. Conclusion: This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV. PMID:29263606

  11. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    International Nuclear Information System (INIS)

    Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie


    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  12. Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hamed Rezaeejam


    Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

  13. A quantitative real time polymerase chain reaction approach for estimating processed animal proteins in feed: preliminary data

    Directory of Open Access Journals (Sweden)

    Maria Cesarina Abete


    Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.

  14. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    P. D. Luka


    Full Text Available Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction from FFT for African swine fever virus (ASFV detection. The modified conventional method gave a higher quality DNA when compared with commercially available DNA extraction kits (QIAamp® DNA Mini Kit, DNeasy® Blood and Tissue Kit, and ZR Genomic DNA™ Tissue MiniPrep. Results: An average A260/A280 DNA purity of 0.86-1.68 and 3.22-5.32 μg DNA/mg for formalin fixed and non-fixed tissues, respectively using a conventional method. In a reproducible and three times repeat PCR, the ASFV DNA expected product size of 278 bp was obtained from the DNA extract of the conventional method but not from the DNA extract of the commercial kits. Conclusion: The present study has demonstrated that the conventional method extracts ASFV genome better than commercial kit. In summary, the commercial kit extraction appeared not suitable to purify ASFV DNA from FFT. We, therefore, recommend that the use of the conventional method be considered for African swine fever DNA extraction from FFT.

  15. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols. (United States)

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R


    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  16. Development of a propidium monoazide-polymerase chain reaction assay for detection of viable Lactobacillus brevis in beer. (United States)

    Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Dong, Jianjun; Yin, Hua; Yu, Junhong; Chang, Zongming; Wang, Dongfeng

    The spoilage of beer by bacteria is of great concern to the brewer as this can lead to turbidity and abnormal flavors. The polymerase chain reaction (PCR) method for detection of beer-spoilage bacteria is highly specific and provides results much faster than traditional microbiology techniques. However, one of the drawbacks is the inability to differentiate between live and dead cells. In this paper, the combination of propidium monoazide (PMA) pretreatment and conventional PCR had been described. The established PMA-PCR identified beer spoilage Lactobacillus brevis based not on their identity, but on the presence of horA gene which we show to be highly correlated with the ability of beer spoilage LAB to grow in beer. The results suggested that the use of 30μg/mL or less of PMA did not inhibit the PCR amplification of DNA derived from viable L. brevis cells. The minimum amount of PMA to completely inhibit the PCR amplification of DNA derived from dead L. brevis cells was 2.0μg/mL. The detection limit of PMA-PCR assay described here was found to be 10 colony forming units (CFU)/reaction for the horA gene. Moreover, the horA-specific PMA-PCR assays were subjected to 18 reference isolates, representing 100% specificity with no false positive amplification observed. Overall the use of horA-specific PMA-PCR allows for a substantial reduction in the time required for detection of potential beer spoilage L. brevis and efficiently differentiates between viable and nonviable cells. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  17. Detection of DNA from Leishmania (Viannia: accuracy of polymerase chain reaction for the diagnosis of cutaneous leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Herintha Coeto Neitzke-Abreu

    Full Text Available Cutaneous leishmaniasis (CL can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L and blood sample-enriched leukocytes (PCR-B with three conventional diagnostic techniques: parasite direct search (DS, Montenegro skin test (MST, and indirect immunofluorescence reaction (IIF. The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia (minicircle kDNA fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species.

  18. Markov chain Monte Carlo techniques applied to parton distribution functions determination: Proof of concept (United States)

    Gbedo, Yémalin Gabin; Mangin-Brinet, Mariane


    We present a new procedure to determine parton distribution functions (PDFs), based on Markov chain Monte Carlo (MCMC) methods. The aim of this paper is to show that we can replace the standard χ2 minimization by procedures grounded on statistical methods, and on Bayesian inference in particular, thus offering additional insight into the rich field of PDFs determination. After a basic introduction to these techniques, we introduce the algorithm we have chosen to implement—namely Hybrid (or Hamiltonian) Monte Carlo. This algorithm, initially developed for Lattice QCD, turns out to be very interesting when applied to PDFs determination by global analyses; we show that it allows us to circumvent the difficulties due to the high dimensionality of the problem, in particular concerning the acceptance. A first feasibility study is performed and presented, which indicates that Markov chain Monte Carlo can successfully be applied to the extraction of PDFs and of their uncertainties.

  19. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio


    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  20. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q


    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  1. Value of polymerase chain reaction in patients with presumptively diagnosed and treated as tuberculous pericardial effusion

    International Nuclear Information System (INIS)

    Rehman, H.; Hafizullah, M.; Shah, S.T.; Khan, S.B.; Hadi, A.; Ahmad, F.; Shah, I.; Gul, A.M.


    Objective: To know the sensitivity of polymerase chain reaction (PCR) in pericardial fluid and response to antituberculous treatment (ATT) in PCR positive patients who were presumptively diagnosed and treated as tuberculous pericardial effusion. Methodology: This was a descriptive cross sectional study carried out from June 1, 2009 to 31 May 2010 at Cardiology Department, Lady Reading Hospital, Peshawar. Patients with presumptive diagnosis and receiving treatment for tuberculous pericardial effusion were included. Pericardial fluid sample was aspirated under fluoroscopy for the routine work up. The specimens were subjected to PCR detection of mycobacterium tuberculous DNA. Results: During 12 month study period, a total of 54 patients with large pericardial effusion presented to Cardiology department, Lady Reading Hospital, Peshawar. Of them, 46 patients fulfilled the criteria for presumptive diagnosis of tuberculous pericardial effusion. PCR for mycobacterium tuberculous DNA in pericardial fluid was positive in 45.7%(21). Patients were followed for three months. In PCR positive group, 01 patient while in PCR negative group 3 patients were lost to follow up. Among PCR positive patients 17(85%) while in PCR negative group 11(47.82%) patient responded to ATT both clinically and echo-cardio graphically. We found that patients who were PCR positive responded better to therapy than those who were PCR negative and this finding was statistically significant (p=0.035). Conclusion: PCR, with all its limitations, is potentially a useful diagnostic test in patients with presumptively diagnosed tuberculous pericardial effusion. A PCR positive patient responds better to therapy as compared to PCR negative patient. (author)

  2. Clinical application of polymerase chain reaction to diagnose Clostridium difficile in hospitalized patients with diarrhea. (United States)

    Morelli, Michael S; Rouster, Susan D; Giannella, Ralph A; Sherman, Kenneth E


    Clostridium difficile is a common cause of diarrhea in hospitalized patients and is associated with significant morbidity and cost. The current diagnostic standard, enzyme immunoassay (EIA), has low sensitivity, leading to duplicate testing and empiric treatment. We sought to show the usefulness and potential cost effectiveness of polymerase chain reaction (PCR) amplification of toxin B gene for diagnosis of C. difficile-induced diarrhea. A total of 148 stool samples from academic and community-based hospitals were sent for EIA testing and were evaluated prospectively for the presence of toxin B gene by PCR. Results were compared with EIA regarding sensitivity, specificity, and predictive values. Medical charts were reviewed to determine the following: (1) number of EIAs sent per admission, (2) number sent within a 24-hour time period, and (3) how caregivers practiced based on EIA results. The mean age of 130 patients was 55 years. EIA and PCR were positive in 6.8% and 13.6% of patients, respectively. EIA sensitivity was 40%, specificity was 98%, and positive and negative predictive values were 80% and 91%, respectively. The cost of the PCR was $22/sample. Empiric treatment for C. difficile was given unnecessarily in 42% of EIA-negative results. Thirty percent of patients had 3 or more EIAs sent during their hospital admission. Of patients with multiple samples sent, 57% had more than 1 sample sent in a 24-hour period. Many physicians do not conform to practice guidelines regarding recommended diagnosis and empiric treatment of C. difficile. Toxin B gene PCR represents a more sensitive and potentially cost-effective method to diagnose C. difficile-induced diarrhea than EIA and should be considered for use as an alternative diagnostic standard.

  3. Newborn screening for congenital cytomegalovirus using real-time polymerase chain reaction in umbilical cord blood. (United States)

    Barkai, Galia; Barzilai, Asher; Mendelson, Ella; Tepperberg-Oikawa, Michal; Roth, Daphne Ari-Even; Kuint, Jacob


    Congenital cytomegalovirus (C-CMV) infection affects 0.4-2% of newborn infants in Israel, most of whom are asymptomatic. Of these, 10-20% will subsequently develop hearing impairment and may have benetitted from early detection by neonatal screeing. To retrospectively anaIyze the results of a screening program for C-CMV performed at the Sheba Medical Center, Tel, Hashomer, during a 1 year period, using real-time polymerase chain reaction (rt-PCR) from umbilical cord blood. CMV DNA was detected by rt-PCR performed on infants' cord blood. C-CMV was confirmed by urine culture (Shell-vial). All confirmed cases were further investigated for C-CMV manifestations by head ultrasound, complete blood count, liver enzyme measurement, ophthalmology examination and hearing investigation. During the period 1 June 2009 to 31 May 2010, 11,022 infants were born at the Sheba Medical Center, of whom 8105 (74%) were screened. Twenty-three (0.28%) were positive for CMV and 22 of them (96%) were confirmed by urine culture. Two additional infants, who had not been screened, were detected after clinical suspicion. All 24 infants were further Investigated, and 3 (12.5%) had central nervous system involvement (including hearing impairment) and were offered intravenous ganciclovir for 6 weeks. Eighteen infants (82%) would not otherwise have been diagnosed. The relatively low incidence of C-CMV detected in our screening program probably reflects the low sensitivity of cord blood screening. Nevertheless, this screening program reliably detected a non-negligible number of infants who could benefit from early detection. Other screening methods using saliva should be investigated further.

  4. A polymerase chain reaction-based methodology to detect gene doping. (United States)

    Carter, Adam; Flueck, Martin


    The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

  5. Polymerase chain reaction with two molecular targets in mucosal leishmaniasis' diagnosis: a validation study

    Directory of Open Access Journals (Sweden)

    Clemencia Ovalle Bracho


    Full Text Available We validated the polymerase chain reaction (PCR with a composite reference standard in 61 patients clinically suspected of having mucosal leishmaniasis, 36 of which were cases and 25 were non-cases according to this reference standard. Patient classification and test application were carried out independently by two blind observers. One pair of primers was used to amplify a fragment of 120 bp in the conserved region of kDNA and another pair was used to amplify the internal transcript spacers (ITS rDNA. PCR showed 68.6% (95% CI 59.2-72.6 sensitivity and 92% (95% CI 78.9-97.7 specificity; positive likelihood ratio: 8.6 (95% CI 2.8-31.3 and negative likelihood ratio: 0.3 (95% CI 0.3-0.5, when kDNA molecular target was amplified. The test performed better on sensitivity using this target compared to the ITS rDNA molecular target which showed 40% (95% CI 31.5-42.3 sensitivity and 96% (95% CI 84.1-99.3 specificity; positive likelihood ratio: 10 (95% CI 2.0-58.8 and negative likelihood ratio: 0.6 (95% CI 0.6-0.8. The inter-observer agreement was excellent for both tests. Based upon results obtained and due to low performance of conventional methods for diagnosing mucosal leishmaniasis, we consider PCR with kDNA as molecular target is a useful diagnostic test and the ITS rDNA molecular target is useful when the aim is to identify species.

  6. [Value of polymerase chain reaction in serum for the diagnosis of enteroviral meningitis]. (United States)

    Marque Juillet, S; Lion, M; Pilmis, B; Tomini, E; Dommergues, M-A; Laporte, S; Foucaud, P


    Enteroviruses (EV) are a common cause of aseptic meningitis in children. Virological diagnosis of EV meningitis is currently based on the detection of the viral genome in the cerebrospinal fluid (CSF). This study attempted to determine the correlation and the temporality of the polymerase chain reaction (PCR) assay in serum and CSF and to evaluate the possibility of diagnosing EV infection only on the serum PCR. The EV genome was sought by RT real-time PCR (Smart Cycler EV Primer and Probe Set(®), Cepheid) in CSF and serum, collected at the same time, for all children who underwent a lumbar puncture for suspected meningitis, between 1 June and 31 July 2010 at the Versailles Hospital. Forty-four patients were included in the study. EV infection was documented for 22 of them. In 10 patients, the EV genome was detected in CSF only; in 3 patients in serum only, and in 9 patients in both. Among patients with acute EV neurological infection, viremic children were significantly younger (1.6 months versus 5.8 years; Pvalue of EV PCR in serum. It suggests that in some children and under certain conditions (age >3 months, clinical and biological compatibility with a viral infection, no previous antibiotic therapy, time from symptom onset to blood sampling <30 h, PCR in serum analyzed within 3h), PCR in serum, when positive, is a possible alternative. Therefore, it may be possible to diagnose EV infection without performing a lumbar puncture in a limited number of young children (11.4% of our suspected cases). This study needs to be reinforced by a multicenter study with a broader panel of patients. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  7. Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A. (United States)

    Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum


    The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.

  8. Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses

    Directory of Open Access Journals (Sweden)

    Kieu The Loan Trinh


    Full Text Available Purpose: We aim to fabricate a thermoplastic poly(methylmethacrylate (PMMA Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs for rapid molecular detection of foodborne pathogen bacteria. Methods: A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. Results: A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. Conclusions: In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately.

  9. Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Tashfeen, S.; Ahmed, S.; Bhatti, F.A.; Ali, N.


    Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)

  10. Postinduction minimal residual disease monitoring by polymerase chain reaction in children with acute lymphoblastic leukemia. (United States)

    Paganin, Maddalena; Fabbri, Giulia; Conter, Valentino; Barisone, Elena; Polato, Katia; Cazzaniga, Giovanni; Giraldi, Eugenia; Fagioli, Franca; Aricò, Maurizio; Valsecchi, Maria Grazia; Basso, Giuseppe


    Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. Monitoring minimal residual disease (MRD) by using real-time quantitative polymerase chain reaction (RQ-PCR) provides information for patient stratification and individual risk-directed treatment. Cooperative studies have documented that measurement of blast clearance from the bone marrow during and after induction therapy identifies patient populations with different risk of relapse. We explored the possible contribution of measurements of MRD during the course of treatment. We used RQ-PCR to detect MRD in 110 unselected patients treated in Italy in the International Collaborative Treatment Protocol for Children and Adolescents With Acute Lymphoblastic Leukemia (AIEOP-BFM ALL 2000). The trial took place in AIEOP centers during postinduction chemotherapy. Results were categorized as negative, low positive (below the quantitative range [< 5 × 10(-4)]), or high positive (≥ 5 × 10(-4)). Patients with at least one low-positive or high-positive result were assigned to the corresponding subgroup. Patients who tested high positive, low positive, or negative had significantly different cumulative incidences of leukemia relapse: 83.3%, 34.8%, and 8.6%, respectively (P < .001). Two thirds of positive cases were identified within 4 months after induction-consolidation therapy, suggesting that this time frame may be most suitable for cost-effective MRD monitoring, particularly in patients who did not clear their disease at the end of consolidation. These findings provide further insights into the dynamic of MRD and the ongoing effort to define molecular relapse in childhood ALL. © 2014 by American Society of Clinical Oncology.

  11. Does Polymerase Chain Reaction of Tissue Specimens Aid in the Diagnosis of Tuberculosis?

    Directory of Open Access Journals (Sweden)

    Yoo Jin Lee


    Full Text Available Background Mycobacterial culture is the gold standard test for diagnosing tuberculosis (TB, but it is time-consuming. Polymerase chain reaction (PCR is a highly sensitive and specific method that can reduce the time required for diagnosis. The diagnostic efficacy of PCR differs, so this study determined the actual sensitivity of TB-PCR in tissue specimens. Methods We retrospectively reviewed 574 cases. The results of the nested PCR of the IS6110 gene, mycobacterial culture, TB-specific antigen-induced interferon-γ release assay (IGRA, acid-fast bacilli (AFB staining, and histological findings were evaluated. Results The positivity rates were 17.6% for PCR, 3.3% for the AFB stain, 22.2% for mycobacterial culture, and 55.4% for IGRA. PCR had a low sensitivity (51.1% and a high specificity (86.3% based on the culture results of other studies. The sensitivity was higher (65.5% in cases with necrotizing granuloma but showed the highest sensitivity (66.7% in those with necrosis only. The concordance rate between the methods indicated that PCR was the best method compared to mycobacterial culture, and the concordance rate increased for the methods using positive result for PCR or histologic features. Conclusions PCR of tissue specimens is a good alternative to detect tuberculosis, but it may not be as sensitive as previously suggested. Its reliability may also be influenced by some histological features. Our data showed a higher sensitivity when specimens contained necrosis, which indicated that only specimens with necrosis should be used for PCR to detect tuberculosis.

  12. Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA. (United States)

    Fahrimal, Y; Goff, W L; Jasmer, D P


    Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

  13. Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY)


    Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati


    Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...

  14. Particle Markov Chain Monte Carlo Techniques of Unobserved Component Time Series Models Using Ox

    DEFF Research Database (Denmark)

    Nonejad, Nima

    This paper details Particle Markov chain Monte Carlo techniques for analysis of unobserved component time series models using several economic data sets. PMCMC combines the particle filter with the Metropolis-Hastings algorithm. Overall PMCMC provides a very compelling, computationally fast...... and efficient framework for estimation. These advantages are used to for instance estimate stochastic volatility models with leverage effect or with Student-t distributed errors. We also model changing time series characteristics of the US inflation rate by considering a heteroskedastic ARFIMA model where...

  15. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood. (United States)

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada


    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  16. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu


    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  17. Prognostic significance of bi/oligoclonality in childhood acute lymphoblastic leukemia as determined by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Carlos Alberto Scrideli


    Full Text Available CONTEXT: The CDR-3 region of heavy-chain immunoglobulin has been used as a clonal marker in the study of minimal residual disease in children with acute lymphoblastic leukemia. Southern blot and polymerase chain reaction studies have demonstrated the occurrence of bi/oligoclonality in a variable number of cases of B-lineage acute lymphoblastic leukemia, a fact that may strongly interfere with the detection of minimal residual disease. Oligoclonality has also been associated with a poorer prognosis and a higher chance of relapse. OBJECTIVES: To correlate bi/oligoclonality, detected by polymerase chain reaction in Brazilian children with B-lineage acute lymphoblastic leukemia with a chance of relapse, with immunophenotype, risk group, and disease-free survival. DESIGN: Prospective study of patients’ outcome. SETTING: Pediatric Oncology Unit of the University Hospital, Faculty of Medicine of Ribeirão Preto, University of São Paulo. PARTICIPANTS: 47 children with acute lymphoblastic leukemia DIAGNOSTIC TEST: Polymerase chain reaction using consensus primers for the CDR-3 region of heavy chain immunoglobulin (FR3A, LJH and VLJH for the detection of clonality. RESULTS: Bi/oligoclonality was detected in 15 patients (31.9%. There was no significant difference between the groups with monoclonality and biclonality in terms of the occurrence of a relapse (28.1% versus 26.1%, presence of CALLA+ (81.2% versus 80% or risk group (62.5% versus 60%. Disease-free survival was similar in both groups, with no significant difference (p: 0.7695. CONCLUSIONS: We conclude that bi/oligoclonality was not associated with the factors investigated in the present study and that its detection in 31.9% of the patients may be important for the study and monitoring of minimal residual disease.

  18. A shock tube study of C4–C6 straight chain alkenes + OH reactions

    KAUST Repository

    Khaled, Fathi


    Alkenes are known to be good octane boosters and they are major components of commercial fuels. Detailed theoretical calculations and direct kinetic measurements of elementary reactions of alkenes with combustion radicals are scarce for C4 alkenes and they are practically absent for C5 and larger alkenes. The overall rate coefficients for the reaction of OH radical with 1-butene (CH CHCH CH, k ), 1-pentene (CH CHCH CH-CH, k ), cis/trans 2-pentene (CH CHCHCH CH, k and k ), 1-hexene (CH CHCH CH CH CH, k ) and cis/trans 2-hexene (CH CHCHCH CH CH, k and k ) were measured behind reflected shock waves over the temperature range of 833-1377K and pressures near 1.5atm. The reaction progress was followed by measuring mole fraction of OH radicals near 306.7nm using UV laser absorption technique. It is found that the rate coefficients of OH+trans-2-alkenes are larger than those of OH+cis-2-alkenes, followed by OH+1-alkenes. The derived Arrhenius expressions for the overall rate coefficients (in cm.mol.s) are:. kI=(4.83±0.03)104.T2.72±0.01.exp(940.8±2.9cal/molRT)(946K-1256K) + kII=(5.66±0.54)10-1.T4.14±0.80.exp(4334±227cal/molRT)(875K-1379K) + kIII=(3.25±0.12)104.T2.76±0.5.exp(1962±83cal/molRT)(877K-1336K) + kIV=(3.42±0.09)104.T2.76±0.5.exp(1995±59cal/molRT)(833K-1265K) + kV=(7.65±0.58)10-4.T5±1.exp(5840±175cal/molRT)(836K-1387K) + kVI=(2.58±0.06)106.T2.17±0.37.exp(1461±55cal/molRT)(891K-1357K) + kVII=(3.08±0.05)106.T2.18±0.37.exp(1317±38cal/molRT)(881K-1377K) +

  19. A shock tube study of C4–C6 straight chain alkenes + OH reactions

    KAUST Repository

    Khaled, Fathi; Badra, Jihad; Farooq, Aamir


    Alkenes are known to be good octane boosters and they are major components of commercial fuels. Detailed theoretical calculations and direct kinetic measurements of elementary reactions of alkenes with combustion radicals are scarce for C4 alkenes and they are practically absent for C5 and larger alkenes. The overall rate coefficients for the reaction of OH radical with 1-butene (CH CHCH CH, k ), 1-pentene (CH CHCH CH-CH, k ), cis/trans 2-pentene (CH CHCHCH CH, k and k ), 1-hexene (CH CHCH CH CH CH, k ) and cis/trans 2-hexene (CH CHCHCH CH CH, k and k ) were measured behind reflected shock waves over the temperature range of 833-1377K and pressures near 1.5atm. The reaction progress was followed by measuring mole fraction of OH radicals near 306.7nm using UV laser absorption technique. It is found that the rate coefficients of OH+trans-2-alkenes are larger than those of OH+cis-2-alkenes, followed by OH+1-alkenes. The derived Arrhenius expressions for the overall rate coefficients (in cm.mol.s) are:. kI=(4.83±0.03)104.T2.72±0.01.exp(940.8±2.9cal/molRT)(946K-1256K) + kII=(5.66±0.54)10-1.T4.14±0.80.exp(4334±227cal/molRT)(875K-1379K) + kIII=(3.25±0.12)104.T2.76±0.5.exp(1962±83cal/molRT)(877K-1336K) + kIV=(3.42±0.09)104.T2.76±0.5.exp(1995±59cal/molRT)(833K-1265K) + kV=(7.65±0.58)10-4.T5±1.exp(5840±175cal/molRT)(836K-1387K) + kVI=(2.58±0.06)106.T2.17±0.37.exp(1461±55cal/molRT)(891K-1357K) + kVII=(3.08±0.05)106.T2.18±0.37.exp(1317±38cal/molRT)(881K-1377K) +

  20. Application of radioanalytical techniques in the study of the products of heavy-ion reactions

    International Nuclear Information System (INIS)

    Hoffman, D.C.


    The use of heavy ions to induce nuclear reactions was reported as early as 1950. Since then it has been one of the most active areas of nuclear research. Intense beams of ions as heavy as uranium with energies high enough to overcome the Coulomb barriers of even the heaviest elements are available. The large variety of possible reactions gives rise to a multitude of products, which have been studied by many chemical and physical techniques. Chemical techniques have been of special value for the separation and unequivocal identification of low-yield species from the plethora of other nuclides present. Heavy-ion reactions have been essential for the production of the transmendelevium elements and a host of new isotopes. The systematics of compound nucleus reactions, transfer reactions and deeply inelastic reactions have been elucidated using chemical techniques. The variety of chemical procedures and techniques which have been developed for the study of heavy-ion reactions and their products has been examined. The determination of the chemical properties of the transmendelevium elements, which are very short-lived and can only be produced an ''atom at a time'' via heavy-ion reactions, is discussed. (author)

  1. Analytical definition of fission chain reaction parameters for cylindrical uranium bar and energy release evaluations for HIF hybrid targets

    International Nuclear Information System (INIS)

    Imshennik, V.S.


    Within the conditions of Heavy-Ion Fusion (HIF) arises a possibility to obtain the fission chain reaction for a cylindrical HIF target. The paper contains the solution interpolated with the diffusion approximation in order to receive the general approximation expressions for the bar critical radius as well as for over-critical state. The obtained critical parameters generalized for uranium envelope are used for rough evaluation of the energy release in HIF hybrid targets [ru

  2. Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction


    Saed, Mohand O.; Torbati, Amir H.; Nair, Devatha P.; Yakacki, Christopher M.


    This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addi...

  3. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

    Directory of Open Access Journals (Sweden)

    Kosuke Nakamura


    Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  4. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome


    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo


    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  5. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum. (United States)

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing


    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Results of Multiplex Polymerase Chain Reaction Assay to Identify Urethritis Pathogens

    Directory of Open Access Journals (Sweden)

    Mehmet Sarıer


    Full Text Available Objective: The purpose of this study was to evaluate the results of multiplex polymerase chain reaction (PCR test applied to identify the pathogens in male patients who attended our urology clinic with a pre-diagnosis of urethritis related with sexual intercourse. Materials and Methods: In this study, we included a total of 91 male patients, who sought medical advice in our clinic between August 2015 and October 2016 due to complaints of urethral discharge, dysuria and urethral itching, having a visible urethral discharge during the physical examination or a positive leukocyte esterase test (Combur-Test®-Roche in the first urine sample. In the urethral swab samples of these patients, urethritis pathogens were searched with a multiplex PCR test. The multiplex PCR kit, which is able to identify nine pathogens and produced by PathoFinder® (Holland, was used in the process. The pathogens that could be detected by the kit were Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma urealyticum, Gardnerella vaginalis, Trichomonas vaginalis, Treponema pallidum, and Candida albicans. Results: The average age of the subjects was 35.1 (19-57 years. Sixty one out of 91 patients (67% were found to have a pathogen in the urethral swab sample. In 45 patients (49.4%, only one pathogen, in 12 (13.1% - two different pathogens and in 4 (4.3% patients, 3 different pathogens were detected. The pathogens found were as follows: Ureaplasma urealyticum in 22 patients (27.1%, Gardnerella vaginalis in 15 (18.6%, Neisseria gonorrhoeae in 13 (16.1%, Mycoplasma genitalium (10 patients; 12.3%, Mycoplasma hominis (8 patients; 9.9%, Chlamydia trachomatis (8 patients; 9.9%, Trichomonas vaginalis (3 patients; 3.8%, and Candida albicans (2 patients; 2.4%. None of the patients were identified with Treponema pallidum. None of the pathogens were identified in 30 patients (32.9% whose samples were examined by PCR method. Conclusion

  7. Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

    Directory of Open Access Journals (Sweden)

    Arbefeville S


    Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

  8. Saliva Polymerase-Chain-Reaction Assay for Cytomegalovirus Screening in Newborns (United States)

    Boppana, Suresh B.; Ross, Shannon A.; Shimamura, Masako; Palmer, April L.; Ahmed, Amina; Michaels, Marian G.; Sánchez, Pablo J.; Bernstein, David I.; Tolan, Robert W.; Novak, Zdenek; Chowdhury, Nazma; Britt, William J.; Fowler, Karen B.


    BACKGROUND Congenital cytomegalovirus (CMV) infection is an important cause of hearing loss, and most infants at risk for CMV-associated hearing loss are not identified early in life because of failure to test for the infection. The standard assay for newborn CMV screening is rapid culture performed on saliva specimens obtained at birth, but this assay cannot be automated. Two alternatives — real-time polymerase-chain-reaction (PCR)–based testing of a liquid-saliva or dried-saliva specimen obtained at birth — have been developed. METHODS In our prospective, multicenter screening study of newborns, we compared real-time PCR assays of liquid-saliva and dried-saliva specimens with rapid culture of saliva specimens obtained at birth. RESULTS A total of 177 of 34,989 infants (0.5%; 95% confidence interval [CI], 0.4 to 0.6) were positive for CMV, according to at least one of the three methods. Of 17,662 newborns screened with the use of the liquid-saliva PCR assay, 17,569 were negative for CMV, and the remaining 85 infants (0.5%; 95% CI, 0.4 to 0.6) had positive results on both culture and PCR assay. The sensitivity and specificity of the liquid-saliva PCR assay were 100% (95% CI, 95.8 to 100) and 99.9% (95% CI, 99.9 to 100), respectively, and the positive and negative predictive values were 91.4% (95% CI, 83.8 to 96.2) and 100% (95% CI, 99.9 to 100), respectively. Of 17,327 newborns screened by means of the dried-saliva PCR assay, 74 were positive for CMV, whereas 76 (0.4%; 95% CI, 0.3 to 0.5) were found to be CMV-positive on rapid culture. Sensitivity and specificity of the dried-saliva PCR assay were 97.4% (95% CI, 90.8 to 99.7) and 99.9% (95% CI, 99.9 to 100), respectively. The positive and negative predictive values were 90.2% (95% CI, 81.7 to 95.7) and 99.9% (95% CI, 99.9 to 100), respectively. CONCLUSIONS Real-time PCR assays of both liquid- and dried-saliva specimens showed high sensitivity and specificity for detecting CMV infection and should be

  9. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes

    Directory of Open Access Journals (Sweden)

    Thabit AK


    Full Text Available Abrar K Thabit,1,2 David P Nicolau1,3 1Center for Anti-Infective Research and Development, Hartford Hospital, Hartford, CT, USA; 2Faculty of Pharmacy, King Abdulaziz University, Jeddah, Saudi Arabia; 3Division of Infectious Diseases, Hartford Hospital, Hartford, CT, USA Background: Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated.Aim: We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day, length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting.Methods: Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest.Results: The most common ribotypes were 027 (38%, 014/020 (21%, and 106/174 (21%. Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2. The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively. Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6. Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters, although the degree of nausea/vomiting did not differ between the three groups (P=0.3. A serum creatinine level ≥1.5 times the premorbid level was seen in only three

  10. Reverse transcription-quantitative polymerase chain reaction: description of a RIN-based algorithm for accurate data normalization

    Directory of Open Access Journals (Sweden)

    Boissière-Michot Florence


    Full Text Available Abstract Background Reverse transcription-quantitative polymerase chain reaction (RT-qPCR is the gold standard technique for mRNA quantification, but appropriate normalization is required to obtain reliable data. Normalization to accurately quantitated RNA has been proposed as the most reliable method for in vivo biopsies. However, this approach does not correct differences in RNA integrity. Results In this study, we evaluated the effect of RNA degradation on the quantification of the relative expression of nine genes (18S, ACTB, ATUB, B2M, GAPDH, HPRT, POLR2L, PSMB6 and RPLP0 that cover a wide expression spectrum. Our results show that RNA degradation could introduce up to 100% error in gene expression measurements when RT-qPCR data were normalized to total RNA. To achieve greater resolution of small differences in transcript levels in degraded samples, we improved this normalization method by developing a corrective algorithm that compensates for the loss of RNA integrity. This approach allowed us to achieve higher accuracy, since the average error for quantitative measurements was reduced to 8%. Finally, we applied our normalization strategy to the quantification of EGFR, HER2 and HER3 in 104 rectal cancer biopsies. Taken together, our data show that normalization of gene expression measurements by taking into account also RNA degradation allows much more reliable sample comparison. Conclusion We developed a new normalization method of RT-qPCR data that compensates for loss of RNA integrity and therefore allows accurate gene expression quantification in human biopsies.

  11. [Assessment of the treatment with imiquimod in persistent infection by human papillomavirus with the polimerase chain reaction method]. (United States)

    Hernández Quijano, Tomás; Illanes Aguiar, Berenice; Salas Linares, Natividad; Alarcón Romero, Luz del Carmen; Hernández Valencia, Marcelino


    Molecular studies have shown that oncogenic genotypes of human papillomavirus (HPV) are the main risk factor for cervical cancer development. Sub-clinical wound does not cause symptoms and is diagnosed by colposcopy or histology, in addition the latent infection is associated with the presence of DNA of the HPV, but when clinical and histological abnormalities are not presented only molecular techniques can detect this infection. To determine if complementary processing with imiquimod, recent medicament with powerful antiviral activity in vitro as in vivo, reduces the cervical persistence of HPV. This study was carried out with 87 patients, who had antecedents of HPV cervical and intraepithelial wound with low degree. Patients were divided as follows: treated with cryotherapy, cervical loop electrosurgical and imiquimod, all with diagnosis by cervical cytology, colposcopy and polymerase chain reaction (PCR) for HPV. At 3, 6 and 12 months after the processing, PCR, cervical cytology and colposcopy control were carried out again. Out of the 87 patients studied, 11% (10) patients treated with cervical cytology were positive for VPH; with colposcopy 8% (7) of patients and with PCR 40% (34) of patients; decreased persistence with combined methods of loop and imiquimod was obtained in 29% (5) patients; however, when utilized imiquimod alone, there were 55% (11) patients with persistence determined by PCR method. Imiquimod appears to be beneficial in 45% of the patients, in contrast with efficacy reported until 85% in genitals and annals warts, in addition, the capacity of eliminating the viruses has been shown, therefore it is possible that its potential effect could be observed long-time. It is evident that the percentages of viral detection are improved for PCR method, compared with indirect methods as cervical cytology and colposcopy, which is favorable when virus serotypes are of high degree of transformation and ablative methods should be conservatives due to

  12. Application of Polymerase Chain Reaction for High Sensitivity Detection of Roundup Ready™ Soybean Seeds and Grains in Varietal Mixtures

    Directory of Open Access Journals (Sweden)

    Ashok Pandey


    Full Text Available Strong increase in the production of genetically modified organisms (GMOs observed over the years has led to a consolidation of transgenic seed industries worldwide. The dichotomy between the evaluated risk and the perceived risk of transgenic use has defined their level of acceptability among different global societies. GMOs have been widely applied to agricultural commodities, among them the Roundup Ready™ (RR™ soybean line GTS 40-3-2 has become the most prevalent transgenic crop in the world. This variety was developed to confer plant tolerance against glyphosate-based agricultural herbicide Roundup Ready™. Issues related to detection and traceability of GMOs have gained worldwide interest due to their increasing global diffusion and the related socioeconomic and health implications. Also, due to the widespread use of GMOs in food production, labelling regulations have been established in some countries to protect the right of consumers and producers. Besides regulatory demand, consumer concern issues have resulted in the development of several methods of detecting and quantifying foods derived from genetically engineered crops and their raw materials. Polymerase chain reaction (PCR has been proven to be the method of choice to detect the presence or absence of the introduced genes of GMOs at DNA level. The present paper aims to verify whether the PCR technique can detect RR™ soybean seeds among conventional ones to further certification as non-GM soybean seeds and grains. This analysis could be accomplished through the development of new methodology called 'intentional contamination' of soybean conventional seeds or grains with the respective RR™ soybeans. The results show that the PCR method can be applied with high sensitivity in order to certify conventional soybean seeds and grains.

  13. Sampling the genomic pool of protein tyrosine kinase genes using the polymerase chain reaction with genomic DNA. (United States)

    Oates, A C; Wollberg, P; Achen, M G; Wilks, A F


    The polymerase chain reaction (PCR), with cDNA as template, has been widely used to identify members of protein families from many species. A major limitation of using cDNA in PCR is that detection of a family member is dependent on temporal and spatial patterns of gene expression. To circumvent this restriction, and in order to develop a technique that is broadly applicable we have tested the use of genomic DNA as PCR template to identify members of protein families in an expression-independent manner. This test involved amplification of DNA encoding protein tyrosine kinase (PTK) genes from the genomes of three animal species that are well known development models; namely, the mouse Mus musculus, the fruit fly Drosophila melanogaster, and the nematode worm Caenorhabditis elegans. Ten PTK genes were identified from the mouse, 13 from the fruit fly, and 13 from the nematode worm. Among these kinases were 13 members of the PTK family that had not been reported previously. Selected PTKs from this screen were shown to be expressed during development, demonstrating that the amplified fragments did not arise from pseudogenes. This approach will be useful for the identification of many novel members of gene families in organisms of agricultural, medical, developmental and evolutionary significance and for analysis of gene families from any species, or biological sample whose habitat precludes the isolation of mRNA. Furthermore, as a tool to hasten the discovery of members of gene families that are of particular interest, this method offers an opportunity to sample the genome for new members irrespective of their expression pattern.

  14. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process (United States)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.


    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  15. Optical diagnostics of vascular reactions triggered by weak allergens using laser speckle-contrast imaging technique

    International Nuclear Information System (INIS)

    Kuznetsov, Yu L; Kalchenko, V V; Astaf'eva, N G; Meglinski, I V


    The capability of using the laser speckle contrast imaging technique with a long exposure time for visualisation of primary acute skin vascular reactions caused by a topical application of a weak contact allergen is considered. The method is shown to provide efficient and accurate detection of irritant-induced primary acute vascular reactions of skin. The presented technique possesses a high potential in everyday diagnostic practice, preclinical studies, as well as in the prognosis of skin reactions to the interaction with potentially allergenic materials. (laser biophotonics)

  16. Optical diagnostics of vascular reactions triggered by weak allergens using laser speckle-contrast imaging technique

    Energy Technology Data Exchange (ETDEWEB)

    Kuznetsov, Yu L; Kalchenko, V V [Department of Veterinary Resources, Weizmann Institute of Science, Rehovot, 76100 (Israel); Astaf' eva, N G [V.I.Razumovsky Saratov State Medical University, Saratov (Russian Federation); Meglinski, I V [N.G. Chernyshevsky Saratov State University, Saratov (Russian Federation)


    The capability of using the laser speckle contrast imaging technique with a long exposure time for visualisation of primary acute skin vascular reactions caused by a topical application of a weak contact allergen is considered. The method is shown to provide efficient and accurate detection of irritant-induced primary acute vascular reactions of skin. The presented technique possesses a high potential in everyday diagnostic practice, preclinical studies, as well as in the prognosis of skin reactions to the interaction with potentially allergenic materials. (laser biophotonics)

  17. Comparison of techniques for the determination of conversion during suspension polymerization reactions

    Directory of Open Access Journals (Sweden)

    J. C. Santos


    Full Text Available The determination of conversion during suspension polymerization reactions is not an easy task due to the heterogeneity of the reaction medium and the tendency of particles to agglomerate rapidly when stirring is stopped. Usually, bulk polymerization in ampoules is employed to study the kinetics of suspension polymerization reactions. In this work, a comparison of different techniques for the determination of conversion during suspension polymerization reactions is presented. Results showed a good agreement between the conversion obtained by gravimetry during styrene suspension polymerization and on-line conversion monitoring data using fiber-optic based Raman Spectroscopy. Nevertheless, the polymerization rate of styrene bulk polymerization carried out in ampoules was higher than the real reaction rate of styrene suspension polymerization due to slightly higher reaction temperatures. Simulation results using the experimental temperature data in a mathematical model confirmed these results.

  18. Population synthesis of radio and gamma-ray millisecond pulsars using Markov Chain Monte Carlo techniques (United States)

    Gonthier, Peter L.; Koh, Yew-Meng; Kust Harding, Alice


    We present preliminary results of a new population synthesis of millisecond pulsars (MSP) from the Galactic disk using Markov Chain Monte Carlo techniques to better understand the model parameter space. We include empirical radio and gamma-ray luminosity models that are dependent on the pulsar period and period derivative with freely varying exponents. The magnitudes of the model luminosities are adjusted to reproduce the number of MSPs detected by a group of thirteen radio surveys as well as the MSP birth rate in the Galaxy and the number of MSPs detected by Fermi. We explore various high-energy emission geometries like the slot gap, outer gap, two pole caustic and pair starved polar cap models. The parameters associated with the birth distributions for the mass accretion rate, magnetic field, and period distributions are well constrained. With the set of four free parameters, we employ Markov Chain Monte Carlo simulations to explore the model parameter space. We present preliminary comparisons of the simulated and detected distributions of radio and gamma-ray pulsar characteristics. We estimate the contribution of MSPs to the diffuse gamma-ray background with a special focus on the Galactic Center.We express our gratitude for the generous support of the National Science Foundation (RUI: AST-1009731), Fermi Guest Investigator Program and the NASA Astrophysics Theory and Fundamental Program (NNX09AQ71G).

  19. Photo-Induced Electron-Exchange Reactions Exhibiting Chain Characteristics; Echanges d'Electrons Photoinduits Presentant les Caracteristiques d'une Reaction en Chaine; Vyzvannye fotonami reaktsii ehlektronnogo obmena, proyavlyayushchie kharakteristiki tsepochki; Intercambio de Electrones Fotoinducido del Tipo de Cadena

    Energy Technology Data Exchange (ETDEWEB)

    Stranks, D. R.; Yandell, J. R. [University of Adelaide, Adelaide (Australia)


    , which may be observed in rigorously pure reactant solutions. However, in solutions containing micromolar concentrations of impurities, this exponent can rise to 0.70 owing to the importance of the scavenging reaction Tl{sup 2}+ + S ->Tl{sup +} (or Tl{sup 3+}) + S'. The short lifetime of Tl{sup 2+} (probably milliseconds) has so far prevented the measurement of the rate of the Tl{sup 2+} disproportionation reaction by rotating sector techniques. The relative rates of these electron-transfer reactions are discussed in terms of electron-tunnelling theories. The observed primary quantum yield for the reaction Tl{sup 3+}. OH{sup -} + hv -> Tl{sup 2+} + OH is shown to be consistent with the Noyes theory of diffusion of geminate radicals. (author) [French] L'absorption d'une lumiere de longueur d'onde appropriee peut considerablement accelerer la vitesse d'un echange deux electrons. L'absorption avec transfert de charges produit un etat d'oxydation intermediaire auquel est due la propagation d'une reaction en chaine entre les deux etats d'oxydation stables. Les auteurs etablissent les equations cinetiques generales pour les systemes d'echange impliquant une propagation en chaine et une terminaison soit lineaire soit quadratique. Ils demontrent que la relation de dependance entre le rendement quantique observe, d'une part, et les concentrations en corps reagissants et l'intensite de la lumiere absorbee, d'autre part, est plus complexe que dans l'hypothese admise jusqu'ici. En principe, une etude cinetique portant sur un tel systeme d'echange devrait tendrea evaluer le rendement quantique primaire pour le processus d'absorption initial avec transfert de charge, les vitesses du transfert d'electrons entre chacun des deux etats d'oxydation stables et l'etat intermediaire, ainsi que la vitesse de dismutation de l'etat d'oxydation intermediaire. Ces considerations generales sont illustrees par les resultats d'une etude experimentale sur le systeme Tl{sup I}-Tl{sup III}. Pour

  20. Lower-Order Compensation Chain Threshold-Reduction Technique for Multi-Stage Voltage Multipliers

    Directory of Open Access Journals (Sweden)

    Francesco Dell’ Anna


    Full Text Available This paper presents a novel threshold-compensation technique for multi-stage voltage multipliers employed in low power applications such as passive and autonomous wireless sensing nodes (WSNs powered by energy harvesters. The proposed threshold-reduction technique enables a topological design methodology which, through an optimum control of the trade-off among transistor conductivity and leakage losses, is aimed at maximizing the voltage conversion efficiency (VCE for a given ac input signal and physical chip area occupation. The conducted simulations positively assert the validity of the proposed design methodology, emphasizing the exploitable design space yielded by the transistor connection scheme in the voltage multiplier chain. An experimental validation and comparison of threshold-compensation techniques was performed, adopting 2N5247 N-channel junction field effect transistors (JFETs for the realization of the voltage multiplier prototypes. The attained measurements clearly support the effectiveness of the proposed threshold-reduction approach, which can significantly reduce the chip area occupation for a given target output performance and ac input signal.

  1. Lower-Order Compensation Chain Threshold-Reduction Technique for Multi-Stage Voltage Multipliers. (United States)

    Dell' Anna, Francesco; Dong, Tao; Li, Ping; Wen, Yumei; Azadmehr, Mehdi; Casu, Mario; Berg, Yngvar


    This paper presents a novel threshold-compensation technique for multi-stage voltage multipliers employed in low power applications such as passive and autonomous wireless sensing nodes (WSNs) powered by energy harvesters. The proposed threshold-reduction technique enables a topological design methodology which, through an optimum control of the trade-off among transistor conductivity and leakage losses, is aimed at maximizing the voltage conversion efficiency (VCE) for a given ac input signal and physical chip area occupation. The conducted simulations positively assert the validity of the proposed design methodology, emphasizing the exploitable design space yielded by the transistor connection scheme in the voltage multiplier chain. An experimental validation and comparison of threshold-compensation techniques was performed, adopting 2N5247 N-channel junction field effect transistors (JFETs) for the realization of the voltage multiplier prototypes. The attained measurements clearly support the effectiveness of the proposed threshold-reduction approach, which can significantly reduce the chip area occupation for a given target output performance and ac input signal.

  2. Qualitative and quantitative polymerase chain reaction (PCR) for detection of Leishmania in spleen samples from naturally infected dogs. (United States)

    Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares


    Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic

  3. Enhanced protein electrophoresis technique for separating human skeletal muscle myosin heavy chain isoforms (United States)

    Bamman, M. M.; Clarke, M. S.; Talmadge, R. J.; Feeback, D. L.


    Talmadge and Roy (J. Appl. Physiol. 1993, 75, 2337-2340) previously established a sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS-PAGE) protocol for separating all four rat skeletal muscle myosin heavy chain (MHC) isoforms (MHC I, IIa, IIx, IIb); however, when applied to human muscle, the type II MHC isoforms (Ila, IIx) are not clearly distinguished. In this brief paper we describe a modification of the SDS-PAGE protocol which yields distinct and consistent separation of all three adult human MHC isoforms (MHC I, IIa, IIx) in a minigel system. MHC specificity of each band was confirmed by Western blot using three monoclonal IgG antibodies (mAbs) immunoreactive against MHCI (mAb MHCs, Novacastra Laboratories), MHCI+IIa (mAb BF-35), and MHCIIa+IIx (mAb SC-71). Results provide a valuable SDS-PAGE minigel technique for separating MHC isoforms in human muscle without the difficult task of casting gradient gels.

  4. Rapid identification of Mycobacterium avium ssp paratuberculosis laboratory strains by IS900-Nested polymerase chain reaction. (United States)

    Taheri, Mohammad Mohammad; Mosavari, Nader; Feizabadi, Mohammad Mehdi; Tadayon, Keyvan; Keshavarz, Rouholah; Pajoohi, Reza Aref; Soleimani, Kioomars; Pour, Shojaat Dashti


    Mycobacterium avium ssp paratuberculosis (MAP) causes paratuberculosis (Johne's disease) in ruminants. As a species, M. avium comprises M. avium subsp. hominissuis and a number of clones that are known to have evolved from this subspecies, namely M. avium subsp. avium (MAA), M. avium subsp. silvaticum, and MAP. Despite the very high genomic similarity of MAP and MAA, the insertion sequence IS900, which is 1,451-bp long, is now understood to be exclusively present in 10-20 copies in the genome of MAP. In the present study, a multidiscipline polymerase chain reaction (PCR)-based algorithm targeting16SrRNA, IS6110, IS901, IS1245, and IS900 markers has been employed to differentiate between six laboratory strains of M. avium complex (including MAP 316F, III&V, and 2e plus MAA D4), Mycobacterium tuberculosis DT, and Mycobacterium bovis AN5 strains used at the Razi Institute (Tehran, Iran) for the preparation of paratuberculin, avian, human, and bovine tuberculin, respectively. Three laboratory strains of III&V, 2e, and 316F were subcultured on Herrold's egg yolk medium, whereas the MAA strain of D4 along with M. bovis AN5 and M. tuberculosis DT were subcultured on Lowenstein-Jensen slopes. All the inoculated culture tubes were incubated for 8weeks at 37°C. Eventually, their genomic DNA was extracted according to the method of van Soolingen. Five individual PCRs were conducted on these templates to amplify 16SrRNA (genus-specific marker shared by all mycobacteria), IS900 (MAP-specific marker), IS901 (MAA-specific marker), IS1245 (M. avium complex (MAC)-specific marker), and IS6110 (M. tuberculosis complex (MTC)-specific marker) loci. Consequently, a 543-bp amplicon was amplified by all the six strains in PCR against 16SrRNA, an indication of their identity as members of Mycobacterium genus. A 245-bp fragment was detected in only IS6110-PCR with M. bovis AN5 as well as M. tuberculosis DT. In the IS1245 assessment, the MAA strain of D4 produced a 427-bp amplicon, whereas

  5. Building supply chain communication systems: a review of methods and techniques

    Directory of Open Access Journals (Sweden)

    A F Cutting-Decelle


    Full Text Available With the increasing importance of computer-based communication technologies, communication networks are becoming crucial in supply chain management. Given the objectives of the supply chain, supply chain management is situated at the intersection of different professional sectors, each of them with its own vocabulary, its own knowledge and rules. This paper provides a review of the main approaches to supply chain communications through the analysis of different ways of modelling a supply chain and the presentation of new semantic-based approaches that have been and are being developed to improve the quality of the information exchanges within the supply chain.

  6. The existence and characterization of self-sustaining multiplicative fusion and fission reaction chains

    International Nuclear Information System (INIS)

    Harms, A.A.; Heindler, M.


    The mathematical-physical similarities and differences between fusion and fission multiplication processes are investigated. It is shown that advanced fusion cycles can sustain excursion tendencies which are essentially analogous to conventional fission cycles. The result that fission excursions are unbounded and that fusion excursions eventually attain an asymptote represents a significant distinction between these fundamental self-sustaining nuclear multiplicative chains. (Auth.)

  7. Molecular weight control in emulsion polymerization by catalytic chain transfer : a reaction engineering approach

    NARCIS (Netherlands)

    Smeets, N.M.B.; Meda, U.S.; Heuts, J.P.A.; Keurentjes, J.T.F.; Herk, van A.M.; Meuldijk, J.


    For the application of catalytic chain transfer in (mini)emulsion polymerization, catalyst partitioning and deactivation are key parameters that govern the actual catalyst concentration at the locus of polymerization and consequently the final molecular weight distribution. A global model, based on

  8. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline


    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...

  9. The evaluation of supply chain performance in the Oil Products Distribution Company, using information technology indicators and fuzzy TOPSIS technique

    Directory of Open Access Journals (Sweden)

    Daryosh Mohamadi Janaki


    Full Text Available Information Technology (IT plays an essential role on development of effective supply chain planning and it can improve the supply chain performance, either directly or indirectly. As a national industry, the National Iranian Oil Products Distribution Company involves a large number of organizations within its supply chain. Therefore, this descriptive-survey uses information sharing indicators, fuzzy TOPSIS technique based on managers and expert opinions to evaluate and to rank some oil products distribution companies. Data are analyzed and the results show that Oil Products Distribution Company of Chaharmahal and Bakhtiari received the highest rank and Farsan maintained the lowest rank compared with other regional companies.

  10. Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique (United States)

    Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing


    Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.

  11. Polymerase chain reaction fingerprints of methicillin-resistant Staphylococcus aureus clinical isolates in Greece are related to certain antibiotypes. (United States)

    Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris


    Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.

  12. AFM Imaging of Hybridization Chain Reaction-Mediated Signal Transmission Between two DNA Origami Structures

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelbo; Gothelf, Kurt Vesterager


    transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins - of which one is immobilized in specific points along tracks on DNA origami structures - are polymerized to form a continuous DNA duplex, which is visible using atomic force...... microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred >200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another...

  13. Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

    Energy Technology Data Exchange (ETDEWEB)

    Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.


    Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.

  14. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    DEFF Research Database (Denmark)

    Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen


    Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...


    Directory of Open Access Journals (Sweden)

    A. A. Sultanova


    Full Text Available It is the chain growth specific reaction rate that was determined for the process of methyl methacrylate mass radical polymerization within the temperature range of 40–900 С in quasi-steady approximation by means of Monte Carlo method. The theoretical model of radical polymerization was developed taking the gel effect into account. Computer software was developed that enables to imitate radical polymerization process taking gel effect into account within the minimum run time. The programme was tested on asymptotic examples as well as was applied for methyl methacrylate mass radical polymerization. The programme makes it possible to calculate monomer conversion, molecular mass variation, molecular-mass distribution, etc.

  16. Detection of Vibrio spp. in shrimp from aquaculture sites in Iran using polymerase chain reaction (PCR)


    Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy


    Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...

  17. Molecular detection of the carriage rate of four intestinal protozoa with real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L


    Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub......-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...

  18. The Importance of IgG Avidity and the Polymerase Chain Reaction in Treating Toxoplasmosis during Pregnancy: Current Knowledge

    Directory of Open Access Journals (Sweden)

    João Bortoletti Filho


    Full Text Available A brief report on the nature and epidemiology of T. gondii infection is firstly presented. The importance of the specific IgG avidity test and polymerase chain reaction (PCR for toxoplasmosis is discussed, along with their significance and importance as auxiliary methods for determining the most likely time for the initial infection by this coccidian and for defining the therapeutic strategy. Lastly, practical comments are made in relation to the classical therapeutic regimens, with special attention to the indications for fetal treatment, when this is necessary.

  19. Rapid detection of cytomegalovirus in bronchoalveolar lavage fluid and serum samples by polymerase chain reaction: correlation of virus isolation and clinical outcome for patients with human immunodeficiency virus infection

    DEFF Research Database (Denmark)

    Hansen, K K; Vestbo, Jørgen; Benfield, T


    Bronchoalveolar lavage (BAL) fluids and serum samples from 153 patients with pulmonary symptoms who were infected with human immunodeficiency virus (HIV) and underwent BAL were examined for the presence of cytomegalovirus (CMV) by conventional culture and by polymerase chain reaction (PCR...... technique than conventional culture. Detection of CMV DNA in BAL fluid or serum predicted subsequent development of extrapulmonary CMV disease but not death for HIV-infected patients with pulmonary symptoms....

  20. Time-resolved studies of free radicals and laser-initiated chain reactions: Final report, 1 April 1979-31 March 1988

    International Nuclear Information System (INIS)

    Leone, S.R.


    Pulsed lasers were used in this work to photofragment molecules or to initiate chain reactions. One of the major advances was the availability of high-powered rare gas halide excimer lasers. In addition, pulsed Nd:YAG lasers and dye lasers were used throughout. Results include: generalized kinetic formulations of the problem of laser-initiated chain reactions. Several studies were carried out to explore the details of chain combustion phenomena, slow chain reactions, chain branching behavior, and vibrational temperatures of combusting mixtures. A method to determine the rotational temperature of nitrogen molecules by laser multiphoton ionization was shown. The chain reaction methodology was applied to complex polyatomic systems, in which complete infrared spectra of the emitting species were obtained. Systems studied included, chlorine + HBr, HI, methane, hydrogen, ethane, propane, butane, cyclopropane, and cyclohexane. Photofragmentation studies involved the production and analysis of radical species, such as methyl, CH 2 I, and CCH. Molecules studied included methylene iodide, methyl iodide, dimethyl mercury, acetone, acetylene, vinyl chloride, dichloroethylene, and fluorochloroethylene. The first infrared characterization of a highly vibrationally excited radical was shown. Reactions of methyl radicals were studied in detail, in which a new method for obtaining absolute values of the methyl radical reaction rates were obtained

  1. Enhanced detection rate of typhoid fever among clinically suspected patients in a tertiary referral hospital in Dhaka, Bangladesh using nested polymerase chain reaction technology. (United States)

    Khan, S; Miah, M R; Khatun, S


    A nested polymerase chain reaction (PCR) specific for Salmonella enterica subspecies enteric serovar Typhi was used for the detection of the pathogen, in blood. This study was done during the period of March 2013 to February 2014. A total of 80 clinically suspected cases of typhoid fever were included in the study. Blood was collected from all participating individuals. Nested PCR targeting the flagellin gene (fliC) of Salmonella Typhi & blood culture were done for each of the cases. The positivity rate of PCR & blood culture was 70%& 20% respectively. The positivity rate of PCR was significantly higher than blood culture (Ptyphoid fever cases on the basis of clinical features but with negative cultures. We conclude that the PCR technique could be used as a novel diagnostic method of typhoid fever, particularly in culture-negative cases in an endemic country like Bangladesh.

  2. Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells. (United States)

    Pierce, Kenneth E; Wangh, Lawrence J


    Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.

  3. Diagnosis of Gestational, Congenital, and Placental Malaria in Colombia: Comparison of the Efficacy of Microscopy, Nested Polymerase Chain Reaction, and Histopathology (United States)

    Campos, Ivón M.; Uribe, Mary L.; Cuesta, Carolina; Franco-Gallego, Alexander; Carmona-Fonseca, Jaime; Maestre, Amanda


    The technical capability of different methods to diagnose Plasmodium in maternal peripheral blood, placenta, and umbilical cord blood has not been assessed in Colombia and seldom explored in other malaria-endemic regions. We designed a study to compare the technical and the operational-economical performances of light microscopy (LM), nested polymerase chain reaction (nPCR), and histopathology (HP). In maternal blood, LM had 41% sensitivity and 100% specificity and in placental blood, 35% and 100%, respectively, compared with nPCR. In placental tissue, LM had 33% sensitivity and 95% specificity; and nPCR 47% and 77%, respectively; compared with HP. Light microscopy had the best operational-economical qualification. We concluded that nPCR and HP performed better compared with LM, but field implementation of these two techniques remains a problem. Therefore, LM is recommended as the gold standard for diagnosis of gestational malaria and placental blood infection in the field. PMID:21633030

  4. The hypertriglyceridemic clamp technique. Studies using long-chain and structured triglyceride emulsions in healthy subjects. (United States)

    Nordenström, Jörgen; Thörne, Anders; Aberg, Wiveca; Carneheim, Claes; Olivecrona, Thomas


    In a randomized crossover study, plasma kinetics of 2 different types of fat emulsions were studied in 8 healthy volunteers by using a hypertriglyceridemic clamp technique. The method involves the stabilization of serum triglyceride (TG) concentration during 180 minutes at a predetermined level (4 mmol/L) by adjustment of TG infusion rate by repeated online measurements of serum TG concentration. The fat emulsions under study were a long-chain fatty acid triglyceride (LCT) emulsion (Intralipid 20%, Fresenius Kabi, Sweden) and a structured triglyceride (STG) emulsion (Structolipid 20%, Fresenius Kabi) where medium- and long-chain fatty acids have been interesterified within a TG molecule. The hypertriglyceridemic clamp was found to have acceptable reproducibility when tested in 3 healthy individuals on 2 different occasions, as similar steady-state TG levels were obtained by infusing similar amounts of fat. The average (+/-SEM) TG concentration during the 180-minute clamp was similar for STGs and LCTs (4.0 +/- 0.1 vs 3.9 +/- 0.1 mmol/L; not significant), but the amount of fat that had to be infused was significantly higher during STG than during LCT clamping (0.31 +/- 0.04 vs 0.21 +/- 0.02 g TG per minute; P < .05). Higher serum levels of free fatty acids (1.80 +/- 0.13 vs 0.96 +/- 0.09 mmol/L; P < .05), free glycerol (1.30 +/- 0.07 vs 0.76 +/- 0.08 mmol/L; P < .001), and beta-OH butyrate (1.61 +/- 0.44 vs 1.17 +/- 0.23 mmol/L; not significant) were obtained at the end of the clamp during infusion of STGs compared with LCTs. During infusion of STGs the medium-chain fatty acids octanoic (C:8) and decanoic acid (C:10) constituted approximately half of circulating fatty acids that correspond to the compositional ratio of the emulsion. Plasma lipoprotein lipase (LPL) concentration was higher during STG than during LCT clamping (6.06 +/- 0.62 vs 3.15 +/- 0.40 mU/mL; P < .05), and there was a positive correlation between the mean LPL concentration and the amount of

  5. Polymerase chain reaction amplification fails to detect aromatase cytochrome P450 transcripts in normal human endometrium or decidua. (United States)

    Bulun, S E; Mahendroo, M S; Simpson, E R


    It has been proposed that the biosynthesis of estrogens by the human endometrium may be of physiological significance during the menstrual cycle. Local estrogen production was also suggested to be important in the development of endometrial cancer; however, the presence or absence of aromatase enzyme activity in normal human endometrium is controversial. To address this issue, we used a sensitive technique capable of detecting mRNA transcripts present in only very low copy number. The polymerase chain reaction linked to reverse transcription (RT-PCR) was used to evaluate the presence or absence of aromatase cytochrome P450 (P450arom) transcripts in endometrial tissues (n = 7) and endometrial stromal cells (n = 9) under various culture conditions. RNA was isolated from four proliferative and three secretory tissue samples and from cultured endometrial stromal cells isolated from seven proliferative and two secretory endometria. Five sets of cultures were treated with medroxyprogesterone acetate (MPA), estradiol (E2), and forskolin. Additionally, RNA was isolated from decidualized endometrium obtained from a patient with tubal pregnancy. A single stranded cDNA was synthesized from total RNA using Moloney murine leukemia virus reverse transcriptase and a P450arom-specific oligonucleotide. The single stranded cDNA was used as a template for PCR and was amplified for 20-35 cycles using P450arom-specific primers. RNA from adipose tissue and placenta was amplified to provide positive controls, whereas myometrial RNA was used as a negative control. In two experiments involving two endometrial tissues and three sets of cells in culture, a rat P450arom cRNA was coamplified in each sample as an internal control to demonstrate that the remote possibility of RT-PCR failures in individual test samples cannot account for our negative results. By Southern or slot blot hybridization of the amplified fragments using human and rat P450arom-specific probes, we found no evidence for


    Directory of Open Access Journals (Sweden)

    Devita Kusdianingrum


    Full Text Available ABSTRAK: Sekitar 8-20% isolate M. tuberculosis yang resisten terhadap isoniazid diketahui telah mengalami mutasi pada posisi regio promoter inhA [1]. Untuk memperoleh titik mutasi pada regio promoter, maka amplifikasi fragmen target perlu untuk dilakukan. Tujuan dilakukannya penelitian ini adalah untuk mengamplifikasi regio promoter inhA, mengetahui ada tidaknya mutasi dan jenis mutasi pada isolat 134 MDR-TB. Tahap isolasi DNA dilakukan menggunakan metode Boom yang telah dimodifikasi. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ dan reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’. Amplikon disekuensing secara satu arah menggunakan forward primer. Analisis homologi dilakukan menggunakan program online BLASTn, sementara identifikasi mutasi dilakukan menggunakan software MEGA4. Hasil penelitian menunjukkan bahwa analisis homologi isolate 134 terhadap M. tuberculosis H37Rv adalah sebesar 99%. Tahap analisis mutasi menemukan terjadinya perubahan sitosin menjadi timin (CàT pada posisi -15 isolat 134 MDR-TB   ABSTRACT: Approximately 8-20% M. tuberculosis isolates that are resistant to isoniazid habe been known to have a mutation in inhA promoter region [1]. To find the mutation in inhA promoter region, it is necessary to carry out the amplification of the target fragment. The purpose of this research were to amplify the inhA promoter region and to find out if there is a mutation and type of mutation at MDR-TB isolate. DNA isolation was done by a modified Boom method. Target fragment was amplified by a pair primer (forward primer 5’ ACATACCTGCTGCGCAAT 3’ and reverse primer 5’ CTCCGGTAACCAGGACT GAA 3’ using Polymerase Chain Reaction (PCR technique. Amplicon was sequenced in one forward direction. Homology analysis was conducted by online BLASTn program, while the mutation was identified by MEGA4. The result of this research showed that homology analysis of 134 was homolog

  7. Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal. (United States)

    Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P


    The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.

  8. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis. (United States)

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui


    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

  9. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection. (United States)

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao


    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

  10. Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples (United States)

    Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo


    Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

  11. Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

    Energy Technology Data Exchange (ETDEWEB)

    Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)


    Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

  12. Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

    International Nuclear Information System (INIS)

    Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David


    Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

  13. Multiple and high-throughput droplet reactions via combination of microsampling technique and microfluidic chip

    KAUST Repository

    Wu, Jinbo


    Microdroplets offer unique compartments for accommodating a large number of chemical and biological reactions in tiny volume with precise control. A major concern in droplet-based microfluidics is the difficulty to address droplets individually and achieve high throughput at the same time. Here, we have combined an improved cartridge sampling technique with a microfluidic chip to perform droplet screenings and aggressive reaction with minimal (nanoliter-scale) reagent consumption. The droplet composition, distance, volume (nanoliter to subnanoliter scale), number, and sequence could be precisely and digitally programmed through the improved sampling technique, while sample evaporation and cross-contamination are effectively eliminated. Our combined device provides a simple model to utilize multiple droplets for various reactions with low reagent consumption and high throughput. © 2012 American Chemical Society.

  14. Meat species identification by polymerase chain reaction technique to authenticate alheiras de caça


    Santos, C.G.; Melo, V.S.; Amaral, J.S.; Oliveira, M.B.P.P.; Mafra, I.


    The manufacture of traditional meat products is a long-established practice in the Northeast of Portugal, being Alheiras one of the most appreciated products. Alheiras are traditional smoked fermented sausages, mainly produced with pork and poultry meat in a mixture with bread and spices. Currently, game meat Alheiras (Alheiras de caça) are also available as very attractive meat products and prone to adulterations. To allow accurate information for consumers and avoid unfair co...

  15. Detection of adulterations in tradictional portuguese game meat products by polymerase chain reaction technique


    Santos, C.G.; Melo, V.S.; Amaral, J.S.; Oliveira, M.B.P.P.; Mafra, I.


    Authenticity assessment and fraud detection in processed meat products have becn attracting an increased attention driven by public health, economic and legal cancems, and also for religiolls reasons. Currcntly, ooe af the major issues conceming adulterations in the meat indust:ry regards the fraudulent substitution af higher commercial valued meat species by less expensive oDes [1]. The manufacture af traditional meat products is a long-established practice in the Northeast of Po...

  16. Sample preparation techniques based on combustion reactions in closed vessels - A brief overview and recent applications

    International Nuclear Information System (INIS)

    Flores, Erico M.M.; Barin, Juliano S.; Mesko, Marcia F.; Knapp, Guenter


    In this review, a general discussion of sample preparation techniques based on combustion reactions in closed vessels is presented. Applications for several kinds of samples are described, taking into account the literature data reported in the last 25 years. The operational conditions as well as the main characteristics and drawbacks are discussed for bomb combustion, oxygen flask and microwave-induced combustion (MIC) techniques. Recent applications of MIC techniques are discussed with special concern for samples not well digested by conventional microwave-assisted wet digestion as, for example, coal and also for subsequent determination of halogens

  17. Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction. (United States)

    Saed, Mohand O; Torbati, Amir H; Nair, Devatha P; Yakacki, Christopher M


    This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addition reaction. Strain-to-failure and glass transition behavior were investigated as a function of crosslinking monomer, pentaerythritol tetrakis(3-mercaptopropionate) (PETMP). An example non-stoichiometric system of 15 mol% PETMP thiol groups and an excess of 15 mol% acrylate groups was used to demonstrate the robust nature of the material. The LCE formed an aligned and transparent monodomain when stretched, with a maximum failure strain over 600%. Stretched LCE samples were able to demonstrate both stress-driven thermal actuation when held under a constant bias stress or the shape-memory effect when stretched and unloaded. A permanently programmed monodomain was achieved via a second-stage photopolymerization reaction of the excess acrylate groups when the sample was in the stretched state. LCE samples were photo-cured and programmed at 100%, 200%, 300%, and 400% strain, with all samples demonstrating over 90% shape fixity when unloaded. The magnitude of total stress-free actuation increased from 35% to 115% with increased programming strain. Overall, the two-stage TAMAP methodology is presented as a powerful tool to prepare main-chain LCE systems and explore structure-property-performance relationships in these fascinating stimuli-sensitive materials.

  18. A comparison of approximation techniques for variance-based sensitivity analysis of biochemical reaction systems

    Directory of Open Access Journals (Sweden)

    Goutsias John


    Full Text Available Abstract Background Sensitivity analysis is an indispensable tool for the analysis of complex systems. In a recent paper, we have introduced a thermodynamically consistent variance-based sensitivity analysis approach for studying the robustness and fragility properties of biochemical reaction systems under uncertainty in the standard chemical potentials of the activated complexes of the reactions and the standard chemical potentials of the molecular species. In that approach, key sensitivity indices were estimated by Monte Carlo sampling, which is computationally very demanding and impractical for large biochemical reaction systems. Computationally efficient algorithms are needed to make variance-based sensitivity analysis applicable to realistic cellular networks, modeled by biochemical reaction systems that consist of a large number of reactions and molecular species. Results We present four techniques, derivative approximation (DA, polynomial approximation (PA, Gauss-Hermite integration (GHI, and orthonormal Hermite approximation (OHA, for analytically approximating the variance-based sensitivity indices associated with a biochemical reaction system. By using a well-known model of the mitogen-activated protein kinase signaling cascade as a case study, we numerically compare the approximation quality of these techniques against traditional Monte Carlo sampling. Our results indicate that, although DA is computationally the most attractive technique, special care should be exercised when using it for sensitivity analysis, since it may only be accurate at low levels of uncertainty. On the other hand, PA, GHI, and OHA are computationally more demanding than DA but can work well at high levels of uncertainty. GHI results in a slightly better accuracy than PA, but it is more difficult to implement. OHA produces the most accurate approximation results and can be implemented in a straightforward manner. It turns out that the computational cost of the

  19. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain. (United States)

    Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur


    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

  20. Polymerase chain reaction and nested-PCR approaches for detecting Cryptosporidium in water catchments of water treatment plants in Curitiba, State of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Silvia Cristina Osaki


    Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.

  1. Simultaneous detection of hepatitis B virus genotypes and mutations associated with resistance to lamivudine, adefovir, and telbivudine by the polymerase chain reaction-ligase detection reaction

    Directory of Open Access Journals (Sweden)

    Yong-Zhong Wang

    Full Text Available OBJECTIVES: Detection of mutations associated to nucleos(tide analogs and hepatitis B virus (HBV genotyping are essential for monitoring treatment of HBV infection. We developed a multiplex polymerase chain reaction-ligase detection reaction (PCR-LDR assay for the rapid detection of HBV genotypes and mutations associated with lamivudine, adefovir, and telbivudine resistance in HBV-infected patients. METHODS: HBV templates were amplified by PCR, followed by LDR and electrophoresis on a sequencer. The assay was evaluated using plasmids that contained wild-type or mutant HBV sequences and 216 clinical samples. RESULTS: The PCR-LDR assay and sequencing gave comparable results for 158 of the 216 samples (73.1% with respect to mutation detection and genotyping. Complete agreement between the two methods was observed for all the samples (100% at codon 180 and codon 204. Concordant results were observed for 99.4% of the 158 samples at codon 181 and 98.7% at codon 236. The genotyping results were completely concordant between the PCR-LDR assay and sequencing. The PCR-LDR assay could detect a proportion of 1% mutant plasmid in a background of wild-type plasmid. CONCLUSION: The PCR-LDR assay is sensitive and specific for detection of HBV genotypes and drug resistance mutations, and could be helpful for decision making in the treatment of HBV infection.

  2. Pelacakan Virus Bercak Putih pada Udang Vaname (Litopenaeus vannamei di Lombok dengan Real-Time Polymerase Chain Reaction (DETECTION OF WHITE SPOT SYNDROME VIRUS IN LITOPENAEUS VANNAMEI IN LOMBOK ISLAND USING REAL-TIME POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Lulu Arafani


    Full Text Available White spot syndrome virus (WSSV is one of the most threatening diseases in shrimp and othercrustaceans affecting global shrimp farming. Since firstly detected in Taiwan in 1992, the disease hasspread globally and followed with considerable socio-economic consequences. This research was performedto detect the WSSV infection in shrimp farming in Lombok Island’s (West Nusa Tenggara using real-timepolymerase chain reaction. Samples of vaname (Litopenaeus vannamei were collected from several shrimpfarming in Lombok. Results indicated that the spread of WSSV has reached shrimp farms in Lombok,especially in Lendang Jae, West Lombok. Therefore, a biosurveillance program is strongly recommendedto government to avoid and halt the spread of the disease in East Indonesia region .

  3. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction. (United States)

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas


    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  4. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection. (United States)

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria


    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  5. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis (United States)

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.


    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  6. Machine learning techniques for gait biometric recognition using the ground reaction force

    CERN Document Server

    Mason, James Eric; Woungang, Isaac


    This book focuses on how machine learning techniques can be used to analyze and make use of one particular category of behavioral biometrics known as the gait biometric. A comprehensive Ground Reaction Force (GRF)-based Gait Biometrics Recognition framework is proposed and validated by experiments. In addition, an in-depth analysis of existing recognition techniques that are best suited for performing footstep GRF-based person recognition is also proposed, as well as a comparison of feature extractors, normalizers, and classifiers configurations that were never directly compared with one another in any previous GRF recognition research. Finally, a detailed theoretical overview of many existing machine learning techniques is presented, leading to a proposal of two novel data processing techniques developed specifically for the purpose of gait biometric recognition using GRF. This book · introduces novel machine-learning-based temporal normalization techniques · bridges research gaps concerning the effect of ...

  7. Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting

    DEFF Research Database (Denmark)

    Atabay, H. I.; Bang, Dang Duong; Aydin, F.


    Aims: The objective of this study was to subtype Arcobacter butzleri isolates using RAPD-PCR. Methods and Results: Thirty-five A. butzleri isolates obtained from chicken carcasses were examined. PCR-mediated DNA fingerprinting technique with primers of the variable sequence motifs was used...... to detect polymorphism within the isolates. Eleven distinct DNA profiles were obtained as follows: Of the 35 strains, 10 as profile 4; seven as profile 1; five as profile 3; three as profiles 2 and 9; two as profile 10; one as profiles 5, 6, 7, 8 and 11. Conclusions: Chicken carcasses sold in markets were...... found to be contaminated with several different strains of A. butzleri . RAPD-PCR technique was found to be a useful technique for distinguishing A. butzleri isolates. Significance and Impact of the Study: The presence of several different A. butzleri strains on chicken carcasses may indicate multiple...

  8. Identification of Bacterial Plant Pathogens Using Multilocus Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry (United States)


    pathogens also have been detected and identified by numerous nucleic acid-based techniques, including Southern blot hybridization and direct nucleotide...Xanthomonas axonopodis pv. vitians FB-1309; ATCC19320 Lettuce ; USA 1 Xanthomonas axonopodis sp. alfalfae XA129; Med. 2 Alfalfa; Sudan 1 Xanthomonas

  9. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13. (United States)

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna


    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.

  10. Frequency of Chlamydia trachomatis among male patients with urethritis in northeast of Iran detected by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Kiarash Ghazvini


    Full Text Available Planning for appropriate preventive measures against Chlamydia trachomatis, a common cause of sexually transmitted disease, requires knowledge of prevalence of infection so that interventions can be targeted in a cost-effective manner. This study was performed on 178 male patients presenting with urethritis in the Mashhad province to determine the prevalence of chlamydial infection in Northeast Iran. A cotton swab and first voided urine specimen were collected according to standard procedures. Polymerase chain reaction (PCR tests were used for the detection of C. trachomatis in the specimens collected and the results were analyzed using SPSS program. Results showed that 10.6% of male patients in this group were infected with C. trachomatis. This study provides strong evidence that prevalence of Chlamydia in the Northeast Iran is high and suggests that Chlamydia screening as a routine part of STD investigations is highly necessary in this area.

  11. Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction. (United States)

    Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal


    The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

  12. Detection of Coxiella burnetii in Aborted Fetuses of Cattle and Sheep Using Polymerase Chain Reaction Assay in Mashhad City, Iran

    Directory of Open Access Journals (Sweden)

    Zeinab Abiri


    Full Text Available Background: Coxiella burnetii is an important intracellular pathogen that ruminants can act as primary reservoirs. Reservoirs may excrete the bacterium into the placenta, vaginal mucus and feces. Objectives: The aim of this study was to detect C. burnetii in aborted samples from ruminant flocks in Mashhad city, northeast of Iran, using the polymerase chain reaction (PCR assay. Materials and Methods: A total number of 154 fetal tissue samples of cattle, sheep and goat were subjected to nested PCR assay. Results: Sixteen (17.3% out of 92 samples from sheep and 15 (25% from 60 cattle fetuses were positive. Conclusions: The results of this study indicate the presence of C. burnetii in aborted ruminants and these can be the potential reservoirs of C. burnetii in the mentioned area.

  13. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation. (United States)

    Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum


    A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda


    Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

  15. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice. (United States)

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H


    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  16. Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

    International Nuclear Information System (INIS)

    Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong


    Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

  17. Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction. (United States)

    Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton


    A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

  18. Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction. (United States)

    Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi


    A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

  19. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans. (United States)

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi


    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  20. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper


    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...


    Kelly, Kathleen M; Wack, Allison N; Bradway, Dan; Simons, Brian W; Bronson, Ellen; Osterhout, Gerard; Parrish, Nicole M; Montali, Richard J


    A 25-yr-old Diana monkey (Cercopithecus diana) with a 1.5-yr history of chronic colitis and diarrhea was found to have disseminated granulomatous disease with intralesional acid fast bacilli. Bacilli were identified as Mycobacterium genavense by polymerase chain reaction, sequencing of the 16S-23S ribosomal RNA intergenic spacer (ITS) gene, and mycolic acid analysis by high-performance liquid chromatography. Mycobacterium genavense is a common cause of mycobacteriosis in free-ranging and captive birds. In addition, recognition of opportunistic infection in human immunodeficiency virus-positive patients is increasing. Disease manifestations of M. genavense are similar to Mycobacterium avium complex (MAC) and include fever, wasting, and diarrhea with disseminated disease. Similar clinical signs and lesions were observed in this monkey. Mycobacterium genavense should be considered as a differential for disseminated mycobacterial disease in nonhuman primates as this agent can mimic MAC and related mycobacteria.

  2. Investigating the nature of palladium chain-walking in the enantioselective redox-relay Heck reaction of alkenyl alcohols. (United States)

    Hilton, Margaret J; Xu, Li-Ping; Norrby, Per-Ola; Wu, Yun-Dong; Wiest, Olaf; Sigman, Matthew S


    The mechanism of the redox-relay Heck reaction was investigated using deuterium-labeled substrates. Results support a pathway through a low energy palladium-alkyl intermediate that immediately precedes product formation, ruling out a tautomerization mechanism. DFT calculations of the relevant transition structures at the M06/LAN2DZ+f/6-31+G* level of theory show that the former pathway is favored by 5.8 kcal/mol. Palladium chain-walking toward the alcohol, following successive β-hydride eliminations and migratory insertions, is also supported in this study. The stereochemistry of deuterium labels is determined, lending support that the catalyst remains bound to the substrate during the relay process and that both cis- and trans-alkenes form from β-hydride elimination.


    Directory of Open Access Journals (Sweden)



    Full Text Available Yeast Saccharomyces cerevisiae is an excellent model to studi genes function of eukarotic cells such as study of gene encoding protein phosphatase PTC2. Novel phenotypic caused by mutated gene is an important step to study function of gene. In this study constructed mutant of PTC2 gene encoding protein phosphatase. Method that used in this construction was replacement of target gene (PTC2 with auxotroph marker Candida albicans HIS3 by Polymer Chain Reaction (PCR or called by PCR-mediated disruption. Mutant colonies which grew in selective medium SC without histidine were confirmed by PCR amplification. By using 1% Agarose gel electrophoresis the result showed that size of ptc2D::CgHIS3 transformant was 3.52 kb while wild type strain was 2.9 kb, indicated that ptc2D::CgHIS3 has integrated on chromosome V replacing PTC2 wild type.

  4. Implementation of polymerase chain reaction (PCR and Real-Time PCR in quick identification of bovine herpesvirus 1

    Directory of Open Access Journals (Sweden)

    Milić Nenad


    Full Text Available Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these cell lines. The application of polymerize chain reaction (PCR using a primer for glucoprotein B and thymidine - kinasis, established the presence of bovine herpes virus 1 nucleic acid in one sample of a bovine nasal smear, while the presence of this virus was established in three samples in an examination of the nasal smear samples using the Real-Time PCR method.

  5. γ-Particle coincidence technique for the study of nuclear reactions (United States)

    Zagatto, V. A. B.; Oliveira, J. R. B.; Allegro, P. R. P.; Chamon, L. C.; Cybulska, E. W.; Medina, N. H.; Ribas, R. V.; Seale, W. A.; Silva, C. P.; Gasques, L. R.; Zahn, G. S.; Genezini, F. A.; Shorto, J. M. B.; Lubian, J.; Linares, R.; Toufen, D. L.; Silveira, M. A. G.; Rossi, E. S.; Nobre, G. P.


    The Saci-Perere γ ray spectrometer (located at the Pelletron AcceleratorLaboratory - IFUSP) was employed to implement the γ-particle coincidence technique for the study of nuclear reaction mechanisms. For this, the 18O+110Pd reaction has been studied in the beam energy range of 45-54 MeV. Several corrections to the data due to various effects (energy and angle integrations, beam spot size, γ detector finite size and the vacuum de-alignment) are small and well controlled. The aim of this work was to establish a proper method to analyze the data and identify the reaction mechanisms involved. To achieve this goal the inelastic scattering to the first excited state of 110Pd has been extracted and compared to coupled channel calculations using the São Paulo Potential (PSP), being reasonably well described by it.

  6. γ-Particle coincidence technique for the study of nuclear reactions

    Energy Technology Data Exchange (ETDEWEB)

    Zagatto, V.A.B., E-mail: [Instituto de Física da Universidade de São Paulo (Brazil); Oliveira, J.R.B.; Allegro, P.R.P.; Chamon, L.C.; Cybulska, E.W.; Medina, N.H.; Ribas, R.V.; Seale, W.A.; Silva, C.P.; Gasques, L.R. [Instituto de Física da Universidade de São Paulo (Brazil); Zahn, G.S.; Genezini, F.A.; Shorto, J.M.B. [Instituto de Pesquisas Energéticas e Nucleares (Brazil); Lubian, J.; Linares, R. [Instituto de Física da Universidade Federal Fluminense (Brazil); Toufen, D.L. [Instituto Federal de Educação, Ciência e Tecnologia (Brazil); Silveira, M.A.G. [Centro Universitário da FEI (Brazil); Rossi, E.S. [Centro Universitário FIEO – UNIFIEO (Brazil); Nobre, G.P. [Lawrence Livermore National Laboratory (United States)


    The Saci-Perere γ ray spectrometer (located at the Pelletron AcceleratorLaboratory – IFUSP) was employed to implement the γ-particle coincidence technique for the study of nuclear reaction mechanisms. For this, the {sup 18}O+{sup 110}Pd reaction has been studied in the beam energy range of 45–54 MeV. Several corrections to the data due to various effects (energy and angle integrations, beam spot size, γ detector finite size and the vacuum de-alignment) are small and well controlled. The aim of this work was to establish a proper method to analyze the data and identify the reaction mechanisms involved. To achieve this goal the inelastic scattering to the first excited state of {sup 110}Pd has been extracted and compared to coupled channel calculations using the São Paulo Potential (PSP), being reasonably well described by it.

  7. Biomimetic surface modification of polypropylene by surface chain transfer reaction based on mussel-inspired adhesion technology and thiol chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing, E-mail:; Gong, Yongkuan


    Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH{sub 2}) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such

  8. The Role of Multiplex Polymerase Chain Reaction in Detecting Etiological Causes of Bacterial Prostatitis Associated Benign Prostatic Hyperplasia

    Directory of Open Access Journals (Sweden)

    Bramastha Rosadi


    Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease. 

  9. Biomimetic surface modification of polypropylene by surface chain transfer reaction based on mussel-inspired adhesion technology and thiol chemistry

    International Nuclear Information System (INIS)

    Niu, Zhijun; Zhao, Yang; Sun, Wei; Shi, Suqing; Gong, Yongkuan


    Highlights: • Biomimetic surface modification of PP was successfully conducted by integrating mussel-inspired technology, thiol chemistry and cell outer membranes-like structures. • The resultant biomimetic surface exhibits good interface and surface stability. • The obvious suppression of protein adsorption and platelet adhesion is also achieved. • The residue thoil groups on the surface could be further functionalized. - Abstract: Biomimetic surface modification of polypropylene (PP) is conducted by surface chain transfer reaction based on the mussel-inspired versatile adhesion technology and thiol chemistry, using 2-methacryloyloxyethylphosphorylcholine (MPC) as a hydrophilic monomer mimicking the cell outer membrane structure and 2,2-azobisisobutyronitrile (AIBN) as initiator in ethanol. A layer of polydopamine (PDA) is firstly deposited onto PP surface, which not only offers good interfacial adhesion with PP, but also supplies secondary reaction sites (-NH 2 ) to covalently anchor thiol groups onto PP surface. Then the radical chain transfer to surface-bonded thiol groups and surface re-initiated polymerization of MPC lead to the formation of a thin layer of polymer brush (PMPC) with cell outer membrane mimetic structure on PP surface. X-ray photoelectron spectrophotometer (XPS), atomic force microscopy (AFM) and water contact angle measurements are used to characterize the PP surfaces before and after modification. The protein adsorption and platelet adhesion experiments are also employed to evaluate the interactions of PP surface with biomolecules. The results show that PMPC is successfully grafted onto PP surface. In comparison with bare PP, the resultant PP-PMPC surface exhibits greatly improved protein and platelet resistance performance, which is the contribution of both increased surface hydrophilicity and zwitterionic structure. More importantly, the residue thiol groups on PP-PMPC surface create a new pathway to further functionalize such

  10. Radioinitiation of Chain Branched Reactions and its Sensitization; Amorcage sous rayonnement des reactions par ramification en chaine; sensibilisation du processus; Radiatsionnoe initsiirovanie tsennykh razvetvlennykh reaktsij i ego sensibilizatsiya; Radioiniciacion de reacciones en cadena ramificadas y medios para aumentar su sensibilidad

    Energy Technology Data Exchange (ETDEWEB)

    Barelko, E V; Kartashova, L I; Komarov, P N; Proskurnin, M A [Karpov Physico-Chemical Institute, Moscow, Union of Soviet Socialist Republics (Russian Federation)


    This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author) [French] Dans ce memoire, les auteurs presentent les resultats d'une etude consacree a l'amorcage sous rayonnement de reactions, d'oxydation des composes organiques, par ramification en chaine. Ils montrent le role des rayonnements en tant qu'agents d'amorcage de la reaction, en citant comme exemples l'oxydation de certains hydrocarbures non satures et du butanol. La reaction possede un caractere d'auto-acceleration et continue spontanement lorsque l'action des rayonnements a cesse. La reaction d'oxydation du benzene a ete etudiee en detail; elle est caracterisee par la haute stabilite de la substance vis-a-vis de l'action des rayonnements. Les auteurs formulent les principes de la sensibilisation, par l'action de substances instables vis-a-vis des rayonnements de l'amorcage sous rayonnement de la reaction d'oxydation de substances stables vis-a-vis des rayonnements et chimiquement inertes. Le memoire fournit les caracteristiques quantitatives

  11. Supply Chain Security. Tools, Trends, and Techniques : Toyota and Honda cases


    Klimova, Nadezda; Akimova, Anna


      Supply chain management has experienced great changes within the last fifty years. Inevitably, many companies entered the global market with the prime intention to achieve their defined goals. In comparison with the local markets, the global environment requires more efforts and changes in the supply chain operation in order to remain viable in business. Several business models are introduced for achieving the success in the market, suggested by the following researchers: Liker, Choi, Ronal...

  12. Importance of polymerase chain reaction in diagnosis of pulmonary and extra-pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Iqbal, S.; Ahmed, R.; Adhami, S.U.Z.


    Pakistan ranks eighth on the list of 22 high-burden tuberculosis (TB) countries in the world according to the World Health Organisation's (WHO) Global Tuberculosis Control 2009. Including other reasons the main cause is improper and late diagnosis of the disease. PCR may play an important role to control the disease with its rapid, sensitive and specific diagnosis. But in Pakistan due to lake of knowledge about this latest technique we are not using this technique appropriately. Clinicians still trust on conventional methods of TB diagnosis, which are time consuming or insensitive. The present study was arranged to highlight the importance of PCR in TB diagnosis in pulmonary and extra-pulmonary cases and its comparison with conventional methods. Methods: Samples obtained from 290 patients of suspected TB (pulmonary or extra-pulmonary) were subjected to ZN smear examination, LJ medium culture and PCR test by amplifying 541 bp fragment of Mycobacterium tuberculosis complex genome. The present prospective study is performed at Shalamar Hospital Lahore from November 2008 to November 2010. Results: A distinctly difference was observed in the test results done by PCR and other conventional techniques in pulmonary or extra-pulmonary tuberculosis samples (p<0.001). The sensitivity of different tests was 68.62% for PCR, 26.90% for LJ medium culture, and 14.14% for ZN smear examination (p<0.05). However, there was no significant difference between different tests as for as specificity was concerned. PCR test sensitivity in pulmonary and extra-pulmonary clinical samples was 78.34 and 61.76% respectively, being significantly higher (p<0.05) when compared with sensitivity of other tests. The mean detection time for M. tuberculosis was 25 days by LJ medium culture and less than 1 day by smear examination and PCR test. Conclusion: PCR test is more sensitive than ZN smear examination and LJ medium culture for the diagnosis of TB in pulmonary and extra-pulmonary clinical samples

  13. Accurate Digital Polymerase Chain Reaction Quantification of Challenging Samples Applying Inhibitor-Tolerant DNA Polymerases. (United States)

    Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes


    Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.

  14. The influence of cricket fast bowlers' front leg technique on peak ground reaction forces. (United States)

    Worthington, Peter; King, Mark; Ranson, Craig


    High ground reaction forces during the front foot contact phase of the bowling action are believed to be a major contributor to the high prevalence of lumbar stress fractures in fast bowlers. This study aimed to investigate the influence of front leg technique on peak ground reaction forces during the delivery stride. Three-dimensional kinematic data and ground reaction forces during the front foot contact phase were captured for 20 elite male fast bowlers. Eight kinematic parameters were determined for each performance, describing run-up speed and front leg technique, in addition to peak force and time to peak force in the vertical and horizontal directions. There were substantial variations between bowlers in both peak forces (vertical 6.7 ± 1.4 body weights; horizontal (braking) 4.5 ± 0.8 body weights) and times to peak force (vertical 0.03 ± 0.01 s; horizontal 0.03 ± 0.01 s). These differences were found to be linked to the orientation of the front leg at the instant of front foot contact. In particular, a larger plant angle and a heel strike technique were associated with lower peak forces and longer times to peak force during the front foot contact phase, which may help reduce the likelihood of lower back injuries.

  15. Identification of four squid species by quantitative real-time polymerase chain reaction. (United States)

    Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan


    Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Assessing the accuracy of a polymerase chain reaction test for Ichthyophonus hoferi in Yukon River Chinook salmon Oncorhynchus tshawytscha. (United States)

    Whipps, Christopher M; Burton, Tamara; Watral, Virginia G; St-Hilaire, Sophie; Kent, Michael L


    Ichthyophonus hoferi Plehn & Mulsow, 1911, is a cosmopolitan, protistan pathogen of marine fishes. It is prevalent in mature returning Chinook salmon Oncorhynchus tshawytscha in the Yukon River watershed, and may be associated with prespawning mortality. We developed and evaluated a polymerase chain reaction (PCR) test for I. hoferi using primers specific to the parasite's small subunit rDNA. The test has a minimum detection limit of approximately 10(-5) parasite spores per reaction and does not cross-react with the closely related salmon parasites Dermocystidium salmonis or Sphaerothecum destruens. Sensitivity and specificity of the PCR test used on somatic muscle and heart tissue for detecting infected fish were determined using 334 Chinook salmon collected from the Yukon River at 2 locations (Tanana and Emmonak) in 2003 and 2004. The true infection status of the fish was determined by testing somatic muscle, heart and kidney tissue using histological evaluation, culture, and PCR. The severity of infection was grouped into 2 categories, light and heavy infection. The probability of detecting a heavily infected fish (sensitivity of the test) was generally much higher than the probability of detecting light infection, suggesting that more than one tissue and/or method should be used to accurately detect light or early infection by I. hoferi. The probability of correctly identifying a negative fish (specificity of the test) was always greater than 94% regardless of the tissue used, infection severity, sampling site or year of collection.

  17. Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico. (United States)

    Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M


    A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

  18. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto


    Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  19. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis. (United States)

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul


    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  20. Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta Lima


    Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

  1. The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.


    Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

  2. Detection of giardine gene in local isolates of Giardia duodenalis by polymerase chain reaction (PCR). (United States)

    Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A


    Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.

  3. The reactions of loaded carbon nanotubes, studied by novel electron microscope techniques

    International Nuclear Information System (INIS)

    Rawcliffe, A.


    A novel electron microscope technique, controlled environment transmission electron microscopy (CETEM), has been used to investigate the reaction of materials loaded within the internal cavities of carbon nanotubes. CETEM allows the introduction of up to 20 mbar of gas around an electron microscope sample, while maintaining a high resolution imaging capability. The microscope is stable, flexible and reliable under these conditions and high resolution images of encapsulated transmission metal oxide reduction have been recorded at 460 deg. C. Recently discovered carbon nanotubes have in theory many applications, many of which will require controlled reliable loading of the internal cavity. However, at present, there is little experimental evidence to confirm theoretical descriptions of the fundamental mechanisms which govern both the extent of loading and the state in which it is found. Similarly, reaction within the cavity and the effect of encapsulation on the nano-scale particle distribution must also be understood, and CETEM proves to be an ideal technique for the study of these processes. Nanotubes have been loaded from aqueous solution with (NH 4 ) 2 IrCI 6 and with molten MoO 3 or K 2 WO 4 /WO 3 . Bulk samples of the first salt are known to decompose spontaneously in air at 200 deg. C, and the bulk oxides are partially reduced at temperature under hydrogen to give potentially useful conducting phases. Comparing the reaction of these materials it is thus possible to: investigate the effect of loading on their reaction; compare the reaction of these materials in- and out-side the tube cavity; and assess the result of violent loading processes on the tubes themselves. Fortuitously, a spontaneous decomposition, a solid-gas reduction and a phase rearrangement were all recorded, allowing mechanistic implications of encapsulation to be considered for each of these reactions. Perhaps surprisingly, the results can be largely interpreted using the reported bulk

  4. Multiplex polymerase chain reaction for identification of Escherichia coli, Escherichia albertii and Escherichia fergusonii. (United States)

    Lindsey, Rebecca L; Garcia-Toledo, L; Fasulo, D; Gladney, L M; Strockbine, N


    Escherichia coli, Escherichia albertii, and Escherichia fergusonii are closely related bacteria that can cause illness in humans, such as bacteremia, urinary tract infections and diarrhea. Current identification strategies for these three species vary in complexity and typically rely on the use of multiple phenotypic and genetic tests. To facilitate their rapid identification, we developed a multiplex PCR assay targeting conserved, species-specific genes. We used the Daydreamer™ (Pattern Genomics, USA) software platform to concurrently analyze whole genome sequence assemblies (WGS) from 150 Enterobacteriaceae genomes (107 E. coli, 5 Shigella spp., 21 E. albertii, 12 E. fergusonii and 5 other species) and design primers for the following species-specific regions: a 212bp region of the cyclic di-GMP regulator gene (cdgR, AW869_22935 from genome K-12 MG1655, CP014225) for E. coli/Shigella; a 393bp region of the DNA-binding transcriptional activator of cysteine biosynthesis gene (EAKF1_ch4033 from genome KF1, CP007025) for E. albertii; and a 575bp region of the palmitoleoyl-acyl carrier protein (ACP)-dependent acyltransferase (EFER_0790 from genome ATCC 35469, CU928158) for E. fergusonii. We incorporated the species-specific primers into a conventional multiplex PCR assay and assessed its performance with a collection of 97 Enterobacteriaceae strains. The assay was 100% sensitive and specific for detecting the expected species and offers a quick and accurate strategy for identifying E. coli, E. albertii, and E. fergusonii in either a single reaction or by in silico PCR with sequence assemblies. Published by Elsevier B.V.

  5. Amplification of nonspecific products in quantitative polymerase chain reactions (qPCR

    Directory of Open Access Journals (Sweden)

    Adrián Ruiz-Villalba


    Full Text Available Quantitative PCR allows the precise measurement of DNA concentrations and is generally considered to be straightforward and trouble free. However, a survey with 93 validated assays for genes in the Wnt-pathway showed that the amplification of nonspecific products occurs frequently and is unrelated to Cq or PCR efficiency values. Titration experiments showed that the occurrence of low and high melting temperature artifacts was shown to be determined by annealing temperature, primer concentration and cDNA input. To explore the range of input variations that occur in the normal use of the Cre assay these conditions were mimicked in a complete two-way design of template −plasmid DNA- and non-template −mouse cDNA- concentrations. These experiments showed that the frequency of the amplification of the correct product and the artifact, as well as the valid quantification of the correct product, depended on the concentration of the non-template cDNA. This finding questions the interpretation of dilution series in which template as well as non-template concentrations are simultaneously decreasing. Repetition of this cDNA concentration experiment with other templates revealed that exact reproduction qPCR experiments was affected by the time it takes to complete the pipetting of a qPCR plate. Long bench times were observed to lead to significantly more artifacts. However, the measurement of artifact-associated fluorescence can be avoided by inclusion of a small heating step after the elongation phase in the amplification protocol. Taken together, this trouble-shooting journey showed that reliability and reproducibility of qPCR experiments not only depends on standardization and reporting of the biochemistry and technical aspects but also on hitherto neglected factors as sample dilution and waiting times in the laboratory work flow. Keywords: RT-qPCR, Melting curve analysis, Reaction parameters, Artifacts

  6. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms. (United States)

    Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven


    Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The

  7. Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction. (United States)

    Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V


    ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

  8. Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum (United States)

    Taylor, P.W.; Winton, J.R.


    Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

  9. Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre


    Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

  10. Detection of feline herpes virus 1 via polymerase chain reaction and immunohistochemistry in cats with ulcerative facial dermatitis, eosinophilic granuloma complex reaction patterns and mosquito bite hypersensitivity. (United States)

    Persico, Paola; Roccabianca, Paola; Corona, Antonio; Vercelli, Antonella; Cornegliani, Luisa


    Ulcerative dermatitis caused by feline herpes virus 1 (FHV-1) is an uncommon disease characterized by cutaneous ulcers secondary to epidermal, adnexal and dermal necrosis. Differential diagnoses for FHV-1 lesions include, but are not limited to, mosquito bite hypersensitivity and eosinophilic granuloma complex. Histopathological diagnosis of FHV-1 dermatitis is based on the detection of the intranuclear inclusion bodies. In cases where intranuclear inclusions are missing but clinical and histological findings are compatible with FHV-1 dermatitis, immunohistochemistry (IHC) and PCRs have been used. In this retrospective study, we evaluated the presence of FHV-1 by IHC and PCR in skin biopsies and compared the results of the two tests. Sixty-four skin biopsy specimens from cats with compatible lesions were reviewed and tested via PCR and IHC for evidence of FHV-1. Polymerase chain reaction was positive in 12 of 64 biopsies; PCR and IHC were positive only in two of 64 biopsies, and these cases were considered true positive cases. The higher number of PCR-positive cases was possibly attributed to amplification of viral DNA from a live attenuated vaccination, but a previous FHV-1 infection with subsequent amplification of latently inserted FHV-1 could not be excluded. If clinical signs and histopathology suggest FHV-1 infection in the absence of typical inclusion bodies, IHC is the preferred diagnostic test; PCR may be useful for initial screening, but due to false positives is not sufficient for a definitive diagnosis. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.

  11. Deteksi Daging Babi Pada Produk Bakso di Pusat Kota Salatiga Menggunakan Teknik Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Fidia Fibriana


    Full Text Available Teknik PCR mempunyai kemampuan yang sensitif untuk deteksi keberadaan daging babi di dalam daging segar maupun produk olahan yang dicampur dengan bahan lain. Tujuan penelitian ini untuk mengetahui apakah produk bakso yang dijajakan di pusat kota Salatiga mengandung daging babi. Teknik stratified random sampling digunakan untuk mengambil sampel bakso yang dijajakan 13 warung bakso dari 25 warung bakso yang tersebar di pusat Kota Salatiga. Isolasi dan purifikasi DNA sampel bakso, daging sapi, dan daging babi menggunakan metode isolasi DNA jaringan hewan. DNA hasil isolasi dilanjutkan proses PCR menggunakan primer p14 untuk mengamplifikasi lokus PRE-1 pada genom babi. Proses amplifikasi DNA dengan program denaturasi awal pada suhu 93 °C selama 2 menit, diikuti 45 siklus terdiri atas denaturasi 93 °C selama 1 menit, annealing 62 °C selama 30 detik, ekstensi 72 °C selama 1 menit, kemudian diakhiri ekstensi 72 °C selama 2 menit. Produk PCR yang diharapkan muncul berukuran 481bp. Hasil elektroforesis gel agarose 1,2% pada produk PCR menunjukkan adanya pita DNA spesifik berukuran 481 bp pada daging babi dan sampel bakso nomor tiga belas, sehingga disimpulkan warung bakso nomor tiga belas produk baksonya mengandung daging babi.PCR technique has the ability to be sensitive to the detection of the presence of pork in fresh meat and processed products are mixed with other materials. The aim of this research to determine whether the product meatballs are sold in downtown Salatiga containing pork. Stratified random sampling technique is used to take samples of meatballs stall which sold 13 of the 25 meatballs stalls in the Salatiga City centre. Isolation and purification of DNA samples of meatballs, beef, and pork using DNA isolation method of animal tissue. DNA isolation results continue the process of PCR using primers to amplify p14 locus PRE-1 in the pig genome. DNA amplification process with initial denaturation program at a temperature of 93

  12. Bakteri Legionella pneumophila Terdeteksi pada Air Kolam Renang di Kota Surabaya dengan Nested Polymerase Chain Reaction (LEGIONELLA PNEUMOPHILA BACTERIADETECTED IN SWIMMING POOL WATER OF SURABAYA BY USING NESTED POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Eduardus Bimo Aksono


    Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup

  13. Detection of Clostridium tyrobutyricum using cultivation and biochemical methods and polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Radka Burdychová


    Full Text Available Anaerobic spore-forming bacteria of the genus Clostridium are commonly present in raw milk and some milk products. Their spores can survive pasteurization and can provoke so called late blowing defect in cheese caused by butyric acid fermentation. The only species of the genus Clostridium that is able to provoke late blowing is Clostridium tyrobutyricum.In this work, two cultivation methods for detection of butyric acid producing clostridia in raw and pasteurized milk and in cheese samples were compared. The results show that tube method is suitable for route identification (in concentration 102 CFU/ml or /g of clostridia in milk and cheese. The standard cultivation technique is suitable for more sensitive identification (10 CFU/ml or /g. All presumptive colonies grown anaerobically on selective RCM agar with polymyxine B (500 μg/ml were classified to be of species Clostridium tyrobutyricum using PCR only. The confirmation using API tests were different in 50 % cases. The results show, that described PCR method is suitable for rapid screening of the presence of Clostridium tyrobutyricum in milk and cheese. PCR from one colony is possible to use for the analysis.

  14. A simple thermometric technique for reaction-rate determination of inorganic species, based on the iodide-catalysed cerium(IV)-arsenic(III) reaction. (United States)

    Grases, F; Forteza, R; March, J G; Cerda, V


    A very simple reaction-rate thermometric technique is used for determination of iodide (5-20 ng ml ), based on its catalytic action on the cerium(IV)-arsenic(III) reaction, and for determination of mercury(II) (1.5-10 ng ml ) and silver(I) (2-10 ng ml ), based on their inhibitory effect on this reaction. The reaction is followed by measuring the rate of temperature increase. The method suffers from very few interferences and is applied to determination of iodide in biological and inorganic samples, and Hg(II) and Ag(I) in pharmaceutical products.

  15. Rapid genetically modified organism (GMO screening of various food products and animal feeds using multiplex polymerase chain reaction (PCR

    Directory of Open Access Journals (Sweden)

    Lisha, V.


    Full Text Available modified crops which brought up a controversy on the safety usage of genetically modified organisms (GMOs. It has been implemented globally that all GMO products and its derived ingredients should have regulations on the usage and labelling. Thus, it is necessary to develop methods that allow rapid screening of GMO products to comply with the regulations. This study employed a reliable and flexible multiplex polymerase chain reaction (PCR method for the rapid detection of transgenic elements in genetically modified soy and maize along with the soybean LECTIN gene and maize ZEIN gene respectively. The selected four common transgenic elements were 35S promoter (35S; Agrobacterium tumefaciens nopaline synthase terminator (NOS; 5-enolypyruvylshikimate-3-phosphate synthase (epsps gene; and Cry1Ab delta-endotoxin (cry1Ab gene. Optimization of the multiplex PCR methods were carried out by using 1% Roundup ReadyTM Soybean (RRS as the certified reference material for soybean that produced fourplex PCR method detecting 35S promoter, NOS terminator, epsps gene and soybean LECTIN gene and by using 1% MON810 as the certified reference material for maize that produced triplex PCR method detecting 35S promoter, cry1Ab gene and maize ZEIN gene prior to screening of the GMO traits in various food products and animal feeds. 1/9 (11.1% of the animal feed contained maize and 1/15 (6.7% of the soybean food products showed positive results for the detection of GMO transgenic gene. None of the maize food products showed positive results for GMO transgenic gene. In total, approximately 4% of the food products and animal feed were positive as GMO. This indicated GMOs have not widely entered the food chain. However, it is necessary to have an appropriate screening method due to GMOs’ unknown potential risk to humans and to animals. This rapid screening method will provide leverage in terms of being economically wise, time saving and reliable.

  16. Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

    Directory of Open Access Journals (Sweden)

    Raden Wasito


    Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

  17. Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY

    Directory of Open Access Journals (Sweden)

    Susan Maphilindawati Noor


    Full Text Available Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4, B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle in Java (Jakarta andBandung, South Sulawesi (Maros, East Nusa Tenggara (Kupang and Belu were used in this study. TheDNA bands were observed by agarose gel in the presence of ethidium bromide. Identification was performedbased on the size and number of DNA products amplified by PCR from each isolates. The results showedthat the 50 isolates were of B. abortus field strains. This finding showed that the cause of bovine brucellosisin Indonesia is B. abortus field strains.

  18. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta


    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  19. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. (United States)

    Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh


    Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016

  20. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Kush Shrivastava


    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

  1. Detection of Mycoplasma pneumoniae by two polymerase chain reactions and role of M. pneumoniae in acute respiratory tract infections in pediatric patients

    NARCIS (Netherlands)

    Ieven, M; Ursi, D; Van Bever, H; Quint, W; Niesters, H G; Goossens, H

    Mycoplasma pneumoniae and viruses in acute respiratory tract infections in children were studied during the winter of 1992-1993 in Antwerp, Belgium. M. pneumoniae was diagnosed in nasopharyngeal aspirates by culture and polymerase chain reaction (PCR). For this, amplification of a fragment of the PI

  2. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.


    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  3. Bayesian estimation for quantification by real-time polymerase chain reaction under a branching process model of the DNA molecules amplification process

    NARCIS (Netherlands)

    Lalam, N.; Jacob, C.


    The aim of Quantitative Polymerase Chain Reaction is to determine the initial amount X0 of specific nucleic acids from an observed trajectory of the amplification process, the amplification being achieved through successive replication cycles. This process depends on the efficiency fpngn of

  4. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents (United States)

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  5. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae) (United States)

    David E. Schreiber; Karen J. Garner; James M. Slavicek


    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  6. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay (United States)

    Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.


    Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

  7. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay


    Almy, Frederic S.; Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.


    Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic.

  8. Powerful strategy for polymerase chain reaction-based clonality assessment in T-cell malignancies Report of the BIOMED-2 Concerted Action BHM4 CT98-3936

    NARCIS (Netherlands)

    Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.


    Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.

  9. Evaluation of a polymerase chain reaction reverse hybridization line probe assay for the detection and identification of medically important fungi in bronchoalveolar lavage fluids.

    NARCIS (Netherlands)

    Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.


    An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical

  10. Diagnosis of visceral leishmaniasis by the polymerase chain reaction using blood, bone marrow and lymph node samples from patients from the Sudan

    DEFF Research Database (Denmark)

    Andresen, K; Gasim, S; Elhassan, A M


    We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...

  11. Chain reaction on de-halogenation of 1,2-dibromotetrafluoroethane and 1,1,2-trichlorotrifluoroethane induced by irradiation in alcohols

    International Nuclear Information System (INIS)

    Nakagawa, Seiko


    Methanol and 2-propanol solutions of 1,2-dibromotetrafluoroethane and 1,1,2-trichlorotrifluoroethane were irradiated with γ-rays after perfect de-oxygenation. The product, formed by the substitution of one of the bromine or chlorine atoms with a hydrogen atom, was observed by radiation-induced degradation and the product was also de-halogenated. The G-value of de-halogenation was more than a thousand times higher than G(e solv − ) and increased with the decreasing dose rate, meaning that a chain reaction is involved in the process. The efficiency of the degradation in 2-propanol was several times higher than that in methanol. It is concluded that the charge transfer from an alcohol radical will be the trigger of the chain reaction the same as in the degradation of hexachloroethane in alcohol solutions (Sawai et al., 1978). - Highlights: • Halone2402 and Furon113 were de-halogenated by radiation-induced chain reaction in pure alcohol. • The efficiency of the degradation in 2-propanol was several times higher than that in methanol. • The charge transfer from an alcohol radical will be the trigger of the chain reaction

  12. Quantitative 16S rDNA-targeted polymerase chain reaction and oligonucleotide hybridization for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere

    NARCIS (Netherlands)

    Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.


    A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific

  13. Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

    DEFF Research Database (Denmark)

    Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie


    Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

  14. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica). (United States)

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo


    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  15. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter


    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  16. Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

    NARCIS (Netherlands)

    Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.


    A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

  17. Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

    NARCIS (Netherlands)

    Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

    The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

  18. Remeasurement and compilation of excitation function of proton induced reactions on iron for activation techniques

    International Nuclear Information System (INIS)

    Takacs, S.; Vasvary, L.; Tarkanyi, F.


    Excitation functions of proton induced reactions on nat Fe(p, xn) 56 Co have been remeasured in the energy region up to 18 MeV using stacked foil technique and standard high resolution gamma-ray spectrometry at the Debrecen MGC-20E cyclotron. Compilation of the available data measured between 1959 and 1993 has been made. The corresponding excitation functions have been reviewed, critical comparison of all the available data was done to obtain the most accurate data set. The feasibility of the evaluated data set was checked by reproducing experimental calibration curves for TLA by calculation. (orig.)

  19. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis. (United States)

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi


    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  20. Identification of nickel response genes in abnormal early developments of sea urchin by differential display polymerase chain reaction. (United States)

    Ryu, Tae Kwon; Lee, Gunsup; Rhee, Yong; Park, Heung-Sik; Chang, Man; Lee, Sukchan; Lee, Jaean; Lee, Taek-Kyun


    Bioassays and biomarkers have been previously developed to assess the effects of heavy metal contaminants on the early life stages of the sea urchin. In this study, malformation in the early developmental processes was observed in sea urchin (Strongylocentrotus intermedius) larvae exposed to 10 ppm Ni for over 30 h. The most critical stage at which the triggering of nickel effects takes place is thought to be the blastula stage, which occurs after fertilization in larval development. To investigate the molecular-level responses of sea urchin exposed to heavy metal stress and to explore the differentially expressed genes that are induced or repressed by nickel, differential display polymerase chain reaction (DD-PCR) was used with sea urchin mRNAs. The malformation-related genes expressed in the early life stages of the sea urchin were cloned from larvae exposed to 10 ppm of nickel for 15 h, and accessed via DD-PCR. Sequence analysis results revealed that each of the genes evidenced high homology with EGF2, PCSK9, serine/threonine protein kinase, apolipophorin precursor protein, and MGC80921 protein/transcript variant 2. This result may prove useful in the development of novel biomarkers for the assessment of heavy metal stresses on sea urchin embryos. Copyright © 2012 Elsevier Inc. All rights reserved.