WorldWideScience

Sample records for chain reaction technique

  1. Chain reaction

    International Nuclear Information System (INIS)

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  2. Polymerase chain reaction

    OpenAIRE

    Gaurav Solanki

    2015-01-01

    The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation...

  3. [Detection of leptospirosis reservoirs in Madagascar using the polymerase chain reaction technique].

    Science.gov (United States)

    Ralaiarijaona, R L; Bellenger, E; Chanteau, S; Roger, F; Pérolat, P; Rasolofo Razanamparany, V

    2001-01-01

    A polymerase chain reaction (PCR) technique was used for detection of the Leptospira interrogans rrs gene in kidney tissue from 115 rats, 50 zebu cattles and 13 pigs in an attempt to identify a possible animal reservoir of leptospirosis in Madagascar. In addition, serological testing of 105 individuals in close contact with animals was carried out. The PCR analysis was negative for all the samples tested and only one person was found seropositive at a low titer. The findings suggest that leptospirosis, if prevalent in Madagascar, is likely rare.

  4. A novel technique for measuring variations in DNA copy-number: competitive genomic polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Nakagawara Akira

    2007-07-01

    Full Text Available Background Changes in genomic copy number occur in many human diseases including cancer. Characterization of these changes is important for both basic understanding and diagnosis of these diseases. Microarrays have recently become the standard technique and are commercially available. However, it is useful to have an affordable technique to complement them. Results We describe a novel polymerase chain reaction (PCR-based technique, termed competitive genomic PCR (CGP. The main characteristic of CGP is that different adaptors are added to the sample and control genomic DNAs after appropriate restriction enzyme digestion. These adaptor-supplemented DNAs are subjected to competitive PCR using an adaptor-primer and a locus-specific primer. The amplified products are then separated according to size differences between the adaptors. CGP eliminates the tedious steps inherent in quantitative PCR and achieves moderate throughput. Assays with different X chromosome numbers showed that it can provide accurate quantification. High-resolution analysis of neuroblastoma cell lines around the MYCN locus revealed novel junctions for amplification, which were not detected by a commercial array. Conclusion CGP is a moderate throughput technique for analyzing changes in genomic copy numbers. Because CGP can measure any genomic locus using PCR primers, it is especially useful for detailed analysis of a genomic region of interest.

  5. Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Gaurav Solanki

    2012-10-01

    Full Text Available The polymerase chain reaction (PCR is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation and diagnosis of a growing number of diseases. PCR is also used in forensics laboratories. PCR can identify genes that have been implicated in the development of cancer. The present paper is an attempt to review basics of PCR in relation to its methods, application and use.

  6. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...

  7. BORRELIA BURGDORFERI DNA IN BIOLOGICAL SAMPLES FROM PATIENTS WITH SARCOIDOSIS USING THE POLYMERASE CHAIN REACTION TECHNIQUE

    Institute of Scientific and Technical Information of China (English)

    连伟; 罗慰慈

    1995-01-01

    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  8. DETECTION OF BORRELIA BURGDOFERI DNA IN GRANULOMATOUS TISSUES FROM PATIENTSWITH SARCOIDOSIS USING POLYMERASE CHAIN REACTION IN SITU TECHNIQUE

    Institute of Scientific and Technical Information of China (English)

    徐作军; 马东来; 罗慰慈; 朱元珏

    1996-01-01

    To investigate the correlation between sarcoidosis and Borrelia burgdorferi (Bb) infection,flagella DNA of Bb were detected in 23 granulomatous tissue specimens from patients with confirmed sarcoidosis usingpolymerase chain reaction in situ technique (in situ PCR) and the antibodies to Bb were examined in 55 serum samples obtained from the patients by indirect immunoflurescence assays. Our data presented that =(1) None of granulomatous tissues was found to have Bb DNA in 23 tissue samples. (2) Thirty of 55(54.6%) patients with sarcoidosis were found antibodies to Bh positive,in contrast,six of 60 (10%) norreal subjects had antibodies against Bb,the positive rate was remarkably higher in patient group than thatin healthy group (P(0. 005). The results suggest that Bb might not be the causative agent of sarcoidosis,the elevated titres of serum antibodies against Bb in patients with sarcoidosis is a nonspecific response.

  9. DNAzyme-based biosensor for Cu(2+) ion by combining hybridization chain reaction with fluorescence resonance energy transfer technique.

    Science.gov (United States)

    Chen, Ying; Chen, Ling; Ou, Yidian; Wang, Zhenhua; Fu, Fengfu; Guo, Liangqia

    2016-08-01

    A novel signal amplification strategy based on Cu(2+)-dependent DNAzyme was developed for sensing Cu(2+) ion by combining hybridization chain reaction (HCR) with fluorescence resonance energy transfer (FRET) technique. In the presence of Cu(2+) ion, the substrate strands of Cu(2+)-dependent DNAzyme immobilized on magnetic beads were specifically cleaved and released. The released strands initiated the HCR process of hairpin H1 and H2 labeled with FAM as the donor and TAMRA as the acceptor, respectively. Long nicked dsDNA structures were self-assembled to bring the donor and the acceptor in close proximity, resulting in a FRET process. The relative ratio of fluorescent intensities of the acceptor and donor was used to quantitatively detect Cu(2+) ion with a limit of detection of 0.5nmolL(-1). This proposed biosensor was applied to detect Cu(2+) ion in tap water with satisfactory results. PMID:27216680

  10. Comparison of polymerase chain reaction and Warthin-Starry techniques to detect Leptospira spp. in kidneys of slaughtered cattle

    Directory of Open Access Journals (Sweden)

    Shahrzad Azizi

    2014-02-01

    Full Text Available Leptospirosis is a worldwide zoonotic disease that is caused by Gram-negative spirochaetes, Leptospira species. Affected animals excrete the organism in the urine into the environment and act as a source of infection. Cattle are maintenance hosts for some serovars of leptospirosis and are important in the transmission of the infection to humans. At post mortem examination, affected cattle show white spots in their kidneys but these are not specific for leptospirosis. Sometimes it is necessary that leptospirosis be diagnosed in the carcass. Different direct methods, including polymerase chain reaction (PCR, Warthin-Starry silver stain (WS, immunofluorescence (IF and immunohistochemistry (IHC can be used in order to diagnose leptospirosis in the affected tissues, such as kidney. The main advantage of the WS technique is direct visualisation of the bacteria in the tissue samples. Silver staining is useful for retrospective studies on formalin-fixed and paraffin-embedded samples but little information is available on the sensitivity and specificity of the technique. The present study aimed to find a simple and inexpensive method that can be used in any laboratory and that also, if clinical samples are not available, can detect Leptospira in tissue samples post mortem. This study was performed on 19 paraffin-embedded kidneys of slaughtered cows that grossly had focal to multifocal white spots. Leptospirosis was confirmed in these samples with PCR based on the LipL32 gene. Out of 19 PCR positive kidneys, Leptospira was identified in 13 stained samples by WS. The kidneys revealed different grades of interstitial nephritis. No relationship was found between severity of lesions and presence of leptospires in the kidneys. The PCR results on the urine and blood were consistent with matching WS stained kidneys. Out of 13 kidneys that were positive with silver staining, 7 matching blood and 10 matching urine samples were confirmed positive for leptospirosis

  11. Detection of Phakopsora pachyrhizi fungus by Polymerase Chain Reaction technique (PCR) after soy grains treatment by electron beams

    International Nuclear Information System (INIS)

    Today Brazil, as the largest soy exporter in the world, has undergone the consequences of the contamination of these crops by the Asian dust fungus, being harmed since the plantation up to the harvest, with losses in its productivity ranging 10-80%. As it is a new disease in the Americas, there are not any resistant species to this fungus attack. The grains contamination harms the exportation for countries which do not want to have their crops contaminated, affecting therefore the international commerce and agro-business relationship with those countries Brazil has trade with. The Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is of difficult control, since occurs through the wind dispersion. The P. pachyrhizi is an Asian fungus and was recently found in South Africa, Paraguay, Argentina and Brazil. As an alternative process to minimize these losses is the process to preserve the grains by radiation, the use of the electron accelerator was indicated, since its advantage for the grains exportation industry is fundamental. Besides the possibility of being disconnected when not in use, this source does not need to be recharged, is easily available and has high dose rate, streamlining the process and reducing logistics costs. The present work aims to identify, by the Polymerase Chain Reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soy grains, at doses 1 and 2 kGy, at the IPEN-CNEN electron Accelerator, a Dynamitron Machine (Radiation Dynamics Co. model JOB, New York, USA), with 1.5 MeV power and 2.5 mA electrical current. (author)

  12. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  13. Polymerase Chain Reaction for Educational Settings.

    Science.gov (United States)

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  14. Supply chain reaction

    International Nuclear Information System (INIS)

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  15. Identification of bovine material in porcine spray-dried blood derivatives using the Polymerase Chain Reaction technique

    Directory of Open Access Journals (Sweden)

    Sánchez A.

    2004-01-01

    Full Text Available Due to the widely supported theory of bovine spongiform encephalopathy (BSE spread in cattle by contaminated animal feeds, screening of feed products has become essential. For many years, manufacturers have used blood and plasma proteins as high quality ingredients of foods for both pets and farm animals. However, in Europe, the Commission Regulation 1234/2003/EC temporally bans the use of processed animal proteins, including blood-derivative products, in feedstuffs for all farm animals which are fattened or bred for the production of food. This regulation has some exceptions, such as the use of non ruminant blood products into the feed of farm fish. Authorization of the re-introduction of these proteins into animal feed formulations, especially non ruminant proteins into the feed for non ruminant farm animals, is expected when adequate control methods to discriminate ruminant proteins exist. Currently, the number of validated methods to differentiate the species of origin for most of the animal by-products is limited. Here we report the development of a rapid and sensitive polymerase chain reaction (PCR-based assay, which allows detection of bovine or porcine specific mitochondrial DNAfrom spray-dried blood derivate products (plasma, whole blood and red cells, as a marker for bovine contamination in porcine products. Sample extracts, suitable for PCR, were easily and quickly obtained with the commercial PrepManTM Ultra reagent (Applied Biosystems. To confirm the porcine origin of the samples, primers targeting a specific region of 134 bp of the porcine cytochrome b coding sequence were designed (cytbporc1-F and cytbporc2-R. Previously published PCR primers (L8129 and H8357, specific for a 271 bp fragment of the bovine mitochondrial ATPase 8-ATPase 6 genes, were chosen to accomplish amplification of bovine DNA. The limit of detection (LOD of the bovine PCR assay was at least of 0.05% (v/v of bovine inclusion in spray-dried porcine plasma or red

  16. The polymerase chain reaction (PCR): general methods.

    Science.gov (United States)

    Waters, Daniel L E; Shapter, Frances M

    2014-01-01

    The polymerase chain reaction (PCR) converts very low quantities of DNA into very high quantities and is the foundation of many specialized techniques of molecular biology. PCR utilizes components of the cellular machinery of mitotic cell division in vitro which respond predictably to user inputs. This chapter introduces the principles of PCR and discusses practical considerations from target sequence definition through to optimization and application.

  17. DNA Amplified Technique Out body Polymerase chain Reaction (PCR)%DNA体外扩增技术——聚合酶链式反应(PCR)

    Institute of Scientific and Technical Information of China (English)

    李莹

    2000-01-01

    PCR is DNA amplified technique outbody. It possess high - speed, simple and specific merit. It has wide out look of applificalion in Molecular Biology. This paper introduced PCR's basic principle, factors of effect and applification.%PcR(Polymerase Chain Reaction)译为聚合酶链式反应,是近年来发展起来的一种DNA体外扩增技术.具有快速,简便和特异性强的优点,在分子生物学研究方面的应用具有广阔的前景.本文简要介绍了PCR技术的原理,影响因素及其应用.

  18. Detection of mycoplasmas in urethral swabs from HIV-1 infected patients and control individuals using culture techniques and polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Regina Ayr Florio da CUNHA

    1998-01-01

    Full Text Available The objective of the present study was to determine the prevalence of certain mycoplasma species, i.e., Mycoplasma hominis, Ureaplasma urealyticum and Mycoplasma penetrans, in urethral swabs from HIV-1 infected patients compared to swabs from a control group. Mycoplasmas were detected by routine culture techniques and by the Polymerase Chain Reaction (PCR technique, using 16SrRNA generic primers of conserved region and Mycoplasma penetrans specific primers. The positivity rates obtained with the two methods were comparable. Nevertheless, PCR was more sensitive, while the culture techniques allowed the quantification of the isolates. The results showed no significant difference (p O objetivo do presente estudo foi determinar a prevalência de determinadas espécies de micoplasmas, tais como, Mycoplasma hominis, Ureaplasma urealyticum e Mycoplasma penetrans, em swabs uretrais de pacientes infectados com HIV-1 comparando com um grupo controle. Micoplasmas foram detectados por técnicas padrão de cultivo e pela reação de polimerase em cadeia para a qual foram utilizados "primers" genéricos obtidos da região conservada 16SrRNA e "primers" específicos para Mycoplasma penetrans. A positividade obtida nos dois métodos foi comparável. Contudo, o PCR mostrou ser mais sensível nas condições empregadas enquanto que o cultivo permitiu a quantificação dos isolados. Os resultados demonstraram não haver diferenças significantes (p < 0,05 nas taxas de positividade entre os métodos empregados para a detecção dos micoplasmas.

  19. The chain re-action

    CERN Multimedia

    2009-01-01

    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  20. Systematic use of universal 16S rRNA gene polymerase chain reaction (PCR) and sequencing for processing pleural effusions improves conventional culture techniques.

    Science.gov (United States)

    Insa, Rosario; Marín, Mercedes; Martín, Adoración; Martín-Rabadán, Pablo; Alcalá, Luís; Cercenado, Emilia; Calatayud, Laura; Liñares, Josefina; Bouza, Emilio

    2012-03-01

    Conventional culture of pleural fluid samples frequently provides false-negative results. Universal polymerase chain reaction (PCR) of the 16S ribosomal ribonucleic acid (rRNA) gene (16S PCR) has proven useful in the diagnosis of various bacterial infections. We conducted a prospective study to assess the value of 16S PCR in the etiologic diagnosis of pleural effusion. All pleural fluid samples received for culture were also studied using 16S PCR. Positive samples were sequenced for identification. Clinical records and conventional culture results were analyzed to classify pleural fluid samples as infected or not infected. We studied 723 samples. We excluded 188 samples because they were obtained from a long-term chest tube, there was a diagnosis of mycobacterial infection, or there were insufficient data to classify the episode. Finally, 535 pleural fluid samples were analyzed. According to our criteria, 82 (15.3%) were infected and 453 (84.7%) were not infected. In the infected samples, 16S PCR was positive in 67 samples (81.7%) while conventional culture was positive in 45 (54.9%). There were 4 false positives with 16S PCR (0.9%) and 12 with culture (2.6%). The values for the etiologic diagnosis of bacterial pleural effusion of conventional culture compared with 16S PCR were as follows: sensitivity, 54.9%/81.7%; specificity, 97.4%/99.1%; positive predictive value, 76.3%/94.4%; negative predictive value, 92.6%/96.8%; and accuracy, 90.8%/96.5%.When compared with conventional culture, 16S PCR plus sequencing substantially improves the etiologic diagnosis of infectious pleural effusion. In our opinion, this technique should be added to the routine diagnostic armamentarium of clinical microbiology laboratories.

  1. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo

    2012-01-01

    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  2. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...

  3. Detection of Listeria monocytogenes by using the polymerase chain reaction

    International Nuclear Information System (INIS)

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with 32P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains

  4. Detection and strain differentiation of infectious bronchitis virus in tracheal tissues from experimentally infected chickens by reverse transcription-polymerase chain reaction. Comparison with an immunohistochemical technique

    DEFF Research Database (Denmark)

    Handberg, Kurt; Nielsen, O.L.; Pedersen, M.W.;

    1999-01-01

    Oligonucleotide pairs were constructed for priming the amplification of fragments of nucleocapsid (N) protein and spike glycoprotein (S) genes of avian infectious bronchitis virus (IBV) by reverse transcription-polymerase chain reaction (RT-PCR). One oligonucleotide pair amplified a common segment......3896 and 793B strains of IBV, respectively, Groups of specific pathogen free chickens were experimentally inoculated with the Massachusetts (H120, M41), the D1466 and the 793B strains of IBV, and tracheal tissue preparations were made from each bird for RT-PCR and for immunohistochemistry (IHC) up to 3...... days post-inoculation. The N-gene RT-PCR detected IBV in 82% of the chickens, while IHC only detected IBV in 60%. This difference was significant (P PCR varied from 67 to 100% for the various strains of IBV inoculated. The S1 gene oligonucleotide pairs were...

  5. Transformational leadership: a cascading chain reaction.

    Science.gov (United States)

    Murphy, Lorraine

    2005-03-01

    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment. PMID:15720482

  6. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  7. Polymerase Chain Reaction on a Viral Nanoparticle.

    Science.gov (United States)

    Carr-Smith, James; Pacheco-Gómez, Raúl; Little, Haydn A; Hicks, Matthew R; Sandhu, Sandeep; Steinke, Nadja; Smith, David J; Rodger, Alison; Goodchild, Sarah A; Lukaszewski, Roman A; Tucker, James H R; Dafforn, Timothy R

    2015-12-18

    The field of synthetic biology includes studies that aim to develop new materials and devices from biomolecules. In recent years, much work has been carried out using a range of biomolecular chassis including α-helical coiled coils, β-sheet amyloids and even viral particles. In this work, we show how hybrid bionanoparticles can be produced from a viral M13 bacteriophage scaffold through conjugation with DNA primers that can template a polymerase chain reaction (PCR). This unprecedented example of a PCR on a virus particle has been studied by flow aligned linear dichroism spectroscopy, which gives information on the structure of the product as well as a new protototype methodology for DNA detection. We propose that this demonstration of PCR on the surface of a bionanoparticle is a useful addition to ways in which hybrid assemblies may be constructed using synthetic biology.

  8. [Polymerase chain reaction and its application].

    Science.gov (United States)

    Sárosi, I; Gerald, E; Girish, V N

    1992-07-01

    The polymerase chain reaction (PCR) is one of the most important new methods in molecular biology. It is widely used in genetic and anthropologic basic research, in oncology and virology, in all those fields, where molecular biologic methods can give answers to the questions raised. The procedure enables one to multiply with extreme precision targeted pieces of amounts as little as one target molecule of DNA or RNA by five to six logs, making them easy to be handled and examined by routine molecular biological methods. The method is presented through one possible application field, that is of great importance in the study of hepatocarcinogenesis. Sensitivity of PCR in detection of hepatitis B virus DNA is greater by four logs than animal inoculation, the last most sensitive method known.

  9. Detection of human papilloma virus in the cervical Pap smears and with polymerase chain reaction technique in the rural area of Western Maharashtra, India

    Directory of Open Access Journals (Sweden)

    Poorva Gurjar

    2016-08-01

    Conclusions: Pap smears and HPV DNA testing with PCR play significant role in the early detection of cervical lesions where clinical examination has limitations. High risk HPV detection with the PCR technique can be used as a tool to identify the population at risk for subsequent development of cervical cancer. [Int J Reprod Contracept Obstet Gynecol 2016; 5(8.000: 2648-2651

  10. Identification of Erwinia stewartii by a ligase chain reaction assay.

    OpenAIRE

    Wilson, W.J.; Wiedmann, M; Dillard, H. R.; Batt, C A

    1994-01-01

    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed...

  11. Appropriate chicken sample size for identifying the composition of broiler intestinal microbiota affected by dietary antibiotics, using the polymerase chain reaction-denaturing gradient gel electrophoresis technique.

    Science.gov (United States)

    Zhou, H; Gong, J; Brisbin, J T; Yu, H; Sanei, B; Sabour, P; Sharif, S

    2007-12-01

    The bacterial microbiota in the broiler gastrointestinal tract are crucial for chicken health and growth. Their composition can vary among individual birds. To evaluate the composition of chicken microbiota in response to environmental disruption accurately, 4 different pools made up of 2, 5, 10, and 15 individuals were used to determine how many individuals in each pool were required to assess the degree of variation when using the PCR-denaturing gradient gel electrophoresis (DGGE) profiling technique. The correlation coefficients among 3 replicates within each pool group indicated that the optimal sample size for comparing PCR-DGGE bacterial profiles and downstream applications (such as identifying treatment effects) was 5 birds per pool for cecal microbiota. Subsequently, digesta from 5 birds was pooled to investigate the effects on the microbiota composition of the 2 most commonly used dietary antibiotics (virginiamycin and bacitracin methylene disalicylate) at 2 different doses by using PCR-DGGE, DNA sequencing, and quantitative PCR techniques. Thirteen DGGE DNA bands were identified, representing bacterial groups that had been affected by the antibiotics. Nine of them were validated. The effect of dietary antibiotics on the microbiota composition appeared to be dose and age dependent. These findings provide a working model for elucidating the mechanisms of antibiotic effects on the chicken intestinal microbiota and for developing alternatives to dietary antibiotics. PMID:18029800

  12. Detection of Mycobacterium bovis in Organs of Slaughtered Cattle by DNA-Based Polymerase Chain Reaction and Ziehl-Neelsen Techniques in Bauchi State, Nigeria

    Directory of Open Access Journals (Sweden)

    A. S. Sa’idu

    2015-01-01

    Full Text Available Bovine tuberculosis is a chronic, infectious, and contagious zoonotic disease of domestic animals, wild animals, and humans. It also poses a public health threat and economic losses. This study was aimed at determining the prevalence of bovine tuberculosis in slaughtered cattle, based on PM meat inspection, Ziehl-Neelsen staining, and PCR techniques in Bauchi State, Nigeria. A Prospective study was conducted on 800 cattle slaughtered in the three Zonal abattoirs of Bauchi State, Nigeria. One hundred and twenty (15% tissues from different organs had suspected bTB lesions at PM. Out of the samples examined 35 (29.2% were AFB positive by ZN and 10 (8.3% were confirmed positive for M. bovis by PCR, with an overall prevalence of 29.16% and 8.33%, respectively. Female had a higher prevalence rate than male cattle at 16.66% and 12.5 % by ZN and 5.00% and 3.33% by PCR, respectively (P>0.05, χ2=0.218. However, there was a statistically significant association (P<0.05, χ2=7.002 between detection of bTB and the age of cattle. ZN revealed that cattle aged 6 years and above had the highest number of positive bTB cases 67.9%, while cattle aged 3–5 years had the lowest 14.81%. PCR technique revealed that the cattle aged 6 and above years also had the highest percentage positive M. bovis cases of 22.84%, whereas cattle aged 3–5 years had the lowest and the overall prevalence rate of 8.33%. The study found a high infection rate of bTB among cattle and majority of the lesions 54.2% were from lungs. The prevalence of bTB was higher in Bauchi metropolitan abattoir which supplies larger population of the state with beef.

  13. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    Science.gov (United States)

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  14. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M

    2012-02-03

    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  15. Indirect techniques for astrophysical reaction rates determinations

    Science.gov (United States)

    Hammache, F.; Oulebsir, N.; Benamara, S.; De Séréville, N.; Coc, A.; Laird, A.; Stefan, I.; Roussel, P.

    2016-05-01

    Direct measurements of nuclear reactions of astrophysical interest can be challenging. Alternative experimental techniques such as transfer reactions and inelastic scattering reactions offer the possibility to study these reactions by using stable beams. In this context, I will present recent results that were obtained in Orsay using indirect techniques. The examples will concern various astrophysical sites, from the Big-Bang nucleo synthesis to the production of radioisotopes in massive stars.

  16. A novel rapid genotyping technique for Collie eye anomaly: SYBR Green-based real-time polymerase chain reaction method applicable to blood and saliva specimens on Flinders Technology Associates filter paper.

    Science.gov (United States)

    Chang, Hye-Sook; Mizukami, Keijiro; Yabuki, Akira; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Arai, Toshiro; Yamato, Osamu

    2010-09-01

    Collie eye anomaly (CEA) is a canine inherited ocular disease that shows a wide variety of manifestations and severity of clinical lesions. Recently, a CEA-associated mutation was reported, and a DNA test that uses conventional polymerase chain reaction (PCR) has now become available. The objective of the current study was to develop a novel rapid genotyping technique by using SYBR Green-based real-time PCR for future large-scale surveys as a key part in the strategy to eradicate CEA by selective breeding. First, a SYBR Green-based real-time PCR assay for genotyping of CEA was developed and evaluated by using purified DNA samples from normal, carrier, and affected Border Collies in which genotypes had previously been determined by conventional PCR. This real-time PCR assay demonstrated appropriate amplifications in all genotypes, and the results were consistent with those of conventional PCR. Second, the availability of Flinders Technology Associates filter paper (FTA card) as DNA templates for the real-time PCR assay was evaluated by using blood and saliva specimens to determine suitability for CEA screening. DNA-containing solution prepared from a disc of blood- or saliva-spotted FTA cards was available directly as templates for the real-time PCR assay when the volume of solution was 2.5% of the PCR mixture. In conclusion, SYBR Green-based real-time PCR combined with FTA cards is a rapid genotyping technique for CEA that can markedly shorten the overall time required for genotyping as well as simplify the sample preparation. Therefore, this newly developed technique suits large-scale screening in breeding populations of Collie-related breeds. PMID:20807925

  17. Efficacy of an in-house polymerase chain reaction assay for rapid diagnosis of Mycobacterium tuberculosis in patients with tubercular lymphadenitis: Comparison with fine needle aspiration cytology and conventional techniques

    Directory of Open Access Journals (Sweden)

    Sharma Meera

    2010-10-01

    Full Text Available Introduction: Tubercular lymphadenitis (TB-L is the most common manifestation of extrapulmonary tuberculosis. Excisional biopsy with histopathological examination, Ziehl-Neelsen staining (ZNS and culture and fine needle aspiration (FNA cytology, although useful in the diagnosis of TB-L, cannot diagnose a substantial proportion of cases. We investigated the role of an in-house polymerase chain reaction (PCR assay targeting the IS6110 gene from the FNA material in the diagnosis of the disease. Materials and Methods: The clinical profile of 150 patients with lymphadenopathy was noted and the fine needle aspirate was collected. After cytological processing, ZNS and culture on Lowenstein-Jensen media, mycobacterial DNA was isolated from the residual aspirate material and IS6110 gene PCR was performed. Results of cytology, ZNS, culture and IS6110 gene PCR were compared. Results: There were 49 confirmed patients of TB-L based on laboratory parameters (either culture isolation of Mycobacterium tuberculosis or any two of cytology, ZNS, PCR positive and clinical response to therapy. Sensitivity and specificity of FNA was 89.8% and 96%, of ZNS was 40.8% and 99%, of culture was 40.8% and 100% and of IS6110 gene PCR test was 100% and 92.1%. Conclusion: IS6110 PCR can be considered a valuable adjunct to cytology, ZNS and culture techniques in the diagnosis of TB-L.

  18. Effect of gamma radiation on the growth of Aspergillus Flavus aflatoxins producer and on the use of polymerase chain reaction technique (PCR) in samples of maize grains artificially inoculated

    International Nuclear Information System (INIS)

    The aim of this present study was to verify the effects of gamma radiation on the growth of Aspergillus flavus Link aflatoxins producer; to demonstrate the application of Polymerase Chain Reaction (PCR) technique in the diagnostic of A. Flavus, as well to verify the effect of radiation in the profile of DNA bands. Twenty samples of grains maize with 200 g each were individually irradiated with 20 kGy, to eliminate the microbial contamination. In following, the samples were inoculated with an toxigenic A. flavus (1x106 spores/ml), incubated for 15 days at 25 deg C with a relative humidity of around 97,5% and irradiated with 0, 2; 5 and 10 kGy. The samples, 5 to each dose of irradiation, were individually analyzed for the number of fungal cells, water activity, viability test (fluorescein diacetate and ethidium bromide), PCR and aflatoxins (AFB) detection. The results showed that the doses used were effective in reducing the number of Colony Forming Units (CFU/g) mainly the doses of 5 and 10 kGy. In addition, the viability test showed a decrease of viable cells with increase of irradiation doses. The reduction of AFB1 and AFB-2, was more efficient with the use of 2 kGy in comparison with the dose of 5 kGy, while the dose of 10 kGy, degraded the aflatoxins. Thereby, it was observed that AFB2 showed to be more radiosensitive. The use of PCR technique showed the presence of DNA bands, in all samples. (author)

  19. Detection of Francisella tularensis in blood by polymerase chain reaction.

    OpenAIRE

    Long, G W; Oprandy, J J; Narayanan, R. B.; Fortier, A H; Porter, K R; Nacy, C.A.

    1993-01-01

    We developed a polymerase chain reaction-based assay for Francisella tularensis which we evaluated by using spiked blood samples and experimentally infected mice. The assay detected both type A and type B F. tularensis at levels equivalent to one CFU/microliter of spiked blood. Results from polymerase chain reaction-based assay of limiting dilutions of blood from mice infected with the live vaccine strain agreed closely with results from blood culture.

  20. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  1. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  2. A noncontact temperature measurement method in polymerase chain reaction reactors

    Science.gov (United States)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.

    2016-04-01

    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  3. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

    OpenAIRE

    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

    2014-01-01

    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients.

  4. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle

    2014-12-01

    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  5. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe

    2013-01-01

    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his...... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  6. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend;

    1991-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...... was minimized. The polymerase chain reaction detected a higher number of Chlamydia trachomatis infections among both symptomatic and asymptomatic females and males, and it also detected Chlamydia trachomatis at an earlier stage of infection when compared to cell culture. The polymerase chain reaction did...

  7. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend;

    1993-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...... was minimized. The polymerase chain reaction detected a higher number of Chlamydia trachomatis infections among both symptomatic and asymptomatic females and males, and it also detected Chlamydia trachomatis at an earlier stage of infection when compared to cell culture. The polymerase chain reaction did...

  8. The generalised self-sustaining chain reaction theory about ADS

    International Nuclear Information System (INIS)

    The basic connotation of ADS (accelerator driven system) is investigated from the point of view of generalized self-sustaining chain reaction. The ADS is composed of proton accelerator, neutron producing target and the subcritical reactor. This system can be viewed entirely as a generalized self sustaining chain reaction system. In this view of point, the accelerator with target, as a part of ADS, can be viewed as an energy-neutron transformer (energy be fed to accelerator to produce medium energy protons, neutrons be produced in the heavy target as a result of proton-heavy nucleus spallation reaction). In this generalized self-sustaining chain reaction system, the number of neutrons produced after a fission event is not only the fission neutrons but also the neutrons produced by the energy-neutron transformer. That is, the ADS has more effective secondary neutrons after a fission event. It is just these additional neutrons, the ADS can be in state of self-sustaining chain reaction (criticality), although the reactor part of ADS is in state of sub-criticality. The critical equation of the generalized self-sustaining chain reaction system is presented. The relationship between the effective multiplication factors of ADS and subcritical reactor part of ADS is also presented. The power output of ADS is represented by a function of the proton current, the subcritical reactivity of the reactor in ADS, the number of neutrons produced in spallation process per proton and etc. At last, the probable application of ADS in the future is investigated

  9. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2015-01-01

    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the en

  10. [The contamination under polymerase chain reaction studies: problems and solutions].

    Science.gov (United States)

    Titov, V N; Ameliushkina, V A; Rozhkova, T A

    2015-01-01

    The study was carried out to determine risk factors of false positive and false negative results under polymerase chain reaction-analysis of clinical material. The samples with high viral load can be the source of false positive results. The contamination with nucleic acids can occur at any section of polymerase chain reaction analysis. The study data permitted to establish that the most sensitive stage is isolation and purification of nucleic acids especially under manual mode of operation. The detection of positive signal in most samples of one setting indicates total contamination. The cases when only several samples are polluted are special challenge. The presence of sample with high concentration of viral nucleic acid and several samples with low concentration in one setting means necessity of repeated analysis beginning with stage of isolation of nucleic acid. The analysis of curves of accumulation of products of amplification, their forms and positioning on chart is the obligatory stage of polymerase chain reaction study in real time regimen. These actions permit to exclude the readouts of false negative testing results to departments. The study conclusions are equipotent for polymerase chain reaction testing of any nucleic acid targets.

  11. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  12. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    Science.gov (United States)

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  13. Mathematics analysis of polymerase chain reaction kinetic curves.

    Science.gov (United States)

    Sochivko, D G; Fedorov, A A; Varlamov, D A; Kurochkin, V E; Petrov, R V

    2016-01-01

    The paper reviews different approaches to the mathematical analysis of polymerase chain reaction (PCR) kinetic curves. The basic principles of PCR mathematical analysis are presented. Approximation of PCR kinetic curves and PCR efficiency curves by various functions is described. Several PCR models based on chemical kinetics equations are suggested. Decision criteria for an optimal function to describe PCR efficiency are proposed.

  14. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    Science.gov (United States)

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  15. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction

    NARCIS (Netherlands)

    J. Fan (Jun); W.Y. Zhang (Wen); Y.Y. Wu (Yu); X.Y. Jing (Xiou); E.C.J. Claas (Eric)

    1993-01-01

    textabstractThe aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The resul

  16. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  17. Supply chain management under fuzziness recent developments and techniques

    CERN Document Server

    Öztayşi, Başar

    2014-01-01

    Supply Chain Management Under Fuzziness presents recently developed fuzzy models and techniques for supply chain management. These include: fuzzy PROMETHEE, fuzzy AHP, fuzzy ANP, fuzzy VIKOR, fuzzy DEMATEL, fuzzy clustering, fuzzy linear programming, and fuzzy inference systems. The book covers both practical applications and new developments concerning these methods. This book offers an excellent resource for researchers and practitioners in supply chain management and logistics, and will provide them with new suggestions and directions for future research. Moreover, it will support graduate students in their university courses, such as specialized courses on supply chains and logistics, as well as related courses in the fields of industrial engineering, engineering management and business administration.

  18. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维

    2003-01-01

    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  19. Enteroviral pharyngitis diagnosed by reverse transcriptase-polymerase chain reaction.

    OpenAIRE

    Sharland, M.; Hodgson, J.; Davies, E G; Booth, J.; Jeffery, S

    1996-01-01

    The role of enteroviruses in childhood pharyngitis was investigated using enteroviral specific reverse transcriptase-polymerase chain reaction (RT-PCR). Viral/bacterial throat swabs were taken from 50 children with acute pharyngitis and 26 controls. A positive culture was identified in only 26% of children with pharyngitis (adenovirus 10%, group A streptococci 2%), and none of the controls. Enteroviral RT-PCR was positive in 8% of the pharyngitis group and none of the controls. Enteroviruses ...

  20. Polymerase chain reaction-based molecular diagnosis of cutaneous infections in dermatopathology.

    Science.gov (United States)

    Swick, Brian L

    2012-12-01

    Conventional methods, including microscopy, culture, and serologic studies, are a mainstay in the diagnosis of cutaneous infection. However, owing to limitations associated with these techniques, such as low sensitivity for standard microscopy and in the case of culture delay in diagnosis, polymerase chain-reaction based molecular techniques have taken on an expanding role in the diagnosis of infectious processes in dermatopathology. In particular, these assays are a useful adjunct in the diagnosis of cutaneous tuberculosis, atypical mycobacterial infection, leprosy, Lyme disease, syphilis, rickettsioses, leishmaniasis, and some fungal and viral infections. Already in the case of tuberculosis and atypical mycobacterial infection, standardized polymerase chain-reaction assays are commonly used for diagnostic purposes. With time, additional molecular-based techniques will decrease in cost and gain increased standardization, thus delivering rapid diagnostic confirmation for many difficult-to-diagnose cutaneous infections from standard formalin-fixed paraffin-embedded tissue specimens.

  1. Reaction chain modeling of denitrification reactions during a push-pull test

    Science.gov (United States)

    Boisson, A.; de Anna, P.; Bour, O.; Le Borgne, T.; Labasque, T.; Aquilina, L.

    2013-05-01

    Field quantitative estimation of reaction kinetics is required to enhance our understanding of biogeochemical reactions in aquifers. We extended the analytical solution developed by Haggerty et al. (1998) to model an entire 1st order reaction chain and estimate the kinetic parameters for each reaction step of the denitrification process. We then assessed the ability of this reaction chain to model biogeochemical reactions by comparing it with experimental results from a push-pull test in a fractured crystalline aquifer (Ploemeur, French Brittany). Nitrates were used as the reactive tracer, since denitrification involves the sequential reduction of nitrates to nitrogen gas through a chain reaction (NO3- → NO2- → NO → N2O → N2) under anaerobic conditions. The kinetics of nitrate consumption and by-product formation (NO2-, N2O) during autotrophic denitrification were quantified by using a reactive tracer (NO3-) and a non-reactive tracer (Br-). The formation of reaction by-products (NO2-, N2O, N2) has not been previously considered using a reaction chain approach. Comparison of Br- and NO3- breakthrough curves showed that 10% of the injected NO3- molar mass was transformed during the 12 h experiment (2% into NO2-, 1% into N2O and the rest into N2 and NO). Similar results, but with slower kinetics, were obtained from laboratory experiments in reactors. The good agreement between the model and the field data shows that the complete denitrification process can be efficiently modeled as a sequence of first order reactions. The 1st order kinetics coefficients obtained through modeling were as follows: k1 = 0.023 h- 1, k2 = 0.59 h- 1, k3 = 16 h- 1, and k4 = 5.5 h- 1. A next step will be to assess the variability of field reactivity using the methodology developed for modeling push-pull tracer tests.

  2. Convective polymerase chain reaction around micro immersion heater

    Science.gov (United States)

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  3. Robust quantification of polymerase chain reactions using global fitting.

    Directory of Open Access Journals (Sweden)

    Ana C Carr

    Full Text Available BACKGROUND: Quantitative polymerase chain reactions (qPCR are used to monitor relative changes in very small amounts of DNA. One drawback to qPCR is reproducibility: measuring the same sample multiple times can yield data that is so noisy that important differences can be dismissed. Numerous analytical methods have been employed that can extract the relative template abundance between samples. However, each method is sensitive to baseline assignment and to the unique shape profiles of individual reactions, which gives rise to increased variance stemming from the analytical procedure itself. PRINCIPAL FINDINGS: We developed a simple mathematical model that accurately describes the entire PCR reaction profile using only two reaction variables that depict the maximum capacity of the reaction and feedback inhibition. This model allows quantification that is more accurate than existing methods and takes advantage of the brighter fluorescence signals from later cycles. Because the model describes the entire reaction, the influences of baseline adjustment errors, reaction efficiencies, template abundance, and signal loss per cycle could be formalized. We determined that the common cycle-threshold method of data analysis introduces unnecessary variance because of inappropriate baseline adjustments, a dynamic reaction efficiency, and also a reliance on data with a low signal-to-noise ratio. SIGNIFICANCE: Using our model, fits to raw data can be used to determine template abundance with high precision, even when the data contains baseline and signal loss defects. This improvement reduces the time and cost associated with qPCR and should be applicable in a variety of academic, clinical, and biotechnological settings.

  4. Single-species reactions on a random catalytic chain

    Energy Technology Data Exchange (ETDEWEB)

    Oshanin, G [Laboratoire de Physique Theorique des Liquides, Universite Paris 6, 4 Place Jussieu, 75252 Paris (France); Burlatsky, S F [United Technologies Research Center, United Technologies Corporation, 411 Silver Lane, 129-21 East Hartford, CT (United States)

    2002-11-29

    We present an exact solution for a catalytically activated annihilation A+A {yields} 0 reaction taking place on a one-dimensional chain in which some segments (placed at random, with mean concentration p) possess special, catalytic properties. An annihilation reaction takes place as soon as any two A particles land from the reservoir onto two vacant sites at the extremities of the catalytic segment, or when any A particle lands onto a vacant site on a catalytic segment while the site at the other extremity of this segment is already occupied by another A particle. We find that the disorder-average pressure P{sup (quen)} per site of such a chain is given by P{sup (quen)} P{sup (Lan)} + {beta}{sup -1}F, where P{sup (Lan)}={beta}{sup -1} ln(1+z) is the Langmuir adsorption pressure, (z being the activity and {beta}{sup -1} the temperature), while {beta}{sup -1}F is the reaction-induced contribution, which can be expressed, under appropriate change of notation, as the Lyapunov exponent for the product of 2x2 random matrices, obtained exactly by Derrida and Hilhorst (1983 J. Phys. A: Math. Gen. 16 2641). Explicit asymptotic formulae for the particle mean density and the compressibility are also presented. (letter to the editor)

  5. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    International Nuclear Information System (INIS)

    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves

  6. Preliminary evaluation of the ligase chain reaction for specific detection of Neisseria gonorrhoeae.

    OpenAIRE

    Birkenmeyer, L; Armstrong, A S

    1992-01-01

    Rapid identification of Neisseria gonorrhoeae in clinical specimens is essential for effective control. Traditional culture requires a minimum of 24 h, and for some specimens harboring gonococci, the gonococci fail to grow or are misidentified. The recently described ligase chain reaction (LCR) is a highly specific and sensitive DNA amplification technique which was evaluated as an alternative to routine culture. Three LCR probe sets were used. Two of the probe sets were directed against the ...

  7. Automated polymerase chain reaction in capillary tubes with hot air.

    Science.gov (United States)

    Wittwer, C T; Fillmore, G C; Hillyard, D R

    1989-06-12

    We describe a simple, compact, inexpensive thermal cycler that can be used for the polymerase chain reaction. Based on heat transfer with air to samples in sealed capillary tubes, the apparatus resembles a recirculating hair dryer. The temperature is regulated via thermocouple input to a programmable set-point process controller that provides proportional output to a solid state relay controlling a heating coil. For efficient cooling after the denaturation step, the controller activates a solenoid that opens a door to vent hot air and allows cool air to enter. Temperature-time profiles and amplification results approximate those obtained using water baths and microfuge tubes.

  8. Simultaneous Removal of Multiple DNA Segments by Polymerase Chain Reactions.

    Science.gov (United States)

    Krishnamurthy, Vishnu; Zhang, Kai

    2017-01-01

    Precise DNA manipulation is a key enabling technology for synthetic biology. Approaches based on restriction digestion are often limited by the presence of certain restriction enzyme recognition sites. Recent development of restriction-free cloning approaches has greatly enhanced the flexibility and speed of molecular cloning. Most restriction-free cloning methods focus on DNA assembly. Much less work has been dedicated towards DNA removal. Here we introduce a protocol that allows simultaneous removal of multiple DNA segments from a plasmid using polymerase chain reactions (PCR). Our approach will be beneficial to applications in multiple sites mutagenesis, DNA library construction, genetic and protein engineering, and synthetic biology. PMID:27671942

  9. A chain reaction approach to modelling gene pathways.

    Science.gov (United States)

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  10. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  11. APPLICATION OF POLYMERASE CHAIN REACTION FOR DIAGNOSING AMEBIC LIVER ABSCESS

    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏

    1996-01-01

    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  12. Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

    International Nuclear Information System (INIS)

    Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C2H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH3; and ammonia, which produces NH2. In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

  13. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy

    2015-09-01

    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:http://dx.doi.org/10.1016/j.ab.2015.03.033, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  14. Nested methylation-specific polymerase chain reaction cancer detection method

    Science.gov (United States)

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  15. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed

    2012-03-01

    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  16. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  17. Marzipan: polymerase chain reaction-driven methods for authenticity control.

    Science.gov (United States)

    Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus

    2011-11-23

    According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

  18. Controlling Hybridization Chain Reactions with pH.

    Science.gov (United States)

    Idili, Andrea; Porchetta, Alessandro; Amodio, Alessia; Vallée-Bélisle, Alexis; Ricci, Francesco

    2015-08-12

    By taking inspiration from nature, where self-organization of biomolecular species into complex systems is finely controlled through different stimuli, we propose here a rational approach by which the assembly and disassembly of DNA-based concatemers can be controlled through pH changes. To do so we used the hybridization chain reaction (HCR), a process that, upon the addition of an initiator strand, allows to create DNA-based concatemers in a controlled fashion. We re-engineered the functional units of HCR through the addition of pH-dependent clamp-like triplex-forming domains that can either inhibit or activate the polymerization reaction at different pHs. This allows to finely regulate the HCR-induced assembly and disassembly of DNA concatemers at either basic or acidic pHs in a reversible way. The strategies we present here appear particularly promising as novel tools to achieve better spatiotemporal control of self-assembly processes of DNA-based nanostructures. PMID:26177980

  19. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    Science.gov (United States)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  20. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng

    2015-05-01

    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  1. Detecting herpes simplex virus in aqueous humor of patients suffering from corneal endotheliitis by polymerase chain reaction and indirect immunofluorescent technique%聚合酶链反应和间接免疫荧光法对角膜内皮炎病原诊断的比较研究

    Institute of Scientific and Technical Information of China (English)

    王怡; 范松涛; 孙洪臣

    2009-01-01

    目的 探讨聚合酶链反应(PCR)和间接免疫荧光法(IIF)对角膜内皮炎的病原学诊断价值.方法 分别应用PCR和IIF对临床诊断为角膜内皮炎患者的房水进行单纯疱疹病毒检测,同时以老年白内障患者的房水作为对照,并做统计学分析.结果 16例角膜内皮炎患者的房水中,用PCR法检测阳性11例,阳性检出率为68.75%,20例对照组房水中无1例阳性,二者有显著性差异(P﹤0.05);13例角膜内皮炎患者的房水中,用IIF法检测阳性4例,阳性检出率为30.77%,20例对照组房水中无1例阳性,二者有显著性差异(P﹤0.05);角膜内皮炎患者的房水中PCR阳性检出率(68.75%)与IIF阳性检出率(30.77%)差异有统计学意义(P﹤0.05).结论 PCR法和IIF法均可作为角膜内皮炎的病原学快速诊断,但PCR法比IIF法敏感,可首选.%Objective To evaluate the significance of polymerase chain reaction and indirect immunofluorescent technique on etiologic diagnosis of endotheliitis.Methods Herpes simplex virus in aqueous aspirate of the study group with corneal endotheliitis and the control groups with senile cataract were detected by polymerase chain reaction (PCR) and indirect immunofluorescent (IIF) technique. Results In the study group,11 cases suffering from corneal endotheliitis had positive reactions in aqueous humor detected by PCR,the positive ratio was 68.75%. While in the control group, no case suffering from senile cataract had positive reaction detected by PCR. There was a significant difference between two groups. In the study group, 4 cases suffering from corneal endotheliitis had positive reactions in aqueous humor detected by IIF technique,the positive ratio was 30.77%. While in the control group, no case suffering from senile cataract had positive reaction detected by IIF technique. There was a significant difference between the study group and the control group statistically (P<0.05). It the study groups, there was a significant difference

  2. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    OpenAIRE

    2012-01-01

    AIM: To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).

  3. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  4. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    OpenAIRE

    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini

    2008-01-01

    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  5. Preparative isolation of polymerase chain reaction products using mixed-mode chromatography.

    Science.gov (United States)

    Matos, T; Silva, G; Queiroz, J A; Bülow, L

    2015-11-15

    The polymerase chain reaction (PCR) has become one of the most useful techniques in molecular biology laboratories around the world. The purification of the target DNA product is often challenging, however, and most users are restricted to employing available commercial kits. The recent developments in mixed-mode chromatography have shown higher selectivity for a variety of nucleic acid-containing samples. Capto Adhere is a mixed-mode chromatography resin that offers a high-selectivity ligand and is here applied for the purification of amplified DNAs from PCR mixtures in a 10-min single step, with yields above 95%, high linearity, and high precision for different concentrations.

  6. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan

    2004-01-01

    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  7. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    Science.gov (United States)

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count <1800/mm(3) was observed in 60%, and positive C-reactive protein in 46%. Thirty neonates had positive blood culture, and Klebsiella pneumoniae (22%) was the predominant organism. Nested urine PCR was positive in 38 (76%) and detected bacterial DNA in 8 neonates with negative blood cultures. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents.

  8. Fluorescence-based temperature control for polymerase chain reaction.

    Science.gov (United States)

    Sanford, Lindsay N; Wittwer, Carl T

    2014-03-01

    The ability to accurately monitor solution temperature is important for the polymerase chain reaction (PCR). Robust amplification during PCR is contingent on the solution reaching denaturation and annealing temperatures. By correlating temperature to the fluorescence of a passive dye, noninvasive monitoring of solution temperatures is possible. The temperature sensitivity of 22 fluorescent dyes was assessed. Emission spectra were monitored and the change in fluorescence between 45 and 95°C was quantified. Seven dyes decreased in intensity as the temperature increased, and 15 were variable depending on the excitation wavelength. Sulforhodamine B (monosodium salt) exhibited a fold change in fluorescence of 2.85. Faster PCR minimizes cycling times and improves turnaround time, throughput, and specificity. If temperature measurements are accurate, no holding period is required even at rapid speeds. A custom instrument using fluorescence-based temperature monitoring with dynamic feedback control for temperature cycling amplified a fragment surrounding rs917118 from genomic DNA in 3min and 45s using 35 cycles, allowing subsequent genotyping by high-resolution melting analysis. Gold-standard thermocouple readings and fluorescence-based temperature differences were 0.29±0.17 and 0.96±0.26°C at annealing and denaturation, respectively. This new method for temperature cycling may allow faster speeds for PCR than currently considered possible.

  9. Investigation on detection of Haemophilus ducreyi by Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xibao(张锡宝); FEI Shi(费实); DENG Wenguo(邓文国); CAO wenlig(曹文苓); ZHU huilan(朱慧兰); MENG jinxiu(孟锦秀); YAN jinglan(颜景兰)

    2002-01-01

    Objective:To investigate the application of polymerase chain reaction (PCR) detection of Haemophilus ducreyi in clinical diagnosis of chancroid.Methods: Nucleotide sequences of 16srRNA gene specific for H. Dureyi were used to develop primer sets for amplification of two strains. The amplified products were tested via PCR and sequenced by electrophoresis in a 1.5 % gel.These products were compared with those of heterogeneous species or related bacteria to test the specificity of the PCR assay. PCR amplification with different concentrations of H.ducreyi was performed to test its sensitivity.Results: PCR amplification of two strains of H. Ducreyi produced a single band of expected 438bp length. The sequence was identified with genomic DNA. None of the other 19 reference species amplified under the same conditions gave this result. The highest sensitivity of PCR assay in the present test was 10ng/L.Conclusions: PCR assay for detection of H. Ducreyi is a rapid, specific, and sensitive detection method. If laboratory conditions are strictly controlled, PCR assay is a potentially useful laboratory test for H. Ducreyi infection diagnosis.

  10. Monitoring infection: from blood culture to polymerase chain reaction (PCR).

    Science.gov (United States)

    Book, Malte; Lehmann, Lutz Eric; Zhang, XiangHong; Stüber, Frank

    2013-06-01

    In patients with sepsis, diagnosis of blood stream infection (BSI) is a key concern to the therapist. Direct verification of pathogens in the blood stream executed by blood cultures (BC) still is regarded as the gold standard up to date. The quickest possible initiation of an appropriate antimicrobial therapy is a cornerstone of an effective therapy. Moreover, in this view BC can also serve to identify antimicrobial agents to target the pathogen. However, when employing BC the time needed until microbiological results are available ranges from 24 up to 72 h. Moreover, infections caused by multiple pathogens often remain undetected and concurrent antibiotic therapy may lower the overall sensitivity. Alternative pathogen characterization can be performed by polymerase chain reaction (PCR) based amplification methods. Results using PCR can be obtained within 6-8 h. Therefore, the time delay until an appropriate therapy can be reduced enormously. Moreover, these methods have the potential to enhance the sensitivity in the diagnosis of blood stream infections. Therefore, PCR based methods might be a valuable adjunct to present procedures of diagnosing bacteraemia.

  11. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  12. Analysis of human cytomegalovirus using the polymerase chain reaction.

    Science.gov (United States)

    Mendelson, M

    2000-01-01

    As with numerous other branches of science, the study of human cytomegalovirus (HCMV) infection has been revolutionized by the polymerase chain reaction (PCR) method first devised by Mullis and Faloona (1). PCR allows the in vitro amplification of HCMV DNA sequences by the simultaneous primer extension of complementary DNA strands. Similarly, reverse transcription-PCR (RT-PCR) allows the study of targeted gene expression, by reverse transcription of RNA to complementary DNA (cDNA), followed by amplification of target DNA using predetermined primers. The PCR method is used in the clinical diagnosis of HCMV infection, particularly in the setting of transplantation medicine and in those patients infected with the human immunodeficiency virus (HIV). In addition, the advent of PCR and RT-PCR has transformed our understanding of the pathogenesis of HCMV infection, central to which is the definition of the sites of latency, the degree and type of gene expression within the latently infected cell, and the factors influencing both the maintenance of latency and reactivation of the virus during immunosuppression.

  13. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  14. Identifying of meat species using polymerase chain reaction (PCR)

    Science.gov (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  15. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  16. Polymerase chain reaction as a succesful biotechnological application. Ways we use PCR in the fields of bioinformatics forensics and genetics

    OpenAIRE

    Λάζαρη, Σπυριδούλα

    2011-01-01

    Molecular genetics use molecular methods that amplify specific fragments of DNA. Today, the molecular techniques which were developed for amplification and detection of specific sequences of nucleic acids helped in a great deal to understand the structure of many diseases. Polymerase chain reaction or PCR is a technique that is used for isolation and amplification of a specific sequence of DNA. PCR is an in vitro method that exploits the in vivo procedure of replication of DNA. DNA polyme...

  17. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  18. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S

    2012-02-03

    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  19. Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Joshua E Lane

    2003-04-01

    Full Text Available The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

  20. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  1. Amplification refractory mutation system polymerase chain reaction versus optimized polymerase chain reaction restriction-fragment length polymorphism for apolipoprotein E genotyping of majorly depressed patients.

    Science.gov (United States)

    You, Hongmin; Chen, Jin; Zhou, Jingjing; Huang, Hua; Pan, Junxi; Wang, Ziye; Lv, Lin; Zhang, Lujun; Li, Juan; Qin, Bin; Yang, Yongtao; Xie, Peng

    2015-11-01

    Major depressive disorder (MDD) is a prevalent, debilitating mood disorder that has been associated with several genetic polymorphisms. One such polymorphism, namely that of apolipoprotein E (APOE), has three allelic forms (ε2, ε3 and ε4) that encode for six unique isoforms of the APOE protein. A growing number of techniques have been developed for APOE genotyping; however, not all polymerase chain reaction (PCR)‑based genotyping techniques are equally accurate or cost‑effective. In order to find a more accurate and cost‑effective APOE genotyping method for MDD screening in large populations, the present study comparatively evaluated two genotyping methods, amplification refractory mutation system PCR (ARMS‑PCR) and optimized PCR restriction‑fragment length polymorphism (PCR‑RFLP), in blood samples taken from a population of 708 MDD patients. Although either of the two methods were able to detect all six unique APOE genotypes, comparisons of the two methods with Sanger sequencing demonstrated that ARMS‑PCR (94%) was significantly more accurate than optimized PCR‑RFLP (82%). ARMS‑PCR should prove useful in quickly verifying ambiguous results obtained by other APOE genotyping methods and can be cost-effectively performed in the setting of a small laboratory or a population-based screening program.

  2. Multivariate High Order Statistics of Measurements of the Temporal Evolution of Fission Chain-Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Mattingly, J.K.

    2001-03-08

    The development of high order statistical analyses applied to measurements of the temporal evolution of fission chain-reactions is described. These statistics are derived via application of Bayes' rule to conditional probabilities describing a sequence of events in a fissile system beginning with the initiation of a chain-reaction by source neutrons and ending with counting events in a collection of neutron-sensitive detectors. Two types of initiating neutron sources are considered: (1) a directly observable source introduced by the experimenter (active initiation), and (2) a source that is intrinsic to the system and is not directly observable (passive initiation). The resulting statistics describe the temporal distribution of the population of prompt neutrons in terms of the time-delays between members of a collection (an n-tuplet) of correlated detector counts, that, in turn, may be collectively correlated with a detected active source neutron emission. These developments are a unification and extension of Rossi-a, pulsed neutron, and neutron noise methods, each of which measure the temporal distribution of pairs of correlated events, to produce a method that measures the temporal distribution of n-tuplets of correlated counts of arbitrary dimension n. In general the technique should expand present capabilities in the analysis of neutron counting measurements.

  3. Identification of duck plague virus by polymerase chain reaction

    Science.gov (United States)

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  4. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    Science.gov (United States)

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  5. Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    JANNOTTI-PASSOS Liana Konovaloff

    2000-01-01

    Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

  6. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  7. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    Directory of Open Access Journals (Sweden)

    PD Andrade

    2013-01-01

    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  8. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae.

    OpenAIRE

    1991-01-01

    We report a set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae. The results of this assay on strains of V. cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe. The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells. The polymerase chain reaction method could directly detect...

  9. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Science.gov (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  10. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    Institute of Scientific and Technical Information of China (English)

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  11. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    Science.gov (United States)

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-06-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted.

  12. Sequencing of simple sequence repeat anchored polymerase chain reaction amplification products of Biomphalaria glabrata

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2002-01-01

    Full Text Available Simple sequence repeat anchored polymerase chain reaction amplification (SSR-PCR is a genetic typing technique based on primers anchored at the 5' or 3' ends of microsatellites, at high primer annealing temperatures. This technique has already been used in studies of genetic variability of several organisms, using different primer designs. In order to conduct a detailed study of the SSR-PCR genomic targets, we cloned and sequenced 20 unique amplification products of two commonly used primers, CAA(CT6 and (CA8RY, using Biomphalaria glabrata genomic DNA as template. The sequences obtained were novel B. glabrata genomic sequences. It was observed that 15 clones contained microsatellites between priming sites. Out of 40 clones, seven contained complex sequence repetitions. One of the repeats that appeared in six of the amplified fragments generated a single band in Southern analysis, indicating that the sequence was not widespread in the genome. Most of the annealing sites for the CAA(CT6 primer contained only the six repeats found within the primer sequence. In conclusion, SSR-PCR is a useful genotyping technique. However, the premise of the SSR-PCR technique, verified with the CAA(CT6 primer, could not be supported since the amplification products did not result necessarily from microsatellite loci amplification.

  13. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  14. Dynamics of interfacial reactions between O(3 P) atoms and long-chain liquid hydrocarbons

    Science.gov (United States)

    Allan, Mhairi; Bagot, Paul A. J.; Köhler, Sven P. K.; Reed, Stewart K.; Westacott, Robin E.; Costen, Matthew L.; McKendrick, Kenneth G.

    2007-09-01

    Recent progress that has been made towards understanding the dynamics of collisions at the gas-liquid interface is summarized briefly. We describe in this context a promising new approach to the experimental study of gas-liquid interfacial reactions that we have introduced. This is based on laser-photolytic production of reactive gas-phase atoms above the liquid surface and laser-spectroscopic probing of the resulting nascent products. This technique is illustrated for reaction of O(3P) atoms at the surface of the long-chain liquid hydrocarbon squalane (2,6,10,15,19,23-hexamethyltetracosane). Laser-induced fluorescence detection of the nascent OH has revealed mechanistically diagnostic correlations between its internal and translational energy distributions. Vibrationally excited OH molecules are able to escape the surface. At least two contributions to the product rotational distributions are identified, confirming and extending previous hypotheses of the participation of both direct and trapping-desorption mechanisms. We speculate briefly on future experimental and theoretical developments that might be necessary to address the many currently unanswered mechanistic questions for this, and other, classes of gas-liquid interfacial reaction.

  15. Design of Multiplex Polymerase Chain Reaction (PCR Method for Molecular Detection of Yersinia pestis Bacterium

    Directory of Open Access Journals (Sweden)

    Mohammad Soleimani

    2010-01-01

    Full Text Available Objective: Yersinia pestis, the causative agent of the zoonotic plague infection, is a majorpublic health concern both as a threat and potential bioweapon. The objective of thepresent study was to establish a uniplex and multiplex - polymerase chain reaction (PCRtest for the specific detection of Y. pestis.Materials and Methods: PCR reactions performed by three pair primers which targetedthe caf1 and pla genes located on the pFra and pPst plasmids and the irp2 chromosomalgene located on the ‘pathogenicity island’. After TA cloning of the PCR products, the test’slimit of detection (LOD was determined. For evaluating the specificity, PCR reactionswere performed with negative control bacteria.Results: Assays were performed with the genome of Y. pestis which produced three DNAfragments of the expected sizes 300, 400 and 520 bp which corresponded to the irp2,caf1 and pla genes, respectively. The lower LoD was 370 copy numbers for the caf1 geneand 21 for the pla gene. In PCR reactions that used negative control bacteria, detectablefragments were not observed.Conclusion: Our method clearly discriminated Y. pestis DNA. The rapidity, specificityand sensitivity of this procedure suggest that it can serve as a useful alternative methodfor the inoculation of laboratory animals or the use of specific culture media for routineplaque surveillance and outbreak investigations. Another vital result of this study was theestablishment of Y. pestis molecular detection technique in Iran.

  16. Diagnosis of Aspergillus fumigatus endophthalmitis from formalin fixed paraffin-embedded tissue by polymerase chain reaction-based restriction fragment length polymorphism

    OpenAIRE

    Biwas Jyotirmay; Bagyalakshmi R; Therese Lily

    2008-01-01

    New molecular biological technique of Polymerase Chain Reaction (PCR) based Restriction Fragment Length Polymorphism (RFLP) can identify the species from paraffin-embedded tissue section. We demonstrated Aspergillus fumigatus fungus by PCR-based RFLP technique from paraffin section of an eyeball of an eight- month-old child removed for endogenous endophthalmitis.

  17. Effect of gamma radiation on the growth of Aspergillus Flavus aflatoxins producer and on the use of polymerase chain reaction technique (PCR) in samples of maize grains artificially inoculated; Efeitos da radiacao gama no crescimento de Aspergillus flavus produtor de aflatoxinas e no emprego da tecnica da Reacao em Cadeia da Polimerase (RCP) em amostras de graos de milho inoculadas artificialmente

    Energy Technology Data Exchange (ETDEWEB)

    Aquino, Simone

    2003-07-01

    The aim of this present study was to verify the effects of gamma radiation on the growth of Aspergillus flavus Link aflatoxins producer; to demonstrate the application of Polymerase Chain Reaction (PCR) technique in the diagnostic of A. Flavus, as well to verify the effect of radiation in the profile of DNA bands. Twenty samples of grains maize with 200 g each were individually irradiated with 20 kGy, to eliminate the microbial contamination. In following, the samples were inoculated with an toxigenic A. flavus (1x10{sup 6} spores/ml), incubated for 15 days at 25 deg C with a relative humidity of around 97,5% and irradiated with 0, 2; 5 and 10 kGy. The samples, 5 to each dose of irradiation, were individually analyzed for the number of fungal cells, water activity, viability test (fluorescein diacetate and ethidium bromide), PCR and aflatoxins (AFB) detection. The results showed that the doses used were effective in reducing the number of Colony Forming Units (CFU/g) mainly the doses of 5 and 10 kGy. In addition, the viability test showed a decrease of viable cells with increase of irradiation doses. The reduction of AFB{sub 1} and AFB-2, was more efficient with the use of 2 kGy in comparison with the dose of 5 kGy, while the dose of 10 kGy, degraded the aflatoxins. Thereby, it was observed that AFB2 showed to be more radiosensitive. The use of PCR technique showed the presence of DNA bands, in all samples. (author)

  18. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    International Nuclear Information System (INIS)

    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

  19. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    1994-01-01

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  20. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    Science.gov (United States)

    Souza, M T; Carvalho-Zilse, G A

    2014-01-01

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species. PMID:25117306

  1. Development and application of polymerase chain reaction test for detection of Conidiobolus lamprauges

    Directory of Open Access Journals (Sweden)

    Marcelo M. Silveira

    2013-12-01

    Full Text Available Conidiobolomycosis is a granulomatous disease caused by the fungus Conidiobolus spp. in humans and animals. Traditional technique for diagnosis of the disease is isolation of the agent associated with the presence of typical clinical signs and pathological conditions. The aim of this study was to describe the development of a specific polymerase chain reaction (PCR test for Conidiobolus lamprauges to detect the fungus in clinical samples. Samples from suspected animals were collected and submitted to isolation, histopathological analysis and amplification by PCR. DNA from tissues was subjected to PCR with fungi universal primers 18S rDNA gene, and specific primers were designed based on the same gene in C. lamprauges that generated products of about 540 bp and 222 bp respectively. The culture was positive in 26.6% of clinical samples. The PCR technique for C. lamprauges showed amplification of DNA from fresh tissues (80% and paraffin sections (44.4%. In conclusion, the PCR technique described here demonstrated a high sensitivity and specificity for detection of fungal DNA in tissue samples, providing a tool for the rapid diagnosis of C. lamprauges.

  2. Thermal reactions of polymer chains with coal structures

    Energy Technology Data Exchange (ETDEWEB)

    P. Straka; J. Nahunkova [Academy of Sciences of the Czech Republic, Prague (Czech Republic). Institute of Rock Structure and Mechanics

    2003-07-01

    The thermal decompositions of polyethylene, polystyrene and polyamide 6 in the presence of coal was studied by DSC and TGA methods and reactions of these polymers with coal were described. Tars and cokes obtained were characterized and mass balance of the process expressed. Polyethylene decomposes by a free radical mechanism and the major products are 1-alkenes, {alpha},{omega}-alkadienes and n-alkanes. In the presence of coal, formed unsaturated products are adsorbed on the inner surface of coal and semicoke. Maximum weight losses of the coal-polyethylene mixture occur at higher temperature in comparison with that from the decomposition of polyethylene alone. Further, thermal reactions of coal with polystyrene were studied. In the range of 410 490{sup o}C a thermal degradation of coal proceeded, simultaneously, with decomposition of polystyrene. Because coal is a strong H-donor, unsaturated products of polystyrene decomposition (mainly styrene) was hydrogenated by coal. Some aromatic products of polystyrene decomposition reacted with the coal tar structures and new aromatics were formed. That is why the conversion time of polystyrene decomposition was much higher in the presence of coal. The yields of tar from copyrolysis with styrene polymers are higher in comparison with pyrolysis of coal alone. Also composition of tar is changed. Finally, reactions of coal with polyamide 6 were investigated. During the thermal degradation of coal the decomposition of polyamide 6 occurs and {epsilon}-caprolactam and the cyclic dimer are formed. The {epsilon}-caprolactam formation is promoted by water and hydrogen from coal degradation as due to high content of hydrogen coal acts as a strong H- and water donor. Under high-temperature conditions of copyrolysis beside a-caprolactam mainly carbon oxides, methane, aliphatic hydrocarbons, simple aromatics and stable oil are formed. 8 refs., 3 figs., 7 tabs.

  3. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjærg, Lars Stubbe; Hansen, J-ES; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...... hybridization. It was not possible to detect any viral antigen production in the cultures, and attempts to recover virus by highly sensitive coculture techniques were unsuccessful, indicating that the infection was latent. The PCR technique provides a simple approach to the study of viral infection in cases...

  4. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    Science.gov (United States)

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  5. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    Science.gov (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  6. [The applications of thermostable ligase chain reaction in facilitating DNA recombination].

    Science.gov (United States)

    Xiangda, Zhou; Xiao, Song; Cong, Huai; Haiyan, Sun; Hongyan, Chen; Daru, Lu

    2016-02-01

    The traditional Type Ⅱ restriction enzyme-based method is restricted by the purification steps, and therefore, cannot be applied to specific DNA assembly in chaotic system. To solve this problem, Thermostable Ligase Chain Reaction (TLCR) was introduced in the process of DNA assembly and capture. This technique combines the feature of thermostable DNA ligase and sequence specific oligo ligation template, "Helper", to achieve specific assembly of target fragments and exponential increase of products in multiple thermocyclings. Two plasmid construction experiments were carried out in order to test the feasibility and practical performance of TLCR. One was that, TLCR was used to specifically capture a 1.5 kb fragment into vector from an unpurified chaotic system which contained 7 different sizes of fragments. The results showed that the capturing accuracy was around 80%, which proved the feasibility and accuracy of using TLCR to specific assembly of DNA fragments in a complicated mixed system. In the other experiment, TLCR was used to capture two fragments (total length was 27 kb) from Hind Ⅲ digestion of Lambda genome into vector by order. The results also showed an accuracy of around 80%. As demonstrated in the results, TLCR can simplify the process of DNA recombination experiments and is suitable for the assembly of multiple and large DNA fragments. This technique can provide convenience to biological experiments.

  7. Polymerase chain reaction with lesion scrapping for the diagnosis of human American tegumentary leishmaniasis

    Directory of Open Access Journals (Sweden)

    Eneide Aparecida Sabaini Venazzi

    2006-06-01

    Full Text Available The objective of this work was to compare the polymerase chain reaction (PCR using lesion scrapping with other conventional techniques for the diagnosis of the American tegumentary leishmaniasis (ATL. For this, patients with cutaneous lesions suspected to be ATL were studied. The DNA was amplified with the MP1L/MP3H primers. From the 156 studied patients, 79 (50.6% presented positive parasite direct search (PD, 81 (51.9% had positive Montenegro skin test (MST, and 90 (57.7% presented PD and/or MST positive. The PCR was positive in all of the positive-PD patients (100% sensitivity, in 91.1% of the positive PD and/or MST patients, and in 27.3% of the patients that presented negative PD and positive MST. The PCR positivity was similar to the PD (P = 0.2482 and inferior to the MST (P = 0.0455, and to the PD/MST association (P = 0.0133. The high PCR sensitivity, and positivity in those cases where the PD was negative, highlights the importance of this technique as an auxiliary tool for the diagnosis of ATL.

  8. Method of carbon chain extension using novel aldol reaction

    Energy Technology Data Exchange (ETDEWEB)

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  9. Preparation of End Grafted Polyacrylonitrile Brushes through Surface Confined Radical Chain Transfer Reaction

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    End grafted polyacrylonitrile (PAN) brush was prepared through surface initiated polymerization via the chain transfer process. The thiol-terminated monolayer and PAN brushes were characterized by FTIR, X-ray photoelectron spectroscopy (XPS), atomic force microscopy (AFM), ellipsometry and contact angle measurements ete. It is demonstrated that radical chain transfer reaction and surface initiated precipitate polymerization can be used to prepare end-grafted polymer brushes.

  10. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Cobbs Gary

    2012-08-01

    Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the

  11. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    Science.gov (United States)

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  12. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    Science.gov (United States)

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  13. Supply chain simulation tools and techniques: a survey

    NARCIS (Netherlands)

    Kleijnen, J.P.C.

    2005-01-01

    The main contribution of this paper is twofold: it surveys different types of simulation for supply chain management; it discusses several methodological issues. These different types of simulation are spreadsheet simulation, system dynamics, discrete-event simulation and business games. Which simul

  14. Evaluation of IgG anti-toxoplasma avidity and polymerase chain reaction in the postnatal diagnosis of congenital toxoplasmosis.

    Science.gov (United States)

    Torres, Elizabeth; Rivera, Raul; Cardona, Nestor; Sanchez, Victor; Lora, Fabiana; Gómez-Marín, Jorge Enrique

    2013-06-01

    Confirmatory tests for congenital toxoplasmosis were evaluated in 23 infected and 31 uninfected newborns. Conventional polymerase chain reaction was better than real-time polymerase chain reaction, but did not identify additional cases. Avidity tests added 2 new cases that were not identified by other criteria. Overall sensitivity was 82.6%. Avidity assay, but not polymerase chain reaction, increased the sensitivity of confirmatory assays in congenital toxoplasmosis.

  15. Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Jong Gyun Ahn

    2012-11-01

    Full Text Available &lt;B&gt;Purpose:&lt;/B&gt; Methods for quick and reliable detection of &lt;I&gt;Streptococcus pneumoniae&lt;/I&gt; are needed for the diagnosis of pneumococcal disease and vaccine studies. This study aimed to show that sequential multiplex polymerase chain reaction (PCR is more efficient than conventional culture in achieving &lt;I&gt;S. pneumoniae -positive&lt;/i&gt; results. &lt;B&gt;Methods:&lt;/B&gt; Nasopharyngeal (NP secretions were obtained from 842 pediatric patients admitted with lower respiratory infections at Severance Children’s Hospital in Korea between March 2009 and June 2010. For identification and serotype determination of pneumococci from the NP secretions, the secretions were evaluated via multiplex PCR technique with 35 serotype-specific primers arranged in 8 multiplex PCR sets and conventional bacteriological culture technique. &lt;B&gt;Results:&lt;/B&gt; Among the results for 793 samples that underwent both bacterial culture and PCR analysis for pneumococcal detection, 153 (19.3% results obtained by PCR and 81 (10.2% results obtained by conventional culture technique were positive for S. pneumoniae. The predominant serotypes observed, in order of decreasing frequency, were 19A (23%, 6A/B (16%, 19F (11%, 15B/C (5%, 15A (5%, and 11A (4%; further, 26% of the isolates were non-typeable. &lt;B&gt;Conclusion:&lt;/B&gt; As opposed to conventional bacteriological tests, PCR analysis can accurately and rapidly identify pneumococcal serotypes.

  16. Detection and analysis of polymerase chain reaction products by mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  17. HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

    DEFF Research Database (Denmark)

    Cowland, J B; Madsen, H O; Morling, N

    1995-01-01

    A total of 280 persons were HLA-DQA1 typed by two different polymerase chain reaction (PCR) based methods; (i) a reverse dot-blot (RDB) method, which can differentiate between six alleles, and (ii) a combined PCR-restriction fragment length polymorphism (PCR-RFLP) and allele-specific amplification...

  18. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    Science.gov (United States)

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  19. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...

  20. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.;

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...

  1. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  2. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  3. Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias;

    2015-01-01

    Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours...

  4. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Science.gov (United States)

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  5. Analysis of adult otitis media: polymerase chain reaction versus culture for bacteria and viruses.

    Science.gov (United States)

    Liederman, E M; Post, J C; Aul, J J; Sirko, D A; White, G J; Buchman, C A; Ehrlich, G D

    1998-01-01

    Recent studies using the polymerase chain reaction (PCR) have identified bacterial and viral genomic sequences in culture-negative pediatric middle ear effusions. To evaluate this technique in adults, 19 effusions were analyzed to compare bacterial and viral culture and PCR detection of Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and adenovirus. Effusions from 4 subjects positive for human immunodeficiency virus (HIV) were analyzed by PCR for HIV virus. Three of 19 effusions were culture-positive for bacteria, and 0 of 19 for viruses. Fifteen of 19 effusions were PCR-positive for bacterial genomic sequences, and 0 of 19 for adenovirus. Thirteen of 15 PCR-positive specimens demonstrated S pneumoniae, 5 of 15 H influenzae, and 0 of 13 M catarrhalis. All 4 effusions from HIV-positive subjects were PCR-positive for HIV. No effusion was culture-positive and PCR-negative. These results confirm that culture-negative middle ear effusions contain genomic sequences from bacterial pathogens. Finding of HIV RNA and DNA in effusion from HIV-positives suggests replicating virus in this fluid.

  6. Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction.

    Science.gov (United States)

    Hough, Angela J; Harbison, Sally-Ann; Savill, Marion G; Melton, Laurence D; Fletcher, Graham

    2002-08-01

    A quantitative real-time polymerase chain reaction (PCR) detection method specific for Listeria monocytogenes was developed, and studies involving pure culture showed that the response of the assay was linear over 7 log10 (log) cycles. The method was then applied to the detection of L. monocytogenes artificially inoculated onto cabbage, a vegetable chosen because it is a major component of coleslaw, which has been associated with an outbreak of listeriosis. After being allowed to attach to the food, cells were washed from the cabbage leaf surface and recovered by centrifugation. The DNA was purified by an organic solvent extraction technique and analyzed by real-time PCR. In this matrix, the method again produced a linear response over 7 log cycles from 1.4 x 10(2) to 1.4 x 10(9) CFU of L. monocytogenes in 25 g of cabbage, and analysis of the reproducibility of the system showed that log differences in L. monocytogenes numbers added to cabbage could be reliably distinguished. The system allowed quantitative results to be obtained within 8 h and was relatively inexpensive, showing good potential for routine analytical use. PMID:12182489

  7. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  8. Mechanisms of Propidium Monoazide Inhibition of Polymerase Chain Reaction and implications for Propidium Monoazide Applications

    Science.gov (United States)

    Lee, C. M.; Darrach, H.; Ponce, A.; McFarland, E.; Laymon, C.; Fingland, N. K.

    2015-12-01

    PMA-qPCR is a laboratory technique that can be used to identify viable microbes by employing the use of propidium monoazide (PMA), a DNA-intercalating dye, and quantitative polymerase chain reaction (qPCR). The current model of PMA-qPCR operates under the assumption that PMA is only capable of entering membrane-compromised cells, where it irreversibly cross-links to DNA and makes it unavailable for amplification via qPCR. However, the exact mechanism behind PMA's entry into the cell and its interaction with genetic material is not well understood. To better understand PMA's capabilities, we have examined the effect PMA has on enzyme binding and processivity using endonucleases and exonucleases. Our results suggest that the current model behind PMA-qPCR inhibition is incomplete, in that rather than precipitating the entirety of the DNA, PMA also inhibits enzyme binding and/or processivity in soluble DNA. These results have important implications for studying the viable community of microorganisms in various applications, such as environmental monitoring, planetary protection and bioburden assessment, and biohazard detection.

  9. Polymerase chain reaction and real-time PCR for diagnosing of Leishmania infantum chagasi in dogs.

    Science.gov (United States)

    Ramos, Rafael Antonio do Nascimento; Ramos, Carlos Alberto do Nascimento; Jusi, Márcia Mariza Gomes; de Araújo, Flábio Ribeiro; Machado, Rosangela Zacarias; Faustino, Maria Aparecida da Glória; Alves, Leucio Câmara

    2012-01-01

    The importance of dogs as a reservoir for Leishmania infantumchagasi in urban environments has stimulated numerous studies assessing diagnostic techniques. When performed properly, such procedures are an important step in preventing leishmaniasis in humans. Molecular methods have become prominent for this purpose. The aim of the present study was to determine the performance of the polymerase chain reaction (PCR) and real-time PCR (qPCR) for diagnosing of canine visceral leishmaniasis (CVL) using different biological samples. For this, 35 dogs from an area endemic for CVL were used. Bone marrow aspirate and lymph node and spleen fragments from these dogs were used for the molecular diagnosis. In the present study, qPCR was able to detect a greater number of positive animals than seen with PCR. Among the different biological samples used, there was no significant difference in L. infantumchagasi DNA detection between PCR and qPCR. However, considering that lymph nodes are easy to acquire, these can be considered to be the best samples for making molecular diagnoses of L. infantum chagasi infection.

  10. Molecular sexing of birds: A comparative review of polymerase chain reaction (PCR)-based methods.

    Science.gov (United States)

    Morinha, F; Cabral, J A; Bastos, E

    2012-09-01

    Accurate identification of sex in birds is important for the management and conservation of avian wildlife in several ways, namely in the development of population, behavioral and ecological studies, as well as in the improvement of ex situ captive breeding programs. In general, nestlings, juveniles and adult birds of a wide number of sexually monomorphic species cannot be sexed based on phenotypic traits. The development of molecular methodologies for avian sexing overcame these difficulties, allowing a reliable gender differentiation for these species. The polymerase chain reaction (PCR)-based methods have been widely applied in molecular sexing of birds, using a large diversity of sex-linked markers. During the last 15 yrs, there was a continuous improvement in the PCR-based protocols for bird sexing, increasing the accuracy, speed and high-throughput applicability of these techniques. The recent advances in real-time PCR platforms and whole genome analysis methods provided new resources for the detection and analysis of novel specific markers and protocols. This review presents a comparative guide of classical and recent advances in PCR-based methods for avian molecular sexing, highlighting its strengths and limitations. Future research opportunities in this field are also addressed.

  11. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples.

    Science.gov (United States)

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.

    1998-03-01

    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  12. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185

  13. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Institute of Scientific and Technical Information of China (English)

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou

    2005-01-01

    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  14. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Science.gov (United States)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-01

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  15. Validation and aplication of a polymerase chain reaction (PCR to detect porcine circovirus type 2 (PCV-2 in swine sera

    Directory of Open Access Journals (Sweden)

    Luisa Fernanda Villadiego Marmolejo

    2007-12-01

    Full Text Available Porcine circovirosis is an infectious-contagious syndrome caused by porcine circovirus type 2 (PCV-2 found mainly in recently weaned piglets causing dermatitis, neurological and reproductive disorders, pneumonia and encephalitis. The objectives of the present study were to validate a Polymerase Chain Reaction (PCR technique to detect PCV-2 in swine serum and to apply the validated technique in swine serum samples to detect PCV-2. After the application of two different PCRs, 100% of the surveyed animals were negative to PCV-2; furthermore, the PCR targeted to a region between ORFs 1 and 2 of the virus was found more sensitive when compared to another PCR targeted to the capsid protein gene. As a conclusion, PCR is a valid technique to detect PCV-2 in swine serum and the surveyed population was free of the virus.

  16. Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

    Science.gov (United States)

    Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

    2014-09-01

    Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures.

  17. A rapid DNA extraction method from culture and clinical samples. Suitable for the detection of human cytomegalovirus by the polymerase chain reaction.

    Science.gov (United States)

    Zandotti, C; De Lamballerie, X; Guignole-Vignoli, C; Bollet, C; De Micco, P

    1993-02-01

    We propose an one-step DNA extraction method suitable for the polymerase chain reaction. This procedure utilizes Chelex 100, a chelating in exchange resin. This technique was compared with a traditional technique (proteinase K lysis, phenol-chloroform extraction and ethanol precipitation) for isolation of human cytomegalovirus DNA from clinical samples. The procedure using Chelex 100 appeared to be a simple and fast extraction method for human cytomegalovirus DNA.

  18. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.;

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  19. Comparison of different polymerase chain reaction-based approaches for clonality assessment of immunoglobulin heavy-chain gene rearrangements in B-cell neoplasia

    NARCIS (Netherlands)

    Derksen, P W; Langerak, A W; Kerkhof, E; Wolvers-Tettero, I L; Boor, P P; Mulder, A H; Vrints, L W; Coebergh, J W; van Krieken, J H; Schuuring, E; Kluin, P M; van Dongen, J J

    1999-01-01

    Several frequently applied polymerase chain reaction strategies for analysis of immunoglobulin heavy-chain gene rearrangements were compared by analyzing 70 B-cell lymphoproliferative disorders and 24 reactive lymphoid lesions. Southern blot analysis was used as the "gold standard" for clonality ass

  20. Asteroid mass estimation using Markov-Chain Monte Carlo techniques

    Science.gov (United States)

    Siltala, Lauri; Granvik, Mikael

    2016-10-01

    Estimates for asteroid masses are based on their gravitational perturbations on the orbits of other objects such as Mars, spacecraft, or other asteroids and/or their satellites. In the case of asteroid-asteroid perturbations, this leads to a 13-dimensional inverse problem where the aim is to derive the mass of the perturbing asteroid and six orbital elements for both the perturbing asteroid and the test asteroid using astrometric observations. We have developed and implemented three different mass estimation algorithms utilizing asteroid-asteroid perturbations into the OpenOrb asteroid-orbit-computation software: the very rough 'marching' approximation, in which the asteroid orbits are fixed at a given epoch, reducing the problem to a one-dimensional estimation of the mass, an implementation of the Nelder-Mead simplex method, and most significantly, a Markov-Chain Monte Carlo (MCMC) approach. We will introduce each of these algorithms with particular focus on the MCMC algorithm, and present example results for both synthetic and real data. Our results agree with the published mass estimates, but suggest that the published uncertainties may be misleading as a consequence of using linearized mass-estimation methods. Finally, we discuss remaining challenges with the algorithms as well as future plans, particularly in connection with ESA's Gaia mission.

  1. Coamplification at lower denaturation temperature polymerase chain reaction enables selective identification of K-Ras mutations in formalin-fixed, paraffin-embedded tumor tissues without tumor-cell enrichment.

    Science.gov (United States)

    Yu, Shaorong; Xie, Li; Hou, Zhibo; Qian, Xiaoping; Yu, Lixia; Wei, Jia; Ding, Yitao; Liu, Baorui

    2011-09-01

    Conventional polymerase chain reaction-based Sanger sequencing is the standard assay for the detection of K-Ras mutations. However, this method is deficient in identifying small numbers of mutation-bearing cells, and tumor-cell enrichment methods such as microdissection or macrodissection are labor intensive and not always achievable. We applied the recently described coamplification at lower denaturation temperature polymerase chain reaction, which amplifies minority alleles selectively, to detect K-Ras mutations directly in 29 formalin-fixed, paraffin-embedded pancreatic specimens and compared the results with those of conventional polymerase chain reaction. To avoid a false-negative result from the coamplification at lower denaturation temperature polymerase chain reaction assay, we applied a more sensitive peptide nucleic acid polymerase chain reaction method as the gold standard. Dilution experiments indicated an approximately 5-fold improvement in sensitivity with coamplification at lower denaturation temperature polymerase chain reaction-based Sanger sequencing. Conventional polymerase chain reaction detected K-Ras mutations in 11 formalin-fixed, paraffin-embedded pancreatic specimens (37.9%), whereas coamplification at lower denaturation temperature polymerase chain reaction could identify all of those mutations as well as mutations in 10 additional samples, for a total of 21 (72.4%, P = .002) of 29. Unlike peptide nucleic acid polymerase chain reaction, coamplification at lower denaturation temperature polymerase chain reaction identified all K-Ras mutations in specimens in which tumor cells accounted for at least 20% of the total. Adoption of coamplification at lower denaturation temperature polymerase chain reaction is straightforward and requires no additional reagents or instruments. The technique is a good strategy to detect K-Ras mutations selectively in formalin-fixed, paraffin-embedded tissues without tumor-cell enrichment.

  2. Experimental verification of a computational technique for determining ground reactions in human bipedal stance.

    Science.gov (United States)

    Audu, Musa L; Kirsch, Robert F; Triolo, Ronald J

    2007-01-01

    We have developed a three-dimensional (3D) biomechanical model of human standing that enables us to study the mechanisms of posture and balance simultaneously in various directions in space. Since the two feet are on the ground, the system defines a kinematically closed-chain which has redundancy problems that cannot be resolved using the laws of mechanics alone. We have developed a computational (optimization) technique that avoids the problems with the closed-chain formulation thus giving users of such models the ability to make predictions of joint moments, and potentially, muscle activations using more sophisticated musculoskeletal models. This paper describes the experimental verification of the computational technique that is used to estimate the ground reaction vector acting on an unconstrained foot while the other foot is attached to the ground, thus allowing human bipedal standing to be analyzed as an open-chain system. The computational approach was verified in terms of its ability to predict lower extremity joint moments derived from inverse dynamic simulations performed on data acquired from four able-bodied volunteers standing in various postures on force platforms. Sensitivity analyses performed with model simulations indicated which ground reaction force (GRF) and center of pressure (COP) components were most critical for providing better estimates of the joint moments. Overall, the joint moments predicted by the optimization approach are strongly correlated with the joint moments computed using the experimentally measured GRF and COP (0.78 unity slope (experimental=computational results) for postures of the four subjects examined. These results indicate that this model-based technique can be relied upon to predict reasonable and consistent estimates of the joint moments using the predicted GRF and COP for most standing postures.

  3. Simplified procedures for applying the polymerase chain reaction to routinely fixed paraffin wax sections.

    Science.gov (United States)

    Coates, P J; d'Ardenne, A J; Khan, G; Kangro, H O; Slavin, G

    1991-02-01

    The polymerase chain reaction was applied to the analysis of DNA contained in archival paraffin wax embedded material. DNA suitable for the reaction was obtained from these tissues by simple extraction methods, without previous dewaxing of tissue sections. When compared with unfixed material, the reaction efficiency was compromised, so that an increased number of amplification cycles were required to produce equivalent amounts of amplified product. This in turn led to an increase in amplification artefacts, which can be minimised by a simple modification of the standard reaction. Amplification of relatively large DNA fragments was not always successful, and it seems prudent to bear this in mind when designing oligonucleotide primers which are to be used for the amplification of archival material. The efficiency of the procedure can be improved by dividing the amplification cycles into two parts: this reduces the amount of reagent needed, is relatively simple and inexpensive, and can be performed in one working day.

  4. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

    Science.gov (United States)

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-01-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  5. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    Directory of Open Access Journals (Sweden)

    V.K. Jain

    2010-02-01

    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  6. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples.

    Science.gov (United States)

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal

    2008-07-01

    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  7. Quantitative interpretation to the chain mechanism of free radical reactions in cyclohexane pyrolysis

    Institute of Scientific and Technical Information of China (English)

    Yingxian Zhao; Bo Shen; Feng Wei

    2011-01-01

    Pyrolysis of cyclohexane was conducted with a plug flow tube reactor in the temperature range of 873-973 K.Based on the experimental data,the mechanism and kinetic model of cyclohexane pyrolysis reaction were proposed.The kinetic analysis shows that overall conversion of cyclohexane is a first order reaction,of which the rate constant increased from 0.0086 to 0.0225 to 0.0623 s- 1 with the increase of temperature from 873 to 923 to 973 K,and the apparent activation energy was determined to be 155.0+1.0 kJ.mo1-1.The mechanism suggests that the cyclohexane is consumed by four processes:the homolysis of C-C bond (Path Ⅰ),the homolysis of C-H bond (Path Ⅱ) in reaction chain initiation,the H-abstraction of various radicals from the feed molecules in reaction chain propagation (Path Ⅲ),and the process associated with coke formation (Path Ⅳ).The reaction path probability (RPP) ratio of Xpath Ⅰ ∶ Xpath Ⅱ∶ XPath Ⅲ ∶ XPath Ⅳ was 0.5420 ∶ 0.0045 ∶ 0.3897 ∶ 0.0638 at 873 K,and 0.4336 ∶ 0.0061 ∶ 0.4885 ∶ 0.0718 at 973 K,respectively.

  8. Instability Criterion of One-Dimensional Detonation Wave with Three-Step Chain Branching Reaction Model

    Institute of Scientific and Technical Information of China (English)

    TENG Hong-Hui; JIANG Zong-Lin

    2011-01-01

    @@ One-dimensional detonation waves are simulated with the three-step chain branching reaction model, and the instability criterion is studied.The ratio of the induction zone length and the reaction zone length may be used to decide the instability, and the detonation becomes unstable with the high ratio.However, the ratio is not invariable with different heat release values.The critical ratio, corresponding to the transition from the stable detonation to the unstable detonation, has a negative correlation with the heat release.An empirical relation of the Chapman-Jouguet Mach number and the length ratio is proposed as the instability criterion.

  9. Cyclic polyesters prepared by poly(oxypropylene oxymaloyl ring-chain reactions

    Directory of Open Access Journals (Sweden)

    2007-01-01

    Full Text Available The synthesis of cyclic polyesters of poly(oxypropylene oxymaloyl from a ring-chain reaction was carried out at 40°C with 'Maghnite' an acid exchanged montmorillonite as acid solid ecocatalyst (Mag–H+. 'Maghnite' is already used as catalyst for polymerization of many vinylic and heterocyclic monomers [1]. The effect of amount of catalyst on yield and molecular weight of polymer was studied.A typical reaction product was analyzed by gel permeation chromatography (GPC as well as by nuclear magnetic resonance spectroscopy (1H-NMR and the existence of cyclic species was proven.

  10. Digital polymerase chain reaction in an array of femtoliter polydimethylsiloxane microreactors.

    Science.gov (United States)

    Men, Yongfan; Fu, Yusi; Chen, Zitian; Sims, Peter A; Greenleaf, William J; Huang, Yanyi

    2012-05-15

    We developed a simple, compact microfluidic device to perform high dynamic-range digital polymerase chain reaction (dPCR) in an array of isolated 36-femtoliter microreactors. The density of the microreactors exceeded 20000/mm(2). This device, made from polydimethylsiloxane (PDMS), allows the samples to be loaded into all microreactors simultaneously. The microreactors are completely sealed through the deformation of a PDMS membrane. The small volume of the microreactors ensures a compact device with high reaction efficiency and low reagent and sample consumption. Future potential applications of this platform include multicolor dPCR and massively parallel dPCR for next generation sequencing library preparation. PMID:22482776

  11. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  12. STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Honcharova S.Y.

    2015-08-01

    Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

  13. Exploiting the tetrazine-norbornene reaction for single polymer chain collapse.

    Science.gov (United States)

    Hansell, Claire F; Lu, Annhelen; Patterson, Joseph P; O'Reilly, Rachel K

    2014-04-21

    Single chain polymer nanoparticles (SCNPs) have been formed using polystyrenes decorated with pendent norbornenes and a bifunctional tetrazine crosslinker. Characterisation by size exclusion chromatography and (1)H NMR gives evidence for the formation of SCNPs by the tetrazine-norbornene reaction, whilst light scattering, neutron scattering, transmission electron microscopy and atomic force microscopy show that discrete well-defined nanoparticles are formed and their size in solution calculated.

  14. A polymerase chain reaction assay to determine infection of Aedes polynesiensis by Wuchereria bancrofti

    OpenAIRE

    Nicolas, L.; Luquiaud, P.; Lardeux, Frédéric; Mercer, D.R.

    1996-01-01

    The sensitivity of a previously described polymerase chain reaction (PCR) assay was improved to detect a single mosquito, infected by as few as 1-2 microfilariae of #Wuchereria bancrofti$, among 20-50 uninfected mosquitoes. Wild-caught #Aedes polynesiensis$ were used to compare assessment of infection by dissection of individuals with the PCR assay of pools of mosquitoes. The PCR assay was at least as sensitive as dissection for detection of mosquitoes infected with #W. bancrofti$. (Résumé d'...

  15. High-speed droplet-allele-specific polymerase chain reaction for genotyping of single nucleotide polymorphisms.

    Science.gov (United States)

    Matsuda, Kazuyuki; Honda, Takayuki

    2015-01-01

    Single nucleotide alternations such as single nucleotide polymorphisms (SNPs) or single nucleotide mutations are useful genetic markers for molecular diagnosis, prognosis, drug response, and predisposition to diseases. Rapid identification of SNPs or mutations is clinically important, especially for determining drug responses and selection of molecular-targeted therapy. Here, we describe a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) by using our droplet-PCR machine (droplet-AS-PCR).

  16. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard;

    2015-01-01

    Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...

  17. A reverse transcription-polymerase chain reaction assay for the detection of avian pneumovirus (Colorado strain).

    Science.gov (United States)

    Ali, A; Reynolds, D L

    1999-01-01

    A reverse transcription-polymerase chain reaction assay was developed for the detection of avian pneumovirus (Colorado strain) (APV-Col). The specific primers were designed from the published sequence of the matrix protein gene of APV-Col. The primers amplified a product of 631 nucleotides from APV-Col. The assay identified only APV-Col and did not react with Newcastle disease virus and infectious bronchitis virus.

  18. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    International Nuclear Information System (INIS)

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  19. Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri

    Directory of Open Access Journals (Sweden)

    Grace Q. Chen

    2010-01-01

    Full Text Available Problem statement: In transgenic plants, the number of transgene copies could greatly influence the level of expression and genetic stability of the target gene, thus it is important to develop an efficient method for accurate estimation of transgene copies. The quantitative Polymerase Chain Reaction (qPCR technique is becoming more efficient nowadays to determine copy numbers of transgenes in transgenic plants, being used here, for the first time in quantifying copy numbers of transgenes in Lesquerella fendleri. Approach: The system utilized a known one copy gene, LfKCS4/5, from L. fendleri as an endogenous calibrator and the threshold Crossing point (Ct measured by Applied Biosystem 7500 system to calculate the copy numbers of transgenes in primary transgenic lines (T0 generation. Results: The qPCR condition was optimized and each primer set had a PCR efficiency of 0.99 or 1.01. Our data demonstrated unambiguous 2-fold discrimination of the copy number of β-glucuronidase gene (gusA and hygromycine phosphotransferase II (hptII genes in 12 T0 lines. Most of the lines contained one or two copies of each gene. Eight out of 12 samples (66.7% showed more copies of gusA gene than that of hptII gene, suggesting rearrangements of the Transferred (T-DNA. Possible modifications of the T-DNA cassette in L. fendleri are discussed based on main models of T-DNA integration in the plant genome. Conclusion: The qPCR described in this study is an efficient method and it is particularly useful in identification and selection of transgenic plants with desirable copy numbers at early stage.

  20. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  1. PREVALENCE OF CYTOMEGALOVIRUS IN CHILDREN WHO RECEIVE BONE MARROW TRANSPLANTATION BY MEANS OF REAL-TIME POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    López-Montanero Edith Elizabeth

    2015-01-01

    Full Text Available Introduction: The citomegalovirus (CMV is an important virus worldwide. The early and mass-produced detection of the viral load for CMV helps to treat in an early way the infection and to avoid the disease in immunodeficient patients that in several cases could be lethal. Objective: To determine the prevalence of CMV in immunodeficient children who received bone marrow transplantation by means of real-time polymerase chain reaction. Methods: Retrospective, descriptive and cross-sectional study. The viral load was determined in plasma samples recollected since 2009 to 2012 in children who received bone marrow transplantation in the Hospital de la Sociedad de Lucha contra el Cáncer (SOLCA in Guayaquil, Ecuador. Results: 38 samples were analyzed. The average age was 7.2 years, and 57.9% (n=22 were men and 42.1% (n=16 women, with a male-female relationship 1:4. Of the analyzed samples, five patients presented positive results in the mentioned technique, who were the 80% of the female gender. And the population with the higher number of cases with positive results were Los Ríos, Guayas and Esmeraldas. The patients who were transplanted due to acute lymphoblastic leukemia and lymphoma with leukemization to acute lymphoblastic leukemia had positive results for active infection by CMV, 80% and 20%, respectively. Conclusion: The prevalence of CMV in children who received bone marrow transplantation by means of real-time polymerase chain reaction was of 13%, higher in the female gender. Rev.cienc.biomed. 2015;6(1:53-59 KEYWORDS Cytomegalovirus; Cytomegalovirus Infections; Transplant Recipients; Polymerase Chain Reaction.

  2. 聚合酶链反应-高分辨率溶解曲线技术在常见沙门菌分型中的应用研究%Clinical value of polymerase chain reaction high-resolution melting-curve technique in frequent Salmonella typing

    Institute of Scientific and Technical Information of China (English)

    盛翔宇; 张智杰; 薛文成; 周连庆; 梁雪妮; 刘蒙蒙; 孟冬娅

    2015-01-01

    目的:建立沙门菌的聚合酶链反应-高分辨率溶解曲线(PCR-HRM)分型方法,结合DNA测序方法,比较PCR-HRM分型方法和血清学分型方法的一致性,评价该方法的临床应用价值。方法对全部32株沙门菌,先用传统的血清学分型技术进行分型,然后选择fljB、gyrB和ycfQ 3个基因为目的基因,用PCR-HRM技术对其进行分型,最后通过扩增上述3个目的基因并测序作为分型的金标准,比较血清学分型技术和PCR-HRM技术分型的一致率和正确率,分析两种方法不一致的可能原因。结果对32株所测沙门菌,血清学分型技术分出6个血清型,PCR-HRM分型技术分出5个曲线型,血清学分型技术和PCR-HRM分型技术的一致率为84.4%;以测序结果作为金标准,血清学分型技术的正确分型率为84.4%,PCR-HRM技术的正确分型率为96.9%,两种方法比较差异尚无统计学意义(P=0.156),但在本研究中PCR-HRM技术具有更高的分型正确率。结论 PCR-HRM分型方法具有简单、快速、灵敏度高和正确率高的优点,与传统的血清学分型方法具有良好的一致性,在建立标准操作规程之后,PCR-HRM技术在沙门菌分型中具有良好的应用价值。%Objective To establish a polymerase chain reaction-high resolution melting curve (PCR-HRM)typing method for Salmonella, and to compare the consistency of PCR-HRM typing method and serological typing method combined with DNA sequencing method, then evaluate the clinical applying value of the method. Methods Total of 32 cases of Salmonella, typed by traditional serotyping method ifrstly, then selected lfjB, gyrB and ycfQ as the target genes and typed by PCR-HRM technique, the three target genes were ifnally ampliifed and sequenced as gold standard. The consistent rate and correct rate of serotyping method and PCR-HRM technique were compared and the possible inconsistent causes of the two methods were analyzed

  3. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  4. Compliance error compensation technique for parallel robots composed of non-perfect serial chains

    OpenAIRE

    Klimchik, Alexandr; Pashkevich, Anatol; Chablat, Damien; Hovland, Geir

    2012-01-01

    International audience The paper presents the compliance errors compensation technique for over-constrained parallel manipulators under external and internal loadings. This technique is based on the non-linear stiffness modeling which is able to take into account the influence of non-perfect geometry of serial chains caused by manufacturing errors. Within the developed technique, the deviation compensation reduces to an adjustment of a target trajectory that is modified in the off-line mod...

  5. Degenerate Oligonucleotide Primed-Polymerase Chain Reaction-Based Array Comparative Genomic Hybridization for Extensive Amplicon Profiling of Breast Cancers : A New Approach for the Molecular Analysis of Paraffin-Embedded Cancer Tissue

    OpenAIRE

    Daigo, Yataro; Chin, Suet-Feung; Gorringe, Kylie L.; Bobrow, Lynda G; Bruce A J Ponder; Pharoah, Paul D P; Caldas, Carlos

    2001-01-01

    We have developed a protocol for degenerate oligonucleotide-primed-polymerase chain reaction-based array comparative genomic hybridization (array CGH) that, when combined with a laser microdissection technique, allows the analysis of cancer cell populations isolated from routine, formalin-fixed, paraffin-embedded tissue samples. Comparison of copy number changes detected by degenerate oligonucleotide-primed-polymerase chain reaction-based array CGH to those detected by conventional array CGH ...

  6. Polymerase chain reaction for the evaluation of Schistosoma mansoni infection in two low endemicity areas of Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Gabriel Costa de Carvalho

    2012-11-01

    Full Text Available This study aimed to evaluate the occurrence of schistosomiasis in areas with low endemicity using polymerase chain reaction (PCR as a diagnostic method. We analysed faecal samples from 219 individuals residing in Piau and Coronel Pacheco, state of Minas Gerais, Brazil, using a single faecal sample from each individual and two slides of the Kato-Katz technique as a gold standard. Fifteen out of the 219 samples were positive with both methods of diagnosis. One sample was diagnosed as positive by the Kato-Katz technique only and 61 were diagnosed only by PCR. The positivity rates were 7.3% with the Kato-Katz method and 34.7% with PCR. When both techniques were assumed to have 100% specificity and positive individuals were identified by both methods, the sensitivity of the Kato-Katz method was 20.8% and the PCR sensitivity was 98.7%. The Kappa index between the two techniques was 0.234, suggesting weak agreement. The assessment of a single faecal sample by PCR detected more cases of infection than the analysis of one sample with two slides using the Kato-Katz technique, suggesting that PCR can be a useful diagnostic tool, particularly in areas with low endemicity.

  7. An optimized polymerase chain reaction assay to identify avian virus vaccine contamination with Chicken anemia virus.

    Science.gov (United States)

    Amer, Haitham M; Elzahed, Hanan M; Elabiare, Elham A; Badawy, Ahmed A; Yousef, Ausama A

    2011-01-01

    The use of embryonating chicken eggs in preparation of avian virus vaccines is the principle cause for contamination with Chicken anemia virus (CAV). Identification of CAV in contaminated vaccines relies on the expensive, tedious, and time-consuming practice of virus isolation in lymphoblastoid cell lines. The experience of the last 2 decades indicates that polymerase chain reaction is extending to replace most of the classic methods for detection of infectious agents. In the present report, a simple, rapid, and accurate polymerase chain reaction method for detection of CAV in poultry vaccines is described. Oligonucleotide primers homologous to highly conserved sequences of the VP1 gene were used to amplify a fragment of 676 bp. The developed assay was specific for detecting CAV from different sources, with no cross reactivity with many avian viruses. No inter- and intra-assay variations were observed. The analytical sensitivity of the test was high enough to detect 5 TCID(50) (50% tissue culture infective dose) of the virus per reaction; however, different factors related to the vaccine matrix showed considerable effects on the detection limit. In conclusion, this method may represent a suitable alternative to virus isolation for identification of CAV contamination of poultry virus vaccines.

  8. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wei-Ping Qian; Li-Ka Shing; Yue-Qiu Tan; Ying Chen; Ying Peng; Zhi Li; Guang-Xiu Lu; Marie C. Lin; Hsiang-Fu Kung; Ming-Ling He

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen.METHODS: Hepatitis B viral DNA was isolated from HBV carriers' semen and sera using phenol extraction method and QTAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction.RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5×107 and 1.67×107 copies of HBV DNA per mL in two HBV infected patients' sera, while 2.L4×105 and 3.02×105 copies of HBV DNA per mL in the semen.CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen.

  9. Evaluation of the polymerase chain reaction in the diagnosis of cutaneous leishmaniasis due to Leishmania major: a comparison with direct microscopy of smears and sections from lesions

    DEFF Research Database (Denmark)

    Andresen, K; Gaafar, A; El-Hassan, A M;

    1996-01-01

    We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....

  10. Novel assay of competitively differentiated polymerase chain reaction for screening point mutation of hepatitis B virus

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Xue-Juan Chen; Jian-Guo Li; Lin Gu; Yang-Su Huang; Zhi-Liang Gao

    2003-01-01

    AIM: Point mutation, one of the commonest gene mutations,is the most important molecular pathogenesis of cancer and chronic infection. The commonest methods for detection of point mutation are based on polymerase chain reaction (PCR). These techniques, however, cannot be used in large scale screening since they are neither accurate nor simple.For this reason, this study established a novel method of competitively differentiated PCR (CD-PCR) for screening point mutation in clinical practice.METHODS: Two competitively differentiated primers for mutant-type and wild-type templates respectively with an identically complemented region in 3′ end except for last 2base pairs and a different non-complemented region in 5′end were designed. Thus, competitive amplification might be carried out at a lower annealing temperature at first, and then differentiated amplification at a higher annealing temperature when primers could not combine with initial templates. The amplification was performed in one-tube.The products of CD-PCR were detected using microplate hybridization assay. CD-PCR was evaluated by detecting G1896A variant of hepatitis B virus (HBV) in form of recombinant plasmids and in sera from patients with hepatitis B, and compared with allele-specific PCR (AS-PCR) and competitive AS-PCR.RESULTS: CD-PCR was successfully established. It could clearly distinguish wild-type and mutant-type plasmid DNA of G1896A variant when the amount of plasmid DNA was between 102-108copies/reaction, while for AS-PCR and competitive AS-PCR, the DNA amount was between 102-104copies/reaction. CD-PCR could detect one copy of G1896A variant among 10-100 copies of wild-type plasmid DNA. The specificity of CD-PCR was higher than those of AS-PCR and competitive AS-PCR in the detection of HBV G1896A variant in sera from patients with hepatitis B. CD-PCR was independent of the amount of HBV DNA in serum. HBV G1896A variant was more often found in HBeAg (-) patients with a lower level of

  11. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    1993-01-01

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  12. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline;

    2015-01-01

    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma...

  13. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping, E-mail: dianping.tang@fzu.edu.cn

    2013-06-14

    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling.

  14. Acyl chains of phospholipase D transphosphatidylation products in Arabidopsis cells: a study using multiple reaction monitoring mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Dominique Rainteau

    Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.

  15. Genome editing. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations.

    Science.gov (United States)

    Gantz, Valentino M; Bier, Ethan

    2015-04-24

    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype, whereas individuals homozygous for two copies of the allele will display a mutant phenotype. We have developed a method called the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome-editing system for generating autocatalytic mutations, to produce homozygous loss-of-function mutations. In Drosophila, we found that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome, thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  16. Diagnosis of Dengue by Using Reverse Transcriptase-Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Miagostovich Marize Pereira

    1997-01-01

    Full Text Available A rapid identification of dengue viruses from clinical samples by using a nested reverse transcriptase-polymerase chain reaction (RT-PCR procedure was carried out for diagnostic and epidemiological purposes. RT-PCR identified DEN-1 and DEN-2 viruses in 41% (41/100 of previously confirmed cases and provided an accurate confirmation of DHF in four fatal cases. RT-PCR was also useful for detecting and typing dengue viruses in suspected cases, allowing a rapid identification of new serotypes in endemic areas

  17. A polymerase chain reaction protocol for the detection of various geographical isolates of white spot virus.

    Science.gov (United States)

    Tapay, L M; Nadala, E C; Loh, P C

    1999-09-01

    Polymerase chain reaction (PCR) primers were designed based on the sequence of a cloned fragment of the white spot virus (WSV) genome and were used to detect at least four geographic isolates of WSV from both experimentally- and naturally-infected shrimp. In addition to high specificity, the one-step and two-step PCR protocols were determined to have sensitivities of 10-100 pg and 100 femtograms respectively. The two-step PCR protocol is recommended as a very sensitive and specific alternative protocol to Western blot assay for the detection of WSV.

  18. Characterization of a nested polymerase chain reaction assay for detection of parvovirus B19.

    OpenAIRE

    Patou, G.; Pillay, D.; Myint, S; Pattison, J.

    1993-01-01

    The characterization and application of a nested polymerase chain reaction (PCR) assay for the detection of human parvovirus B19 DNA is described. The assay was evaluated with 149 diagnostic serum samples (collected up to 150 days after the onset of symptoms) previously tested by dot blot hybridization for B19 DNA and by class-specific capture radioimmunoassays for the detection of B19 immunoglobulin M (IgM) and IgG. B19 DNA was detectable by the PCR in 70% of the sera. There was a statistica...

  19. [Identification of the causative agents of glanders and melioidosis by polymerase chain reaction].

    Science.gov (United States)

    Tkachenko, G A; Antonov, V A; Zamaraev, V S; Iliukhin, V I

    2003-01-01

    Burkholderia mallei and B. pseudomallei are causative agents of glanders and melioidosis, respectively, i.e. severe and fatal infection diseases of man and animal. The computer-based analysis of the 23S rRNA gene sites was used for selecting the primers. Two pairs of primers were chosen for the identification of B. mallei and Bpseudomallei. DNAs from 48 B. pseudomallei and 15 strains of B. mallei, unlike from other geterological bacteria, were positively amplified. Therefore, the method of polymerase chain reaction can be used in laboratory diagnosis of glanders and melioidosis.

  20. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  1. Development and validation of a Myxoma virus real-time polymerase chain reaction assay

    OpenAIRE

    Albini, S.; Sigrist, B; Guttinger, R; Schelling, C.; Hoop, R K; Vogtlin, A

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  2. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    Science.gov (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  3. Use of polymerase chain reaction for detection of Listeria monocytogenes in food.

    OpenAIRE

    Niederhauser, C; Candrian, U; Höfelein, C; M. Jermini; Bühler, H P; Lüthy, J

    1992-01-01

    A previously described polymerase chain reaction (PCR) assay (B. Furrer, U. Candrian, C. Höfelein, and J. Lüthy, J. Appl. Bacteriol. 70:372-379, 1991) was used to analyze food for the presence of Listeria monocytogenes. Food samples were artificially contaminated to develop two procedures to detect the organism following enrichment steps. Procedure A was based on dilution of the enrichment broth followed by lysis of the bacteria and direct analysis of the lysate with PCR. With procedure A and...

  4. Rapid detection of Helicobacter pylori in gastric biopsy material by polymerase chain reaction.

    OpenAIRE

    Hammar, M.; Tyszkiewicz, T; Wadström, T.; O'Toole, P W

    1992-01-01

    By using primers based on the sequence of a species-specific antigen of Helicobacter pylori (P. O'Toole, S.M. Logan, M. Kostrzynska. T. Wadström, and T.J. Trust, J. Bacteriol. 173:505-513, 1991), a protocol was established for detection of this microorganism in gastric biopsy samples by the polymerase chain reaction (PCR). A single primer pair was used to specifically amplify a 298-bp sequence in a rapid two-step PCR. The primers exhibited the same specificity in PCR as that which we reported...

  5. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    Science.gov (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples.

  6. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    OpenAIRE

    Liang Gaofeng; Ma Chao; Zhu Yanliang; Li Shuchun; Shao Youhua; Wang Yong; Xiao Zhongdang

    2010-01-01

    Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase ...

  7. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction

    OpenAIRE

    Alexandrakis, G.; JALALI, S; Gloor, P

    1998-01-01

    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In o...

  8. A Novel Nested Polymerase Chain Reaction (n-PCR) Assay for Identifying Sorghum nitidum

    OpenAIRE

    Wei, Shasha; Zhirui DENG; Liping YIN; Yi, Jianping; Renqi WU; Qin CHEN

    2011-01-01

    This work developed a novel nested polymerase chain reaction (n-PCR) assay to identify Sorghum nitidum (S. nitidum). It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band ...

  9. Specific detection of the toxic shock syndrome toxin-1 gene using the polymerase chain reaction.

    Science.gov (United States)

    Jaulhac, B; Prevost, G; Piemont, Y

    1991-08-01

    A rapid and specific assay for toxic shock syndrome toxin-1 gene (tst gene) detection in Staphylococcus aureus was developed using the polymerase chain reaction. A two-primer set and an oligonucleotide detection probe were synthesized. After 40 cycles of amplification, detection of a 160-bp amplified DNA fragment was carried out by agarose gel electrophoresis and Southern blot hybridization. This assay was sensitive since it was able to detect 1-10 bacteria. It was also specific since no amplification was documented with DNAs from enterotoxigenic S. aureus or Gram-negative bacteria devoid of the tst gene.

  10. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.

    Science.gov (United States)

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J

    2016-09-01

    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii. PMID:27206968

  11. Analysis of ancient DNA from coprolites: a perspective with random amplified polymorphic DNA-polymerase chain reaction approach

    Directory of Open Access Journals (Sweden)

    Iñiguez Alena M

    2003-01-01

    Full Text Available The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pretreatment was essential to overcome the DNA degradation and the serial dilutions helped with to prevent polymerase chain reaction (PCR inhibitors. Moreover, the random amplified polymorphic DNA-PCR has been shown to be a reliable technique for further experiments to recover specific aDNA sequences.

  12. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    Science.gov (United States)

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  13. Molecular detection of the carriage rate of four intestinal protozoa with real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L;

    2015-01-01

    -Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...... intestinalis, and Cryptosporidium. Questionnaires were administered for epidemiological data collection. E. histolytica was not detected in any of the samples, whereas Giardia (37.2%), E. dispar (18.6%), and Cryptosporidium (1%) were found. Most of the children sourced their drinking water from community wells...... (91%), while the majority disposed of feces in the bush (81.9%). Our study is the first to use real-time PCR to evaluate the epidemiology of E. histolytica, Giardia, and Cryptosporidium in Nigeria where previous studies using traditional diagnostic techniques have suggested higher and lower carriage...

  14. Identifiability of parameters and behaviour of MCMC chains: a case study using the reaction norm model.

    Science.gov (United States)

    Shariati, M M; Korsgaard, I R; Sorensen, D

    2009-04-01

    Markov chain Monte Carlo (MCMC) enables fitting complex hierarchical models that may adequately reflect the process of data generation. Some of these models may contain more parameters than can be uniquely inferred from the distribution of the data, causing non-identifiability. The reaction norm model with unknown covariates (RNUC) is a model in which unknown environmental effects can be inferred jointly with the remaining parameters. The problem of identifiability of parameters at the level of the likelihood and the associated behaviour of MCMC chains were discussed using the RNUC as an example. It was shown theoretically that when environmental effects (covariates) are considered as random effects, estimable functions of the fixed effects, (co)variance components and genetic effects are identifiable as well as the environmental effects. When the environmental effects are treated as fixed and there are other fixed factors in the model, the contrasts involving environmental effects, the variance of environmental sensitivities (genetic slopes) and the residual variance are the only identifiable parameters. These different identifiability scenarios were generated by changing the formulation of the model and the structure of the data and the models were then implemented via MCMC. The output of MCMC sampling schemes was interpreted in the light of the theoretical findings. The erratic behaviour of the MCMC chains was shown to be associated with identifiability problems in the likelihood, despite propriety of posterior distributions, achieved by arbitrarily chosen uniform (bounded) priors. In some cases, very long chains were needed before the pattern of behaviour of the chain may signal the existence of problems. The paper serves as a warning concerning the implementation of complex models where identifiability problems can be difficult to detect a priori. We conclude that it would be good practice to experiment with a proposed model and to understand its features

  15. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain...

  16. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO;

    1993-01-01

    CP-specific B lymphocytes were isolated by antigen-coated immunomagnetic beads. After the purification, at least 98% of the immunoglobulin-secreting recovered cells were HibCP specific. The RNA was isolated and amplified by cDNA synthesis using a kappa constant region primer followed by polymerase chain...... reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...

  17. Estimation of the diagnostic accuracy of the glyco-C and US9 gene-based polymerase chain reaction technique for the detection of bovine Herpesvirus type 5 DNA in decomposed brain suspension from a slaughter house using Bayesian analysis, Brazil.

    Science.gov (United States)

    Cardoso, Tereza Cristina; Antello, Talita Fontes; Vieira, Flávia Volpato; Machado, Saulo Tarso Zacarias; Nogueira, Adriana Hellmeister de Campos

    2012-03-01

    Brazil represents the greatest beef producer among tropical countries, and the major obstacle for meat international trade is sanitary problems especially closely related to viral encephalitis. The goal of this study was to estimate the accuracy of the glycol and US9 gene-based polymerase chain reactions (PCRs) for the detection of bovine Herpesvirus type 5 (BoHV-5) from decomposed brain samples (n = 95). For this purpose, a latent-class (bayesian) approach was used. Sensitivity (Se) was estimated to be 70% (95% probability interval, 40-80) and specificity (Sp) 100% in the statistical analysis for both PCRs used. Accordingly, a minimum of ≥40% of the calves was estimated to harbor BoHV-5 DNA even after 72 h of decomposition at room temperature. It was concluded that US9 gene-based PCR could also be considered a cost-effective alternative in sanitary programmers. However, given the importance of veterinary diagnoses, PCR-positive samples should be further confirmed through in vitro isolation and/or sequencing. PMID:21786161

  18. Means – End Chain Theory and Laddering Technique: Applications in Consumer Behavior Research

    Directory of Open Access Journals (Sweden)

    Ayca Kangal

    2013-04-01

    Full Text Available Means – end chain (MEC theory and laddering technique uncovers the decision making process of consumers related to marketing offerings such as goods, services and experiences in a cognitive approach from a consumer perspective view which are popularly used approaches in marketing context. The purpose of the study is to discusss and present the laddering techique to Turkish literature, which is a frequently used qualitative research method in consumer behavior, both with related theoretical structure and practice. With this purpose, the overview of the literature within the frame of means – end chain theory, practices in consumer behavior, laddering technique, data collection, data analyze and interperation steps, limits of the laddering technique and alternatives of soft laddering (hard laddering is discussed. Laddering technique among with alternative data collection tools are anticipated Turkish researchers’ interest.

  19. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    Science.gov (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR.

  20. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  1. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan

    2001-01-01

    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......) x s(-1)) > backbone amides (10-10(-3) M(-1) x s(-1)) > Gln(0.03 M(-1) x s(-1)) approximately Asn (0.03 M(-1) x s(-1)). The rate constants for reaction of HOCl with backbone amides (peptide bonds) vary by 4 orders of magnitude with uncharged peptide bonds reacting more readily with HOCl than those...

  2. Dynamics of interfacial reactions between O({sup 3} P) atoms and long-chain liquid hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Allan, Mhairi [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Bagot, Paul A J [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Koehler, Sven P K [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Reed, Stewart K [Department of Physics and Astronomy, University of Edinburgh, The King' s Buildings, Edinburgh EH9 3JZ (United Kingdom); Westacott, Robin E [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Costen, Matthew L [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); McKendrick, Kenneth G [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom)

    2007-09-15

    Recent progress that has been made towards understanding the dynamics of collisions at the gas-liquid interface is summarized briefly. We describe in this context a promising new approach to the experimental study of gas-liquid interfacial reactions that we have introduced. This is based on laser-photolytic production of reactive gas-phase atoms above the liquid surface and laser-spectroscopic probing of the resulting nascent products. This technique is illustrated for reaction of O({sup 3}P) atoms at the surface of the long-chain liquid hydrocarbon squalane (2,6,10,15,19,23-hexamethyltetracosane). Laser-induced fluorescence detection of the nascent OH has revealed mechanistically diagnostic correlations between its internal and translational energy distributions. Vibrationally excited OH molecules are able to escape the surface. At least two contributions to the product rotational distributions are identified, confirming and extending previous hypotheses of the participation of both direct and trapping-desorption mechanisms. We speculate briefly on future experimental and theoretical developments that might be necessary to address the many currently unanswered mechanistic questions for this, and other, classes of gas-liquid interfacial reaction.

  3. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.

    2009-01-01

    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  4. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. (Univ. of Illinois, Chicago (USA)); Wunder, J.S.; Andrulis, I.L. (Mount Sinai Hospital, Toronto, Ontario (Canada)); Gazdar, A.F. (National Cancer Inst., Bethesda, MD (USA)); Willman, C.L.; Griffith, B. (Univ. of New Mexico, Albuquerque (USA)); Von Hoff, D.D. (Univ. of Texas, San Antonio (USA))

    1990-09-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  5. Solving the SAT problem using a DNA computing algorithm based on ligase chain reaction.

    Science.gov (United States)

    Wang, Xiaolong; Bao, Zhenmin; Hu, Jingjie; Wang, Shi; Zhan, Aibin

    2008-01-01

    A new DNA computing algorithm based on a ligase chain reaction is demonstrated to solve an SAT problem. The proposed DNA algorithm can solve an n-variable m-clause SAT problem in m steps and the computation time required is O (3m+n). Instead of generating the full-solution DNA library, we start with an empty test tube and then generate solutions that partially satisfy the SAT formula. These partial solutions are then extended step by step by the ligation of new variables using Taq DNA ligase. Correct strands are amplified and false strands are pruned by a ligase chain reaction (LCR) as soon as they fail to satisfy the conditions. If we score and sort the clauses, we can use this algorithm to markedly reduce the number of DNA strands required throughout the computing process. In a computer simulation, the maximum number of DNA strands required was 2(0.48n) when n=50, and the exponent ratio varied inversely with the number of variables n and the clause/variable ratio m/n. This algorithm is highly space-efficient and error-tolerant compared to conventional brute-force searching, and thus can be scaled-up to solve large and hard SAT problems. PMID:17904730

  6. Effects of ionization mode on charge-site-remote and related fragmentation reactions of long-chain quaternary ammonium ions.

    Science.gov (United States)

    Seto, C; Grossert, J S; Waddell, D S; Curtis, J M; Boyd, R K

    2001-05-01

    Comparison of collisionally activated fragment spectra of long-chain quaternary ammonium ions, formed by liquid-assisted secondary ion mass spectrometry (LSIMS) and electrospray ionization (ESI), shows the latter are dominated by radical cations while the former yield mainly even-electron charge-site-remote (CSR) fragments, similar to the report for different precursors by Cheng et al., J. Am. Soc. Mass Spectrom. 1998, 9, 840. Here, mixed-site fragmentation products (formal loss of a radical directly bonded to the nitrogen plus a radical derived from the long chain) are of comparable importance for both ionization techniques. These observations are difficult to understand if the CSR ions are formed by a concerted rearrangement-elimination reaction, since precollision internal energies of the ESI ions are much lower than those of the ions from LSIMS. Alternatively, if one discards the concerted mechanism for high-energy CA, and assumes that the even-electron fragments are predominantly formed via homolytic bond cleavage, the colder radical cations from ESI survive to the detector while the more energized counterparts from LSIMS preferentially lose a hydrogen atom to yield the CSR ions, as proposed by Wysocki and Ross (Int. J. Mass Spectrom. Ion Processes 1991, 104, 179). The present work also attempts to reconcile discrepancies involving critical energies and known structures for neutral fragments. PMID:11349955

  7. ISOLASI Campylobacter DARI KARKAS AYAM MENGGUNAKAN METODE KONVENSIONAL DAN POLYMERASE CHAIN REACTIONS [Isolation of Campylobacter from Poultry Carcasses using Conventional and Polymerase Chain Reaction Methods

    Directory of Open Access Journals (Sweden)

    Surachmi Setiyaningsih2

    2013-06-01

    Full Text Available Campylobacter jejuni and Campylobacter coli are two spesies of Campylobacter sp. frequently found as pathogenic bacteria causing human gastrointestinal infections. Contaminated chicken carcasses have been reported as the source of human campylobacteriosis. In this study, Campylobacter were isolated from chicken carcasses sold in traditional markets and supermarkets. In traditional markets, chicken carcasses are sold without proper packaging or in an open space and stored at room temperature (25-30°C for prolonged period allowing pathogenic bacteria to grow. While at supermarkets, chicken carcasses are openly displayed or enclosed in plastic wrappings and stored in a refrigerator (4-8°C. A total of 298 samples of chicken carcasses from traditional markets and supermarkets in the area of DKI Jakarta, West Java (Bogor and Sukabumi and Central Java (Kudus and Demak were collected. Isolation and identification using conventional and Polymerase Chain Reactions (PCR methods were done to determine the prevalence of C. jejuni and C. coli contamination in poultry. The results showed that chicken carcasses sold in the sampling area, both traditional markets and supermarkets, were contaminated with C. jejuni and C. coli. The contamination rate of Campylobacter sp. in chicken carcasses sold in supermarkets, were 14.1% by conventional methods and 29.5% by PCR. This was higher than those in traditional markets, i.e. 5.7 and 12.1%, respectively. It is also confirmed that the prevalence for contamination of C. jejuni was higher than C. coli in 298 samples, i.e. 16.1% and 3.7% by conventional method and 23.5% and 18.1% by PCR method respectively.

  8. Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction.

    Science.gov (United States)

    Chen, Ruey-Shyang; Tsay, Jwu-Guh; Huang, Yu-Fen; Chiou, Robin Y Y

    2002-05-01

    The Aspergillus flavus group covers species of A. flavus and Aspergillus parasiticus as aflatoxin producers and Aspergillus oryzae and Aspergillus sojae as koji molds. Genetic similarity among these species is high, and aflatoxin production of a culture may be affected by cultivation conditions and substrate composition. Therefore, a polymerase chain reaction (PCR)-mediated method of detecting the aflatoxin-synthesizing genes to indicate the degree of risk a genotype has of being a phenotypic producer was demonstrated. In this study, 19 strains of the A. flavus group, including A. flavus, A. parasiticus, A. oryzae, A. sojae, and one Aspergillus niger, were subjected to PCR testing in an attempt to detect four genes, encoding for norsolorinic acid reductase (nor-1), versicolorin A dehydrogenase (ver-1), sterigmatocystin O-methyltransferase (omt-1), and a regulatory protein (apa-2), involved in aflatoxin biosynthesis. Concurrently, the strains were cultivated in yeast-malt (YM) broth for aflatoxin detection. Fifteen strains were shown to possess the four target DNA fragments. With regard to aflatoxigenicity, all seven aflatoxigenic strains possessed the four DNA fragments, and five strains bearing less than the four DNA fragments did not produce aflatoxin. When peanut kernels were artificially contaminated with A. parasiticus and A. niger for 7 days, the contaminant DNA was extractable from a piece of cotyledon (ca. 100 mg), and when subjected to multiplex PCR testing using the four pairs of primers coding for the above genes, they were successfully detected. The target DNA fragments were detected in the kernels infected with A. parasiticus, and none was detected in the sound (uninoculated) kernels or in the kernels infected with A. niger.

  9. Diagnosis of human herpesvirus 6B primary infection by polymerase chain reaction in young children with exanthematic disease

    Directory of Open Access Journals (Sweden)

    Ivna de Melo Magalhães

    2011-06-01

    Full Text Available INTRODUCTION: Exanthem subitum is a classical rash disease of early childhood caused by human herpesvirus 6B (HHV-6B. However, the rash is frequently misdiagnosed as that of either measles or rubella. METHODS: In this study, a nested multiplex polymerase chain reaction (PCR was used to diagnose HHV-6B primary infection, differentiate it from infections caused by HHV-6A and compare it to antibody avidity tests. The samples were separated into case group and control group according to the results of the indirect immunofluorescence assay (IFA technique. RESULTS: From the saliva samples analyzed, HHV-6A DNA was detected in 3.2% of the case group and in 2.6% of the control group. Regarding HHV-6B, PCR detected viral DNA in 4.8% of the case group and in 1.3% of the control group. Among the serum samples studied, a frequency of 1.7% was determined for HHV-6A in the case group and 1.2% in the control group. PCR did not detect HHV-6B DNA in serum samples. The sensitivity and specificity of the PCR technique ranged from 0% to 4.8% and 97.5% to 100%, respectively, compared to IFA. CONCLUSIONS: The PCR technique was not suitable for diagnosing primary infection by HHV-6B in children with exanthematic disease and should not substitute the IFA.

  10. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes

    2014-12-01

    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  11. Detection of spirorchiid trematodes in gastropod tissues by polymerase chain reaction: preliminary identification of an intermediate host of Learedius learedi.

    Science.gov (United States)

    Stacy, Brian A; Frankovich, Thomas; Greiner, Ellis; Alleman, A Rick; Herbst, Lawrence H; Klein, Paul; Bolten, Alan; McIntosh, Antoinette; Jacobson, Elliott R

    2010-08-01

    Marine spirorchiid trematodes are associated with morbidity and mortality in sea turtles worldwide. The intermediate hosts remain unknown, and discovery efforts are hindered by the large number and great diversity of potential hosts within sea turtle habitats, as well the potential for low prevalence and overdispersion. A high-throughput DNA extraction and polymerase chain reaction-based method was developed to detect the internal transcribed spacer 2 (ITS2) region of the ribosomal gene of 2 spirorchiid genera, Learedius and Hapalotrema , within pooled samples of gastropod tissues. A model system consisting of freshwater snail ( Pomacea bridgesii ) tissues and DNA extracts spiked with adult Learedius learedi and known quantities of spirorchiid DNA was used to develop and test the technique. Threshold of detection was found to be equivalent to an early prepatent infection within 1.5 g of gastropod tissue. This technique was used to screen approximately 25 species of marine gastropods at a captive facility where green turtles ( Chelonia mydas ) become infected by L. learedi . The parasite was detected in a sample of knobby keyhole limpet ( Fissurella nodosa ), thus providing the first evidence of an intermediate host for a marine spirorchiid trematode. This technique has many potential applications in trematode life cycle discovery studies.

  12. Comparison of DNA extraction protocols for Mycobacterium Tuberculosis in diagnosis of tuberculous meningitis by real-time polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Rajeev Thakur

    2011-01-01

    Full Text Available Background: Several nucleic acid amplification techniques are available for detection of Mycobacterium tuberculosis (MTB in pulmonary and extrapulmonary samples, but insufficient data are available on the diagnostic utility of these techniques in tubercular meningitis where bacilli load is less. The success of final amplification and detection of nucleic acid depends on successful extraction of DNA from the organism. Aims: We performed this study to compare four methods of extraction of MTB DNA from cerebrospinal fluid (CSF samples so as to select one method of DNA extraction for amplification of nucleic acid from clinical samples. Materials and Methods: Four methods of extracting MTB DNA from CSF samples for testing by real-time polymerase chain reaction (PCR were compared: QIAGEN R protocol for DNA purification using QIAamp spin procedure (manual, AMPLICOR R respiratory specimen preparation kit, MagNA Pure R kit extraction, combined manual DNA extraction with automated extraction by MagNA Pure R . Real-time PCR was performed on COBAS TaqMan 48 Analyzer R with known positive and negative controls. Results: The detection limit for the combined manual and MagNA Pure R extraction protocol was found to be 100 copies of MTB DNA per reaction as against 1,000 copies of MTB DNA per reaction by the QIAGEN R , AMPLICOR R , and the MagNA Pure R extraction protocol. Conclusion: The real-time PCR assay employing the combination of manual extraction steps with MagNA Pure R extraction protocol for extraction of MTB DNA proved to be better than other extraction methods in analytical sensitivity, but could not detect less than 10 2 bacilli /ml.

  13. Cloning and sequencing of human lambda immunoglobulin genes by the polymerase chain reaction.

    Science.gov (United States)

    Songsivilai, S; Bye, J M; Marks, J D; Hughes-Jones, N C

    1990-12-01

    Universal oligonucleotide primers, designed for amplifying and sequencing genes encoding the rearranged human lambda immunoglobulin variable region, were validated by amplification of the lambda light chain genes from four human heterohybridoma cell lines and in the generation of a cDNA library of human V lambda sequences from Epstein-Barr virus-transformed human peripheral blood lymphocytes. This technique allows rapid cloning and sequencing of human immunoglobulin genes, and has potential applications in the rescue of unstable human antibody-producing cell lines and in the production of human monoclonal antibodies.

  14. High-throughput Procedure for Single Pollen Grain Collection and Polymerase Chain Reaction in Plants

    Institute of Scientific and Technical Information of China (English)

    Ping-Hua Chen; Yong-Bao Pan; Ru-Kai Chen

    2008-01-01

    Single pollen grain polymersse chain reaction (PCR) has succeeded in several species, however only limited numbers of pollen grains were involved due to difficulties in pollen isolation and lysis. This has limited its application in genetic analysis and mapping studies in plants. A high-throughput (HT) procedure for collecting and detecting genetic variation in a large number of individual pollen grains by PCR is reported. The HT procedure involved the collection of Individual pollen grains by a pair of special forceps and the lysis of pollen grains in a heated alkali/detergent solution followed by neutralization with a tris-ethylenediamine tetraacetic acid (TE) buffer. These resulting template solutions yielded PCR reactions involving the 5S ribosomal RNA intergenic spacers, randomly amplified polymorphic DNA, and simple sequence repeats markers. Using this procedure, one person with experience could collect and process up to 288 single pollen grain PCR reactions per day. The method worked well on sugarcane, corn, Miscanthus spp., snap bean, sorghum, and tomato. The ability to collect and conduct PCR on individual pollen grains on a large scale offers a new approach to genetic analyses and mapping studies in an easily controllable environment with a considerable cost reduction. The method will also significantly benefit studies in species that are difficult subjects for classical genetic research.

  15. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  16. Probing chain-end functionalization reactions in living anionic polymerization via matrix-assisted laser desorption ionization time-of-flight mass spectrometry

    Science.gov (United States)

    Arnould, Mark A.; Polce, Michael J.; Quirk, Roderic P.; Wesdemiotis, Chrys

    2004-11-01

    Matrix-assisted laser desorption ionization (MALDI) time-of-flight (TOF) mass spectrometry (MS) is applied to examine the products arising upon the preparation of chain-end functional polymers via living anionic polymerization techniques. Both post-polymerization functionalizations as well as the use of functionalized initiators are investigated. MALDI-TOF MS is shown to be a sensitive probe for the qualitative analysis of the major and minor oligomers from novel functionalization reactions whose mechanisms are not yet well established. The method is particularly valuable for the identification of the end groups of the minor, and often unexpected, distributions that may be undetectable by other analytical means. Complete characterization of all oligomers generated during functionalization reactions provides an essential tool to the synthetic chemist for understanding the corresponding mechanisms. This insight is necessary for selecting alternative routes or making modifications to the reaction conditions. It is demonstrated that MALDI-TOF MS can convey quantitative information about the yields of the chain-end groups introduced during functionalization. From the cases presented it is evident that post-polymerization reactions allow for better control of chain-end functionality and molecular weight than functionalization with the limited number of currently available protected functionalized initiators.

  17. Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis.

    Directory of Open Access Journals (Sweden)

    Melissa K Gregory

    Full Text Available BACKGROUND: Δ6-Desaturase (Fads2 is widely regarded as rate-limiting in the conversion of dietary α-linolenic acid (18:3n-3; ALA to the long-chain omega-3 polyunsaturated fatty acid docosahexaenoic acid (22:6n-3; DHA. However, increasing dietary ALA or the direct Fads2 product, stearidonic acid (18:4n-3; SDA, increases tissue levels of eicosapentaenoic acid (20:5n-3; EPA and docosapentaenoic acid (22:5n-3; DPA, but not DHA. These observations suggest that one or more control points must exist beyond ALA metabolism by Fads2. One possible control point is a second reaction involving Fads2 itself, since this enzyme catalyses desaturation of 24:5n-3 to 24:6n-3, as well as ALA to SDA. However, metabolism of EPA and DPA both require elongation reactions. This study examined the activities of two elongase enzymes as well as the second reaction of Fads2 in order to concentrate on the metabolism of EPA to DHA. METHODOLOGY/PRINCIPAL FINDINGS: The substrate selectivities, competitive substrate interactions and dose response curves of the rat elongases, Elovl2 and Elovl5 were determined after expression of the enzymes in yeast. The competitive substrate interactions for rat Fads2 were also examined. Rat Elovl2 was active with C(20 and C(22 polyunsaturated fatty acids and this single enzyme catalysed the sequential elongation reactions of EPA→DPA→24:5n-3. The second reaction DPA→24:5n-3 appeared to be saturated at substrate concentrations not saturating for the first reaction EPA→DPA. ALA dose-dependently inhibited Fads2 conversion of 24:5n-3 to 24:6n-3. CONCLUSIONS: The competition between ALA and 24:5n-3 for Fads2 may explain the decrease in DHA levels observed after certain intakes of dietary ALA have been exceeded. In addition, the apparent saturation of the second Elovl2 reaction, DPA→24:5n-3, provides further explanations for the accumulation of DPA when ALA, SDA or EPA is provided in the diet. This study suggests that Elovl2 will be

  18. A novel mechanism for direct real-time polymerase chain reaction that does not require DNA isolation from prokaryotic cells.

    Science.gov (United States)

    Soejima, Takashi; Xiao, Jin-Zhong; Abe, Fumiaki

    2016-01-01

    Typically, polymerase chain reaction (PCR) is performed after DNA isolation. Real-time PCR (qPCR), also known as direct qPCR in mammalian cells with weak membranes, is a common technique using crude samples subjected to preliminary boiling to elute DNA. However, applying this methodology to prokaryotic cells, which have solid cell walls, in contrast to mammalian cells which immediately burst in water, can result in poor detection. We successfully achieved PCR elongation with the addition of 1.3 cfu of Cronobacter muytjensii to a newly developed direct qPCR master mix without performing any crude DNA extraction (detection limit of 1.6 × 10(0) cfu/ml for the test sample compared with a detection limit of 1.6 × 10(3) cfu/ml primarily for crude (boiling) or classical DNA isolation). We revealed that the chromosomal DNA retained in prokaryotic cells can function as a PCR template, similarly to the mechanism in in situ PCR. Elucidating this reaction mechanism may contribute to the development of an innovative master mix for direct qPCR to detect genes in a single bacterium with solid cell walls and might lead to numerous novel findings in prokaryotic genomics research. PMID:27334801

  19. A novel mechanism for direct real-time polymerase chain reaction that does not require DNA isolation from prokaryotic cells.

    Science.gov (United States)

    Soejima, Takashi; Xiao, Jin-Zhong; Abe, Fumiaki

    2016-01-01

    Typically, polymerase chain reaction (PCR) is performed after DNA isolation. Real-time PCR (qPCR), also known as direct qPCR in mammalian cells with weak membranes, is a common technique using crude samples subjected to preliminary boiling to elute DNA. However, applying this methodology to prokaryotic cells, which have solid cell walls, in contrast to mammalian cells which immediately burst in water, can result in poor detection. We successfully achieved PCR elongation with the addition of 1.3 cfu of Cronobacter muytjensii to a newly developed direct qPCR master mix without performing any crude DNA extraction (detection limit of 1.6 × 10(0) cfu/ml for the test sample compared with a detection limit of 1.6 × 10(3) cfu/ml primarily for crude (boiling) or classical DNA isolation). We revealed that the chromosomal DNA retained in prokaryotic cells can function as a PCR template, similarly to the mechanism in in situ PCR. Elucidating this reaction mechanism may contribute to the development of an innovative master mix for direct qPCR to detect genes in a single bacterium with solid cell walls and might lead to numerous novel findings in prokaryotic genomics research.

  20. Validity of the polymerase chain reaction in the diagnosis of clinically suspected cases of American visceral leishmaniasis.

    Science.gov (United States)

    Pedrosa, Celia Maria Silva; Ximenes, Ricardo Arraes de Alencar; Almeida, Wendell Alexandre Pinheiro de; Rocha, Eliana Maria Mauricio da

    2013-01-01

    To test the validity of the polymerase chain reaction for diagnosing American visceral leishmaniasis, 88 suspected cases were studied. Diagnosis was confirmed in 47 (53.5%) and ruled out in 41 (46.5%) patients. Samples of bone marrow and peripheral blood were processed by polymerase chain reaction to evaluate the sensitivity and specificity of the test and its agreement beyond chance with microscopy examination. The polymerase chain reaction was positive in bone marrow of 100% of the patients with amastigotes seen with microscopy examination, and in 59.5% in those where no parasite were seen. Agreement beyond chance between visualization of the parasite in bone marrow aspirates and polymerase chain reaction was considered weak (Kappa=0.41). Concordance between polymerase chain reaction of bone marrow aspirates and of peripheral blood was considered excellent (Kappa=0.88). The test turned out positive in all bone marrow aspirates of those with the disease and whereas the positivity rate was 58.5% among those without the disease, with specificity rate of 41.5%.

  1. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations

    Science.gov (United States)

    Gantz, Valentino M.; Bier, Ethan

    2015-01-01

    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype while individuals homozygous for two copies of the allele will display a mutant phenotype. Here, we develop a method that we refer to as the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome editing system for generating autocatalytic mutations to generate homozygous loss-of-function mutations. We demonstrate in Drosophila that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  2. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  3. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR

    Directory of Open Access Journals (Sweden)

    Seiki Kuramitsu

    2013-03-01

    Full Text Available Polymerase chain reaction (PCR-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3' end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science.

  4. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra

    2016-08-01

    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  5. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi

    2014-12-01

    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  6. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou

    2008-01-01

    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  7. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  8. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    Science.gov (United States)

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  9. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  10. A Novel Nested Polymerase Chain Reaction (n-PCR Assay for Identifying Sorghum nitidum

    Directory of Open Access Journals (Sweden)

    Shasha WEI

    2011-11-01

    Full Text Available This work developed a novel nested polymerase chain reaction (n-PCR assay to identify Sorghum nitidum (S. nitidum. It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band at ~873 bp in gel spectra, while other relatives, including Sorghum halepense, Sorghum almum, Sorghum bicolor, Sorghum propinum and Sorghum sudanse exhibited negative amplifications. This assay was able to specifically identify S. nitidum fast and effectively, which could be applied widely in field inspection, agriculture production and plant protection.

  11. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  12. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  13. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  14. Treponema pallidum and Haemophilus ducreyi DNA detection by A Multi-Nested Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    郑和平; SylviaBruisten; 何玉山; 黄进梅; 吴兴中

    2004-01-01

    Objectives: To develop a multi-nested polymerase chain reaction in an assay to detect early Treponema pallidum and Haemophilus ducreyi DNA in the swabs of genital ulcers. Methods: Four pairs of outer and inner primers, specific to the basic membrane protein gene of Treponema pallidum and to the 16s rRNA gene of H ducreyi were synthesized. The multi-nested PCR was developed and applied to detect Treponema pallidum and Haemophilus dicreyi in clinical swabs. Result: The two samples of standard strains of Haemophilus ducreyi and one Treponema pallidum were amplified and showed 309-bp rRNA gene of Haemophilus ducreyi and 506-bp DNA of Treponema palidum, respectively. Out of 51 samples of genital ulcer detected, 29 showed Treponemapallidum positive product and noHaemophilus ducreyi DNA was found. Conclusion: The multi-nested PCR for Treponema pallidum and Haemophilus ducreyi could be useful for early detection and distinguishing diagnosis between syphilis and chancroid.

  15. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P

    2004-01-01

    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  16. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R

    2003-01-01

    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  17. A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

    Directory of Open Access Journals (Sweden)

    Elisa Morganti

    2011-01-01

    Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

  18. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications.

    Science.gov (United States)

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav

    2004-02-01

    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  19. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  20. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Directory of Open Access Journals (Sweden)

    Liang Gaofeng

    2011-01-01

    Full Text Available Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR. Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA. The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  1. DNA Polymer Brush Patterning through Photocontrollable Surface-Initiated DNA Hybridization Chain Reaction.

    Science.gov (United States)

    Huang, Fujian; Zhou, Xiang; Yao, Dongbao; Xiao, Shiyan; Liang, Haojun

    2015-11-18

    The fabrication of DNA polymer brushes with spatial resolution onto a solid surface is a crucial step for biochip research and related applications, cell-free gene expression study, and even artificial cell fabrication. Here, for the first time, a DNA polymer brush patterning method is reported based on the photoactivation of an ortho-nitrobenzyl linker-embedded DNA hairpin structure and a subsequent surface-initiated DNA hybridization chain reaction (HCR). Inert DNA hairpins are exposed to ultraviolet light irradiation to generate DNA duplexes with two active sticky ends (toeholds) in a programmable manner. These activated DNA duplexes can initiate DNA HCR to generate multifunctional patterned DNA polymer brushes with complex geometrical shapes. Different multifunctional DNA polymer brush patterns can be fabricated on certain areas of the same solid surface using this method. Moreover, the patterned DNA brush surface can be used to capture target molecules in a desired manner.

  2. Diagnosis of Progressive Spinal Muscular Atrophy by Using Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    姚娟; 丁新生; 陈克连; 程虹; 邓晓萱; 沈鸣九; 王颖

    2001-01-01

    Objective To understand the deletion in the survival motor neuron gene (SMN) of childhood-onset spinal muscular atrophy (SMA) in Chinese, and the value of diagnosis of SMA using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)method. Methods Deletions of SMN gene of exon 7 and 8 in 10 cases of presumed SMA, and 20 normal controls from 6 families and 30 unrelated controls were performed by PCR-RFLP analysis. Results Deletions of SMN gene detected in 9 of 10 (90%) cases of presumed SMA . No deletions of SMN in the telomere were found in the other members of families and controls.Conclusion PCR-RFLP is a sensitive, specific and simple method in diagnosis of SMA.

  3. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction.

    Science.gov (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-01-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  4. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang

    2006-01-01

    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  5. Variance-reduced simulation of lattice discrete-time Markov chains with applications in reaction networks

    Science.gov (United States)

    Maginnis, P. A.; West, M.; Dullerud, G. E.

    2016-10-01

    We propose an algorithm to accelerate Monte Carlo simulation for a broad class of stochastic processes. Specifically, the class of countable-state, discrete-time Markov chains driven by additive Poisson noise, or lattice discrete-time Markov chains. In particular, this class includes simulation of reaction networks via the tau-leaping algorithm. To produce the speedup, we simulate pairs of fair-draw trajectories that are negatively correlated. Thus, when averaged, these paths produce an unbiased Monte Carlo estimator that has reduced variance and, therefore, reduced error. Numerical results for three example systems included in this work demonstrate two to four orders of magnitude reduction of mean-square error. The numerical examples were chosen to illustrate different application areas and levels of system complexity. The areas are: gene expression (affine state-dependent rates), aerosol particle coagulation with emission and human immunodeficiency virus infection (both with nonlinear state-dependent rates). Our algorithm views the system dynamics as a "black-box", i.e., we only require control of pseudorandom number generator inputs. As a result, typical codes can be retrofitted with our algorithm using only minor changes. We prove several analytical results. Among these, we characterize the relationship of covariances between paths in the general nonlinear state-dependent intensity rates case, and we prove variance reduction of mean estimators in the special case of affine intensity rates.

  6. The use of polymerase chain reaction for early diagnosis of tuberculosis in Mycobacterium tuberculosis culture

    Directory of Open Access Journals (Sweden)

    M. Chagas

    2010-06-01

    Full Text Available Early diagnosis plays a vital role in controlling tuberculosis. The conventional methodology is slow, with results taking several weeks, in addition to having low sensitivity, especially in clinical paucibacillary samples. The objective of this study was to evaluate the use of polymerase chain reaction (PCR on solid medium culture for a rapid diagnosis of tuberculosis, mainly in cases of negative sputum smears. Forty sputum samples were collected from inpatients with tuberculosis treated for less than 2 days. Bacilloscopy, PCR for sputum, culture on Löwestein-Jensen (LJ solid medium, and daily PCR from culture were performed on each sample. DNA extracted from the BCG vaccine, which contains attenuated bacillus Calmette-Guérin, was used as the positive control. Smear microscopy showed 68.6% sensitivity, 80% specificity, 96% positive predictive value, and 26.7% negative predictive value, with culture on LJ medium as the gold standard. Culture at day 28 showed 74.3% sensitivity and 100% specificity. PCR of DNA extracted from sputum amplified a 1027-bp fragment of the 16s RNA gene, showing 22.9% sensitivity and 60% specificity. PCR performed with DNA extracted from daily culture showed that, from the 17th to the 40th day, the sensitivity (85.7% and specificity (60% were constant. We conclude that a 17-day culture is a good choice for rapid diagnosis and to interfere with the transmission chain of tuberculosis.

  7. Simulation of manufacturing processes and manufacturing chains using finite element techniques

    OpenAIRE

    Afazov, Shukri

    2009-01-01

    This thesis presents work on the simulation of manufacturing chains, simulation of manufacturing processes (casting, forging, shot-peening and heat treatment) and fatigue life prediction by using the finite element method (FEM). The objectives and the contributions of this thesis consist of development of mathematical algorithms and techniques for mapping and transferring FE data (stresses, strains, displacements, etc.) from macro-to-macro and micro-to-macro FE models among different FE solve...

  8. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Energy Technology Data Exchange (ETDEWEB)

    Liu Dayu, E-mail: ruark@126.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Zhou Xiaomian, E-mail: zhouximi@yahoo.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China)

    2012-03-09

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil-water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: Black-Right-Pointing-Pointer Droplet formation in a capillary. Black-Right-Pointing-Pointer Transport the droplet using oscillation-flow. Black-Right-Pointing-Pointer Oscillation droplet PCR. Black-Right-Pointing-Pointer Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil-water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 {mu}L) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to

  9. A Markov chain technique for determining the acquisition behavior of a digital tracking loop

    Science.gov (United States)

    Chadwick, H. D.

    1972-01-01

    An iterative procedure is presented for determining the acquisition behavior of discrete or digital implementations of a tracking loop. The technique is based on the theory of Markov chains and provides the cumulative probability of acquisition in the loop as a function of time in the presence of noise and a given set of initial condition probabilities. A digital second-order tracking loop to be used in the Viking command receiver for continuous tracking of the command subcarrier phase was analyzed using this technique, and the results agree closely with experimental data.

  10. Leishmania spp. identification by polymerase chain reaction-restriction fragment length polymorphism analysis and its applications in French Guiana.

    Science.gov (United States)

    Simon, Stéphane; Veron, Vincent; Carme, Bernard

    2010-02-01

    Leishmania (Viannia) guyanensis was for many years the only species commonly identified in French Guiana, but precise species identifications were quite rare. We describe a new restriction fragment length polymorphism-polymerase chain reaction technique using a 615-bp fragment of the RNA polymerase II gene and 2 restriction enzymes, TspRI and HgaI. Seven reference strains (Leishmania (Leishmania) amazonensis, Leishmania (Viannia) lainsoni, Leishmania (Viannia) braziliensis, L. (V.) guyanensis, Leishmania (Viannia) naiffi, Leishmania (Leishmania) major, Leishmania (Leishmania) infantum) and 112 clinical samples from positive lesions were used for the development of the technique. The rates of positive species identification were 85.7% for punch skin biopsy specimens, 93.1% for positive Giemsa-stained smears, and 100% for positive culture supernatants. In the framework of cutaneous leishmaniasis species surveillance for the 2006 to 2008 period, parasite identification was carried out for 199 samples from different patients. The prevalence of the various Leishmania spp. was 84.4% for L. (V.) guyanensis, 8.0% for L. (V.) braziliensis, 5.0% for L. (L.) amazonensis, and 2.6% for L. (V.) lainsoni. L. (V.) braziliensis seems to be locally an emerging pathogen.

  11. Polymerase chain reaction of peripheral blood as a tool for the diagnosis of visceral leishmaniasis in children

    Directory of Open Access Journals (Sweden)

    Thiago Leite Fraga

    2010-05-01

    Full Text Available The diagnosis of visceral leishmaniasis (VL generally requires the use of invasive tests for the collection of infected tissue (aspirates of bone marrow, spleen, liver or lymph nodes. This difficulty has led to the search for safer and less painful techniques to confirm the occurrence of the disease in children. Polymerase chain reaction (PCR is a method that is advantageous in that it allows the use of peripheral blood samples for diagnosis. This paper reports the utilisation of PCR on peripheral blood samples to diagnose VL in 45 children in Mato Grosso do Sul, Brazil. This technique is compared with methods carried out using tissue collected by invasive procedures, including direct microscopy, culture and detection of Leishmania DNA by PCR in bone marrow aspirates. The results show that PCR of peripheral blood provides great sensitivity (95.6% that is similar to that from the PCR of bone marrow aspirates (91.1% and higher than that achieved with microscopy (80% or culture (26.7% methods. PCR of peripheral blood proved to be a suitable tool for the diagnosis of VL in children because it is highly sensitive and safe, with tissue collection being less invasive than in traditional tests.

  12. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    Science.gov (United States)

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis.

  13. ESTIMATION OF CHAIN REACTION BANKRUPTCY STRUCTURE BY CHANCE DISCOVERY METHOD- WITH TIME ORDER METHOD AND DIRECTED KEYGRAPH

    Institute of Scientific and Technical Information of China (English)

    Shinichi GODA; Yukio OHSAWA

    2007-01-01

    Chain reaction bankruptcy is regarded as common phenomenon and its effect is to be taken into account when credit risk portfolio is analyzed. But consideration and modeling of its effect leave much room for improvement. That is mainly because method for grasping relations among companies with limited data is underdeveloped. In this article, chance discovery method is applied to estimate industrial relations that are to include companies' relations that transmit chain reaction of bankruptcy.Time order method and directed KeyGraph are newly introduced to distinguish and express the time order among defaults that is essential information for the analysis of chain reaction bankruptcy. The steps for the data analysis are introduced and result of example analysis with default data in Kyushu,Japan, 2005 is presented. The structure estimated by the new method is compared with the structure of actual account receivable holders of bankrupted companies for evaluation.

  14. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  15. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip

    Science.gov (United States)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang

    2008-02-01

    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  16. Continuous reaction performances of benzene alkylation with long chain olefins catalyzed by ionic liquid

    Institute of Scientific and Technical Information of China (English)

    Congzhen QIAO; Chengyue LI

    2008-01-01

    Based on a compulsive mixing-reacting-sepa-rating-recycling small experimental setup,the continuous reaction performances of benzene alkylation with long chain olefins catalyzed by [BMIM]Cl-AlCl3 ionic liquid were investigated. Three different situations including normal continuous operation mode (reagent materials), sidetrack feeding from different axial positions along the static mixing reactor (reagent materials) and normal con-tinuous alkylation using industrial paraffin and olefins materials were examined. Even under the relatively hype-critical reaction conditions, the single pass conversion of pure 1-dodecene could reach to nearly 100.0%, and the selectivity of 2-phenyl isomer was higher than 37.7%. Although the positions along the reactor for sidetrack feeding were different, the 100.0% single pass conversion of 1-dodecene was also attained before the outlet of the reactor. The refined industrial olefins as raw material could meet with the requirements of continuous alkyla-tion. The influences of impurities such as di-olefins and non-benzene aromatics on the catalytic activity and stability should be studied further.

  17. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation.

    Science.gov (United States)

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K

    2016-08-01

    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA. PMID:27393216

  18. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF

    2000-01-01

    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  19. Amplifying genes using the polymerase chain reaction: A promising diagnostic tool

    International Nuclear Information System (INIS)

    The power to amplify genetic material several millionfold using the polymerase chain reaction (PCR) has greatly enhanced the ability of molecular biologists to examine and manipulate genes. We have used the PCR reaction to detect bluetongue virus (BTV) in infected animals and are currently able to serogroup, serotype and determine the geographic origin of a BTV isolate. Similarly, using a combination of hybridization analyses and direct sequencing of the PCR products we can rapidly detect avian influenza virus, Newcastle disease virus and Mycoplasma and predict if we have nucleic acid sequences that are characteristic of a virulent or avirulent isolate. The ability to manipulate genetic information has made it possible to generate proteins containing deletions or create chimeric proteins which contain additions to their sequences. Such studies are important for the understanding of immune responses to various protein epitopes. Besides its sensitivity, PCR has the advantage of speed over some other detection systems. A comprehensive detection and diagnosis can be done in a few hours compared with several weeks previously required for virus isolations. However, there are disadvantages to using PCR. Because of its ability to amplify a sequence several millionfold, contaminants other than the target species may be amplified and since the DNA polymerase used in PCR has no editing or proofreading functions, errors may be quickly incorporated into the final PCR product. 13 refs, 8 figs

  20. Detection of hepatitis C virus sequences in sera with controversial serology by nested polymerase chain reaction.

    Science.gov (United States)

    Lazizi, Y; Elfassi, E; Pillot, J

    1992-04-01

    The specificity of first-generation enzyme-linked immunosorbent assays (ELIAs) for antibody detection in individuals with hepatitis C virus (HCV) infection has been questioned in some pathological situations. We observed a surprisingly high prevalence of anti-HCV antibodies in alcoholic patients, and thus, false-positive reactions in anti-HCV tests were strongly suspected. The introduction of new epitopes, particularly a core protein, C22 (second-generation tests), seems to increase the sensitivity of anti-HCV detection. In order to study the specificity of the second-generation tests, 60 serum samples from alcoholic patients found to be positive by the first-generation anti-HCV ELISA (Ortho) were reexamined by a second-generation anti-HCV enzyme immunoassay (Abbott) and a recombinant immunoblot assay (RIBA II; Chiron). Fifteen serum samples gave contradictory results when they were tested by the two assays. We performed nested polymerase chain reactions (PCRs) to confirm that the discrepancies that we observed could be due to the presence of low levels of anti-HCV antibodies, which were detected by a more sensitive test, or to unspecific positive reactions. Nested PCR revealed the presence of HCV RNA sequences in all anti-HCV-positive sera or sera that were weakly positive by ELISA. Anti-HCV positive by RIBA II was always correlated with the presence of viral RNA in serum, but HCV RNA was detected in RIBA II-negative sera. These results indicate that the specificity of the second-generation tests is an important improvement but that an HCV infection can still persist without detectable antibodies. PCR remains the reference assay to clear up controversial serology results and to detect HCV infection in patients with no anti-HCV-detectable immune response. PMID:1315339

  1. AN OPTIMIZED ENERGY AWARE CHAINING TECHNIQUE FOR DATA GATHERING IN WIRELESS SENSOR NETWORKS

    Directory of Open Access Journals (Sweden)

    Ouadoudi Zytoune

    2013-01-01

    Full Text Available Wireless Sensor Network (WSN is a collection of small sensor nodes with aptitude to sense, compute and transmit data that are deployed to observe a physical environment. The sensor node has limited capabilities, especially its energy reserve, its processing ability and its memory storage. Data dissemination and gathering protocols design for WSN are crucial challenges since those protocols should be easy, energy-efficient, and robust to deal with a very large number of nodes. Also, they should be self-configurable to node failures and dynamic changes of the network topology. In this paper, we present a new algorithm for gathering sensor reading based on chain forming using Ant Colony Optimization (ACO technique. To allow network lifetime extension, the ACO provides the shortest network nodes chaining instead of starting from the furthest node and using Greedy algorithm as PEGASIS do. The leader role duration is defined for each node based on its required energy to do this role in the established chain. Which avoids fast node’s energy depletion and then, the network lifetime would be extended. Through simulation, it is proved that the proposed algorithm allows network stability extension compared to the most known chaining algorithm.

  2. Double Gene Targeting Multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products.

    Science.gov (United States)

    Hossain, M A Motalib; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Asing; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Zaidul, I S M

    2016-08-17

    Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction-restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials. PMID:27501408

  3. Following the Transient Reactions in Lithium-Sulfur Batteries Using In an In Situ Nuclear Magnetic Resonance Technique

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Jie; Hu, Jian Z.; Chen, Honghao; Vijayakumar, M.; Zheng, Jianming; Pan, Huilin; Walter, Eric D.; Hu, Mary Y.; Deng, Xuchu; Feng, Ju; Liaw, Bor Yann; Gu, Meng; Deng, Zhiqun; Lu, Dongping; Xu, Suochang; Wang, Chong M.; Liu, Jun

    2015-05-13

    Li-S batteries hold great potential for next-generation, large-format power source applications; yet, the fundamental understanding of the electrochemical reaction pathways remains lacking to enable their functionality as promised. Here, in situ NMR technique employing a specially designed cylindrical micro battery was used to monitor the chemical environments around Li+ ions during repetitive charge-discharge process and track the transient electrochemical and chemical reactions occurring in the whole Li-S system. The in situ NMR provides real time, quantitative information related to the temporal concentration variations of the polysulfides with various chain lengths, providing important clues for the reaction pathways during both discharge and charge processes. The in-situ technique also reveals that redox reactions may involve transient species that are difficult to detect in ex-situ NMR study. Intermediate species such as charged free radicals may play an important role in the formation of the polysulfide products. Additionally, in situ NMR measurement simultaneously reveals vital information on the 7Li chemical environments in the electrochemical and parasitic reactions on the lithium anode that promotes the understanding of the failure mechanism in the Li-S system. These new insights could help design effective strategies to accelerate the development of Li-S battery technology.

  4. Early diagnosis of primary human herpesvirus 6 infection in childhood: Serology, polymerase chain reaction, and virus load

    OpenAIRE

    Chiu, SS; Peiris, M.; Tse, CYC; Cheung, CY

    1998-01-01

    Qualitative and quantitative polymerase chain reaction (PCR) for human herpesvirus 6 (HHV-6) DNA in whole blood and plasma was correlated with serology and clinical assessment in 143 children hospitalized for undifferentiated febrile illness to evaluate options for diagnosis of primary HHV-6 infection on the acute blood specimen. PCR and serology for HHV-7 were done in parallel to define serologic cross-reactions. Using HHV-6 seroconversion as the reference standard, detection of HHV-6 DNA in...

  5. Formal verification technique for grid service chain model and its application

    Institute of Scientific and Technical Information of China (English)

    XU Ke; WANG YueXuan; WU Cheng

    2007-01-01

    Ensuring the correctness and reliability of large-scale resource sharing and complex job processing is an important task for grid applications. From a formal method perspective, a grid service chain model based on state Pi calculus is proposed in this work as the theoretical foundation for the service composition and collaboration in grid. Following the idea of the Web Service Resource Framework (WSRF), state Pi calculus enables the life-cycle management of system states by associating the actions in the original Pi calculus with system states. Moreover, model checking technique is exploited for the design-time and run-time logical verification of grid service chain models. A grid application scenario of the dynamic analysis of material deformation structure is also provided to show the effectiveness of the proposed work.

  6. Trojan Horse technique to measure nuclear astrophysics rearrangement reactions

    Science.gov (United States)

    Spitaleri, Claudio

    2013-03-01

    The knowledge of nucleosynthesis and of energy production in stars requires an increasingly precise measurement of nuclear fusion reactions at the Gamow energy. Because of the Coulomb barrier reaction cross sections in astrophysics cannot be accessed directly at ultra -low energies, unless very favorable conditions are met. Moreover, the energies characterizing nuclear processes in several astrophysical contexts are so low that the presence of atomic electrons must be taken into account. Theoretical extrapolations of available data are then needed to derive astrophysical S(E)-factors. To overcome these experimental difficulties the Trojan Horse Method (THM) has been introduced. The method provides a valid alternative path to measure unscreened low-energy cross sections of reactions between charged particles, and to retrieve information on the electron screening potential when ultra-low energy direct measurements are available. While the theory has been discussed in detail in some theoretical works, present in the scientific literature, also in relation to different types of excitation functions (e.g. non-resonant and resonant), work on detailed methodology used to extract the events to be considered for the bare nucleus cross section measurements is still on going. In this work we will present some critical points in the application of THM that deserve to be discussed in more detail.

  7. Uso da técnica de Southern Blot/Hibridização associada à reação em cadeia da polimerase para aumentar a sensibilidade no diagnóstico das infecções por hemoplasmas em gatos domésticos: Use of Southern Blot/Hybridization technique associated to polymerase chain reaction to improve the sensitivity in the diagnosis of hemoplasma infections in domestic cats

    Directory of Open Access Journals (Sweden)

    Daniel B. Macieira

    2009-12-01

    Full Text Available O objetivo deste trabalho foi verificar se a técnica de Southern Blot/Hibridização (SB em associação à reação de polimerização em cadeia (PCR aumenta a sensibilidade na detecção de DNA de hemoplasmas em gatos domésticos (Felis catus. O sangue total foi coletado em tubos contendo o anticoagulante ácido etilenodiamino tetra-acético, o DNA extraído a partir de 149 animais e a PCR realizada com o uso de sequências iniciadoras espécie-específicas, para amplificar subunidade 16S do RNA ribossomal de Mycoplasma haemofelis e 'Candidatus M. haemominutum' dessas amostras. Para a hibridização, foram utilizadas sondas específicas quimicamente marcadas, e os resultados visualizados por meio da adição de substrato quimiluminescente seguida de autoradiografia. Dezoito (12,1% das 149 amostras testadas apresentaram resultado PCR-positivo para o DNA de hemoplasmas. A técnica de SB mostrou que 24/149 (16,1% amostras apresentaram resultado positivo para hemoplasmas, confirmando os 18 resultados PCR-positivos, além de revelar seis outros adicionais (p The aim of this study was to determine whether Southern Blot/Hybridization (SB associated to Polymerase Chain Reaction (PCR improves the sensitivity in the detection of hemoplasma DNA in domestic cats (Felis catus. Whole blood was collected in tubes containing the anticoagulant ethylenediamine tetra-acetic acid and DNA extracted from 149 animals. PCR was performed using species specific primers to amplify the 16S ribosomal RNA subunit of Mycoplasma haemofelis and 'Candidatus M. haemominutum' from these samples. Hybridization was performed using a 16S rDNA probes chemically labeled and the results were visualized using a chemiluminescent substrate addition followed by autoradiography. Eighteen (12.1% of the 149 tested samples had a positive PCR result for hemoplasma species DNA. SB/hybridization technique showed that 24/149 (16.1% samples were positive for hemoplasmas, confirming the 18 PCR

  8. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers.

  9. Correlation between API 50 CH and multiplex polymerase chain reaction for the identification of vaginal lactobacilli in isolates

    Directory of Open Access Journals (Sweden)

    Eliane Melo Brolazo

    2011-03-01

    Full Text Available Identification of Lactobacillus sp. strains by phenotypic methods may lead to doubtful results possibly interfering in the reliability of the epidemiological and probiotics studies. Therefore this study aimed to determine the best methodology for the identification of the large diversity of lactobacilli species found in the vagina by comparing two techniques, one based on their biochemical profile and other employing molecular biology. A carbohydrate fermentation test (API 50 CH was compared with multiplex polymerase chain reaction (PCR for the identification of species of vaginal lactobacilli from 135 healthy women. The kappa index was used to evaluate agreement between the methods. Using the molecular technique, L. crispatus (32.6%, L. jensenii (25% and L. gasseri (20.6% were the most frequent species. However, using the biochemical technique, the most frequent species were: L. acidophilus (34.8%, L. crispatus (27.2% and L. fermentum (13%. Although L. acidophilus was the most frequent specie found by biochemical tests, no strain of this microorganism was detected by PCR. Agreement between the methods was low for identification of all the most common species. Although rates of L. crispatus detected were similar using both methods (32.6% and 27.2%, agreement between them was relatively low (kappa = 0.52. Conclusions: Our results confirmed the limitation of the biochemical method and the applicability of a previously published molecular method (Multiplex PCR for the identification of lactobacilli in the vaginal tract, focusing on further necessity of its improvement for also targeting L. vaginalis and L. iners.

  10. DETECTION OF PHENOL DEGRADING BACTERIA AND PSEUDOMONAS PUTIDA IN ACTIVATED SLUDGE BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen

    2009-04-01

    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  11. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao

    2005-01-01

    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.

  12. Spatio-temporal characterization techniques of high-power femtosecond laser chains

    Science.gov (United States)

    Gallet, Valentin; Pariente, Gustave; Kahaly, Subhendu; Gobert, Olivier; Quéré, Fabien

    2014-03-01

    In this letter, we propose two techniques capable of spatio-temporally characterizing high-power femtosecond laser chains. We demonstrate a new implementation of SEA TADPOLE. To avoid the problems induced by the the significant spatial jittering of the focal spot on high-power laser chains, our setup is adapted to collimated beams. In addition, a fibered light source is also used to correct the phase fluctuations. This experimental setup allows identifying any spatiotemporal distortions such as the pulse front tilt for instance. In this paper, to the best of our knowledge, we present the very first spatio-temporal characterization done on a TW laser. However, a SEA TADPOLE measurement is not immediate since it requires scanning the beam over the two transverse dimensions which prevent us from studying the shot-to-shot laser fluctuations. This is why, we developed MUFFIN, a single-shot technique capable of spatio-temporally characterizing a laser pulse along its two transverse dimensions. First experimental results obtained with this technique are presented here.

  13. Technique of beryllium determination using an (α,n) reaction

    International Nuclear Information System (INIS)

    The possibility of detecting small amounts of 9Be using the (α, n) reaction has been investigated. It is shown that at a 210Po α-particle source intensity of 3x108 s-1 for limit of the detectable amount of beryllium is equal to 0.1 μg in the case of recording neutron-gamma (>= 3.6 MeV) coincidences. Other light elements (B, F, Al, Mg, Si etc.) do not produce a noticeable background under such conditions

  14. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  15. Identification of related DNA sequences in Borrelia burgdorferi and two strains of Leptospira interrogans by using polymerase chain reaction.

    OpenAIRE

    Kron, M A; Gupta, A; Mackenzie, C. D.

    1991-01-01

    The suitability of a polymerase chain reaction assay for Borrelia burgdorferi in epidemiological studies of infected tick populations was evaluated by using 28 strains of Leptospira interrogans and lysates of fixed adult Ixodes tick tissues. Two false positives representing leptospires were differentiated from B. burgdorferi by using an oligonucleotide probe.

  16. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjaerg, L L; Hansen, J E; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...

  17. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    Science.gov (United States)

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence.

  18. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;

    2007-01-01

    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR...

  19. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  20. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Johansen, Markku; Jorsal, Sven Erik Lind;

    2014-01-01

    obtained by averaging test results from individual fecal samples in relation to a quantitative polymerase chain reaction (qPCR) test for Lawsonia intracellularis. Ten diarrheic and 10 normal fecal samples were submitted from each of 43 Danish swine herds (n = 860 fecal samples). Pools (n = 43), each...

  1. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    Science.gov (United States)

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  2. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.;

    1999-01-01

    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot...

  3. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Science.gov (United States)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  4. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    Science.gov (United States)

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  5. Testing vaccines in human experimental malaria: statistical analysis of parasitemia measured by a quantitative real-time polymerase chain reaction.

    NARCIS (Netherlands)

    Hermsen, C.C.; Vlas, S.J. de; Gemert, G.J.A. van; Telgt, D.S.C.; Verhage, D.F.; Sauerwein, R.W.

    2004-01-01

    Clinical trials are an essential step in evaluation of safety and efficacy of malaria vaccines, and human experimental malaria infections have been used for evaluation of protective immunity of Plasmodium falciparum malaria. In this study, a quantitative real-time polymerase chain reaction was used

  6. Report on waterborne diseases: The polymerase chain reaction for the identification of enteric viruses in water; Rapporto sulle malattie infettive di origine idricamerizzazione a catena per l`identificazione dei virus enterici nell`acqua

    Energy Technology Data Exchange (ETDEWEB)

    Muscillo, M.; La Rosa, G. [Istituto Superiore di Sanita, Rome (Italy). Lab. di Igiene Ambientale

    1995-12-01

    A variety of human infectious diseases are associated with the pollution of water by enteric viruses. The epidemiological data on cases associated with drinking and recreational water show Norwalk, hepatitis A and E viruses, rotavirus and enteroviruses as the etiological agents. The polymerase chain reaction (PCR) is certainly the most reliable technique available for the rapid identification of these viruses in water samples.

  7. MULTI-DOCUMENT TEXT SUMMARIZATION USING CLUSTERING TECHNIQUES AND LEXICAL CHAINING

    Directory of Open Access Journals (Sweden)

    S. Saraswathi

    2010-07-01

    Full Text Available This paper investigates the use of clustering and lexical chains to produce coherent summaries of multiple documents in text format to generate an indicative, less redundant summary. The summary is designed as per user’s requirement of conciseness i.e., the documents are summarized according to the percentage input by the user. For achieving the above, various clustering techniques are used. Clustering is done at two levels, one at single document level and then at multi-document level. The clustered sentences are scored based on five different methods and lexically linked to produce the final summary in a text document.

  8. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    Institute of Scientific and Technical Information of China (English)

    Yuhki Sakuraoka; Tokihiko Sawada; Takayuki Shiraki; Kyunghwa Park; Yuhichiro Sakurai; Naohisa Tomosugi; Keiichi Kubota

    2012-01-01

    AIM:TO establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).METHODS:Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC.Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years.Quantitative PCR was performed.Immunohistochemistry and in situ hybridization for hepcidin were also performed.RESULTS:Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully.The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues.A method of in situ hybridization for hepcidin was established successfully,and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue.CONCLUSION:We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  9. Modeling the Manipulation of Natural Populations by the Mutagenic Chain Reaction.

    Science.gov (United States)

    Unckless, Robert L; Messer, Philipp W; Connallon, Tim; Clark, Andrew G

    2015-10-01

    The use of recombinant genetic technologies for population manipulation has mostly remained an abstract idea due to the lack of a suitable means to drive novel gene constructs to high frequency in populations. Recently Gantz and Bier showed that the use of CRISPR/Cas9 technology could provide an artificial drive mechanism, the so-called mutagenic chain reaction (MCR), which could lead to rapid fixation of even a deleterious introduced allele. We establish the near equivalence of this system to other gene drive models and review the results of simple models showing that, when there is a fitness cost to the MCR allele, an internal equilibrium may exist that is usually unstable. In this case, introductions must be at a frequency above this critical point for the successful invasion of the MCR allele. We obtain estimates of fixation and invasion probabilities for the appropriate scenarios. Finally, we discuss how polymorphism in natural populations may introduce sources of natural resistance to MCR invasion. These modeling results have important implications for application of MCR in natural populations. PMID:26232409

  10. Detection of herpesviral sequences in tissues of green turtles with fibropapilloma by polymerase chain reaction.

    Science.gov (United States)

    Lu, Y; Wang, Y; Yu, Q; Aguirre, A A; Balazs, G H; Nerurkar, V R; Yanagihara, R

    2000-01-01

    An alpha-herpesvirus has been associated recently with green turtle fibropapilloma (FP). To further clarify the role of this newfound green turtle herpesvirus (GTHV) in the pathogenesis of FP, various normal-appearing tissues and organs (including skin, eye, brain, heart, liver, spleen, intestine, lung, kidney, nerve, gonad, tongue, gall bladder, urinary bladder, thyroid and peripheral blood mononuclear cells (PBMC) from blood) and tumor tissues from 19 green turtles (Chelonia mydas) with FP, and tissues from three green turtles without FP, collected during 1997 to 1999 in the Hawaiian Islands, were tested for GTHV sequences by nested polymerase chain reaction (PCR), using GTHV-specific oligonuclotide primers. GTHV sequences were detected in all tumors (51/51) and most tissues (133/167) of tumored turtles. By contrast, such sequences were undetectable in tissues (0/28) of three non-tumored turtles. Analysis of GTHV sequences detected in different tissues and tumors revealed a low degree of genetic diversity (green turtles and its absence in tissues of non-tumored turtles, argues for an etiologic role in FP.

  11. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Science.gov (United States)

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  12. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Laure F Pittet

    Full Text Available Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR. In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old, formerly diagnosed as Bordetella pertussis (IS481+. No B. holmesii (IS481+, IS1001-, hIS1001+ was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  13. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens

    Directory of Open Access Journals (Sweden)

    Adriana Antônia da Cruz Furini

    2013-12-01

    Full Text Available OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens.METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results.RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard, we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively.CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis.

  14. Improvement of Temperature Uniformity for Polymerase Chain Reaction Chip with Heat Spreader

    Science.gov (United States)

    Chen, Rong-Sheng; Mao, Chao-Yang; Chen, Yung-Shieng

    2007-11-01

    For polymerase chain reaction (PCR) applications, a uniform temperature field in the microreactor is crucial. In this paper, we report on the electrothermal and computational fluid dynamics (CFD) simulations performed with the aim of optimizing the temperature distribution by heat spreaders for PCR application. Firstly, the equivalent resistivity of the microresistor heater is evaluated, and a conformable result is then verified by comparing with the experimental result using a prototype PCR chip. Secondly, the temperature distribution at 94 °C in the PCR chip is investigated. Furthermore, a heat spreader is inserted into the PCR chip to reduce the temperature difference in the DNA sample and thus improve the temperature uniformity effectively. The results demonstrated that the effective volume percentage and the energy consumption in the chamber are positively related to the thickness of the heat spreader, while the temperature difference is inversely related to the thickness of the heat spreader. Finally, the (b)-design is better than the (a)-design in terms of both the increase in effective volume percentage of the DNA sample and the decrease in energy consumption. In other words, the (b)-design is recognized as having better temperature uniformity.

  15. Improving Nuclear Safety of Fast Reactors by Slowing Down Fission Chain Reaction

    Directory of Open Access Journals (Sweden)

    G. G. Kulikov

    2014-01-01

    Full Text Available Light materials with small atomic mass (light or heavy water, graphite, and so on are usually used as a neutron reflector and moderator. The present paper proposes using a new, heavy element as neutron moderator and reflector, namely, “radiogenic lead” with dominant content of isotope 208Pb. Radiogenic lead is a stable natural lead. This isotope is characterized by extremely low micro cross-section of radiative neutron capture (~0.23 mb for thermal neutrons, which is smaller than graphite and deuterium cross-sections. The reflector-converter for a fast reactor core is the structure capable of transforming some part of prompt neutrons leaked from the core into the reflected neutrons with properties similar to those of delayed neutrons, that is, sufficiently large contribution to reactivity at the level of effective fraction of delayed neutrons and relatively long lifetime, comparable with lifetimes of radionuclides-emitters of delayed neutrons. It is evaluated that the use of radiogenic lead makes it possible to slow down the chain fission reaction on prompt neutrons in the fast reactor. This can improve the fast reactor safety and reduce some requirements to the technologies used to fabricate fuel for the fast reactor.

  16. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    Directory of Open Access Journals (Sweden)

    Parvin Hassanzadeh

    2012-03-01

    Full Text Available Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain reaction (PCR. The aim of this study was to evaluate the prevalence of Chlamydia trachomatis infection in pregnant women referred to a teaching hospital affiliated to Shiraz University of Medical Sciences. Urine samples were obtained from 210 pregnant women and investigated microscopically and macroscopically by urinalysis. Precipitants were also used for DNA extraction and PCR test for detecting Chlamydia trachomatis. Among 210 urine specimens from women aged 15-39 years, none were positive for Chlamydia trachomatis by PCR. In spite of the high sensitivity and specificity of PCR, and the elimination of inhibitory effects on PCR test, no pregnant woman was positive for Chlamydia trachomatis. Here, we suggest that a larger sample should be studied and other sensitive methods could also be used in the future.

  17. Human papillomavirus infection in lung vs. oral squamous cell carcinomas: a polymerase chain reaction study.

    Science.gov (United States)

    Halimi, M; Morshedi Asl, S

    2011-06-01

    The role of Human Papillomavirus (HPV) has been suspected in pathogenesis of various malignancies; however, the available data are not conclusive. This study aimed to determine and compare the frequency of HPV infection in oral and lung Squamous Cell Carcinoma (SCC) by a sensitive method. Sixty specimens of oral and lung SCC (30 cases each one) were reevaluated in Tabriz Imam Reza Centre in a 24 month period. Following genomic DNA extract, the Polymerase Chain Reaction (PCR) amplification was performed in presence of specific MY11 and MY09 primers for HPV infection. Three cervical specimens and a combination of PCR solution lacking DNA plus healthy persons' DNA samples were employed as positive and negative controls, respectively. The oral group was significantly older than the lung group (68.90 vs. 56.67 y, p infection in the oral and lung groups were comparable (20 vs. 10%, respectively; p = 0.47). Majority of patients with HPV infection were older than 60 years (88.9%) or male (88.9%). In the oral group, all these cases were well differentiated and the majority was of lower lip origin (83.3%). In the lung group, 66.7% of these specimens were moderately differentiated and the origin was bronchus in all cases. In conclusion, the rate of HPV infection in lung and oral SCC samples is rather lower than the previous reports in the literature. This rate is apparently higher in the oral than the lung SCC specimens. PMID:22235505

  18. Design, construction, and validation of a modular library of sequence diversity standards for polymerase chain reaction.

    Science.gov (United States)

    Baum, Paul D; Young, Jennifer J; Zhang, Qianjun; Kasakow, Zeljka; McCune, Joseph M

    2011-04-01

    Methods to measure the sequence diversity of polymerase chain reaction (PCR)-amplified DNA lack standards for use as assay calibrators and controls. Here we present a general and economical method for developing customizable DNA standards of known sequence diversity. Standards ranging from 1 to 25,000 sequences were generated by directional ligation of oligonucleotide "words" of standard length and GC content and then amplified by PCR. The sequence accuracy and diversity of the library were validated using AmpliCot analysis (DNA hybridization kinetics) and Illumina sequencing. The library has the following features: (i) pools containing tens of thousands of sequences can be generated from the ligation of relatively few commercially synthesized short oligonucleotides; (ii) each sequence differs from all others in the library at a minimum of three nucleotide positions, permitting discrimination between different sequences by either sequencing or hybridization; (iii) all sequences have identical length, GC content, and melting temperature; (iv) the identity of each standard can be verified by restriction digestion; and (v) once made, the ends of the library may be cleaved and replaced with sequences to match any PCR primer pair. These standards should greatly improve the accuracy and reproducibility of sequence diversity measurements.

  19. Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.

    Science.gov (United States)

    Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin

    2010-03-01

    Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.

  20. Salmonellae in fish feces analyzed by in situ hybridization and quantitative polymerase chain reaction.

    Science.gov (United States)

    Sha, Qiong; Forstner, Michael R J; Bonner, Timothy H; Hahn, Dittmar

    2013-09-01

    The potential of fish to transfer salmonellae from heterogeneous aquatic biofilms into feces was assessed in controlled aquarium studies with Suckermouth Catfish Hypostomus plecostomus and with biofilms inoculated with salmonellae. Neither the presence of catfish nor inoculation with salmonellae had detectable effects on the abundance of the microbial community. Densities of the microbial community were about 10(5) cells/mL in the water during a 1-week period, whereas densities of the microbial community increased 10-fold (10(6) to 10(7) cells/mg) in catfish feces during the same period. Salmonellae were detected by both quantitative polymerase chain reaction (qPCR) and situ hybridization in water samples immediately after inoculation, in numbers of about 10(4) cells/mL, representing up to 20% of the cells of the microbial community. Numbers decreased by three orders of magnitude within the first 3 d of the study, which represented only 0.01% of the community, and became undetectable after day 5. In catfish feces, numbers of Salmonella initially increased to up to 6% of the cells of the community but then declined. These results suggest that Salmonella are not biomagnified during gut passage, and thus, fish only provide a means for the translocation of this pathogen.

  1. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    Science.gov (United States)

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  2. Improved Multiplex Polymerase Chain Reaction for Rapid Staphylococcus Aureus Detection in Meat and Milk Matrices

    Directory of Open Access Journals (Sweden)

    Šramková Zuzana

    2016-06-01

    Full Text Available Staphylococcal food poisoning represents one of the most frequently occurring intoxications, caused by staphylococcal enterotoxins (SE-s and staphylococcal enterotoxin-like proteins (SEl-s. Therefore, there is a need for rapid, sensitive and specific detection method for this human pathogen and its toxin genes in food matrices. The present work is focused on Staphylococcus aureus detection by a nonaplex polymerase chain reaction, which targets the 23S rRNA gene for identification of S. aureus at the species level, genes for classical SE-s (SEA, SEC, SED, new SE-s (SEH, SEI, SEl-s (SEK, SEL and tsst-1 gene (toxic shock syndrome toxin. Primers were properly designed to avoid undesirable interactions and to create a reliably identifiable profile of amplicons when visualized in agarose gel. According to obtained results, this approach is able to reach the detection sensitivity of 12 colony forming units from milk and meat matrices without prior culturing and DNA extraction.

  3. Isolation and polymerase chain reaction-based identification of Riemerella anatipestifer from ducks in Kerala, India

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2014-10-01

    Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.

  4. The utility of the polymerase chain reaction assay for aetiologic definition of unspecified bacterial meningitis cases

    Directory of Open Access Journals (Sweden)

    Mari Tuyama

    2008-03-01

    Full Text Available Most patients with acute suppurative meningitis are otherwise healthy individuals with regard to immune mechanisms against invasive bacterial disease. This medical emergency is among the most dramatic and potentially ravaging diseases that affect humans, particularly young children. The illness often strikes suddenly, and can either result in death or leave the survivors with significant neurological dysfunctions. The demonstration of a bacterial aetiology is necessary for decisions regarding treatment and prophylaxis. Conventional bacteriological methods frequently fail to identify an agent, as a result of administration of antibiotics or delayed lumbar punctures. We investigated the major aetiologic sources of unspecified bacterial meningitis cases (G00.9, ISCD-10 by polymerase chain reaction (PCR-based identification of Neisseria meningitidis (crgA, Streptococcus pneumoniae (ply and Haemophilus influenzae (bexA in cerebrospinal fluid samples. The multiplex PCR detected N. meningitidis in 92%, S. pneumoniae in 4% and H. influenzae in 1% of the 192 clinical samples assayed; 3% were negative for all three DNA targets. Bacterial DNA detection was found to be a valuable adjunct to enhance bacterial meningitis surveillance when the yield of specimens by culture is reduced. The implementation of PCR assays as a diagnostic procedure in Public Health Laboratories is perceived to be a significant advance in the investigation of bacterial meningitis.

  5. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Science.gov (United States)

    Costa, Daniela Camargos; Madureira, Ana Paula; Amaral, Lara Cotta; Sanchez, Bruno Antônio Marinho; Gomes, Luciano Teixeira; Fontes, Cor Jésus Fernandes; Limongi, Jean Ezequiel; Brito, Cristiana Ferreira Alves de; Carvalho, Luzia Helena

    2014-02-01

    The polymerase chain reaction (PCR)-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene) were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34) of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  6. Laboratory reporting accuracy of polymerase chain reaction testing for avian polyomavirus.

    Science.gov (United States)

    Fitzgerald, Brenna; Olsen, Geoff; Speer, Brian

    2013-03-01

    Polymerase chain reaction (PCR) assays are available for detection of birds infected with avian polyomavirus (APV). Several laboratories offer this diagnostic assay in the United States, but little information is available regarding assay sensitivity, specificity, and accuracy. In this study, known APV-positive and APV-negative samples (each n = 10, 5 undiluted and 5 diluted) were sent to 5 commercial laboratories. A significant difference in reporting accuracy was found among laboratories, most notably for dilute APV-positive samples. Two out of 5 laboratories provided 100% accurate results, 1 had an accuracy of 90%, and 2 reported 80% and 75% accuracy, respectively. The accuracies of the last 2 laboratories were negatively affected by test sensitivities of 60% and 50%, respectively. These findings show that although accurate results were reported by most laboratories, both false-positive and false-negative results were reported by at least 3 laboratories, and false-negative results reported for dilute APV-positive samples predominated. These study findings illustrate a need for veterinary diagnostic laboratories to institute improved voluntary quality control measures.

  7. Genital infection caused by Entamoeba histolytica confirmed by polymerase chain reaction analyses.

    Science.gov (United States)

    Asano, Hiroshi; Kaneuchi, Masanori; Furuta, Itsuko; Yamaya, Yukie; Hatanaka, Kanako C; Takeda, Mahito; Matsuno, Yoshihiro; Sakuragi, Noriaki

    2014-05-01

    Entamoeba histolytica is estimated to infect approximately 1% of the global population. In Japan, the prevalence of amebic dysentery has been increasing, with more than 800 patients newly diagnosed annually. However, genital infection with E. histolytica is uncommon even in endemic areas. We present a case of vaginitis caused by E. histolytica. A 50-year-old Japanese woman without history of overseas travel presented to a nearby clinic with increased vaginal discharge. She had hemorrhagic erosion at the uterine cervix with yellowish vaginal discharge, and was referred to our hospital for exclusion of malignancy. Cervical cytology revealed periodic acid-Schiff-positive protozoa not aggregating around squamous cells, and thus amebic vaginitis was suspected. We performed polymerase chain reaction (PCR) analyses and identified E. histolytica. The vaginitis was treated with metronidazole, and the disappearance of amebic protozoa was confirmed by cytology and PCR. Therefore, it may be important to obtain early diagnosis by cervical cytology and PCR.

  8. DIFFERENTIATION OF PSEUDOCONDYLOMA OF VULVA AND CONDYLOMA ACUMINATA BY DOT BLOT HYBRIDIZATION AND POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿

    1996-01-01

    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  9. DETECTION OF PATHOGENS CAUSING GENITAL ULCER DISEASE BY MULTIPLEX POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    Ai-ying Liu; Ming-jun Jiang; Yue-ping Yin; Jiang-fang Sun

    2005-01-01

    Objective To establish a multiplex polymerase chain reaction (M-PCR) assay for simultaneous detection of pathogens causing genital ulcer disease (GUD).Methods Based on the gene-specific region of the following pathogens: Chlamydia trachomatis ompl/ompb, herpes simplex virus (HSV) DNA polymerase, Treponema pallidum tpp47, Haemophilus ducreyi 16s rRNA, four sets of primers were designed and an M-PCR assay was developed to detect four pathogens in one test. The assay was evaluated with diagnostic result of golden standard for each pathogen.Results Of the 51 clinical samples, M-PCR showed slightly higher positive rate (47.1%) of HSV than cell culture (23.6%).Meanwhile, the positive rate of T. p allidum detected by M-PCR and dark-field microscopy was 19.6% ( 10/51) and 15.7% (8/51),respectively. Only one sample was positive for H. ducreyiand no sample was positive for C. trachomatis detected by both M-PCR assay and culture.Conclusion This primary study indicated that M-PCR assay can simultaneously and rapidly detect the four etiologic pathogens causing GUD.

  10. Diagnosis of Streptococcus pneumoniae meningitis by polymerase chain reaction amplification of the gene for pneumolysin

    Directory of Open Access Journals (Sweden)

    Juliana de A Matos

    2006-08-01

    Full Text Available Diagnosis of bacterial meningitis has long been based on classical methods of Gram stain, serological tests, and culture of cerebrospinal fluid (CSF. The performance of these methods, especially culture and direct smear, is thwarted by failure to detect bacteria following administration of antimicrobial agents and reluctance to performance lumbar punctures at admission. Indeed, patients with meningitis frequently receive antibiotics orally or by injection before the diagnosis is suspected or established. Thus an alternative method has become necessary to help clinicians and epidemiologists to management and control of bacterial meningitis. We evaluate the application of a polymerase chain reaction-based (PCR assay for amplification of pneumolysin gene (ply to diagnosis of Streptococcus pneumoniae meningitis. The PCR assay sensitivity for CSF was 96% (95% confidence interval, CI, 90-99% compared to a sensitivity of 59% for culture (95% CI 49-69%, 66% for Gram stain (95% CI 56-74%, and 78% for latex agglutination test (95% CI 69-86%; PCR specificity was 100% (95% CI 83-100%. PCR results were available within 4 h of the start of the assay. This molecular approach proved to be reliable and useful to identify this bacterium compared with other classical laboratory methods for identification of bacterial meningitis pathogens.

  11. Molecular probes and the polymerase chain reaction for detection and typing of Leishmania species in Mexico.

    Science.gov (United States)

    Monroy-Ostria, Amalia; Sanchez-Tejeda, Gustavo

    2002-04-01

    Leishmaniasis in Mexico is a public health problem because all the clinical forms have been recorded in most Mexican states. We studied patients showing clinical symptoms of any form of leishmaniasis, from several endemic areas. Bone marrow samples, aspirates or skin biopsies were taken and deoxyribonucleic acid (DNA) was extracted and amplified by the polymerase chain reaction (PCR) with universal primers AJS1 and DeB8, specific for the Leishmania subgenus Leishmania. The PCR products were then hybridized by dot- or Southern blotting and probed with probe 9.2, specific for the L. mexicana complex. If hybridization did not occur, the DNA was amplified with primers D1 and D2, specific for members of the L. donovani complex, and PCR products were hybridized with probe B4Rsa, also specific for the L. donovani complex. DNA was also amplified with primers B1 and B2, specific for the subgenus Viannia, and the PCR products were hybridized with probe B18, specific for the L. braziliensis complex. It was found that in Tabasco and Veracruz, Mexico, localized cutaneous leishmaniasis (LCL) is caused by infection with members of the L. mexicana complex, whereas in the states of Nayarit and Campeche it was due to infection with the L. mexicana and/or L. braziliensis complexes. Visceral leishmaniasis was caused by L. (L.) chagasi, mainly in the states of Chiapas and Guerrero, and by L. (L.) mexicana in one immunocompromised patient from Tabasco.

  12. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan

    2014-02-01

    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  13. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction.

    Science.gov (United States)

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T

    1997-01-01

    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244

  14. Use of neuropathological tissue for molecular genetic studies: parameters affecting DNA extraction and polymerase chain reaction.

    Science.gov (United States)

    Kösel, S; Graeber, M B

    1994-01-01

    Nuclear and mitochondrial DNA were extracted from gray matter of human cerebral cortex which had either been formalin-fixed and embedded into paraffin or stored in formalin for up to 26 years. Extraction conditions were optimized for proteinase K digestion, i.e., enzyme concentration, digestion temperature and incubation time. Using the polymerase chain reaction (PCR), DNA was successfully amplified from archival material and sequenced employing a direct nonradioactive cycle sequencing protocol. In general, tissue embedded into paraffin following brief fixation in formalin gave good quantitative results, i.e., up to 1 microgram DNA/mg tissue were extracted. This yield was at least one order of magnitude higher than that obtained with tissue stored in formalin. However, paraffin-embedded neuropathological material was found to contain an as-yet-unidentified PCR inhibitor, and a deleterious effect of long-term fixation in unbuffered low-grade formalin was clearly detectable. Importantly, both paraffin-embedded tissue blocks and human brain that had been stored in formalin for many years yielded DNA sufficient for qualitative analysis. The implications of these findings for the use of neuropathological material in molecular genetic studies are discussed.

  15. Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

    Directory of Open Access Journals (Sweden)

    Lei Zhang

    2014-01-01

    Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

  16. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  17. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    Science.gov (United States)

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. PMID:25827436

  18. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  19. Detection of helicobacter pylori in benign laryngeal lesions by polymerase chain reaction: a cross sectional study

    Directory of Open Access Journals (Sweden)

    Izadi Farzad

    2012-04-01

    Full Text Available Abstract Background Although Helicobacter Pylori (HP was detected in some cases of chronic laryngitis, the results were not confirmed by polymerase chain reaction (PCR. By this time, it has not been found in laryngeal lesions by in house PCR, the most sensitive method for detecting the genome tracks. Regarding the previous results and also few numbers of studies about the presence of HP in benign laryngeal lesions, specifically by PCR, we aimed to investigate the presence of HP in benign laryngeal lesions by in-house PCR. Methods The samples were taken from 55 patients with benign laryngeal lesions and frozen in −20°C. One milliliter (ml of lysis buffer was added to 100 mg (mg of each sample and the tube was placed in 56°C overnight. Then DNA extraction was carried out. Results To find HP DNA, in-house PCR was performed that revealed 5 positive results among 55 patients with benign laryngeal lesions. Of them, 3 were polyp, 1 was nodule and 1 was papilloma. Conclusion Although the number of positive results was not a lot in this study, it was in contrast with previous studies which could not find any HP tracks in benign laryngeal lesions by other methods. More studies about the prevalence of HP in benign laryngeal lesions improve judging about the effect of this infection on benign laryngeal lesions.

  20. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying

    2007-01-01

    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  1. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  2. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2007-01-23

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  3. Detecting of Mycoplasma genitalium in male patients with urethritis symptoms in Turkey by polymerase chain reaction

    International Nuclear Information System (INIS)

    The aim of this study was to investigate the incidence of Mycoplasma genitalium in the urine samples of 63 male patients who had urethritis symptoms. Along with Neisseria gonorrhoeae (N. gonorrhoeae) and Chlamydia trachomatis (C. trachomatis). We also investigated Mycoplasma hominis (M. hominis) and Ureaplasma urealyticum (U. urealyticum), both of which are known to cause urethritis. Microorganisms were investigated in urine samples of the patients with polymerase chain reaction. The study was conducted between September 2003 - February 2004 at the Department of Microbiology and Clinical Microbiology Ankara University School of Medicine, Ankara, Turkey. A total of 63 urine samples were analyzed and 6 (9.52%) patients had N. gonorrhoeae, 4 (6.34%) had C. trachomatis, while 4 (6.34%) urines were positive in terms of M. genitalium. Nevertheless, 3 (4.76%) patients had U. urealyticum and 2 (3.17%) patients had M. hominis. One urine sample was positive in terms of both N. gonorrhoeae and U. urealyticum, and another urine sample was positive in terms of both M. hominis and U. urealyticum. The results were compared with the control group and found no statistically significant difference. Mycoplasma species are found in normal flora of urogenital system and also as an agent of urogenital infection. In our study, we found low microorganism rates when compared with Europe and America. This difference may be due to the conservative sexual behavior in Turkey. (author)

  4. Hepatitis C virus-polymerase chain reaction of routinely processed liver biopsies.

    Science.gov (United States)

    el-Batanony, M H; Savage, K; Jacobs, R; el-Refaie, A O; Squadrito, G G; Brown, D; Saleh, S M; Raouf, A A; Amer, K M; Dusheiko, G M

    1994-08-01

    The aim of the study was to evaluate the specificity and sensitivity of detection of hepatitis C virus (HCV)-RNA in formalin-fixed paraffin-embedded (FFPE) liver biopsies by polymerase chain reaction (PCR). Routinely processed FFPE diagnostic needle liver biopsies as well as stored serum samples from 43 patients with liver disease were tested for HCV-RNA by reverse transcription-nested PCR using the same sets of primers and following strict anticontamination measures. Twenty-nine cases were positive and 14 were negative for serum HCV-RNA. Tissue HCV-RNA was detected in 17 out of the 29 serum HCV-RNA-positive cases but not in any of the 14 serum HCV-RNA-negative cases. Compared to serum-PCR, tissue-PCR was 100% specific, 58.6% sensitive, and 72% efficient. HCV-RNA was detected more frequently in biopsies stored for less than 1 year, than in those stored for more than 1 year (P = 0.046). In biopsies stored for up to 1 year detection of HCV-RNA by PCR was 81.8% sensitive and 90.9% efficient. Short ( 0.5 cm) ones. It is concluded that following strict anticontamination measures, HCV-RNA detection by PCR in routinely fixed, processed, and stored diagnostic liver biopsies provides a valuable adjunct to diagnosis of HCV infection. In this study, this option was free from contamination problems, even though routine batch histological processing schedules were used. PMID:7964648

  5. Differentiation of Helicobacter pylori isolates by polymerase chain reaction-restriction fragment length polymorphism

    Institute of Scientific and Technical Information of China (English)

    SHI Li; SUN Yong; ZHANG Ya-li; ZHANG Zhen-shu; ZHOU Dian-yuan

    2002-01-01

    Objective: To investigate the association between the diversity of urease gene and urease activity of clinical isolates of Helicobacter pylori (H. pylori). Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of urease gene and rapid urease activity test were used to study the urease activity of different clinical isolates of H. pylori. Results: H. pylori clinical isolates were divided into 4types according to their PCR-RFLP results of urease gene and urease activity. Type I , possessing strong urease activity (0. 11) and presented 1 fragment of 1.7 kb by PCR-RFLP, had close relations with gastric ulcer; type Ⅱ , with the weakest urease activity (0. 07) and 2 fragments (1.3 and 0. 4 kb respectively), was associated with duodenal bulb ulcer; type Ⅱ , with the strongest urease activity (0. 12) and 2 fragments (0. 4and 0. 17 kb) with or without 1 fragment (0. 23 or 0. 37 kb) , was responsible for gastritis; type Ⅳ, with weak urease activity (0. 09) and 2 fragments (1.5 and 0. 2 kb), was shown to be related to both gastric and duodenal bulb ulcers. Conclusion: The diversity of urease gene decides different urease activities of different clinical isolates of H. pylori, hence the different possibilities of pathogenesis due to this bacteria.

  6. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics.

    Science.gov (United States)

    Li, Yuyuan; Xing, Da; Zhang, Chunsun

    2009-02-01

    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  7. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Directory of Open Access Journals (Sweden)

    Daniela Camargos Costa

    2014-02-01

    Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  8. Analysis of polymorphism in the bovine casein genes by use of the polymerase chain reaction.

    Science.gov (United States)

    Pinder, S J; Perry, B N; Skidmore, C J; Savva, D

    1991-01-01

    Methods have been devised for detecting polymorphisms in the bovine beta- and kappa-casein genes using the polymerase chain reaction (PCR) followed either by restriction enzyme digestion (to reveal a restriction fragment length polymorphism (RFLP] or by hybridization of an allele-specific oligonucleotide. These methods, as well as being faster and more sensitive than traditional RFLP methods, are of more general applicability since they can detect any change in DNA sequence. They require only a small sample of blood or semen and are applicable to animals of any age or sex. These methods make possible large-scale screening and thus selection for alleles at these loci. Typing of blood DNA can give erroneous results when the animal concerned is a twin; however, this can be overcome by retesting using milk or semen. Analysis of the kappa-casein genotype of Holstein-Friesian bulls gives frequencies for the A and B alleles of 0.80 and 0.20 respectively. Selection in favour of the B allele, which is superior for cheese production, could thus have a large effect. The A3 and B alleles at the beta-casein locus have been shown to be rare in the Holstein-Friesian population. Linkage disequilibrium exists between beta-casein B and kappa-casein B.

  9. Polymerase chain reaction-based screening for the ceftriaxone-resistant Neisseria gonorrhoeae F89 strain.

    Science.gov (United States)

    Goire, N; Lahra, M M; Ohnishi, M; Hogan, T; Liminios, A E; Nissen, M D; Sloots, T P; Whiley, D M

    2013-04-04

    Emergence and spread of Neisseria gonorrhoeae resistant to extended spectrum cephalosporins is a major problem threatening treatment of gonorrhoea and is further highlighted by the recent report of a second ceftriaxone-resistant N. gonorrhoeae strain (F89) in Europe, initially observed in France and subsequently identified in Spain. N. gonorrhoeae antimicrobial resistance (AMR) surveillance has acquired new importance and molecular tools have the potential to enhance bacterial culture-based methods. In this study, we established a polymerase chain reaction (PCR) protocol for direct detection of the F89 strain. A key component of this screening protocol was the development of a hybridisation probe-based melting curve analysis assay (mosaic501-hybPCR) to detect the presence of an A501P substitution on the N. gonorrhoeae mosaic penicillin binding protein 2 (PBP2) sequence, an important characteristic of the F89 strain. The mosaic501-hybPCR was evaluated using plasmid-derived positive controls (n=3) and characterised gonococcal (n=33) and non-gonococcal (n=58) isolates. The protocol was then applied to 159 clinical specimens from Sydney, Australia, collected during the first half of the year 2012 that were N. gonorrhoeae PCR-positive. Overall, the results indicate that the PCR-based protocol is suitable for direct detection of the N. gonorrhoeae F89 strain in non-cultured clinical samples. It therefore provides an additional tool to aid investigations into the potential spread of F89 strain throughout Europe and elsewhere.

  10. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Gleichweit, Christoph; Amende, Max; Bauer, Udo; Schernich, Stefan; Höfert, Oliver; Lorenz, Michael P. A.; Zhao, Wei; Bachmann, Philipp; Papp, Christian, E-mail: christian.papp@fau.de [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Müller, Michael; Koch, Marcus [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Wasserscheid, Peter [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Libuda, Jörg; Steinrück, Hans-Peter [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany)

    2014-05-28

    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H{sub 12}-NEC), dodecahydro-N-propylcarbazole (H{sub 12}-NPC), and dodecahydro-N-butylcarbazole (H{sub 12}-NBC), on Pt(111) and on Al{sub 2}O{sub 3}-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al{sub 2}O{sub 3}, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC.

  11. A quantitative real time polymerase chain reaction approach for estimating processed animal proteins in feed: preliminary data

    Directory of Open Access Journals (Sweden)

    Maria Cesarina Abete

    2013-04-01

    Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.

  12. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    Directory of Open Access Journals (Sweden)

    T. M. Nabeel Muhammad

    2015-01-01

    Full Text Available Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasal swabs were tested by PCR. Results: PCR analysis showed 56 positives (71.7% for infectious coryza out of total 78 samples tested. Of 56 infra orbital sinus swabs tested, 47 were positive (83.9% and 9 nasal swabs (40.9% out of 22 tested had given positive results for infectious coryza. Samples collected from birds at acute stage of disease and samples collected before treatment with antibiotics were given better results on PCR. Conclusion: For preventing the economic losses associated with the disease, an early, accurate and rapid diagnosis is essential. PCR is a rapid and highly sensitive diagnostic technique which can substitute conventional cultural examination.

  13. A polymerase chain reaction-based method for isolating clones from a complimentary DNA library in sheep.

    Science.gov (United States)

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon; Hutmacher, Dietmar W

    2014-10-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes.

  14. Diagnosis of foot-and mouth disease by real time reverse transcription polymerase chain reaction under field conditions in Brazil

    Directory of Open Access Journals (Sweden)

    Clarke Neville P

    2008-12-01

    Full Text Available Abstract Background Foot-and-mouth disease (FMD is an economically important and highly contagious viral disease that affects cloven-hoofed domestic and wild animals. Virus isolation and enzyme-linked immunosorbent assay (ELISA are the gold standard tests for diagnosis of FMD. As these methods are time consuming, assays based on viral nucleic acid amplification have been developed. Results A previously described real-time reverse transcriptase polymerase chain reaction (RT-PCR assay with high sensitivity and specificity under laboratorial and experimental conditions was used in the current study. To verify the applicability of this assay under field conditions in Brazil, 460 oral swabs from cattle were collected in areas free of FMD (n = 200 and from areas with outbreaks of FMD (n = 260. Three samples from areas with outbreaks of FMD were positive by real-time RT-PCR, and 2 of those samples were positive by virus isolation and ELISA. Four other samples were considered inconclusive by real-time RT-PCR (threshold cycle [Ct] > 40; whereas all 200 samples from an area free of FMD were real-time RT-PCR negative. Conclusion real-time RT-PCR is a powerful technique for reliable detection of FMDV in a fraction of the time required for virus isolation and ELISA. However, it is noteworthy that lack of infrastructure in certain areas with high risk of FMD may be a limiting factor for using real-time RT-PCR as a routine diagnostic tool.

  15. Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hamed Rezaeejam

    2015-01-01

    Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

  16. Morphological and polymerase chain reaction-restriction fragment lenght polymorphism characterization of Biomphalaria kuhniana and Biomphalaria amazonica from Colombia

    Directory of Open Access Journals (Sweden)

    Luz E Velásquez

    2002-10-01

    Full Text Available In Colombia, five Biomphalaria planorbid species are known: B. kuhniana, B. straminea, B. peregrina, B. canonica and B. oligoza(var. B. philippiana. Among them, B. straminea is intermediate host of Schistosoma mansoni and B. peregrina has been found to be experimentally susceptible to this parasite. B. straminea is commonly confused with B. kuhniana and they have been clustered together with B. intermedia in the complex named B. straminea. The difficulties involved in the specific identification, based on morphological data, have motivated the use of new techniques as auxiliary tools in cases of inconclusive morphological identification of such planorbid. In the present study, five Biomphalaria populations from the Colombian Amazon region and from Interandian Valleys were morphologically identified and characterized by polymerase chain reaction-restriction fragment lenght polymorphism directed at the internal transcribed spacer region of the rRNA gene, followed by digestion of the generated fragment with restriction enzymes (DdeI, AluI, RsaI, MvaI and HaeIII. Known profiles of the Brazilian species B. straminea, B. peregrina, B. kuhniana, B. intermedia and B. amazonica, besides B. kuhniana from Colombia, were used for comparison. The five populations under study were morphologically and molecularly identified as B. kuhniana and B. amazonica.

  17. Haplotyping using a combination of polymerase chain reaction-single-strand conformational polymorphism analysis and haplotype-specific PCR amplification.

    Science.gov (United States)

    Zhou, Huitong; Li, Shaobin; Liu, Xiu; Wang, Jiqing; Luo, Yuzhu; Hickford, Jon G H

    2014-12-01

    A single nucleotide polymorphism (SNP) may have an impact on phenotype, but it may also be influenced by multiple SNPs within a gene; hence, the haplotype or phase of multiple SNPs needs to be known. Various methods for haplotyping SNPs have been proposed, but a simple and cost-effective method is currently unavailable. Here we describe a haplotyping approach using two simple techniques: polymerase chain reaction-single-strand conformational polymorphism (PCR-SSCP) and haplotype-specific PCR. In this approach, individual regions of a gene are analyzed by PCR-SSCP to identify variation that defines sub-haplotypes, and then extended haplotypes are assembled from the sub-haplotypes either directly or with the additional use of haplotype-specific PCR amplification. We demonstrate the utility of this approach by haplotyping ovine FABP4 across two variable regions that contain seven SNPs and one indel. The simplicity of this approach makes it suitable for large-scale studies and/or diagnostic screening.

  18. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    P. D. Luka

    2014-10-01

    Full Text Available Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction from FFT for African swine fever virus (ASFV detection. The modified conventional method gave a higher quality DNA when compared with commercially available DNA extraction kits (QIAamp® DNA Mini Kit, DNeasy® Blood and Tissue Kit, and ZR Genomic DNA™ Tissue MiniPrep. Results: An average A260/A280 DNA purity of 0.86-1.68 and 3.22-5.32 μg DNA/mg for formalin fixed and non-fixed tissues, respectively using a conventional method. In a reproducible and three times repeat PCR, the ASFV DNA expected product size of 278 bp was obtained from the DNA extract of the conventional method but not from the DNA extract of the commercial kits. Conclusion: The present study has demonstrated that the conventional method extracts ASFV genome better than commercial kit. In summary, the commercial kit extraction appeared not suitable to purify ASFV DNA from FFT. We, therefore, recommend that the use of the conventional method be considered for African swine fever DNA extraction from FFT.

  19. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    International Nuclear Information System (INIS)

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  20. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    Science.gov (United States)

    Shen, Cenchao; Yang, Wenjuan; Ji, Qiaoli; Maki, Hisaji; Dong, Anjie; Zhang, Zhizhou

    2009-11-01

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  1. Molecular characterization of Trichinella genotypes by inter-simple sequence repeat polymerase chain reaction (ISSR-PCR).

    Science.gov (United States)

    Fonseca-Salamanca, F; Nogal-Ruiz, J J; Benito, C; Camachot, M V; Martínez-Fernández, A R

    2006-06-01

    A bulk analysis of inter-simple sequence repeat-polymerase chain reaction (ISSR-PCR) provides a quick, reliable, and highly informative system for DNA banding patterns that permit species identification. The present study evaluates the applicability of this system to Trichinella species identification. After a single amplification carried out on a single larva with the primer 816([CA]nRY) under high stringency conditions, which provide high reproducibility, we were able to identify by consistent banding patterns 5 sibling species: Trichinella spiralis (ISS48), 2 Trichinella britovi isolates (ISS11 and ISS86), Trichinella murrelli (ISS35), Trichinella nativa (ISS71), Trichinella nelsoni (ISS29); 3 additional Trichinella genotypes: T8 (ISS149), T9 (ISS408 and ISS409), and T6 (ISS34); and the nonencapsulated species Trichinella pseudospiralis (ISS13). Moreover, 33 new Trichinella isolates from 2 zoogeographical regions were unequivocally identified. All Trichinella isolates have shown an identical pattern with those produced by the reference strain. According to these data, we have demonstrated that ISSR-PCR is a robust technique that emerges as a useful new application for the molecular identification of Trichinella isolates in epidemiological studies. PMID:16884006

  2. Detection and Enumeration of Streptococcus agalactiae from Bovine Milk Samples by Real-Time Polymerase Chain Reaction.

    Science.gov (United States)

    de Carvalho, Nara Ladeira; Gonçalves, Juliano Leonel; Botaro, Bruno Garcia; Silva, Luis Felipe de Prada E; dos Santos, Marcos Veiga

    2015-09-01

    The aim of this study was to evaluate the use of real-time polymerase chain reaction (qPCR) combined with DNA extraction directly from composite milk and bulk tank samples for detection and enumeration of Streptococcus agalactiae (SAG) causing subclinical mastitis. Dilutions of sterile reconstituted skim milk inoculated with SAG ATCC 13813 were used to establish a standard curve (cfu/mL) for the qPCR assay targeting SAG. The analytical sensitivity and repeatability of the qPCR assay were determined. Bulk tank (BTM; n = 38) and composite milk samples (CM; n = 26) collected from lactating cows with positive isolation of SAG were submitted to the qPCR protocol and SAG plate counting, with results from both methods compared. Amplification of DNA was not possible in two out of 64 samples, indicating that qPCR was able to detect SAG in 96 and 97% of BTM and CM samples, respectively. The inter-assay coefficient of variation was <5%, showing that the technique had adequate repeatability. The qPCR protocol can be a high-throughput and rapid diagnostic assay to accurately detect SAG from BTM and CM samples compared with conventional microbiological culture method. However, the evaluated qPCR protocol is not accurate for enumerating SAG in milk samples, probably due to quantification of DNA of non-viable cells. PMID:26134534

  3. Subtyping of new Brazilian avian metapneumovirus isolates from chickens and turkeys by reverse transcriptase-nested-polymerase chain reaction.

    Science.gov (United States)

    D'Arce, Regina C F; Coswig, Lia T; Almeida, Renata S; Trevisol, Iara M; Monteiro, Maria C B; Rossini, Lavínia I; Di Fabio, José; Hafez, Hafez M; Arns, Clarice W

    2005-04-01

    The aim of this study was to improve a reverse transcriptase (RT)-nested-polymerase chain reaction (PCR) able to differentiate avian pneumovirus (APV) subtypes A and B, and to characterize new Brazilian isolates. Representative APV strains and clinical field samples from chickens and turkey flocks were amplified in the chicken embryo-related cell line. Viral RNA was extracted from harvested cells, and submitted to cDNA synthesis. The primers utilized for RT-PCR were compatible with the G gene of both the A and B subtypes of APV, while the nested primers were subtype specific. This approach showed that three new APVs from chickens and one from turkeys were subtype A, confirmed by sequencing. This is the first report of APV isolation from turkeys in Brazil. Four other APVs were detected and classified as subtype A by RT-nested-PCR. These optimized techniques could be useful for differentiation of APV subtypes A and B, proving to be a valuable molecular epidemiological tool.

  4. Detection of congenital cytomegalovirus infection by real-time polymerase chain reaction analysis of saliva or urine specimens.

    Science.gov (United States)

    Ross, Shannon A; Ahmed, Amina; Palmer, April L; Michaels, Marian G; Sánchez, Pablo J; Bernstein, David I; Tolan, Robert W; Novak, Zdenek; Chowdhury, Nazma; Fowler, Karen B; Boppana, Suresh B

    2014-11-01

    Viral culture of urine or saliva has been the gold standard technique for the diagnosis of congenital cytomegalovirus (CMV) infection. Results of rapid culture and polymerase chain reaction (PCR) analysis of urine and saliva specimens from 80 children were compared to determine the clinical utility of a real-time PCR assay for diagnosis of congenital CMV infection. Results of urine PCR were positive in 98.8% of specimens. Three PCR-positive urine samples were culture negative. Results of saliva PCR and culture were concordant in 78 specimens (97.5%). Two PCR-positive saliva samples were culture negative. These findings demonstrate that PCR performs as well as rapid culture of urine or saliva specimens for diagnosing congenital CMV infection and saliva specimens are easier to collect. Because PCR also offers more rapid turnaround, is unlikely to be affected by storage and transport conditions, has lower cost, and may be adapted to high-throughput situations, it is well suited for targeted testing and large-scale screening for CMV.

  5. Single-molecule RNA detection at depth by hybridization chain reaction and tissue hydrogel embedding and clearing

    Science.gov (United States)

    Shah, Sheel; Lubeck, Eric; Schwarzkopf, Maayan; He, Ting-Fang; Greenbaum, Alon; Sohn, Chang Ho; Lignell, Antti; Choi, Harry M. T.; Gradinaru, Viviana; Pierce, Niles A.

    2016-01-01

    Accurate and robust detection of mRNA molecules in thick tissue samples can reveal gene expression patterns in single cells within their native environment. Preserving spatial relationships while accessing the transcriptome of selected cells is a crucial feature for advancing many biological areas – from developmental biology to neuroscience. However, because of the high autofluorescence background of many tissue samples, it is difficult to detect single-molecule fluorescence in situ hybridization (smFISH) signals robustly in opaque thick samples. Here, we draw on principles from the emerging discipline of dynamic nucleic acid nanotechnology to develop a robust method for multi-color, multi-RNA imaging in deep tissues using single-molecule hybridization chain reaction (smHCR). Using this approach, single transcripts can be imaged using epifluorescence, confocal or selective plane illumination microscopy (SPIM) depending on the imaging depth required. We show that smHCR has high sensitivity in detecting mRNAs in cell culture and whole-mount zebrafish embryos, and that combined with SPIM and PACT (passive CLARITY technique) tissue hydrogel embedding and clearing, smHCR can detect single mRNAs deep within thick (0.5 mm) brain slices. By simultaneously achieving ∼20-fold signal amplification and diffraction-limited spatial resolution, smHCR offers a robust and versatile approach for detecting single mRNAs in situ, including in thick tissues where high background undermines the performance of unamplified smFISH. PMID:27342713

  6. Detection of DNA from Leishmania (Viannia: accuracy of polymerase chain reaction for the diagnosis of cutaneous leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Herintha Coeto Neitzke-Abreu

    Full Text Available Cutaneous leishmaniasis (CL can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L and blood sample-enriched leukocytes (PCR-B with three conventional diagnostic techniques: parasite direct search (DS, Montenegro skin test (MST, and indirect immunofluorescence reaction (IIF. The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia (minicircle kDNA fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species.

  7. Approach to molecular characterization of different strains of Fasciola hepatica using random amplified polymorphic DNA polymerase chain reaction.

    Science.gov (United States)

    Scarcella, S; Miranda-Miranda, E; Solana, M V; Solana, H

    2015-04-01

    The aim of the present study was to genetically characterize Fasciola hepatica strains from diverse ecogeographical regions (America and Europe), susceptible and resistant to Triclabendazole, using the random amplified polymorphic DNA fragments (RAPDs-PCR) technique to elucidate genetic variability between the different isolates. Ten different oligonucleotide primers of 10 bases with GC content varying from 50-70% were used. A polymerase chain reaction (PCR) was carried out in 25 μl of total volume. Duplicate PCR reactions on each individual template DNA were performed to test the reproducibility of the individual DNA bands. The size of the RAPD-PCR fragments was determined by the reciprocal plot between the delay factors (Rf) versus the logarithm of molecular weight ladder. The phenogram obtained showed three main clusters, the major of which contained European Strains (Cullompton and Sligo) showing a genetic distance of 27.2 between them. The American strains (Cedive and Cajamarca) on the other hand formed each their distinctive group but clearly maintaining a closer genetic relationship among them than that to their European counterparts, with which showed a distance of 33.8 and 37.8, respectively. This polymorphism would give this species enhanced adaptability against the host, as well as the environment. The existence of genetically different populations of F. hepatica could allow, against any selection pressure, natural or artificial (for use fasciolicides products and/or control measures), one or more populations of F. hepatica to be able to survive and create resistance or adaptability to such selective pressure.

  8. Application of Freeman Chain Codes: An Alternative Recognition Technique for Malaysian Car Plates

    CERN Document Server

    Jusoh, Nor Amizam

    2011-01-01

    Various applications of car plate recognition systems have been developed using various kinds of methods and techniques by researchers all over the world. The applications developed were only suitable for specific country due to its standard specification endorsed by the transport department of particular countries. The Road Transport Department of Malaysia also has endorsed a specification for car plates that includes the font and size of characters that must be followed by car owners. However, there are cases where this specification is not followed. Several applications have been developed in Malaysia to overcome this problem. However, there is still problem in achieving 100% recognition accuracy. This paper is mainly focused on conducting an experiment using chain codes technique to perform recognition for different types of fonts used in Malaysian car plates.

  9. [The detection of minimal residual disease in patients with chronic B-cell lymphatic leukemia using patient-specified polymerase chain reaction].

    Science.gov (United States)

    Sidorova, Iu V; Sorokina, T V; Biderman, B V; Nikulina, E E; Kisilichina, D G; Naumova, E V; Pochtar', M E; Lugovskaia, S A; Ivanova, V L; Kovaleva, L G; Ptushkin, V V; Nikitin, E A; Sudarikov, A B

    2011-12-01

    The new effective protocols of treatment of chronic B-cell lymphatic leukemia, including purine analogs and monoclonal antibodies, provide robust remissions under this disease. Accordingly, the requirements to remission quality assessment are changed too. In particular the assessment of minimal residual disease is obligatory. To assess minimal residual disease in terms of quantity in case of chronic B-cell lymphatic leukemia the technique of polymerase chain reaction was applied in real time with patient-specific primers from the area of V-D-J combinations of genes of heavy chain of immunoglobulin. The study included samples from 60 patients suffering of chronic B-cell lymphatic leukemia. In 15 of them (25%), it was impossible to apply neither the sequence analysis of genes of heavy chain of immunoglobulin nor the fitting of patient-specific primer. The results of quantitative determination of minimal residual disease were obtained in 45 patients (55 tests). The minimal residual disease was detected in 30 of 55 samples (54.5%) and was not detected in 25 of 55 samples (45.5%). At the same time, the quantitative determination of minimal residual disease was implemented in regard to the initial level of neoplastic cells. The method sensitivity qualified by serial dilutions, consisted 10(-5) or 1 neoplastic cell to 100 000 normal cells. The comparative analysis was applied to the results of determination of minimal residual disease using two methods -polymerase chain reaction in real time using patient-specified primers and four-color flow cytofluometry. The determination of minimal residual disease with both methods was implemented in 37 patients (45 tests). The results of both methods matched in 93.3% (42 tests out of 45) with maximal disparity of one degree. Then Spearman factor consisted 0.87 (p polymerase chain reaction in real time. Therefore, the detection of minimal residual disease under chronic B-cell lymphatic leukemia using the method of polymerase chain

  10. A Theoretical Investigation on the Reaction Mechanism of the C8H+·10 Side-Chain Decomposition Processes

    Institute of Scientific and Technical Information of China (English)

    CHENG Xue-Li; ZHAO Yan-Yun; LI Feng

    2008-01-01

    The dissociation of ethylbenzene cation C8H+·10 served as a prototype to investigate the decompasition mechanisms of alkylbenzene cations.The reactions of C8H+·10 decomposition reaction system have been studied extensively at the B3L YP/6-311++G** level with Gaussion 98 package.The chain reaction of C8H+·10 dissociation is initiated by C-H bond rupture.All reaction channels were fully investigated with the vibrational mode analysis to confirm the transition states and reveal the reaction mechanism.The energetically most favorable pathway is C8H+·10→TS4→·P2+H· and the channel ieading to C8H+·10 and C2H4 is also competitive.

  11. Stereoselective synthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-ulose via autoxidation reaction

    Institute of Scientific and Technical Information of China (English)

    LIU Hong-Min; ZHANG Fuyi; TAO Jing-Chao

    2004-01-01

    Many different approaches for synthesis of branched chain sugars have beenestablished,1 because they are very useful intermediates for synthesis of other non-sugar chiralmolecules, and usually occur in nature. Branched chain glycosidulose can be used for construction offive- and six-membered carbocyclic rings to which two chiral carbons of sugar are incorporated byintramolecular aldol condensation and Robinson annulation,2 Therefore they are useful in thesynthesis of natural products which consist of annulated carbohydrates or where a highlyfunctionalised enantiomerically pure cyclopentane or cyclohexane is required. Also, this type ofbranched chain sugar can be considered as the synthons of monoterpenoid natural products of theiridoid class which have the cyclopentan-(c)-pyran structure. In view of the importance of branchedchain glycosiduloses, it is desirable to have a general, convenient methodology to their synthesis.However, none of the literature methods was reported on their synthesis by a nuclephilic addition toa partially protected glycosidulose, due to the fact that these glycosiduloses are very difficult tosynthesize selectively and unstable;3 and what is more, one-step synthesis branched chainglycosidulose using this method is almost impossible.In this paper, we report on a general, convenient method for stereoselective syntheses of2,2-bis(C-branched-chain)glucopyranosid-3-uloses by the new reaction of 1 with various activemethylene compounds. The generality of this method was examined in detail. The optimumtemperature was 18-25℃. The solvent DMF was better than the others. In all cases he yields werehigher than 60%.All the 2,2-bis(C-branched-chain)glucopyranosid-3-uloses were characterized by X-raycrystallographic analyses. In addition, the important iintermediate in this reaction was isolated,which is the product of autoxidation of 1 at C-3 position. Thus the reaction mechanism for thesynthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-uloses

  12. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q

    2015-06-01

    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  13. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio

    2010-11-01

    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  14. Use of pooled samples for the detection of Salmonella in feces by polymerase chain reaction.

    Science.gov (United States)

    Singer, Randall S; Cooke, Cara L; Maddox, Carol W; Isaacson, Richard E; Wallace, Richard L

    2006-07-01

    Many epidemiological studies of Salmonella rely on conventional bacteriological culture methods to detect Salmonella in fecal samples. These culture-based methods are inefficient for epidemiological studies in populations with a low prevalence of Salmonella. The objective of this study was to optimize a protocol that uses pooled Salmonella enrichment broth cultures of bovine feces and polymerase chain reaction (PCR) for the detection of the invA gene of Salmonella in feces. In one field trial, 196 animals were sampled, and all samples were tested by culture, invA PCR on individual samples, invA PCR on pools of 5 samples, and BAX PCR on individual samples. All assays showed a high agreement on individual samples (kappa > or = 0.75). The invA PCR was run on each of 40 pools and detected 19 of 22 culture-positive pools. In another field trial, 152 samples were taken from 4 dairies, and the invA PCR was performed on pools of 5 samples in addition to bacteriological culture of individual samples. Salmonella was detected in 5 of the 32 pools (7 total positive samples) by both PCR and culture. One pool was PCR-positive but culture-negative. Pooling did not dramatically affect the performance of the invA PCR; most of the culture-positive samples were detected, including all of the samples when there were 4 or more Salmonella colonies on the agar plate. Based on these field trials, invA PCR on pooled samples appears to be an efficient method of Salmonella detection as long as Salmonella loads are not extremely low.

  15. Application of the polymerase chain reaction and molecular probe technology for the diagnosis of tuberculosis

    International Nuclear Information System (INIS)

    Conventional methods for the diagnosis of tubercolosis based on microscopic examination and in vitro culture is both time consuming and tedious. Molecular methods of diagnosis have been suggested as an alternative which may provide the clinical laboratory with a means for rapid diagnosis. The present study was carried out to determined the feasibility of this approach for the detection of mycobacteria. Clinical specimens received from patients with suspected diagnosis of tuberculous infection were used. All specimens were examined microscopically and those that were smear positive were cultured. An aliquot of each specimen were kept for analysis by in vitro amplification using the polymerase chain reaction (PCR). The primers used for PCR were 20-mers specific for the insertion element IS986, which is restricted to the M. tuberculosis complex group. All specimens were analysed in quintriplicate, with 2 samples unspiked and 3 sampled spiked with M. tuberculosis. Appropriate positive and negative controls were included in all essays. Following amplification, the specimens were analysed by agarose gel electrophoresis (AGE). All specimens were further subject to hybridization studies using a specific radiolabelled probe. The sensitivity of the amplification assay coupled with visualization of the amplified targets using eithidium bromide staining was found to be about 1 fg of DNA. A total of 40 smear positive specimens were analyzed, 29 of which were culture positive. Twenty-eight of the 29 culture positive specimens tested positive by PCR/hybridization analysis. Of the 11 culture negative specimens, 9 were positive by PCR. Overall 37/40 (92.5%) specimens were positive by PCR/hybridization analysis. (author). 13 refs, 1 tab

  16. Use of polymerase chain reaction in the diagnosis of Whipple's disease.

    Science.gov (United States)

    Kono, Masanori; Yamamoto, Kei; Nagamatsu, Maki; Kutsuna, Satoshi

    2015-12-01

    Whipple's disease, a systemic, chronic infectious disease caused by Tropheryma whipplei, is extremely rare in Asian populations. A correct diagnosis is necessary due to its high mortality rate. Unfortunately, patients are apt to be misdiagnosed with connective tissue diseases since they typically present with arthritis or arthralgia. There are three diagnostic tools for Whipple's disease using intestinal tissues: 1) periodic acid-Schiff (PAS)-positive macrophages; 2) electron microscopic observation; and 3) polymerase chain reaction (PCR). It is challenging to diagnose this disease in the absence of histological findings, especially in Japan, where the clinical protocol currently used to make the diagnosis needs improvement, although symptomology and PCR results may be sufficient. Herein, we investigated a 24-year-old Japanese woman who had suffered from intermittent fever, migratory arthralgia, and watery diarrhea for several months. Her biopsied intestinal tissue was negative for foamy macrophages and PAS-positive cells, and electron microscopy did not provide diagnostic insight. PCR amplification of the specimens, however, successfully revealed T. whipplei. Whipple's disease was diagnosed based on a positive PCR result and strong clinical suspicion. The patient was treated parenterally with ceftriaxone (2 g daily) for two weeks, followed by oral treatment with 160 mg trimethoprim and 800 mg sulfamethoxazole twice per day. After one month of treatment, her symptoms disappeared and inflammatory markers returned to normal levels. This case illustrates the practicality and effectiveness of a PCR-based diagnostic test in combination with clinical suspicion to correctly diagnose Whipple's disease, especially in cases when a histological examination does not provide insight.

  17. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Santos, M S; Souza, E S; S Junior, R M; Talhari, S; Souza, J V B

    2010-08-01

    Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP). More specifically: a) to evaluate 3 different amplification regions, b) to investigate 3 different restriction enzymes, and c) to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2) were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel) produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas--FMTAM) were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  18. [Value of polymerase chain reaction in serum for the diagnosis of enteroviral meningitis].

    Science.gov (United States)

    Marque Juillet, S; Lion, M; Pilmis, B; Tomini, E; Dommergues, M-A; Laporte, S; Foucaud, P

    2013-06-01

    Enteroviruses (EV) are a common cause of aseptic meningitis in children. Virological diagnosis of EV meningitis is currently based on the detection of the viral genome in the cerebrospinal fluid (CSF). This study attempted to determine the correlation and the temporality of the polymerase chain reaction (PCR) assay in serum and CSF and to evaluate the possibility of diagnosing EV infection only on the serum PCR. The EV genome was sought by RT real-time PCR (Smart Cycler EV Primer and Probe Set(®), Cepheid) in CSF and serum, collected at the same time, for all children who underwent a lumbar puncture for suspected meningitis, between 1 June and 31 July 2010 at the Versailles Hospital. Forty-four patients were included in the study. EV infection was documented for 22 of them. In 10 patients, the EV genome was detected in CSF only; in 3 patients in serum only, and in 9 patients in both. Among patients with acute EV neurological infection, viremic children were significantly younger (1.6 months versus 5.8 years; P3 months, clinical and biological compatibility with a viral infection, no previous antibiotic therapy, time from symptom onset to blood sampling <30 h, PCR in serum analyzed within 3h), PCR in serum, when positive, is a possible alternative. Therefore, it may be possible to diagnose EV infection without performing a lumbar puncture in a limited number of young children (11.4% of our suspected cases). This study needs to be reinforced by a multicenter study with a broader panel of patients.

  19. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine

    Directory of Open Access Journals (Sweden)

    K.R. Caleffi

    2012-02-01

    Full Text Available Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT and dapsone, rifampicin and clofazimine for borderline (BB and lepromatous (LL forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients’ urine samples was successfully amplified by PCR-Pra in 46.6% (34/73 of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306. In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386. PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033. Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

  20. Biosynthetic enhancement of the detection of bacteria by the polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Julie S Do

    Full Text Available Molecular viability testing (MVT was previously reported to specifically detect viable bacterial cells in complex samples. In MVT, brief nutritional stimulation induces viable cells, but not non-viable cells, to produce abundant amounts of species-specific ribosomal RNA precursors (pre-rRNA. Quantitative polymerase chain reaction (qPCR is used to quantify specific pre-rRNAs in a stimulated aliquot relative to a non-stimulated control. In addition to excluding background signal from non-viable cells and from free DNA, we report here that MVT increases the analytical sensitivity of qPCR when detecting viable cells. Side-by-side limit-of-detection comparisons showed that MVT is 5-fold to >10-fold more sensitive than standard (static DNA-targeted qPCR when detecting diverse bacterial pathogens (Aeromonas hydrophila, Acinetobacter baumannii, Listeria monocytogenes, Mycobacterium avium, and Staphylococcus aureus in serum, milk, and tap water. Sensitivity enhancement may come from the elevated copy number of pre-rRNA relative to genomic DNA, and also from the ratiometric measurement which reduces ambiguity associated with weak or borderline signals. We also report that MVT eliminates false positive signals from bacteria that have been inactivated by moderately elevated temperatures (pasteurization, a condition that can confound widely-used cellular integrity tests that utilize membrane-impermeant compounds such as propidium iodide (PI or propidium monoazide (PMA to differentiate viable from inactivated bacteria. MVT enables the sensitive and specific detection of very small numbers of viable bacteria in complex matrices.

  1. Polymerase chain reaction targeting insertion sequence for the diagnosis of extrapulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    V Makeshkumar

    2014-01-01

    Full Text Available Background & objectives: Diagnosis of extrapulmonary tuberculosis (EPTB is difficult using conventional diagnostic methods. This study was conducted to evaluate the use of polymerase chain reaction (PCR in diagnosis of definitive and probable extrapulmonary tuberculosis patients, and to assess the performance of insertion sequence (IS 6110 based PCR assay as compared to conventional culture by Lowenstein-Jensen (LJ method for the diagnosis of EPTB. Methods: A total of 178 non repeated clinical specimens were collected from clinically suspected extrapulmonary tuberculosis patients. The specimens included 59 ascitic fluid, 54 pleural fluid, 25 cerebrospinal fluid (CSF, 12 fine needle aspiration (FNA, 8 urine, 7 pus, 6 synovial fluid, 2 skin tissue, one pericardial fluid, one liver abscess, one pancreatic cyst fluid, one omental biopsy and one semen sample. All these clinical samples were subjected to Ziehl-Neelsen staining (ZN for acid fast bacilli (AFB and culture on LJ medium. PCR was performed by targeting 123bp fragment of insertion sequence IS6110 of Mycobacterium tuberculosis (MTB. Results: Of the 178 specimens, 10 (5.61% were ZN smear positive for AFB, six (3.37% were L-J culture positive from 10 AFB smear positive cases and 48 (26.96% were PCR IS 6110 positive for M. tuberculosis. Interpretation & conclusions: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis. False positive PCR IS6110 in three CSF samples may be due to latent TB infection which was limitation in this study.

  2. Polymerase chain reaction with two molecular targets in mucosal leishmaniasis' diagnosis: a validation study

    Directory of Open Access Journals (Sweden)

    Clemencia Ovalle Bracho

    2007-08-01

    Full Text Available We validated the polymerase chain reaction (PCR with a composite reference standard in 61 patients clinically suspected of having mucosal leishmaniasis, 36 of which were cases and 25 were non-cases according to this reference standard. Patient classification and test application were carried out independently by two blind observers. One pair of primers was used to amplify a fragment of 120 bp in the conserved region of kDNA and another pair was used to amplify the internal transcript spacers (ITS rDNA. PCR showed 68.6% (95% CI 59.2-72.6 sensitivity and 92% (95% CI 78.9-97.7 specificity; positive likelihood ratio: 8.6 (95% CI 2.8-31.3 and negative likelihood ratio: 0.3 (95% CI 0.3-0.5, when kDNA molecular target was amplified. The test performed better on sensitivity using this target compared to the ITS rDNA molecular target which showed 40% (95% CI 31.5-42.3 sensitivity and 96% (95% CI 84.1-99.3 specificity; positive likelihood ratio: 10 (95% CI 2.0-58.8 and negative likelihood ratio: 0.6 (95% CI 0.6-0.8. The inter-observer agreement was excellent for both tests. Based upon results obtained and due to low performance of conventional methods for diagnosing mucosal leishmaniasis, we consider PCR with kDNA as molecular target is a useful diagnostic test and the ITS rDNA molecular target is useful when the aim is to identify species.

  3. Comparison of nasopharyngeal culture, polymerase chain reaction (PCR) and serological test for diagnosis of pertussis.

    Science.gov (United States)

    Cengiz, Ali Bülent; Yildirim, Inci; Ceyhan, Mehmet; Seçmeer, Gülten; Gür, Deniz; Kara, Ateş

    2009-01-01

    This prospective study, which was designed to compare nasopharyngeal culture, polymerase chain reaction (PCR) and serology in the diagnosis of pertussis, covered 35 children aged between 0 and 16 who were admitted to Hacettepe University Ihsan Doğramaci Children's Hospital between 1 March 2005 and 31 August 2006 with coughing for 7 days or longer, paroxysmal cough of any duration, or cough with inspiratory whoop and/or vomiting (or apnea) after coughs. The demographic data and vaccination history of the patients were recorded. During the initial examination, samples were taken from the posterior nasopharynx for Bordetella pertussis (B. pertussis) culture and PCR analysis. In order to determine antibody positivity and antibody levels against B. pertussis antigens, serum samples were taken during the initial examination (acute phase) and two weeks later (convalescent phase). In the first serum sample, immunoglobulin M (IgM) was determined against pertussis toxin. In the first and second samples, IgA and IgG antibodies were evaluated against pertussis toxin and filamentous hemagglutinin. Culture yielded negative results in all of the patients. PCR was positive in two cases (5.7%). In the PCR-positive patients, IgM, IgA and IgG type anti-pertussis antibodies were found to be positive in the first serum samples, and IgA and IgG antibodies were found to be positive in the second serum samples. Therefore, it was considered that serology could be as sensitive as PCR when type IgM, IgA and IgG antibodies were found to be positive against a minimum of two antigens of B. pertussis. In conclusion, both PCR and serologic tests--if evaluating all types of antibodies to a minimum of two antigens of B. pertussis obtained in both acute and convalescent sera--could be more sensitive than culture in the diagnosis of pertussis.

  4. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

    Science.gov (United States)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

    1998-01-01

    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  5. Ground Reaction Forces and Loading Rates Associated with Parkour and Traditional Drop Landing Techniques

    OpenAIRE

    Damien L. Puddle; Maulder, Peter S.

    2013-01-01

    Due to the relative infancy of Parkour there is currently a lack of empirical evidence on which to base specific technique instruction upon. The purpose of this study was to compare the ground reaction forces and loading rates involved in two Parkour landing techniques encouraged by local Parkour instructors and a traditional landing technique recommended in the literature. Ten male participants performed three different drop landing techniques (Parkour precision, Parkour roll, and traditiona...

  6. Chain extension and branching of poly(L-lactic acid produced by reaction with a DGEBA-based epoxy resin

    Directory of Open Access Journals (Sweden)

    2007-11-01

    Full Text Available Dicarboxylated poly(L-lactic acid (PLLA was synthesized by reacting succinic anhydride with L-lactic acid prepolymer prepared by melt polycondensation. PLLA and epoxy resin based on diglycidyl ether of bisphenol A (DGEBA copolymers were prepared by chain extension of dicarboxylated PLLA with DGEBA. Infrared spectra confirmed the formation of dicarboxylated PLLA and PLLA/DGEBA copolymer. Influences of reaction temperature, reaction time, and the amount of DGEBA on the molecular weight and gel content of PLLA/DGEBA copolymer were studied. The viscosity average molecular weight of PLLA/DGEBA copolymer reached 87 900 when reaction temperature, reaction time, and mol ratio of dicarboxylated PLLA to DGEBA is 150°C, 30 min, and 1:1 respectively, while gel content of PLLA/DGEBA copolymer is almost zero.

  7. Optical diagnostics of vascular reactions triggered by weak allergens using laser speckle-contrast imaging technique

    Energy Technology Data Exchange (ETDEWEB)

    Kuznetsov, Yu L; Kalchenko, V V [Department of Veterinary Resources, Weizmann Institute of Science, Rehovot, 76100 (Israel); Astaf' eva, N G [V.I.Razumovsky Saratov State Medical University, Saratov (Russian Federation); Meglinski, I V [N.G. Chernyshevsky Saratov State University, Saratov (Russian Federation)

    2014-08-31

    The capability of using the laser speckle contrast imaging technique with a long exposure time for visualisation of primary acute skin vascular reactions caused by a topical application of a weak contact allergen is considered. The method is shown to provide efficient and accurate detection of irritant-induced primary acute vascular reactions of skin. The presented technique possesses a high potential in everyday diagnostic practice, preclinical studies, as well as in the prognosis of skin reactions to the interaction with potentially allergenic materials. (laser biophotonics)

  8. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

    Science.gov (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

    2016-04-01

    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  9. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in wetlands, western Kenya: confirmation by polymerase chain reaction method.

    Science.gov (United States)

    Ohba, Shin-Ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; Sonye, Gorge; Minakawa, Noboru; Takagi, Masahiro

    2010-09-01

    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%). This study demonstrates that the polymerase chain reaction method can determine whether aquatic mosquito predators feed on An. gambiae s.l. larvae if the predators have undigested An. gambiae s.l. in their midgut or stomach. PMID:20939371

  10. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.;

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The...... selectivity of the assay was evaluated against 155 strains, including 32 E. coli O157, 38 E. coli non-O157, and 85 non-E. coli. It was shown to be highly inclusive (100%) and exclusive (100%). The assay has a 100% detection probability of approximately 2 x 10(3) cells per reaction....

  11. Application of the Charlesby model to the radiation-induced chain reaction cross-linking of oxirane functionalised polymers

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, Julian J. E-mail: julian.j.murphy@awe.co.uk; Jones, Richard G

    2001-01-01

    A range of copolymers containing styrene and epoxystyrene, when formulated with a photo-acid generator, undergo a cross-linking reaction by a chain reaction mechanism when exposed to high-energy radiation in an electron beam lithographic writing machine. The sensitivities of the formulations are shown to correlate with a simple kinetic model for the radiation chemistry of the system. Deductions about the nature of the cross-linking species have been made by comparing the behaviour of the epoxystyrene system with that observed for an epoxy novolac. (author)

  12. Enhanced protein electrophoresis technique for separating human skeletal muscle myosin heavy chain isoforms

    Science.gov (United States)

    Bamman, M. M.; Clarke, M. S.; Talmadge, R. J.; Feeback, D. L.

    1999-01-01

    Talmadge and Roy (J. Appl. Physiol. 1993, 75, 2337-2340) previously established a sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS-PAGE) protocol for separating all four rat skeletal muscle myosin heavy chain (MHC) isoforms (MHC I, IIa, IIx, IIb); however, when applied to human muscle, the type II MHC isoforms (Ila, IIx) are not clearly distinguished. In this brief paper we describe a modification of the SDS-PAGE protocol which yields distinct and consistent separation of all three adult human MHC isoforms (MHC I, IIa, IIx) in a minigel system. MHC specificity of each band was confirmed by Western blot using three monoclonal IgG antibodies (mAbs) immunoreactive against MHCI (mAb MHCs, Novacastra Laboratories), MHCI+IIa (mAb BF-35), and MHCIIa+IIx (mAb SC-71). Results provide a valuable SDS-PAGE minigel technique for separating MHC isoforms in human muscle without the difficult task of casting gradient gels.

  13. Ideal-observer computation in medical imaging with use of Markov-chain Monte Carlo techniques

    Science.gov (United States)

    Kupinski, Matthew A.; Hoppin, John W.; Clarkson, Eric; Barrett, Harrison H.

    2003-03-01

    The ideal observer sets an upper limit on the performance of an observer on a detection or classification task. The performance of the ideal observer can be used to optimize hardware components of imaging systems and also to determine another observer's relative performance in comparison with the best possible observer. The ideal observer employs complete knowledge of the statistics of the imaging system, including the noise and object variability. Thus computing the ideal observer for images (large-dimensional vectors) is burdensome without severely restricting the randomness in the imaging system, e.g., assuming a flat object. We present a method for computing the ideal-observer test statistic and performance by using Markov-chain Monte Carlo techniques when we have a well-characterized imaging system, knowledge of the noise statistics, and a stochastic object model. We demonstrate the method by comparing three different parallel-hole collimator imaging systems in simulation.

  14. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

    Directory of Open Access Journals (Sweden)

    Kosuke Nakamura

    2016-06-01

    Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  15. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    OpenAIRE

    T. M. Nabeel Muhammad; Sreedevi, B.

    2015-01-01

    Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR) was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasa...

  16. Transgenes monitoring in an industrial soybean oil processing by conventional and real-time polymerase chain reaction

    OpenAIRE

    Costa, J; Mafra, I; Amaral, J S; Oliveira, M. B. P. P.

    2009-01-01

    In recent years a great effort has been devoted to the development of new methods for the qualitative and quantitative detection of transgenic sequences in food. Most of the developed analytical methods for GMO detection are DNA-based, since protein-based assays are not suitable for processed food. For that purpose, polimerase chain reaction (PCR) and real-time quantitative PCR have been successfully applied. Since the approval of Roundup Ready (RR) soybean in Europe, the production of soybea...

  17. Rapid Detection/pathotyping of Newcastle disease virus isolates in clinical samples using real time polymerase chain reaction assay

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Abdul Wajid, Muhammad Wasim, Tahir Yaqub, Shafqat F Rehmani, Tasra Bibi, Nadia Mukhtar, Javed Muhammad, Umar Bacha, Suliman Qadir Afridi, Muhammad Nauman Zahid, Zia u ddin, Muhammad Zubair Shabbir, Kamran Abbas & Muneer Ahmad ### Abstract In the present protocol we describe the real time reverse transcription polymerase chain reaction (rRT-PCR) assay for the rapid detection/pathotyping of Newcastle disease virus (NDV) isoaltes in clinical samples. Fusion gene and matrix ...

  18. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    OpenAIRE

    Camila Ximenes; Eduardo Brandão; Paula Oliveira; Abraham Rocha; Tamisa Rego; Rafael Medeiros; Ana Aguiar-Santos; João Ferraz; Christian Reis; Paulo Araujo; Luiz Carvalho; Melo, Fabio L

    2014-01-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuche...

  19. Fite-Faraco staining in combination with multiplex polymerase chain reaction: A new approach to leprosy diagnosis

    OpenAIRE

    Abu Hena Hasanoor Reja; Nibir Biswas; Supratik Biswas; Sarbani Dasgupta; Imran Hussain Chowdhury; Surajita Banerjee; Tapas Chakraborty; Pijush Kumar Dutta; Basudev Bhattacharya

    2013-01-01

    Background: Leprosy is not always an easy disease to diagnose, and patients can remain undiagnosed for longtime, not only at the peripheral clinics but also even at places with higher medical facilities, so, there is an urgent need for rapid and definitive modalities for leprosy diagnosis. This prospective study evaluates the ability of Fite-Faraco staining (FF staining) and multiplex polymerase chain reaction (PCR) over hematoxylin and eosin staining (H and E staining) and Ziehl-Neelsen stai...

  20. Allele-specific duplex polymerase chain reaction to differentiate Mycobacterium abscessus subspecies and to detect highly clarithromycin-resistant isolates.

    Science.gov (United States)

    Kim, H Y; Lee, S Y; Kim, B J; Kook, Y H

    2016-01-01

    On the basis of the structural differences of erm, we used a duplex polymerase chain reaction (PCR) to differentiate Mycobacterium abscessus subsp. abscessus and subsp. massiliense isolates and to detect the point mutations of 23S rRNA gene that confer a high level of resistance to clarithromycin. Subsp. massiliense strains occupying almost half of the clinical isolates can be simply identified, and their clarithromycin susceptibility can be rapidly determined. PMID:27514964

  1. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction.

    OpenAIRE

    Lunkenheimer, K; Hufert, F. T.; Schmitz, H.

    1990-01-01

    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specim...

  2. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase

    OpenAIRE

    Diaz, R S; Sabino, E. C.

    1998-01-01

    For certain applications of the polymerase chain reaction (PCR), it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq) DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We use...

  3. Viral etiology of respiratory infections in children in southwestern Saudi Arabia using multiplex reverse-transcriptase polymerase chain reaction

    OpenAIRE

    Al-Ayed, Mohamed S.; Asaad, Ahmed M; Qureshi, Mohamed A.; Ameen, Mohammed S.

    2014-01-01

    Objectives: To investigate 15 respiratory viruses in children with acute respiratory tract infections (ARTIs) using multiplex reverse-transcriptase polymerase chain reaction (RT-PCR), and to analyze the clinical and epidemiological features of these viruses. Methods: In a cross-sectional study, 135 children, ≤5 years of age who presented with ARTIs in Najran Maternity and Children Hospital, Najran, Saudi Arabia between October 2012 and July 2013 were included. The clinical and sociodemographi...

  4. Pilot Study of COBAS PCR and Ligase Chain Reaction for Detection of Rectal Infections Due to Chlamydia trachomatis

    OpenAIRE

    Matthew R Golden; Astete, Sabina G.; Galvan, Rosa; Lucchetti, Aldo; Sanchez, Jorge; Celum, Connie L.; Whittington, William L. H.; Stamm, Walter E.; Holmes, King K.; Totten, Patricia A.

    2003-01-01

    We tested rectal specimens from men who have sex with men for Chlamydia trachomatis by using COBAS PCR (Roche Diagnostics) and ligase chain reaction LCR (Abbott laboratories) and compared three PCR specimen-processing procedures. Chlamydiae were detected by one or more procedures in 22 of 186 specimens. All three PCR tests were positive for 17 specimens, all of which also tested positive by LCR.

  5. Differentiation of Neisseria gonorrhoeae strains by polymerase chain reaction and restriction fragment length polymorphism of outer membrane protein IB genes.

    OpenAIRE

    Lau, Q C; Chow, V T; Poh, C. L.

    1995-01-01

    OBJECTIVES--To employ polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis for the rapid differentiation of Neisseria gonorrhoeae protein IB (PIB) isolates and to compare its usefulness with the widely accepted auxotype/serovar classification scheme. METHODS--The outer membrane protein IB genes of 47 gonococcal isolates belonging to 10 different serovars were amplified by PCR. The approximately 1 kb DNA products were then digested separately with restri...

  6. Value of Candida polymerase chain reaction and vaginal cytokine analysis for the differential diagnosis of women with recurrent vulvovaginitis.

    OpenAIRE

    Stephanie Weissenbacher; Witkin, Steven S.; Vera Tolbert; Paulo Giraldo; Iara Linhares; Andrea Haas; E. Rainer Weissenbacher; Ledger, William J.

    2000-01-01

    Objectives: Recurrent vulvovaginitis remains difficult to diagnose accurately and to treat. The present investigation evaluated the utility of testing vaginal specimens from women with symptomatic recurrent vulvovaginitis for Candida species by polymerase chain reaction (PCR) and for cytokine responses.Methods: Sixty-one consecutive symptomatic women with pruritus, erythema, and/or a thick white discharge and a history of recurrent vulvovaginitis and 31 asymptomatic women with no such history...

  7. Identification of the origin of marker chromosomes by two-color fluorescence in situ hybridization and polymerase chain reaction in azoospermic patients.

    Science.gov (United States)

    Wei, C L; Cheng, J L; Yang, W C; Li, L Y; Cheng, H C; Fu, J J

    2015-11-19

    Y chromosomal microdeletions at the azoospermia factor locus and chromosome abnormalities have been implicated as the major causes of idiopathic male infertility. A marker chromosome is a structurally abnormal chromosome in which no part can be identified by cytogenetics. In this study, to identify the origin of the marker chromosomes and to perform a genetic diagnosis of patients with azoospermia, two-color fluorescence in situ hybridization (FISH) and polymerase chain reaction (PCR) techniques were carried out. The marker chromosomes for the two patients with azoospermia originated in the Y chromosome; it was ascertained that the karyotype of both patients was 46,X, ish del(Y)(q11)(DYZ3+, DXZ1-). The combination of two-color FISH and PCR techniques is an important method for the identification of the origin of marker chromosomes. Thus, genetic counseling and a clear genetic diagnosis of patients with azoospermia before intracytoplasmic sperm injection or other clinical managements are important.

  8. Comparison of bacterial culture and polymerase chain reaction (PCR) for the detection of F. tularensis subsp. holarctica in wild animals.

    Science.gov (United States)

    Sting, Reinhard; Runge, Martin; Eisenberg, Tobias; Braune, Silke; Müller, Wolfgang; Otto, Peter

    2013-01-01

    Detection of the zoonotic pathogen Francisella tularensis subsp. holarctica (EF tularensis) in wild animals with culture techniques as well as polymerase chain reaction were compared and discussed on the basis of the investigation of 60 animals. The samples originated from 55 European brown hares (Lepus europaeus), two red foxes (Vulpes vulpes) and one each from a wild rabbit (Oryctolagus cuniculus), a European beaver (Castor fiber), and a lemur (Lemur catta). When comparing the growth of 28 F. tularensis isolates on the cysteine blood agar and the modified Martin-Lewis-agar used in this study, cultivation was successful for 26 isolates on both media, but for two isolates only on the cysteine blood agar. Out of 43 carcasses 19 tested positive in bacteriological culture and PCR. Two culture positive samples of tonsils originating from foxes could not be confirmed by PCR, although PCR was positive in 22 samples that missed growth of F. tularensis. Comparative studies on cultural detection of E. tularensis were performed on samples of 16 hares from lung, spleen, liver and gut and in one case with a peritoneal swab. In at least one of these localizations cultivation of the pathogen was successful. Detection rate was reduced to 94% (15 of 16 hares) considering only the results of the cultures of the lungs and spleens. For a sensitive and rapid detection of F. tularensis subsp. holarctica, the PCR is a suitable method thereby avoiding hazardous multiplying of the pathogen. However, cultivation of F. tularensis is often a prerequisite for further studies on antibiotic resistance patterns of the pathogen, molecular epidemiological and pathological analyses of tularaemia.

  9. Quantitative Detection of Interleukin 8 Gene Expression in Lung Cancer by Real-time Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    JianzhongSu; QianggangDong; JinsuHuang; GuoliangBao

    2004-01-01

    OBJECTIVE To develop a method for absolute quantification of interleukin 8 (IL-8) mRNA by using real-time polymerase chain reaction (PCR). METHODS The IL-8 mRNA and protein expression in 2 human lung cancer cell lines, H460 and A549, were evaluated by real-time PCR and ELISA. The IL-8 mRNA expression in 9 cases of normal lung tissue and 44 cases of non-small cell lung cancer (NSCLC) were examined. RESULTS The IL-8 mRNA copy number in a given sample can be measured by real-time PCR. The gene expression of IL-8 is correlated with its protein secretion. The normalized value of IL-8 expression was 4.87+1.69 (copies/104 GAPDH copies) in normal lung tissue and 17.04±23.96 in NSCLC, respectively. The difference between these two groups is statistically significant (P=0.002). Using 9.74 and 19.48 as cut-off points for positive expression and overexpression of IL-8, 52.3%(23/44cases) of NSCLC were found to express an increased level of IL-8, among which 29.5% (13/44cases) were defined as positive expression and 22.7% (10/44cases) as overexpression. Statistical analysis indicated that IL-8 overexpression was significantly increased in female cancers, squamous carcinoma, and in late stages of disease (P<0.05). CONCLUSION The IL-8 gene expression can be determined by a real-time PCR technique. IL-8 overexpression is correlated with gender, histopathology and stages of the disease.

  10. Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

    Directory of Open Access Journals (Sweden)

    Arbefeville S

    2015-09-01

    Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

  11. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes

    Science.gov (United States)

    Thabit, Abrar K; Nicolau, David P

    2016-01-01

    Background Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated. Aim We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day), length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting. Methods Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest. Results The most common ribotypes were 027 (38%), 014/020 (21%), and 106/174 (21%). Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2). The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively). Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6). Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters), although the degree of nausea/vomiting did not differ between the three groups (P=0.3). A serum creatinine level ≥1.5 times the premorbid level was seen in only three patients, each infected with a different ribotype. Conclusion Although these data provide a baseline assessment of outcomes to aid in the design of future studies, the diversity of C. difficile ribotypes within the population must be considered, and additional work with other ribotypes

  12. Early detection of Brucella canis via quantitative polymerase chain reaction analysis.

    Science.gov (United States)

    Kauffman, L K; Bjork, J K; Gallup, J M; Boggiatto, P M; Bellaire, B H; Petersen, C A

    2014-02-01

    Canine brucellosis is a reportable zoonotic disease that can lead to canine reproductive losses and human infection through contact with infected urine or other genitourinary secretions. Although many locations require testing and euthanasia of positive dogs, current diagnosis is limited by the time required for seroconversion, for example, presence of B. canis-specific antibodies. The goal of this study was to determine the diagnostic ability of Brucella canis-specific quantitative polymerase chain reaction (qPCR) assay to detect B. canis in field samples prior to serological positivity for faster diagnosis and prevention of transmission within kennels or in households. Two kennels, one of which was located in the owner's home, were sampled following observation of suggestive clinical signs and positive serology of at least one dog. Specimens obtained were comparatively analysed via serology and qPCR analysis. 107 dogs were analysed for B. canis infection via qPCR: 105 via whole-blood samples, 65 via vaginal swab, six via urine and seven via genitourinary tract tissue taken at necropsy. Forty-five dogs were found to be infected with canine brucellosis via qPCR, of which 22 (48.89%) were seropositive. A statistically significant number (P = 0.0228) of qPCR-positive dogs, 5/25 (20.00%), seroconverted within a 30-day interval after initial serologic testing. As compared to serology, qPCR analysis of DNA from vaginal swabs had a sensitivity of 92.31% and specificity of 51.92%, and qPCR analysis of DNA from whole-blood samples had a sensitivity of 16.67% and specificity of 100%. B. canis outer membrane protein 25 DNA qPCR from non-invasive vaginal swab and urine samples provided early detection of B. canis infection in dogs prior to detection of antibodies. This assay provides a critical tool to decrease zoonotic spread of canine brucellosis, its associated clinical presentation(s), and emotional and economic repercussions.

  13. [Comparison of direct microscopy, culture and polymerase chain reaction methods for the diagnosis of cutaneous leishmaniasis].

    Science.gov (United States)

    Ertabaklar, Hatice; Özlem Çalışkan, Serçin; Boduç, Erengül; Ertuğ, Sema

    2015-01-01

    Cutaneous leishmaniasis (CL) is an endemic disease especially in Southeastern Anatolia of Turkey and recently shows a trend for spread to other regions of the country including the Aegean region. The diagnosis of CL is based on combined evaluation of epidemiological data with the clinical symptoms and laboratory findings. Direct microscopic examination and culture methods are mainly used in the routine diagnosis of CL, while molecular methods are mainly used for research. The aim of this study was to detect the presence of Leishmania spp. in samples obtained from CL-suspected patients by using direct microscopy, culture and polymerase chain reaction (PCR) methods and to compare the results. A total of 55 patients who were admitted to Parasitology Laboratory of Adnan Menderes University Hospital, Aydin (located at Aegean region in Turkey), between 2012-2014 were included in the study. Smear preparations from the skin lesions of cases were fixed and stained with Giemsa, and the presence of amastigote forms were evaluated by direct microscopy. NNN medium was used for the cultivation of samples. Total genomic DNA of Leishmania from the samples were extracted with a commercial kit (NucleoSpin Tissue(®) Kit, Macherey-Nagel, Germany) and PCR was performed by using 13A and 13B primers to amplify the 116 base pair fragment of Leishmania spp. specific kinetoplast DNA. Amastigotes were observed in 29 (53%) of the 55 samples by direct microscopy, promastigotes were detected among 34 (62%) samples in culture, and parasite-specific amplicons were revealed in 30 (55%) samples by PCR. All assays were positive in 24 patients while in 18 patients all of the tests yielded negative results. Thirty-seven (67%) out of 55 cases were diagnosed as CL when reactivity in at least one of these three methods were considered as positive. Accordingly the positivity rates of the methods were 78.4% (29/37) for direct microscopy, 92% (34/37) for culture and 81.1% (30/37) for PCR in CL

  14. Nanoscale superstructures assembled by polymerase chain reaction (PCR): programmable construction, structural diversity, and emerging applications.

    Science.gov (United States)

    Kuang, Hua; Ma, Wei; Xu, Liguang; Wang, Libing; Xu, Chuanlai

    2013-11-19

    Polymerase chain reaction (PCR) is an essential tool in biotechnology laboratories and is becoming increasingly important in other areas of research. Extensive data obtained over the last 12 years has shown that the combination of PCR with nanoscale dispersions can resolve issues in the preparation DNA-based materials that include both inorganic and organic nanoscale components. Unlike conventional DNA hybridization and antibody-antigen complexes, PCR provides a new, effective assembly platform that both increases the yield of DNA-based nanomaterials and allows researchers to program and control assembly with predesigned parameters including those assisted and automated by computers. As a result, this method allows researchers to optimize to the combinatorial selection of the DNA strands for their nanoparticle conjugates. We have developed a PCR approach for producing various nanoscale assemblies including organic motifs such as small molecules, macromolecules, and inorganic building blocks, such as nanorods (NRs), metal, semiconductor, and magnetic nanoparticles (NPs). We start with a nanoscale primer and then modify that building block using the automated steps of PCR-based assembly including initialization, denaturation, annealing, extension, final elongation, and final hold. The intermediate steps of denaturation, annealing, and extension are cyclic, and we use computer control so that the assembled superstructures reach their predetermined complexity. The structures assembled using a small number of PCR cycles show a lower polydispersity than similar discrete structures obtained by direct hybridization between the nanoscale building blocks. Using different building blocks, we assembled the following structural motifs by PCR: (1) discrete nanostructures (NP dimers, NP multimers including trimers, pyramids, tetramers or hexamers, etc.), (2) branched NP superstructures and heterochains, (3) NP satellite-like superstructures, (4) Y-shaped nanostructures and DNA

  15. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes

    Directory of Open Access Journals (Sweden)

    Thabit AK

    2016-06-01

    Full Text Available Abrar K Thabit,1,2 David P Nicolau1,3 1Center for Anti-Infective Research and Development, Hartford Hospital, Hartford, CT, USA; 2Faculty of Pharmacy, King Abdulaziz University, Jeddah, Saudi Arabia; 3Division of Infectious Diseases, Hartford Hospital, Hartford, CT, USA Background: Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated.Aim: We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day, length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting.Methods: Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest.Results: The most common ribotypes were 027 (38%, 014/020 (21%, and 106/174 (21%. Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2. The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively. Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6. Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters, although the degree of nausea/vomiting did not differ between the three groups (P=0.3. A serum creatinine level ≥1.5 times the premorbid level was seen in only three

  16. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene.

    Science.gov (United States)

    Brakstad, O G; Aasbakk, K; Maeland, J A

    1992-07-01

    Synthetic oligonucleotide primers of 21 and 24 bases, respectively, were used in the polymerase chain reaction (PCR) to amplify a sequence of the nuc gene, which encodes the thermostable nuclease of Staphylococcus aureus. A DNA fragment of approximately 270 bp was amplified from lysed S. aureus cells or isolated DNA. The PCR product was detected by agarose gel electrophoresis or Southern blot analysis by using a 33-mer internal nuc gene hybridization probe. With S. aureus cells the lower detection limit was less than 10 CFU, and with the isolated target the lower detection limit was 0.69 pg of DNA. The primers recognized 90 of 90 reference or clinical S. aureus strains. Amplification was not recorded when 80 strains representing 16 other staphylococcal species were tested or when 20 strains representing 9 different nonstaphylococcal species were tested. Some of the non-S. aureus staphylococci produced thermostable nucleases but were PCR negative. The PCR product was generated when in vitro-cultured S. aureus was used to prepare simulated clinical specimens of blood, urine, cerebrospinal fluid, or synovial fluid. No PCR product was generated when the sterile body fluids were tested. However, the sensitivity of the PCR was reduced when S. aureus in blood or urine was tested in comparison with that when bacteria in saline were tested. With the bacteria in blood, the detection limit of the PCR was 10(3) CFU. A positive PCR result was recorded when a limited number of clinical samples from wounds verified to be infected with S. aureus were tested, while the PCR product was not detected in materials from infections caused by other bacteria. Generation of PCR products was not affected by exposure of S. aureus to bactericidal agents, including cloxacillin and gentamicin, prior to testing, but was affected by exposure to UV radiation. The PCR for amplification of the nuc gene has potential for the rapid diagnosis of S. aureus infections by direct testing of clinical

  17. Detection of food hazards in foods: comparison of real time polymerase chain reaction and cultural methods

    Directory of Open Access Journals (Sweden)

    Paolo Bonilauri

    2016-01-01

    Full Text Available Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples

  18. [Development of a real-time polymerase chain reaction method for the identification of Candida species].

    Science.gov (United States)

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza

    2015-01-01

    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  19. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    Science.gov (United States)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  20. STUDY ON CO-CURING REACTION IN CHAIN PROLONGED BISMALEIMIDE-UNSATURATED POLYMER RESIN SYSTEM

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The curing process of chemical reacton between flexible unsaturated polymer resin and diphenylmethane bismaleimides which have been chain-prolonged by diaminodiphenylmethane is presented, also the kinetics parameters and curing technology are investigated.

  1. Dynamical Models for NGC 6503 using a Markov Chain Monte Carlo Technique

    CERN Document Server

    Puglielli, David; Courteau, Stéphane

    2010-01-01

    We use Bayesian statistics and Markov chain Monte Carlo (MCMC) techniques to construct dynamical models for the spiral galaxy NGC 6503. The constraints include surface brightness profiles which display a Freeman Type II structure; HI and ionized gas rotation curves; the stellar rotation, which is nearly coincident with the ionized gas curve; and the line of sight stellar dispersion, with a sigma-drop at the centre. The galaxy models consist of a Sersic bulge, an exponential disc with an optional inner truncation and a cosmologically motivated dark halo. The Bayesian/MCMC technique yields the joint posterior probability distribution function for the input parameters. We examine several interpretations of the data: the Type II surface brightness profile may be due to dust extinction, to an inner truncated disc or to a ring of bright stars; and we test separate fits to the gas and stellar rotation curves to determine if the gas traces the gravitational potential. We test each of these scenarios for bar stability...

  2. Decomposition of ozone in water in the presence of organic solutes acting as promoters and inhibitors of radical chain reactions

    Energy Technology Data Exchange (ETDEWEB)

    Staehelin, J.; Hoigne, J.

    1985-12-01

    The decomposition of aqueous ozone is generally due to a chain reaction involving .OH radicals. Many organic solutes (impurities) can react with .OH to yield .O/sub 2//sup -/ upon addition of O/sub 2/. .O/sub 2//sup -/ transfers its electron to a further ozone molecule in a rather selective reaction. The ozonide anion (.O/sub 3//sup -/) formed immediately decomposes into a further .OH radical. Compounds that convert .OH radicals into ozone-selective .O/sub 2//sup -/, therefore, act as promoters of the chain reaction. The efficiencies of different .OH to .O/sub 2//sup -/ converters (e.g., formic acid, primary and secondary alcohols (including sugars), glyoxylic acid, and humic acids) are tested in the presence of other .OH radical scavengers that do not primarily produce .O/sub 2//sup -/ (carbonate, aliphatic alkyl compounds, and tert-butyl alcohol). The derived reaction kinetics allows one to qualitatively interpret the variation of the lifetime of O/sub 3/ found in model solutions and even in natural waters and during drinking water treatment.

  3. Dispersion quality of amine functionalized multiwall carbon nanotubes plays critical roles in polymerase chain reaction enhancement

    Energy Technology Data Exchange (ETDEWEB)

    Yuce, Meral, E-mail: meralyuce@sabanciuniv.edu; Budak, Hikmet [Sabanci University, Nanotechnology Research and Application Centre (Turkey)

    2014-12-15

    Impact of dispersion quality of NH{sub 2}-MWCNTs (13–18 nm in diameter with a length between 1 and 12 µm, >99 % purity) in the amplification efficiency of a random DNA oligonucleotide library (96 bp) was investigated. Amplification yield in the presence of non-filtered NH{sub 2}-MWCNT dispersion, filtered NH{sub 2}-MWCNT dispersion and surface-attached NH{sub 2}-MWCNTs was explored, and physical interactions between NH{sub 2}-MWCNTs and major PCR reagents including DNA template, wild type Taq DNA polymerase enzyme and primers were determined using high resolution polyacrylamide gel electrophoresis, dynamic light scattering, UV–Vis-NIR spectroscopy and scanning electron microscopy techniques. The results revealed that presence of NH{sub 2}-MWCNT dispersion which was sonicated, centrifuged and filtered, enhanced the total PCR efficiency up to 70 % while the presence of NH{sub 2}-MWCNT only centrifuged after sonication, inhibited the reaction significantly at similar concentrations. Furthermore, the NH{sub 2}-MWCNTs coupled covalently onto magnetic microspheres, contributed for the specificity enhancement whilst decreasing the amplification efficiency by 30 % at the maximum concentration, which suggests a removable enhancement system for sensitive applications. On the other hand, the relative hydrodynamic size distribution measurements displayed a clear difference between the filtered NH{sub 2} and non-filtered NH{sub 2}-MWCNT water dispersions, which justifies the inhibition of the amplification by the non-filtered NH{sub 2}-MWCNTs containing big agglomerates and bundles. Finally, we demonstrated that major PCR components adsorb onto the NH{sub 2}-MWCNTs with diverse affinities, and maintain their functions after adsorption, which provides a good framework to further develop tunable NH{sub 2}-MWCNT-carriers to be utilized in various nanobiotechnology and material science applications.

  4. Polymerase chain reaction and Southern blot-based analysis of the C9orf72 hexanucleotide repeat in different motor neuron diseases.

    Science.gov (United States)

    Hübers, Annemarie; Marroquin, Nicolai; Schmoll, Birgit; Vielhaber, Stefan; Just, Marlies; Mayer, Benjamin; Högel, Josef; Dorst, Johannes; Mertens, Thomas; Just, Walter; Aulitzky, Anna; Wais, Verena; Ludolph, Albert C; Kubisch, Christian; Weishaupt, Jochen H; Volk, Alexander E

    2014-05-01

    The GGGGCC-hexanucleotide repeat expansion in C9orf72 is the most common genetic cause of familial amyotrophic lateral sclerosis and frontotemporal dementia. This study determined the frequency of C9orf72 repeat expansions in different motor neuron diseases (amyotrophic lateral sclerosis (ALS), motor neuron diseases affecting primarily the first or the second motor neuron and hereditary spastic paraplegia). Whereas most studies on C9orf72 repeat expansions published so far rely on a polymerase chain reaction-based screening, we applied both polymerase chain reaction-based techniques and Southern blotting. Furthermore, we determined the sensitivity and specificity of Southern blotting of the C9orf72 hexanucleotide repeat in DNA derived from lymphoblastoid cell lines. C9orf72 repeat expansions were found in 27.1% out of 166 familial ALS patients, only once in 68 sporadic ALS patients, and not in 61 hereditary spastic paraplegia patients or 52 patients with motor neuron diseases affecting clinically primarily either the first or the second motor neuron. We found hints for a correlation between C9orf72 repeat length and the age of onset. Somatic instability of the C9orf72 repeat was observed in lymphoblastoid cell lines compared with DNA derived from whole blood from the same patient and therefore caution is warranted for repeat length determination in immortalized cell lines.

  5. The 1,3-dipolar cycloaddition reaction of chiral carbohydrate-derived nitrone and olefin: towards long-chain sugars.

    Science.gov (United States)

    Oukani, Hassan; Pellegrini-Moïse, Nadia; Jackowski, Olivier; Chrétien, Françoise; Chapleur, Yves

    2013-11-15

    The thermal and microwave-activated 1,3-dipolar cycloadditions of several α,β-unsaturated esters derived from d-mannose and chiral nitrones derived from threitol have been studied as a model reaction en route to eleven carbon long chain carbohydrates. Very high facial selectivity is observed for the chiral nitrones whereas the olefin facial selectivity varies with the substrate. The presence of a dioxolane ring α to the olefinic bond is beneficial to the facial selectivity of the olefin whereas a pyranose ring is not. The combination of a d-mannose derivative and a l-threitol-derived nitrone is a matched pair suitable for the synthesis of long chain sugars with nine contiguous chiral centres. Finally complete facial selectivity was observed with exo-glycals which gave a single cycloadduct.

  6. Indirect measurements of reactions in hot p-p chain and CNO cycles

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Y. B.; Guo, B.; Jin, S. J.; Li, Z. H.; Binh, D. N.; Hashimoto, H.; Hayakawa, S.; He, J. J.; Hu, J.; Iwasa, N.; Kahl, D. M.; Kubono, S.; Kume, N.; Li, E. T.; Li, Y. J.; Liu, X.; Su, J.; Xu, S. W.; Yamaguchi, H.; Yan, S. Q. [China Institute of Atomic Energy, PO Box 275 (10), Beijing 102413 (China); Center for Nuclear Study, University of Tokyo, Wako (Japan); Institute of Modern Physics, China Academy of Sciences, Lanzhou (China); Department of Physics, Tohoku university, Sendai (Japan); Center for Nuclear Study, University of Tokyo, Wako (Japan); Department of Physics, Tohoku university, Sendai (Japan); China Institute of Atomic Energy, PO Box 275 (10), Beijing 102413 (China); Institute of Modern Physics, China Academy of Sciences, Lanzhou (China); Center for Nuclear Study, University of Tokyo, Wako (Japan); China Institute of Atomic Energy, PO Box 275 (10), Beijing 102413 (China); and others

    2012-11-12

    Several reactions have been experimentally studied, including the {sup 12}N(d,n){sup 13}O and the ones induced by the {sup 3}He+{sup 12}C entrance channel. The former was carried out at the CRIB facility of University of Tokyo, aiming to indirectly determine the astrophysical reaction rates of the {sup 12}N(p,{gamma}){sup 13}O reaction. For the {sup 3}He+{sup 12}C entrance channel, many excited states of several nuclei are populated and the angular distribution of each state is being analyzed.

  7. A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte;

    We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

  8. GROUND REACTION FORCES AND LOADING RATES ASSOCIATED WITH PARKOUR AND TRADITIONAL DROP LANDING TECHNIQUES

    Directory of Open Access Journals (Sweden)

    Damien L. Puddle

    2013-03-01

    Full Text Available Due to the relative infancy of Parkour there is currently a lack of empirical evidence on which to base specific technique instruction upon. The purpose of this study was to compare the ground reaction forces and loading rates involved in two Parkour landing techniques encouraged by local Parkour instructors and a traditional landing technique recommended in the literature. Ten male participants performed three different drop landing techniques (Parkour precision, Parkour roll, and traditional onto a force plate. Compared to the traditional technique the Parkour precision technique demonstrated significantly less maximal vertical landing force (38%, p < 0.01, ES = 1.76 and landing loading rate (54%, p < 0.01, ES = 1.22. Similarly, less maximal vertical landing force (43%, p < 0.01, ES = 2.04 and landing loading rate (63%, p < 0.01, ES = 1.54 were observed in the Parkour roll technique compared to the traditional technique. It is unclear whether or not the Parkour precision technique produced lower landing forces and loading rates than the Parkour roll technique as no significant differences were found. The landing techniques encouraged by local Parkour instructors such as the precision and roll appear to be more appropriate for Parkour practitioners to perform than a traditional landing technique due to the lower landing forces and loading rates experienced

  9. Evaluation of polymerase chain reaction for the detection of Paracoccidioides brasiliensis DNA on serum samples from patients with paracoccidioidomycosis

    Directory of Open Access Journals (Sweden)

    Cecília Eugenia Charbel

    2006-03-01

    Full Text Available The aim of this study was to demonstrate the DNA of Paracoccidioides brasiliensis in human serum samples of patients with paracoccidioidomycosis using the polymerase chain reaction (PCR. The diagnosis of paracoccidioidomycosis (PCM was defined by microscopic observation of the fungus on direct exam or histopathology, culture, and serological positivity. DNA from serum of 33 patients with PCM was extracted and submitted to nested-PCR using primers from the gp 43 gene. Only one sample was positive on nested-PCR. We conclude that the prevalence of fungemia in patients with different clinical forms of PCM is low, limiting the use of serum DNA detection as an alternative diagnostic tool.

  10. Identification of co-occurring Branchinecta fairy shrimp species from encysted embryos using multiplex polymerase chain reaction

    Science.gov (United States)

    Vandergast, A.G.; Wood, D.A.; Simovich, M.; Bohonak, A.J.

    2009-01-01

    Morphological identification of many fairy shrimp species is difficult because distinguishing characters are restricted to adults. We developed two multiplex polymerase chain reaction assays that differentiate among three Branchinecta fairy shrimp with distributional overlap in southern California vernal pools. Two of the species are federally listed as threatened. Molecular identification of Branchinecta from cysts allows for species surveys to be conducted during the dry season, expanding the timeframe for population assessment and providing a less intrusive method of sampling sensitive vernal pool habitats. ?? Published 2009. This article is a US Government work and is in the public domain in the USA.

  11. Rapid detection of avian influenza virus in chicken fecal samples by immunomagnetic capture reverse transcriptase–polymerase chain reaction assay

    DEFF Research Database (Denmark)

    Dhumpa, Raghuram; Handberg, Kurt; Jørgensen, Poul Henrik;

    2011-01-01

    chain reaction (RT-PCR) without RNA extraction because of effective removal of RT-PCR inhibitors. The developed bead-based assay showed a similar detection limit comparable to the RNA extraction and the classic virus isolation method. Using ready-to-use antibody-conjugated bead, the method requires less....... In this study, magnetic beads were applied for immunoseparation and purification of AIV from spiked chicken fecal sample. The beads were conjugated with monoclonal antibodies against the AIV nucleoprotein, which is conserved in all the AIV. The bead-captured virus was detected by reverse transcriptase–polymerase...

  12. Escherichia coli Vertebral Osteomyelitis Diagnosed According to Broad-range 16S rRNA Gene Polymerase Chain Reaction (PCR).

    Science.gov (United States)

    Shibata, Satoshi; Tanizaki, Ryutaro; Watanabe, Koji; Makabe, Kenta; Shoda, Naoki; Kutsuna, Satoshi; Nagamatsu, Maki; Oka, Shinichi; Ohmagari, Norio

    2015-01-01

    Identifying the causative agent of pyogenic osteomyelitis is often challenging, especially when antibiotics are administered before a biopsy. We herein present a case of osteomyelitis in the cervical vertebrae presenting with progressive paralytic symptoms, in which we successfully identified Escherichia coli from a biopsy specimen using broad-range 16S rRNA gene polymerase chain reaction (PCR) even though sensitive antibiotics had been used for more than 50 days before the biopsy. Broad-range 16S rRNA gene PCR is a useful diagnostic method, especially when prebiopsy antibiotics are unavoidably used for a clinically unstable state.

  13. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    Science.gov (United States)

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola.

  14. Identifiability of parameters and behaviour of the MCMC chains: a case study using the reaction norm model

    DEFF Research Database (Denmark)

    Shariati, M M; Korsgaard, I R; Sorensen, D

    2009-01-01

    Markov chain Monte Carlo (MCMC) enables fitting complex hierarchical models that may adequately reflect the process of data generation. Some of these models may contain more parameters than can be uniquely inferred from the distribution of the data, causing non-identifiability. The reaction norm ...... of complex models where identifiability problems can be difficult to detect a priori. We conclude that it would be good practice to experiment with a proposed model and to understand its features before embarking on a full MCMC implementation...

  15. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    Science.gov (United States)

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  16. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) Larvae in Wetlands, Western Kenya: Confirmation by Polymerase Chain Reaction Method

    OpenAIRE

    Ohba, Shin-ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; SONYE, GORGE; Minakawa, Noboru; Takagi, Masahiro

    2010-01-01

    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%)....

  17. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in Wetlands, Western Kenya: Confirmation by polymerase chain reaction method

    OpenAIRE

    Ohba, Shin-ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; SONYE, GORGE; Minakawa, Noboru; Takagi, Masahiro

    2010-01-01

    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%)....

  18. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    Science.gov (United States)

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. PMID:26374912

  19. The first identification of a blood-sucking abomasal nematode Ashworthius sidemi in cattle (Bos taurus) using simple polymerase chain reaction (PCR).

    Science.gov (United States)

    Moskwa, Bożena; Bień, Justyna; Cybulska, Aleksandra; Kornacka, Aleksandra; Krzysiak, Michał; Cencek, Tomasz; Cabaj, Władysław

    2015-06-30

    A simple polymerase chain reaction (PCR) test was used to identify Ashworthius sidemi, a blood-sucking gastrointestinal nematode that commonly infects bison, red and roe deer, and moose in Poland. The present study uses this technique to confirm the possibility of transmission of A. sidemi infection from wildlife to domestic animals, such as cattle and sheep, grazing on the same natural pastures. A 406 bp fragment of genomic A. sidemi DNA was actually detected in DNA isolated from larval cultures derived from feces from cattle. A. sidemi DNA has been detected in cattle which represent a new host for this parasite. This is the first evidence of A. sidemi in cattle. The results reveal that a PCR test based on DNA from L3 larvae can be used for in vivo detection of A. sidemi invasions in breeding animals. In conclusion, the transfer of A. sidemi infection from wildlife to the farm animals sharing the same pastures appears possible.

  20. Survey of Leptospira spp in pampas deer (Ozotoceros bezoarticus in the Pantanal wetlands of the state of Mato Grosso do Sul, Brazil by serology and polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Anahí Souto Vieira

    2011-09-01

    Full Text Available This work reports a survey of Leptospira spp in pampas deer (Ozotoceros bezoarticus in the Pantanal wetlands of the state of Mato Grosso do Sul, Brazil by serology and polymerase chain reaction (PCR. Seventy pampas deer were captured in the dry season and surveyed using PCR, microscopic agglutination test (MAT (n = 51 and by both techniques (n = 47. PCR detected infections in two pampas deer and MAT detected infections in three. Through sequencing and phylogenetic analyses, the PCR-amplified fragment detected in deer was identified as Leptospira interrogans. Serovars Pomona and Butembo were detected using MAT and the highest titre was 200 for serovar Pomona. Epidemiological aspects of the findings are discussed.

  1. Droplet digital polymerase chain reaction assay for screening of ESR1 mutations in 325 breast cancer specimens.

    Science.gov (United States)

    Takeshita, Takashi; Yamamoto, Yutaka; Yamamoto-Ibusuki, Mutsuko; Inao, Toko; Sueta, Aiko; Fujiwara, Saori; Omoto, Yoko; Iwase, Hirotaka

    2015-12-01

    Droplet digital polymerase chain reaction (ddPCR), which could perform thousands of PCRs on a nanoliter scale simultaneously, would be an attractive method to massive parallel sequencing for identifying and studying the significance of low-frequency rare mutations. Recent evidence has shown that the key potential mechanisms of the failure of aromatase inhibitors-based therapy involve identifying activating mutations affecting the ligand-binding domain of the ESR1 gene. Therefore, the detection of ESR1 mutations may be useful as a biomarker predicting an effect of the treatment. We aimed to develop a ddPCR-based method for the sensitive detection of ESR1 mutations in 325 breast cancer specimens, in which 270 primary and 55 estrogen receptor-positive (ER+) metastatic breast cancer (MBC) specimens. Our ddPCR assay could detect the ESR1 mutant molecules with low concentration of 0.25 copies/μL. According to the selected cutoff, ESR1 mutations occurred in 7 (2.5%) of 270 primary breast cancer specimens and in 11 (20%) of 55 ER+ MBC specimens. Among the 11 MBC specimens, 5 specimens (45.5%) had the most common ESR1 mutation, Y537S, 4 specimens (36.3%) each had D538G, Y537N, and Y537C. Interestingly, 2 patients had 2 ESR1 mutations, Y537N/D538G and Y537S/Y537C, and 2 patients had 3 ESR1 mutations, Y537S/Y537N/D538G. Biopsy was performed in heterochrony in 8 women twice. In 8 women, 4 women had primary breast cancer and MBC specimens and 4 women had 2 specimens when treatment was failure. Four of these 8 women acquired ESR1 mutation, whereas no ESR1 mutation could be identified at first biopsy. ddPCR technique could be a promising tool for the next-generation sequencing-free precise detection of ESR1 mutations in endocrine therapy resistant cases and may assist in determining the treatment strategy.

  2. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    OpenAIRE

    Parvin Hassanzadeh; Hosein Sharifi; Abdollah Bazargani; Reza Khashei; Amir Emami; Mohammad Motamedifar

    2012-01-01

    Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain r...

  3. CREATING A CHAIN REACTION: THE COMPETITIVENESS OF THE AGRICULTURAL INPUT INDUSTRY IN SOUTH AFRICA

    OpenAIRE

    Esterhuizen, Dirk; van Rooyen, C.J.

    2001-01-01

    The South African agricultural industry is consistently challenged to increase its competitiveness. The agribusiness supply chain starts with the input sector. The objective of this paper is therefore to determine the competitiveness of the various agricultural input industries in South Africa by using Balassa's method of Revealed Comparative Trade Advantage. This status will then be related to performance of the agricultural industry as a whole. South African manufacturing of farming requisi...

  4. The constructive technique and its application in solving a nonlinear reaction diffusion equation

    Institute of Scientific and Technical Information of China (English)

    Lai Shao-Yong; Guo Yun-Xi; Qing Yin; Wu Yong-Hong

    2009-01-01

    A mathematical technique based on the consideration of a nonlinear partial differential equation together with an additional condition in the form of an ordinary differential equation is employed to study a nonlinear reaction diffusion equation which describes a real process in physics and in chemistry. Several exact solutions for the equation are acquired under certain circumstances.

  5. Detection of variable DNA repeats in diverse eukaryotic microorganisms by a single set of polymerase chain reaction primers.

    Science.gov (United States)

    Riley, D E; Samadpour, M; Krieger, J N

    1991-12-01

    We cloned and sequenced a variable DNA repeat from Trichomonas vaginalis, a flagellated protozoan parasite. Targeting of this repeat in the polymerase chain reaction resulted in complex and intense product patterns for a wide variety of eukaryotic microorganisms, including the pathogenic protozoan parasites T. vaginalis, Giardia lamblia, Leishmania donovani, three species of Trypanosoma, and four species of Acanthamoeba; the nonpathogenic protozoans, Paramecium tetraurelia and Tetrahymena thermophilia; and a yeast, Saccharomyces cerevisiae. Each microorganism exhibited a distinctive pattern of repeats. For example, a characteristic pattern was exhibited by six clinical T. vaginalis isolates. Eight G. lamblia isolates exhibited either one of two characteristic pattern types. There was no reaction with human DNA or DNA from the prokaryotes Ureaplasma urealyticum and Mycoplasma hominis. This approach may facilitate detection of a wide variety of eukaryotic microorganisms by use of a single primer set and holds promise for the development of typing schemes for both T. vaginalis and G. lamblia. PMID:1757544

  6. Multiple and high-throughput droplet reactions via combination of microsampling technique and microfluidic chip

    KAUST Repository

    Wu, Jinbo

    2012-11-20

    Microdroplets offer unique compartments for accommodating a large number of chemical and biological reactions in tiny volume with precise control. A major concern in droplet-based microfluidics is the difficulty to address droplets individually and achieve high throughput at the same time. Here, we have combined an improved cartridge sampling technique with a microfluidic chip to perform droplet screenings and aggressive reaction with minimal (nanoliter-scale) reagent consumption. The droplet composition, distance, volume (nanoliter to subnanoliter scale), number, and sequence could be precisely and digitally programmed through the improved sampling technique, while sample evaporation and cross-contamination are effectively eliminated. Our combined device provides a simple model to utilize multiple droplets for various reactions with low reagent consumption and high throughput. © 2012 American Chemical Society.

  7. Target-selective joint polymerase chain reaction: A robust and rapid method for high-throughput production of recombinant monoclonal antibodies from single cells

    Directory of Open Access Journals (Sweden)

    Isobe Masaharu

    2011-07-01

    Full Text Available Abstract Background During the development of a therapeutic antibody, large numbers of monoclonal antibodies are required to screen for those that are best suited for the desired activity. Although the single cell-based immunoglobulin variable gene cloning technique is a powerful tool, the current methods remain an obstacle to the rapid production of large numbers of recombinant antibodies. Results We have developed a novel overlap extension polymerase chain reaction, the target-selective joint polymerase chain reaction (TS-jPCR, and applied it to the generation of linear immunoglobulin gene expression constructs. TS-jPCR is conducted using a PCR-amplified immunoglobulin variable gene and an immunoglobulin gene-selective cassette (Ig-cassette that contains all essential elements for antibody expression and overlapping areas of immunoglobulin gene-specific homology. The TS-jPCR technique is simple and specific; the 3'-random nucleotide-tailed immunoglobulin variable gene fragment and the Ig-cassette are assembled into a linear immunoglobulin expression construct, even in the presence of nonspecifically amplified DNA. We also developed a robotic magnetic beads handling instrument for single cell-based cDNA synthesis to amplify immunoglobulin variable genes by rapid amplification of 5' cDNA ends PCR. Using these methods, we were able to produce recombinant monoclonal antibodies from large numbers of single plasma cells within four days. Conclusion Our system reduces the burden of antibody discovery and engineering by rapidly producing large numbers of recombinant monoclonal antibodies in a short period of time.

  8. Verification of liquid level in reaction vessels by using gamma-ray transmission techniques

    International Nuclear Information System (INIS)

    A case study was conducted to verify the liquid levels in four reaction vessels by using gamma-ray transmission techniques. The study was carried out at a petrochemical plant in Kuantan. Under normal practice, the level of the liquid inside the vessels is determined by using the permanently installed nuclear level gauge (Cs-137) and Geiger-Muller survey meter. The problem arises when a known quantity of liquid is pump into the reaction vessels does not tally with the reading from these readings. In turn this condition makes the product off-specification and surplus of expensive chemical liquid that will increase the production cost. The gamma-ray transmission technique was introduced to determine the actual level inside the vessel. This technique also used to verify the existing data and to calibrate the plant permanently installed nuclear gauge(Cs-137). (Author)

  9. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    Science.gov (United States)

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB.

  10. Polymerase Chain Reaction (PCR) Versus Bacterial Culture in Detection of Organisms in Otitis Media with Effusion (OME) in Children.

    Science.gov (United States)

    Aly, Balegh H; Hamad, Mostafa S; Mohey, Mervat; Amen, Sameh

    2012-03-01

    The aim of this study was to compare between polymerase chain reaction (PCR) and bacterial culture in detection of Streptococcus Pneumonia and M. Catarrhalis in otitis media with effusion (OME) in children. Fifty patients having OME were included in this study between 2003 and 2008. Myringotomy and tympanostomy tube insertion were done in every patient and the middle ear effusion samples were aspirated. The samples were subjected to bacteriological study in the form of culture and molecular study in the form of PCR using JM201/202-204 primer probe set for both S. pneumonia and M. catarrhalis. The results of Bacterial cultures are as follows: five cases (10%) were culture positive for S. pneumonia. Six cases (12%) were culture positive for M. catarrhalis. Only one case (2%) showed positively for both S. pneumonia and M. catarrhalis. Polymerase chain reaction test shows that 18 cases (36%) were positive for S. pneumonia, 22 cases (44%) were positive for M. catarrhalis, 6 cases (12%) were positive for both organism and 4 cases (8%) were negative. The difference between the proportion of culture positive and PCR positive specimens for both organisms individually and collectively was significant (P PCR is more accurate than bacterial culture in detection of organisms in middle ear fluid in OME and that M. catarrhalis plays a significant rule in OME as it is the sole organism identified more than the other one by PCR.

  11. A polymerase chain reaction assay for ascosporic inoculum of Sclerotinia species

    Science.gov (United States)

    A PCR assay was developed which amplified a 170-bp fragment of the intergenic spacer region of Sclerotinia sclerotiorum, the cause of white mould. Sensitivity was 10 S. sclerotiorum ascospores per DNA extraction (0.2 ascospores per PCR reaction). The presence of soil did not affect sensitivity a...

  12. Machine learning techniques for gait biometric recognition using the ground reaction force

    CERN Document Server

    Mason, James Eric; Woungang, Isaac

    2016-01-01

    This book focuses on how machine learning techniques can be used to analyze and make use of one particular category of behavioral biometrics known as the gait biometric. A comprehensive Ground Reaction Force (GRF)-based Gait Biometrics Recognition framework is proposed and validated by experiments. In addition, an in-depth analysis of existing recognition techniques that are best suited for performing footstep GRF-based person recognition is also proposed, as well as a comparison of feature extractors, normalizers, and classifiers configurations that were never directly compared with one another in any previous GRF recognition research. Finally, a detailed theoretical overview of many existing machine learning techniques is presented, leading to a proposal of two novel data processing techniques developed specifically for the purpose of gait biometric recognition using GRF. This book · introduces novel machine-learning-based temporal normalization techniques · bridges research gaps concerning the effect of ...

  13. Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting

    DEFF Research Database (Denmark)

    Atabay, H. I.; Bang, Dang Duong; Aydin, F.;

    2002-01-01

    Aims: The objective of this study was to subtype Arcobacter butzleri isolates using RAPD-PCR. Methods and Results: Thirty-five A. butzleri isolates obtained from chicken carcasses were examined. PCR-mediated DNA fingerprinting technique with primers of the variable sequence motifs was used...... found to be contaminated with several different strains of A. butzleri . RAPD-PCR technique was found to be a useful technique for distinguishing A. butzleri isolates. Significance and Impact of the Study: The presence of several different A. butzleri strains on chicken carcasses may indicate multiple...

  14. Side chain effects in reactions of the potassium-tyrosine charge transfer complex

    Science.gov (United States)

    da Silva, F. Ferreira; Meneses, G.; Ingólfsson, O.; Limão-Vieira, P.

    2016-10-01

    Fragmentation of transient negative ions of tyrosine formed through electron transfer in collisions with neutral potassium atoms is presented in the collision energy range from 30 to 75 eV. At low collision energies the dominating side chain channel observed corresponds to the cleavage of the bond from the para-position of the phenyl ring to the β-C of the remaining moiety, but cleavage of the Cαsbnd Cβ bond is also observed. Further fragments are formed through cleavage of the Cα bond to the carbonyl group, through decomposition of the carboxyl group or through significant decomposition of the backbone. The dehydrogenated molecular anion is also observed with appreciable intensity. These results are discussed in the context of earlier studies on dissociative electron attachment to tyrosine and other amino acids, as well as within the role of the side chain in electron induced decomposition of this aromatic amino acid. Stabilization of the temporary molecular anion in the transient collision complex is discussed and we argue that this may have significant influence on the branching ratios observed.

  15. Analysis of Supply Chain Network Using RFID Technique with Hybrid Algorithm

    CERN Document Server

    Suresh, P

    2010-01-01

    Radio Frequency IDentification (RFID) is a dedicated short range communication technology. The term RFID is used to describe various technologies that use radio waves to automatically identify people or objects. RFID is a method of remotely storing and retrieving data using RFID tag. Radio Frequency Identification (RFID) technology has been attracting considerable attention with the expectation of improved supply chain visibility for consumer goods, apparel, and pharmaceutical manufacturers, as well as retailers and government procurement agencies. RFID technology is used today in many applications, including security and access control, transportation and supply chain tracking. Supply Chain Management (SCM) is now at the centre stage of Manufacturing and service organizations. According to the strategies in markets, supply chains and logistics are naturally being modelled as distributed systems. The economic importance has motivated both private companies and academic researchers to pursue the use of operati...

  16. Development and preparation of superconducting mixed oxides by means of the reaction spray technique. Final report

    International Nuclear Information System (INIS)

    The report summarizes the work leading to a modification of the reaction spray technique in order to apply this technique for the preparation of powders for ceramic high-Tc superconductors. The task was to modify an existing reaction spray equipment to the specific requirements of the intended system for powder preparation and subsequent fabrication of superconducting, sintered specimens. The modification of the existing reaction spray equipment was relatively soon completed, and further optimizations finally resulted in a system capable of processing the material (YBaCuO; BiSrCaCuO) in batches of 10 kg in a routine operation mode, which proved to be a successful achievement for the fabrication of the sintered parts, which were formed by axial pressing and isostatic or hot pressing, or by thin film techniques. All the techniques were designed so as to yield superconducting specimens suitable for fabricating superconducting component parts. The Tc-values achieved were approx. 92 K (110 K) for YBaCuO (BiSrCaCuO). The jc values achieved 102 .. 103 A/cm2, represent the currently best achievable results for polycrystalline, sintered materials without any further structural optimization treatment being done. The dimensions of the disks, hollow cylinders, and thin films cover a range from several centimeters up to decimeters. (orig.)

  17. Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction.

    Science.gov (United States)

    Saed, Mohand O; Torbati, Amir H; Nair, Devatha P; Yakacki, Christopher M

    2016-01-01

    This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addition reaction. Strain-to-failure and glass transition behavior were investigated as a function of crosslinking monomer, pentaerythritol tetrakis(3-mercaptopropionate) (PETMP). An example non-stoichiometric system of 15 mol% PETMP thiol groups and an excess of 15 mol% acrylate groups was used to demonstrate the robust nature of the material. The LCE formed an aligned and transparent monodomain when stretched, with a maximum failure strain over 600%. Stretched LCE samples were able to demonstrate both stress-driven thermal actuation when held under a constant bias stress or the shape-memory effect when stretched and unloaded. A permanently programmed monodomain was achieved via a second-stage photopolymerization reaction of the excess acrylate groups when the sample was in the stretched state. LCE samples were photo-cured and programmed at 100%, 200%, 300%, and 400% strain, with all samples demonstrating over 90% shape fixity when unloaded. The magnitude of total stress-free actuation increased from 35% to 115% with increased programming strain. Overall, the two-stage TAMAP methodology is presented as a powerful tool to prepare main-chain LCE systems and explore structure-property-performance relationships in these fascinating stimuli-sensitive materials. PMID:26862925

  18. DETECTION OF PHENOL DEGRADING BACTERIA AND PSEUDOMONAS PUTIDA IN ACTIVATED SLUDGE BY POLYMERASE CHAIN REACTION

    OpenAIRE

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen

    2009-01-01

    Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Pu...

  19. Implementing A Greedy Chain Routing Technique With Spread Spectrum On Grid-Based WSNs

    OpenAIRE

    Hossein Sharifi Noghabi; Arash Ghazi askar; Arash Moghani; Arash Boustani; Motahareh Bahrami Zanjani

    2012-01-01

    Wireless Sensor Networks (WSN) are set of energy-limited sensors, which recently have been point of interest due to their vast applications. One of the efficient ways to consume energy in these networks is to utilize optimal routing protocols. In this approach, we proposed a greedy hierarchical chain-based routing method, named, PGC (stands for Persian Greedy Chain) which route the network applying Spread Spectrum codes as a mask given to the grid cells. Due to similarities between the propos...

  20. Application of semi-nested polymerase chain reaction targeting internal transcribed spacer region for rapid detection of panfungal genome directly from ocular specimens

    Directory of Open Access Journals (Sweden)

    Bagyalakshmi R

    2007-01-01

    Full Text Available Background: The incidence of fungal endophthalmitis has dramatically increased in recent years and rapid detection of fungi using nucleic acid-based amplification techniques is helpful in management. Aim: To evaluate semi-nested polymerase chain reaction (PCR targeting internal transcribed spacer (ITS region for detection of panfungal genome in ocular specimens. Statistical analysis used: Z test for two proportion. Materials and Methods: Standardization of PCR targeting ITS primers was carried out by determining analytical sensitivity and specificity. The sensitivity and specificity of PCR was determined by serial tenfold dilutions of C. albicans (ATCC 24433 DNA and DNA extracts of laboratory isolates of Aspergillus fumigatus , Fusarium lichenicola (4, other fungal and closely related bacterial strains and also human DNA. Semi-nested PCR was applied onto a total of 168 ocular specimens with clinically suspected fungal etiology during 2003-2005. Results and Conclusions: PCR was specific and sensitive to detect 1fg of fungal DNA with ITS primers. PCR detected fungal genome in 90 (53.57% in comparison with the conventional technique, positive in 34 (20.23% by smear examination and in 42 (25% by culture. The increase in clinical sensitivity by 28.57% using PCR was found to be statistically significant { P < 0.001 using Z test for two proportion}. The accuracy of the test was found to be 70.85%. PCR proved to be a rapid diagnostic technique for detection of panfungal genome directly from clinical specimens

  1. γ-Particle coincidence technique for the study of nuclear reactions

    Energy Technology Data Exchange (ETDEWEB)

    Zagatto, V.A.B., E-mail: vinicius.zagatto@gmail.com [Instituto de Física da Universidade de São Paulo (Brazil); Oliveira, J.R.B.; Allegro, P.R.P.; Chamon, L.C.; Cybulska, E.W.; Medina, N.H.; Ribas, R.V.; Seale, W.A.; Silva, C.P.; Gasques, L.R. [Instituto de Física da Universidade de São Paulo (Brazil); Zahn, G.S.; Genezini, F.A.; Shorto, J.M.B. [Instituto de Pesquisas Energéticas e Nucleares (Brazil); Lubian, J.; Linares, R. [Instituto de Física da Universidade Federal Fluminense (Brazil); Toufen, D.L. [Instituto Federal de Educação, Ciência e Tecnologia (Brazil); Silveira, M.A.G. [Centro Universitário da FEI (Brazil); Rossi, E.S. [Centro Universitário FIEO – UNIFIEO (Brazil); Nobre, G.P. [Lawrence Livermore National Laboratory (United States)

    2014-06-01

    The Saci-Perere γ ray spectrometer (located at the Pelletron AcceleratorLaboratory – IFUSP) was employed to implement the γ-particle coincidence technique for the study of nuclear reaction mechanisms. For this, the {sup 18}O+{sup 110}Pd reaction has been studied in the beam energy range of 45–54 MeV. Several corrections to the data due to various effects (energy and angle integrations, beam spot size, γ detector finite size and the vacuum de-alignment) are small and well controlled. The aim of this work was to establish a proper method to analyze the data and identify the reaction mechanisms involved. To achieve this goal the inelastic scattering to the first excited state of {sup 110}Pd has been extracted and compared to coupled channel calculations using the São Paulo Potential (PSP), being reasonably well described by it.

  2. Efficacy of real-time polymerase chain reaction for rapid diagnosis of endobronchial tuberculosis

    Directory of Open Access Journals (Sweden)

    Gang Hou

    2014-10-01

    Conclusions: Real-time PCR detection of M. tuberculosis DNA in EBTB biopsy tissue is more sensitive than sputum smear and bronchial brush smear, including at early disease stages. This PCR method may be a useful adjunct to culture- and smear-based techniques to allow more rapid EBTB diagnosis and timelier treatment.

  3. Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

    Science.gov (United States)

    Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

    2014-02-01

    Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

  4. Role of multiplex polymerase chain reaction using IS6110 and Protein b for the diagnosis of extra-pulmonary tuberculosis: North India

    Directory of Open Access Journals (Sweden)

    Kusum Sharma

    2015-01-01

    Full Text Available Background: Prompt and accurate diagnosis of extra-pulmonary tuberculosis (TB is highly challenging. Current conventional techniques lack sensitivity and are time-consuming. Here, we report our experience with multiplex polymerase chain reaction (MPCR using two targets namely IS6110 and protein antigen b in the diagnosis of extra-pulmonary TB. Materials and Methods: A total of 150 patients of extra-pulmonary TB visiting tertiary care center in north India between September 2008 and December 2009 were included in the study. Sixty-six biopsy samples and 84 were body fluids from these patients were subjected for microscopy (Ziehl-Neelsen, culture on LJ medium and for Multiplex PCR using IS6110 and Protein b antigen. Results: Smear positivity was noted in 11 samples (7.33%, and LJ culture yielded Mycobacterium tuberculosis in 8 biopsies and 9 body fluids with overall positivity of 11.3%. The multi-targeted PCR could detect M. tuberculosis in a total of 112 samples. Of 112 positive samples, only Protein b band was detected in 7 samples and only IS6110 was detected in 5 samples. Overall Protein b, PCR could detect 71.33% of the cases, whereas IS6110 was positive in 66.6% of the cases. Overall the sensitivities of microscopy, culture, IS6110 PCR, Protein b PCR and MPCR were 7.33%, 11.3%, 66.67%, 71.3% and 74.6%, respectively. Thus by using more than two targets the sensitivity increased from 66.67% of IS6110 to 74.6% in MPCR. Conclusion: Multiplex polymerase chain reaction using IS6110 and Protein b antigen is a highly sensitive and specific tool in the diagnosis of pauci-bacillary conditions like extra-pulmonary TB.

  5. Detection of equine herpesvirus type 1 using a real-time polymerase chain reaction.

    Science.gov (United States)

    Diallo, Ibrahim S; Hewitson, Glen; Wright, Lucia; Rodwell, Barry J; Corney, Bruce G

    2006-01-01

    Equid herpesvirus 1 (EHV1) is a major disease of equids worldwide causing considerable losses to the horse industry. A variety of techniques, including PCR have been used to diagnose EHV1. Some of these PCRs were used in combination with other techniques such as restriction enzyme analysis (REA) or hybridisation, making them cumbersome for routine diagnostic testing and increasing the chances of cross-contamination. Furthermore, they involve the use of suspected carcinogens such as ethidium bromide and ultraviolet light. In this paper, we describe a real-time PCR, which uses minor groove-binding probe (MGB) technology for the diagnosis of EHV1. This technique does not require post-PCR manipulations thereby reducing the risk of cross-contamination. Most importantly, the technique is specific; it was able to differentiate EHV1 from the closely related member of the Alphaherpesvirinae, equid herpesvirus 4 (EHV4). It was not reactive with common opportunistic pathogens such as Escherichia coli, Klebsiella oxytoca, Pseudomonas aeruginosa and Enterobacter agglomerans often involved in abortion. Similarly, it did not react with equine pathogens such as Streptococcus equi, Streptococcus equisimilis, Streptococcus zooepidemicus, Taylorella equigenitalis and Rhodococcus equi, which also cause abortion. The results obtained with this technique agreed with results from published PCR methods. The assay was sensitive enough to detect EHV1 sequences in paraffin-embedded tissues and clinical samples. When compared to virus isolation, the test was more sensitive. This test will be useful for the routine diagnosis of EHV1 based on its specificity, sensitivity, ease of performance and rapidity. PMID:16137772

  6. Trojan Horse as an indirect technique in nuclear astrophysics. Resonance reactions

    OpenAIRE

    Mukhamedzhanov, A. M.; Blokhintsev, L.D.; Irgaziev, B. F.; Kadyrov, A. S.; M. La Cognata; Spitaleri, C.(Dip. di Fisica e Astronomia, Univ. di Catania, via S. Sofia, Catania, Italy); Tribble, R. E.

    2007-01-01

    The Trojan Horse method is a powerful indirect technique that provides information to determine astrophysical factors for binary rearrangement processes $x + A \\to b + B$ at astrophysically relevant energies by measuring the cross section for the Trojan Horse reaction $a + A \\to y+ b + B$ in quasi-free kinematics. We present the theory of the Trojan Horse method for resonant binary subreactions based on the half-off-energy-shell R matrix approach which takes into account the off-energy-shell ...

  7. Impact of Sophisticated Stationary Forecast Techniques on the Bullwhip Effect in a Supply Chain

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The bullwhip effect in a multistage supply chain was analyzed using sophisticated stationary forecasts (third order moving average and third order exponential smoothing forecasts ). The third order exponential smoothing and third order moving average forecasts sometimes have a variance reducing effect on the supply chain.In a supply chain with positively correlated or independent and identically distributed (i. i. d) demands, the order variance based on simple moving average forecast (or simple exponential smoothing forecast) is larger than the order variance based on second order moving average forecast (or second order exponential smoothing forecast) ,and the order variance based on second order moving average forecast ( or second order exponential smoothing forecast) is larger than the order variance based on third order moving average forecast( or third order exponential smoothing forecast). In addition, for i.i.d demands, third order exponential smoothing forecast leads to a larger variation than third order moving average forecast.

  8. Quantum and Molecular Mechanical (QM/MM) Monte Carlo Techniques for Modeling Condensed-Phase Reactions.

    Science.gov (United States)

    Acevedo, Orlando; Jorgensen, Wiliiam L

    2014-09-01

    A recent review (Acc. Chem. Res. 2010, 43:142-151) examined our use and development of a combined quantum and molecular mechanical (QM/MM) technique for modelling organic and enzymatic reactions. Advances included the PDDG/PM3 semiempirical QM (SQM) method, computation of multi-dimensional potentials of mean force (PMF), incorporation of on-the-fly QM in Monte Carlo simulations, and a polynomial quadrature method for rapidly treating proton-transfer reactions. The current article serves as a follow up on our progress. Highlights include new reactions, alternative SQM methods, a polarizable OPLS force field, and novel solvent environments, e.g., "on water" and room temperature ionic liquids. The methodology is strikingly accurate across a wide range of condensed-phase and antibody-catalyzed reactions including substitution, decarboxylation, elimination, isomerization, and pericyclic classes. Comparisons are made to systems treated with continuum-based solvents and ab initio or density functional theory (DFT) methods. Overall, the QM/MM methodology provides detailed characterization of reaction paths, proper configurational sampling, several advantages over implicit solvent models, and a reasonable computational cost. PMID:25431625

  9. Static and dynamic systems in Rickettsia slovaca life cycle evaluated by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Spitalská, E; Sparagano, O; Boldis, V

    2010-04-01

    Quantitative real-time polymerase chain reaction was used to characterize the growth of Rickettsia slovaca, a tick-borne pathogen transmitted by Dermacentor reticulatus and D. marginatus ticks, in static (L929 and Vero cells) and dynamic (D. marginatus and Ixodes ricinus ticks) cultivation systems. The highest points of bacterial multiplication and the time-spans between the inoculum and the maximum of rickettsial copies were increased in consecutive order from eukaryotic cells, I. ricinus to D. marginatus systems. In dynamic system, multiplication maximum of R. slovaca was achieved 9 days earlier in I. ricinus; however, the number of rickettsial DNA copies was approximately 3.6 x 10(6) more in D. marginatus. PMID:20537110

  10. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

    Science.gov (United States)

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

    2013-04-01

    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  11. Development of a polymerase chain reaction assay for species identification of goose and mule duck in foie gras products.

    Science.gov (United States)

    Rodrı X0301 Guez, Miguel A; Garcı X0301 A, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martı X0301 N, Rosario

    2003-12-01

    Polymerase chain reaction amplification of a conserved region of the α-actin gene has been used for the specific identification of goose (Anser anser) and mule duck (Anas platyrhynchos×Cairina moschata) foie gras. Universal primers were used for the amplification of a DNA fragment containing three introns and four exons of the α-actin gene in goose and mule duck. Sequence analysis of the amplified fragments was necessary for the design of forward species-specific primers in the goose and mule duck α-actin genes. The use of species-specific forward primers, together with a reverse universal primer, produced amplicons of different length, allowing clear identification of goose and mule duck foie gras samples. Analysis of experimental mixtures demonstrated that 1% of duck can be easily detected in goose foie gras using the PCR method developed here. This genetic marker can be very useful for the accurate identification of these two species in foie gras products.

  12. Identification of goose, mule duck, chicken, turkey, and swine in foie gras by species-specific polymerase chain reaction.

    Science.gov (United States)

    Rodríguez, Miguel A; García, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martín, Rosario

    2003-03-12

    A specific Polymerase Chain Reaction (PCR) has been developed for the identification of goose (Anser anser), mule duck (Anas platyrhynchos x Cairina moschata), chicken (Gallus gallus), turkey (Meleagris gallopavo), and swine (Sus scrofa domesticus) in foie gras. A forward common primer was designed on a conserved DNA sequence in the mitochondrial 12S ribosomal RNA gene (rRNA), and reverse primers were designed to hybridize on species-specific DNA sequences of each species considered. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose, mule duck, chicken, turkey, and swine in foie gras. Analysis of experimental mixtures demonstrated that the detection limit of the assay was approximately 1% for each species analyzed. This genetic marker can be very useful for the accurate identification of these species, avoiding mislabeling or fraudulent species substitution in foie gras.

  13. DETEKSI DAN SPESIASI PARASIT MALARIA SAMPEL MONITORING PENGOBATAN DIHYDROARTEMISININ-PIPERAQUINE DI KALIMANTAN DAN SULAWESI: MIKROSKOPIS VS POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Reni Herman

    2012-07-01

    Full Text Available In monitoring the treatment of malaria with Dihydroartemisinin-piperaquine (DHP, microscopic cross check and Polymerase Chain Reaction (PCR performed to validate the results of laboratory examinations in the field. This study used finger prick samples from subjects with a diagnosis of malaria in monitoring the treatment of malaria with DHP in Kalimantan and Sulawesi. Samples taken at day 0, blood smears made on slides for microscopic and blood spot on filter paper for PCR examination. The PCR method used is a single-round multiplex polymerase chain reaction that has been modified, the examination of each species carried out in different tubes to distinguish the species P. falciparum or P. Vivax. Target of DNA amplification is a species-specific gene sequences in the small-subunit ribosomal RNA (SSUrRNA, 300 bp for P. falciparum and 276 bp for P.vivax.  P. falciparum and P.vivax identified in 229 samples of blood smears and blood spots. Microscopic and PCR gave the same results, positive 93.4% and negative 6.6% with a sensitivity of  99% and specificity 93.3%. P.falciparum sensitivity and specificity of 92% and 99%, P.vivax 97% and 94%, PCR as a gold standard. There are differences in the results of examination of 5 samples, ie with microscopic examination identified as P.vivax  while the PCR as P. falciparum. In this study, identification of  the microscopic parasite similar to the results of identification by PCR, but differ in determining the types of parasites. In general, the ability to microscopic diagnosis of malaria is very good, but confirmation by PCR is still needed.AbstrakPada monitoring pengobatan malaria  dengan Dihydroartemisinin-piperaquine (DHP,cek silang mikroskopis dan Polymerase Chain Reaction (PCR dilakukan untuk memvalidasi hasil pemeriksaan di laboratorium lapangan. Penelitian ini menggunakan sediaan darah jari dari subyek dengan diagnosis malaria pada monitoring pengobatan malaria dengan DHP di Kalimantan dan Sulawesi

  14. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction.

    Science.gov (United States)

    Lunkenheimer, K; Hufert, F T; Schmitz, H

    1990-01-01

    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specimens of patients with acute Lassa fever, viral RNA could be demonstrated. Negative results were obtained with all serum and urine specimens of healthy subjects. Our data suggest that PCR may be applied as an alternative to virus isolation in the rapid diagnosis of Lassa fever. Images PMID:2279999

  15. Histoplasmosis diagnosis using a polymerase chain reaction method. Application on human samples in French Guiana, South America.

    Science.gov (United States)

    Maubon, Danièle; Simon, Stéphane; Aznar, Christine

    2007-08-01

    Untreated histoplasmosis is life threatening, especially in immunosuppressed patients. In French Guiana, South America, it is one of the most common opportunistic infections in AIDS patients. Twenty-one cases of disseminated histoplasmosis were diagnosed in 2004 in the mycology laboratory of Cayenne hospital. Culture samples for histoplasmosis diagnosis is simple, sensitive, and specific, but it is a lengthy process. Management of the disease is then dangerously delayed. In this work, we tested a polymerase chain reaction (PCR) method on 40 samples from patients with suspected disseminated histoplasmosis. The recently described Hcp100 nested PCR method was used to detect Histoplasma capsulatum DNA in these samples. All of the positive cultures for H. capsulatum were also positive with PCR method. Tested on other fungi or negative culture, it also showed high specificity. Furthermore, it allows treating patients more rapidly. Culture remains necessary, but histoplasmosis PCR offers great prospects, on a clinical point of view.

  16. Detection of Leptospira spp. in wildlife reservoir hosts in Ontario through comparison of immunohistochemical and polymerase chain reaction genotyping methods.

    Science.gov (United States)

    Shearer, Karen E; Harte, Michael J; Ojkic, Davor; Delay, Josepha; Campbell, Douglas

    2014-03-01

    A total of 460 kidney samples from wildlife (beavers, coyotes, deer, foxes, opossums, otters, raccoons, skunks) were obtained from road-kill and hunter/trapper donations in Ontario between January 2010 and November 2012. The objectives of the study were to detect Leptospira spp. by immunohistochemistry and polymerase chain reaction (PCR), to map presence of leptospires in wildlife relative to livestock and human populations, and to characterize positive samples by sequencing and comparison to leptospires known to affect domestic animals and humans. The proportion of samples that tested positive ranged from 0% to 42%, with the highest rates in skunks and raccoons. Leptospira spp. were present in kidneys of wildlife across Ontario, particularly in areas of high human density, and areas in which livestock populations are abundant. The PCR was too weak in most samples to permit genotyping and examination of the relationship between the leptospires found in this study and those affecting domestic animals and humans.

  17. IDENTIFICATION OF MYCOBACTERIUM GENAVENSE IN A DIANA MONKEY (CERCOPITHECUS DIANA) BY POLYMERASE CHAIN REACTION AND HIGH-PERFORMANCE LIQUID CHROMATOGRAPHY.

    Science.gov (United States)

    Kelly, Kathleen M; Wack, Allison N; Bradway, Dan; Simons, Brian W; Bronson, Ellen; Osterhout, Gerard; Parrish, Nicole M; Montali, Richard J

    2015-06-01

    A 25-yr-old Diana monkey (Cercopithecus diana) with a 1.5-yr history of chronic colitis and diarrhea was found to have disseminated granulomatous disease with intralesional acid fast bacilli. Bacilli were identified as Mycobacterium genavense by polymerase chain reaction, sequencing of the 16S-23S ribosomal RNA intergenic spacer (ITS) gene, and mycolic acid analysis by high-performance liquid chromatography. Mycobacterium genavense is a common cause of mycobacteriosis in free-ranging and captive birds. In addition, recognition of opportunistic infection in human immunodeficiency virus-positive patients is increasing. Disease manifestations of M. genavense are similar to Mycobacterium avium complex (MAC) and include fever, wasting, and diarrhea with disseminated disease. Similar clinical signs and lesions were observed in this monkey. Mycobacterium genavense should be considered as a differential for disseminated mycobacterial disease in nonhuman primates as this agent can mimic MAC and related mycobacteria.

  18. A rapid, efficient, and economical inverse polymerase chain reaction-based method for generating a site saturation mutant library.

    Science.gov (United States)

    Jain, Pankaj C; Varadarajan, Raghavan

    2014-03-15

    With the development of deep sequencing methodologies, it has become important to construct site saturation mutant (SSM) libraries in which every nucleotide/codon in a gene is individually randomized. We describe methodologies for the rapid, efficient, and economical construction of such libraries using inverse polymerase chain reaction (PCR). We show that if the degenerate codon is in the middle of the mutagenic primer, there is an inherent PCR bias due to the thermodynamic mismatch penalty, which decreases the proportion of unique mutants. Introducing a nucleotide bias in the primer can alleviate the problem. Alternatively, if the degenerate codon is placed at the 5' end, there is no PCR bias, which results in a higher proportion of unique mutants. This also facilitates detection of deletion mutants resulting from errors during primer synthesis. This method can be used to rapidly generate SSM libraries for any gene or nucleotide sequence, which can subsequently be screened and analyzed by deep sequencing.

  19. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    DEFF Research Database (Denmark)

    Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen;

    2011-01-01

    Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...... for risk assessment. Results: In water collected from the apartments Legionella spp were detected by qPCR in the concentration range from LOQ to 9.6* 10(5)GU/L while L. pneumophila were detected in a range from LOQ to 6.8*10(5) GU/L. By culturing, the legionellae were detected in the range from below...

  20. Quantification of Porcine Follicle-stimulating Hormone Receptor Messenger Ribonucleic Acid by Reverse Transcription-competitive Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    An easy and reliable method was developed for construction and quantification of competitive templates, which shared the same sequence as the amplified target DNA except for a 20-bp insertion in the middle by recombinant polymerase chain reaction (PCR). Among the advantages of competitive PCR is that any predictable or unpredictable variable that affects amplification has the same effect on both target and competitor species and that the final ratio of amplified products reflects exactly the initial targets. The utilization of a thermostable reverse transcriptase in the RT step was proposed to overcome the problem of the efficiency of target cDNA synthesis. In addition, to obtain reliable measurements, it was recommended to perform four PCR with amounts of competitive template flanking the concentration of the target mRNA.

  1. Species identification of Crassostrea and Ostrea oysters by polymerase chain reaction amplification of the 5S rRNA gene.

    Science.gov (United States)

    Cross, Ismael; Rebordinos, Laureana; Diaz, Edgardo

    2006-01-01

    A specific multiplex polymerase chain reaction (PCR) was developed for the identification of Crassostrea angulata, C. gigas, Ostrea edulis, and O. stentina oyster species. Universal primers were used for the amplification of complete repetition units of 5S rDNA in each of the 4 species. The alignment of the obtained sequences was the basis for the specific design of species-specific primers (ED1, ED2, ST1, ST2, CR1, and CR2) located in the nontranscribed spacer regions. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed identification of Crassostrea and Ostrea species. A multiplex PCR with a set of the 6 designed primers showed that they did not interfere with each other and bound specifically to the DNA target. This genetic marker can be very useful for traceability of the species, application in the management of oyster cultures, and conservation of the genetic resources of the species. PMID:16512239

  2. Detection of Nesopora caninum-specific DNA from cerebrospinal fluid by polymerase chain reaction in a dog with confirmed neosporosis.

    Science.gov (United States)

    Ishigaki, Kyohei; Noya, Masahiko; Kagawa, Yumiko; Ike, Kazunori; Orima, Hiromitsu; Imai, Soichi

    2012-08-01

    A one-month male Greyhound dog presented with a swinging gait of the hindlimbs, and later developed muscular atrophy of the femoral region and hyperextension of hindlimbs. The dog had positive serum IFAT titers to Neospora caninum, but a negative titer in the cerebrospinal fluid (CSF). N. caninum-specific DNA was amplified from the CSF using a semi-nested polymerase chain reaction assay. Clusters of protozoa in biopsied muscle fibers were subsequently confirmed as N. caninum tachyzoites by immunohistochemical examination. Early recognition and treatment are necessary for effective recovery of clinical canine neosporosis, but antemortem diagnosis is difficult. We suggest that the detection of parasite deoxyribonucleic acid in the CSF is a useful antemortem diagnostic method in facilitating treatment of this disease. PMID:22446406

  3. Evaluation of reference genes for quantitative polymerase chain reaction across life cycle stages and tissue types of Tribolium castaneum.

    Science.gov (United States)

    Toutges, Michelle J; Hartzer, Kris; Lord, Jeffrey; Oppert, Brenda

    2010-08-25

    The genome of the genetic model for coleopteran insects, Tribolium castaneum, is now available for downstream applications. To facilitate gene expression studies in T. castaneum, genes were evaluated for suitability as normalizers in comparisons across tissues and/or developmental stages. In less diverse samples, such as comparisons within developmental stages or tissue only, normalizers for mRNA were more stable and consistent. Overall, the genes for ribosomal proteins rps6, rpl13a, rps3, and rps18 were the most stable normalizers for broad scale gene expression analysis in T. castaneum. However, their stability ranking was dependent upon the instrument as well as the analysis program. These data emphasize the need to optimize normalizers used in all real-time polymerase chain reaction experiments specifically for the experimental conditions and thermocycler and to carefully evaluate data generated by computational algorithms.

  4. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    Science.gov (United States)

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis.

  5. Meningitis with polymerase chain reaction for varicella zoster positivity in cerebrospinal flid of a young immunocompetent adult

    Science.gov (United States)

    Gupta, Pooja; Ranjan, Rajeev; Agrawal, C. S.; Muralikrishnan, K; Dave, Nikhil; Rana, Davinder Singh

    2016-01-01

    Meningitis caused by varicella zoster virus (VZV) is quite rare among young immunocompetent adults though immunocompromised patients are often seen to be affected by reactivation of VZV presenting with primary clinical features of dermatomal rashes and neurological sequelae. Here, we report the clinical scenario of a young, healthy male who had presented with fever, headache, and onset of dermatomal rashes later than the fever and was eventually diagnosed to be a case of VZV meningitis. We would like to highlight the fact that even young immunocompetent patients though rarely, might contract VZV meningitis and clinicians should have a high index of suspicion and keen eyes to catch the more obvious features of VZV infection on complete physical examination and must not harbor any reservations in ordering polymerase chain reaction for VZV DNA or initiating aggressive antiviral therapy. PMID:27695246

  6. Meningitis with polymerase chain reaction for varicella zoster positivity in cerebrospinal flid of a young immunocompetent adult

    Science.gov (United States)

    Gupta, Pooja; Ranjan, Rajeev; Agrawal, C. S.; Muralikrishnan, K; Dave, Nikhil; Rana, Davinder Singh

    2016-01-01

    Meningitis caused by varicella zoster virus (VZV) is quite rare among young immunocompetent adults though immunocompromised patients are often seen to be affected by reactivation of VZV presenting with primary clinical features of dermatomal rashes and neurological sequelae. Here, we report the clinical scenario of a young, healthy male who had presented with fever, headache, and onset of dermatomal rashes later than the fever and was eventually diagnosed to be a case of VZV meningitis. We would like to highlight the fact that even young immunocompetent patients though rarely, might contract VZV meningitis and clinicians should have a high index of suspicion and keen eyes to catch the more obvious features of VZV infection on complete physical examination and must not harbor any reservations in ordering polymerase chain reaction for VZV DNA or initiating aggressive antiviral therapy.

  7. Extraction of DNA from exfoliative cytology specimens and its suitability for analysis by the polymerase chain reaction.

    Science.gov (United States)

    Jackson, D P; Payne, J; Bell, S; Lewis, F A; Taylor, G R; Peel, K R; Sutton, J; Quirke, P

    1990-01-01

    The extraction of DNA from archival exfoliative cytology samples would allow the molecular biological analysis of this readily available material using the polymerase chain reaction (PCR). We have quantitatively and qualitatively studied the extraction of DNA from a variety of cytological preparations. For both fresh and archival cervical smears, overnight incubation with proteinase K produces high yields of high molecular weight DNA, but simply boiling the samples produces DNA suitable for PCR amplification of a single copy gene. Increasing the proteinase K incubation to several days allows the extraction of DNA from fixed and stained archival cytology slides from a variety of sites. The extracted DNA was again suitable for PCR analysis. Fresh and archival cytological material can be utilized for molecular biological study of disease processes using PCR. Archival cytological material is probably the best source of DNA and RNA after stored frozen tissue.

  8. The sensitivity and specificity of a reverse transcription-polymerase chain reaction assay for the avian pneumovirus (Colorado strain).

    Science.gov (United States)

    Pedersen, J C; Reynolds, D L; Ali, A

    2000-01-01

    A reverse transcription-polymerase chain reaction (RT-PCR) assay for the detection of avian pneumovirus (APV), Colorado strain (US/CO), was evaluated for sensitivity and specificity. The single-tube RT-PCR assay utilized primers developed from the matrix (M) gene sequence of the US/CO APV. The RT-PCR amplified the US/CO APV but did not amplify other pneumoviruses, including the avian pneumoviruses subgroups A and B. The RT-PCR was capable of detecting between 10(0.25) mean tissue culture infective dose (TCID50) and 10(-0.44) TCID50 of the US/CO APV. These results have demonstrated that the single-tube RT-PCR assay is a specific and sensitive assay for the detection of US/CO APV.

  9. An allele-specific polymerase chain reaction assay for the differentiation of members of the Anopheles culicifacies complex

    Indian Academy of Sciences (India)

    O P Singh; Geeta Goswami; N Nanda; K Raghavendra; D Chandra; S K Subbarao

    2004-09-01

    Anopheles culicifacies, the principal vector of malaria in India, is a complex of five cryptic species which are morphologically indistinguishable at any stage of life. In view of the practical difficulties associated with classical cytotaxonomic method for the identification of members of the complex, an allele-specific polymerase chain reaction (ASPCR) assay targeted to the D3 domain of 28S ribosomal DNA was developed. The assay discriminates An. culicifacies species A and D from species B, C and E. The assay was validated using chromosomally-identified specimens of An. culicifacies from different geographical regions of India representing different sympatric associations. The assay correctly differentiates species A and D from species B, C and E. The possible use of this diagnostic assay in disease vector control programmes is discussed.

  10. Evaluation of a commercial real-time polymerase chain reaction assay for detection of environmental contamination with Clostridium difficile.

    Science.gov (United States)

    Deshpande, A; Kundrapu, S; Sunkesula, V C K; Cadnum, J L; Fertelli, D; Donskey, C J

    2013-09-01

    Contaminated environmental surfaces are an important source for transmission of Clostridium difficile. However, there are no efficient and easy methods to assess contamination. The performance of a commercial real-time polymerase chain reaction (PCR) assay was evaluated for detection of environmental toxigenic C. difficile in comparison with anaerobic culture followed by toxin testing of isolates. For 66 sites sampled, PCR had a sensitivity of 17.39%, specificity 100%, positive predictive value 100% and negative predictive value 69.35%. Increasing the PCR cycle threshold (CT) value to 45 increased sensitivity to 52% without decreasing specificity. The commercial PCR assay is not sufficiently sensitive for environmental monitoring, but improved sensitivity might be possible through CT value modification.

  11. A new measurement approach of ionizing radiation in irradiated trout (Oncorhynchus mykiss) by Randomly Polymorphic DNA-Polymerase Chain Reaction.

    Science.gov (United States)

    Şakalar, Ergün; Mol, Sühendan

    2016-05-01

    Trout (Oncorhynchus mykiss) were irradiated at doses of 0.250, 0.500, 1, 3, 5, 7 and 9 kGy in gamma cell. DNAs were extracted from the irradiated samples before and after storage. 1ERP primers were designed, and RAPD-PCR (Randomly Polymorphic DNA-Polymerase Chain Reaction) was applied to make randomly amplifications on the DNA of the irradiated samples. Agarose gel profiles of irradiated fish were obtained to determine change of band profiles. In addition, DNA fragmentation occurring in each dose was determined by comet assay for the verification of methodology developed in this study. The molecular methodology was developed to estimate ionizing radiation (IR) level in irradiated fish. This methodology allows the analysis of the trout irradiated up to the dose limit of around 0.5 kGy and stored for a period of three months. PMID:27407216

  12. Quantitative Profiling of Long-Chain Bases by Mass Tagging and Parallel Reaction Monitoring

    DEFF Research Database (Denmark)

    Ejsing, Christer S; Bilgin, Mesut; Fabregat, Andreu

    2015-01-01

    sensitive and specific assays for monitoring these molecules. Here we describe a shotgun lipidomics method for quantitative profiling of LCB molecules. The method employs a "mass-tag" strategy where LCBs are chemically derivatized with deuterated methyliodide (CD3I) to produce trimethylated derivatives...... having a positively charged quaternary amine group. This chemical derivatization minimizes unwanted in-source fragmentation of LCB analytes and prompts a characteristic trimethylaminium fragment ion that enables sensitive and quantitative profiling of LCB molecules by parallel reaction monitoring...... on a hybrid quadrupole time-of-flight mass spectrometer. Notably, the strategy provides, for the first time, a routine for monitoring endogenous 3-ketosphinganine molecules and distinguishing them from more abundant isomeric sphingosine molecules. To demonstrate the efficacy of the methodology we report an in...

  13. Importance of polymerase chain reaction in diagnosis of pulmonary and extra-pulmonary tuberculosis

    International Nuclear Information System (INIS)

    Pakistan ranks eighth on the list of 22 high-burden tuberculosis (TB) countries in the world according to the World Health Organisation's (WHO) Global Tuberculosis Control 2009. Including other reasons the main cause is improper and late diagnosis of the disease. PCR may play an important role to control the disease with its rapid, sensitive and specific diagnosis. But in Pakistan due to lake of knowledge about this latest technique we are not using this technique appropriately. Clinicians still trust on conventional methods of TB diagnosis, which are time consuming or insensitive. The present study was arranged to highlight the importance of PCR in TB diagnosis in pulmonary and extra-pulmonary cases and its comparison with conventional methods. Methods: Samples obtained from 290 patients of suspected TB (pulmonary or extra-pulmonary) were subjected to ZN smear examination, LJ medium culture and PCR test by amplifying 541 bp fragment of Mycobacterium tuberculosis complex genome. The present prospective study is performed at Shalamar Hospital Lahore from November 2008 to November 2010. Results: A distinctly difference was observed in the test results done by PCR and other conventional techniques in pulmonary or extra-pulmonary tuberculosis samples (p<0.001). The sensitivity of different tests was 68.62% for PCR, 26.90% for LJ medium culture, and 14.14% for ZN smear examination (p<0.05). However, there was no significant difference between different tests as for as specificity was concerned. PCR test sensitivity in pulmonary and extra-pulmonary clinical samples was 78.34 and 61.76% respectively, being significantly higher (p<0.05) when compared with sensitivity of other tests. The mean detection time for M. tuberculosis was 25 days by LJ medium culture and less than 1 day by smear examination and PCR test. Conclusion: PCR test is more sensitive than ZN smear examination and LJ medium culture for the diagnosis of TB in pulmonary and extra-pulmonary clinical samples

  14. HLA-DR Typing by Polymerase Chain Reaction with Sequence- Specific Primers Compared to Serological typing

    Directory of Open Access Journals (Sweden)

    M Adib

    2004-12-01

    Full Text Available Background: Considering the role of HLA matching in transplant outcome, the quality of HLA-DR typing is clearly an important issue. In recent years, serological methods have been replaced with DNA based typing methods. The main objective of this study was to compare HLA-DR typing data obtained from existing serologic method with data obtained by the new PCR-SSP method. Methods: 55 peripheral blood samples were collected from randomly selected individuals who were referred to the transplantation laboratory of Isfahan, in Aliasghar Hospital, and were typed for HLA-DR antigens by both methods. HLA-DR typing by serologic method was performed using 30 different antisera and for PCR-SSP method, specific primers were used for HLA-DRB1*01-10(except DR6, 8, 10, and also for HLA-DR52, and DR53. After DNA extraction, 13 pairs specific primers were used for each sample separately and PCR reaction were done. In this study, the third intron of DR locus was used as internal positive control. After PCR amplification, products of reaction electrophoresis was performed on 2% agarose gel, and after taking photo of gel, interpretation and comparison of results were performed. Results: The results of 31 samples (56.3% corresponded completely to serological method, 12 samples (22% were assigned heterozygous in serology and homozygous in molecular typing, 7 samples (12.7% were heterozygous in both methods but different in one allele. 2 samples (3.6% were homozygous in serology and heterozygous in molecular typing, and also one sample (1.8% was homozygous in both methods but so that in serology DR14, and in molecular typing DR11 were assigned. And finally 2 samples from 55 (3.6% were not detectable in serological method. Conclusion: The typing data obtained from the conventional and the new methods were compared. Sensitivity, specificity, positive predictive value (PPV, and negative predictive value (NPV were calculated. The results indicated that the DNA based method

  15. Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta Lima

    1998-01-01

    Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

  16. The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

  17. A Study on Diagnosis of Mycoplasma Hominis in The Urogenital Tract By Nested Polymerase Chain Reaction with First Void Urine in Men

    Institute of Scientific and Technical Information of China (English)

    徐斌; 温泉; 刘洋; 张林

    2001-01-01

    Objectives: To evaluate the efficacy of nested polymerase chain reaction (PCR) with first void urine (FVU) for the diagnosis of Mycoplasma hominis in male patients.Methods: Matched FVU specimens and urethral swabs were collected from 194 male patients with Nongonococcal Urethritis and tested by nested PCR and cell culture. Cell culture was used as a gold standard for evaluating other assay techniques.Results: For FVU nested PCR assay and FVU cell culture,our results showed that the sensitivity was 100% and 93.3%;specificity was 97.0% and 98.2%; positive predictive value (PPV) was 85.7% and 90.3%, negative predictive value (NPV)was 100% and 98.8%, respectively. The total consistency between the two techniques was 97.4 %.Conclusions: For the diagnosis of Mycoplasma hominis in men, nested PCR detecting FVU is a highly sensitive and specific method. First void urine can replace swab culture or PCR in terms of acceptability and feasibility.

  18. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

    Science.gov (United States)

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

    2014-10-01

    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  19. Disposable on-chip microfluidic system for buccal cell lysis, DNA purification, and polymerase chain reaction.

    Science.gov (United States)

    Cho, Woong; Maeng, Joon-Ho; Ahn, Yoomin; Hwang, Seung Yong

    2013-09-01

    This paper reports the development of a disposable, integrated biochip for DNA sample preparation and PCR. The hybrid biochip (25 × 45 mm) is composed of a disposable PDMS layer with a microchannel chamber and reusable glass substrate integrated with a microheater and thermal microsensor. Lysis, purification, and PCR can be performed sequentially on this microfluidic device. Cell lysis is achieved by heat and purification is performed by mechanical filtration. Passive check valves are integrated to enable sample preparation and PCR in a fixed sequence. Reactor temperature is needed to lysis and PCR reaction is controlled within ±1°C by PID controller of LabVIEW software. Buccal epithelial cell lysis, DNA purification, and SY158 gene PCR amplification were successfully performed on this novel chip. Our experiments confirm that the entire process, except the off-chip gel electrophoresis, requires only approximately 1 h for completion. This disposable microfluidic chip for sample preparation and PCR can be easily united with other technologies to realize a fully integrated DNA chip.

  20. Identification of four squid species by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan

    2016-02-01

    Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. PMID:26772407