
Sample records for chain reaction profiling

  1. Chain reaction

    International Nuclear Information System (INIS)

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  2. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study


    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana


    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients.

  3. Chain Reaction Polymerization. (United States)

    McGrath, James E.


    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  4. Polymerase chain reaction


    Gaurav Solanki


    The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation...

  5. Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Gaurav Solanki


    Full Text Available The polymerase chain reaction (PCR is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation and diagnosis of a growing number of diseases. PCR is also used in forensics laboratories. PCR can identify genes that have been implicated in the development of cancer. The present paper is an attempt to review basics of PCR in relation to its methods, application and use.

  6. Supply chain reaction

    International Nuclear Information System (INIS)

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  7. Comparison of arbitrarily primed-polymerase chain reaction and plasmid profiles typing of Pseudomonas aeruginosa strains from burn patients and hospital environment

    International Nuclear Information System (INIS)

    Objective was to identify the strengths and weakness of arbitrary primed-polymerase chain reaction (A P-PCR) and plasmid profiles for typing of Pseudomonas aeruginosa (P. aeruginosa) and tracking of source of infections. Seventy-four strains of P. aeruginosa were isolated from burn patients and hospital environment between January to April 2003 in Ghotbadden Burn Hospital, Shiraz, Iran. The strains were classified by photo Capt Mw program, similarity and clustering of strains were assessed using NTSYS-PC version 2.02K software. Based on 50% and 64.7% and 67.5% similarity on the plotted dendrogram, 38 plasmid profiles were classified into: 2, 3 and 5 clusters, respectively. Photo Capt Mw program categorized AP-PCR products to 47 different types of 6 to 12 bands between 0.376 to 3.7 kb. Based on dendrogram pattern 3 levels (62 %, 81% and 84.6%) of similarity were selected. Using these criteria 2, 5and 11 clusters were obtained, respectively. As compared with plasmid profiles, AP-PCR analysis protocol is rapid, reproducible and differentiated the isolates with higher discrimination power. These results suggest that during admission of patients in burn center a limited number of common strains cross-contaminate burn victims. However, transmissions of infection from hospital environment to patients also occur in the minority of the victims. To control cross-contamination of the patient wounds with antibiotics resistant isolates, strong disinfection of patients' bathroom after scrubbing of each patient wounds is mandatory. (author)

  8. Polymerization as a Model Chain Reaction (United States)

    Morton, Maurice


    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  9. The chain re-action

    CERN Multimedia


    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  10. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K


    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity of...

  11. Determining Annealing Temperatures for Polymerase Chain Reaction (United States)

    Porta, Angela R.; Enners, Edward


    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  12. Transformational leadership: a cascading chain reaction. (United States)

    Murphy, Lorraine


    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment. PMID:15720482

  13. Degenerate Oligonucleotide Primed-Polymerase Chain Reaction-Based Array Comparative Genomic Hybridization for Extensive Amplicon Profiling of Breast Cancers : A New Approach for the Molecular Analysis of Paraffin-Embedded Cancer Tissue


    Daigo, Yataro; Chin, Suet-Feung; Gorringe, Kylie L.; Bobrow, Lynda G; Bruce A J Ponder; Pharoah, Paul D P; Caldas, Carlos


    We have developed a protocol for degenerate oligonucleotide-primed-polymerase chain reaction-based array comparative genomic hybridization (array CGH) that, when combined with a laser microdissection technique, allows the analysis of cancer cell populations isolated from routine, formalin-fixed, paraffin-embedded tissue samples. Comparison of copy number changes detected by degenerate oligonucleotide-primed-polymerase chain reaction-based array CGH to those detected by conventional array CGH ...

  14. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  15. Robust quantification of polymerase chain reactions using global fitting.

    Directory of Open Access Journals (Sweden)

    Ana C Carr

    Full Text Available BACKGROUND: Quantitative polymerase chain reactions (qPCR are used to monitor relative changes in very small amounts of DNA. One drawback to qPCR is reproducibility: measuring the same sample multiple times can yield data that is so noisy that important differences can be dismissed. Numerous analytical methods have been employed that can extract the relative template abundance between samples. However, each method is sensitive to baseline assignment and to the unique shape profiles of individual reactions, which gives rise to increased variance stemming from the analytical procedure itself. PRINCIPAL FINDINGS: We developed a simple mathematical model that accurately describes the entire PCR reaction profile using only two reaction variables that depict the maximum capacity of the reaction and feedback inhibition. This model allows quantification that is more accurate than existing methods and takes advantage of the brighter fluorescence signals from later cycles. Because the model describes the entire reaction, the influences of baseline adjustment errors, reaction efficiencies, template abundance, and signal loss per cycle could be formalized. We determined that the common cycle-threshold method of data analysis introduces unnecessary variance because of inappropriate baseline adjustments, a dynamic reaction efficiency, and also a reliance on data with a low signal-to-noise ratio. SIGNIFICANCE: Using our model, fits to raw data can be used to determine template abundance with high precision, even when the data contains baseline and signal loss defects. This improvement reduces the time and cost associated with qPCR and should be applicable in a variety of academic, clinical, and biotechnological settings.

  16. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo


    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  17. Detection of Francisella tularensis in blood by polymerase chain reaction.


    Long, G W; Oprandy, J J; Narayanan, R. B.; Fortier, A H; Porter, K R; Nacy, C.A.


    We developed a polymerase chain reaction-based assay for Francisella tularensis which we evaluated by using spiked blood samples and experimentally infected mice. The assay detected both type A and type B F. tularensis at levels equivalent to one CFU/microliter of spiked blood. Results from polymerase chain reaction-based assay of limiting dilutions of blood from mice infected with the live vaccine strain agreed closely with results from blood culture.



    Kouritzin, Michael A.; Hongwei Long


    In the context of simulating the transport of a chemical or bacterial contaminant through a moving sheet of water, we extend a well-established method of approximating reaction-diffusion equations with Markov chains by allowing convection, certain Poisson measure driving sources and a larger class of reaction functions. Our alterations also feature dramatically slower Markov chain state change rates often yielding a ten to one-hundred-fold simulation speed increase over the previous version o...

  19. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle


    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  20. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe


    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his...... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  1. The generalised self-sustaining chain reaction theory about ADS

    International Nuclear Information System (INIS)

    The basic connotation of ADS (accelerator driven system) is investigated from the point of view of generalized self-sustaining chain reaction. The ADS is composed of proton accelerator, neutron producing target and the subcritical reactor. This system can be viewed entirely as a generalized self sustaining chain reaction system. In this view of point, the accelerator with target, as a part of ADS, can be viewed as an energy-neutron transformer (energy be fed to accelerator to produce medium energy protons, neutrons be produced in the heavy target as a result of proton-heavy nucleus spallation reaction). In this generalized self-sustaining chain reaction system, the number of neutrons produced after a fission event is not only the fission neutrons but also the neutrons produced by the energy-neutron transformer. That is, the ADS has more effective secondary neutrons after a fission event. It is just these additional neutrons, the ADS can be in state of self-sustaining chain reaction (criticality), although the reactor part of ADS is in state of sub-criticality. The critical equation of the generalized self-sustaining chain reaction system is presented. The relationship between the effective multiplication factors of ADS and subcritical reactor part of ADS is also presented. The power output of ADS is represented by a function of the proton current, the subcritical reactivity of the reactor in ADS, the number of neutrons produced in spallation process per proton and etc. At last, the probable application of ADS in the future is investigated

  2. Detection of Listeria monocytogenes by using the polymerase chain reaction

    International Nuclear Information System (INIS)

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with 32P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains

  3. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna


    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  4. Characteristics of a chain thermal explosion as a function of the kinetic properties of reaction chains (United States)

    Azatyan, V. V.; Piloyan, A. A.; Saikova, G. R.; Smirnov, N. N.


    Study of the combustion and explosion of hydrogen‒carbon oxide‒air mixtures shows that the sharpness of a chain thermal explosion depends on the frequency of branching in a given branch of a reaction chain. It is established that varying the CO: H2 concentration allows us to observe and eliminate the degeneration of an explosion while maintaining the regimes of ignition and deflagration.

  5. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维


    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  6. The chain gas phase reactions. The present problems

    International Nuclear Information System (INIS)

    The results of investigations of chain gas phase reactions which are directed for solving practically important problems have been carried out. The problem of increasing methanol formation selectivity in the direct natural gas oxidation process is discussed. The peculiarities of cool flame of cyclic hydrocarbons, particularly cyclohexane which are containing in the different kinds of fuel. The influence of cool flame on intensity and full consumption of fuels burning is examined. Conjugated processes of SO2 conversion to SO3 and sulfur under effect of hydrocarbon and hydrogen oxidation chain gas phase reactions are considered. The results of discussed investigations can be served as a basis for the developing of industrial processes for conversion natural hydrocarbon row materials and also the ecological problems of utilization of SO2 gas ejected from thermoelectric power stations and metallurgical plants

  7. Polymerase chain reaction: A molecular diagnostic tool in periodontology


    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam


    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology w...

  8. Enteroviral pharyngitis diagnosed by reverse transcriptase-polymerase chain reaction.


    Sharland, M.; Hodgson, J.; Davies, E G; Booth, J.; Jeffery, S


    The role of enteroviruses in childhood pharyngitis was investigated using enteroviral specific reverse transcriptase-polymerase chain reaction (RT-PCR). Viral/bacterial throat swabs were taken from 50 children with acute pharyngitis and 26 controls. A positive culture was identified in only 26% of children with pharyngitis (adenovirus 10%, group A streptococci 2%), and none of the controls. Enteroviral RT-PCR was positive in 8% of the pharyngitis group and none of the controls. Enteroviruses ...

  9. Reaction chain modeling of denitrification reactions during a push-pull test (United States)

    Boisson, A.; de Anna, P.; Bour, O.; Le Borgne, T.; Labasque, T.; Aquilina, L.


    Field quantitative estimation of reaction kinetics is required to enhance our understanding of biogeochemical reactions in aquifers. We extended the analytical solution developed by Haggerty et al. (1998) to model an entire 1st order reaction chain and estimate the kinetic parameters for each reaction step of the denitrification process. We then assessed the ability of this reaction chain to model biogeochemical reactions by comparing it with experimental results from a push-pull test in a fractured crystalline aquifer (Ploemeur, French Brittany). Nitrates were used as the reactive tracer, since denitrification involves the sequential reduction of nitrates to nitrogen gas through a chain reaction (NO3- → NO2- → NO → N2O → N2) under anaerobic conditions. The kinetics of nitrate consumption and by-product formation (NO2-, N2O) during autotrophic denitrification were quantified by using a reactive tracer (NO3-) and a non-reactive tracer (Br-). The formation of reaction by-products (NO2-, N2O, N2) has not been previously considered using a reaction chain approach. Comparison of Br- and NO3- breakthrough curves showed that 10% of the injected NO3- molar mass was transformed during the 12 h experiment (2% into NO2-, 1% into N2O and the rest into N2 and NO). Similar results, but with slower kinetics, were obtained from laboratory experiments in reactors. The good agreement between the model and the field data shows that the complete denitrification process can be efficiently modeled as a sequence of first order reactions. The 1st order kinetics coefficients obtained through modeling were as follows: k1 = 0.023 h- 1, k2 = 0.59 h- 1, k3 = 16 h- 1, and k4 = 5.5 h- 1. A next step will be to assess the variability of field reactivity using the methodology developed for modeling push-pull tracer tests.

  10. Radioinitiation of Chain Branched Reactions and its Sensitization

    International Nuclear Information System (INIS)

    This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author)

  11. Convective polymerase chain reaction around micro immersion heater (United States)

    Hennig, Martin; Braun, Dieter


    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  12. Application of polymerase chain reaction to detect rearrangement of immunoglobulin heavy chain genes in lymphoproliferative disease. (United States)

    Khalil, S H; Siegrist, K; Akhtar, M


    As part of our routine work-up in the diagnosis of lymphoproliferative disease, we used a rapid polymerase chain reaction (PCR) assay to amplify the DNA fragments of the framework 3 (FR3) region of the immunoglobulin heavy (IgH) chain genes. The assay does not involve hybridization, nested priming, or sequencing of the amplified PCR product. It was performed on 66 specimens of B-cell lymphoproliferative disease, including acute lymphoblastic leukemia, chronic lymphocytic leukemia, multiple myeloma, hairy cell leukemia and follicular lymphoma. Twenty-six specimens of negative controls, including acute myeloid leukemia, chronic myeloid leukemia in myeloid transformation and idiopathic thrombocytopenic purpura, were also analyzed. The assay was performed with 77% sensitivity and 100% specificity. The standard IgH chain gene rearrangement by Southern blot analysis is reserved for the remaining negative cases if clinically indicated. PMID:17353588

  13. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    International Nuclear Information System (INIS)

    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves

  14. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique


    İLHAK, O. İrfan; Arslan, Ali


    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

  15. Identification of Erwinia stewartii by a ligase chain reaction assay.


    Wilson, W.J.; Wiedmann, M; Dillard, H. R.; Batt, C A


    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed...

  16. A chain reaction approach to modelling gene pathways. (United States)

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen


    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By


    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏


    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  18. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  19. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    Energy Technology Data Exchange (ETDEWEB)

    Liu Jinfeng [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail:; Shen Xingyan [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Zhu Debin [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)


    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency.

  20. Polymerase chain reaction: A molecular diagnostic tool in periodontology (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam


    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  1. Early detection of typhoid by polymerase chain reaction

    International Nuclear Information System (INIS)

    Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

  2. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy


    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  3. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang


    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  4. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes

    International Nuclear Information System (INIS)

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement. (paper)

  5. Nested methylation-specific polymerase chain reaction cancer detection method (United States)

    Belinsky, Steven A.; Palmisano, William A.


    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  6. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed


    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  7. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed


    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  8. Polymerase chain reaction: A molecular diagnostic tool in periodontology. (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam


    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  9. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Directory of Open Access Journals (Sweden)

    Rajendran Maheaswari


    Full Text Available This review discusses the principles of polymerase chain reaction (PCR and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  10. Detecting mycoplasma contamination in cell cultures by polymerase chain reaction. (United States)

    Uphoff, Cord C; Drexler, Hans G


    The detection of mycoplasmas in human and animal cell cultures is mandatory for every cell culture laboratory, because these bacteria are common contaminants, persist unrecognized in cell cultures for many years, and affect research results as well as the purity of cell culture products. The reliability of the mycoplasma detection depends on the sensitivity and specificity of the method and should also be convenient to be included in the basic routine of cell culture quality assessment. Polymerase chain reaction (PCR) detection is one of the acknowledged methodologies to detect mycoplasmas in cell cultures and cell culture products. Although the PCR offers a fast and simple technique to detect mycoplasmas, the method is also susceptible to errors and can produce false positive as well as false-negative results. Thus, the establishment and the routine application of the PCR assay require optimization and the inclusion of the appropriate control reactions. The presented protocol describes sample preparation, DNA extraction, PCR run, the analysis of the PCR products, and speciation of the contaminant. It also provides detailed information on how to avoid artifacts produced by the method. Established properly, PCR is a reliable, fast, and sensitive method and should be applied regularly to monitor the contamination status of cell cultures. PMID:21516400

  11. Controlling Hybridization Chain Reactions with pH. (United States)

    Idili, Andrea; Porchetta, Alessandro; Amodio, Alessia; Vallée-Bélisle, Alexis; Ricci, Francesco


    By taking inspiration from nature, where self-organization of biomolecular species into complex systems is finely controlled through different stimuli, we propose here a rational approach by which the assembly and disassembly of DNA-based concatemers can be controlled through pH changes. To do so we used the hybridization chain reaction (HCR), a process that, upon the addition of an initiator strand, allows to create DNA-based concatemers in a controlled fashion. We re-engineered the functional units of HCR through the addition of pH-dependent clamp-like triplex-forming domains that can either inhibit or activate the polymerization reaction at different pHs. This allows to finely regulate the HCR-induced assembly and disassembly of DNA concatemers at either basic or acidic pHs in a reversible way. The strategies we present here appear particularly promising as novel tools to achieve better spatiotemporal control of self-assembly processes of DNA-based nanostructures. PMID:26177980

  12. Circulating polymerase chain reaction chips utilizing multiple-membrane activation (United States)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin


    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.



    Andréia de Abreu; Rosane Lúcia Chicarelli Alcântara


    Supply Chain Management can be seen as a way to achieve integration of all corporate functions. In practice, Supply Chain Management is complex and characterized by numerous activities spread over multiple functions and organizations, which pose challenges to reach effective implementation. Based on literature review, the objective of this paper is to present the theoretical indications regarding professional profile recommended for the Supply Chain Management and discuss the role of these pr...

  14. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections



    AIM: To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).

  15. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  16. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei


    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  17. Identifying of meat species using polymerase chain reaction (PCR) (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah


    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  18. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  19. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi


    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  20. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)


    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  1. Branched chain amino acid profile in early chronic kidney disease

    Directory of Open Access Journals (Sweden)

    M Anil Kumar


    Full Text Available The nutritional status in chronic kidney disease (CKD patients is a predictor of prognosis during the first period of dialysis. Serum albumin is the most commonly used nutritional marker. Another index is plasma amino acid profile. Of these, the plasma levels of branched chain amino acids (BCAA, especially valine and leucine, correlate well with nutritional status. Plasma BCAAs were evaluated along with albumin and C-reactive protein in 15 patients of early stages of CKD and 15 age- and sex-matched healthy controls. A significant decrease in plasma valine, leucine and albumin levels was observed in CKD patients when compared with the controls (P <0.05. No significant difference in C-reactive protein (CRP levels was observed between the two groups. Malnutrition seen in our CKD patients in the form of hypoalbuminemia and decreased concentrations of BCAA points to the need to evaluate the nutritional status in the early stages itself. Simple measures in the form of amino acid supplementation should be instituted early to decrease the morbidity and mortality before start of dialysis in these patients.

  2. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E


    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  3. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M


    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.


    Directory of Open Access Journals (Sweden)

    Berezhnoy S. B.


    Full Text Available The possibility of using involute sprockets, more technologically advanced in manufacturing, compared with sprockets with straight, convex-concave profile of the lug on the criterion shock resistance circuit, the maximum permissible speed of the drive sprocket for bush roller chain drives and gears with a toothed chain. The comparative analysis of researches of operation of roller and tooth chain gearings with various steps and types of profiles of sprockets showed that in all cases with increase in a step of a chain the coefficient of speed of blow increases, and the increase in number of lugs at sprockets reduces the speed of blow of the hinge about sprockets tooth. Value of coefficient of speed of blow for couple an evolvent sprockets - a gear chain is much less than value of coefficient of speed of blow for couple a plug-roller chain –sprockets of any profile. Less noise during the work of tooth chain gearings is due to evolvent sprockets. As a result of researches it is established that on kinetic energy of impact of sprockets and the hinge of a chain, sprockets with an evolvent profile can be applied on an equal basis with the sprockets having concave-convex or rectilinear profiles of lugs. Respectively, evolvent sprockets can be used both in chain transfers with roller and with gear chains


    Directory of Open Access Journals (Sweden)

    Andréia de Abreu


    Full Text Available Supply Chain Management can be seen as a way to achieve integration of all corporate functions. In practice, Supply Chain Management is complex and characterized by numerous activities spread over multiple functions and organizations, which pose challenges to reach effective implementation. Based on literature review, the objective of this paper is to present the theoretical indications regarding professional profile recommended for the Supply Chain Management and discuss the role of these professionals in cross-functional business processes. The literature review demonstrated a growing interest in the thematic, especially because the “soft” aspects (human and behavioral to achieve supply chain internal and external integration. All functions must be involved in Supply Chain Management and supply chain managers have a critical role to play: challenge the supremacy of functions in the organizational structure, implementing the practice of "horizontal work" through cross-functional teams. Overall, this research contributes to academic and practical professionals by the description of the job profile of the supply chain managers and presentation of forms to achieve internal integration.

  6. The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers

    International Nuclear Information System (INIS)

    Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type

  7. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction. (United States)

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S


    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  8. Polymerase chain reaction for the diagnosis of viral hepatitis B and C.


    Bréchot, C


    Polymerase chain reaction is a highly sensitive technique for the detection of hepatitis B virus-DNA and hepatitis C virus-RNA in serum, liver tissue, and peripheral mononuclear blood cells. In chronic hepatitis B, it is particularly useful for identification of infectious subjects who are hepatitis B surface antigen positive and anti-hepatitis B e antigen antibody-positive, and for follow up of hepatitis B virus infections in liver transplantation programmes. Polymerase chain reaction detect...

  9. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae.



    We report a set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae. The results of this assay on strains of V. cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe. The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells. The polymerase chain reaction method could directly detect...

  10. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF


    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  11. Hybridization probes for conventional DNA fingerprinting used as single primers in the polymerase chain reaction to distinguish strains of Cryptococcus neoformans.


    Meyer, W.; Mitchell, T G; Freedman, E Z; Vilgalys, R


    In conventional DNA fingerprinting, hypervariable and repetitive sequences (minisatellite or microsatellite DNA) are detected with hybridization probes. As demonstrated here, these probes can be used as single primers in the polymerase chain reaction (PCR) to generate individual fingerprints. Several conventional DNA fingerprinting probes were used to prime the PCR, yielding distinctive, hypervariable multifragment profiles for different strains of Cryptococcus neoformans. PCR fingerprinting ...

  12. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G


    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  13. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan


    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

  14. Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    JANNOTTI-PASSOS Liana Konovaloff


    Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

  15. Minimum energy reaction profiles for ATP hydrolysis in myosin. (United States)

    Grigorenko, Bella L; Kaliman, Ilya A; Nemukhin, Alexander V


    The minimum energy reaction profiles corresponding to two possible reaction mechanisms of adenosine triphosphate (ATP) hydrolysis in myosin are computed in this work within the framework of the quantum mechanics-molecular mechanics (QM/MM) method by using the same partitioning of the model system to the QM and MM parts and the same computational protocol. On the first reaction route, one water molecule performs nucleophilic attack at the phosphorus center P(γ) from ATP while the second water molecule in the closed protein cleft serves as a catalytic base assisted by the Glu residue from the myosin salt bridge. According to the present QM/MM calculations consistent with the results of kinetic studies this reaction pathway is characterized by a low activation energy barrier about 10 kcal/mol. The computed activation energy barrier for the second mechanism, which assumes the penta-coordinated oxyphosphorane transition state upon involvement of single water molecule in the reaction, is considerably higher than that for the two-water mechanism. PMID:21839658

  16. Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis. (United States)

    Ote, Isabelle; Taminiau, Bernard; Duprez, Jean-Noël; Dizier, Isabelle; Mainil, Jacques G


    Staphylococcus aureus is recognized worldwide as a pathogen causing many serious diseases in humans and animals, and is the most common aetiological agent of clinical and subclinical bovine mastitis. The importance of evaluating the combination of S. aureus virulence factors has been emphasized both in human and veterinary medicine, and knowledge about the genetic variability within different S. aureus populations would help in the design of efficient treatments. The aim of the present study was to determine the genetic profiles of S. aureus strains isolated from milk of cows suffering from clinical and subclinical mastitis in Belgium. The presence of about forty virulence-associated genes was investigated by specific polymerase chain reaction (PCR) amplification. A high number of genotypic subtypes were observed, demonstrating further the large variation in the presence of virulence genes in S. aureus isolates and the considerable diversity of strains populations that are able to cause mastitis in cows. In accordance with other studies, we showed that some genes are associated with mastitis-causing S. aureus isolates, whereas others are absent or rarely present. We also further highlighted the presence of conserved gene combinations, namely the enterotoxigenic egc-cluster and the bovine pathogenicity island SaPIbov. Importantly, the presence of isolates carrying genes coding for toxins involved in important human infections makes the milk of cows with mastitis a potential reservoir for these toxins, and therefore a potential danger in human health, which strengthens the importance to consider raw milk consumption and its processing very carefully. PMID:21708435

  17. DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

    International Nuclear Information System (INIS)

    A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms

  18. Method of carbon chain extension using novel aldol reaction

    Energy Technology Data Exchange (ETDEWEB)

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek


    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  19. Limitations of clonality analysis of B cell proliferations using CDR3 polymerase chain reaction


    Hoeve, M A; Krol, A D G; Philippo, K; Derksen, P W B; Veenendaal, R. A.; Schuuring, E; Kluin, Ph M; Krieken, J.H.J.M. van


    Background/Aims—Detection of clonal immunoglobulin heavy chain (IgH) rearrangements by the polymerase chain reaction (PCR) is an attractive alternative to Southern blotting in lymphoma diagnostics. However, the advantages and limitations of PCR in clonality analysis are still not fully appreciated. In this study, clonality was analysed by means of PCR, focusing in particular on the sample size requirements when studying extremely small samples of polyclonal and monoclonal lesions.

  20. A new measurement approach of ionizing radiation in irradiated trout (Oncorhynchus mykiss) by Randomly Polymorphic DNA-Polymerase Chain Reaction. (United States)

    Şakalar, Ergün; Mol, Sühendan


    Trout (Oncorhynchus mykiss) were irradiated at doses of 0.250, 0.500, 1, 3, 5, 7 and 9 kGy in gamma cell. DNAs were extracted from the irradiated samples before and after storage. 1ERP primers were designed, and RAPD-PCR (Randomly Polymorphic DNA-Polymerase Chain Reaction) was applied to make randomly amplifications on the DNA of the irradiated samples. Agarose gel profiles of irradiated fish were obtained to determine change of band profiles. In addition, DNA fragmentation occurring in each dose was determined by comet assay for the verification of methodology developed in this study. The molecular methodology was developed to estimate ionizing radiation (IR) level in irradiated fish. This methodology allows the analysis of the trout irradiated up to the dose limit of around 0.5 kGy and stored for a period of three months. PMID:27407216

  1. Immunomagnetic Separation Combined with Polymerase Chain Reaction for the Detection of Alicyclobacillus acidoterrestris in Apple Juice


    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen


    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agar...

  2. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.


    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam


    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  4. Polyvinylpyrrolidone-Agarose Gel Electrophoresis Purification of Polymerase Chain Reaction-Amplifiable DNA from Soils


    Young, Charles C.; Burghoff, Robert L.; Keim, Lois G.; Minak-Bernero, Vera; Lute, James R.; Hinton, Stephen M.


    This communication describes a modification of agarose gel electrophoresis to provide a rapid and simple method for the purification of polymerase chain reaction-amplifiable DNA from soil. This modification is to add polyvinylpyrrolidone to the agarose gel. The polyvinylpyrrolidone addition retards the electrophoretic mobility of denaturing phenolic compounds so that they do not comigrate with nucleic acids.

  5. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints." (United States)

    Phelps, Tara L.; And Others


    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  6. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory (United States)

    Elkins, Kelly M.


    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  7. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.; Ahlford, A.; Syvänen, A.-C; Kutter, Jörg Peter; Wolff, Anders

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple and...

  8. Comparison of a conventional polymerase chain reaction with real-time polymerase chain reaction for the detection of neurotropic viruses in cerebrospinal fluid samples


    M Ramamurthy; Alexander, M; Aaron, S; Kannangai, R.; Ravi, V.; Sridharan, G.; A.M. Abraham


    Purpose : To compare a conventional polymerase chain reaction (PCR) and real-time PCR for the detection of neurotropic DNA viruses. Materials and Methods : A total of 147 cerebrospinal fluid (CSF) samples was collected from patients attending a tertiary care hospital in South India for a period from 2005 to 2008. All these samples were tested using a conventional multiplex/uniplex PCR and a real-time multiplex/uniplex PCR. This technique was used to detect a large number of herpes viruses res...

  9. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Institute of Scientific and Technical Information of China (English)

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou


    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  10. Physician access to drug profiles to reduce adverse reactions (United States)

    Yasnoff, William A.; Tomkins, Edward L.; Dunn, Louise M.


    Adverse drug reactions (ADRs) are a major source of preventable morbidity and mortality, especially among the elderly, who use more drugs and are more sensitive to them. The insurance industry has recently addressed this problem through the implementation of drug interaction alerts to pharmacists in conjunction with immediate online claims adjudication for almost 60% of prescriptions (expected to reach 90% within 5 years). These alerts are based on stored patient drug profiles maintained by pharmacy benefit managers (PBMs) which are updated whenever prescriptions are filled. While these alerts are very helpful, the pharmacist does not prescribe, resulting in time-consuming and costly delays to contact the physician and remedy potential interactions. We have developed and demonstrated the feasibility of the PINPOINT (Pharmaceutical Information Network for prevention of interactions) system for making the drug profile and interaction information easily available to the physician before the prescription is written. We plan to test the cost-effectiveness of the system in a prospective controlled clinical trial.

  11. Acyl chains of phospholipase D transphosphatidylation products in Arabidopsis cells: a study using multiple reaction monitoring mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Dominique Rainteau

    Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.

  12. Estimation and Preparation of the Hypervariable Regions I/II Templates for Mitochondrial DNA Typing From Human Bones and Teeth Remains Using Singleplex Quantitative Polymerase Chain Reaction. (United States)

    Le, Thien Ngoc; Van Phan, Hieu; Dang, Anh Tuan Mai; Nguyen, Vy Thuy


    A method was designed for estimating and sequencing of mitochondrial DNA (mtDNA) that effectively and more quickly provides a complete mtDNA profile. In this context, we have developed this novel strategy for typing mtDNA from 10 bones and teeth remains (3 months to 44 years). The quantification of mtDNA was achieved by singleplex real-time polymerase chain reaction of the hypervariable region I fragment (445 bp) and hypervariable region II fragment (617 bp). Combined with the melting curve analysis, we have determined as little as 10 pg of mtDNA template that is suitable for sequence analysis. Furthermore, quantitative polymerase chain reaction products were directly used for following step of mtDNA typing by Sanger sequencing. This method allows the profile to be completely provided for faster human identification. PMID:27356010

  13. A microfluidic device providing continuous-flow polymerase chain reaction heating and cooling

    International Nuclear Information System (INIS)

    The objective of this study is to describe a new type of microfluidic device that could be used to manipulate fluid temperature in many microfluidic applications. The key component is a composite material containing a thermally conductive phase placed in a purposeful manner to manipulate heat flow into and out of an embedded microchannel. In actual use, the device is able to vary temperature along a defined flow path with remarkable precision. As a demonstration of capability, a functional prototype was designed and fabricated using four layers of patterned copper laminated between alternating layers of polyimide and acrylic. The key fabrication steps included laser micromachining, acid etching, microchannel formation, and hot lamination. In order to achieve the desired temperature variations along the microchannel, an outer optimization loop and an inner finite element analysis loop were used to iteratively obtain a near-optimal copper pattern. With a minor loss of generality, admissible forms were restricted to comb-like patterns. For a given temperature profile, the pattern was found by refining a starting guess based on a deterministic rubric. Thermal response was measured using fine thermocouples placed at critical locations along the microchannel wall. At most of these points, the agreement between measured and predicted temperatures was within 1 °C, and temperature gradients as high as ±45 °C mm−1 (equivalent to ±90 °C s−1 at 2 μl min−1 flow rate) were obtained within the range of 59–91 °C. The particular profile chosen for case study makes it possible to perform five cycles of continuous-flow polymerase chain reaction (PCR) in less than 15 s, i.e. it entails five successive cycles of cooling from 91 to 59 °C, rapid reheating from 59 to 73 °C, slow reheating from 73 to 76 °C, and a final reheating from 73 to 91 °C, using a resistively heated source at 100 °C at and a thermoelectrically cooled sink at 5

  14. A microfluidic device providing continuous-flow polymerase chain reaction heating and cooling (United States)

    Harandi, A.; Farquhar, T.


    The objective of this study is to describe a new type of microfluidic device that could be used to manipulate fluid temperature in many microfluidic applications. The key component is a composite material containing a thermally conductive phase placed in a purposeful manner to manipulate heat flow into and out of an embedded microchannel. In actual use, the device is able to vary temperature along a defined flow path with remarkable precision. As a demonstration of capability, a functional prototype was designed and fabricated using four layers of patterned copper laminated between alternating layers of polyimide and acrylic. The key fabrication steps included laser micromachining, acid etching, microchannel formation, and hot lamination. In order to achieve the desired temperature variations along the microchannel, an outer optimization loop and an inner finite element analysis loop were used to iteratively obtain a near-optimal copper pattern. With a minor loss of generality, admissible forms were restricted to comb-like patterns. For a given temperature profile, the pattern was found by refining a starting guess based on a deterministic rubric. Thermal response was measured using fine thermocouples placed at critical locations along the microchannel wall. At most of these points, the agreement between measured and predicted temperatures was within 1 °C, and temperature gradients as high as ±45 °C mm-1 (equivalent to ±90 °C s-1 at 2 μl min-1 flow rate) were obtained within the range of 59-91 °C. The particular profile chosen for case study makes it possible to perform five cycles of continuous-flow polymerase chain reaction (PCR) in less than 15 s, i.e. it entails five successive cycles of cooling from 91 to 59 °C, rapid reheating from 59 to 73 °C, slow reheating from 73 to 76 °C, and a final reheating from 73 to 91 °C, using a resistively heated source at 100 °C at and a thermoelectrically cooled sink at 5 °C.

  15. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma... (United States)


    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... sample (100 to 2000 ng/5 μl) with one of the following 45 μl PCR cocktails: (i) 5 μl 10x PCR buffer, 1...

  16. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.;


    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  17. Optimization of asymmetric polymerase chain reaction for rapid fluorescent DNA sequencing. (United States)

    Wilson, R K; Chen, C; Hood, L


    A high-throughput method for the preparation of single-stranded template DNA, which is suitable for sequence analysis using fluorescent labeling chemistry, is described here. In this procedure, the asymmetric polymerase chain reaction is employed to amplify recombinant plasmid or bacteriophage DNA directly from colonies or plaques. The use of amplification primers located at least 200 base pairs 5' to the site of sequencing primer annealing removes the need for extensive purification of the asymmetric polymerase chain reaction product. Instead, the single-stranded product DNA is purified by a simple isopropanol precipitation step and then directly sequenced using fluorescent dye-labeled oligonucleotides. This method significantly reduces the time and labor required for template preparation and improves fluorescent DNA sequencing strategies by providing a much more uniform yield of single-stranded DNA. PMID:2317375

  18. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    Directory of Open Access Journals (Sweden)

    V.K. Jain


    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  19. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples. (United States)

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal


    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  20. Light chain editing generates polyreactive antibodies in chronic graft-versus-host reaction


    Witsch, Esther J.; Cao, Hong; Fukuyama, Hidehiro; Weigert, Martin


    The chronic graft-versus-host (cGvH) reaction is a model of induced lupus caused by alloreactive CD4+ T cells from a Bm-12 mouse in a C57BL/6 recipient. We used this cGvH reaction in C57BL/6 anti-DNA H chain transgenic mice, 56R/B6, to understand the structure, specificity, and origin of the induced autoantibodies (auto-Abs). We found anti-DNA Abs that reacted to several different antigens, such as phosphatidylserine, myelin basic protein, thyroglobulin, histone, insulin, cytochrome C, and β-...

  1. Instability Criterion of One-Dimensional Detonation Wave with Three-Step Chain Branching Reaction Model

    Institute of Scientific and Technical Information of China (English)

    TENG Hong-Hui; JIANG Zong-Lin


    @@ One-dimensional detonation waves are simulated with the three-step chain branching reaction model, and the instability criterion is studied.The ratio of the induction zone length and the reaction zone length may be used to decide the instability, and the detonation becomes unstable with the high ratio.However, the ratio is not invariable with different heat release values.The critical ratio, corresponding to the transition from the stable detonation to the unstable detonation, has a negative correlation with the heat release.An empirical relation of the Chapman-Jouguet Mach number and the length ratio is proposed as the instability criterion.

  2. Quantitative interpretation to the chain mechanism of free radical reactions in cyclohexane pyrolysis

    Institute of Scientific and Technical Information of China (English)

    Yingxian Zhao; Bo Shen; Feng Wei


    Pyrolysis of cyclohexane was conducted with a plug flow tube reactor in the temperature range of 873-973 K.Based on the experimental data,the mechanism and kinetic model of cyclohexane pyrolysis reaction were proposed.The kinetic analysis shows that overall conversion of cyclohexane is a first order reaction,of which the rate constant increased from 0.0086 to 0.0225 to 0.0623 s- 1 with the increase of temperature from 873 to 923 to 973 K,and the apparent activation energy was determined to be 155.0+1.0 kJ.mo1-1.The mechanism suggests that the cyclohexane is consumed by four processes:the homolysis of C-C bond (Path Ⅰ),the homolysis of C-H bond (Path Ⅱ) in reaction chain initiation,the H-abstraction of various radicals from the feed molecules in reaction chain propagation (Path Ⅲ),and the process associated with coke formation (Path Ⅳ).The reaction path probability (RPP) ratio of Xpath Ⅰ ∶ Xpath Ⅱ∶ XPath Ⅲ ∶ XPath Ⅳ was 0.5420 ∶ 0.0045 ∶ 0.3897 ∶ 0.0638 at 873 K,and 0.4336 ∶ 0.0061 ∶ 0.4885 ∶ 0.0718 at 973 K,respectively.

  3. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng


    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  4. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.


    Dewit, D.; Wootton, M.; Allan, B; Steyn, L


    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not c...

  5. DNA amplification by polymerase chain reaction from brain tissues embedded in paraffin.


    Gall, K; Pavelić, J.; Jadro-Santel, D.; Poljak, M; Pavelić, K.


    A method which enables analysis of DNA from archival paraffin embedded normal and malignant brain tissue is described. The demonstration of a 317-bp long beta-actin DNA sequence by the polymerase chain reaction (PCR) was used to identify which fixation procedure, deparaffinization time and DNA extraction procedure would give the best results. Tissue specimens 1-39 years old were included in the experiments. Specimens fixed in either 10% formalin, Carnoy's or AMeX fixative were found to be bes...

  6. Microdissection and polymerase chain reaction amplification of genomic DNA from histological tissue sections.


    Moskaluk, C A; Kern, S.E.


    Polymerase chain reaction (PCR)-based assays are being used increasingly to study the molecular genetic changes that occur in minute cellular lesions that are identified in histological sections. It is often desirable to microdissect the cells of interest in a lesion, isolating them from surrounding normal tissue to obtain the purest representation of genomic DNA possible. We present here an optimized microdissection and DNA extraction protocol that reliably produces PCR-amplifiable DNA from ...

  7. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.


    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P


    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate p...

  8. Uji Diagnostik Polymerase Chain Reaction –Restriction Fragment Length Polymorphism Dalam Menegakkan Diagnosis Onikomikosis.


    Lubis, Nova Zairina


    Background: Onychomycosis is a fungal infection of one or more units of the nail caused by dermatophytes, or mold and nondermatophytes yeast. Investigations are needed to establish the diagnosis of onychomycosis before starting treatment. Several investigations methods for diagnosing onychomycosis such as microscopic examination with 20% KOH, fungal culture, histopathology examination with PAS staining (Periodic acid Schiff) and PCR (Polymerase Chain Reaction), for culture methods require a l...

  9. Detection of Mycoplasma pneumoniae by polymerase chain reaction and nonradioactive hybridization in microtiter plates.


    Lüneberg, E; Jensen, J S; M. Frosch


    In order to improve the diagnosis of a Mycoplasma pneumoniae infection, we developed a polymerase chain reaction (PCR)-based assay. The gene encoding elongation factor Tu (tuf) was selected as the target sequence. Oligonucleotides derived from variable stretches of the tuf gene were able to prime the amplification of a 950-bp fragment exclusively when M. pneumoniae DNA was used as the template. The sensitivity of the assay was increased 10-fold when the amplification products were hybridized ...

  10. Amplification of human minisatellites by the polymerase chain reaction: towards DNA fingerprinting of single cells.


    Jeffreys, A J; Wilson, V.; Neumann, R.; Keyte, J


    Hypervariable minisatellites can be amplified from human DNA by the polymerase chain reaction, using primers from DNA flanking the minisatellite to amplify the entire block of tandem repeat units. Minisatellite alleles up to 5-10 kb long can be faithfully amplified. At least six minisatellite loci can be co-amplified from the same DNA sample and simultaneously detected to provide a reproducible and highly variable DNA fingerprint which can be obtained from nanogram quantities of human DNA. Th...

  11. Genomic fingerprints of Staphylococcus aureus of bovine origin by polymerase chain reaction-based DNA fingerprinting.


    Matthews, K R; Kumar, S. J.; O'Conner, S. A.; Harmon, R J; Pankey, J W; Fox, L. K.; Oliver, S P


    Staphylococcus aureus (n = 75) isolated from mammary secretions of cows with subclinical and clinical mastitis from several geographic locations in the USA were examined using polymerase chain reaction-based DNA fingerprinting. DNA fingerprints were produced using a synthetic oligonucleotide primer (5'GTAACGCC3') to produce a distinct spectrum of amplified DNA fragments facilitating a high degree of resolution for differentiating S. aureus strains. PCR-based DNA fingerprinting grouped the 75 ...

  12. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction


    Harmey, Judith H.; Harmey, Matthew A.


    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  13. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J


    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  14. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics


    Li Jiang; Matthew Mancuso; Zhengda Lu; Gunkut Akar; Ethel Cesarman; David Erickson


    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics ...

  15. Compact-like kink in a real electrical reaction-diffusion chain

    International Nuclear Information System (INIS)

    We demonstrate experimentally the compact-like kinks existence in a real electrical reaction-diffusion chain. Our measures show that such entities are strictly localized and consequently present a finite spatial extent. We show equally that the kink velocity is threshold-dependent. A theoretical quantification of the critical coupling under which propagation fails is also achieved and reveals that nonlinear coupling leads to a propagation failure reduction

  16. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis


    Padmavathy L; Rao L; Veliath A


    Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR) is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patien...

  17. Detection of Durum Wheat Pasta Adulteration in the Jordanian Market by Polymerase Chain Reaction Technology


    H. Al-Rousan; N.D. Al-Hmoud; Ibrahim, M. A.; B.O. Hayek


    Taking into account the impact of monitoring food adulteration on the quality of food products, the aim of this study was to use polymerase chain reaction technology to detect possible adulteration of durum wheat pasta products in the Jordanian market. Cetyltrimethyl ammonium bromide method was applied for extracting genomic DNA from twenty six randomly collected pasta products, the results suggested the suitability of this method for DNA extraction from pasta products. Specific primers were ...

  18. The design and construction of an electronic model of the chain reaction process

    International Nuclear Information System (INIS)

    The design and construction of an electronic model simulating the nuclear chain reaction process up to three successive neutron generations is briefly described. This model is equipped with a special sound effect. However, a tape recorder can be attached and replayed in synchronism with the display with minimum hardware modifications. In this manner, it can function as a useful educational aid. The circuit is built around easily available ttl integrated circuits. (author)

  19. A polymerase chain reaction assay to determine infection of Aedes polynesiensis by Wuchereria bancrofti


    Nicolas, L.; Luquiaud, P.; Lardeux, Frédéric; Mercer, D.R.


    The sensitivity of a previously described polymerase chain reaction (PCR) assay was improved to detect a single mosquito, infected by as few as 1-2 microfilariae of #Wuchereria bancrofti$, among 20-50 uninfected mosquitoes. Wild-caught #Aedes polynesiensis$ were used to compare assessment of infection by dissection of individuals with the PCR assay of pools of mosquitoes. The PCR assay was at least as sensitive as dissection for detection of mosquitoes infected with #W. bancrofti$. (Résumé d'...

  20. Effect of fungal and plant secondary metabolites on polimerase chain reaction (PCR)


    Thaler, Nejc; Bajc, Marko


    Secondary metabolites are organic compounds that can be found in both fungi and plants, where they play an important role as defensive and signal molecules, or provide other kinds of advantage in natural selection, but are not directly involved in normal growth, development and reproduction of an organism. When working with DNA techniques, it is the secondary metabolites that most often affect the efficiency of polymerase chain reaction (PCR), either by hindering cell lysis, causing ...

  1. Preliminary evaluation of the ligase chain reaction for specific detection of Neisseria gonorrhoeae.


    Birkenmeyer, L; Armstrong, A S


    Rapid identification of Neisseria gonorrhoeae in clinical specimens is essential for effective control. Traditional culture requires a minimum of 24 h, and for some specimens harboring gonococci, the gonococci fail to grow or are misidentified. The recently described ligase chain reaction (LCR) is a highly specific and sensitive DNA amplification technique which was evaluated as an alternative to routine culture. Three LCR probe sets were used. Two of the probe sets were directed against the ...

  2. Differentiation of Giardia duodenalis from other Giardia spp. by using polymerase chain reaction and gene probes.


    Mahbubani, M H; Bej, A K; Perlin, M H; Schaefer, F W; Jakubowski, W; Atlas, R M


    Giardia spp. are waterborne organisms that are the most commonly identified pathogenic intestinal protozoans in the United States. Current detection techniques for Giardia species in water include microscopy and immunofluorescence techniques. Species of the genus Giardia are classified on the basis of taxonomic criteria, such as cell morphology, and on host specificity. We have developed a polymerase chain reaction- and gene probe-based detection system specific for Giardia spp., which can di...

  3. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction.


    Alexander, H S; Key, D.W.; Nagy, E.


    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb Ba...

  4. Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase chain reaction technology.


    Tzianabos, T; Anderson, B E; McDade, J E


    A polymerase chain reaction (PCR) procedure for detecting rickettsial DNA was developed and shown to be specific for Rickettsia rickettsii and R. conorii, the etiologic agents of Rocky Mountain spotted fever (RMSF) and Boutonneuse fever, respectively. Blood clots were obtained from nine confirmed RMSF patients and six controls and analyzed for the presence of rickettsial DNA by the PCR method. A defined region of the rickettsial genome was successfully amplified from seven of the nine clinica...

  5. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    International Nuclear Information System (INIS)

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  6. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman


    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  7. Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

    International Nuclear Information System (INIS)

    Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C2H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH3; and ammonia, which produces NH2. In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

  8. A string reaction coordinate for the folding of a polymer chain (United States)

    Leitold, Christian; Lechner, Wolfgang; Dellago, Christoph


    We investigate the crystallization mechanism of a single, flexible homopolymer chain with short range attractions. For a sufficiently narrow attractive well, the system undergoes a first-order like freezing transition from an expanded disordered coil to a compact crystalline state. Based on a maximum likelihood analysis of committor values computed for configurations obtained by Wang-Landau sampling, we construct a non-linear string reaction coordinate for the coil-to-crystal transition. In contrast to a linear reaction coordinate, the string reaction coordinate captures the effect of different degrees of freedom controlling different stages of the transition. Our analysis indicates that a combination of the energy and the global crystallinity parameter Q6 provide the most accurate measure for the progress of the transition. While the crystallinity paramter Q6 is most relevant in the initial stages of the crystallization, the later stages are dominated by a decrease in the potential energy.

  9. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)


    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  10. Quantitative Profiling of Feruloylated Arabinoxylan Side-Chains from Graminaceous Cell Walls (United States)

    Schendel, Rachel R.; Meyer, Marleen R.; Bunzel, Mirko


    Graminaceous arabinoxylans are distinguished by decoration with feruloylated monosaccharidic and oligosaccharidic side-chains. Although it is hypothesized that structural complexity and abundance of these feruloylated arabinoxylan side-chains may contribute, among other factors, to resistance of plant cell walls to enzymatic degradation, quantitative profiling approaches for these structural units in plant cell wall materials have not been described yet. Here we report the development and application of a rapid and robust method enabling the quantitative comparison of feruloylated side-chain profiles in cell wall materials following mildly acidic hydrolysis, C18-solid phase extraction (SPE), reduction under aprotic conditions, and liquid chromatography with diode-array detection/mass spectrometry (LC-DAD/MS) separation and detection. The method was applied to the insoluble fiber/cell wall materials isolated from 12 whole grains: wild rice (Zizania aquatica L.), long-grain brown rice (Oryza sativa L.), rye (Secale cereale L.), kamut (Triticum turanicum Jakubz.), wheat (Triticum aestivum L.), spelt (Triticum spelta L.), intermediate wheatgrass (Thinopyrum intermedium), maize (Zea mays L.), popcorn (Zea mays L. var. everta), oat (Avena sativa L.) (dehulled), barley (Hordeum vulgare L.) (dehulled), and proso millet (Panicum miliaceum L.). Between 51 and 96% of the total esterified monomeric ferulates were represented in the quantified compounds captured in the feruloylated side-chain profiles, which confirms the significance of these structures to the global arabinoxylan structure in terms of quantity. The method provided new structural insights into cereal grain arabinoxylans, in particular, that the structural moiety α-l-galactopyranosyl-(1→2)-β-d-xylopyranosyl-(1→2)-5-O-trans-feruloyl-l-arabinofuranose (FAXG), which had previously only been described in maize, is ubiquitous to cereal grains. PMID:26834763

  11. Contamination profiles of short-chain polychlorinated n-alkanes in foodstuff samples from Japan

    Energy Technology Data Exchange (ETDEWEB)

    Matsukami, Hidenori; Kurunthachalam, S.; Ohi, Etsumasa; Takasuga, Takumi [Shimadzu Techno Research, Inc., Kyoto (Japan); Iino, Fukuya; Nakanishi, Junko [National Inst. of Advanced Industrial Science and Technology, Tsukuba (Japan)


    Polychlorinated n-alkanes (PCAs) are group of chemicals manufactured by chlorination of liquid n-paraffin or paraffin wax that contain 30 to 70% chlorine by weight. Large amounts of PCAs are widely used as plasticizers for vinyl chloride, lubricants, paints, and flame retardants and number of other industrial applications. Annual global production of PCAs is approximately 300 kilo tones, with a majority having medium-carbon-chain (C14-C19) length. According to the investigation made by Kagaku Kogyo Nippon-Sha, the annual consumption of PCAs in Japan was about 83,000 tons in between 1986-2001. Short-carbon-chain (C10-C13) has been placed on the Priority Substance List under Canadian Environmental Protection Act and on the Environmental Protection Agency Toxic Release Inventory in the USA due to its potential to act as tumor promoters in mammals. Data on environment levels of PCAs is meager, nevertheless, PCAs have been measured at relatively high concentrations in biota from Sweden, biota, sediment from Canada and marine biota and human milk from the Canadian Arctic. In our earlier study, we reported concentrations of short-chain PCAs from sewage treatment plant (STP) collected from Tama River, Tokyo and river water and sediment from Tokyo and Osaka. STP influent water contained greater shortchain PCAs concentrations than STP effluent. In addition, some river water and sediment samples contained detectable concentrations of short-chain PCAs, which was similar to other industrial countries. However, there is no study conducted to explore the contamination profiles of short-chain PCAs in human foodstuff samples. In the present study, we analyzed eleven foodstuff samples that were purchased from various supermarkets in order to know the short-chain PCAs concentrations in the foodstuff and possible human total daily intake (TDI) amounts.

  12. Updating the Nuclear Reaction Rate Library (REACLIB) I. Experimental Reaction Rates of the Proton-Proton Chain

    International Nuclear Information System (INIS)

    REACLIB is one of the most comprehensive and popular astrophysical reaction rate libraries. However, its experimentally obtained rates for light isotopes still rely mainly on the Caughlan and Fowler (1988) compilation and have never been updated despite the progress in many relevant nuclear astrophysics experiments. Moreover, due to fitting errors REACLIB is not reliable at temperatures lower than 107K. In this work we establish the formalism for updating the obsolete Caughlan-Fowler experimental rates of REACLIB. Then we use the NACRE compilation and results from the LUNA experiments to update some important charged-particle induced rates of REACLIB focusing on the proton-proton chain. The updated rates (available also in digital form) can now be used in the low temperature regime (below 107K) which was forbidden to the old version of REACLIB. (authors)

  13. Cutaneous adverse drug reaction profile in a tertiary care out patient setting in Eastern India

    Directory of Open Access Journals (Sweden)

    Abanti Saha


    Conclusions: Cutaneous adverse drug reaction profile in this study is similar in many ways to studies conducted earlier in India. Incidence of life-threatening reactions like SJS-TEN was higher compared with studies conducted abroad. Reaction time and lesion patterns are helpful in identifying an offending drug in the setting of multiple drug therapy.

  14. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G


    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  15. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping, E-mail:


    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling.

  16. Monte Carlo Simulations of Density Profiles for Hard-Sphere Chain Fluids Confined Between Surfaces

    Institute of Scientific and Technical Information of China (English)


    Covering a wide range of bulk densities, density profiles for hard-sphere chain fluids (HSCFs) with chain length of 3,4,8,20,32 and 64 confined between two surfaces were obtained by Monte Carlo simulations using extended continuum configurational-bias (ECCB) method. It is shown that the enrichment of beads near surfaces is happened at high densities due to the bulk packing effect, on the contrary, the depletion is revealed at low densities owing to the configurational entropic contribution. Comparisons with those calculated by density functional theory presented by Cai et al. indicate that the agreement between simulations and predictions is good. Compressibility factors of bulk HSCFs calculated using volume fractions at surfaces were also used to test the reliability of various equations of state of HSCFs by different authors.

  17. Genome editing. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations. (United States)

    Gantz, Valentino M; Bier, Ethan


    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype, whereas individuals homozygous for two copies of the allele will display a mutant phenotype. We have developed a method called the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome-editing system for generating autocatalytic mutations, to produce homozygous loss-of-function mutations. In Drosophila, we found that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome, thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  18. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan


    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  19. Zoster ... "a lmost" ... sine herpete: diagnostic utility of real time-polymerase chain reaction. (United States)

    Vena, Gino A; Apruzzi, Doriana; Vestita, Michelangelo; Calvario, Agata; Foti, Caterina; Cassano, Nicoletta


    Zoster sine herpete is a particular form of varicella zoster virus (VZV) infection characterized by segmental pain and dysesthesia, without any cutaneous lesions ever becoming perceptible. This report describes the case of a female patient, presenting with intercostal pain associated with a single papulo-vesicular lesion localized within the same area. Thanks to such a lesion, real time-polymerase chain reaction (PCR) analysis on vesicle fluid swab was possible, thus revealing a significant number of VZV genome copies. This innovative tool has proven essential to diagnose this abortive form of herpes zoster, which would otherwise have remained unidentified. PMID:21213602

  20. Direct detection of Mycobacterium tuberculosis in sputum by polymerase chain reaction and DNA hybridization.


    Nolte, F S; Metchock, B; McGowan, J. E.; Edwards, A; Okwumabua, O; Thurmond, C; Mitchell, P S; Plikaytis, B; Shinnick, T


    A polymerase chain reaction (PCR) assay for the rapid diagnosis of pulmonary tuberculosis was developed by using oligonucleotide primers to amplify a fragment of IS6110, an insertion sequence repeated multiple times in the chromosome of Mycobacterium tuberculosis. Sediment obtained from sputa processed by the N-acetyl-L-cysteine-NaOH method was suspended in a simple lysis buffer and was heated at 100 degrees C for 30 min prior to amplification. A dUTP-uracil N-glycosylase PCR protocol was use...

  1. Characterization of a nested polymerase chain reaction assay for detection of parvovirus B19.


    Patou, G.; Pillay, D.; Myint, S; Pattison, J.


    The characterization and application of a nested polymerase chain reaction (PCR) assay for the detection of human parvovirus B19 DNA is described. The assay was evaluated with 149 diagnostic serum samples (collected up to 150 days after the onset of symptoms) previously tested by dot blot hybridization for B19 DNA and by class-specific capture radioimmunoassays for the detection of B19 immunoglobulin M (IgM) and IgG. B19 DNA was detectable by the PCR in 70% of the sera. There was a statistica...

  2. Use of polymerase chain reaction for detection of Listeria monocytogenes in food.


    Niederhauser, C; Candrian, U; Höfelein, C; M. Jermini; Bühler, H P; Lüthy, J


    A previously described polymerase chain reaction (PCR) assay (B. Furrer, U. Candrian, C. Höfelein, and J. Lüthy, J. Appl. Bacteriol. 70:372-379, 1991) was used to analyze food for the presence of Listeria monocytogenes. Food samples were artificially contaminated to develop two procedures to detect the organism following enrichment steps. Procedure A was based on dilution of the enrichment broth followed by lysis of the bacteria and direct analysis of the lysate with PCR. With procedure A and...



    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini


    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  4. A highly sensitive aptasensor for OTA detection based on hybridization chain reaction and fluorescent perylene probe. (United States)

    Wang, Bin; Wu, Yuanya; Chen, Yanfen; Weng, Bo; Xu, Liqun; Li, Changming


    An optical aptasensor was developed for ultrasensitive detection of ochratoxin A (OTA) based on hybridization chain reaction (HCR) amplification strategy and fluorescent perylene probe (PAPDI)/DNA composites. Dendritic DNA concatamers were synthesized by HCR strategy and modified on magnetic nanoparticles through aptamer as medium. A large amount of PAPDI probe aggregated under the induction of DNA concatamers and caused fluorescence quenching. In the presence of OTA, the PAPDI/DNA composites were released from magnetic nanoparticles due to the strong affinity between aptamer and OTA. In ethanol, PAPDI monomers disaggregated and produced strong fluorescence. The present method displays excellent sensitivity and selectivity towards OTA. PMID:26938491

  5. Rapid method for separation of bacterial DNA from humic substances in sediments for polymerase chain reaction.


    Tsai, Y L; Olson, B H


    The polymerase chain reaction (PCR) was used to amplify an Escherichia coli 16S ribosomal gene fragment from sediments with high contents of humic substances. Total DNA was extracted from 1 g of E. coli seeded or unseeded samples by a rapid freeze-and-thaw method. Several approaches (use of Bio-Gel P-6 and P-30 and Sephadex G-50 and G-200 columns, as well as use of the Stoffel fragment) were used to reduce interference with the PCR. The best results were obtained when crude DNA extracts conta...

  6. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots


    Liang Gaofeng; Ma Chao; Zhu Yanliang; Li Shuchun; Shao Youhua; Wang Yong; Xiao Zhongdang


    Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase ...

  7. Diagnosis of Dengue by Using Reverse Transcriptase-Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Miagostovich Marize Pereira


    Full Text Available A rapid identification of dengue viruses from clinical samples by using a nested reverse transcriptase-polymerase chain reaction (RT-PCR procedure was carried out for diagnostic and epidemiological purposes. RT-PCR identified DEN-1 and DEN-2 viruses in 41% (41/100 of previously confirmed cases and provided an accurate confirmation of DHF in four fatal cases. RT-PCR was also useful for detecting and typing dengue viruses in suspected cases, allowing a rapid identification of new serotypes in endemic areas

  8. Development and validation of a Myxoma virus real-time polymerase chain reaction assay


    Albini, S.; Sigrist, B; Guttinger, R; Schelling, C.; Hoop, R K; Vogtlin, A


    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  9. Development and validation of a Myxoma virus real-time polymerase chain reaction assay. (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea


    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  10. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA


    Ana Lisa do Vale Gomes; Fábio L Melo; Roberto P Werkhauser; Frederico GC Abath


    This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR) protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA). Th...

  11. Real-Time Polymerase Chain Reaction for Detection of Strongyloides stercoralis in Stool


    Sultana, Yasmin; Jeoffreys, Neisha; Watts, Matthew R.; Gilbert, Gwendolyn L.; Lee, Rogan


    The use of real-time polymerase chain reaction (PCR) for detection of Strongyloides stercoralis in stool has recently been described. We compared five DNA extraction methods by using normal human stool spiked with Strongyloides ratti and tested by using a real-time PCR. The PowerSoil kit was found to be the best technique in terms of sensitivity and ease of use. The PCR detected DNA extracted from one spiked S. ratti larva diluted 10−2. The PowerSoil kit was then used to extract DNA from 160 ...

  12. Ultra sensitive detection of Listeria monocytogenes in milk by the polymerase chain reaction (PCR). (United States)

    Starbuck, M A; Hill, P J; Stewart, G S


    The polymerase chain reaction (PCR) has been used to detect Listeria monocytogenes in whole milk at a level of 0.1 cfu per 30 ml. This high degree of sensitivity has been achieved following enzymatic digestion, polysulphonone membrane filtration and amplification of a nucleotide sequence within the promoter region of hlyA. Key elements of the procedure are the absence of enrichment culture and a complete solubilization of the membrane filter, ensuring total nucleic acid recovery. The simplicity of the protocol coupled with high sample volumes and exquisite sensitivity extends the relevance of PCR within food and environmental microbiology. PMID:1368996

  13. Rapid detection of Helicobacter pylori in gastric biopsy material by polymerase chain reaction.


    Hammar, M.; Tyszkiewicz, T; Wadström, T.; O'Toole, P W


    By using primers based on the sequence of a species-specific antigen of Helicobacter pylori (P. O'Toole, S.M. Logan, M. Kostrzynska. T. Wadström, and T.J. Trust, J. Bacteriol. 173:505-513, 1991), a protocol was established for detection of this microorganism in gastric biopsy samples by the polymerase chain reaction (PCR). A single primer pair was used to specifically amplify a 298-bp sequence in a rapid two-step PCR. The primers exhibited the same specificity in PCR as that which we reported...

  14. Use of the Polymerase Chain Reaction in the Detection of Bovine Leukosis


    Kelly, Emma Jane


    A diagnostic test for bovine leukosis was developed using the polymerase chain reaction (PCR) to amplify a 375 base pair region in the gag gene of the proviral genome. Blood samples were collected from 3 adult Holstein cows shown to be infected with bovine leukosis virus (BLV) by the agar-gel immunodiffusion (AGID) technique. The 3 samples were mixed and the composite blood was used to inoculate 10 cows. Five of the cows were inoculated with 0.1 ml of blood, and the other cows were inocula...

  15. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction


    Alexandrakis, G.; JALALI, S; Gloor, P


    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In o...

  16. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction. (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M


    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples. PMID:25197027

  17. A Novel Nested Polymerase Chain Reaction (n-PCR) Assay for Identifying Sorghum nitidum


    Wei, Shasha; Zhirui DENG; Liping YIN; Yi, Jianping; Renqi WU; Qin CHEN


    This work developed a novel nested polymerase chain reaction (n-PCR) assay to identify Sorghum nitidum (S. nitidum). It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band ...

  18. Sensitive detection of Treponema pallidum by using the polymerase chain reaction.


    Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D


    We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions ...

  19. Synthesis and Intramolecular [4+2] Cycloaddition Reactions of 4-Pyridazinecarbonitriles with Alkyne Side Chains


    Norbert Haider; Günther Fülep


    The preparation of a series of new 3-(alkynyl-X)-substituted 4-pyridazinecarbonitriles 2-5 (X = O, NH) is described. The compounds are shown to undergo thermally induced intramolecular Diels-Alder reactions with inverse electron demand, affording the fused benzonitriles 6-8. Incorporation of a 1,2-phenylene unit into the side chain, as in the case of compounds 10 and 13, results in a more favorable conformation of the dienophilic substructure and thus to a pronounced acceleration of the [4+2]...

  20. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .


    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  1. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana


    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  2. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  3. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto


    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  4. Bayesian Lorentzian profile fitting using Markov-Chain Monte Carlo: An observer's approach

    CERN Document Server

    Gruberbauer, M; Weiss, W W


    Aims. Investigating stochastically driven pulsation puts strong requirements on the quality of (observed) pulsation frequency spectra, such as the accuracy of frequencies, amplitudes, and mode life times and -- important when fitting these parameters with models -- a realistic error estimate which can be quite different to the formal error. As has been shown by other authors, the method of fitting Lorentzian profiles to the power spectrum of time-resolved photometric or spectroscopic data via the Maximum Likelihood Estimation (MLE) procedure delivers good approximations for these quantities. We, however, intend to demonstrate that a conservative Bayesian approach allows to treat this problem in a more consistent way. Methods. We derive a conservative Bayesian treatment for the probability of Lorentzian profiles being present in a power spectrum and describe its implementation via evaluating the probability density distribution of parameters by using the Markov-Chain Monte Carlo (MCMC) technique. In addition, ...

  5. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.


    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  6. Vibrational nonequilibrium in chain branching reactions of hydrogen combustion using quasi-classical trajectory analysis (United States)

    Voelkel, Stephen; Raman, Venkat; Varghese, Philip


    In high-speed reactive flows in scramjets, thermal nonequilibrium is introduced in the flow via shock waves. Though rotational and translational energy modes relax back to equilibrium quickly, vibrational relaxation is comparable to the bulk mixing and reaction timescales. The discrepancy between vibration and rotation/translation energy distributions can dramatically alter on the initiation of the fuel oxidation process. For continuum-scale applications, thermal nonequilibrium effects are derived from the rovibrational state-specific reaction and scattering rates associated with the chemical mechanism. In this work, the state-specific reaction rates are calculated for the chain branching reactions in the hydrogen combustion mechanism using a quasi-classical trajectory (QCT) framework. The state-specific rates are incorporated into a multiple temperature continuum-scale model whereby each species is characterized by a Boltzmann distribution parametrized by its own vibrational temperature. The flame ignition rates are implemented in a CFD code to simulate a reactive coflow. Funded by AFOSR FA9550-12-1-0460.

  7. Multivariate High Order Statistics of Measurements of the Temporal Evolution of Fission Chain-Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Mattingly, J.K.


    The development of high order statistical analyses applied to measurements of the temporal evolution of fission chain-reactions is described. These statistics are derived via application of Bayes' rule to conditional probabilities describing a sequence of events in a fissile system beginning with the initiation of a chain-reaction by source neutrons and ending with counting events in a collection of neutron-sensitive detectors. Two types of initiating neutron sources are considered: (1) a directly observable source introduced by the experimenter (active initiation), and (2) a source that is intrinsic to the system and is not directly observable (passive initiation). The resulting statistics describe the temporal distribution of the population of prompt neutrons in terms of the time-delays between members of a collection (an n-tuplet) of correlated detector counts, that, in turn, may be collectively correlated with a detected active source neutron emission. These developments are a unification and extension of Rossi-a, pulsed neutron, and neutron noise methods, each of which measure the temporal distribution of pairs of correlated events, to produce a method that measures the temporal distribution of n-tuplets of correlated counts of arbitrary dimension n. In general the technique should expand present capabilities in the analysis of neutron counting measurements.

  8. Solving the SAT problem using a DNA computing algorithm based on ligase chain reaction. (United States)

    Wang, Xiaolong; Bao, Zhenmin; Hu, Jingjie; Wang, Shi; Zhan, Aibin


    A new DNA computing algorithm based on a ligase chain reaction is demonstrated to solve an SAT problem. The proposed DNA algorithm can solve an n-variable m-clause SAT problem in m steps and the computation time required is O (3m+n). Instead of generating the full-solution DNA library, we start with an empty test tube and then generate solutions that partially satisfy the SAT formula. These partial solutions are then extended step by step by the ligation of new variables using Taq DNA ligase. Correct strands are amplified and false strands are pruned by a ligase chain reaction (LCR) as soon as they fail to satisfy the conditions. If we score and sort the clauses, we can use this algorithm to markedly reduce the number of DNA strands required throughout the computing process. In a computer simulation, the maximum number of DNA strands required was 2(0.48n) when n=50, and the exponent ratio varied inversely with the number of variables n and the clause/variable ratio m/n. This algorithm is highly space-efficient and error-tolerant compared to conventional brute-force searching, and thus can be scaled-up to solve large and hard SAT problems. PMID:17904730

  9. Polymerase chain reaction detection of candidatus liberibacter asiatic associated with citrus huanglonbing

    Directory of Open Access Journals (Sweden)

    G.P. Jagtap


    Full Text Available Polymerase chain reaction diagnosis of Candidatus liberibacter asiatic associated with citrus Huanglonbing disease is molecular technique which is used for detection of disease when pathogen present is very low concentration in disease sample. Among these three DNA isolation methods viz., commercial kit method, sodium sulphite method and membrane bard nucleic acid technique, sodium sulphite method is cost effective for commercial use. In nucleic acid membrane method for DNA extraction isolation there is no use of liquid nitrogen. Polymerase chain reaction detection of disease is based on principal of thermal cycling in which PCR instrument allow to run generally 60-65 thermal cycle, during PCR operation it allow different stages of cycle at different temperatures for different period of time i.e. initiation (940C, denaturation (940C, primer annealing (600C, extension/elongation step (720C, final elongation (720C and holding temperature (40C. PCR based diagnosis system is developed for detection of greening bacteria. The comparative cost of detection by various combinations of reagent and sampling time was determined and cost effective technology was standardized and validated.

  10. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. (Univ. of Illinois, Chicago (USA)); Wunder, J.S.; Andrulis, I.L. (Mount Sinai Hospital, Toronto, Ontario (Canada)); Gazdar, A.F. (National Cancer Inst., Bethesda, MD (USA)); Willman, C.L.; Griffith, B. (Univ. of New Mexico, Albuquerque (USA)); Von Hoff, D.D. (Univ. of Texas, San Antonio (USA))


    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  11. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

    Directory of Open Access Journals (Sweden)

    Mahmood Shishegar


    Full Text Available Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2% of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%. Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensi-tivity profile in our geographic area.

  12. Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran (United States)

    Shishegar, Mahmood; Faramarzi, Abolhasan; Kazemi, Tayyebe; Bayat, Akbar; Motamedifar, Mohammad


    Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR) assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2%) of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%). Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensitivity profile in our geographic area. PMID:23115412

  13. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    International Nuclear Information System (INIS)

    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

  14. Predicting enzyme targets for cancer drugs by profiling human Metabolic reactions in NCI-60 cell lines

    Directory of Open Access Journals (Sweden)

    Ching Wai-Ki


    Full Text Available Abstract Background Drugs can influence the whole metabolic system by targeting enzymes which catalyze metabolic reactions. The existence of interactions between drugs and metabolic reactions suggests a potential way to discover drug targets. Results In this paper, we present a computational method to predict new targets for approved anti-cancer drugs by exploring drug-reaction interactions. We construct a Drug-Reaction Network to provide a global view of drug-reaction interactions and drug-pathway interactions. The recent reconstruction of the human metabolic network and development of flux analysis approaches make it possible to predict each metabolic reaction's cell line-specific flux state based on the cell line-specific gene expressions. We first profile each reaction by its flux states in NCI-60 cancer cell lines, and then propose a kernel k-nearest neighbor model to predict related metabolic reactions and enzyme targets for approved cancer drugs. We also integrate the target structure data with reaction flux profiles to predict drug targets and the area under curves can reach 0.92. Conclusions The cross validations using the methods with and without metabolic network indicate that the former method is significantly better than the latter. Further experiments show the synergism of reaction flux profiles and target structure for drug target prediction. It also implies the significant contribution of metabolic network to predict drug targets. Finally, we apply our method to predict new reactions and possible enzyme targets for cancer drugs.

  15. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.


    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E


    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  16. Design of Multiplex Polymerase Chain Reaction (PCR Method for Molecular Detection of Yersinia pestis Bacterium

    Directory of Open Access Journals (Sweden)

    Mohammad Soleimani


    Full Text Available Objective: Yersinia pestis, the causative agent of the zoonotic plague infection, is a majorpublic health concern both as a threat and potential bioweapon. The objective of thepresent study was to establish a uniplex and multiplex - polymerase chain reaction (PCRtest for the specific detection of Y. pestis.Materials and Methods: PCR reactions performed by three pair primers which targetedthe caf1 and pla genes located on the pFra and pPst plasmids and the irp2 chromosomalgene located on the ‘pathogenicity island’. After TA cloning of the PCR products, the test’slimit of detection (LOD was determined. For evaluating the specificity, PCR reactionswere performed with negative control bacteria.Results: Assays were performed with the genome of Y. pestis which produced three DNAfragments of the expected sizes 300, 400 and 520 bp which corresponded to the irp2,caf1 and pla genes, respectively. The lower LoD was 370 copy numbers for the caf1 geneand 21 for the pla gene. In PCR reactions that used negative control bacteria, detectablefragments were not observed.Conclusion: Our method clearly discriminated Y. pestis DNA. The rapidity, specificityand sensitivity of this procedure suggest that it can serve as a useful alternative methodfor the inoculation of laboratory animals or the use of specific culture media for routineplaque surveillance and outbreak investigations. Another vital result of this study was theestablishment of Y. pestis molecular detection technique in Iran.

  17. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria


    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  18. Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis.

    Directory of Open Access Journals (Sweden)

    Melissa K Gregory

    Full Text Available BACKGROUND: Δ6-Desaturase (Fads2 is widely regarded as rate-limiting in the conversion of dietary α-linolenic acid (18:3n-3; ALA to the long-chain omega-3 polyunsaturated fatty acid docosahexaenoic acid (22:6n-3; DHA. However, increasing dietary ALA or the direct Fads2 product, stearidonic acid (18:4n-3; SDA, increases tissue levels of eicosapentaenoic acid (20:5n-3; EPA and docosapentaenoic acid (22:5n-3; DPA, but not DHA. These observations suggest that one or more control points must exist beyond ALA metabolism by Fads2. One possible control point is a second reaction involving Fads2 itself, since this enzyme catalyses desaturation of 24:5n-3 to 24:6n-3, as well as ALA to SDA. However, metabolism of EPA and DPA both require elongation reactions. This study examined the activities of two elongase enzymes as well as the second reaction of Fads2 in order to concentrate on the metabolism of EPA to DHA. METHODOLOGY/PRINCIPAL FINDINGS: The substrate selectivities, competitive substrate interactions and dose response curves of the rat elongases, Elovl2 and Elovl5 were determined after expression of the enzymes in yeast. The competitive substrate interactions for rat Fads2 were also examined. Rat Elovl2 was active with C(20 and C(22 polyunsaturated fatty acids and this single enzyme catalysed the sequential elongation reactions of EPA→DPA→24:5n-3. The second reaction DPA→24:5n-3 appeared to be saturated at substrate concentrations not saturating for the first reaction EPA→DPA. ALA dose-dependently inhibited Fads2 conversion of 24:5n-3 to 24:6n-3. CONCLUSIONS: The competition between ALA and 24:5n-3 for Fads2 may explain the decrease in DHA levels observed after certain intakes of dietary ALA have been exceeded. In addition, the apparent saturation of the second Elovl2 reaction, DPA→24:5n-3, provides further explanations for the accumulation of DPA when ALA, SDA or EPA is provided in the diet. This study suggests that Elovl2 will be

  19. Correlating intravenous radiographic contrast media reactions with the allergic profile

    International Nuclear Information System (INIS)

    To determine the relevance of allergy as a predisposing factor in reactions to radiographic contrast media, the authors investigated the incidence of allergy among 100 randomly selected patients undergoing intravenous excretory urography and CT. The study population consisted of 50 reactors and 50 nonreactos to radiographic contrast media. All 100 subjects completed an allergy history, percutaneous allergy tests, and an in vitro specific IgE assay to common allergens. Thirty-four of 50 reactors had a positive allergy history, in contrast to 15 of 50 nonreactors (P < .001). Twenty-seven reactors had positive skin tests, in contrast to 12 of 50 nonreactors (P < .005). In vitro IgE assay results are pending. The results indicate that patients with positive histories or positive skin tests or both are at an increased risk for reactions to radiographic contrast media

  20. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations (United States)

    Gantz, Valentino M.; Bier, Ethan


    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype while individuals homozygous for two copies of the allele will display a mutant phenotype. Here, we develop a method that we refer to as the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome editing system for generating autocatalytic mutations to generate homozygous loss-of-function mutations. We demonstrate in Drosophila that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  1. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction. (United States)

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P


    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted. Images PMID:1696290

  2. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina


    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  3. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    Institute of Scientific and Technical Information of China (English)

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan


    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  4. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications. (United States)

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav


    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  5. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi


    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  6. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  7. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.


    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  8. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Directory of Open Access Journals (Sweden)

    Liang Gaofeng


    Full Text Available Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR. Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA. The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  9. Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Joshua E Lane


    Full Text Available The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

  10. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))


    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  11. Detection of hepatopancreatic parvovirus (HPV) in wild shrimp from India by nested polymerase chain reaction (PCR). (United States)

    Manjanaik, B; Umesha, K R; Karunasagar, Indrani; Karunasagar, Iddya


    The prevalence of hepatopancreatic parvovirus (HPV) in wild penaeid shrimp samples from India was studied by nested polymerase chain reaction (PCR) using primers designed in our laboratory. The virus could be detected in 9 out of 119 samples by non-nested PCR. However, by nested PCR 69 out of 119 samples were positive. The PCR results were confirmed by hybridization with digoxigenin-labelled DNA probe. Shrimp species positive by non-nested PCR included Penaeus monodon, Penaeus indicus and Penaeus semisulcatus and by nested PCR Parapenaeopsis stylifera, Penaeus japonicus, Metapenaeus monoceros, M. affinis, M. elegans, M. dobsoni, M. ensis and Solenocera choprai. This is the first report on the prevalence of HPV in captured wild shrimp from India. PMID:15819441

  12. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis

    Directory of Open Access Journals (Sweden)

    Padmavathy L


    Full Text Available Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patients with various types of cutaneous tuberculosis were subjected to PCR. Results: An overall positivity of 64% was observed, which is comparable to other series. Seventy five percent of lupus vulgaris cases, 62.2% of tuberculosis verrucosa cutis and 50% of scrofuloderma cases showed PCR positivity. Conclusion: Though useful, the cost and the technique involved limit the use of PCR in developing countries like ours.

  13. Midtrimester fetal herpes simplex-2 diagnosis by serology, culture and quantitative polymerase chain reaction. (United States)

    Curtin, William M; Menegus, Marilyn A; Patru, Maria-Magdalena; Peterson, C Jeanne; Metlay, Leon A; Mooney, Robert A; Stanwood, Nancy L; Scheible, Amy L; Dorgan, Angela


    The acquisition of herpes simplex virus (HSV) in utero comprises a minority of neonatal herpes infections. Prenatal diagnosis is rare. We describe a midtrimester diagnosis of fetal HSV-2 infection. Ultrasound at 20 weeks for elevated maternal serum α-fetoprotein (MSAFP) showed lagging fetal growth, echogenic bowel, echogenic myocardium, and liver with a mottled pattern of echogenicity. Amniocentesis demonstrated normal karyotype, elevated AFP and positive acetylcholinesterase. Culture isolated HSV-2 with an aberrant growth pattern. Maternal serology was positive for HSV-2. Quantitative DNA polymerase chain reaction (PCR) showed 59 million copies/ml. Fetal autopsy demonstrated widespread tissue necrosis but only sparse HSV-2 inclusions. Fetal HSV-2 infection can be suspected when an elevated MSAFP accompanies ultrasound findings suggesting perinatal infection. Maternal HSV serology, amniotic fluid culture and quantitative PCR are recommended for diagnostic certainty and counseling. PMID:23075531

  14. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR

    Directory of Open Access Journals (Sweden)

    Seiki Kuramitsu


    Full Text Available Polymerase chain reaction (PCR-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3' end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science.

  15. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction. (United States)

    Alexander, H S; Key, D W; Nagy, E


    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb BamHI fragment of the Ontario 1598 ILTV strain. Thirty-four of the Ontario isolates and all of the New Brunswick isolates were amplified successfully. This suggests that the selected primers would be useful for the majority of the isolates encountered in outbreaks of ILTV. Images Figure 1. Figure 2. PMID:9442943

  16. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.


    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  17. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing. (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo


    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  18. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra


    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  19. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S


    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.


    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha


    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  1. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction. (United States)

    Bell, D A


    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes. PMID:1684153

  2. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction. (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng


    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  3. Rapid isolation of DNA from fresh and preserved fish scales for polymerase chain reaction. (United States)

    Yue, G H; Orban, L


    We developed a simple and inexpensive method to extract DNA from fresh and preserved fish scales. The procedure is based on boiling the scales in 5% Chelex 100, followed by digestion with proteinase K and subsequent absorption of genomic DNA using silica. A single fresh scale from larger species (e.g., tilapia) or a few scales from smaller species (e.g., 4 scales from zebrafish) provide over 200 ng of DNA, enough for at least 40 polymerase chain reaction amplifications. The procedure is applicable for DNA isolation not only from fresh and ethanol-preserved scales, but also from dried and formaldehyde-treated samples, and thus might be useful for investigating specimens stored in museums and other collections. Since the removal of a few scales is a gentle means of sample collection, this technique will allow analysis of genetic diversity, mating systems, and parentage in populations of endangered or ornamental fish with minimal experimental influence. PMID:14961356

  4. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou


    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  5. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.


    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  6. The use of polymerase chain reaction for early diagnosis of tuberculosis in Mycobacterium tuberculosis culture

    Directory of Open Access Journals (Sweden)

    M. Chagas


    Full Text Available Early diagnosis plays a vital role in controlling tuberculosis. The conventional methodology is slow, with results taking several weeks, in addition to having low sensitivity, especially in clinical paucibacillary samples. The objective of this study was to evaluate the use of polymerase chain reaction (PCR on solid medium culture for a rapid diagnosis of tuberculosis, mainly in cases of negative sputum smears. Forty sputum samples were collected from inpatients with tuberculosis treated for less than 2 days. Bacilloscopy, PCR for sputum, culture on Löwestein-Jensen (LJ solid medium, and daily PCR from culture were performed on each sample. DNA extracted from the BCG vaccine, which contains attenuated bacillus Calmette-Guérin, was used as the positive control. Smear microscopy showed 68.6% sensitivity, 80% specificity, 96% positive predictive value, and 26.7% negative predictive value, with culture on LJ medium as the gold standard. Culture at day 28 showed 74.3% sensitivity and 100% specificity. PCR of DNA extracted from sputum amplified a 1027-bp fragment of the 16s RNA gene, showing 22.9% sensitivity and 60% specificity. PCR performed with DNA extracted from daily culture showed that, from the 17th to the 40th day, the sensitivity (85.7% and specificity (60% were constant. We conclude that a 17-day culture is a good choice for rapid diagnosis and to interfere with the transmission chain of tuberculosis.

  7. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang


    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  8. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.


    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  9. Molecular differentiation of Angiostrongylus costaricensis, A. cantonensis, and A. vasorum by polymerase chain reaction- restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L


    Full Text Available Angiostrongylus cantonensis, A. costaricensis, and A. vasorum are etiologic agents of human parasitic diseases. Their identification, at present, is only possible by examining the adult worm after a 40-day period following infection of vertebrate hosts with the third-stage larvae. In order to obtain a diagnostic tool to differentiate larvae and adult worm from the three referred species, polymerase chain reaction-restriction fragment length polymorphism was carried out. The rDNA second internal transcribed spacer (ITS2 and mtDNA cytochrome oxidase I regions were amplified, followed by digestion of fragments with the restriction enzymes RsaI, HapII, AluI, HaeIII, DdeI and ClaI. The enzymes RsaI and ClaI exhibited the most discriminating profiles for the differentiation of the regions COI of mtDNA and ITS2 of rDNA respectively. The methodology using such regions proved to be efficient for the specific differentiation of the three species of Angiostrongylus under study.

  10. Morphological and polymerase chain reaction-restriction fragment lenght polymorphism characterization of Biomphalaria kuhniana and Biomphalaria amazonica from Colombia

    Directory of Open Access Journals (Sweden)

    Luz E Velásquez


    Full Text Available In Colombia, five Biomphalaria planorbid species are known: B. kuhniana, B. straminea, B. peregrina, B. canonica and B. oligoza(var. B. philippiana. Among them, B. straminea is intermediate host of Schistosoma mansoni and B. peregrina has been found to be experimentally susceptible to this parasite. B. straminea is commonly confused with B. kuhniana and they have been clustered together with B. intermedia in the complex named B. straminea. The difficulties involved in the specific identification, based on morphological data, have motivated the use of new techniques as auxiliary tools in cases of inconclusive morphological identification of such planorbid. In the present study, five Biomphalaria populations from the Colombian Amazon region and from Interandian Valleys were morphologically identified and characterized by polymerase chain reaction-restriction fragment lenght polymorphism directed at the internal transcribed spacer region of the rRNA gene, followed by digestion of the generated fragment with restriction enzymes (DdeI, AluI, RsaI, MvaI and HaeIII. Known profiles of the Brazilian species B. straminea, B. peregrina, B. kuhniana, B. intermedia and B. amazonica, besides B. kuhniana from Colombia, were used for comparison. The five populations under study were morphologically and molecularly identified as B. kuhniana and B. amazonica.

  11. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Energy Technology Data Exchange (ETDEWEB)

    Liu Dayu, E-mail: [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Zhou Xiaomian, E-mail: [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China)


    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil-water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: Black-Right-Pointing-Pointer Droplet formation in a capillary. Black-Right-Pointing-Pointer Transport the droplet using oscillation-flow. Black-Right-Pointing-Pointer Oscillation droplet PCR. Black-Right-Pointing-Pointer Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil-water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 {mu}L) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to

  12. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    International Nuclear Information System (INIS)

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

  13. Leptospira spp detection by Polymerase Chain Reaction (PCR) in clinical samples of captive black-capped Capuchin monkey (Cebus apella)


    Scarcelli Eliana; Piatti Rosa Maria; Fedullo José Daniel Luzes; Simon Faiçal; Cardoso Maristela Vasconcellos; Castro Vanessa; Miyashiro Simone; Genovez Margareth Élide


    Leptospirosis is a widely distributed zoonosis that affects domestic and wild animals, and that has the man as the end point of its epidemiological chain. Leptospirosis diagnosis in primates is more difficult than in other animal species, as clinical signs and lesions are less evident and antibody response is detected only for short periods. The aim of this article was to describe the detection of Leptospira spp using polymerase chain reaction (PCR), in clinical samples from one captive black...

  14. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation. (United States)

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K


    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA. PMID:27393216

  15. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction (United States)

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant


    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  16. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip (United States)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang


    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  17. Amplifying genes using the polymerase chain reaction: A promising diagnostic tool

    International Nuclear Information System (INIS)

    The power to amplify genetic material several millionfold using the polymerase chain reaction (PCR) has greatly enhanced the ability of molecular biologists to examine and manipulate genes. We have used the PCR reaction to detect bluetongue virus (BTV) in infected animals and are currently able to serogroup, serotype and determine the geographic origin of a BTV isolate. Similarly, using a combination of hybridization analyses and direct sequencing of the PCR products we can rapidly detect avian influenza virus, Newcastle disease virus and Mycoplasma and predict if we have nucleic acid sequences that are characteristic of a virulent or avirulent isolate. The ability to manipulate genetic information has made it possible to generate proteins containing deletions or create chimeric proteins which contain additions to their sequences. Such studies are important for the understanding of immune responses to various protein epitopes. Besides its sensitivity, PCR has the advantage of speed over some other detection systems. A comprehensive detection and diagnosis can be done in a few hours compared with several weeks previously required for virus isolations. However, there are disadvantages to using PCR. Because of its ability to amplify a sequence several millionfold, contaminants other than the target species may be amplified and since the DNA polymerase used in PCR has no editing or proofreading functions, errors may be quickly incorporated into the final PCR product. 13 refs, 8 figs

  18. Real-time polymerase chain reaction for diagnosis and quantitation of negative strand of chikungunya virus. (United States)

    Chiam, Chun Wei; Chan, Yoke Fun; Loong, Shih Keng; Yong, Sara Su Jin; Hooi, Poh Sim; Sam, I-Ching


    Quantitative real-time polymerase chain reaction (qRT-PCR) is useful for diagnosis and studying virus replication. We developed positive- and negative-strand qRT-PCR assays to detect nsP3 of chikungunya virus (CHIKV), a positive-strand RNA alphavirus that causes epidemic fever, rash, and arthritis. The positive- and negative-strand qRT-PCR assays had limits of quantification of 1 and 3 log10 RNA copies/reaction, respectively. Compared to a published E1 diagnostic assay using 30 laboratory-confirmed clinical samples, the positive-strand nsP3 qRT-PCR assay had higher R(2) and efficiency and detected more positive samples. Peak viral load of 12.9 log(10) RNA copies/mL was reached on day 2 of illness, and RNA was detectable up to day 9, even in the presence of anti-CHIKV IgM. There was no correlation between viral load and persistent arthralgia. The positive-strand nsP3 assay is suitable for diagnosis, while the negative-strand nsP3 assay, which uses tagged primers to increase specificity, is useful for study of active viral replication kinetics. PMID:23886793

  19. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases. (United States)

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing


    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  20. Who uses pharmacy for flu vaccinations? Population profiling through a UK pharmacy chain. (United States)

    Anderson, Claire; Thornley, Tracey


    Background There is a need to increase influenza vaccination rates in England particularly among those who are under 65 years of age and at-risk because of other conditions and treatments. Objective To understand the profile of people accessing flu vaccination services within a large pharmacy chain. Method Pharmacists requested people who had been vaccinated in 2014/15 to complete a questionnaire. Data was captured electronically on vaccine delivery levels across 1201 pharmacies. Deprivation profiles were calculated using the Carstairs index. Results 1741 patients from a total of 55 pharmacies completed the survey. Convenience and accessibility remain the key reasons for attending pharmacy. Pharmacy services are accessed by people from all postcode areas, including some from the most deprived localities. Conclusion Pharmacy flu vaccination services complement those provided by general practitioners to help improve overall coverage and vaccination rates for patients in at-risk groups. These services are highly accessed by patients from all socio demographic areas, and seem to be particularly attractive to carers, frontline healthcare workers, and those of working age. PMID:26821372

  1. Leading coordinate analysis of reaction pathways in proton chain transfer: Application to a two-proton transfer model for the green fluorescent protein

    International Nuclear Information System (INIS)

    The 'leading coordinate' approach to computing an approximate reaction pathway, with subsequent determination of the true minimum energy profile, is applied to a two-proton chain transfer model based on the chromophore and its surrounding moieties within the green fluorescent protein (GFP). Using an ab initio quantum chemical method, a number of different relaxed energy profiles are found for several plausible guesses at leading coordinates. The results obtained for different trial leading coordinates are rationalized through the calculation of a two-dimensional relaxed potential energy surface (PES) for the system. Analysis of the 2-D relaxed PES reveals that two of the trial pathways are entirely spurious, while two others contain useful information and can be used to furnish starting points for successful saddle-point searches. Implications for selection of trial leading coordinates in this class of proton chain transfer reactions are discussed, and a simple diagnostic function is proposed for revealing whether or not a relaxed pathway based on a trial leading coordinate is likely to furnish useful information

  2. Characterization of Biomphalaria orbignyi, Biomphalaria peregrina and Biomphalaria oligoza by polymerase chain reaction and restriction enzyme digestion of the internal transcribed spacer region of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Spatz Linus


    Full Text Available The correct identification of Biomphalaria oligoza, B. orbignyi and B. peregrina species is difficult due to the morphological similarities among them. B. peregrina is widely distributed in South America and is considered a potential intermediate host of Schistosoma mansoni. We have reported the use of the polymerase chain reaction and restriction fragment length polymorphism analysis of the internal transcribed spacer region of the ribosomal DNA for the molecular identification of these snails. The snails were obtained from different localities of Argentina, Brazil and Uruguay. The restriction patterns obtained with MvaI enzyme presented the best profile to identify the three species. The profiles obtained with all enzymes were used to estimate genetic similarities among B. oligoza, B. peregrina and B. orbignyi. This is also the first report of B. orbignyi in Uruguay.

  3. Bolus ingestion of individual branched-chain amino acids alters plasma amino acid profiles in young healthy men


    Matsumoto, Takuya; Nakamura, Koichi; Matsumoto, Hideki; Sakai, Ryosei; Kuwahara, Tomomi; Kadota, Yoshihiro; Kitaura, Yasuyuki; SATO, JUICHI; Shimomura, Yoshiharu


    Physiological conditions in humans affect plasma amino acid profiles that might have potential for medical use. Because the branched-chain amino acids (BCAAs) leucine, isoleucine and valine are used as medicines and supplements, we investigated the acute effects of individual BCAAs (10–90 mg/kg body weight) or mixed BCAAs ingested as a bolus on plasma amino acid profiles in young healthy men. Plasma leucine levels rapidly increased and peaked around 30 min after leucine ingestion. Concentrati...

  4. Evolution of density profiles for reaction-diffusion processes

    International Nuclear Information System (INIS)

    The purpose of this work is to study the reaction diffusion equations for the concentration of one species in one spatial dimension. Nonlinear diffusion equations paly an important role in several fields: Physics, Kinetic Chemistry, Poblational Biology, Neurophysics, etc. The study of the behavior of solutions, with nonlinear diffusion coefficient, and monomial creation and annihilation terms, is considered. It is found, that when the exponent of the annihilation term is smaller than the one of the creation term, unstable equilibrium solutions may exist, for which solutions above it explode in finite time, but solutions below it decay exponentially. By means of the reduction to quadratures technique, it is found that is possible to obtain travelling wave solution in those cases when the annihilation term is greater than the creation term. This method of solution always permits to know the propagation velocity of the front, even if the concentration cannot be written in closed form. The portraits of the solutions in phase space show the existence of solutions which velocities may be smaller or greater than the ones found analytically. Linear and nonlinear diffusion equations, differ significantly in that the former are of change of solutions are considered. This is reminiscent of the fact that linear diffusion yields infinite propagation speed, even though the speed of the front is finite. When the strength of the annihilation term increases, as compared with that of the creation term, arbitrary initial conditions (studied numerically) relax to stable platforms that move indefinitly with constant speed. (Author)

  5. Immersion-histo polymerase chain reaction: a practical tool for visualization of single-copy genes in tissue sections.


    L. Pan; Diss, T C; Peng, H.; Isaacson, P G


    A method, immersion-histo polymerase chain reaction (IH-PCR), was developed for visualization of single-copy DNA sequences in cells in paraffin-embedded tissue sections. Sections were mounted on coverslips, cut into small pieces, and immersed in reaction mixtures in micro-tubes for specific DNA amplification using a conventional thermal cycler. This was followed by in situ hybridization, in micro-tubes, with PCR-generated, digoxigenin-labeled probes. Epstein-Barr virus, chromosomal translocat...

  6. Early diagnosis of primary human herpesvirus 6 infection in childhood: Serology, polymerase chain reaction, and virus load


    Chiu, SS; Peiris, M.; Tse, CYC; Cheung, CY


    Qualitative and quantitative polymerase chain reaction (PCR) for human herpesvirus 6 (HHV-6) DNA in whole blood and plasma was correlated with serology and clinical assessment in 143 children hospitalized for undifferentiated febrile illness to evaluate options for diagnosis of primary HHV-6 infection on the acute blood specimen. PCR and serology for HHV-7 were done in parallel to define serologic cross-reactions. Using HHV-6 seroconversion as the reference standard, detection of HHV-6 DNA in...

  7. An amplified electrochemical aptasensor based on hybridization chain reactions and catalysis of silver nanoclusters (United States)

    Chen, Ling; Sha, Liang; Qiu, Yuwei; Wang, Guangfeng; Jiang, Hong; Zhang, Xiaojun


    In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear range of 10-10 M to 10-5 M.In the present study, based on the mimic oxidase catalytic character of nucleic-acid-stabilized silver nanoclusters (DNA/AgNCs) and hybridization chain reactions for signal amplification, the fabrication of a label-free sensitive ``turn-on'' electrochemical aptasensor for the amplified determination of lysozyme was demonstrated. First, the designed DNA duplex was modified on the electrode. With the specific binding of the target, lysozyme and its aptamer, the lysozyme-binding DNA sequence was liberated, exposing the induced DNA sequence, which in turn triggered the formation of the supersandwich DNA structure. Because the cytosine-rich sequence was designed ingeniously on the DNA sequence, DNA/AgNCs were formed on the supersandwich DNA structure. The peroxidase-like character of DNA/AgNCs produced detectable electrochemical signals for the lysozyme aptasensor, which showed a satisfying sensitive detection of lysozyme with a low detection limit of 42 pM and a wide linear

  8. The new possibility of the fusion p + 11B chain reaction being induced by intense laser pulses (United States)

    Belyaev, V. S.; Krainov, V. P.; Matafonov, A. P.; Zagreev, B. V.


    We discuss the experimental and theoretical principal schemes of a thermonuclear reactor, based on the fusion reaction p + 11B: beam collisions, fusion in degenerate plasmas, ignition at the plasma, particle acceleration by nonlinear ponderomotive forces and irradiation of the solid 11B target by a proton beam at the Coulomb explosion of hydrogen microdroplets. The fusion reaction p + 11B can be initiated by ultrashort high intensity laser pulses under conditions far from thermodynamic equilibrium. This may result in fusion products containing a small amount of neutrons and other nuclear radiation effects. It was found that the fusion reaction p + 11B produces further nuclear reactions and generates high-energy protons. The latter can support the chain reaction process. Our approach allows us to also investigate nuclear reactions in the early Universe and in stars.


    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen


    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  10. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao


    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.

  11. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.; Schonenbrucher, H.; Cook, N.; Heuvelink, A.E.; Hoorfar, Jeffrey


    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

  12. Identification of related DNA sequences in Borrelia burgdorferi and two strains of Leptospira interrogans by using polymerase chain reaction.


    Kron, M A; Gupta, A; Mackenzie, C. D.


    The suitability of a polymerase chain reaction assay for Borrelia burgdorferi in epidemiological studies of infected tick populations was evaluated by using 28 strains of Leptospira interrogans and lysates of fixed adult Ixodes tick tissues. Two false positives representing leptospires were differentiated from B. burgdorferi by using an oligonucleotide probe.

  13. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp (United States)

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  14. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld


    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  15. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjærg, Lars Stubbe; Hansen, J-ES; Dalbøge, H;


    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot hybrid...... where viral replication is absent, or where genomic copies are present at such low numbers that they are otherwise undetectable....

  16. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses. (United States)

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola


    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  17. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma... (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... test for Mycoplasma gallisepticum (MGLP ReTi). (a) DNA extraction. Use Qiagen Qiamp Mini Kit for...

  18. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan


    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  19. Testing vaccines in human experimental malaria: statistical analysis of parasitemia measured by a quantitative real-time polymerase chain reaction.

    NARCIS (Netherlands)

    Hermsen, C.C.; Vlas, S.J. de; Gemert, G.J.A. van; Telgt, D.S.C.; Verhage, D.F.; Sauerwein, R.W.


    Clinical trials are an essential step in evaluation of safety and efficacy of malaria vaccines, and human experimental malaria infections have been used for evaluation of protective immunity of Plasmodium falciparum malaria. In this study, a quantitative real-time polymerase chain reaction was used

  20. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;


    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR-BM). M...

  1. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Johansen, Markku; Jorsal, Sven Erik Lind;


    obtained by averaging test results from individual fecal samples in relation to a quantitative polymerase chain reaction (qPCR) test for Lawsonia intracellularis. Ten diarrheic and 10 normal fecal samples were submitted from each of 43 Danish swine herds (n = 860 fecal samples). Pools (n = 43), each...

  2. Modeling the Manipulation of Natural Populations by the Mutagenic Chain Reaction. (United States)

    Unckless, Robert L; Messer, Philipp W; Connallon, Tim; Clark, Andrew G


    The use of recombinant genetic technologies for population manipulation has mostly remained an abstract idea due to the lack of a suitable means to drive novel gene constructs to high frequency in populations. Recently Gantz and Bier showed that the use of CRISPR/Cas9 technology could provide an artificial drive mechanism, the so-called mutagenic chain reaction (MCR), which could lead to rapid fixation of even a deleterious introduced allele. We establish the near equivalence of this system to other gene drive models and review the results of simple models showing that, when there is a fitness cost to the MCR allele, an internal equilibrium may exist that is usually unstable. In this case, introductions must be at a frequency above this critical point for the successful invasion of the MCR allele. We obtain estimates of fixation and invasion probabilities for the appropriate scenarios. Finally, we discuss how polymorphism in natural populations may introduce sources of natural resistance to MCR invasion. These modeling results have important implications for application of MCR in natural populations. PMID:26232409

  3. Improvement of Temperature Uniformity for Polymerase Chain Reaction Chip with Heat Spreader (United States)

    Chen, Rong-Sheng; Mao, Chao-Yang; Chen, Yung-Shieng


    For polymerase chain reaction (PCR) applications, a uniform temperature field in the microreactor is crucial. In this paper, we report on the electrothermal and computational fluid dynamics (CFD) simulations performed with the aim of optimizing the temperature distribution by heat spreaders for PCR application. Firstly, the equivalent resistivity of the microresistor heater is evaluated, and a conformable result is then verified by comparing with the experimental result using a prototype PCR chip. Secondly, the temperature distribution at 94 °C in the PCR chip is investigated. Furthermore, a heat spreader is inserted into the PCR chip to reduce the temperature difference in the DNA sample and thus improve the temperature uniformity effectively. The results demonstrated that the effective volume percentage and the energy consumption in the chamber are positively related to the thickness of the heat spreader, while the temperature difference is inversely related to the thickness of the heat spreader. Finally, the (b)-design is better than the (a)-design in terms of both the increase in effective volume percentage of the DNA sample and the decrease in energy consumption. In other words, the (b)-design is recognized as having better temperature uniformity.

  4. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    Directory of Open Access Journals (Sweden)

    Parvin Hassanzadeh


    Full Text Available Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain reaction (PCR. The aim of this study was to evaluate the prevalence of Chlamydia trachomatis infection in pregnant women referred to a teaching hospital affiliated to Shiraz University of Medical Sciences. Urine samples were obtained from 210 pregnant women and investigated microscopically and macroscopically by urinalysis. Precipitants were also used for DNA extraction and PCR test for detecting Chlamydia trachomatis. Among 210 urine specimens from women aged 15-39 years, none were positive for Chlamydia trachomatis by PCR. In spite of the high sensitivity and specificity of PCR, and the elimination of inhibitory effects on PCR test, no pregnant woman was positive for Chlamydia trachomatis. Here, we suggest that a larger sample should be studied and other sensitive methods could also be used in the future.

  5. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  6. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes


    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  7. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens

    Directory of Open Access Journals (Sweden)

    Adriana Antônia da Cruz Furini


    Full Text Available OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens.METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results.RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard, we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively.CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis.

  8. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction. (United States)

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T


    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244

  9. Three sample preparation protocols for polymerase chain reaction based detection of Cryptosporidium parvum in environmental samples. (United States)

    Kostrzynska, M; Sankey, M; Haack, E; Power, C; Aldom, J E; Chagla, A H; Unger, S; Palmateer, G; Lee, H; Trevors, J T; De Grandis, S A


    Cryptosporidium parvum is a protozoan parasite responsible for an increasing number of outbreaks of gastrointestinal illness worldwide. In this report, we describe development of sample preparation protocols for polymerase chain reaction (PCR)-based detection of C. parvum in fecal material and environmental water samples. Two of these methods were found adequate for isolation of Cryptosporidium DNA from filtered water pellet suspensions. The first involved several filtration steps, immunomagnetic separation and freeze-thaw cycles. The second method involved filtration, addition of EnviroAmp lysis reagent, freeze-thaw cycles and precipitation of the DNA with isopropanol. Using nested PCR, we detected 100 oocysts/ml of filtered water pellet suspension, with either of the above sample preparation procedures. Nested PCR increased sensitivity of the assay by two to three orders of magnitude as compared to the primary PCR. The detection limit for seeded fecal samples was 10-fold higher than for filtered environmental water pellet suspension. Nested PCR results showed 62.4 and 91.1% correlation with immunofluorescence assay (IFA) for fecal samples and filtered environmental water pellet suspensions, respectively. This correlation decreased to 47.2% and 44.4%, respectively, when only IFA positive samples were analyzed. However, in fecal samples contaminated with a high number (> 10(5)/g) of C. parvum oocysts, this correlation was 100%. PMID:10076632

  10. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples. (United States)

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.


    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  11. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Gleichweit, Christoph; Amende, Max; Bauer, Udo; Schernich, Stefan; Höfert, Oliver; Lorenz, Michael P. A.; Zhao, Wei; Bachmann, Philipp; Papp, Christian, E-mail: [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Müller, Michael; Koch, Marcus [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Wasserscheid, Peter [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Libuda, Jörg; Steinrück, Hans-Peter [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany)


    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H{sub 12}-NEC), dodecahydro-N-propylcarbazole (H{sub 12}-NPC), and dodecahydro-N-butylcarbazole (H{sub 12}-NBC), on Pt(111) and on Al{sub 2}O{sub 3}-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al{sub 2}O{sub 3}, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC.

  12. Detection of bovine leukemia virus in cattle by the polymerase chain reaction. (United States)

    Murtaugh, M P; Lin, G F; Haggard, D L; Weber, A F; Meiske, J C


    Bovine leukemia virus (BLV) is widely distributed in U.S. cattle herds. It infects B lymphocytes and causes neoplastic disease in 5-10% of infected animals. Direct economic losses are incurred as a result of death, reduced milk production and condemnation at slaughter. Thus the identification of cattle infected with BLV is of significant concern to the U.S. cattle industry. For this reason, polymerase chain reaction (PCR) amplification was used to examine seropositive and seronegative cattle for the presence of BLV DNA in peripheral blood mononuclear cells. Using an amplification protocol able to detect 1 viral genome in 100,000 cells, BLV was not detected in 7 seronegative cattle in an infected herd. BLV sequences were detected in 13 of 18 seropositive animals with various levels of infection as determined by in vitro lymphocyte culture and electron microscopy. An active infection was demonstrated in one animal, based on the presence of viral RNA. These findings indicate that PCR is a sensitive method for the detection of BLV in cattle and provides new information regarding the dynamics of the infection. PMID:1658030

  13. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism. (United States)

    Souza, M T; Carvalho-Zilse, G A


    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species. PMID:25117306

  14. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus (United States)

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes


    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  15. Detection of canine herpesvirus 1 in a wide range of tissues using the polymerase chain reaction. (United States)

    Burr, P D; Campbell, M E; Nicolson, L; Onions, D E


    Canine herpesvirus 1 (CHV-1), a member of the alphaherpesvirus sub-family, is known to cause fatal infections in litters of puppies and may also be involved in infertility, abortion, and stillbirths in adult dogs. The purpose of this study was to determine the presence of CHV-1 DNA using the polymerase chain reaction (PCR) in twelve key sites that have been associated with latency for the other herpesviruses. A 605 base pair portion of the viral glycoprotein B (gB) gene was amplified using degenerate primers, cloned, and sequenced. Conventional 20 mer primers were designed using this sequence information to amplify a 120 bp fragment of gB situated between the original degenerate primers. The specificity of amplification was confirmed by Southern Blot hybridisation using an internal oligonucleotide probe. DNA was extracted from tissue samples taken from twelve dogs at post mortem and from twenty-four blood samples. Nine out of twelve dogs showed evidence of infection with CHV-1; the tissues most commonly affected were lumbo-sacral ganglia (5/12 dogs), tonsil (5/12), parotid salivary gland (4/9), and liver (4/9). No positive results were detected within the twenty-four blood samples. These results indicate that exposure to CHV-1 may be much more common than previously suggested. PMID:9008334

  16. Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays. (United States)

    Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua


    Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. PMID:26922047

  17. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics (United States)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David


    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  18. Polymerase chain reaction for detection of herpesvirus simiae (B virus) in clinical specimens. (United States)

    Slomka, M J; Brown, D W; Clewley, J P; Bennett, A M; Harrington, L; Kelly, D C


    A polymerase chain reaction (PCR) was designed which is specific to Macaca fascicularis (cynomolgus monkey) isolates of B virus. The PCR primers produced the expected 188 basepair product from the Cyno 2 strain and seven other cynomolgus monkey isolates of B virus. Oligomer hybridization with a 31-mer oligonucleotide was used to confirm the origin of this product. The PCR failed to amplify DNA of Epstein-Barr virus, cytomegalovirus, varicella-zoster virus, and other alphaherpesviruses (herpes simplex virus types 1 and 2, four SA 8 isolates and three rhesus isolates of B virus). PCR testing of swabs obtained from four orally-infected cynomolgus monkeys confirmed the presence of B virus DNA in samples previously shown to be positive by culture. In addition, PCR detected B virus in several swabs from infected monkeys that were culture negative. Total DNA extracts from the trigeminal and sacral ganglia of these animals were tested by nested PCR and B virus DNA was detected in the trigeminal ganglia of 3 of the 4 orally-infected cynomolgus monkeys. Nested PCR did not detect B virus DNA in total DNA extracts obtained from the brains of the four monkeys. PMID:8392323

  19. Trends and advances in food analysis by real-time polymerase chain reaction. (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin


    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185


    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿


    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  1. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying


    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.


    Institute of Scientific and Technical Information of China (English)

    连伟; 罗慰慈


    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  3. Polymerase chain reaction amplification of a GC rich region by adding 1,2 propanediol

    Directory of Open Access Journals (Sweden)

    Zeinab Mousavian


    Full Text Available Background : Apolipoprotein E (ApoE is one of the most important carriers of lipids in mammalians. The gene for this lipoprotein (ApoE is located on chromosome 19 which is related with the pathogenesis of some nervous system disease. ApoE gene is identified as a high guanine-cytosine (GC content fragment. Detection and amplification of these templates are extensively laborious and baffling. The aim of this study was to find a practical and feasible method for the amplification of the number of GC rich genes such as ApoE. Materials and Methods: We experimented with simple polymerase chain reaction (PCR, nested PCR and PCR with 1-2 propanediol, dimethylsulfoxide (DMSO, and ethyleneglicol as additive substances to enhance the amplification ApoE gene and used the 40 samples of the human whole blood were collected in test tubes with a pre-treatment of ethylene diaminetetraacetic acid. Results: According to our observations, presence of 1-2 propanediol, DMSO, and ethyleneglicol as additive substances resulted to enhanced amplification of ApoE gene. Addition of 1-2 propanediol showed the best results, caused optimization and revealed more specific and sharp bands. Conclusion: According to our findings 1-2 propanediol are the best organic reagent for improving the amplification of ApoE gene. Optimization procedure for each GC rich sequence is recommended to be performed separately in order to identify which of the additive agent is more efficient and applicable for a particular target.

  4. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail:; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)


    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  5. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan


    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  6. Detection of Toxoplasma gondii in venous blood from AIDS patients by polymerase chain reaction. (United States)

    Dupouy-Camet, J; de Souza, S L; Maslo, C; Paugam, A; Saimot, A G; Benarous, R; Tourte-Schaefer, C; Derouin, F


    Detection of Toxoplasma gondii in blood by means of the polymerase chain reaction (PCR) may facilitate the diagnosis and follow-up of cerebral toxoplasmosis in patients with AIDS. We evaluated this approach with seven patients with tissue culture-proven parasitemia, 14 patients with presumptive cerebral toxoplasmosis, and 17 healthy human immunodeficiency virus-positive controls. Each sample of blood was assayed on three different occasions by a PCR assay based on detection of the gene encoding the P30 surface protein. A positive PCR diagnosis required positivity in at least two of the three PCR tests. None of the controls had a positive PCR diagnosis, but six of the seven patients with parasitemia did. Cerebral toxoplasmosis was confirmed in 13 of the 14 patients with a presumptive diagnosis; diagnosis by PCR was positive before treatment for 9 of these 13 patients, whereas tissue culture was positive for only 1 patient. During treatment, blood samples were taken from 14 patients at regular intervals until day 12. PCR diagnosis became negative on ethidium-stained gels, but persistent signals were observed after hybridization, in some cases, for up to 12 days after initiation of therapy. PCR on venous blood could thus be a sensitive and noninvasive method for the diagnosis of cerebral and disseminated toxoplasmosis in AIDS patients and could be a potential tool for monitoring the effects of treatment. PMID:8349765

  7. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    International Nuclear Information System (INIS)

    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H12-NEC), dodecahydro-N-propylcarbazole (H12-NPC), and dodecahydro-N-butylcarbazole (H12-NBC), on Pt(111) and on Al2O3-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al2O3, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC

  8. The utility of the polymerase chain reaction assay for aetiologic definition of unspecified bacterial meningitis cases

    Directory of Open Access Journals (Sweden)

    Mari Tuyama


    Full Text Available Most patients with acute suppurative meningitis are otherwise healthy individuals with regard to immune mechanisms against invasive bacterial disease. This medical emergency is among the most dramatic and potentially ravaging diseases that affect humans, particularly young children. The illness often strikes suddenly, and can either result in death or leave the survivors with significant neurological dysfunctions. The demonstration of a bacterial aetiology is necessary for decisions regarding treatment and prophylaxis. Conventional bacteriological methods frequently fail to identify an agent, as a result of administration of antibiotics or delayed lumbar punctures. We investigated the major aetiologic sources of unspecified bacterial meningitis cases (G00.9, ISCD-10 by polymerase chain reaction (PCR-based identification of Neisseria meningitidis (crgA, Streptococcus pneumoniae (ply and Haemophilus influenzae (bexA in cerebrospinal fluid samples. The multiplex PCR detected N. meningitidis in 92%, S. pneumoniae in 4% and H. influenzae in 1% of the 192 clinical samples assayed; 3% were negative for all three DNA targets. Bacterial DNA detection was found to be a valuable adjunct to enhance bacterial meningitis surveillance when the yield of specimens by culture is reduced. The implementation of PCR assays as a diagnostic procedure in Public Health Laboratories is perceived to be a significant advance in the investigation of bacterial meningitis.

  9. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    International Nuclear Information System (INIS)

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

  10. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    Institute of Scientific and Technical Information of China (English)

    Yuhki Sakuraoka; Tokihiko Sawada; Takayuki Shiraki; Kyunghwa Park; Yuhichiro Sakurai; Naohisa Tomosugi; Keiichi Kubota


    AIM:TO establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).METHODS:Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC.Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years.Quantitative PCR was performed.Immunohistochemistry and in situ hybridization for hepcidin were also performed.RESULTS:Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully.The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues.A method of in situ hybridization for hepcidin was established successfully,and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue.CONCLUSION:We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  11. Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

    Directory of Open Access Journals (Sweden)

    Lei Zhang


    Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

  12. Evaluation of a rapid polymerase chain reaction based identification technique for Vibrio cholerae isolates. (United States)

    le Roux, W J; Masoabi, D; de Wet, C M E; Venter, S N


    Rapid and accurate identification of waterborne pathogens, such as Vibrio cholerae, in drinking-water sources is important to enable effective resource management and public health protection. Phenotypic systems currently being used for the identification of Vibrio cholerae isolates are time-consuming and the need exists for the development of suitable molecular techniques that can offer both fast and reliable identification. During this study, isolates identified as Vibrio cholerae by means of two different biochemical test systems (API 20E and VITEK 32) were analysed with the polymerase chain reaction (PCR) to compare the reliability of the various identification systems. The selected PCR technique amplified a sequence within the outer membrane protein of Vibrio cholerae, a gene specific for V. cholerae. It was found that out of 243 isolates biochemically identified as V. cholerae with either the API or VITEK system, 21 isolates did not give a positive result with the PCR detection method. Sequencing the 16S rDNA of more than half of these isolates and comparison of the sequences with Internet databases indicated that most of the isolates belonged to the genus Aeromonas. The results indicated that the rapid PCR procedure was more accurate than the API or VITEK systems currently being used for the phenotypic identification of Vibrio cholerae isolates. PMID:15318514

  13. Detecting of Mycoplasma genitalium in male patients with urethritis symptoms in Turkey by polymerase chain reaction

    International Nuclear Information System (INIS)

    The aim of this study was to investigate the incidence of Mycoplasma genitalium in the urine samples of 63 male patients who had urethritis symptoms. Along with Neisseria gonorrhoeae (N. gonorrhoeae) and Chlamydia trachomatis (C. trachomatis). We also investigated Mycoplasma hominis (M. hominis) and Ureaplasma urealyticum (U. urealyticum), both of which are known to cause urethritis. Microorganisms were investigated in urine samples of the patients with polymerase chain reaction. The study was conducted between September 2003 - February 2004 at the Department of Microbiology and Clinical Microbiology Ankara University School of Medicine, Ankara, Turkey. A total of 63 urine samples were analyzed and 6 (9.52%) patients had N. gonorrhoeae, 4 (6.34%) had C. trachomatis, while 4 (6.34%) urines were positive in terms of M. genitalium. Nevertheless, 3 (4.76%) patients had U. urealyticum and 2 (3.17%) patients had M. hominis. One urine sample was positive in terms of both N. gonorrhoeae and U. urealyticum, and another urine sample was positive in terms of both M. hominis and U. urealyticum. The results were compared with the control group and found no statistically significant difference. Mycoplasma species are found in normal flora of urogenital system and also as an agent of urogenital infection. In our study, we found low microorganism rates when compared with Europe and America. This difference may be due to the conservative sexual behavior in Turkey. (author)

  14. Improving Nuclear Safety of Fast Reactors by Slowing Down Fission Chain Reaction

    Directory of Open Access Journals (Sweden)

    G. G. Kulikov


    Full Text Available Light materials with small atomic mass (light or heavy water, graphite, and so on are usually used as a neutron reflector and moderator. The present paper proposes using a new, heavy element as neutron moderator and reflector, namely, “radiogenic lead” with dominant content of isotope 208Pb. Radiogenic lead is a stable natural lead. This isotope is characterized by extremely low micro cross-section of radiative neutron capture (~0.23 mb for thermal neutrons, which is smaller than graphite and deuterium cross-sections. The reflector-converter for a fast reactor core is the structure capable of transforming some part of prompt neutrons leaked from the core into the reflected neutrons with properties similar to those of delayed neutrons, that is, sufficiently large contribution to reactivity at the level of effective fraction of delayed neutrons and relatively long lifetime, comparable with lifetimes of radionuclides-emitters of delayed neutrons. It is evaluated that the use of radiogenic lead makes it possible to slow down the chain fission reaction on prompt neutrons in the fast reactor. This can improve the fast reactor safety and reduce some requirements to the technologies used to fabricate fuel for the fast reactor.

  15. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas


    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  16. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis. (United States)

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T


    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. PMID:25827436

  17. Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction. (United States)

    Hough, Angela J; Harbison, Sally-Ann; Savill, Marion G; Melton, Laurence D; Fletcher, Graham


    A quantitative real-time polymerase chain reaction (PCR) detection method specific for Listeria monocytogenes was developed, and studies involving pure culture showed that the response of the assay was linear over 7 log10 (log) cycles. The method was then applied to the detection of L. monocytogenes artificially inoculated onto cabbage, a vegetable chosen because it is a major component of coleslaw, which has been associated with an outbreak of listeriosis. After being allowed to attach to the food, cells were washed from the cabbage leaf surface and recovered by centrifugation. The DNA was purified by an organic solvent extraction technique and analyzed by real-time PCR. In this matrix, the method again produced a linear response over 7 log cycles from 1.4 x 10(2) to 1.4 x 10(9) CFU of L. monocytogenes in 25 g of cabbage, and analysis of the reproducibility of the system showed that log differences in L. monocytogenes numbers added to cabbage could be reliably distinguished. The system allowed quantitative results to be obtained within 8 h and was relatively inexpensive, showing good potential for routine analytical use. PMID:12182489

  18. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  19. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu


    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  20. Use of the polymerase chain reaction in epizootiological studies of viral diseases

    International Nuclear Information System (INIS)

    The polymerase chain reaction (PCR) has become a powerful diagnostic tool in veterinary virology. The research team at the Department of Virology of the National Veterinary Institute, Uppsala, Sweden, was among the first groups to develop and apply routine diagnostic PCR assays in veterinary virology, to develop PCR diagnostic kits and to introduce assays of molecular epizootiology, based on comparative nucleotide sequence analysis of the PCR products. In the paper the experiences of 10 years of application of these techniques are summarized, with special regard to technical developments, i.e. simplified methods of sample preparation, precautions to avoid false positive or negative results, comparison of standard and nested PCR and simple assays of visualization. The viruses involved in the routine PCR diagnostic work are listed in two tables. Examples are given concerning the problems of routine PCR diagnosis in veterinary virology. The use of the PCR as a basic method of 'molecular epizootiology' is discussed and illustrated with several examples. The approaches of molecular epizootiology are based on direct sequence analysis of the PCR products, comparative analysis of the sequences and construction of phylogenetic trees. By this approach the phylogenetic relations are determined and the viruses are rapidly identified and grouped. The accurate genetic identification of virus variants provides novel means to the epizootiologists to trace the geographic distribution of the viruses and to determine the origin of a given outbreak. (author)

  1. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples. (United States)

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H


    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  2. GSH2 promoter methylation in pancreatic cancer analyzed by quantitative methylation-specific polymerase chain reaction (United States)



    Tumor suppressor gene silencing via promoter hypermethylation is an important event in pancreatic cancer pathogenesis. Aberrant DNA hypermethylation events are highly tumor specific, and may provide a diagnostic tool for pancreatic cancer patients. The objective of the current study was to identify novel methylation-related genes that may potentially be used to establish novel therapeutic and diagnostic strategies against pancreatic cancer. The methylation status of the GS homeobox 2 (GSH2) gene was analyzed using the sodium bisulfite sequencing method. The GSH2 methylation ratio was examined in primary carcinomas and corresponding normal tissues derived from 47 patients with pancreatic cancer, using quantitative methylation-specific polymerase chain reaction. Methylation ratios were found to be associated with the patient's clinicopathological features. GSH2 gene methylation was detected in 26 (55.3%) of the 47 pancreatic cancer patients, indicating that it occurs frequently in pancreatic cancer. A significant association with methylation was observed for tumor-node-metastasis stage (P=0.031). GSH2 may be a novel methylation-sensitive tumor suppressor gene in pancreatic cancer and may be a tumor-specific biomarker of the disease. PMID:26171036

  3. Differentiation of Helicobacter pylori isolates by polymerase chain reaction-restriction fragment length polymorphism

    Institute of Scientific and Technical Information of China (English)

    SHI Li; SUN Yong; ZHANG Ya-li; ZHANG Zhen-shu; ZHOU Dian-yuan


    Objective: To investigate the association between the diversity of urease gene and urease activity of clinical isolates of Helicobacter pylori (H. pylori). Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of urease gene and rapid urease activity test were used to study the urease activity of different clinical isolates of H. pylori. Results: H. pylori clinical isolates were divided into 4types according to their PCR-RFLP results of urease gene and urease activity. Type I , possessing strong urease activity (0. 11) and presented 1 fragment of 1.7 kb by PCR-RFLP, had close relations with gastric ulcer; type Ⅱ , with the weakest urease activity (0. 07) and 2 fragments (1.3 and 0. 4 kb respectively), was associated with duodenal bulb ulcer; type Ⅱ , with the strongest urease activity (0. 12) and 2 fragments (0. 4and 0. 17 kb) with or without 1 fragment (0. 23 or 0. 37 kb) , was responsible for gastritis; type Ⅳ, with weak urease activity (0. 09) and 2 fragments (1.5 and 0. 2 kb), was shown to be related to both gastric and duodenal bulb ulcers. Conclusion: The diversity of urease gene decides different urease activities of different clinical isolates of H. pylori, hence the different possibilities of pathogenesis due to this bacteria.

  4. Platypus chain reaction: directional and ordered meiotic pairing of the multiple sex chromosome chain in Ornithorhynchus anatinus. (United States)

    Daish, Tasman; Casey, Aaron; Grützner, Frank


    Monotremes are phylogenetically and phenotypically unique animals with an unusually complex sex chromosome system that is composed of ten chromosomes in platypus and nine in echidna. These chromosomes are alternately linked (X1Y1, X2Y2, ...) at meiosis via pseudoautosomal regions and segregate to form spermatozoa containing either X or Y chromosomes. The physical and epigenetic mechanisms involved in pairing and assembly of the complex sex chromosome chain in early meiotic prophase I are completely unknown. We have analysed the pairing dynamics of specific sex chromosome pseudoautosomal regions in platypus spermatocytes during prophase of meiosis I. Our data show a highly coordinated pairing process that begins at the terminal Y5 chromosome and completes with the union of sex chromosomes X1Y1. The consistency of this ordered assembly of the chain is remarkable and raises questions about the mechanisms and factors that regulate the differential pairing of sex chromosomes and how this relates to potential meiotic silencing mechanisms and alternate segregation. PMID:19874721

  5. Correlation between API 50 CH and multiplex polymerase chain reaction for the identification of vaginal lactobacilli in isolates

    Directory of Open Access Journals (Sweden)

    Eliane Melo Brolazo


    Full Text Available Identification of Lactobacillus sp. strains by phenotypic methods may lead to doubtful results possibly interfering in the reliability of the epidemiological and probiotics studies. Therefore this study aimed to determine the best methodology for the identification of the large diversity of lactobacilli species found in the vagina by comparing two techniques, one based on their biochemical profile and other employing molecular biology. A carbohydrate fermentation test (API 50 CH was compared with multiplex polymerase chain reaction (PCR for the identification of species of vaginal lactobacilli from 135 healthy women. The kappa index was used to evaluate agreement between the methods. Using the molecular technique, L. crispatus (32.6%, L. jensenii (25% and L. gasseri (20.6% were the most frequent species. However, using the biochemical technique, the most frequent species were: L. acidophilus (34.8%, L. crispatus (27.2% and L. fermentum (13%. Although L. acidophilus was the most frequent specie found by biochemical tests, no strain of this microorganism was detected by PCR. Agreement between the methods was low for identification of all the most common species. Although rates of L. crispatus detected were similar using both methods (32.6% and 27.2%, agreement between them was relatively low (kappa = 0.52. Conclusions: Our results confirmed the limitation of the biochemical method and the applicability of a previously published molecular method (Multiplex PCR for the identification of lactobacilli in the vaginal tract, focusing on further necessity of its improvement for also targeting L. vaginalis and L. iners.

  6. Development and application of reverse transcriptase nested polymerase chain reaction test for the detection of exogenous avian leukosis virus. (United States)

    García, Maricarmen; El-Attrache, John; Riblet, Sylva M; Lunge, Vagner R; Fonseca, André S K; Villegas, Pedro; Ikuta, Nilo


    A polymerase chain reaction (PCR) assay that utilizes nested primers to amplify a fragment of the long terminal repeat of exogenous avian leukosis virus (ALV) was developed and evaluated for detection of ALV subgroup J directly from clinical samples. Compilation of sequence data from different endogenous and exogenous ALVs allowed the selection of a conserved set of nested primers specific for the amplification of exogenous ALV subgroups A, B, C, D, and J and excluded amplification of endogenous viruses or endogenous viral sequences within the chicken genome. The nested primers were successfully used in both PCR and reverse transcriptase (RT)-PCR assays to detect genetically diverse ALV-J field isolates. Detection limits of ALV-J isolate ADOL-Hc1 DNA by nested PCR and RNA by RT-nested PCR were superior to detection of group-specific antigen by enzyme-linked immunosorbent assay (ELISA) in cell culture. Detection of ALV-J in cloacal swabs by RT-nested PCR was compared with direct detection by antigen-capture (ac)-ELISA; RT-nested PCR detected fewer positive samples than ac-ELISA, suggesting that RT-nested PCR excluded detection of endogenous virus in clinical samples. Detection of ALV-J in plasma samples by RT-nested PCR was compared with virus isolation in C/E chicken embryo fibroblasts; the level of agreement between both assays as applied to plasma samples ranged from low to moderate. The main disagreement between both assays was observed for a group of plasma samples found positive by RT-nested PCR and negative by virus isolation, suggesting that RT-nested PCR detected ALV-J genome in plasma samples of transiently or intermittently infected birds. ALV-J transient and intermittent infection profiles are characterized by inconsistent virus isolation responses throughout the life of a naturally infected flock. PMID:12713157

  7. A Theoretical Investigation on the Reaction Mechanism of the C8H+·10 Side-Chain Decomposition Processes

    Institute of Scientific and Technical Information of China (English)

    CHENG Xue-Li; ZHAO Yan-Yun; LI Feng


    The dissociation of ethylbenzene cation C8H+·10 served as a prototype to investigate the decompasition mechanisms of alkylbenzene cations.The reactions of C8H+·10 decomposition reaction system have been studied extensively at the B3L YP/6-311++G** level with Gaussion 98 package.The chain reaction of C8H+·10 dissociation is initiated by C-H bond rupture.All reaction channels were fully investigated with the vibrational mode analysis to confirm the transition states and reveal the reaction mechanism.The energetically most favorable pathway is C8H+·10→TS4→·P2+H· and the channel ieading to C8H+·10 and C2H4 is also competitive.

  8. Distribution and persistence of probiotic Streptococcus salivarius K12 in the human oral cavity as determined by real-time quantitative polymerase chain reaction. (United States)

    Horz, H-P; Meinelt, A; Houben, B; Conrads, G


    The bacteriocin producer Streptococcus salivarius K12 is used as a probiotic targeting the oral cavity, so our study aimed to assess whether its dispersal and persistence could be monitored using real-time quantitative polymerase chain reaction. To this end, we designed polymerase chain reaction primers and a hybridization probe specifically targeting salA, which encodes for the prepropeptide of salivaricin A. Using a single individual as our subject, we administered four lozenges of K12 Throat Guard per day over 3 days, then measured salA gene levels for 16 different oral sites at six different intervals over 35 days. Four samples each from gingival sulci and from teeth all remained negative. In contrast, in saliva and at all mucosal membranes K12 was detected, but with varying amounts and time profiles. Relatively high salA gene copy numbers, calibrated on the basis of colony-forming units, were seen on the tongue (maximum 4.6 x 10(4)/swab at day 4), in stimulated saliva (2.4 x 10(4)/ml, day 4) and on buccal membranes (1.3 x 10(4)/swab, day 8). K12 was present on both sides of the pharynx but asymmetrically in both quantity and duration. In conclusion, we have developed a real-time quantitative-polymerase chain reaction for counting S. salivarius K12 at various sites in the oral cavity. In the individual studied, K12 could be detected at the mucosal membranes for as long as 3 weeks, but with steadily decreasing numbers after day 8. Thus, K12 may have the potential to control oral bacterial infections only when the uptake is repeated frequently. PMID:17311636

  9. Safety profile and protocol prevention of adverse reactions to uroangiographic contrast media in diagnostic imaging. (United States)

    Rossi, C; Reginelli, A; D'Amora, M; Di Grezia, G; Mandato, Y; D'Andrea, A; Brunese, L; Grassi, R; Rotondi, A


    The purpose of the study is to examine the incidence of adverse reactions caused by non-ionic contrast media in selected patients after desensitization treatment and to evaluate the safety profile of organ iodine contrast media (i.c.m.) in a multistep prevention protocol. In a population of 2000 patients that had received a CT scan, 100 patients with moderate/high risk for adverse reactions against iodinated contrast agents followed a premedication protocol and all adverse reactions are reported and classified as mild, moderate or severe. 1.7 percent of the pre-treated patients reported a mild, immediate type reaction to iodine contrast; of these five patients with allergy 0.71 percent had received iomeprol, 0.35 percent received ioversol and 0.71 percent received iopromide. The incidence of adverse reactions was reported to be higher (4 out of 5 patients) among those that referred a history of hypersensitivity against iodinated i.c.m. Although intravenous contrast materials have greatly improved, especially in terms of their safety profile, they should not be administered if there isn't a clear or justified indication. In conclusion, even if we know that the majority of these reactions are idiosyncratic and unpredictable we propose, with the aim of improving our knowledge on this subject, a multicenter study, based on skin allergy tests (prick test, patch test, intradermal reaction) in selected patients that have had previous experiences of hypersensitivity against parenteral organ iodine contrast media. PMID:24750802

  10. Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting

    DEFF Research Database (Denmark)

    Atabay, H. I.; Bang, Dang Duong; Aydin, F.; Erdogan, H. M.; Madsen, Mogens


    Aims: The objective of this study was to subtype Arcobacter butzleri isolates using RAPD-PCR. Methods and Results: Thirty-five A. butzleri isolates obtained from chicken carcasses were examined. PCR-mediated DNA fingerprinting technique with primers of the variable sequence motifs was used to...... detect polymorphism within the isolates. Eleven distinct DNA profiles were obtained as follows: Of the 35 strains, 10 as profile 4; seven as profile 1; five as profile 3; three as profiles 2 and 9; two as profile 10; one as profiles 5, 6, 7, 8 and 11. Conclusions: Chicken carcasses sold in markets were...

  11. Stereoselective synthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-ulose via autoxidation reaction

    Institute of Scientific and Technical Information of China (English)

    LIU Hong-Min; ZHANG Fuyi; TAO Jing-Chao


    Many different approaches for synthesis of branched chain sugars have beenestablished,1 because they are very useful intermediates for synthesis of other non-sugar chiralmolecules, and usually occur in nature. Branched chain glycosidulose can be used for construction offive- and six-membered carbocyclic rings to which two chiral carbons of sugar are incorporated byintramolecular aldol condensation and Robinson annulation,2 Therefore they are useful in thesynthesis of natural products which consist of annulated carbohydrates or where a highlyfunctionalised enantiomerically pure cyclopentane or cyclohexane is required. Also, this type ofbranched chain sugar can be considered as the synthons of monoterpenoid natural products of theiridoid class which have the cyclopentan-(c)-pyran structure. In view of the importance of branchedchain glycosiduloses, it is desirable to have a general, convenient methodology to their synthesis.However, none of the literature methods was reported on their synthesis by a nuclephilic addition toa partially protected glycosidulose, due to the fact that these glycosiduloses are very difficult tosynthesize selectively and unstable;3 and what is more, one-step synthesis branched chainglycosidulose using this method is almost impossible.In this paper, we report on a general, convenient method for stereoselective syntheses of2,2-bis(C-branched-chain)glucopyranosid-3-uloses by the new reaction of 1 with various activemethylene compounds. The generality of this method was examined in detail. The optimumtemperature was 18-25℃. The solvent DMF was better than the others. In all cases he yields werehigher than 60%.All the 2,2-bis(C-branched-chain)glucopyranosid-3-uloses were characterized by X-raycrystallographic analyses. In addition, the important iintermediate in this reaction was isolated,which is the product of autoxidation of 1 at C-3 position. Thus the reaction mechanism for thesynthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-uloses

  12. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q


    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  13. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio


    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  14. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods (United States)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.


    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  15. Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)

  16. Relevance of semen polymerase chain reaction positive for tuberculosis in asymptomatic men undergoing infertility evaluation

    Directory of Open Access Journals (Sweden)

    Subodh Kumar Regmi


    Full Text Available OBJECTIVE: Male partners of infertile women with genital tuberculosis (TB are often screened for genital TB. We aimed to evaluate the clinical significance of a positive screening semen polymerase chain reaction (PCR for Mycobacterium tuberculosis test (TB-PCR in asymptomatic men undergoing infertility evaluation and determine the need for a detailed investigation and treatment for TB. MATERIALS AND METHODS: Between March 2012 and January 2013, male partners of 15 infertile women with a diagnosis of genitourinary TB (GUTB as the cause of infertility, tested positive either on semen PCR for TB (13 cases, or Mycobacterium Growth Indicator Tube-960 test (2 cases. These asymptomatic men underwent infertility evaluation along with evaluation for GUTB. Diagnosis of GUTB was based on standard clinical criteria, which included a high index of suspicion along with clinical, laboratory, and/or radiological evidence of GUTB. Men who had no clinical evidence of GUTB were followed up with clinical evaluation, semen analysis, and repeat semen PCR for TB after 6 months. RESULTS: Fourteen subjects consented for inclusion in the study. One had a history of pulmonary TB 20 years earlier. Another patient was found to have mediastinal lymphadenopathy (tubercular. All except one had a normal semen analysis. None of the patients met the standard clinical criteria for GUTB diagnosis. 8 patients followed up at 6 months with repeat semen analysis, which was similar to the baseline values and no clinical evidence of TB. INTERPRETATION AND CONCLUSIONS: Asymptomatic men with positive screening semen PCR for TB do not have clinical evidence of TB. Male partners of women with infertility and GUTB should not be screened if they have no symptoms.

  17. Use of polymerase chain reaction in the diagnosis of Whipple's disease. (United States)

    Kono, Masanori; Yamamoto, Kei; Nagamatsu, Maki; Kutsuna, Satoshi


    Whipple's disease, a systemic, chronic infectious disease caused by Tropheryma whipplei, is extremely rare in Asian populations. A correct diagnosis is necessary due to its high mortality rate. Unfortunately, patients are apt to be misdiagnosed with connective tissue diseases since they typically present with arthritis or arthralgia. There are three diagnostic tools for Whipple's disease using intestinal tissues: 1) periodic acid-Schiff (PAS)-positive macrophages; 2) electron microscopic observation; and 3) polymerase chain reaction (PCR). It is challenging to diagnose this disease in the absence of histological findings, especially in Japan, where the clinical protocol currently used to make the diagnosis needs improvement, although symptomology and PCR results may be sufficient. Herein, we investigated a 24-year-old Japanese woman who had suffered from intermittent fever, migratory arthralgia, and watery diarrhea for several months. Her biopsied intestinal tissue was negative for foamy macrophages and PAS-positive cells, and electron microscopy did not provide diagnostic insight. PCR amplification of the specimens, however, successfully revealed T. whipplei. Whipple's disease was diagnosed based on a positive PCR result and strong clinical suspicion. The patient was treated parenterally with ceftriaxone (2 g daily) for two weeks, followed by oral treatment with 160 mg trimethoprim and 800 mg sulfamethoxazole twice per day. After one month of treatment, her symptoms disappeared and inflammatory markers returned to normal levels. This case illustrates the practicality and effectiveness of a PCR-based diagnostic test in combination with clinical suspicion to correctly diagnose Whipple's disease, especially in cases when a histological examination does not provide insight. PMID:26390825

  18. Detection of Listeria monocytogenes in salmon using the Probelia polymerase chain reaction system. (United States)

    Wan, Jason; King, Kerryn; Forsyth, Santina; Coventry, M John


    A validation was conducted on the performance of a commercially available polymerase chain reaction (PCR) kit (Probelia) in comparison with International Organization for Standardization (ISO) method 11290-1 (adopted as an Australian New Zealand Standard Method, AS/NZS 1766.2.16.1:1998) for the detection of Listeria monocytogenes in salmon samples. The validation was conducted following the guidelines of an Australian New Zealand Standard (Guide to Determining the Equivalence of Food Microbiology Test Methods, Part 1, Qualitative Tests, AS/NZS 4659.1:1999), which adopts an approach similar to that recommended by the Association of Analytical Communities Microbiology Method Validation Program for Performance Tested and Peer Verified Methods. The validation study involved the use of five cultures of L. monocytogenes, each challenged at a single level of inoculation into five different types of salmon samples. A total of 60 salmon samples (30 unchallenged and 30 challenged) were tested using both the PCR method and the ISO method. Results from this study indicated that the Probelia PCR method is equivalent to the ISO method. In addition, the detection sensitivity of the Probelia PCR system was determined as approximately 0.5 CFU per PCR assay (equivalent to 20 CFU/ml broth culture) for a pure culture of L. monocytogenes. The Probelia PCR method offers the advantage of detecting L. monocytogenes to genetic specificity within 48 to 50 h, whereas the ISO method requires 5 days for negative results with additional days for confirmed positive results by the use of other biochemical and cultural tests. PMID:12636297

  19. Application of the polymerase chain reaction and molecular probe technology for the diagnosis of tuberculosis

    International Nuclear Information System (INIS)

    Conventional methods for the diagnosis of tubercolosis based on microscopic examination and in vitro culture is both time consuming and tedious. Molecular methods of diagnosis have been suggested as an alternative which may provide the clinical laboratory with a means for rapid diagnosis. The present study was carried out to determined the feasibility of this approach for the detection of mycobacteria. Clinical specimens received from patients with suspected diagnosis of tuberculous infection were used. All specimens were examined microscopically and those that were smear positive were cultured. An aliquot of each specimen were kept for analysis by in vitro amplification using the polymerase chain reaction (PCR). The primers used for PCR were 20-mers specific for the insertion element IS986, which is restricted to the M. tuberculosis complex group. All specimens were analysed in quintriplicate, with 2 samples unspiked and 3 sampled spiked with M. tuberculosis. Appropriate positive and negative controls were included in all essays. Following amplification, the specimens were analysed by agarose gel electrophoresis (AGE). All specimens were further subject to hybridization studies using a specific radiolabelled probe. The sensitivity of the amplification assay coupled with visualization of the amplified targets using eithidium bromide staining was found to be about 1 fg of DNA. A total of 40 smear positive specimens were analyzed, 29 of which were culture positive. Twenty-eight of the 29 culture positive specimens tested positive by PCR/hybridization analysis. Of the 11 culture negative specimens, 9 were positive by PCR. Overall 37/40 (92.5%) specimens were positive by PCR/hybridization analysis. (author). 13 refs, 1 tab

  20. Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri

    Directory of Open Access Journals (Sweden)

    Grace Q. Chen


    Full Text Available Problem statement: In transgenic plants, the number of transgene copies could greatly influence the level of expression and genetic stability of the target gene, thus it is important to develop an efficient method for accurate estimation of transgene copies. The quantitative Polymerase Chain Reaction (qPCR technique is becoming more efficient nowadays to determine copy numbers of transgenes in transgenic plants, being used here, for the first time in quantifying copy numbers of transgenes in Lesquerella fendleri. Approach: The system utilized a known one copy gene, LfKCS4/5, from L. fendleri as an endogenous calibrator and the threshold Crossing point (Ct measured by Applied Biosystem 7500 system to calculate the copy numbers of transgenes in primary transgenic lines (T0 generation. Results: The qPCR condition was optimized and each primer set had a PCR efficiency of 0.99 or 1.01. Our data demonstrated unambiguous 2-fold discrimination of the copy number of β-glucuronidase gene (gusA and hygromycine phosphotransferase II (hptII genes in 12 T0 lines. Most of the lines contained one or two copies of each gene. Eight out of 12 samples (66.7% showed more copies of gusA gene than that of hptII gene, suggesting rearrangements of the Transferred (T-DNA. Possible modifications of the T-DNA cassette in L. fendleri are discussed based on main models of T-DNA integration in the plant genome. Conclusion: The qPCR described in this study is an efficient method and it is particularly useful in identification and selection of transgenic plants with desirable copy numbers at early stage.


    Directory of Open Access Journals (Sweden)

    Yu. Rud


    Full Text Available Purpose. To analyse the nucleotide sequences of salmonids Y chromosome and to determine the fragment for specific primers selection and also to develop the PCR based method for sex determination in huchen H. hucho. Methodology. Using the ClustalW algorithm in MEGA 5.2, the nucleotide sequences of salmonids Y chromosome were analysed. For developing of method for rapid diagnostic of huchen sex the polymerase chain reaction (PCR assay was used. Tne nucleotide sequences of amplified products were investigated by sequencing. Findings. Using PCR assay the method of sex determination in huchen H. hucho was developed. It was shown that specific PCR products in size of 450 nucleotides were visible in huchen males only. In addition we showed that selected primers can be used in sex determination of rainbow trout Oncorhynchus mykiss and this fact is proved the high rate of sdY locus similarity and its wide destribution in salmonids. Originality. The nucleotide sequences of salmonids Y chromosome were analysed and highly conservative region of sdY locus for specific primers selection, which covers sex-linked marker, was identified. Practical Value. Rapid sex determination in huchen by the developed method will allow to identify reversal males in process of gormonal sex reversion. At the stage of reversal males screening, this method will allow to identify the genotypic males (XY in experimental group and discard them because only phenotypic males with XX genotype (reversal males must be used in the crosses with native femelas for getting of 100 % all-females stock.

  2. Human von Willebrand factor gene and pseudogene: Structural analysis and differentiation by polymerase chain reaction

    International Nuclear Information System (INIS)

    Structural analysis of the von Willebrand factor gene located on chromosome 12 is complicated by the presence of a partial unprocessed pseudogene on chromosome 22q11-13. The structures of the von Willebrand factor pseudogene and corresponding segment of the gene were determined, and methods were developed for the rapid differentiation of von Willebrand factor gene and pseudogene sequences. The pseudogene is 21-29 kilobases in length and corresponds to 12 exons (exons 23-34) of the von Willebrand factor gene. Approximately 21 kilobases of the gene and pseudogene were sequenced, including the 5' boundary of the pseudogene. The 3' boundary of the pseudogene lies within an 8-kb region corresponding to intron 34 of the gene. The presence of splice site and nonsense mutations suggests that the pseudogene cannot yield functional transcripts. The pseudogene has diverged ∼3.1% in nucleotide sequence from the gene. This suggests a recent evolutionary origin ∼19-29 million years ago, near the time of divergence of humans and apes from monkeys. Several repetitive sequences were identified, including 4 Alu, one Line-1, and several short simple sequence repeats. Several of these simple repeats differ in length between the gene and pseudogene and provide useful markers for distinguishing these loci. Sequence differences between the gene and pseudogene were exploited to design oligonucleotide primers for use in the polymerase chain reaction to selectivity amplify sequences corresponding to exons 23-34 from either the von Willebrand factor gene or the pseudogene. This method is useful for the analysis of gene defects in patients with von Willebrand disease, without interference from homologous sequences in the pseudogene

  3. Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Jong Gyun Ahn


    Full Text Available &lt;B&gt;Purpose:&lt;/B&gt; Methods for quick and reliable detection of &lt;I&gt;Streptococcus pneumoniae&lt;/I&gt; are needed for the diagnosis of pneumococcal disease and vaccine studies. This study aimed to show that sequential multiplex polymerase chain reaction (PCR is more efficient than conventional culture in achieving &lt;I&gt;S. pneumoniae -positive&lt;/i&gt; results. &lt;B&gt;Methods:&lt;/B&gt; Nasopharyngeal (NP secretions were obtained from 842 pediatric patients admitted with lower respiratory infections at Severance Children’s Hospital in Korea between March 2009 and June 2010. For identification and serotype determination of pneumococci from the NP secretions, the secretions were evaluated via multiplex PCR technique with 35 serotype-specific primers arranged in 8 multiplex PCR sets and conventional bacteriological culture technique. &lt;B&gt;Results:&lt;/B&gt; Among the results for 793 samples that underwent both bacterial culture and PCR analysis for pneumococcal detection, 153 (19.3% results obtained by PCR and 81 (10.2% results obtained by conventional culture technique were positive for S. pneumoniae. The predominant serotypes observed, in order of decreasing frequency, were 19A (23%, 6A/B (16%, 19F (11%, 15B/C (5%, 15A (5%, and 11A (4%; further, 26% of the isolates were non-typeable. &lt;B&gt;Conclusion:&lt;/B&gt; As opposed to conventional bacteriological tests, PCR analysis can accurately and rapidly identify pneumococcal serotypes.

  4. Polymerase chain reaction targeting insertion sequence for the diagnosis of extrapulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    V Makeshkumar


    Full Text Available Background & objectives: Diagnosis of extrapulmonary tuberculosis (EPTB is difficult using conventional diagnostic methods. This study was conducted to evaluate the use of polymerase chain reaction (PCR in diagnosis of definitive and probable extrapulmonary tuberculosis patients, and to assess the performance of insertion sequence (IS 6110 based PCR assay as compared to conventional culture by Lowenstein-Jensen (LJ method for the diagnosis of EPTB. Methods: A total of 178 non repeated clinical specimens were collected from clinically suspected extrapulmonary tuberculosis patients. The specimens included 59 ascitic fluid, 54 pleural fluid, 25 cerebrospinal fluid (CSF, 12 fine needle aspiration (FNA, 8 urine, 7 pus, 6 synovial fluid, 2 skin tissue, one pericardial fluid, one liver abscess, one pancreatic cyst fluid, one omental biopsy and one semen sample. All these clinical samples were subjected to Ziehl-Neelsen staining (ZN for acid fast bacilli (AFB and culture on LJ medium. PCR was performed by targeting 123bp fragment of insertion sequence IS6110 of Mycobacterium tuberculosis (MTB. Results: Of the 178 specimens, 10 (5.61% were ZN smear positive for AFB, six (3.37% were L-J culture positive from 10 AFB smear positive cases and 48 (26.96% were PCR IS 6110 positive for M. tuberculosis. Interpretation & conclusions: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis. False positive PCR IS6110 in three CSF samples may be due to latent TB infection which was limitation in this study.

  5. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine

    Directory of Open Access Journals (Sweden)

    K.R. Caleffi


    Full Text Available Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT and dapsone, rifampicin and clofazimine for borderline (BB and lepromatous (LL forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients’ urine samples was successfully amplified by PCR-Pra in 46.6% (34/73 of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306. In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386. PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033. Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

  6. Chain extension and branching of poly(L-lactic acid produced by reaction with a DGEBA-based epoxy resin

    Directory of Open Access Journals (Sweden)


    Full Text Available Dicarboxylated poly(L-lactic acid (PLLA was synthesized by reacting succinic anhydride with L-lactic acid prepolymer prepared by melt polycondensation. PLLA and epoxy resin based on diglycidyl ether of bisphenol A (DGEBA copolymers were prepared by chain extension of dicarboxylated PLLA with DGEBA. Infrared spectra confirmed the formation of dicarboxylated PLLA and PLLA/DGEBA copolymer. Influences of reaction temperature, reaction time, and the amount of DGEBA on the molecular weight and gel content of PLLA/DGEBA copolymer were studied. The viscosity average molecular weight of PLLA/DGEBA copolymer reached 87 900 when reaction temperature, reaction time, and mol ratio of dicarboxylated PLLA to DGEBA is 150°C, 30 min, and 1:1 respectively, while gel content of PLLA/DGEBA copolymer is almost zero.

  7. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu


    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  8. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in wetlands, western Kenya: confirmation by polymerase chain reaction method. (United States)

    Ohba, Shin-Ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; Sonye, Gorge; Minakawa, Noboru; Takagi, Masahiro


    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%). This study demonstrates that the polymerase chain reaction method can determine whether aquatic mosquito predators feed on An. gambiae s.l. larvae if the predators have undigested An. gambiae s.l. in their midgut or stomach. PMID:20939371

  9. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.;


    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The...... selectivity of the assay was evaluated against 155 strains, including 32 E. coli O157, 38 E. coli non-O157, and 85 non-E. coli. It was shown to be highly inclusive (100%) and exclusive (100%). The assay has a 100% detection probability of approximately 2 x 10(3) cells per reaction....

  10. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L


    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  11. Multiphasic pH profiles for the reaction of tris-(hydroxymethyl)-aminomethane with phenyl esters

    CERN Document Server

    Nissen, Per


    Reanalysis of data (Bruice and York 1961) for the pH dependences of the calculated apparent second-order rate constants (k2) for the reaction of tris-(hydroxymethyl)-aminomethane (TRIS) with phenyl esters reveals that the pH profiles are consistently much better represented as multiphasic, i.e. as a series of straight lines separated by discontinuities in the form of sharp breaks or noncontiguities (jumps), than by the continuous function used by the authors. For p-nitrophenyl acetate, m-nitrophenyl acetate, p-chlorophenyl acetate and phenyl acetate, the profiles are best represented as multiphasic in plots of log k2 vs. pH, whereas the profile for p-methylphenyl acetate is only multiphasic in a plot of k2 vs. pH. Data for the pseudo-first-order rate constants (kobs) give multiphasic pH profiles with patterns identical or very similar to those for k2. Extensive reanalyses of data for a wide variety of enzymatic and non-enzymatic reactions show, similarly, that pH profiles are in general better represented as ...

  12. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    Directory of Open Access Journals (Sweden)

    PD Andrade


    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  13. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction


    P. D. Luka; A. R. Jambol; B. Yakubu


    Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT) remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR) depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction ...

  14. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

    Directory of Open Access Journals (Sweden)

    Kosuke Nakamura


    Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  15. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh


    T. M. Nabeel Muhammad; Sreedevi, B.


    Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR) was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasa...

  16. Alteration in sample preparation to increase the yield of multiplex Polymerase Chain Reaction assay for diagnosis of genital ulcer disease


    Rao, G.; A Das; Prabhakar, P.; V Nema; Risbud, A. R.


    Purpose: Genital Ulcer Disease (GUD) is common sexually transmitted infection (STI). Multiple studies have shown that GUDs are strongly associated with the transmission and the acquisition of HIV infection. An accurate diagnosis of common etiology of GUD namely Herpes, syphilis and Chancroid is possible using Multiplex PCR (M-PCR). However, frequent presence of Polymerase Chain Reaction inhibitors in the ulcer swab specimen limits the performance of the assay. In order to overcome this proble...

  17. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer



    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have d...

  18. Knockout confirmation for Hurries: rapid genotype identification of Trypanosoma cruzi transfectants by polymerase chain reaction directly from liquid culture



    Gene knockout is a widely used approach to evaluate loss-of-function phenotypes and it can be facilitated by the incorporation of a DNA cassette having a drug-selectable marker. Confirmation of the correct knockout cassette insertion is an important step in gene removal validation and has generally been performed by polymerase chain reaction (PCR) assays following a time-consuming DNA extraction step. Here, we show a rapid procedure for the identification of Trypanosoma cruzi transfectants by...

  19. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment


    Krøjgaard Louise H; Krogfelt Karen A; Albrechtsen Hans-Jørgen; Uldum Søren A


    Abstract Background Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the useful...

  20. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase


    Diaz, R S; Sabino, E. C.


    For certain applications of the polymerase chain reaction (PCR), it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq) DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We use...

  1. Viral etiology of respiratory infections in children in southwestern Saudi Arabia using multiplex reverse-transcriptase polymerase chain reaction


    Al-Ayed, Mohamed S.; Asaad, Ahmed M; Qureshi, Mohamed A.; Ameen, Mohammed S.


    Objectives: To investigate 15 respiratory viruses in children with acute respiratory tract infections (ARTIs) using multiplex reverse-transcriptase polymerase chain reaction (RT-PCR), and to analyze the clinical and epidemiological features of these viruses. Methods: In a cross-sectional study, 135 children, ≤5 years of age who presented with ARTIs in Najran Maternity and Children Hospital, Najran, Saudi Arabia between October 2012 and July 2013 were included. The clinical and sociodemographi...

  2. Magnetic isotope effect and oxygen enrichment by 17O isotope in chain oxidation reactions. Communication 1. Theory

    International Nuclear Information System (INIS)

    The theory of magnetic isotope effect and enrichment of molecular oxygen by 17O isotope in chain oxidation reactions of organic compounds is presented. Recombination probabilities of perioxide radicals differing by isotope composition by oxygen are calculated; the magnetic isotope effect and its dependence on diffusion and viscosity coefficients are determined. Some geochemical and space-chemical consequences of the magnetic isotope effect are discussed

  3. Rapid Detection/pathotyping of Newcastle disease virus isolates in clinical samples using real time polymerase chain reaction assay




    Authors: Abdul Wajid, Muhammad Wasim, Tahir Yaqub, Shafqat F Rehmani, Tasra Bibi, Nadia Mukhtar, Javed Muhammad, Umar Bacha, Suliman Qadir Afridi, Muhammad Nauman Zahid, Zia u ddin, Muhammad Zubair Shabbir, Kamran Abbas & Muneer Ahmad ### Abstract In the present protocol we describe the real time reverse transcription polymerase chain reaction (rRT-PCR) assay for the rapid detection/pathotyping of Newcastle disease virus (NDV) isoaltes in clinical samples. Fusion gene and matrix ...

  4. Polymerase chain reaction as a succesful biotechnological application. Ways we use PCR in the fields of bioinformatics forensics and genetics


    Λάζαρη, Σπυριδούλα


    Molecular genetics use molecular methods that amplify specific fragments of DNA. Today, the molecular techniques which were developed for amplification and detection of specific sequences of nucleic acids helped in a great deal to understand the structure of many diseases. Polymerase chain reaction or PCR is a technique that is used for isolation and amplification of a specific sequence of DNA. PCR is an in vitro method that exploits the in vivo procedure of replication of DNA. DNA polyme...

  5. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems


    Camila Ximenes; Eduardo Brandão; Paula Oliveira; Abraham Rocha; Tamisa Rego; Rafael Medeiros; Ana Aguiar-Santos; João Ferraz; Christian Reis; Paulo Araujo; Luiz Carvalho; Melo, Fabio L


    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuche...

  6. Diagnosis of human trypanosomiasis, due to Trypanosoma brucei gambiense in central Africa, by the polymerase chain reaction


    Penchenier, Laurent; Simo, G.; Grébaut, Pascal; Nkinin, S.; Laveissière, Claude; Herder, Stéphane


    During a mass screening of sleeping sickness conducted in 1998 and 1999, and involving 27,932 persons in Cameroon and the Central African Republic, we tested the polymerase chain reaction (PCR) on whole blood for the diagnosis of human African trypanosomiasis due to #Trypanosoma brucei gambiense$. The 1858 samples obtained were from 4 groups : 155 infected patients, 1432 serological suspects detected by the card agglutination test for trypanosomiasis (CATT), 222 negative controls living in th...

  7. Direct method for detecting small quantities of hepatitis B virus DNA in serum and plasma using the polymerase chain reaction.


    Zeldis, J B; Lee, J. H.; Mamish, D; Finegold, D J; Sircar, R; Q. Ling; Knudsen, P J; Kuramoto, I K; Mimms, L T


    Serum components inhibit DNA polymerase, thereby obviating direct detection of serum viral DNA sequences by the polymerase chain reaction (PCR). This has necessitated extraction of nucleic acid from sera before performing PCR and has resulted in loss of sensitivity. By adsorbing virus to a solid surface (microcentrifuge tubes or antibody coated microparticles) followed by proteinase K digestion, as little as three viruses per 200 microliters serum may be directly detected by PCR without nucle...

  8. A novel polymerase chain reaction method for detection of human immunodeficiency virus in dried blood spots on filter paper.


    Yourno, J; Conroy, J.


    A method for detection of proviral human immunodeficiency virus DNA in dried blood spots on filter paper by direct polymerase chain reaction (PCR) has been developed. To develop the method, a standard system was used which was prepared from cells each containing a single integrated provirus and titrated with normal donor blood. This rapid procedure provides virtually quantitative yields of nuclear DNA and exploits most of the standard methodology described for blood specimens. A nested PCR us...



    Reni Herman; Endah Ariyanti; Ervi Salwati; Delima -; Emiliana Tjitra


    In monitoring the treatment of malaria with Dihydroartemisinin-piperaquine (DHP), microscopic cross check and Polymerase Chain Reaction (PCR) performed to validate the results of laboratory examinations in the field. This study used finger prick samples from subjects with a diagnosis of malaria in monitoring the treatment of malaria with DHP in Kalimantan and Sulawesi. Samples taken at day 0, blood smears made on slides for microscopic and blood spot on filter paper for PCR examination. The P...

  10. Rapid, simple method for treating clinical specimens containing Mycobacterium tuberculosis to remove DNA for polymerase chain reaction.


    Buck, G E; O'Hara, L C; Summersgill, J T


    Several simplified methods for treating mycobacteria to release DNA for amplification by the polymerase chain reaction (PCR) were investigated. The most effective of the methods was sonication. Samples were placed in screw-capped microcentrifuge tubes that were then placed in a plastic rack. The rack was floated in a dish of water next to the ultrasonic probe so that the ultrasonic energy was transmitted through the walls of the tubes. This allowed multiple samples to be processed safely and ...

  11. Rapid diagnosis of enterovirus infection by magnetic bead extraction and polymerase chain reaction detection of enterovirus RNA in clinical specimens.


    Muir, P; Nicholson, F; Jhetam, M; Neogi, S; Banatvala, J E


    We describe a rapid method for extraction and detection of enterovirus RNA in clinical samples. By using magnetic bead technology, enterovirus RNA was efficiently and rapidly extracted from cerebrospinal fluid, stool, saliva, blood, pericardial fluid, urine, and cryopreserved or formalin-fixed solid tissue. Enterovirus RNA was then detected by reverse transcription followed by polymerase chain reaction amplification with primers designed to allow detection of most enterovirus serotypes. For d...

  12. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction.


    Lunkenheimer, K; Hufert, F. T.; Schmitz, H.


    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specim...

  13. Detection of Adenoviruses from clinical samples in bone marrow transplant patients by nested PCR (polymerase chain reaction)


    Fatemeh Sabagh; Michael Roggendorf


    Adenoviruses are recognized as common human pathogens that are responsible for a wide variety of infectious syndromes. Bone marrow transplant patients are prone to life threatening opportunistic infections like adenoviruses. The nested polymerase chain reaction has provided an alternative, sensitive diagnostic method for detection of Adenoviruses. In this study we developed PCR from hexon genes as rapid diagnostic method of Advs infections on different clinical samples. Adenovirus infections ...

  14. Pilot Study of COBAS PCR and Ligase Chain Reaction for Detection of Rectal Infections Due to Chlamydia trachomatis


    Matthew R Golden; Astete, Sabina G.; Galvan, Rosa; Lucchetti, Aldo; Sanchez, Jorge; Celum, Connie L.; Whittington, William L. H.; Stamm, Walter E.; Holmes, King K.; Totten, Patricia A.


    We tested rectal specimens from men who have sex with men for Chlamydia trachomatis by using COBAS PCR (Roche Diagnostics) and ligase chain reaction LCR (Abbott laboratories) and compared three PCR specimen-processing procedures. Chlamydiae were detected by one or more procedures in 22 of 186 specimens. All three PCR tests were positive for 17 specimens, all of which also tested positive by LCR.

  15. Value of Candida polymerase chain reaction and vaginal cytokine analysis for the differential diagnosis of women with recurrent vulvovaginitis.


    Stephanie Weissenbacher; Witkin, Steven S.; Vera Tolbert; Paulo Giraldo; Iara Linhares; Andrea Haas; E. Rainer Weissenbacher; Ledger, William J.


    Objectives: Recurrent vulvovaginitis remains difficult to diagnose accurately and to treat. The present investigation evaluated the utility of testing vaginal specimens from women with symptomatic recurrent vulvovaginitis for Candida species by polymerase chain reaction (PCR) and for cytokine responses.Methods: Sixty-one consecutive symptomatic women with pruritus, erythema, and/or a thick white discharge and a history of recurrent vulvovaginitis and 31 asymptomatic women with no such history...

  16. Isolation and Identification of Mycoplasma synoviae From Suspected Ostriches by Polymerase Chain Reaction, in Kerman Province, Iran


    Tebyanian, Hamid; Mirhosseiny, Seyed Hanif; Kheirkhah, Babak; Hassanshahian, Mehdi; farhadian, Hamze


    Background: Mycoplasma synoviae is an important avian pathogen which can cause both respiratory disease and synovial joint inflammation (synovitis) in poultry. Mycoplasmas spp. may cause the respiratory system infection in ostriches with symptoms such as inflammation of the nose, trachea and also damages of lungs. Objectives: The current study aimed to use the M. synoviae specific Polymerase Chain Reaction (PCR) and microbiological methods in order to isolate and identify M. synoviae from sus...

  17. Differentiation of Neisseria gonorrhoeae strains by polymerase chain reaction and restriction fragment length polymorphism of outer membrane protein IB genes.


    Lau, Q C; Chow, V T; Poh, C. L.


    OBJECTIVES--To employ polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis for the rapid differentiation of Neisseria gonorrhoeae protein IB (PIB) isolates and to compare its usefulness with the widely accepted auxotype/serovar classification scheme. METHODS--The outer membrane protein IB genes of 47 gonococcal isolates belonging to 10 different serovars were amplified by PCR. The approximately 1 kb DNA products were then digested separately with restri...

  18. Detection of colonic cells in peripheral blood of colorectal cancer patients by means of reverse transcriptase and polymerase chain reaction.


    Castells, A.; Boix, L.; Bessa, X; Gargallo, L.; Piqué, J M


    Circulating tumour cells play a central role in the metastatic process, but little is known about the relationship between this cellular subpopulation and the development of secondary disease. This study was aimed at assessing the presence of colonic cells in peripheral blood of patients with colorectal cancer in different evolutionary stages, by means of reverse transcriptase polymerase chain reaction (RT-PCR) targeted to carcinoembryonic antigen (CEA) mRNA. In vitro sensitivity was establis...

  19. Transgenes monitoring in an industrial soybean oil processing by conventional and real-time polymerase chain reaction


    Costa, J; Mafra, I; Amaral, J S; Oliveira, M. B. P. P.


    In recent years a great effort has been devoted to the development of new methods for the qualitative and quantitative detection of transgenic sequences in food. Most of the developed analytical methods for GMO detection are DNA-based, since protein-based assays are not suitable for processed food. For that purpose, polimerase chain reaction (PCR) and real-time quantitative PCR have been successfully applied. Since the approval of Roundup Ready (RR) soybean in Europe, the production of soybea...

  20. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome


    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo


    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  1. Use of the Polymerase Chain Reaction to Detect Helicobacter pylori in the Dental Plaque of Healthy and Symptomatic Individuals


    Banatvala, N.; Lopez, C. Romero; Owen, R J; Hurtado, A; Abdi, Y; Davies, G. R.; Hardie, J. M.; Feldman, R A


    A polymerase chain reaction (PCR) assay, based on the amplification of a species specific ureA (urease) gene internal sequence, was used to detect Helicobacter pylori. Total DNA extracts were obtained from dental plaque in patients attending an endoscopy clinic and from apparently healthy schoolchildren of Bangladeshi origin. Of the 54 samples of dental plaque from endoscopy patients examined, 39 were positive (72 per cent). There was 63 per cent correlation (34/54) between H. pylori in the s...

  2. Development and validation of a Pneumocystis jirovecii real-time polymerase chain reaction assay for diagnosis of Pneumocystis pneumonia


    Church, Deirdre L; Ambasta, Anshula; Wilmer, Amanda; Williscroft, Holly; Ritchie, Gordon; Pillai, Dylan R.; Champagne, Sylvie; Daniel G Gregson


    Pneumocystis pneumonia is caused by Pneumocystis jirovecii, an opportunistic fungal pathogen. Presently, many clinical microbiology laboratories rely on direct microscopic detection of P jirovecii. The validation, and clinical and laboratory development of a qualitative P jirovecii real-time polymerase chain reaction assay for the rapid detection of Pneumocystis pneumonia is discussed by the authors. In addition, this new technique is compared with the existing gold-standard immunofluorescenc...

  3. Fite-Faraco staining in combination with multiplex polymerase chain reaction: A new approach to leprosy diagnosis


    Abu Hena Hasanoor Reja; Nibir Biswas; Supratik Biswas; Sarbani Dasgupta; Imran Hussain Chowdhury; Surajita Banerjee; Tapas Chakraborty; Pijush Kumar Dutta; Basudev Bhattacharya


    Background: Leprosy is not always an easy disease to diagnose, and patients can remain undiagnosed for longtime, not only at the peripheral clinics but also even at places with higher medical facilities, so, there is an urgent need for rapid and definitive modalities for leprosy diagnosis. This prospective study evaluates the ability of Fite-Faraco staining (FF staining) and multiplex polymerase chain reaction (PCR) over hematoxylin and eosin staining (H and E staining) and Ziehl-Neelsen stai...

  4. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes (United States)

    Thabit, Abrar K; Nicolau, David P


    Background Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated. Aim We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day), length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting. Methods Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest. Results The most common ribotypes were 027 (38%), 014/020 (21%), and 106/174 (21%). Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2). The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively). Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6). Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters), although the degree of nausea/vomiting did not differ between the three groups (P=0.3). A serum creatinine level ≥1.5 times the premorbid level was seen in only three patients, each infected with a different ribotype. Conclusion Although these data provide a baseline assessment of outcomes to aid in the design of future studies, the diversity of C. difficile ribotypes within the population must be considered, and additional work with other ribotypes

  5. Nanobarcoding: detecting nanoparticles in biological samples using in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Eustaquio T


    Full Text Available Trisha Eustaquio, James F LearyWeldon School of Biomedical Engineering, Purdue University, West Lafayette, IN, USABackground: Determination of the fate of nanoparticles (NPs in a biological system, or NP biodistribution, is critical in evaluating an NP formulation for nanomedicine. Current methods to determine NP biodistribution are greatly inadequate, due to their limited detection thresholds. Herein, proof of concept of a novel method for improved NP detection based on in situ polymerase chain reaction (ISPCR, coined “nanobarcoding,” is demonstrated.Methods: Nanobarcoded superparamagnetic iron oxide nanoparticles (NB-SPIONs were characterized by dynamic light scattering, zeta potential, and hyperspectral imaging measurements. Cellular uptake of Cy5-labeled NB-SPIONs (Cy5-NB-SPIONs was imaged by confocal microscopy. The feasibility of the nanobarcoding method was first validated by solution-phase PCR and “pseudo”-ISPCR before implementation in the model in vitro system of HeLa human cervical adenocarcinoma cells, a cell line commonly used for ISPCR-mediated detection of human papilloma virus (HPV.Results: Dynamic light-scattering measurements showed that NB conjugation stabilized SPION size in different dispersion media compared to that of its precursor, carboxylated SPIONs (COOH-SPIONs, while the zeta potential became more positive after NB conjugation. Hyperspectral imaging confirmed NB conjugation and showed that the NB completely covered the SPION surface. Solution-phase PCR and pseudo-ISPCR showed that the expected amplicons were exclusively generated from the NB-SPIONs in a dose-dependent manner. Although confocal microscopy revealed minimal cellular uptake of Cy5-NB-SPIONs at 50 nM over 24 hours in individual cells, ISPCR detected definitive NB-SPION signals inside HeLa cells over large sample areas.Conclusion: Proof of concept of the nanobarcoding method has been demonstrated in in vitro systems, but the technique needs further

  6. Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

    Directory of Open Access Journals (Sweden)

    Arbefeville S


    Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

  7. Nanoscale superstructures assembled by polymerase chain reaction (PCR): programmable construction, structural diversity, and emerging applications. (United States)

    Kuang, Hua; Ma, Wei; Xu, Liguang; Wang, Libing; Xu, Chuanlai


    Polymerase chain reaction (PCR) is an essential tool in biotechnology laboratories and is becoming increasingly important in other areas of research. Extensive data obtained over the last 12 years has shown that the combination of PCR with nanoscale dispersions can resolve issues in the preparation DNA-based materials that include both inorganic and organic nanoscale components. Unlike conventional DNA hybridization and antibody-antigen complexes, PCR provides a new, effective assembly platform that both increases the yield of DNA-based nanomaterials and allows researchers to program and control assembly with predesigned parameters including those assisted and automated by computers. As a result, this method allows researchers to optimize to the combinatorial selection of the DNA strands for their nanoparticle conjugates. We have developed a PCR approach for producing various nanoscale assemblies including organic motifs such as small molecules, macromolecules, and inorganic building blocks, such as nanorods (NRs), metal, semiconductor, and magnetic nanoparticles (NPs). We start with a nanoscale primer and then modify that building block using the automated steps of PCR-based assembly including initialization, denaturation, annealing, extension, final elongation, and final hold. The intermediate steps of denaturation, annealing, and extension are cyclic, and we use computer control so that the assembled superstructures reach their predetermined complexity. The structures assembled using a small number of PCR cycles show a lower polydispersity than similar discrete structures obtained by direct hybridization between the nanoscale building blocks. Using different building blocks, we assembled the following structural motifs by PCR: (1) discrete nanostructures (NP dimers, NP multimers including trimers, pyramids, tetramers or hexamers, etc.), (2) branched NP superstructures and heterochains, (3) NP satellite-like superstructures, (4) Y-shaped nanostructures and DNA

  8. An exploratory study to evaluate Clostridium difficile polymerase chain reaction ribotypes and infection outcomes

    Directory of Open Access Journals (Sweden)

    Thabit AK


    Full Text Available Abrar K Thabit,1,2 David P Nicolau1,3 1Center for Anti-Infective Research and Development, Hartford Hospital, Hartford, CT, USA; 2Faculty of Pharmacy, King Abdulaziz University, Jeddah, Saudi Arabia; 3Division of Infectious Diseases, Hartford Hospital, Hartford, CT, USA Background: Clostridium difficile infection ranges from mild to severe prolonged diarrhea with systemic symptoms. Previous studies have assessed the correlation of some disease severity parameters to C. difficile ribotypes. However, certain clinical parameters of interest have not yet been evaluated.Aim: We conducted an exploratory study to evaluate the correlation of C. difficile ribotypes to parameters not assessed previously, notably days to diarrhea resolution (in terms of days to formed stools and days to less than three stools per day, length of hospital stay, 30-day recurrence rates, and 30-day readmission rates. Additional severity parameters evaluated include leukocytosis, serum creatinine, fever, and nausea/vomiting.Methods: Polymerase chain reaction ribotyping was performed on C. difficile isolates from baseline stool samples of 29 patients. A retrospective chart review was conducted to assess the parameters of interest.Results: The most common ribotypes were 027 (38%, 014/020 (21%, and 106/174 (21%. Numerically, 027 ribotype patients required more days to less than three stools per day versus 014/020 and 106/174 ribotype patients (P=0.2. The three ribotypes were similar regarding time to formed stools, duration of hospitalization, and 30-day readmission rate (P=0.2, 0.6, and 0.8, respectively. Recurrence within 30 days occurred in two patients with 027 and two patients with 014/020 (P=0.6. Leukocytosis and fever were more prominent with 027 than with 014/020 and 106/174 (P=0.04 for both parameters, although the degree of nausea/vomiting did not differ between the three groups (P=0.3. A serum creatinine level ≥1.5 times the premorbid level was seen in only three

  9. [Development of a real-time polymerase chain reaction method for the identification of Candida species]. (United States)

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza


    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  10. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    International Nuclear Information System (INIS)

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars

  11. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process (United States)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.


    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  12. Patient-reported multiple drug reactions: Clinical profile and results of challenge testing

    Directory of Open Access Journals (Sweden)

    Ramam M


    Full Text Available Background: Some patients report hypersensitivity reactions to many drugs making it difficult to prescribe medications when they fall ill. Aim: To describe the clinical profile of multiple drug hypersensitivity and the results of challenge testing in a large teaching hospital.Methods: We performed a five-year retrospective review of the records of patients who complained of reactions to two or more unrelated drugs and avoided medication because of a fear of developing reactions. Oral challenge testing was carried out in hospital with drugs suspected by the patient to cause reactions and/or commonly prescribed medications. A positive reaction was diagnosed when symptoms and signs resembled previously experienced episodes and there was no such reaction with placebo. Results: Twenty three patients (aged 14-65 years; 19 females underwent challenge testing. Their complaints had been present for 1-30 years, with 2-40 drug reaction episodes reported. Antibiotics and non-steroidal anti-inflammatory drugs (NSAIDs were most commonly implicated, and urticaria/angioedema were the most often reported manifestations. The patients underwent 3-27 challenges with 1-24 drugs. Three had positive challenge reactions with various NSAIDs, 13 developed symptoms and signs that were judged not to be true reactions, and 7 had no reactions. None of our patients qualified for a diagnosis of true multiple drug hypersensitivity. Conclusion: Patients who believe they are allergic to multiple, pharmacologically unrelated drugs are usually mistaken. Challenge testing is a reliable way of demonstrating this and providing patients with a list of safe drugs.

  13. Decomposition of ozone in water in the presence of organic solutes acting as promoters and inhibitors of radical chain reactions

    Energy Technology Data Exchange (ETDEWEB)

    Staehelin, J.; Hoigne, J.


    The decomposition of aqueous ozone is generally due to a chain reaction involving .OH radicals. Many organic solutes (impurities) can react with .OH to yield .O/sub 2//sup -/ upon addition of O/sub 2/. .O/sub 2//sup -/ transfers its electron to a further ozone molecule in a rather selective reaction. The ozonide anion (.O/sub 3//sup -/) formed immediately decomposes into a further .OH radical. Compounds that convert .OH radicals into ozone-selective .O/sub 2//sup -/, therefore, act as promoters of the chain reaction. The efficiencies of different .OH to .O/sub 2//sup -/ converters (e.g., formic acid, primary and secondary alcohols (including sugars), glyoxylic acid, and humic acids) are tested in the presence of other .OH radical scavengers that do not primarily produce .O/sub 2//sup -/ (carbonate, aliphatic alkyl compounds, and tert-butyl alcohol). The derived reaction kinetics allows one to qualitatively interpret the variation of the lifetime of O/sub 3/ found in model solutions and even in natural waters and during drinking water treatment.

  14. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Francisco Danilo Ferreira Paula


    Full Text Available ABSTRACT Introduction: Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. Objective: The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig and T-cell receptor (TCR gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Methods: Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Results: Nine patients (15.8% were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25% by real-time polymerase chain reaction considering a cut-off point of 1 × 10−3 for precursor B-cell acute lymphoblastic leukemia and 1 × 10−2 for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia- free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1% ± 5.6% versus 41.7% ± 17.3%, respectively; p-value = 0.004. There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Conclusion: Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative.

  15. Detection and characterization of cry1Ac transgene construct in Bt cotton: multiple polymerase chain reaction approach. (United States)

    Singh, Chandra K; Ojha, Abhishek; Kachru, Devendra N


    To comply with international labeling regulations for genetically modified (GM) crops and food, and to enable proper identification of GM organisms (GMOs), effective methodologies and reliable approaches are needed. The spurious and unapproved GM planting has contributed to crop failures and commercial losses. To ensure effective and genuine GM cultivation, a methodology is needed to detect and identify the trait of interest and concurrently evaluate the structural and functional stability of the transgene insert. A multiple polymerase chain reaction (PCR) approach was developed for detection, identification, and gene stability confirmation of cry1Ac transgene construct in Bt cotton. As many as 9 samples of Bt cotton hybrid seeds comprising 3 approved Bt hybrids, MECH-12Bt, MECH-162Bt, MECH-184Bt, and a batch of 6 nonapproved Bt hybrids were tested. Initially, single standard PCR assays were run to amplify predominant GM DNA sequences (CaMV 35S promoter, nos terminator, and npt-II marker gene); a housekeeping gene, Gossypium hirsutum fiber-specific acyl carrier protein gene (acp1); a trait-specific transgene (cry1Ac); and a sequence of 7S 3' transcription terminator which specifically borders with 3' region of cry1Ac transgene cassette. The concurrent amplification of all sequences of the entire cassette was performed by 3 assays, duplex, triplex, and quadruplex multiplex PCR assays, under common assay conditions. The identity of amplicons was reconfirmed by restriction endonuclease digestion profile. The 2 distinct transgene cassettes, cry1Ac and npt-II, of the Bt cotton were amplified using the respective forward primer of promoter and reverse primer of terminator. The resultant amplicons were excised, eluted, and purified. The purified amplicons served as template for nested PCR assays. The nested PCR runs confirmed the transgene construct orientation and identity. The limit of detection as established by our assay for GM trait (cry1Ac) was 0.1%. This approach

  16. 15N nuclear reaction analysis for hydrogen profiling at TIT 4.75 MV Van de Graaff

    International Nuclear Information System (INIS)

    A 15N beam line has been upgraded by installing a new analyzing magnet and by controlling beam parameters with a computer. An improved beam intensity of ∼ 20 pnA has realized a detection sensitivity of 1020 H · cm-3 in the hydrogen profilling. The hydrogen profiles have been measured by the 15N nuclear reaction for TiHx and TiHx-Au samples. These profiles are compared with the profiles obtained by SIMS. (author)

  17. [The use of polymerase chain reaction in laboratory diagnosis of dermatophytosis]. (United States)

    Tiryaki, Yasin; Gültekin Korkmazgil, Berna; Eyigör, Mete; Aydın, Neriman


    Dermatophytes are among the common causes of fungal infections in the community. Classical diagnostic tests for dermatophytosis have some disadvantages such as failure of direct microscopy in species differentiation and culture methods being time consuming and having low sensitivity. The aim of this study was to investigate the performance of polymerase chain reaction (PCR) in the identification of dermatophytes directly from the clinical samples and the cultures. A total of 123 samples that comprise 63 skin and 60 nail scrapings obtained from 110 patients (69 female, 41 male; age range: 4-82 years) who were prediagnosed as dermatophytosis, were included in the study. Samples were examined with routine direct microscopy, culture and two different nested PCR (nPCR) protocols. The first was a pan-dermatophyte nPCR protocol targeting chitin synthase gene (CHS-1) of dermatophytes and the second was a nPCR protocol which targets specific ITS-1 genes of Trichophyton rubrum and T.mentagrophytes. Similar PCR methods were also applied to cultivated strains. Sequence analysis was performed for the samples that yielded positive results in pan-dermatophyte nPCR and negative results in T.rubrum/T.mentagrophytes - specific nPCR. Hyphae and/or spore structures were observed in 62 (50%) samples with direct microscopic examination and dermatophytes were isolated in 30 (24%) samples. Twenty-eight of the isolates grown in culture were identified as T.rubrum, and two as T.mentagrophytes with T.rubrum/T.mentagrophytes-specific nPCR protocol. In direct application, 67 (55%) of the clinical samples were found positive with pan-dermatophyte nPCR and 65 (53%) were positive with T.rubrum/T.mentagrophytes-specific nPCR. Samples which were negative in direct microscopic examination were also negative in culture. Nine of them were found positive with pan-dermatophyte nPCR and eight were positive with T.rubrum/T.mentagrophytes-specific nPCR. Two of the 30 samples which were positive in culture

  18. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline;


    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...


    Directory of Open Access Journals (Sweden)

    López-Montanero Edith Elizabeth


    Full Text Available Introduction: The citomegalovirus (CMV is an important virus worldwide. The early and mass-produced detection of the viral load for CMV helps to treat in an early way the infection and to avoid the disease in immunodeficient patients that in several cases could be lethal. Objective: To determine the prevalence of CMV in immunodeficient children who received bone marrow transplantation by means of real-time polymerase chain reaction. Methods: Retrospective, descriptive and cross-sectional study. The viral load was determined in plasma samples recollected since 2009 to 2012 in children who received bone marrow transplantation in the Hospital de la Sociedad de Lucha contra el Cáncer (SOLCA in Guayaquil, Ecuador. Results: 38 samples were analyzed. The average age was 7.2 years, and 57.9% (n=22 were men and 42.1% (n=16 women, with a male-female relationship 1:4. Of the analyzed samples, five patients presented positive results in the mentioned technique, who were the 80% of the female gender. And the population with the higher number of cases with positive results were Los Ríos, Guayas and Esmeraldas. The patients who were transplanted due to acute lymphoblastic leukemia and lymphoma with leukemization to acute lymphoblastic leukemia had positive results for active infection by CMV, 80% and 20%, respectively. Conclusion: The prevalence of CMV in children who received bone marrow transplantation by means of real-time polymerase chain reaction was of 13%, higher in the female gender. Rev.cienc.biomed. 2015;6(1:53-59 KEYWORDS Cytomegalovirus; Cytomegalovirus Infections; Transplant Recipients; Polymerase Chain Reaction.

  20. Human papillomavirus infection and anal carcinoma. Retrospective analysis by in situ hybridization and the polymerase chain reaction.


    Zaki, S R; Judd, R.; Coffield, L. M.; Greer, P; Rolston, F.; Evatt, B L


    To examine the association of human papillomavirus (HPV) infection with anal squamous cell carcinoma, the authors applied the highly sensitive polymerase chain reaction (PCR) and in situ hybridization (ISH) techniques to detect HPV DNA in formalin-fixed, paraffin-embedded tissues from 18 patients. The presence of HPV types 16/18 in 3 (16.7%) of 18 patients with anal carcinoma was found, using a colorimetric ISH technique for HPV types 6, 11, 16, 18, 31, 35, and 51. Results from one of these t...

  1. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products. (United States)

    Infante, Carlos; Manchado, Manuel


    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  2. Rapid and inexpensive species differentiation using a multiplex real-time polymerase chain reaction high-resolution melt assay. (United States)

    Elkins, Kelly M; Perez, Anjelica C U; Sweetin, Katherine C


    We demonstrate a method for developing real-time polymerase chain reaction (PCR) high-resolution melt (HRM) assays to identify multiple species present in a mixture simultaneously using LCGreen Plus and melt temperatures. Highly specific PCR primers are designed to yield amplicons with different melt temperatures for simple routine species identification compared with differentiating melt curve kinetics traces or difference plots. This method is robust and automatable, and it leads to savings in time and reagent costs, is easily modified to probe any species of interest, eliminates the need for post-PCR gel or capillary electrophoresis in routine assays, and requires no expensive dye-labeled primers. PMID:26836486

  3. Evaluation of polymerase chain reaction for the detection of Paracoccidioides brasiliensis DNA on serum samples from patients with paracoccidioidomycosis

    Directory of Open Access Journals (Sweden)

    Cecília Eugenia Charbel


    Full Text Available The aim of this study was to demonstrate the DNA of Paracoccidioides brasiliensis in human serum samples of patients with paracoccidioidomycosis using the polymerase chain reaction (PCR. The diagnosis of paracoccidioidomycosis (PCM was defined by microscopic observation of the fungus on direct exam or histopathology, culture, and serological positivity. DNA from serum of 33 patients with PCM was extracted and submitted to nested-PCR using primers from the gp 43 gene. Only one sample was positive on nested-PCR. We conclude that the prevalence of fungemia in patients with different clinical forms of PCM is low, limiting the use of serum DNA detection as an alternative diagnostic tool.

  4. Detection of Sphingomonas paucimobilis Infections in Domestic Animals by VITEK ® Compaq 2 and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    S Cengiz


    Full Text Available This case report presents the first cases of Sphingomonas paucimobilis in Turkey, which was isolated and identified from two cows, a calf and a lamb by conventional methods, VITEK Compaq® 2 system and Polymerase Chain Reaction (PCR. Compatible findings were reached among clinical history, necropsy findings and bacteriologic results. In conclusion, S. paucimobilis should be considered as a causative agent particularly for respiratory diseases, septicemia and foot infections with resistance to antibiotic treatment. Also, detection methods must be arranged not only for common pathogens but also for S. paucimobilis.

  5. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.; Heum, M.; Thornton, J.M.; Powell, R.


    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot......-sets only. A. salmonicida subsp. salmonicida isolates tested, belonged to group 1. The PCR primer-sets separated A. salmonicida from other reference strains of Aeromonas species and related bacteria with the exception of Aeromonas hydrophila. The results indicated that PCR typing is a useful framework for...

  6. Influence of EDTA and magnesium on DNA extraction from blood samples and specificity of polymerase chain reaction


    H. Khosravinia; Ramesha, KP


    This study consisting of two trails conducted to examine the impact of initial EDTA level added to blood samples on quantity and quality of genomic DNA isolated from avian fresh blood and the influence of initial EDTA level with various levels of $MgCl_2$ added to polymerase chain reaction (PCR) final volume on amplification pattern. EDTA level added to collected blood samples had no significant impact on quantity as well as quality of extracted genomic DNA. However, higher levels of EDTA inc...

  7. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) Larvae in Wetlands, Western Kenya: Confirmation by Polymerase Chain Reaction Method


    Ohba, Shin-ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; SONYE, GORGE; Minakawa, Noboru; Takagi, Masahiro


    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%)....

  8. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in Wetlands, Western Kenya: Confirmation by polymerase chain reaction method


    Ohba, Shin-ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; SONYE, GORGE; Minakawa, Noboru; Takagi, Masahiro


    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%)....

  9. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen. (United States)

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E


    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. PMID:26374912

  10. Ribosomal RNA-based panbacterial polymerase chain reaction for rapid diagnosis of septicaemia in Intensive Care Unit patients. (United States)

    Gupta, Mahua Das; Kaur, Harsimran; Ray, Pallab; Gautam, Vikas; Puri, G D


    Early diagnosis and treatment of sepsis by appropriate antibiotics is of utmost importance. Therefore, we evaluated 16S rRNA panbacterial polymerase chain reaction (PCR) for rapid diagnosis of sepsis in 49 adult patients in Intensive Care Units (ICUs) and compared it with an automated blood culture. 8 ml of 10 ml blood collected was inoculated into BACTEC® aerobic bottle and the remaining 2 ml was used for DNA extraction and PCR. 109 of 115 (93%) episodes of suspected sepsis showed concordant results between automated culture and PCR. Six episodes were positive by PCR only. Panbacterial PCR reduces turnaround time with rapid differentiation between systemic inflammatory response syndrome and sepsis. PMID:27080778

  11. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women


    Parvin Hassanzadeh; Hosein Sharifi; Abdollah Bazargani; Reza Khashei; Amir Emami; Mohammad Motamedifar


    Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain r...



    Esterhuizen, Dirk; van Rooyen, C.J.


    The South African agricultural industry is consistently challenged to increase its competitiveness. The agribusiness supply chain starts with the input sector. The objective of this paper is therefore to determine the competitiveness of the various agricultural input industries in South Africa by using Balassa's method of Revealed Comparative Trade Advantage. This status will then be related to performance of the agricultural industry as a whole. South African manufacturing of farming requisi...

  13. Time-resolved studies of free radicals and laser-initiated chain reactions: Final report, 1 April 1979-31 March 1988

    International Nuclear Information System (INIS)

    Pulsed lasers were used in this work to photofragment molecules or to initiate chain reactions. One of the major advances was the availability of high-powered rare gas halide excimer lasers. In addition, pulsed Nd:YAG lasers and dye lasers were used throughout. Results include: generalized kinetic formulations of the problem of laser-initiated chain reactions. Several studies were carried out to explore the details of chain combustion phenomena, slow chain reactions, chain branching behavior, and vibrational temperatures of combusting mixtures. A method to determine the rotational temperature of nitrogen molecules by laser multiphoton ionization was shown. The chain reaction methodology was applied to complex polyatomic systems, in which complete infrared spectra of the emitting species were obtained. Systems studied included, chlorine + HBr, HI, methane, hydrogen, ethane, propane, butane, cyclopropane, and cyclohexane. Photofragmentation studies involved the production and analysis of radical species, such as methyl, CH2I, and CCH. Molecules studied included methylene iodide, methyl iodide, dimethyl mercury, acetone, acetylene, vinyl chloride, dichloroethylene, and fluorochloroethylene. The first infrared characterization of a highly vibrationally excited radical was shown. Reactions of methyl radicals were studied in detail, in which a new method for obtaining absolute values of the methyl radical reaction rates were obtained

  14. Avian life history profiles for use in the Markov chain nest productivity model (MCnest) (United States)

    The Markov Chain nest productivity model, or MCnest, quantitatively estimates the effects of pesticides or other toxic chemicals on annual reproductive success of avian species (Bennett and Etterson 2013, Etterson and Bennett 2013). The Basic Version of MCnest was developed as a...

  15. Branched chain amino acid metabolism profiles in progressive human nonalcoholic fatty liver disease

    Czech Academy of Sciences Publication Activity Database

    Lake, A.D.; Novák, Petr; Shipkova, P.; Aranibar, N.; Robertson, D.G.; Reily, M.D.; Lehman-McKeeman, L.D.; Vaillancourt, R.R.; Cherrington, N.J.


    Roč. 47, č. 3 (2015), s. 603-615. ISSN 0939-4451 Institutional support: RVO:60077344 Keywords : Branched chain amino acid * nonalcoholic fatty liver disease * nonalcoholic steatohepatitis * metabolomics and transcriptomics Subject RIV: CE - Biochemistry Impact factor: 3.293, year: 2014

  16. Depth profiling of deuterium with the D(3He,p)4He reaction

    International Nuclear Information System (INIS)

    The use of the nuclear reaction D(3He,p)4He for the depth profiling of deuterium was studied. The detection at backward angles of the protons which have energies in excess of 13 MeV, presents distinct advantages with respect to the more conventional method of detecting the associated α particles. The various contributions to the depth resolution in α-Si have been measured or calculated, taking into account detector acceptance angle, size of the probing 3He beam, energy straggling, multiple scattering and lateral spread contributions. Sensitivities are discussed with respect to depth resolution requirements. The method has been applied to deuterium depth profiling in amorphous silicon hydrogenated by implantation or plasma diffusion of deuterium. (orig.)

  17. Influence of temperature inhomogeneity on product profile of reactions occurring within zeolites

    Indian Academy of Sciences (India)

    A V Anil Kumar; S Yashonath; G Ananthakrishna


    In zeolites, diffusion is often accompanied by a reaction or sorption which in turn can induce temperature inhomogeneities. Monte Carlo simulations of Lennard-Jones atoms in zeolite NaCaA are reported for the presence of a hot zone presumed to be created by a reaction or chemi- or physi-sorption site. These simulations show that the presence of localized hot regions can alter both kinetic and transport properties such as diffusion. Further, we show that enhancement of diffusion constant is greater for systems with larger barrier height, a surprising result that may be of considerable significance in many chemical and biological processes. We find an unanticipated coupling between reaction and diffusion due to the presence of a hot zone in addition to that which normally exists via concentration. Implications of this coupling for the product profile of a reaction are discussed. We also propose a mechanism by which mobility of ions or diffusion of molecular species within biomembranes may take place.

  18. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection. (United States)

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao


    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. PMID:26879193

  19. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis. (United States)

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui


    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. J. Med. Virol. 88:871-876, 2016. © 2015 Wiley Periodicals, Inc. PMID:26455510

  20. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N


    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... PCR-ASO technique. The frequencies of the HLA-DPB1 genotypes deduced from the results of PCR-RFLP typing were estimated in 71 healthy Danes.......We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...

  1. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard;


    reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...

  2. Weight gain in anorexia nervosa does not ameliorate the faecal microbiota, branched chain fatty acid profiles, and gastrointestinal complaints. (United States)

    Mack, Isabelle; Cuntz, Ulrich; Grämer, Claudia; Niedermaier, Sabrina; Pohl, Charlotte; Schwiertz, Andreas; Zimmermann, Kurt; Zipfel, Stephan; Enck, Paul; Penders, John


    The gut microbiota not only influences host metabolism but can also affect brain function and behaviour through the microbiota-gut-brain axis. To explore the potential role of the intestinal microbiota in anorexia nervosa (AN), we comprehensively investigated the faecal microbiota and short-chain fatty acids in these patients before (n = 55) and after weight gain (n = 44) in comparison to normal-weight participants (NW, n = 55) along with dietary intake and gastrointestinal complaints. We show profound microbial perturbations in AN patients as compared to NW participants, with higher levels of mucin-degraders and members of Clostridium clusters I, XI and XVIII and reduced levels of the butyrate-producing Roseburia spp. Branched-chain fatty acid concentrations, being markers for protein fermentation, were elevated. Distinct perturbations in microbial community compositions were observed for individual restrictive and binge/purging AN-subtypes. Upon weight gain, microbial richness increased, however perturbations in intestinal microbiota and short chain fatty acid profiles in addition to several gastrointestinal symptoms did not recover. These insights provide new leads to modulate the intestinal microbiota in order to improve the outcomes of the standard therapy. PMID:27229737

  3. Weight gain in anorexia nervosa does not ameliorate the faecal microbiota, branched chain fatty acid profiles, and gastrointestinal complaints (United States)

    Mack, Isabelle; Cuntz, Ulrich; Grämer, Claudia; Niedermaier, Sabrina; Pohl, Charlotte; Schwiertz, Andreas; Zimmermann, Kurt; Zipfel, Stephan; Enck, Paul; Penders, John


    The gut microbiota not only influences host metabolism but can also affect brain function and behaviour through the microbiota-gut-brain axis. To explore the potential role of the intestinal microbiota in anorexia nervosa (AN), we comprehensively investigated the faecal microbiota and short-chain fatty acids in these patients before (n = 55) and after weight gain (n = 44) in comparison to normal-weight participants (NW, n = 55) along with dietary intake and gastrointestinal complaints. We show profound microbial perturbations in AN patients as compared to NW participants, with higher levels of mucin-degraders and members of Clostridium clusters I, XI and XVIII and reduced levels of the butyrate-producing Roseburia spp. Branched-chain fatty acid concentrations, being markers for protein fermentation, were elevated. Distinct perturbations in microbial community compositions were observed for individual restrictive and binge/purging AN-subtypes. Upon weight gain, microbial richness increased, however perturbations in intestinal microbiota and short chain fatty acid profiles in addition to several gastrointestinal symptoms did not recover. These insights provide new leads to modulate the intestinal microbiota in order to improve the outcomes of the standard therapy. PMID:27229737

  4. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection (United States)

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve


    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  5. Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction. (United States)

    Saed, Mohand O; Torbati, Amir H; Nair, Devatha P; Yakacki, Christopher M


    This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addition reaction. Strain-to-failure and glass transition behavior were investigated as a function of crosslinking monomer, pentaerythritol tetrakis(3-mercaptopropionate) (PETMP). An example non-stoichiometric system of 15 mol% PETMP thiol groups and an excess of 15 mol% acrylate groups was used to demonstrate the robust nature of the material. The LCE formed an aligned and transparent monodomain when stretched, with a maximum failure strain over 600%. Stretched LCE samples were able to demonstrate both stress-driven thermal actuation when held under a constant bias stress or the shape-memory effect when stretched and unloaded. A permanently programmed monodomain was achieved via a second-stage photopolymerization reaction of the excess acrylate groups when the sample was in the stretched state. LCE samples were photo-cured and programmed at 100%, 200%, 300%, and 400% strain, with all samples demonstrating over 90% shape fixity when unloaded. The magnitude of total stress-free actuation increased from 35% to 115% with increased programming strain. Overall, the two-stage TAMAP methodology is presented as a powerful tool to prepare main-chain LCE systems and explore structure-property-performance relationships in these fascinating stimuli-sensitive materials. PMID:26862925

  6. Chromatographic elution profile of an analyte involved in reversible chemical reaction of the type A + B AB. (United States)

    Kanatyeva, A Yu


    The chromatographic peak profile of the analyte involved in a chemical reaction of the type A + B AB is considered using method of the apparent adsorption isotherm. The apparent isotherms derived are nonlinear even under assumption of Henry isotherms of individual solutes. Nonlinearity of apparent adsorption isotherm results in peak distortion. The resulted chromatographic peak profile depends on several factors such as the equilibrium constant K(mob) and Henry constants of the solutes. Simulated peak profiles of solutes involved in the chemical reaction are presented as illustration of influence of various factors. PMID:16965781

  7. Optimization of the performance of the polymerase chain reaction in silicon-based microstructures.


    Taylor, T B; Winn-Deen, E S; Picozza, E; Woudenberg, T M; Albin, M


    We have demonstrated the ability to perform real-time homogeneous, sequence specific detection of PCR products in silicon microstructures. Optimal design/ processing result in equivalent performance (yield and specificity) for high surface-to-volume silicon structures as compared to larger volume reactions in polypropylene tubes. Amplifications in volumes as small as 0.5 microl and thermal cycling times reduced as much as 5-fold from that of conventional systems have been demonstrated for the...

  8. A new era for homolytic aromatic substitution: replacing Bu3SnH with efficient light-induced chain reactions. (United States)

    Gurry, Michael; Aldabbagh, Fawaz


    Herein is a pertinent review of recent photochemical homolytic aromatic substitution (HAS) literature. Issues with using the reductant Bu3SnH in an oxidative process where the net loss of a hydrogen atom occurs is discussed. Nowadays more efficient light-induced chain reactions are used resulting in HAS becoming a synthetic mechanism of choice rivaling organometallic, transition-metal and electrophilic aromatic substitution protocols. The review includes aromatic substitution as part of a tandem or cascade reaction, Pschorr reaction, as well as HAS facilitated by ipso-substitution, and Smiles rearrangement. Recently visible-light photoredox catalysis, which is carried out at room temperature has become one of the most important means of aromatic substitution. The main photoredox catalysts used are polypyridine complexes of Ru(ii) and Ir(iii), although eosin Y is an alternative allowing metal-free HAS. Other radical initiator-free aromatic substitutions have used 9-mesityl-10-methylacridinium ion and N,N-bis(2,6-diisopropylphenyl)perylene-3,4,9,10-bis(dicarboximide) as the photoredox catalyst, UV-light, photoinduced electron-transfer, zwitterionic semiquinone radical anions, and Barton ester intermediates. PMID:27056571

  9. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis. (United States)

    Chase, Dorothy M; Elliott, Diane G; Pascho, Ronald J


    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids. PMID:16921877

  10. Market-Based Supply Chain Coordination by Matching Suppliers' Cost Structures with Buyers' Order Profiles


    Yu Xia; Bintong Chen; Panos Kouvelis


    We study competitive marketplaces with multiple suppliers and multiple buyers dealing with a single product. A buyer chooses the supplier who offers the best price for his order profile, as described by his order size and delivery frequency. A supplier's offering price reflects her logistic cost structure as captured by relevant economies of scale in a "setup cost" component, and storage- and distribution-related costs in a "holding cost per unit" component. We argue that the matching of buye...

  11. Volatile profiling reveals intracellular metabolic changes in Aspergillus parasiticus: veA regulates branched chain amino acid and ethanol metabolism

    Directory of Open Access Journals (Sweden)

    Roze Ludmila V


    Full Text Available Abstract Background Filamentous fungi in the genus Aspergillus produce a variety of natural products, including aflatoxin, the most potent naturally occurring carcinogen known. Aflatoxin biosynthesis, one of the most highly characterized secondary metabolic pathways, offers a model system to study secondary metabolism in eukaryotes. To control or customize biosynthesis of natural products we must understand how secondary metabolism integrates into the overall cellular metabolic network. By applying a metabolomics approach we analyzed volatile compounds synthesized by Aspergillus parasiticus in an attempt to define the association of secondary metabolism with other metabolic and cellular processes. Results Volatile compounds were examined using solid phase microextraction - gas chromatography/mass spectrometry. In the wild type strain Aspergillus parasiticus SU-1, the largest group of volatiles included compounds derived from catabolism of branched chain amino acids (leucine, isoleucine, and valine; we also identified alcohols, esters, aldehydes, and lipid-derived volatiles. The number and quantity of the volatiles produced depended on media composition, time of incubation, and light-dark status. A block in aflatoxin biosynthesis or disruption of the global regulator veA affected the volatile profile. In addition to its multiple functions in secondary metabolism and development, VeA negatively regulated catabolism of branched chain amino acids and synthesis of ethanol at the transcriptional level thus playing a role in controlling carbon flow within the cell. Finally, we demonstrated that volatiles generated by a veA disruption mutant are part of the complex regulatory machinery that mediates the effects of VeA on asexual conidiation and sclerotia formation. Conclusions 1 Volatile profiling provides a rapid, effective, and powerful approach to identify changes in intracellular metabolic networks in filamentous fungi. 2 VeA coordinates the

  12. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13. (United States)

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna


    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. PMID:27072123

  13. Molecular detection of the carriage rate of four intestinal protozoa with real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L;


    -Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...... intestinalis, and Cryptosporidium. Questionnaires were administered for epidemiological data collection. E. histolytica was not detected in any of the samples, whereas Giardia (37.2%), E. dispar (18.6%), and Cryptosporidium (1%) were found. Most of the children sourced their drinking water from community wells...... (91%), while the majority disposed of feces in the bush (81.9%). Our study is the first to use real-time PCR to evaluate the epidemiology of E. histolytica, Giardia, and Cryptosporidium in Nigeria where previous studies using traditional diagnostic techniques have suggested higher and lower carriage...

  14. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    DEFF Research Database (Denmark)

    Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen; Uldum, Søren A.


    samples without any background information regarding treatment, timing, etc is dubious. However, the rapid detection by qPCR of high concentrations of Legionella - especially Legionella pneumophila - is valuable as an indicator of risk, although it may be false positive compared to culture results. On the......Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...

  15. Implementation of polymerase chain reaction (PCR and Real-Time PCR in quick identification of bovine herpesvirus 1

    Directory of Open Access Journals (Sweden)

    Milić Nenad


    Full Text Available Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these cell lines. The application of polymerize chain reaction (PCR using a primer for glucoprotein B and thymidine - kinasis, established the presence of bovine herpes virus 1 nucleic acid in one sample of a bovine nasal smear, while the presence of this virus was established in three samples in an examination of the nasal smear samples using the Real-Time PCR method.

  16. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization. (United States)

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J


    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii. PMID:27206968

  17. Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food. (United States)

    Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre


    Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system. PMID:12083257


    Institute of Scientific and Technical Information of China (English)

    徐作军; 马东来; 罗慰慈; 朱元珏


    To investigate the correlation between sarcoidosis and Borrelia burgdorferi (Bb) infection,flagella DNA of Bb were detected in 23 granulomatous tissue specimens from patients with confirmed sarcoidosis usingpolymerase chain reaction in situ technique (in situ PCR) and the antibodies to Bb were examined in 55 serum samples obtained from the patients by indirect immunoflurescence assays. Our data presented that =(1) None of granulomatous tissues was found to have Bb DNA in 23 tissue samples. (2) Thirty of 55(54.6%) patients with sarcoidosis were found antibodies to Bh positive,in contrast,six of 60 (10%) norreal subjects had antibodies against Bb,the positive rate was remarkably higher in patient group than thatin healthy group (P(0. 005). The results suggest that Bb might not be the causative agent of sarcoidosis,the elevated titres of serum antibodies against Bb in patients with sarcoidosis is a nonspecific response.


    Directory of Open Access Journals (Sweden)



    Full Text Available Yeast Saccharomyces cerevisiae is an excellent model to studi genes function of eukarotic cells such as study of gene encoding protein phosphatase PTC2. Novel phenotypic caused by mutated gene is an important step to study function of gene. In this study constructed mutant of PTC2 gene encoding protein phosphatase. Method that used in this construction was replacement of target gene (PTC2 with auxotroph marker Candida albicans HIS3 by Polymer Chain Reaction (PCR or called by PCR-mediated disruption. Mutant colonies which grew in selective medium SC without histidine were confirmed by PCR amplification. By using 1% Agarose gel electrophoresis the result showed that size of ptc2D::CgHIS3 transformant was 3.52 kb while wild type strain was 2.9 kb, indicated that ptc2D::CgHIS3 has integrated on chromosome V replacing PTC2 wild type.

  20. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction. (United States)

    Lunkenheimer, K; Hufert, F T; Schmitz, H


    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specimens of patients with acute Lassa fever, viral RNA could be demonstrated. Negative results were obtained with all serum and urine specimens of healthy subjects. Our data suggest that PCR may be applied as an alternative to virus isolation in the rapid diagnosis of Lassa fever. Images PMID:2279999

  1. Quantification of Porcine Follicle-stimulating Hormone Receptor Messenger Ribonucleic Acid by Reverse Transcription-competitive Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)


    An easy and reliable method was developed for construction and quantification of competitive templates, which shared the same sequence as the amplified target DNA except for a 20-bp insertion in the middle by recombinant polymerase chain reaction (PCR). Among the advantages of competitive PCR is that any predictable or unpredictable variable that affects amplification has the same effect on both target and competitor species and that the final ratio of amplified products reflects exactly the initial targets. The utilization of a thermostable reverse transcriptase in the RT step was proposed to overcome the problem of the efficiency of target cDNA synthesis. In addition, to obtain reliable measurements, it was recommended to perform four PCR with amounts of competitive template flanking the concentration of the target mRNA.

  2. An allele-specific polymerase chain reaction assay for the differentiation of members of the Anopheles culicifacies complex

    Indian Academy of Sciences (India)

    O P Singh; Geeta Goswami; N Nanda; K Raghavendra; D Chandra; S K Subbarao


    Anopheles culicifacies, the principal vector of malaria in India, is a complex of five cryptic species which are morphologically indistinguishable at any stage of life. In view of the practical difficulties associated with classical cytotaxonomic method for the identification of members of the complex, an allele-specific polymerase chain reaction (ASPCR) assay targeted to the D3 domain of 28S ribosomal DNA was developed. The assay discriminates An. culicifacies species A and D from species B, C and E. The assay was validated using chromosomally-identified specimens of An. culicifacies from different geographical regions of India representing different sympatric associations. The assay correctly differentiates species A and D from species B, C and E. The possible use of this diagnostic assay in disease vector control programmes is discussed.

  3. Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda


    Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

  4. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini


    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  5. Development of a multiplex polymerase chain reaction to detect five common Gram-negative bacteria of aquatic animals. (United States)

    Tsai, M-A; Ho, P-Y; Wang, P-C; E, Y-J; Liaw, L-L; Chen, S-C


    A multiplex polymerase chain reaction (m-PCR) technique was developed as a rapid and accurate diagnostic tool for identifying five major Gram-negative bacilli -Vibrio vulnificus, V. parahaemolyticus, Aeromonas hydrophila, Chryseobacterium meningosepticum and Edwardsiella tarda- that cause major diseases in cultured aquatic animals in Taiwan. The expected amplicons for V. vulnificus, V. parahaemolyticus, A. hydrophila, C. meningosepticum and E. tarda were 410, 368, 685, 180 and 230bp, respectively. The assay was shown to be specific for the target pathogens. The sensitivities of detection were estimated to be 20.5fg∼200pg of genomic DNA or 10(2) ∼10(4) colony-forming units (cfu) of bacterial isolates when adopted as PCR templates. The m-PCR was capable of simultaneously amplifying target fragments from bacterial genome DNA mixed with the DNA extracted from viscera and tissues taken from fish without affecting the performance of the method. PMID:22571515

  6. Analysis of ancient DNA from coprolites: a perspective with random amplified polymorphic DNA-polymerase chain reaction approach

    Directory of Open Access Journals (Sweden)

    Iñiguez Alena M


    Full Text Available The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pretreatment was essential to overcome the DNA degradation and the serial dilutions helped with to prevent polymerase chain reaction (PCR inhibitors. Moreover, the random amplified polymorphic DNA-PCR has been shown to be a reliable technique for further experiments to recover specific aDNA sequences.

  7. DNAzyme-based biosensor for Cu(2+) ion by combining hybridization chain reaction with fluorescence resonance energy transfer technique. (United States)

    Chen, Ying; Chen, Ling; Ou, Yidian; Wang, Zhenhua; Fu, Fengfu; Guo, Liangqia


    A novel signal amplification strategy based on Cu(2+)-dependent DNAzyme was developed for sensing Cu(2+) ion by combining hybridization chain reaction (HCR) with fluorescence resonance energy transfer (FRET) technique. In the presence of Cu(2+) ion, the substrate strands of Cu(2+)-dependent DNAzyme immobilized on magnetic beads were specifically cleaved and released. The released strands initiated the HCR process of hairpin H1 and H2 labeled with FAM as the donor and TAMRA as the acceptor, respectively. Long nicked dsDNA structures were self-assembled to bring the donor and the acceptor in close proximity, resulting in a FRET process. The relative ratio of fluorescent intensities of the acceptor and donor was used to quantitatively detect Cu(2+) ion with a limit of detection of 0.5nmolL(-1). This proposed biosensor was applied to detect Cu(2+) ion in tap water with satisfactory results. PMID:27216680

  8. Detection of Nesopora caninum-specific DNA from cerebrospinal fluid by polymerase chain reaction in a dog with confirmed neosporosis. (United States)

    Ishigaki, Kyohei; Noya, Masahiko; Kagawa, Yumiko; Ike, Kazunori; Orima, Hiromitsu; Imai, Soichi


    A one-month male Greyhound dog presented with a swinging gait of the hindlimbs, and later developed muscular atrophy of the femoral region and hyperextension of hindlimbs. The dog had positive serum IFAT titers to Neospora caninum, but a negative titer in the cerebrospinal fluid (CSF). N. caninum-specific DNA was amplified from the CSF using a semi-nested polymerase chain reaction assay. Clusters of protozoa in biopsied muscle fibers were subsequently confirmed as N. caninum tachyzoites by immunohistochemical examination. Early recognition and treatment are necessary for effective recovery of clinical canine neosporosis, but antemortem diagnosis is difficult. We suggest that the detection of parasite deoxyribonucleic acid in the CSF is a useful antemortem diagnostic method in facilitating treatment of this disease. PMID:22446406


    Directory of Open Access Journals (Sweden)

    Reni Herman


    Full Text Available In monitoring the treatment of malaria with Dihydroartemisinin-piperaquine (DHP, microscopic cross check and Polymerase Chain Reaction (PCR performed to validate the results of laboratory examinations in the field. This study used finger prick samples from subjects with a diagnosis of malaria in monitoring the treatment of malaria with DHP in Kalimantan and Sulawesi. Samples taken at day 0, blood smears made on slides for microscopic and blood spot on filter paper for PCR examination. The PCR method used is a single-round multiplex polymerase chain reaction that has been modified, the examination of each species carried out in different tubes to distinguish the species P. falciparum or P. Vivax. Target of DNA amplification is a species-specific gene sequences in the small-subunit ribosomal RNA (SSUrRNA, 300 bp for P. falciparum and 276 bp for P.vivax.  P. falciparum and P.vivax identified in 229 samples of blood smears and blood spots. Microscopic and PCR gave the same results, positive 93.4% and negative 6.6% with a sensitivity of  99% and specificity 93.3%. P.falciparum sensitivity and specificity of 92% and 99%, P.vivax 97% and 94%, PCR as a gold standard. There are differences in the results of examination of 5 samples, ie with microscopic examination identified as P.vivax  while the PCR as P. falciparum. In this study, identification of  the microscopic parasite similar to the results of identification by PCR, but differ in determining the types of parasites. In general, the ability to microscopic diagnosis of malaria is very good, but confirmation by PCR is still needed.AbstrakPada monitoring pengobatan malaria  dengan Dihydroartemisinin-piperaquine (DHP,cek silang mikroskopis dan Polymerase Chain Reaction (PCR dilakukan untuk memvalidasi hasil pemeriksaan di laboratorium lapangan. Penelitian ini menggunakan sediaan darah jari dari subyek dengan diagnosis malaria pada monitoring pengobatan malaria dengan DHP di Kalimantan dan Sulawesi

  10. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.;


    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot......), the glycerophospholipid:cholestrol acetyltransferase protein (GCAT), and the 16S rRNA (16S rDNA). All the atypical A. salmonicida isolates could be assigned to 4 PCR groups. Group 1 comprised 45 strains which rested positive for PCR amplification, using the 16S rDNA, GCAT2, Sprot2, and AP primer......-sets only. A. salmonicida subsp. salmonicida isolates tested, belonged to group 1. The PCR primer-sets separated A. salmonicida from other reference strains of Aeromonas species and related bacteria with the exception of Aeromonas hydrophila. The results indicated that PCR typing is a useful framework for...

  11. Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

    International Nuclear Information System (INIS)

    Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

  12. Differential detection of turkey coronavirus, infectious bronchitis virus, and bovine coronavirus by a multiplex polymerase chain reaction. (United States)

    Loa, C C; Lin, T L; Wu, C C; Bryan, T A; Hooper, T A; Schrader, D L


    The objective of the present study was to develop a multiplex polymerase chain reaction (PCR) method for differential detection of turkey coronavirus (TCoV), infectious bronchitis coronavirus (IBV), and bovine coronavirus (BCoV). Primers were designed from conserved or variable regions of nucleocapsid (N) or spike (S) protein gene among TCoV, IBV, and BCoV and used in the same PCR reaction. Reverse transcription followed by the PCR reaction was used to amplify a portion of N or S gene of the corresponding coronaviruses. The PCR products were detected on agarose gel stained with ethidium bromide. Two PCR products, a 356-bp band corresponding to N gene and a 727-bp band corresponding to S gene, were obtained for TCoV isolates. In contrast, one PCR product of 356 bp corresponding to a fragment of N gene was obtained for IBV strains and one PCR product of 568 bp corresponding to a fragment of S gene was obtained for BCoV. There were no PCR products with the same primers for Newcastle disease virus, Marek's disease virus, turkey pox virus, pigeon pox virus, fowl pox virus, reovirus, infectious bursal disease virus, enterovirus, astrovirus, Salmonella enterica, Escherichia coli, and Mycoplasma gallisepticum. Performance of the assay with serially diluted RNA demonstrated that the multiplex PCR could detect 4.8x10(-3) microg of TCoV RNA, 4.6x10(-4) microg of IBV RNA, and 8.0x10(-2) microg of BCoV RNA. These results indicated that the multiplex PCR as established in the present study is a rapid, sensitive, and specific method for differential detection of TCoV, IBV, and BCoV in a single PCR reaction. PMID:16137773

  13. Polymerase Chain Reaction-based Suppression of Repetitive Sequences in Whole Chromosome Painting Probes for FISH

    Energy Technology Data Exchange (ETDEWEB)

    Dugan, L C; Pattee, M; Williams, J; Eklund, M; Bedford, J S; Christian, A T


    We have developed a method to suppress the PCR amplification of repetitive sequences in whole chromosome painting probes by adding Cot-1 DNA to the amplification mixture. The repetitive sequences in the Cot-1 DNA bind to their homologous sequences in the probe library, prevent the binding of primers, and interfere with extension of the probe sequences, greatly decreasing PCR efficiency selectively across these blocked regions. A second labeling reaction is then done and this product is resuspended in FISH hybridization mixture without further addition of blocking DNA. The hybridization produces little if any non-specific binding on any other chromosomes. We have been able to successfully use this procedure with both human and rat chromosome probes. This technique should be applicable in producing probes for CGH, M-FISH and SKY, as well as reducing the presence of repetitive DNA in genomic libraries.

  14. Reactions of 1,4-bis(tetrazole)benzenes: formation of long chain alkyl halides


    Kelleher, Fintan; Bond, Andrew; Fleming, Adrienne; McGinley, John; Prajapati, Vipa


    The reactions of 1,4-bis[2-(tributylstannyl)tetrazol-5-yl]benzene with α,ω-dibromoalkanes were carried out in order to synthesise pendant alkyl halide derivatives of the parent bis-tetrazole. This led to the formation of several alkyl halide derivatives, substituted variously at N1 or N2 on the tetrazole ring. The crystal structures of 1,4-bis[(2-(4-bromobutyl)tetrazol-5-yl)]benzene (2-N,2-N′), 1,4-bis[(2-(4-bromobutyl)tetrazol-5-yl)]benzene (1-N,2-N′) and 1,4-bis[(2-(8-bromooctyl)tetra...

  15. Leptospira spp detection by Polymerase Chain Reaction (PCR in clinical samples of captive black-capped Capuchin monkey (Cebus apella

    Directory of Open Access Journals (Sweden)

    Scarcelli Eliana


    Full Text Available Leptospirosis is a widely distributed zoonosis that affects domestic and wild animals, and that has the man as the end point of its epidemiological chain. Leptospirosis diagnosis in primates is more difficult than in other animal species, as clinical signs and lesions are less evident and antibody response is detected only for short periods. The aim of this article was to describe the detection of Leptospira spp using polymerase chain reaction (PCR, in clinical samples from one captive black-capped Capuchin monkey (Cebus apella, which presented characteristics compatible with leptospirosis (jaundice and haemorrhagic kdney in the macroscopic post-mortem examination. A friable kidney fragment and urine sample were cultured and submitted to experimental inoculation in guinea pigs and PCR using genus specific primer pair targeting the 16S rRNA region from Leptospira interrogans serovar canicola. Isolation of the agent was negative both in culture and experimental inoculation. The PCR amplification of the clinical samples showed a 330 pb amplified fragment that corresponds to the Leptospira genus. Based on these results PCR was considered an important tool for leptospira detection in nonhumam primates, more sensitive and specific than other techniques, especially considering that the viability of the pathogen was not possible. These advantages enable the detection of the leptospiras in urine and kidney, even when autolysed, frozen or badly conserved, which prevented the isolation and experimental inoculation from positive results.

  16. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

    Directory of Open Access Journals (Sweden)

    Vítor Yamashiro Rocha Soares


    Full Text Available An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis of the mitochondrial cytochrome B (cytb gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1, Bos taurus (1 and Equus caballus (2. Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  17. Species-specific polymerase chain reaction primer sets for the diagnosis of Tenacibaculum maritimum infection. (United States)

    Avendaño-Herrera, Rubén; Magariños, Beatriz; Toranzo, Alicia E; Beaz, Roxana; Romalde, Jesús L


    In this study the specificity and sensitivity of 2 primer pairs, MAR1-MAR2 and Mar1-Mar2, for the detection of Tenacibaculum maritimum were evaluated in parallel using 79 T. maritimum strains isolated from different fish species, as well as 53 representatives of related and unrelated bacterial species. Both primer pairs were species-specific for T. maritimum, since no amplification products were obtained from chromosomal DNA of the non-T. maritimum bacteria tested. However, whereas MAR1-MAR2 identified all the T. maritimum strains studied, producing a unique and clear PCR band of the expected 1088 bp length, the Marl-Mar2 primer pair failed to amplify the 400 bp specific band in 3 sole isolates. To verify if these strains belonged to T. maritimum species, 2 endonucleases (PvuI and SacII) were selected as the most adequate enzymes to confirm the specificity of the MAR1-MAR2 amplified fragment. The digestion patterns obtained with both endonucleases supported the assignation of all the strains to T. maritimum. The sensitivity of both PCR detection methods was also different, showing a reduction of sensitivity in at least one order of magnitude of the Marl-Mar2 primer pair in comparison with MAR1-MAR2. When the MAR-MAR2 PCR protocol was applied to different seeded turbot tissues, the detection limit was 10(2) to 10(4) T. maritimum cells per reaction. In addition, a nested PCR protocol for detection of this pathogens based on MAR1-MAR2 was developed, which increased the sensitivity by approximately 2 orders of magnitude, ranging from 1 to 250 T. maritimum cells per reaction depending on the tissue employed. The tissues that allowed the most easy detection of T. maritimum were the skin and mucus. Based on the findings reported here, we propose the nested PCR protocol as the most adequate for an accurate detection of T. maritimum in diagnostic pathology as well as in epidemiological studies of gliding bacterial disease of marine fish. PMID:15648833

  18. Identification of five highly priced tuna species by quantitative real-time polymerase chain reaction. (United States)

    Liu, Shasha; Xu, Kunhua; Wu, Zhigang; Xie, Xiao; Feng, Junli


    Tunas are economically important fishery worldwide, and are often used for commercial processed production. For effective fishery management and protection of consumers' rights, it is important to develop a molecular method to identify species in canned tuna products rapidly and reliably. Here, we have developed a duplex quantitative real-time PCR (qPCR) for identification of five highly priced tuna species (Thunnus maccoyii, Thunnus obesus, Thunnus albacares, Thunnus alalunga and Katsuwonus pelamis) from processed as well as fresh fish. After amplification and sequencing of seven genetic markers commonly used for species identification, 16S rDNA and control region (CR) of mitochondrial DNA were selected as the reference gene markers for genus Thunnus and tuna species identification, respectively. Subsequently, a 73 bp fragment of 16S rDNA and 85-99 bp fragment of CR were simultaneously amplified from each target species by qPCR. The qPCR efficiency of each reaction was calculated according to the standard curves, and the method was validated by amplification DNA extracted from single or mixed tuna specimen. The developed duplex qPCR system was applied to authenticate species of 14 commercial tuna products successfully, which demonstrated it was really a useful and academic technique to identify highly priced tuna species. PMID:25714139

  19. Identification of four squid species by quantitative real-time polymerase chain reaction. (United States)

    Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan


    Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. PMID:26772407

  20. Knockout confirmation for Hurries: rapid genotype identification of Trypanosoma cruzi transfectants by polymerase chain reaction directly from liquid culture

    Directory of Open Access Journals (Sweden)

    Monica Visnieski Alcantara


    Full Text Available Gene knockout is a widely used approach to evaluate loss-of-function phenotypes and it can be facilitated by the incorporation of a DNA cassette having a drug-selectable marker. Confirmation of the correct knockout cassette insertion is an important step in gene removal validation and has generally been performed by polymerase chain reaction (PCR assays following a time-consuming DNA extraction step. Here, we show a rapid procedure for the identification of Trypanosoma cruzi transfectants by PCR directly from liquid culture - without prior DNA extraction. This simple approach enabled us to generate PCR amplifications from different cultures varying from 106-108 cells/mL. We also show that it is possible to combine different primer pairs in a multiplex detection reaction and even to achieve knockout confirmation with an extremely simple interpretation of a real-time PCR result. Using the “culture PCR” approach, we show for the first time that we can assess different DNA sequence combinations by PCR directly from liquid culture, saving time in several tasks for T. cruzi genotype interrogation.

  1. Simultaneous detection of pyrethroid, organophosphate, and cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex polymerase chain reaction. (United States)

    Domingues, Luísa N; Guerrero, Felix D; Foil, Lane D


    The horn fly, Haematobia irritans irritans (L., 1758) (Diptera: Muscidae), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex polymerase chain reaction (PCR) assay to simultaneously detect target site resistance to pyrethroids (kdr mutation), organophosphates (G262A acetylcholinesterase mutation), and cyclodienes (Rdl mutation) and used the new procedure to follow the progression of these three mutations after exposure to different insecticide pressure. We assayed flies collected at the Macon Ridge research station, Winnsboro, LA, from 2008 to 2012. The multiplex PCR showed robust results in all our assays. The kdr mutation remained at high frequencies during all years, even after 4 yr with no use of pyrethroids. The G262A acetylcholinesterase mutation fluctuated from 7.5 to 23.8% during the studied years, while the Rdl mutation was rare in 2008, 2009, and June 2010, and then significantly increased after the first use of endosulfan. The possibility of screening for all the known target site resistance mutations in a single PCR reaction makes the multiplex PCR a useful and affordable tool that can be used to help diagnose insecticide resistance. PMID:25276924

  2. A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load. (United States)

    Kidd, I M; Clark, D A; Emery, V C


    Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed. PMID:10856765

  3. Dispersion quality of amine functionalized multiwall carbon nanotubes plays critical roles in polymerase chain reaction enhancement

    Energy Technology Data Exchange (ETDEWEB)

    Yuce, Meral, E-mail:; Budak, Hikmet [Sabanci University, Nanotechnology Research and Application Centre (Turkey)


    Impact of dispersion quality of NH{sub 2}-MWCNTs (13–18 nm in diameter with a length between 1 and 12 µm, >99 % purity) in the amplification efficiency of a random DNA oligonucleotide library (96 bp) was investigated. Amplification yield in the presence of non-filtered NH{sub 2}-MWCNT dispersion, filtered NH{sub 2}-MWCNT dispersion and surface-attached NH{sub 2}-MWCNTs was explored, and physical interactions between NH{sub 2}-MWCNTs and major PCR reagents including DNA template, wild type Taq DNA polymerase enzyme and primers were determined using high resolution polyacrylamide gel electrophoresis, dynamic light scattering, UV–Vis-NIR spectroscopy and scanning electron microscopy techniques. The results revealed that presence of NH{sub 2}-MWCNT dispersion which was sonicated, centrifuged and filtered, enhanced the total PCR efficiency up to 70 % while the presence of NH{sub 2}-MWCNT only centrifuged after sonication, inhibited the reaction significantly at similar concentrations. Furthermore, the NH{sub 2}-MWCNTs coupled covalently onto magnetic microspheres, contributed for the specificity enhancement whilst decreasing the amplification efficiency by 30 % at the maximum concentration, which suggests a removable enhancement system for sensitive applications. On the other hand, the relative hydrodynamic size distribution measurements displayed a clear difference between the filtered NH{sub 2} and non-filtered NH{sub 2}-MWCNT water dispersions, which justifies the inhibition of the amplification by the non-filtered NH{sub 2}-MWCNTs containing big agglomerates and bundles. Finally, we demonstrated that major PCR components adsorb onto the NH{sub 2}-MWCNTs with diverse affinities, and maintain their functions after adsorption, which provides a good framework to further develop tunable NH{sub 2}-MWCNT-carriers to be utilized in various nanobiotechnology and material science applications.

  4. Rapid detection of sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction. (United States)

    Yoo, Mi-Sun; Thi, Kim Cuc Nguyen; Van Nguyen, Phu; Han, Sang-Hoon; Kwon, Soon-Hwan; Yoon, Byoung-Su


    A real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for the fast and highly sensitive detection of the sacbrood virus (SBV) genome and applied to honeybee samples. Using plasmid DNA containing a partial SBV genome and diluted serially, as few as 1×10(2)copies/μl (correlation co-efficiency >0.99) were detected by the qRT-PCR assay, whereas 1×10(3)copies/μl were detected by the conventional RT-PCR assay. As a rapid detection method, ultra-rapid real-time PCR (URRT-PCR) was carried out with a GenSpector TMC-1000 silicon-glass chip-based thermal cycler, which has a 6μl micro-chamber volume and a fast outstandingly heating/cooling rate. Using this method, 10(3)copies of pBX-SBV3.8 clone were detected within 17 min after 40 PCR cycles, including melting point analysis. To reduce the detection time for SBV, synthesis of the cDNA of the SBV genome from a honeybee sample was attempted for different reaction times and the cDNA was used as the template for URRT-PCR assays. The results indicated that a 5 min reaction time was sufficient to synthesize cDNA as the template for the SBV URRT-PCR assay. This study described a novel PCR-based method that is able to detect an RNA virus in environmental samples within 22 min, including reverse transcription, PCR detection and melting point analysis in real-time. PMID:22079620

  5. Differential diagnosis of fowlpox and infectious laryngotracheitis viruses in chicken diphtheritic manifestations by mono and duplex real-time polymerase chain reaction. (United States)

    Davidson, Irit; Raibstein, Israel; Altory, Amira


    Infectious laryngotracheitis virus (ILTV) and fowlpox virus (FPV) cause diphtheritic lesions in chicken tracheas and can simultaneously infect the same bird. A differential molecular diagnostic test, the duplex real-time polymerase chain reaction, is now reported using ILTV and FPV vaccine viruses and clinical samples from chickens, either uninfected or naturally infected with ILTV or FPV, or with both viruses. The dual virus amplification by real-time polymerase chain reaction was demonstrated to behave similarly to monoplex amplification, in spite of the fact that the real-time exponential amplification plots of the vaccine viruses were more illustrative than those of the clinical samples. PMID:25317604

  6. Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre;


    Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

  7. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms. (United States)

    Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven


    Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The

  8. Integrated compound profiling screens identify the mitochondrial electron transport chain as the molecular target of the natural products manassantin, sesquicillin, and arctigenin. (United States)

    Lai, Kevin; Selinger, Douglas W; Solomon, Jonathan M; Wu, Hua; Schmitt, Esther; Serluca, Fabrizio C; Curtis, Daniel; Benson, John D


    Phenotypic compound screens can be used to identify novel targets in signaling pathways and disease processes, but the usefulness of these screens depends on the ability to quickly determine the target and mechanism of action of the molecules identified as hits. One fast route to discovering the mechanism of action of a compound is to profile its properties and to match this profile with those of compounds of known mechanism of action. In this work, the Novartis collection of over 12,000 pure natural products was screened for effects on early zebrafish development. The largest phenotypic class of hits, which caused developmental arrest without necrosis, contained known electron transport chain inhibitors and many compounds of unknown mechanism of action. High-throughput transcriptional profiling revealed that these compounds are mechanistically related to one another. Metabolic and biochemical assays confirmed that all of the molecules that induced developmental arrest without necrosis inhibited the electron transport chain. These experiments demonstrate that the electron transport chain is the target of the natural products manassantin, sesquicillin, and arctigenin. The overlap between the zebrafish and transcriptional profiling screens was not perfect, indicating that multiple profiling screens are necessary to fully characterize molecules of unknown function. Together, zebrafish screening and transcriptional profiling represent sensitive and scalable approaches for identifying bioactive compounds and elucidating their mechanism of action. PMID:23138533

  9. Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

    Directory of Open Access Journals (Sweden)

    Raden Wasito


    Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

  10. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta


    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  11. Enhancing the specificity and efficiency of polymerase chain reaction using polyethyleneimine-based derivatives and hybrid nanocomposites

    Directory of Open Access Journals (Sweden)

    Tong W


    Full Text Available Weiwei Tong1,2, Xueyan Cao2, Shihui Wen2, Rui Guo2, Mingwu Shen2, Jianhua Wang3, Xiangyang Shi1,2,41State Key Laboratory for Modification of Chemical Fibers and Polymer Materials, Donghua University, Shanghai, 2College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai, 3Department of Biochemistry and Molecular Cell Biology, School of Medicine, Shanghai Jiao Tong University, Shanghai, People's Republic of China; 4Centro de Química da Madeira, Universidade da Madeira, Funchal, PortugalAbstract: There is a general necessity to improve the specificity and efficiency of the polymerase chain reaction (PCR, and exploring the PCR-enhancing mechanism still remains a great challenge. In this paper we report the use of branched polyethyleneimine (PEI-based derivatives and hybrid nanocomposites as a novel class of enhancers to improve the specificity and efficiency of a nonspecific PCR system. We show that the surface-charge polarity of PEI and PEI derivatives plays a major role in their effectiveness to enhance the PCR. Positively charged amine-terminated pristine PEI, partially (50% acetylated PEI (PEI-Ac50, and completely acetylated PEI (PEI-Ac are able to improve PCR efficiency and specificity with an optimum concentration order of PEI < PEI-Ac50 < PEI-Ac, whereas negatively charged carboxyl-terminated PEI (PEI-SAH; SAH denotes succinamic acid groups and neutralized PEI modified with both polyethylene glycol (PEG and acetyl (Ac groups (PEI-PEG-Ac are unable to improve PCR specificity and efficiency even at concentrations three orders of magnitude higher than that of PEI. Our data clearly suggests that the PCR-enhancing effect is primarily based on the interaction between the PCR components and the PEI derivatives, where electrostatic interaction plays a major role in concentrating the PCR components locally on the backbones of the branched PEI. In addition, multiwalled carbon nanotubes modified with PEI and PEI

  12. Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill

    Directory of Open Access Journals (Sweden)

    Pasquali Giancarlo


    Full Text Available Abstract Background Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR; however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. Results By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs indentified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Conclusion Our study showed that expression stability varied between putative reference genes

  13. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons (United States)

    Weinberg, Alvin M.; Noderer, L. C.


    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  14. Use of Polymerase Chain Reaction Enzyme Linked Oligonucleotide Sorbent Assay (Pcr-Elosa for Detection of Disease Agents

    Directory of Open Access Journals (Sweden)

    Simson Tarigan


    Full Text Available Diagnostic tool comprises one of the vital components in the control of infectious diseases. One of the most common techniques in the diagnosis of infectious disease currently available is the polymerase chain reaction (PCR because this technique is very sensitive, specific, and rapid. This technique requires an adjunct technique to indicate the formation of the right reaction product. Agarose gel electrophoresis has been the most common technique to visualise the PCR product or amplicon. Enzyme linked oligonucleotide sorbent assay (ELOSA is an alternative technique which is more sensitive and gives more important identity of the amplicon. This technique can be more than 100 times as sensitive as a gel agarose electrophoresis, and very specific since confirmation of the amplicon is carried out by DNA hibridisation. The capacity of the ELOSA can also be extended to the detection of disease-causal agent at subtype level, or detection of mutation at particular location in a gene. Since the equipment used for ELOSA is similar to that for ELISA (enzyme linked immunosorbent assay, a large number of samples can be accomplished rapidly. As in ELISA, a number of variation can be made in ELOSA depend on the requirement. Nucleotide can be immobilised on the microwell plate either by passive adsorbtion, by first conjugation of nucleotide with biotin then immobilisation on streptavidin-coated microwell plate, or immobilisaion by covalent bonding. The PCR and ELOSA can be performed at separate or in a single tube by first immobilising the PCR primers on the surface of microwell plates.

  15. Detection of DNA from Leishmania (Viannia: accuracy of polymerase chain reaction for the diagnosis of cutaneous leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Herintha Coeto Neitzke-Abreu

    Full Text Available Cutaneous leishmaniasis (CL can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L and blood sample-enriched leukocytes (PCR-B with three conventional diagnostic techniques: parasite direct search (DS, Montenegro skin test (MST, and indirect immunofluorescence reaction (IIF. The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia (minicircle kDNA fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species.

  16. Comparison of Aerosol Backscatter and Extinction Profiles Based on the Earlinet Database and the Single Calculus Chain for Thessaloniki Greece (2001-2014) (United States)

    Voudouri, K.; Siomos, N.; Giannakaki, E.; Amiridis, V.; d'Amico, G.; Balis, D. S.


    Aerosol backscatter and extinction coefficient profiles derived by the Single Calculus Chain (SCC) algorithm, which was developed within the European Aerosol Research Lidar Network (EARLINET) are compared with profiles derived by the operational inversion algorithm of Thessaloniki. Measurements performed during the period 2001-2014, that have already been uploaded in the EARLINET database, are considered in this study. The objective of this study is to verify, for the case of Thessaloniki, the consistency of the climatology of the aerosol profiles based on SCC and the EARLINET database data respectively. In this paper we show example comparisons for each lidar product submitted in the official database.

  17. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte;


    We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

  18. Multiplex polymerase chain reaction-based prognostic models in diffuse large B-cell lymphoma patients treated with R-CHOP

    DEFF Research Database (Denmark)

    Green, Tina M; Jensen, Andreas K; Holst, René;


    We present a multiplex analysis for genes known to have prognostic value in an attempt to design a clinically useful classification model in patients with diffuse large B-cell lymphoma (DLBCL). Real-time polymerase chain reaction was used to measure transcript levels of 28 relevant genes in 194 de...

  19. Evaluation of Clearview and Magic Lite tests, polymerase chain reaction, and cell culture for detection of Chlamydia trachomatis in urogenital specimens

    NARCIS (Netherlands)

    J.A.J.W. Kluytmans (Jan); W.H.F. Goessens (Wil); J.W. Mouton (Johan); J.H. van Rijsoort-Vos; H.G.M. Niesters (Bert); W.G.V. Quint (Wim); L. Habbema; E. Stolz (Ernst); J.H. Wagenvoort


    textabstractThe Clearview Chlamydia test (CV; Unipath Ltd., Bedford, United Kingdom), the Magic Lite Chlamydia test (ML; CIBA Corning, Medfield, Mass.), a polymerase chain reaction (PCR), and cell culture (CC) were evaluated for detection of Chlamydia trachomatis in urogenital spec

  20. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica). (United States)

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo


    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis. PMID:24712177

  1. Diagnosis of visceral leishmaniasis by the polymerase chain reaction using blood, bone marrow and lymph node samples from patients from the Sudan

    DEFF Research Database (Denmark)

    Andresen, K; Gasim, S; Elhassan, A M;


    We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...

  2. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter;


    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the...

  3. Distinguishing Plasmodium falciparum treatment failures from re-infections by using polymerase chain reaction genotyping in a holoendemic area in northeastern Tanzania

    DEFF Research Database (Denmark)

    Magesa, S M; Mdira, K Y; Farnert, A;


    An in vivo drug sensitivity study was conducted in Magoda village in northeastern Tanzania to evaluate the usefulness of polymerase chain reaction (PCR)-based genotyping of Plasmodium falciparum parasites to distinguish between re-infection and treatment failure. The study tested P. falciparum...

  4. Detection and strain differentiation of infectious bronchitis virus in tracheal tissues from experimentally infected chickens by reverse transcription-polymerase chain reaction. Comparison with an immunohistochemical technique

    DEFF Research Database (Denmark)

    Handberg, Kurt; Nielsen, O.L.; Pedersen, M.W.; Jørgensen, Poul Henrik


    Oligonucleotide pairs were constructed for priming the amplification of fragments of nucleocapsid (N) protein and spike glycoprotein (S) genes of avian infectious bronchitis virus (IBV) by reverse transcription-polymerase chain reaction (RT-PCR). One oligonucleotide pair amplified a common segment...

  5. Detection of gastrin mRNA in fresh human colonic carcinomas by reverse transcription-polymerase chain reaction. (United States)

    Monges, G; Biagini, P; Cantaloube, J F; Chicheportiche, C; Frances, V; Brandini, D; Parc, P; Seitz, J F; Giovannini, M; Sauvan, R


    To investigate the hypothesis that gastrin might be synthesized by tumour tissues in cancer of the colon, samples from six human colon tumours, one hepatic metastasis, four normal colonic mucosal samples and two antral and one fundic gastric mucosal samples from nine patients were analysed to determine whether gastrin mRNA was present. RNA was extracted from surgical specimens by ultracentrifugation on a CsCl cushion, purified using the guanidinium thiocyanate method, reverse-transcribed and amplified by polymerase chain reaction. Gastrin mRNA was detected in each colonic carcinoma sample (including the hepatic metastasis), while no such signal was observed in normal colon biopsies. Positive and negative controls (gastric antrum and fundus respectively) gave the expected results. In each of the positive samples, the chemiluminescent revelation of amplified products after Southern blotting corresponded to gastrin mRNA without the intron. These findings demonstrate the ability of primary and metastatic human colonic tumours to produce gastrin mRNA. Since malignant cell lines have been reported to produce gastrin peptide, and since gastrin receptors were present in some cases, our results support the idea that gastrin may be involved in an autocrine mechanism. PMID:7507679

  6. Multiplex Reverse Transcription-Polymerase Chain Reaction for Simultaneous Screening of 29 Chromosomal Translocation in Hematologic Malignancies

    Institute of Scientific and Technical Information of China (English)


    Multiplex reverse transcription-polymerase chain reaction (M-RT-PCR) has been proved to possess great clinical potential for simultaneous screening of 29 chromosomal translocations in acute leukemia. To evaluate the clinical value of M-RT-PCR in hematologic malignancies, bone marrow samples from 90 patients with various hematologic malignancies, including 25 acute myeloge nous leukemia (AML), 22 acute lymphoblastic leukemia (ALL), 27 chronic myelogenous leukemia (CML), 4 myeloproliferative diseases (MPD), 3 chronic lymphoblastic leukemia (CLL), 3 and 1 malignant histocytosis (MH) were subjected to both M-RT-PCR and chromosome karyotypic analysis. Some of cases were subjected to follow-up examination of M-RT-PCR during the period of ukemia. In our hand, 12 of 29chromosomal translocation transcripts including TEL/PDGFR, DEK/CAN, MLL/AF6, AML1/ETO,F9, BCR/ABL, MLL/MLL, PML/RARα, TLS/ERG, E2A/HLF, EVIl and HOXI1 were detected in 57 cases (63.3 %) of the 90 samples, which were in consistence with the results of karyore, M-RT-PCR had also shown good clinical relevance when used as an approach to detect minimal residual leukemia. We concluded that M-RT-PCR could be used as an effiy in the initial diagnosis of hematologic malignancies but also in subsequent monitor of minimal residual leukemia.

  7. Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

    International Nuclear Information System (INIS)

    To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

  8. A quantitative polymerase chain reaction assay for the enumeration of brown tide algae Aureococcusanophagefferens in coastal waters of Qinhuangdao

    Institute of Scientific and Technical Information of China (English)

    GUO Hao; LIU Yongjian; ZHANG Qi; YUAN Xiutang; ZHANG Weiwei; ZHANG Zhifeng


    Aureococcus anophagefferens, a small pelagophyte algae, has caused brown tide blooms in coastal waters of Qinhua-ngdao in recent years, presenting significant negative impacts on the shellfish mariculture industry. Under standard light microscopy, it is visually indistinguishable from other small algae in field samples due to its extremely small size. In this study, quantitative polymerase chain reaction (qPCR) based on 18S rDNA sequences was developed and used to detect and enumerate A. anophagefferens. A linear regression (R2=0.91) was generated based on cycle thr-esholds value (Ct) versus known concentrations of A. anophagefferens. Twenty-two field samples collected in coastal waters of Qinhuangdao were subjected to DNA extraction and then analyzed using qPCR. Results showed that A. anophagefferens had a wide distribution in coastal waters along Qinhuangdao. Elevated A. anophagefferens abun-dance, category 3 brown tide blooms (>200 000 cells/mL) occurred at Dongshan Beach and Tiger-stone Beach in August in 2013. In shellfish mariculture areas along coastal waters of Qinhuangdao, 4 stations had category 3 blooms, and 6 stations had category 2 blooms (35 000–200 000 cells/mL) in August and all stations had category 1 blooms (>0 to ≤35 000 cells/mL) in October. Quantitative PCR allows for detection of A. anophagefferens cells at low levels in filed samples, which is essential to effective management and prediction of brown tide blooms.

  9. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    Directory of Open Access Journals (Sweden)

    T. M. Nabeel Muhammad


    Full Text Available Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasal swabs were tested by PCR. Results: PCR analysis showed 56 positives (71.7% for infectious coryza out of total 78 samples tested. Of 56 infra orbital sinus swabs tested, 47 were positive (83.9% and 9 nasal swabs (40.9% out of 22 tested had given positive results for infectious coryza. Samples collected from birds at acute stage of disease and samples collected before treatment with antibiotics were given better results on PCR. Conclusion: For preventing the economic losses associated with the disease, an early, accurate and rapid diagnosis is essential. PCR is a rapid and highly sensitive diagnostic technique which can substitute conventional cultural examination.

  10. A quantitative real time polymerase chain reaction approach for estimating processed animal proteins in feed: preliminary data

    Directory of Open Access Journals (Sweden)

    Maria Cesarina Abete


    Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.

  11. Plasmodium spp. and Haemoproteus spp. infection in birds of the Brazilian Atlantic Forest detected by microscopy and polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raquel Tostes


    Full Text Available In recent years haemosporidian infection by protozoa of the genus Plasmodium and Haemoproteus, has been considered one of the most important factors related to the extinction and/or population decline of several species of birds worldwide. In Brazil, despite the large avian biodiversity, few studies have been designed to detect this infection, especially among wild birds in captivity. Thus, the objective of this study was to analyze the prevalence of Plasmodium spp. and Haemoproteus spp. infection in wild birds in captivity in the Atlantic Forest of southeastern Brazil using microscopy and the polymerase chain reaction. Blood samples of 119 different species of birds kept in captivity at IBAMA during the period of July 2011 to July 2012 were collected. The parasite density was determined based only on readings of blood smears by light microscopy. The mean prevalence of Plasmodium spp. and Haemoproteus spp. infection obtained through the microscopic examination of blood smears and PCR were similar (83.19% and 81.3%, respectively, with Caracara plancus and Saltator similis being the most parasitized. The mean parasitemia determined by the microscopic counting of evolutionary forms of Plasmodium spp. and Haemoproteus spp. was 1.51%. The results obtained from this study reinforce the importance of the handling of captive birds, especially when they will be reintroduced into the wild.

  12. Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

    International Nuclear Information System (INIS)

    Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

  13. Bent polydimethylsiloxane–polycarbonate hybrid microdevice for on-chip flow-through polymerase chain reaction employing a single heater

    International Nuclear Information System (INIS)

    We report on a bent microdevice made from elastomeric polydimethylsiloxane (PDMS) on a polycarbonate (PC) solid support. Its bent shape is well sustained, and this allows an on-chip flow-through polymerase chain reaction (PCR) to be performed employing a single heater. The PC support was bent to a predetermined angle by heating the substrate close to the glass transition temperature of PC, and the PDMS microdevice was physically adapted to the curvature of the bent PC. The relatively short plane of the bent PC substrate was then placed on top of a heater, leaving the relatively long plane floating in the air, on the entire surface of which a temperature gradient was established. The plane in contact with the heater represents the zone for denaturation, and the slanted plane floating in the air acts as the annealing/extension zone. Two targets with amplicon sizes of 230 and 282 bp were successfully amplified utilizing microdevices with 4° and 17° inclination angles, respectively, by employing a single heater in both cases and within 30 min. The system provides an effective alternative to conventional 3-temperature control flow-through PCR devices by minimizing the accessories and hence facilitating system miniaturization. (author)

  14. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    P. D. Luka


    Full Text Available Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction from FFT for African swine fever virus (ASFV detection. The modified conventional method gave a higher quality DNA when compared with commercially available DNA extraction kits (QIAamp® DNA Mini Kit, DNeasy® Blood and Tissue Kit, and ZR Genomic DNA™ Tissue MiniPrep. Results: An average A260/A280 DNA purity of 0.86-1.68 and 3.22-5.32 μg DNA/mg for formalin fixed and non-fixed tissues, respectively using a conventional method. In a reproducible and three times repeat PCR, the ASFV DNA expected product size of 278 bp was obtained from the DNA extract of the conventional method but not from the DNA extract of the commercial kits. Conclusion: The present study has demonstrated that the conventional method extracts ASFV genome better than commercial kit. In summary, the commercial kit extraction appeared not suitable to purify ASFV DNA from FFT. We, therefore, recommend that the use of the conventional method be considered for African swine fever DNA extraction from FFT.

  15. Efficacy of a commercial polymerase chain reaction-based assay for detection of Salmonella spp. in animal feeds. (United States)

    Maciorowski, K G; Pillai, S D; Ricke, S C


    Salmonellosis is a cyclic problem in the food industry, to which animal feed has been contributory. Current conventional methods of Salmonella spp. detection require 96 h for detection and confirmation. With modern and just-in-time production schedules, a 96-h hold represents a significant expense in storage and decontamination. The commercially available assay, 'BAX for Screening/Salmonella' (BAX), is based on the principle of the polymerase chain reaction and may represent a significant decrease in assay time. Seven fresh feed formulations, two fresh feed ingredients, seven stored feeds and two stored feed ingredients were artificially contaminated with a primary poultry isolate of Salmonella typhimurium and analysed by conventional and BAX methodology. The results of BAX agreed with conventional plating results for 16 of 18 samples spiked with 1200 cfu 10 g(-1) of feed and 13 of 18 samples spiked with 40 cfu 10 g(-1) of feed. Indigenous Salmonella spp. were detected in five of eight samples of poultry diets by conventional methods. With BAX, Salmonella spp. could not be detected in any of the samples after only 7 h of enrichment but could be detected in two dietary samples after 13 h of enrichment and four dietary samples after 24 h of enrichment. Specific sequences of salmonella DNA that were extracted from poultry diets could be detected with BAX. PMID:11054177

  16. Primary endobronchial synovial sarcoma confirmed by SYT-SSX1 fusion gene transcript by reverse transcriptase polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Kumar Rajiv


    Full Text Available Primary sarcomas of lung are rare compared to metastatic sarcomas. Herein, we report a rare case of primary pulmonary synovial sarcoma with polypoid endobronchial growth in a 35-year-old lady who presented with cough and dyspnea. A malignant pulmonary tumor was suspected and left pneumonectomy was performed. Grossly, a non-encapsulated polypoidal endobronchial tumor measuring 6 cm in greatest diameter, with a solid, tan-white cut surface was identified. Microscopically, tumor was characterized by a proliferation of oval to spindle-shaped cells arranged in sheets and fascicles. Focal hemangiopericytomatous pattern was noted. Immunohistochemically, tumor cells were positive for vimentin, BCL-2, MIC-2 and calponin and focally positive for pancytokeratin and epithelial membrane antigen. A subsequent molecular analysis performed using reverse transcriptase-polymerase chain reaction with RNA extracted from paraffin-embedded tissue, revealed SYT/SSX1 fusion gene which confirmed the diagnosis of synovial sarcoma. The utility of immunohistochemistry and molecular techniques in diagnosis of such a rare case is stressed and the relevant literature is discussed.

  17. Ultrasensitive electrochemical sensor for Hg(2+) by using hybridization chain reaction coupled with Ag@Au core-shell nanoparticles. (United States)

    Li, Zongbing; Miao, Xiangmin; Xing, Ke; Peng, Xue; Zhu, Aihua; Ling, Liansheng


    A novel electrochemical biosensor for Hg(2+) detection was reported by using DNA-based hybridization chain reaction (HCR) coupled with positively charged Ag@Au core-shell nanoparticles ((+)Ag@Au CSNPs) amplification. To construct the sensor, capture probe (CP ) was firstly immobilized onto the surface of glass carbon electrode (GCE). In the presence of Hg(2+), the sandwiched complex can be formed between the immobilized CP on the electrode surface and the detection probe (DP) modified on the gold nanoparticles (AuNPs) based on T-Hg(2+)-T coordination chemistry. The carried DP then opened two ferrocene (Fc) modified hairpin DNA (H1 and H2) in sequence and propagated the happen of HCR to form a nicked double-helix. Numerous Fc molecules were formed on the neighboring probe and produced an obvious electrochemical signal. Moreover, (+)Ag@Au CSNPs were assembly onto such dsDNA polymers as electrochemical signal enhancer. Under optimal conditions, such sensor presents good electrochemical responses for Hg(2+) detection with a detection limit of 3.6 pM. Importantly, the methodology has high selectivity for Hg(2+) detection. PMID:26852203

  18. Detection and characterization of human pathogenic viruses circulating in community wastewater using multi target microarrays and polymerase chain reaction. (United States)

    Wong, Mark V M; Hashsham, Syed A; Gulari, Erdogan; Rouillard, Jean-Marie; Aw, Tiong Gim; Rose, Joan B


    Sewage pollution remains the most significant source of human waterborne pathogens. This study describes the detection and characterization of human enteric viruses in community wastewaters using cell culture coupled with multiple target microarrays (with a total of 780 unique probes targeting 27 different groups of both DNA and RNA viruses) and polymerase chain reaction (PCR) assays. Over a 13-month sampling period, RNA viruses (astroviruses and enteroviruses) were more frequently detected compared to DNA viruses (adenoviruses, particularly type 41 and BK polyomavirus). Overall, many more viruses were shed during the winter months (December-February) compared to the summer months. Exploration of the multiple types of enteric viruses particularly in winter months identified much more significant prevalence of key viral pathogens associated with sewage pollution of the water environment than previously realized and seasonal disinfection used in some parts of the world may lead to a seeding of ambient waters. Molecular characterization of pathogenic viruses in community wastewater will improve the understanding of the potential risk of waterborne disease transmission of viral pathogens. PMID:24334840

  19. Detection of novel organisms associated with salpingitis, by use of 16S rDNA polymerase chain reaction. (United States)

    Hebb, Jennifer K; Cohen, Craig R; Astete, Sabina G; Bukusi, Elizabeth A; Totten, Patricia A


    Although Chlamydia trachomatis and Neisseria gonorrhoeae are established causes of salpingitis, the majority of cases have no known etiology. We used broad-range 16S rDNA polymerase chain reaction to identify novel, possibly uncultivable, bacteria associated with salpingitis and identified bacterial 16S sequences in Fallopian-tube specimens from 11 (24%) of 45 consecutive women with laparoscopically confirmed acute salpingitis (the case patients) and from 0 of 44 women seeking tubal ligations (the control subjects) at Kenyatta National Hospital, Nairobi, Kenya. Bacterial phylotypes most closely related to Leptotrichia spp. were detected as the sole phylotypes in 1, and mixed with other bacterial phylotypes in 2, specimens. Novel bacterial phylotypes and those associated with bacterial vaginosis, including Atopobium vaginae, were identified in 3 specimens. N. gonorrhoeae and Streptococcus pyogenes were identified in 2 and 1 specimens, respectively. The finding of novel phylotypes associated with salpingitis has important implications for the etiology, pathogenesis, and treatment of this important reproductive-tract disease syndrome. PMID:15551209

  20. Polymerase chain reaction of peripheral blood as a tool for the diagnosis of visceral leishmaniasis in children

    Directory of Open Access Journals (Sweden)

    Thiago Leite Fraga


    Full Text Available The diagnosis of visceral leishmaniasis (VL generally requires the use of invasive tests for the collection of infected tissue (aspirates of bone marrow, spleen, liver or lymph nodes. This difficulty has led to the search for safer and less painful techniques to confirm the occurrence of the disease in children. Polymerase chain reaction (PCR is a method that is advantageous in that it allows the use of peripheral blood samples for diagnosis. This paper reports the utilisation of PCR on peripheral blood samples to diagnose VL in 45 children in Mato Grosso do Sul, Brazil. This technique is compared with methods carried out using tissue collected by invasive procedures, including direct microscopy, culture and detection of Leishmania DNA by PCR in bone marrow aspirates. The results show that PCR of peripheral blood provides great sensitivity (95.6% that is similar to that from the PCR of bone marrow aspirates (91.1% and higher than that achieved with microscopy (80% or culture (26.7% methods. PCR of peripheral blood proved to be a suitable tool for the diagnosis of VL in children because it is highly sensitive and safe, with tissue collection being less invasive than in traditional tests.

  1. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    Directory of Open Access Journals (Sweden)

    Ji Yeon Kwon


    Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

  2. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Azzedine Bounamous


    Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  3. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    International Nuclear Information System (INIS)

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  4. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions (United States)

    Shen, Cenchao; Yang, Wenjuan; Ji, Qiaoli; Maki, Hisaji; Dong, Anjie; Zhang, Zhizhou


    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  5. Diagnosis of foot-and mouth disease by real time reverse transcription polymerase chain reaction under field conditions in Brazil

    Directory of Open Access Journals (Sweden)

    Clarke Neville P


    Full Text Available Abstract Background Foot-and-mouth disease (FMD is an economically important and highly contagious viral disease that affects cloven-hoofed domestic and wild animals. Virus isolation and enzyme-linked immunosorbent assay (ELISA are the gold standard tests for diagnosis of FMD. As these methods are time consuming, assays based on viral nucleic acid amplification have been developed. Results A previously described real-time reverse transcriptase polymerase chain reaction (RT-PCR assay with high sensitivity and specificity under laboratorial and experimental conditions was used in the current study. To verify the applicability of this assay under field conditions in Brazil, 460 oral swabs from cattle were collected in areas free of FMD (n = 200 and from areas with outbreaks of FMD (n = 260. Three samples from areas with outbreaks of FMD were positive by real-time RT-PCR, and 2 of those samples were positive by virus isolation and ELISA. Four other samples were considered inconclusive by real-time RT-PCR (threshold cycle [Ct] > 40; whereas all 200 samples from an area free of FMD were real-time RT-PCR negative. Conclusion real-time RT-PCR is a powerful technique for reliable detection of FMDV in a fraction of the time required for virus isolation and ELISA. However, it is noteworthy that lack of infrastructure in certain areas with high risk of FMD may be a limiting factor for using real-time RT-PCR as a routine diagnostic tool.

  6. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes


    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  7. Automation and integration of polymerase chain reaction with capillary electrophoresis for high throughput genotyping and disease diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, N.


    Genotyping is to detect specific loci in the human genome. These loci provide important information for forensic testing, construction of genetic linkage maps, gene related disease diagnosis and pharmacogenetic research. Genotyping is becoming more and more popular after these loci can be easily amplified by polymerase chain reaction (PCR). Capillary electrophoresis has its unique advantages for DNA analysis due to its fast heat dissipation and ease of automation. Four projects are described in which genotyping is performed by capillary electrophoresis emphasizing different aspects. First, the author demonstrates a principle to determine the genotype based on capillary electrophoresis system. VNTR polymorphism in the human D1S80 locus was studied. Second, the separation of four short tandem repeat (STR) loci vWF, THO1, TPOX and CSF1PO (CTTv) by using poly(ethylene oxide) (PEO) was studied in achieving high resolution and preventing rehybridization of the DNA fragments. Separation under denaturing, non-denaturing conditions and at elevated temperature was discussed. Third, a 250 {micro}m i.d., 365 {micro}m o.d. fused silica capillary was used as the microreactor for PCR. Fourth, direct PCR from blood was studied to simplify the sample preparation for genotyping to minimum.

  8. Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction (United States)

    Soo Yean, Cheryl Yeap; Selva Raju, Kishanraj; Xavier, Rathinam; Subramaniam, Sreeramanan; Gopinath, Subash C. B.; Chinni, Suresh V.


    Non-protein coding RNA (npcRNA) is a functional RNA molecule that is not translated into a protein. Bacterial npcRNAs are structurally diversified molecules, typically 50–200 nucleotides in length. They play a crucial physiological role in cellular networking, including stress responses, replication and bacterial virulence. In this study, by using an identified npcRNA gene (Sau-02) in Methicillin-resistant Staphylococcus aureus (MRSA), we identified the Gram-positive bacteria S. aureus. A Sau-02-mediated monoplex Polymerase Chain Reaction (PCR) assay was designed that displayed high sensitivity and specificity. Fourteen different bacteria and 18 S. aureus strains were tested, and the results showed that the Sau-02 gene is specific to S. aureus. The detection limit was tested against genomic DNA from MRSA and was found to be ~10 genome copies. Further, the detection was extended to whole-cell MRSA detection, and we reached the detection limit with two bacteria. The monoplex PCR assay demonstrated in this study is a novel detection method that can replicate other npcRNA-mediated detection assays. PMID:27367909

  9. Development of real-time quantitative polymerase chain reaction assays to track treatment response in retinoid resistant acute promyelocytic leukemia

    Directory of Open Access Journals (Sweden)

    Jelena V Jovanovic


    Full Text Available Molecular detection of minimal residual disease (MRD has become established to assess remission status and guide therapy in patients with PML-RARA+ acute promyelocytic leukemia (APL. However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF-RARA and STAT5b-RARA. Despite their relative rarity (<1% of APL we identified 6 cases (PLZF-RARA, n=5; STAT5b-RARA, n=1, established the respective breakpoint junction regions and designed real-time quantitative polymerase chain reaction (RQ-PCR assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17-associated APL, affording assay sensitivities of ~1 in 104-105. Serial samples were available from 2 PLZF-RARA APL patients. One showed persistent PCR positivity, predicting subsequent relapse, and remains in CR2, ~11 years post-autograft. The other, achieved molecular remission (CRm with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b-RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RQ-PCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly-defined subsets of acute leukemia.

  10. DETECTION OF Leishmania (Viannia IN Nyssomyia neivai AND Nyssomyia whitmani BY MULTIPLEX POLYMERASE CHAIN REACTION, IN SOUTHERN BRAZIL

    Directory of Open Access Journals (Sweden)

    Herintha Coeto Neitzke-Abreu


    Full Text Available Sandflies transmit pathogens of leishmaniasis. The natural infection of sandflies by Leishmania (Viannia was assessed in municipalities, in the state of Paraná, in Southern Brazil. Sandflies were collected with Falcão and Shannon traps. After dissection in search of flagellates in digestive tubes and identification of the species, female sandflies were submitted to the Multiplex Polymerase Chain Reaction (multiplex PCR for detection of the fragment of the kDNA of Leishmania (Viannia and the fragment from the IVS6 cacophony gene region of the phlebotomine insects. The analysis was performed in pools containing seven to 12 guts from females of the same species. A total of 510 female sandflies were analyzed, including nine Migonemyia migonei, 17 Pintomyia fischeri, 216 Nyssomyia neivai, and 268 Nyssomyia whitmani. Although none of the females was found naturally infected by flagellates through dissection, the fragment of DNA from Leishmania (Viannia was shown by multiplex PCR in one sample of Ny. neivai (0.46% and three samples of Ny. whitmani (1.12%. It was concluded that Ny. neivai and Ny. whitmani are susceptible to Leishmania infection, and that multiplex PCR can be used in epidemiological studies to detect the natural infection of the sandfly vector, because of its sensitivity, specificity and feasibility.

  11. Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hamed Rezaeejam


    Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

  12. Development of a SYBR Green quantitative polymerase chain reaction assay for rapid detection and quantification of infectious laryngotracheitis virus. (United States)

    Mahmoudian, Alireza; Kirkpatrick, Naomi C; Coppo, Mauricio; Lee, Sang-Won; Devlin, Joanne M; Markham, Philip F; Browning, Glenn F; Noormohammadi, Amir H


    Infectious laryngotracheitis is an acute viral respiratory disease of chickens with a worldwide distribution. Sensitive detection of the causative herpesvirus is particularly important because it can persist in the host at a very low copy number and be transmitted to other birds. Quantification of viral genome copy number is also useful for clinical investigations and experimental studies. In the study presented here, a quantitative polymerase chain reaction (qPCR) assay was developed using SYBR Green chemistry and the viral gene UL15a to detect and quantify infectious laryngotracheitis virus (ILTV) in ILTV-inoculated chicken embryos or naturally infected birds. The specificity of the assay was confirmed using a panel of viral and bacterial pathogens of poultry. The sensitivity of the assay was compared with two conventional PCR assays, virus titration and an antigen-detecting enzyme-linked immunosorbent assay. The qPCR developed in this study was highly sensitive and specific, and has potential for quantification of ILTV in tissues from naturally and experimentally infected birds and embryos. PMID:21711182

  13. Validation and Identification of Invasive Salmonella Serotypes in Sub-Saharan Africa by Multiplex Polymerase Chain Reaction. (United States)

    Al-Emran, Hassan M; Krumkamp, Ralf; Dekker, Denise Myriam; Eibach, Daniel; Aaby, Peter; Adu-Sarkodie, Yaw; Ali, Mohammad; Rubach, Mathew P; Bjerregaard-Andersen, Morten; Crump, John A; Cruz Espinoza, Ligia Maria; Løfberg, Sandra Valborg; Gassama Sow, Amy; Hertz, Julian T; Im, Justin; Jaeger, Anna; Kabore, Leon Parfait; Konings, Frank; Meyer, Christian G; Niang, Aissatou; Pak, Gi Deok; Panzner, Ursula; Park, Se Eun; Rabezanahary, Henintsoa; Rakotozandrindrainy, Raphaël; Raminosoa, Tiana Mirana; Razafindrabe, Tsiriniaina Jean Luco; Sampo, Emmanuel; Schütt-Gerowitt, Heidi; Sarpong, Nimako; Soura, Abdramane Bassiahi; Tall, Adama; von Kalckreuth, Vera; Wierzba, Thomas F; May, Jürgen; Marks, Florian


    Salmonella enterica serovar Typhi and nontyphoidal Salmonella (NTS) cause the majority of bloodstream infections in sub-Saharan Africa; however, serotyping is rarely performed. We validated a multiplex polymerase chain reaction (PCR) assay with the White-Kauffmann-Le Minor (WKLM) scheme of serotyping using 110 Salmonella isolates from blood cultures of febrile children in Ghana and applied the method in other Typhoid Fever Surveillance in Africa Program study sites. In Ghana, 47 (43%) S. Typhi, 36 (33%) Salmonella enterica serovar Typhimurium, 14 (13%) Salmonella enterica serovar Dublin, and 13 (12%) Salmonella enterica serovar Enteritidis were identified by both multiplex PCR and the WKLM scheme separately. Using the validated multiplex PCR assay, we identified 42 (66%) S. Typhi, 14 (22%) S. Typhimurium, 2 (3%) S. Dublin, 2 (3%) S. Enteritidis, and 4 (6%) other Salmonella species from the febrile patients in Burkina Faso, Guinea-Bissau, Madagascar, Senegal, and Tanzania. Application of this multiplex PCR assay in sub-Saharan Africa could advance the knowledge of serotype distribution of Salmonella. PMID:26933026

  14. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia. (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn


    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. PMID:23541117

  15. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction. (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn


    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization. PMID:19446978

  16. Molecular characterization of Trichinella genotypes by inter-simple sequence repeat polymerase chain reaction (ISSR-PCR). (United States)

    Fonseca-Salamanca, F; Nogal-Ruiz, J J; Benito, C; Camachot, M V; Martínez-Fernández, A R


    A bulk analysis of inter-simple sequence repeat-polymerase chain reaction (ISSR-PCR) provides a quick, reliable, and highly informative system for DNA banding patterns that permit species identification. The present study evaluates the applicability of this system to Trichinella species identification. After a single amplification carried out on a single larva with the primer 816([CA]nRY) under high stringency conditions, which provide high reproducibility, we were able to identify by consistent banding patterns 5 sibling species: Trichinella spiralis (ISS48), 2 Trichinella britovi isolates (ISS11 and ISS86), Trichinella murrelli (ISS35), Trichinella nativa (ISS71), Trichinella nelsoni (ISS29); 3 additional Trichinella genotypes: T8 (ISS149), T9 (ISS408 and ISS409), and T6 (ISS34); and the nonencapsulated species Trichinella pseudospiralis (ISS13). Moreover, 33 new Trichinella isolates from 2 zoogeographical regions were unequivocally identified. All Trichinella isolates have shown an identical pattern with those produced by the reference strain. According to these data, we have demonstrated that ISSR-PCR is a robust technique that emerges as a useful new application for the molecular identification of Trichinella isolates in epidemiological studies. PMID:16884006

  17. Influences of bracket bonding on mutans streptococcus in plaque detected by real time fluorescence-quantitative polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    AI Hong; LU Hong-fei; LIANG Huan-you; WU Jian; LI Ruo-lan; LIU Guo-ping; XI Yun


    Background Enamel demineralization occurs frequently during orthodontic treatment. In this study, we evaluated the changes of the density of mutans streptococcus (MS) in plaque after bracket bonding and using fluoride adhesive on maxillary incisors by real time fluorescence-quantitative polymerase chain reaction (RT-FQ PCR).Methods The study was designed as a self-paired test. Brackets were bonded with fluoride adhesive on the left side, while non-fluoride adhesive on the right side for each patient. Plaque samples were taken from the surfaces around the brackets of four maxillary incisors before brackets bonding and after the bonding 4 weeks later. The amount of MS was measured by RT-FQ PCR. The data obtained were analyzed statistically using the SPSS 11.5 version and the alpha level was set at 0.05 (2-tailed).Results The amount of MS in plaque increased significantly after bracket bonding (P0.05), and among the incisors using and not using fluoride adhesive (P>0.05).Conclusions The increase of the density of MS in plaque after bracket bonding is one of the etiological factors for enamel demineralization in orthodontic patients. The result of this study did not support what we observed clinically that the incidence of enamel demineralization for lateral incisors was higher than that for central incisors. Using fluoride adhesive for bonding did not affect the amount of MS in plaque in our study. Further study is needed.

  18. Prenatal diagnosis of Down syndrome using cell-free fetal DNA in amniotic fluid by quantitative fluorescent polymersase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wu Dan; Chi Hongbin; Shao Minjie; Wu Yao; Jin Hongyan; Wu Baiyan; Qiao Jie


    Backgroud Amniotic fluid (AF) supernatant contains cell-free fetal DNA (cffDNA) fragments.This study attempted to take advantage of cffDNA as a new material for prenatal diagnosis,which could be combined with simple quantitative fluorescent polymerase chain reaction (QF-PCR) to provide an ancillary method for the prenatal diagnosis of trisomy 21 syndrome.Methods AF supernatant samples were obtained from 27 women carrying euploid fetuses and 28 women carrying aneuploid fetuses with known cytogenetic karyotypes.Peripheral blood samples of the parents were collected at the same time.Short tandem repeat (STR) fragments on chromosome 21 were amplified by QF-PCR.Fetal condition and the parental source of the extra chromosome could be determined by the STR peaks.Results The sensitivity of the assay for the aneuploid was 93% (26/28; confidence interval,CI:77%-98%) and the specificity was 100% (26/26; CI:88%-100%).The determination rate of the origin of the extra chromosome was 69%.The sensitivity and the specificity of the assay in the euploid were 100% (27/27).Conclusions Trisomy 21 can be prenatally diagnosed by the QF-PCR method in AF supernatant.This karyotype analysis method greatly reduces the requirement for the specimen size.It will be a benefit for early amniocentesis and could avoid pregnancy complications.The method may become an ancillary method for prenatal diagnosis of trisomy 21.

  19. Amplification of plasmid DNA bound on soil colloidal particles and clay minerals by the polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)


    Polymerase chain reaction (PCR) was used to amplify a 600-base pair (bp) sequence of plasmid pGEX-2T DNA bound on soil colloidal particles from Brown soil (Alfisol) and Red soil (Ultisol), and three different minerals (goethite, kaolinite, montmorillonite). DNA bound on soil colloids, kaolinite, and montmorillonite was not amplified when the complexes were used directly but amplification occurred when the soil colloid or kaolinite-DNA complex was diluted, 10- and 20-fold. The montmorillonite-DNA complex required at least 100-fold dilution before amplification could be detected. DNA bound on goethite was amplified irrespective of whether the complex was used directly, or diluted 10- and 20-fold. The amplification of mineral-bound plasmid DNA by PCR is, therefore, markedly influenced by the type and concentration of minerals used. This information is of fundamental importance to soil molecular microbial ecology with particular reference to monitoring the fate of genetically engineered microorganisms and their recombinant DNA in soil environments.

  20. Utility of a rapid immunochromatographic strip test in detecting canine parvovirus infection compared with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sundaran S. Tinky


    Full Text Available Aim: The present study was undertaken to detect the presence of canine parvovirus (CPV in fecal samples of diarrheic dogs by conventional polymerase chain reaction (PCR and immunochromatographic (IC strip test and to compare the diagnostic potential of these tests. Materials and Methods: A total of 50 fecal samples collected from diarrheic dogs suspected for CPV infection were subjected to PCR using CPV-555 primer amplifying the gene coding for the VP1 protein. These samples were also tested by IC strip test using a commercial rapid Ag test kit. The results were statistically analyzed using McNemar test. Results: A total of 22 samples (44% were detected as positive by PCR, which yielded a specific amplicon of 583 bp. In IC strip test, 18 (36% samples were found to be positive. The sensitivity of the test as compared to PCR was found to be 72.22% and specificity was 92.86%. Positive predictive value and negative predictive value of IC strip test was found to be 88.89% and 81.25%, respectively. Statistical analysis of the results of PCR and IC assay using McNemar test revealed no significant difference (p>0.05. Conclusion: The IC strip test could be employed as a rapid field level diagnostic tool for the diagnosis of canine parvoviral diarrhea.

  1. Babesia bovis and B. bigemina DNA detected in cattle and ticks from Zimbabwe by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    I. Smeenk


    Full Text Available From blood collected from 94 cattle at 12 locations in the eastern and northeastern areas of Zimbabwe, DNA was extracted and analysed by polymerase chain reaction with primers previously reported to be specific for Babesia bigemina and Babesia bovis. Overall, DNA of Babesia bigemina was detected in the blood of 33/94 (35 % cattle and DNA from B. bovis was detected in 27/58 (47 % of cattle. The prevalence of DNA of B. bigemina was significantly higher in young animals (<2 years (23/46 than in animals over 2 years of age (10/48; (chi2 = 8.77; P < 0.01 %. Although tick sampling was not thorough, Boophilus decoloratus could be collected at 7/9 sites sampled and Boophilus microplus at 4/9 sites. Of the 20 B. decoloratus allowed to oviposit before PCR analysis, 1 (5 % contained DNA that could be amplified with primers for B. bigemina while 12 (60 % were positive with primers for B. bovis. Of the B. microplus allowed to oviposit, 11/16 (69 % were positive for B. bovis DNAby PCR and 2/16 (12 % were positive for B. bigemina.

  2. Investigation on natural diets of larval marine animals using peptide nucleic acid-directed polymerase chain reaction clamping. (United States)

    Chow, Seinen; Suzuki, Sayaka; Matsunaga, Tadashi; Lavery, Shane; Jeffs, Andrew; Takeyama, Haruko


    The stomach contents of the larvae of marine animals are usually very small in quantity and amorphous, especially in invertebrates, making morphological methods of identification very difficult. Nucleotide sequence analysis using polymerase chain reaction (PCR) is a likely approach, but the large quantity of larval (host) DNA present may mask subtle signals from the prey genome. We have adopted peptide nucleic acid (PNA)-directed PCR clamping to selectively inhibit amplification of host DNA for this purpose. The Japanese spiny lobster (Panulirus japonicus) and eel (Anguilla japonica) were used as model host and prey organisms, respectively. A lobster-specific PNA oligomer (20 bases) was designed to anneal to the sequence at the junction of the 18 S rDNA gene and the internal transcribed spacer 1 (ITS1) of the lobster. PCR using eukaryote universal primers for amplifying the ITS1 region used in conjunction with the lobster-specific PNA on a mixed DNA template of lobster and eel demonstrated successful inhibition of lobster ITS1 amplification while allowing efficient amplification of eel ITS1. This method was then applied to wild-caught lobster larvae of P. japonicus and P. longipes bispinosus collected around Ryukyu Archipelago, Japan. ITS1 sequences of a wide variety of animals (Ctenophora, Cnidaria, Crustacea, Teleostei, Mollusca, and Chaetognatha) were detected. PMID:20535520

  3. Cyclometalated iridium complex-based label-free photoelectrochemical biosensor for DNA detection by hybridization chain reaction amplification. (United States)

    Li, Chunxiang; Wang, Hongyang; Shen, Jing; Tang, Bo


    Photoactive material is the most crucial factor which intimately determines analytical performances of the photoelectrochemical sensor. On the basis of the high affinity of dipyrido [3,2-a:2',3'-c] phenazine (dppz) with DNA helix, a novel photoactive intercalator, [(ppy)2Ir(dppz)](+)PF6(-)(ppy = 2-phenylpyridine and dppz = dipyrido [3,2-a:2',3'-c] phenazine) was prepared and characterized by UV-vis absorption spectroscopy, fluorescence spectroscopy, and cyclic voltammetry. The photoelectrochemical properties of the as-prepared iridium(III) complex immobilized on the ITO electrode was investigated. Either cathodic or anodic photocurrent generation can be observed when triethanolamine (TEOA) or dissolved O2 is used as a sacrificial electron donor/acceptor, respectively. The probable photocurrent-generation mechanisms are speculated. A highly sensitive iridium(III) complex-based photoelectrochemical sensor was proposed for DNA detection via hybridization chain reaction (HCR) signal amplification. Under optimal conditions, the biosensor was found to be linearly proportional to the logarithm of target DNA concentration in the range from 0.025 to 100 pmol L(-1) with a detection limit of 9.0 fmol L(-1) (3σ). Moreover, the proposed sensor displayed high selectivity and good reproducibility, demonstrating efficient and stable photoelectric conversion ability of the Ir(III) complex. PMID:25816127

  4. Comparative efficacy of conventional diagnostic methods and evaluation of polymerase chain reaction for the diagnosis of bovine brucellosis

    Directory of Open Access Journals (Sweden)

    Raheela Akhtar


    Full Text Available The comparative efficacy of Rose Bengal Plate Test (RBPT and Milk Ring test (MRT was calculated in terms of sensitivity and specificity for the diagnosis of bovine brucellosis in cows (Group A and buffaloes (Group B from Lahore and Okara districts of Punjab, Pakistan. Using bacterial growth as a gold standard RBPT showed high sensitivity values of 100% in both groups. While its specificity was 96.29% (Group A and 90.62% (Group B. On the other hands MRT showed low sensitivity (80.0% in Group A; 86.6% in Group B while its specificity was 100% in all the animals of both groups. The calculated positive predictive and negative predictive values of both groups were in correspondence with their specificity and sensitivity values respectively. High sensitivity and low specificity of RBPT as compare to high specificity and low sensitivity of MRT in all groups suggested the poor efficacy of both tests used individually as compare to bacterial growth. In the continuation of this study polymerase chain reaction (PCR was evaluated for its diagnostic efficacy of quick Brucella abortus isolation from same samples. PCR conducted on serum samples gave more positive results than on milk samples. Therefore, the combination of both conventional tests alongwith serum PCR can be recommended. [Vet. World 2010; 3(2.000: 53-56

  5. Molecular typing of Paenibacillus larvae strains isolated from Bulgarian apiaries based on repetitive element polymerase chain reaction (Rep-PCR). (United States)

    Rusenova, Nikolina; Parvanov, Parvan; Stanilova, Spaska


    The aim of the present study was to perform molecular typing of Paenibacillus larvae (P. larvae) isolates from Bulgarian apiaries with repetitive element polymerase chain reaction (rep-PCR) using BOX A1R, MBO REP1, and ERIC primers. A total of 96 isolates collected from brood combs with clinical symptoms of American foulbrood originating from apiaries located in different geographical regions of Bulgaria, a reference strain P. larvae NBIMCC 8478 and 30 commercial honey samples with Bulgarian origin were included in the study. Rep-PCR fingerprinting analysis revealed two genotypes ab and AB of P. larvae isolates from brood combs and honey samples. A combination of genotypes ab/AB was detected in one apiary and honey sample. The prevailing genotype ab was found in 78.1 % of brood combs isolates as well as in the reference strain whereas genotype AB was determined in 21.9 % of isolates. The examination of honey samples confirmed the preponderance of ab genotype which was demonstrated in 20 of 30 samples analyzed. In conclusion, the genetic epidemiology of P. larvae revealed two genotypes--ab and AB for Bulgarian strains. Developed protocols for molecular typing of P. larvae are reliable and may be used to trace the source of infection. PMID:23361165

  6. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase

    Directory of Open Access Journals (Sweden)

    R.S. Diaz


    Full Text Available For certain applications of the polymerase chain reaction (PCR, it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We used the forward mutation assay to compare the fidelity of Taq polymerase and Thermotoga maritima (ULTMA™ DNA polymerase, an enzyme that does have proofreading activity. We did not find significant differences in the fidelity of either enzyme, even when using optimal buffer conditions, thermal cycling parameters, and number of cycles (0.2% and 0.13% error rates for ULTMA™ and Taq, respectively, after reading about 3,000 bases each. We conclude that for sequencing purposes there is no difference in using a DNA polymerase that contains an inherent 3' to 5' exonuclease activity for DNA amplification. Perhaps the specificity and fidelity of PCR are complex issues influenced by the nature of the target sequence, as well as by each PCR component.

  7. Detection and Enumeration of Streptococcus agalactiae from Bovine Milk Samples by Real-Time Polymerase Chain Reaction. (United States)

    de Carvalho, Nara Ladeira; Gonçalves, Juliano Leonel; Botaro, Bruno Garcia; Silva, Luis Felipe de Prada E; dos Santos, Marcos Veiga


    The aim of this study was to evaluate the use of real-time polymerase chain reaction (qPCR) combined with DNA extraction directly from composite milk and bulk tank samples for detection and enumeration of Streptococcus agalactiae (SAG) causing subclinical mastitis. Dilutions of sterile reconstituted skim milk inoculated with SAG ATCC 13813 were used to establish a standard curve (cfu/mL) for the qPCR assay targeting SAG. The analytical sensitivity and repeatability of the qPCR assay were determined. Bulk tank (BTM; n = 38) and composite milk samples (CM; n = 26) collected from lactating cows with positive isolation of SAG were submitted to the qPCR protocol and SAG plate counting, with results from both methods compared. Amplification of DNA was not possible in two out of 64 samples, indicating that qPCR was able to detect SAG in 96 and 97% of BTM and CM samples, respectively. The inter-assay coefficient of variation was <5%, showing that the technique had adequate repeatability. The qPCR protocol can be a high-throughput and rapid diagnostic assay to accurately detect SAG from BTM and CM samples compared with conventional microbiological culture method. However, the evaluated qPCR protocol is not accurate for enumerating SAG in milk samples, probably due to quantification of DNA of non-viable cells. PMID:26134534

  8. Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription

    Institute of Scientific and Technical Information of China (English)

    Stephen Johnston; Zachary Gallaher; Krzysztof Czaja


    Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2-ΔΔCt normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

  9. Randomly amplified polymorphic DNA-polymerase chain reaction analysis of two different populations of cultured Korean catfish Silurus asotus

    Indian Academy of Sciences (India)

    Jong-Man Yoon; Gye-Woong Kim


    Genetic similarity and diversity of cultured catfish Silurus asotus populations collected from two areas in western Korea were examined using randomly amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR). Out of 20 random primers tested, 5 produced 1344 RAPD bands ranging from 8.2 to 13.6 polymorphic bands per primer. The polymorphic bands in these populations ranged from 56.4% to 59.6%. Polymorphic bands per lane within populations ranged from 4.9% to 5.3%. The similarity within the Kunsan population varied from 0.39 to 0.82 with a mean (± SD) of 0.56 ± 0.08. The level of bandsharing values was 0.59 ± 0.07 within the catfish population from Yesan. The genetic similarity in cultured catfish populations may have been caused because individuals from two populations were reared in the same environmental conditions or by inbreeding during several generations. However, in view of bandsharing values, polymorphic bands and also the specific major bands that were inter-population-specific, significant genetic differentiation between these populations were present even if bandsharing (BS) values were somewhat numerically different. Therefore, the number of RAPD polymorphisms identified in this study may be sufficient to permit estimating genetic similarity and diversity. However, in future, additional populations, sampling sites and individuals will be necessary to make up for these weak points.

  10. Diagnosis of human herpesvirus 6B primary infection by polymerase chain reaction in young children with exanthematic disease

    Directory of Open Access Journals (Sweden)

    Ivna de Melo Magalhães


    Full Text Available INTRODUCTION: Exanthem subitum is a classical rash disease of early childhood caused by human herpesvirus 6B (HHV-6B. However, the rash is frequently misdiagnosed as that of either measles or rubella. METHODS: In this study, a nested multiplex polymerase chain reaction (PCR was used to diagnose HHV-6B primary infection, differentiate it from infections caused by HHV-6A and compare it to antibody avidity tests. The samples were separated into case group and control group according to the results of the indirect immunofluorescence assay (IFA technique. RESULTS: From the saliva samples analyzed, HHV-6A DNA was detected in 3.2% of the case group and in 2.6% of the control group. Regarding HHV-6B, PCR detected viral DNA in 4.8% of the case group and in 1.3% of the control group. Among the serum samples studied, a frequency of 1.7% was determined for HHV-6A in the case group and 1.2% in the control group. PCR did not detect HHV-6B DNA in serum samples. The sensitivity and specificity of the PCR technique ranged from 0% to 4.8% and 97.5% to 100%, respectively, compared to IFA. CONCLUSIONS: The PCR technique was not suitable for diagnosing primary infection by HHV-6B in children with exanthematic disease and should not substitute the IFA.

  11. Detection of hepatitis E virus RNA in sera of patients with hepatitis E by polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Zhen-Yu Zhao; Bing Ruan; Hui Shao; Zhen-Juan Chen; She-Lan Liu


    BACKGROUND: The duration of viremia during hepatitis E virus (HEV) infection has rarely been reported. This study was undertaken to detect HEV RNA in sera of patients with hepatitis E and to understand the process of HEV infection more thoroughly. METHODS:HEV RNA was detected in the serum samples of hospitalized patients with acute hepatitis E by reverse transcriptase-nested polymerase chain reaction (RT-nPCR) using two pairs of primers from open reading frame (ORF) 1 of the HEV genome. RESULTS:The serum samples from 44 (70%) of 62 patients were positive for HEV RNA. Thirty-two of these patients, with 288 serial serum specimens, were followed up for the whole process, and 24 patients (75%) were positive for HEV RNA. The positive rates declined with the course of the disease, serum HEV RNA persisting for 20.6 days on average after onset of illness. Serum HEV RNA remained positive in 36 (81.8%) of the 44 patients at the time their alanine aminotransferase (ALT) began to decrease. There was no difference in HEV RNA positivity between serum with high levels of HEV antibody (peak P/N ratio ≥4.0) and that with low levels (peak P/N ratio0.05), respectively. CONCLUSIONS: There is a relatively long period of HEV viremia in patients with hepatitis E. The proportion of HEV viremia and its duration are not directly related to serum ALT values or HEV antibody levels.

  12. Early detection of Toxoplasma gondii by real-time polymerase chain reaction methods in patients with recurrent spontaneous abortions

    Directory of Open Access Journals (Sweden)

    Parviz Saleh


    Full Text Available Introduction: One of the causes of recurrent spontaneous abortions (RSA is an infection by the toxoplasmosis Protozoa. In comparison, we present detailed results using real-time polymerase chain reaction (PCR methods of detection. In this study, it was tried to detect Toxoplasma gondii (T. gondii by real-time PCR methods in patients with RSA. Methods: Amniotic fluid sampling was performed in the 16-20th weeks of gestation in 50 pregnant women with a history of RSA. The extracted deoxyribonucleic acid (DNA samples were analyzed using quantitative real-time PCR. Results: In all the cases, the detection of T. gondii was negative in the peripheral blood, and amniotic fluid samples by using the molecular methods (real-time PCR. Using the serological detection methods, 6% of patients were diagnosed as positive for the immunoglobulin M (IgM antibody. In addition, the IgG antibody was positive in 46% of the patients. Conclusion: It can be concluded that the serological methods lack specificity.

  13. A chain REACTion

    DEFF Research Database (Denmark)

    Byskov, Jens


    Health systems in developing countries are subject to many improvement efforts, from regional, national and international governments and agencies. REACT looks at ways in which decisions concerning these interventions might be made differently, embedding fairness, accountability and trust on a mo...

  14. Short-chain fructooligosaccharides do not alter glucose homeostasis but improve the lipid profile in obese rats

    Directory of Open Access Journals (Sweden)

    Fernanda Soares da Silva-Morita


    Full Text Available The present study investigated the effects of short-chain fructooligosaccharides (scFOS feeding on body weight, fat accumulation, glucose homeostasis and lipid profile in cafeteria (CAF obese rats. Male Wistar rats were divided randomly into two groups: control group (CTL, n = 10, which received a chow diet and water and CAF (n = 20, which received the cafeteria diet, standard chow and soda. After 30 weeks of diet, 10 animals of CAF group received scFOS in the diet (50 g kg-1 of diet over a period of 50 days, forming the CAF FOS group. Were evaluated the body weight, fat pad as well as, quantity of feces, glucose tolerance, insulin resistance (IR and serum lipids levels. Animals submitted to the CAF diet displayed obesity, hyperglycemia, glucose intolerance, hyperinsulinemia and IR. The scFOS feeding   not altered obesity, glucose intolerance, hyperinsulinemia and IR. CAF rats also presented hypertriglyceridemia and lower levels of HDL-cholesterol. The CAF FOS animals had reduced serum triglycerides (TG and increased HDL-cholesterol. Thus, the use of scFOS in the diet can be considered as a hypolipidemic agent in the obese state.

  15. Profile of rheumatology patients willing to report adverse drug reactions: bias from selective reporting

    Directory of Open Access Journals (Sweden)

    Protić D


    Full Text Available Dragana Protić,1 Nada Vujasinović-Stupar,2 Zoran Bukumirić,3 Slavica Pavlov-Dolijanović,4 Snežana Baltić,5 Slavica Mutavdžin,6 Ljiljana Markovic-Denić,7 Marija Zdravković,8 Zoran Todorović1 1Department of Pharmacology, Clinical Pharmacology and Toxicology, Faculty of Medicine, University of Belgrade, Belgrade, Serbia; 2Department 2, Institute of Rheumatology, Faculty of Medicine, University of Belgrade, Belgrade, Serbia; 3Institute for Medical Statistics and Informatics, Faculty of Medicine, University of Belgrade, Belgrade, Serbia; 4Department 5, Institute of Rheumatology, Faculty of Medicine, University of Belgrade, Belgrade, Serbia; 5Department 5, Institute of Rheumatology, Belgrade, Serbia; 6Institute of Physiology “Rihard Burjan”, Faculty of Medicine, University of Belgrade, Belgrade, Serbia; 7Institute of Epidemiology, Faculty of Medicine, University of Belgrade, Belgrade, Serbia; 8Department of Cardiology, Medical Center “Bežanijska kosa”, Faculty of Medicine, University of Belgrade, Belgrade, Serbia Background: Adverse drug reactions (ADRs have a significant impact on human health and health care costs. The aims of our study were to determine the profile of rheumatology patients willing to report ADRs and to identify bias in such a reporting system. Methods: Semi-intensive ADRs reporting system was used in our study. Patients willing to participate (N=261 completed the questionnaire designed for the purpose of the study at the hospital admission. They were subsequently classified into two groups according to their ability to identify whether they had experienced ADRs during the previous month. Group 1 included 214 out of 261 patients who were able to identify ADRs, and group 2 consisted of 43 out of 261 patients who were not able to identify ADRs in their recent medical history. Results: Group 1 patients were more significantly aware of their diagnosis than the patients from group 2. Marginal significance was found

  16. Cervical cytology as a diagnostic tool for female genital schistosomiasis: Correlation to cervical atypia and Schistosoma polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Pavitra Pillay


    Full Text Available Background: Female genital schistosomiasis (FGS is a tissue reaction to lodged ova of Schistosoma haematobium in the genital mucosa. Lesions can make the mucosa friable and prone to bleeding and discharge. Women with FGS may have an increased risk of HIV acquisition, and FGS may act as a cofactor in the development of cervical cancer. Objectives: To explore cytology as a method for diagnosing FGS and to discuss the diagnostic challenges in low-resource rural areas. The correlation between FGS and squamous cell atypia (SCA is also explored and discussed. Cytology results are compared to Schistosoma polymerase chain reaction (PCR in vaginal lavage and urine and in urine microscopy. Materials and Methods: In a clinical study, 394 women aged between 16 and 23 years from rural high schools in KwaZulu-Natal, South Africa, underwent structured interviews and the following laboratory tests: Cytology Papanicolaou (Pap smears for S. haematobium ova and cervical SCA, real-time PCR for Schistosoma-specific DNA in vaginal lavage and urine samples, and urine microscopy for the presence of S. haematobium ova. Results: In Pap smears, S. haematobium ova were detected in 8/394 (2.0%. SCA was found in 107/394 (27.1%, seven of these had high-grade squamous intraepithelial lesion (HSIL. Schistosoma specific DNA was detected in 38/394 (9.6% of vaginal lavages and in 91/394 (23.0% of urines. Ova were found microscopically in 78/394 (19.7% of urines. Conclusion: Schistosoma PCR on lavage was a better way to diagnose FGS compared to cytology. There was a significant association between S. haematobium ova in Pap smears and the other diagnostic methods. In low-resource Schistosoma-endemic areas, it is important that cytology screeners are aware of diagnostic challenges in the identification of schistosomiasis in addition to the cytological diagnosis of SCA. Importantly, in this study, three of eight urines were negative but showed Schistosoma ova in their Pap smear, and

  17. The identification of two Trypanosoma cruzi I genotypes from domestic and sylvatic transmission cycles in Colombia based on a single polymerase chain reaction amplification of the spliced-leader intergenic region

    Directory of Open Access Journals (Sweden)

    Lina Marcela Villa


    Full Text Available A single polymerase chain reaction (PCR reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruzi I to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.

  18. Evaluation of gold nanoparticles as the additive in real-time polymerase chain reaction with SYBR Green I dye

    International Nuclear Information System (INIS)

    Gold nanoparticles (AuNPs) have been proven to be able to improve the specificity or increase the efficiency of a polymerase chain reaction (PCR) when a suitable amount of AuNPs was used. However, there is still a lack of systematic evaluation of AuNPs in real-time PCR. In this study, DNA degradation and the fluorescence quenching effect of AuNPs were first tested in real-time PCR. Then two different kinds of Taq DNA polymerase, native and recombinant Taq polymerase, were employed to evaluate the AuNPs' effect on the threshold cycle (CT) values, standard curves and melting curves in real-time PCR. Different ratios of the amount of native Taq DNA polymerase to the amount of AuNPs were also tested. It was found that AuNPs could be applied in real-time PCR with correlation coefficient R2>0.989. The combination of 2.09 nM AuNPs with 3.75 U of native Taq DNA polymerase could make the amplification curves shift to the left and enhance the efficiency of the real-time PCR (0.628 39 without AuNPs compared with 0.717 89 with 2.09 nM AuNPs), thus enabling faster detection in comparison with those of control samples. However, no improvement ability of AuNPs was found in real-time PCR based on recombinant rTaq DNA polymerase. Besides, the results suggest that a complex interaction exists between AuNPs and native Taq DNA polymerase

  19. Identification of HIV-1 Genotypic Resistance in Patients on First-line Antiretroviral Therapy Using Polymerase Chain Reaction and Sequencing

    Institute of Scientific and Technical Information of China (English)

    Jiang Xiao; Gui-ju Gao; Hong-xin Zhao; Yan-mei Li; Ying-xiu Huang; Wen Zhang; Wen-jing Su; Wei Zhang; Ning Han; Di Yang; Xin Li


    Objective The aim of the study was to evaluate the characteristics of HIV drug-genotypic resistance among patients taking ifrst-line ARV regimens using polymerase chain reaction and sequencing, and guide to design optimal ARV regimens for these patients. Methods HIV reverse transcriptase-encoded gene was ampliifed with RT-PCR and ampliifed PCR products were aligned and comparatively analyzed with HIV resistance database to ifnd drug-resistance mutations. Results Twenty-eight PCR products were amplified and sequenced successfully in 30 serum samples of recruited HIV-infected patients with virologic failure. The resistance rate was 96%, mutations in NRT region were found in 26 patients (93%), while mutations in NNRT region were found in 27 patients (96%). M184V was the most common mutation (86%), K65R was selected in 14%of recruited individuals and TAMs occurred in 50%of patients, which resulted in resistance to NRTIs. Y181C and V179D were the most common mutations in NNRTIs and prevalence was 43%(12/28) and 36%(10/28), respectively, which resulted in cross-resistance to NNRTIs due to low-genetic barrier. Conclusions Virologic failure may occur in long-term administration of ifrst-line ARV regimens, and drug-resistance mutations can be found in these patients, which resulted in resistance to ifrst-line ARV regimens. We emphasized that HIV viral load assay and resistance assay were important tools to guide healthcare workers to design an optimal second-line ARV regimens for HAART-experienced individuals with virologic failure.

  20. Alteration in sample preparation to increase the yield of multiplex Polymerase Chain Reaction assay for diagnosis of genital ulcer disease

    Directory of Open Access Journals (Sweden)

    G Rao


    Full Text Available Purpose: Genital Ulcer Disease (GUD is common sexually transmitted infection (STI. Multiple studies have shown that GUDs are strongly associated with the transmission and the acquisition of HIV infection. An accurate diagnosis of common etiology of GUD namely Herpes, syphilis and Chancroid is possible using Multiplex PCR (M-PCR. However, frequent presence of Polymerase Chain Reaction inhibitors in the ulcer swab specimen limits the performance of the assay. In order to overcome this problem, alternative specimen preparation method was used. Materials and Methods: To determine the common etiology, GUD specimens obtained under an STI operations research study were tested with M-PCR after the samples were prepared using Roche Amplicor specimen preparation kit. PCR inhibiting samples were identified from that, which showed negative results. These samples were subjected to phenol-chloroform extraction and ethanol precipitation before the conduct of M-PCR on them. Results: Of the 237 GUD specimens tested, in 145 etiologies could be detected, whereas 92 samples were found negative. Further spiking with one of the target DNA, 128 of the negative samples were found to contain the inhibitors. These 126 samples were then subjected to phenol chloroform extraction and ethanol precipitation followed by M-PCR. Using this method for sample preparation, etiology could be determined in 46 (23% additional samples. This success rate of altered sample preparation method has been lower than that has reported. Conclusion: The results indicate that sample preparation using phenol chloroform extraction and ethanol precipitation, prior to M-PCR helps to eliminate the inhibitors and increase the yield of the assay. However, being a laborious procedure, it may be used for samples giving negative results after the screening by Roche Amplicor specimen preparation kit.