WorldWideScience

Sample records for chain reaction products

  1. Rapid electrochemiluminescence assays of polymerase chain reaction products.

    Science.gov (United States)

    Kenten, J H; Casadei, J; Link, J; Lupold, S; Willey, J; Powell, M; Rees, A; Massey, R

    1991-09-01

    We demonstrate the first use of an electrochemiluminescent (ECL) label, [4-(N-succimidyloxycarbonylpropyl)-4'-methyl-2,2'- bipyridine]ruthenium(II) dihexafluorophosphate (Origen label; IGEN Inc.), in DNA probe assays. This label allows rapid (less than 25 min) quantification and detection of polymerase chain reaction (PCR)-amplified products from oncogenes, viruses, and cloned genes. For the PCR, we used labeled oligonucleotide primers complementary to human papiloma virus and the Ha-ras oncogene. These samples were followed by ECL analysis or hybridization with specific, Origen-labeled oligonucleotide probes. These studies demonstrate the speed, specificity, and effectiveness of the new ECL labels, compared with 32P, for nucleic acid probe applications. We describe formats involving conventional methodologies and a new format that requires no wash step, allowing simple and rapid sample analysis. These rapid assays also reduce PCR contamination, by requiring less sample handling. Improvements in ECL detectability are currently under investigation for use in DNA probe assays without amplification.

  2. Identification of spoilage yeasts in a food-production chain by microsatellite polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Baleiras Couto, M.M.; Hartog, B.J.; Veld, J.H.J. Huis in 't; Hofstra, H.; Vossen, J.M.B.M. van der

    1996-01-01

    A survey of yeast strains present in the production chain of mayonnaise and salad dressings was carried out over a period of 14 months. Attempts were made to identify the isolated yeasts with the API system, but identification of all species involved was not possible. In the investigation the

  3. Rapid and sensitive detection of Campylobacter spp. in chicken products by using the polymerase chain reaction

    NARCIS (Netherlands)

    Giesendorf, B A; Quint, W G; Henkens, M H; Stegeman, H; Huf, F A; Niesters, H G

    1992-01-01

    The polymerase chain reaction (PCR) after a short enrichment culture was used to detect Campylobacter spp. in chicken products. After the 16S rRNA gene sequence of Campylobacter jejuni was determined and compared with known sequences from other enterobacteria, a primer and probe combination was sele

  4. Rapid and sensitive detection of Campylobacter spp. in chicken products by using the polymerase chain reaction

    NARCIS (Netherlands)

    Giesendorf, B A; Quint, W G; Henkens, M H; Stegeman, H; Huf, F A; Niesters, H G

    1992-01-01

    The polymerase chain reaction (PCR) after a short enrichment culture was used to detect Campylobacter spp. in chicken products. After the 16S rRNA gene sequence of Campylobacter jejuni was determined and compared with known sequences from other enterobacteria, a primer and probe combination was

  5. Detection and analysis of polymerase chain reaction products by mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  6. Prediction of insecticidal activity of Bacillus thuringiensis strains by polymerase chain reaction product profiles.

    OpenAIRE

    Carozzi, N B; Kramer, V C; Warren, G W; Evola, S; Koziel, M G

    1991-01-01

    A rapid analysis of Bacillus thuringiensis strains predictive of insecticidal activity was established by using polymerase chain reaction (PCR) technology. Primers specific to regions of high homology within genes encoding three major classes of B. thuringiensis crystal proteins were used to generate a PCR product profile characteristic of each insecticidal class. Predictions of insecticidal activity were made on the basis of the electrophoretic patterns of the PCR products. Included in the s...

  7. Detection of specific polymerase chain reaction product by utilizing the 5'----3' exonuclease activity of Thermus aquaticus DNA polymerase.

    OpenAIRE

    1991-01-01

    The 5'----3' exonuclease activity of the thermostable enzyme Thermus aquaticus DNA polymerase may be employed in a polymerase chain reaction product detection system to generate a specific detectable signal concomitantly with amplification. An oligonucleotide probe, nonextendable at the 3' end, labeled at the 5' end, and designed to hybridize within the target sequence, is introduced into the polymerase chain reaction assay. Annealing of probe to one of the polymerase chain reaction product s...

  8. Preparative isolation of polymerase chain reaction products using mixed-mode chromatography.

    Science.gov (United States)

    Matos, T; Silva, G; Queiroz, J A; Bülow, L

    2015-11-15

    The polymerase chain reaction (PCR) has become one of the most useful techniques in molecular biology laboratories around the world. The purification of the target DNA product is often challenging, however, and most users are restricted to employing available commercial kits. The recent developments in mixed-mode chromatography have shown higher selectivity for a variety of nucleic acid-containing samples. Capto Adhere is a mixed-mode chromatography resin that offers a high-selectivity ligand and is here applied for the purification of amplified DNAs from PCR mixtures in a 10-min single step, with yields above 95%, high linearity, and high precision for different concentrations.

  9. Analysis of ligase chain reaction products amplified in a silicon-glass chip using capillary electrophoresis.

    Science.gov (United States)

    Cheng, J; Shoffner, M A; Mitchelson, K R; Kricka, L J; Wilding, P

    1996-04-26

    Ligase chain reaction (LCR) is a useful molecular technique for detecting known point mutations. We report the first example of the use of a disposable silicon-glass micro-chip for LCR and the first application of capillary electrophoresis (CE) to analyze samples amplified by LCR in a chip. Silicon-glass chips were manufactured using conventional photolithography and anodic bonding. The chips provide three distinct advantages for LCR: excellent thermal conductivity, a micro reaction volume ( < 10 microliters), and reproducible, low-cost manufacturing. Investigation and quantitation of amplification efficiency of LCR in a chip or in a tube requires an analytical technique that is faster and more convenient than the conventional slab gel methods. Slab gel electrophoresis uses relatively large amounts of sample and is labor-intensive and time-consuming, and thus is unsuitable for the separation and detection of LCR products. In contrast CE requires sample volume (original LCR products) of less than 1 microliter and is therefore well-suited to analysis of the micro-volume reaction mixture from chips. We combined CE with a sensitive laser induced fluorescence (LIF) detection system for the rapid separation and quantitative detection of LCR products amplified from the lacI gene in a silicon-glass chip. Comparative studies were made with LCR between tubes and silicon-glass chips. CE-LIF analysis is ideally suited to examination of micro-LCR amplification with high throughput. The technologies may find medical uses in disease diagnosis and research.

  10. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying

    2007-01-01

    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  11. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    Science.gov (United States)

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis.

  12. Identification of Listeria spp. strains isolated from meat products and meat production plants by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Roberta Mazza

    2015-12-01

    Full Text Available Listeriosis is a foodborne disease caused by Listeria monocytogenes and is considered as a serious health problem, due to the severity of symptoms and the high mortality rate. Recently, other Listeria species have been associated with disease in human and animals. The aim of this study was to develop a multiplex polymerase chain reaction (PCR in order to simultaneously detect six Listeria species (L. grayi, L. welshimeri, L. ivanovii, L. monocytogenes, L. seeligeri, L. innocua in a single reaction. One hundred eighteen Listeria spp. strains, isolated from meat products (sausages and processing plants (surfaces in contact and not in contact with meat, were included in the study. All the strains were submitted to biochemical identification using the API Listeria system. A multiplex PCR was developed with the aim to identify the six species of Listeria. PCR allowed to uniquely identify strains that had expressed a doubtful profile with API Listeria The results suggest that the multiplex PCR could represent a rapid and sensitive screening test, a reliable method for the detection of all Listeria species, both in contaminated food and in clinical samples, and also a tool that could be used for epidemiological purposes in food-borne outbreaks. A further application could be the development of a PCR that can be directly applied to the pre-enrichment broth.

  13. Acyl chains of phospholipase D transphosphatidylation products in Arabidopsis cells: a study using multiple reaction monitoring mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Dominique Rainteau

    Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.

  14. HF Chain Reaction Laser

    Science.gov (United States)

    1975-05-01

    reaction can develop uni2ormly in a subsonic flow with snall teemperatiu-e rise over a distance much longer than the time for mixing, thus tendiný to isolate...upper level population, moreover, the observed effects of H2, Tabla 3, appear to be predicted reasonably well by the model. In the calcula- tions 112

  15. Development of a polymerase chain reaction assay for species identification of goose and mule duck in foie gras products.

    Science.gov (United States)

    Rodrı X0301 Guez, Miguel A; Garcı X0301 A, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martı X0301 N, Rosario

    2003-12-01

    Polymerase chain reaction amplification of a conserved region of the α-actin gene has been used for the specific identification of goose (Anser anser) and mule duck (Anas platyrhynchos×Cairina moschata) foie gras. Universal primers were used for the amplification of a DNA fragment containing three introns and four exons of the α-actin gene in goose and mule duck. Sequence analysis of the amplified fragments was necessary for the design of forward species-specific primers in the goose and mule duck α-actin genes. The use of species-specific forward primers, together with a reverse universal primer, produced amplicons of different length, allowing clear identification of goose and mule duck foie gras samples. Analysis of experimental mixtures demonstrated that 1% of duck can be easily detected in goose foie gras using the PCR method developed here. This genetic marker can be very useful for the accurate identification of these two species in foie gras products.

  16. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    Science.gov (United States)

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  17. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase.

    Science.gov (United States)

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

    2013-11-01

    An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies.

  18. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan); Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki [System Instruments Co., Ltd., 776-2 Komiya-cho, Hachioji, Tokyo 192-0031 (Japan); Noda, Mamoru; Igimi, Shizunobu [Division of Biomedical Food Research, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Ikebukuro, Kazunori, E-mail: ikebu@cc.tuat.ac.jp [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan)

    2013-11-01

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 10{sup 6} copies.

  19. Partial strands synthesizing leads to inevitable aborting and complicated products in consecutive polymerase chain reactions (PCRs)

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Various abnormal phenomena have been observed during PCR so far. The present study performed a series of consecutive PCRs (including many rounds of re-amplification continuously) and found that the abortion of re-amplification was inevitable as long as a variety of complicated product appeared. The aborting stages varied, according to the lengths of targets. Longer targets reached the abortion earlier than the shorter ones, marked by appearance of the complex that was immobile in electropho-resis. Denatured gel-electrophoresis revealed that the complex was mainly made up of shorter or partially synthesized strands, together with small amounts of full-length ones. Able to be digested by S1 nuclease but unable by restriction endonucleases (REs), the complex was proved to consist of both single regions and double-helix regions that kept the complex stable thermodynamically. Simulations gave evidence that partial strands, even at lower concentration, could disturb re-amplification effec- tively and lead to the abortion of re-amplifications finally. It was pointed out that the partial strands formed chiefly via polymerase’s infidelity, and hence the solution to lighten the abnormality was also proposed.

  20. Partial strands synthesizing leads to inevitable aborting and complicated products in consecutive polymerase chain reactions (PCRs)

    Institute of Scientific and Technical Information of China (English)

    LUO Rui; ZHANG DaMing

    2007-01-01

    Various abnormal phenomena have been observed during PCR so far. The present study performed a series of consecutive PCRs (including many rounds of re-amplification continuously) and found that the abortion of re-amplification was inevitable as long as a variety of complicated product appeared.The aborting stages varied, according to the lengths of targets. Longer targets reached the abortion earlier than the shorter ones, marked by appearance of the complex that was immobile in electrophoresis. Denatured gel-electrophoresis revealed that the complex was mainly made up of shorter or partially synthesized strands, together with small amounts of full-length ones. Able to be digested by S1 nuclease but unable by restriction endonucleases (REs), the complex was proved to consist of both single regions and double-helix regions that kept the complex stable thermodynamically. Simulations gave evidence that partial strands, even at lower concentration, could disturb re-amplification effectively and lead to the abortion of re-amplifications finally. It was pointed out that the partial strands formed chiefly via polymerase's infidelity, and hence the solution to lighten the abnormality was also proposed.

  1. Polymerization as a Model Chain Reaction

    Science.gov (United States)

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  2. Mitochondrial DNA variation in chinook salmon and chum salmon detected by restriction enzyme analysis of polymerase chain reaction products

    Science.gov (United States)

    Cronin, M.; Spearman, R.; Wilmot, R.; Patton, J.; Bickman, J.

    1993-01-01

    We analyze intraspecific mitochondrial DNA variation in chinook salmon from drainages in the Yukon River, the Kenai River, and Oregon and California rivers; and chum salmon from the Yukon River and vancouver Island, and Washington rivers. For each species, three different portions of the mtDNA molecule were amplified seperately using the polymerase chain reaction and then digested with at least 19 restrictions enzymes. Intraspecific sequence divergences between haplotypes were less than 0.01 base subsitution per nucleotide. Nine chum salmon haplotypes were identified. Yukon River chum salmon stocks displayed more haplotypes (8) occurred in all areas. Seven chinook salmon haplotypes were identified. Four haplotypes occurred in the Yukon and Kenai rviers and four occured in the Oregon/California, with only one haplotype shared between the regions. Sample sizes were too small to quantify the degree of stock seperation among drainages, but the patterns of variation that we observed suggest utility of the technique in genetic stock identification.

  3. Polymerase chain reaction assay for avian polyomavirus.

    OpenAIRE

    Phalen, D.N.; Wilson, V G; Graham, D L

    1991-01-01

    A polymerase chain reaction assay was developed for detection of budgerigar fledgling disease virus (BFDV). The assay used a single set of primers complementary to sequences located in the putative coding region for the BFDV VP1 gene. The observed amplification product had the expected size of 550 bp and was confirmed to derive from BFDV DNA by its restriction digestion pattern. This assay was specific for BFDV and highly sensitive, being able to detect as few as 20 copies of the virus. By us...

  4. Polymerase chain reaction with nearby primers.

    Science.gov (United States)

    Garafutdinov, Ravil R; Galimova, Aizilya A; Sakhabutdinova, Assol R

    2017-02-01

    DNA analysis of biological specimens containing degraded nucleic acids such as mortal remains, archaeological artefacts, forensic samples etc. has gained more attention in recent years. DNA extracted from these samples is often inapplicable for conventional polymerase chain reaction (PCR), so for its amplification the nearby primers are commonly used. Here we report the data that clarify the features of PCR with nearby and abutting primers. We have shown that the proximity of primers leads to significant reduction of the reaction time and ensures the successful performance of DNA amplification even in the presence of PCR inhibitors. The PCR with abutting primers is usually characterized by the absence of nonspecific amplification products that causes extreme sensitivity with limit of detection on single copy level. The feasibility of PCR with abutting primers was demonstrated on species identification of 100 years old rotten wood. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Polymerase chain reaction assay for avian polyomavirus.

    Science.gov (United States)

    Phalen, D N; Wilson, V G; Graham, D L

    1991-05-01

    A polymerase chain reaction assay was developed for detection of budgerigar fledgling disease virus (BFDV). The assay used a single set of primers complementary to sequences located in the putative coding region for the BFDV VP1 gene. The observed amplification product had the expected size of 550 bp and was confirmed to derive from BFDV DNA by its restriction digestion pattern. This assay was specific for BFDV and highly sensitive, being able to detect as few as 20 copies of the virus. By using the polymerase chain reaction, BFDV was detected in adult, nestling, and embryo budgerigar (Melopsitticus undulatus) tissue DNAs and in sera from adult and nestling budgerigars. These results suggest the possibility of persistent infections in adult birds and lend further support to previously described evidence of possible in ovo transmission. BFDV was also detected in chicken embryo fibroblast cell cultures and chicken eggs inoculated with the virus. A 550-bp product with identical restriction enzyme sites was amplified from a suspected polyomavirus isolated from a peach-faced lovebird (Agapornis pesonata) and from tissue DNA from a Hahn's macaw (Ara nobilis) and a sun conure (Aratinga solstitialis) with histological lesions suggestive of polyomavirus infection. These fragments also hybridized with a BFDV-derived probe, proving that they were derived from a polyomavirus very similar, if not identical, to BFDV.

  6. The chain re-action

    CERN Multimedia

    2009-01-01

    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  7. Polymerase Chain Reaction on a Viral Nanoparticle.

    Science.gov (United States)

    Carr-Smith, James; Pacheco-Gómez, Raúl; Little, Haydn A; Hicks, Matthew R; Sandhu, Sandeep; Steinke, Nadja; Smith, David J; Rodger, Alison; Goodchild, Sarah A; Lukaszewski, Roman A; Tucker, James H R; Dafforn, Timothy R

    2015-12-18

    The field of synthetic biology includes studies that aim to develop new materials and devices from biomolecules. In recent years, much work has been carried out using a range of biomolecular chassis including α-helical coiled coils, β-sheet amyloids and even viral particles. In this work, we show how hybrid bionanoparticles can be produced from a viral M13 bacteriophage scaffold through conjugation with DNA primers that can template a polymerase chain reaction (PCR). This unprecedented example of a PCR on a virus particle has been studied by flow aligned linear dichroism spectroscopy, which gives information on the structure of the product as well as a new protototype methodology for DNA detection. We propose that this demonstration of PCR on the surface of a bionanoparticle is a useful addition to ways in which hybrid assemblies may be constructed using synthetic biology.

  8. Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

    Science.gov (United States)

    Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2010-06-01

    Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

  9. Environmental Management in Product Chains

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard; Forman, Marianne

    2009-01-01

    ). An overview of examples from our own research and from literature of the type and the role of environmental issues and initiatives in product chains (fourth section). A typology for characterizing corporate strategies as part of environmental management in product chains and characterizing those competencies......The chapter aims at giving background to companies, consultants, governmental regulators, NGOs etc. for the analysis and planning of environmental management in specific product chains through: A framework for understanding environmental management in product chains as shaped by the interaction...... between existing resources, norms and values and external pressures for environmental management (second section). A model for the types of corporate network relations that need to be mapped and understood in order to analyze and/or develop environmental management in a product chain (third section...

  10. A-T linker adapter polymerase chain reaction for determining flanking sequences by rescuing inverse PCR or thermal asymmetric interlaced PCR products.

    Science.gov (United States)

    Trinh, Quoclinh; Zhu, Pengyu; Shi, Hui; Xu, Wentao; Hao, Junran; Luo, Yunbo; Huang, Kunlun

    2014-12-01

    The polymerase chain reaction (PCR)-based genome walking method has been extensively used to isolate unknown flanking sequences, whereas nonspecific products are always inevitable. To resolve these problems, we developed a new strategy to isolate the unknown flanking sequences by combining A-T linker adapter PCR with inverse PCR (I-PCR) or thermal asymmetric interlaced PCR (TAIL-PCR). The result showed that this method can be efficiently achieved with the flanking sequence from the Arabidopsis mutant and papain gene. Our study provides researchers with an additional method for determining genomic DNA flanking sequences to identify the target band from bulk of bands and to eliminate the cloning step for sequencing.

  11. Environmental Management in Product Chains

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard; Forman, Marianne

    2009-01-01

    ). An overview of examples from our own research and from literature of the type and the role of environmental issues and initiatives in product chains (fourth section). A typology for characterizing corporate strategies as part of environmental management in product chains and characterizing those competencies...... between existing resources, norms and values and external pressures for environmental management (second section). A model for the types of corporate network relations that need to be mapped and understood in order to analyze and/or develop environmental management in a product chain (third section...

  12. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity of...

  13. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  14. Polymerase Chain Reaction for Educational Settings.

    Science.gov (United States)

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  15. Evaluation of a real-time polymerase chain reaction (PCR) assay for detection of anisakis simplex parasite as a food-borne allergen source in seafood products.

    Science.gov (United States)

    Lopez, Itziar; Pardo, Miguel Angel

    2010-02-10

    Anisakis simplex has been recognized as an important cause of disease in humans and as a food-borne allergen source. Actually, this food-borne parasite was recently identified as an emerging food safety risk. An A. simplex -specific primer-probe system based on a real-time polymerase chain reaction (PCR) detection assay has been successfully optimized and validated with seafood samples. In addition, a DNA extraction procedure has been optimized to detect the presence of the nematode in food samples. The assay is a very reliable, specific, and sensitive methodology to detect the presence of traces of this parasite in seafood products, including highly processed samples. As a result, 13 sequences of cytochrome c oxidase II gene were obtained and scrutinized to calculate intra- and interspecific variabilities of 0 and 35-67%, respectively. Finally, an efficiency of 2.07 +/- 0.14 of the assay was calculated, and a limit of detection of 40 ppm parasite in 25 g of sample was also optimized. Actually, the presence of this parasite in several seafood products has been demonstrated, enforcing the necessity of a design for a good manufacturing practice protocol for the processing industry to minimize the presence of this parasite as a food-borne allergen source in seafood products.

  16. Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

    Science.gov (United States)

    Aravindran, S.; Sahilah, A. M.; Aminah, A.

    2014-09-01

    Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

  17. Environmental management in product chains

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard; Forman, Marianne; Hansen, Anne Grethe

    of environmental initiatives, a number of recommendations for governmental regulation, which can support the further diffusion of environmental management in product chains, are developed. Furthermore, the report describes a number of theoretical perspectives from sociology of technology, organisation theory...

  18. Concurrent Product & Supply Chain Creation

    DEFF Research Database (Denmark)

    Gubi, Ebbe

    it is a structural premise. We also know that logistics costs generally are estimated 15-20% of total product costs. Accordingly, it stands to reason that a company can reduce costs, and thereby gain an edge on its competitors, by tailoring the supply chain in question to an individual product or product family; i...

  19. Application of a qualitative and quantitative real-time polymerase chain reaction method for detecting genetically modified papaya line 55-1 in papaya products.

    Science.gov (United States)

    Nakamura, Kosuke; Akiyama, Hiroshi; Takahashi, Yuki; Kobayashi, Tomoko; Noguchi, Akio; Ohmori, Kiyomi; Kasahara, Masaki; Kitta, Kazumi; Nakazawa, Hiroyuki; Kondo, Kazunari; Teshima, Reiko

    2013-01-15

    Genetically modified (GM) papaya (Carica papaya L.) line 55-1 (55-1), which is resistant to papaya ringspot virus infection, has been marketed internationally. Many countries have mandatory labeling regulations for GM foods, and there is a need for specific methods for detecting 55-1. Here, an event- and construct-specific real-time polymerase chain reaction (PCR) method was developed for detecting 55-1 in papaya products. Quantitative detection was possible for fresh papaya fruit up to dilutions of 0.001% and 0.01% (weight per weight [w/w]) for homozygous SunUp and heterozygous Rainbow cultivars, respectively, in non-GM papaya. The limit of detection and quantification was as low as 250 copies of the haploid genome according to a standard reference plasmid. The method was applicable to qualitative detection of 55-1 in eight types of processed products (canned papaya, pickled papaya, dried fruit, papaya-leaf tea, jam, puree, juice, and frozen dessert) containing papaya as a main ingredient. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. The polymerase chain reaction (PCR): general methods.

    Science.gov (United States)

    Waters, Daniel L E; Shapter, Frances M

    2014-01-01

    The polymerase chain reaction (PCR) converts very low quantities of DNA into very high quantities and is the foundation of many specialized techniques of molecular biology. PCR utilizes components of the cellular machinery of mitotic cell division in vitro which respond predictably to user inputs. This chapter introduces the principles of PCR and discusses practical considerations from target sequence definition through to optimization and application.

  1. Fast capillary electrophoresis-laser induced fluorescence analysis of ligase chain reaction products: human mitochondrial DNA point mutations causing Leber's hereditary optic neuropathy.

    Science.gov (United States)

    Muth, J; Williams, P M; Williams, S J; Brown, M D; Wallace, D C; Karger, B L

    1996-12-01

    High speed capillary electrophoresis-laser-induced fluorescence (CE-LIF) has been used to separate and detect point mutations using the ligase chain reaction (LCR). The method utilizes short capillary columns (7.5 cm effective length) and fields of 400 V/cm to analyze DNA-ethidium bromide complexes using an He/Ne laser. The method was first demonstrated with a commercially available kit for LCR based on a lacI gene fragment inserted in a Bluescript II phagemid. LCR-CE-LIF was then applied to detect point mutations in human mitochondrial DNA, resulting in Leber's hereditary optic neuropathy (LHON). Three severe mutations were analyzed in which the original base is substituted by a thymidine base at positions 3460, 11778 and 14459. Appropriate primers were designed with polyT tails for length discrimination of pooled samples. Successful detection of mutated samples was achieved, with appropriate correction for small amounts of nonspecific ligated product. The method is rapid, easy to implement, and automatable.

  2. Efficient wastewater treatment and simultaneously electricity production using a photocatalytic fuel cell based on the radical chain reactions initiated by dual photoelectrodes.

    Science.gov (United States)

    Zhao, Kai; Bai, Jing; Zeng, Qingyi; Zhang, Yan; Li, Jinhua; Li, Linsen; Xia, Ligang; Zhou, Baoxue

    2017-09-05

    Efficient conversion of wastewater into clean energy was achieved by applying a radical chain reaction strategy in a solar responsive photocatalytic fuel cell (PFC) system. The system was constructed with two photoelectrodes where ferrous ions were added to enhance the radical reactions for organic pollutants degradation from the surface of electrodes to the whole solution system via coming into a continuous radical chain reaction. The results indicated that the short-circuit current (Jsc) and the power density (JVmax) obtained in the PFC system is up to 1.41-1.60 and 1.52-2.02 times larger than those of the PFC without ferrous ions. Meanwhile, the degradation rate of refractory organics (methyl orange, methylene blue, congo red and tetracycline) increased to 91.98%, 98.57%, 92.36% and 68.09% from 53.61%, 45.38%, 51.09% and 30.65% respectively after 90min operation. The proposed PFC with a radical chain reaction strategy provides a more economical and efficient way for energy recovery and wastewater treatment and implies a possibility of developing much higher efficient PFC system when applying the other electrodes. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Transformational leadership: a cascading chain reaction.

    Science.gov (United States)

    Murphy, Lorraine

    2005-03-01

    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment.

  4. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...... in 25 patients in whose nasopharyngeal secretions BP had been demonstrated after 4-7 days of culture. The detection limit of PCR in aqueous solution was 1-2 BP bacteria per reaction tube. PCR was 100% specific for BP, showing no response with other Bordetella species or other bacteria known to colonize...... of PCR for the diagnosis of BP, we used known concentrations of BP, Bordetella parapertussis and Bordetella bronchiseptica in aqueous solutions. PCR was furthermore carried out on species of bacteria that might be isolated from the nasopharynx. The applicability of PCR to patient specimens was tested...

  5. [The contamination under polymerase chain reaction studies: problems and solutions].

    Science.gov (United States)

    Titov, V N; Ameliushkina, V A; Rozhkova, T A

    2015-01-01

    The study was carried out to determine risk factors of false positive and false negative results under polymerase chain reaction-analysis of clinical material. The samples with high viral load can be the source of false positive results. The contamination with nucleic acids can occur at any section of polymerase chain reaction analysis. The study data permitted to establish that the most sensitive stage is isolation and purification of nucleic acids especially under manual mode of operation. The detection of positive signal in most samples of one setting indicates total contamination. The cases when only several samples are polluted are special challenge. The presence of sample with high concentration of viral nucleic acid and several samples with low concentration in one setting means necessity of repeated analysis beginning with stage of isolation of nucleic acid. The analysis of curves of accumulation of products of amplification, their forms and positioning on chart is the obligatory stage of polymerase chain reaction study in real time regimen. These actions permit to exclude the readouts of false negative testing results to departments. The study conclusions are equipotent for polymerase chain reaction testing of any nucleic acid targets.

  6. [Polymerase chain reaction and its application].

    Science.gov (United States)

    Sárosi, I; Gerald, E; Girish, V N

    1992-07-01

    The polymerase chain reaction (PCR) is one of the most important new methods in molecular biology. It is widely used in genetic and anthropologic basic research, in oncology and virology, in all those fields, where molecular biologic methods can give answers to the questions raised. The procedure enables one to multiply with extreme precision targeted pieces of amounts as little as one target molecule of DNA or RNA by five to six logs, making them easy to be handled and examined by routine molecular biological methods. The method is presented through one possible application field, that is of great importance in the study of hepatocarcinogenesis. Sensitivity of PCR in detection of hepatitis B virus DNA is greater by four logs than animal inoculation, the last most sensitive method known.

  7. Production of monoclonal antibodies for detection of Citrus leprosis virus C in enzyme-linked immuno-assays and immunocapture reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Choudhary, Nandlal; Roy, Avijit; Govindarajulu, A; Nakhla, M K; Levy, L; Brlansky, R H

    2014-09-01

    Citrus leprosis virus C (CiLV-C) causes damage in citrus production in the South and Central America. Since closely related types of citrus viruses have recently been described monoclonal antibodies (MAbs) are needed for accurate and sensitive diagnosis of CiLV-C. In this study, MAbs to the expressed coat protein of CiLV-C were produced for serological detection of CiLV-C in crude extracts of infected tissues in double antibody sandwich enzyme-linked immunosorbent assays (DAS-ELISA), dot blot immunosorbent assays (DBIA) and immuonocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) procedures. Monoclonal antibodies were developed in mice to the purified expressed coat protein of CiLV-C. The published standard protocols of DAS-ELISA, DBIA and IC-RT-PCR were followed for the detection of coat protein p29 of CiLV-C in the crude extracts of CiLV-C infected tissues. Two monoclonal antibodies, designated G10 and C11, were identified from four potential candidates for the specific and sensitive detection of coat protein p29 of CiLV-C in the crude citrus extracts of CiLV-C infected tissues in DAS-ELISA, whereas G10 was also selected based on performance for use in the DBIA and IC-RT-PCR diagnostic assays. Sensitivity analysis comparing the three methods for detection of coat protein p29 of CiLV-C determined that IC-RT-PCR was more sensitive than DAS-ELISA and DBIA. The creation of MAbs to CiLV-C allows for the sensitive and accurate detection of the virus from CiLV-C infected citrus leaf tissues. Successful detection of the virus in three diagnostic assays formats provides flexibility to diagnosticians who can use either ELISA or DBIA for screening large numbers of samples, and IC-RT-PCR for rapid, sensitive confirmation testing. Published by Elsevier B.V.

  8. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo

    2012-01-01

    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  9. Double Pion Production Reactions

    CERN Document Server

    Oset, E; Cano, F; Hernández, E; Kamalov, S S; Nacher, J C; Tejedor, J A G

    1999-01-01

    We report on reactions producing two pions induced by real and virtual photons or nucleons. The role of different resonances in these reactions is emphasized. Novel results on coherent two pion photoproduction in nuclei are also reported.

  10. Long chain branching on linear polypropylene by solid state reactions

    NARCIS (Netherlands)

    Borsig, E.; Gotsis, A. D.; Picchioni, F.

    2008-01-01

    A method was developed for the long chain branching (LCB) of isotactic polypropylene (iPP) via modification in the solid state. PP long chains have been linked as branches to the original linear iPP chains using solid state reactions in the presence of a free radical initiator and a multifunctional

  11. The polymerase chain reaction: current and future clinical applications.

    OpenAIRE

    Lynch, J R; Brown, J. M.

    1990-01-01

    The polymerase chain reaction has undergone rapid improvement since its initial development, such that the technique currently permits rapid, accurate, predictive tests to be made in the field of prenatal diagnosis and has greatly aided forensic medicine. It is anticipated that the polymerase chain reaction will also facilitate advances in other fields, in particular preimplantation diagnosis, virology, bacteriology, and cancer therapy.

  12. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    Science.gov (United States)

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  13. Chain-reaction crash on a highway in high visibility

    Science.gov (United States)

    Nagatani, Takashi

    2016-05-01

    We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

  14. Marzipan: polymerase chain reaction-driven methods for authenticity control.

    Science.gov (United States)

    Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus

    2011-11-23

    According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

  15. Meson production in + reactions

    Indian Academy of Sciences (India)

    H Machner; M Betigeri; J Bojowald; A Budzanowski; A Chatterjee; J Ernst; L Freindl; D Frekers; W Garske; K Grewer; A Hamacher; J Ilieva; L Jarczyk; K Kilian; S Kliczewski; W Klimala; D Kolev; T Kutsarova; J Lieb; H Machner; A Magiera; H Nann; L Pentchev; H S Plendl; D Protić; B Razen; P Von Rossen; B J Roy; R Siudak; J Smyrski; R V Srikantiah; A Strzałkowski; R Tsenov; K Zwoll

    2001-08-01

    Total and differential cross sections for the reactions $p+d → 3He + 0 with = ; and + → 3H + + were measured with the GEM detector at COSY for beam momenta between threshold and the maximum of the corresponding baryon resonance. For both reactions a strong forward–backward asymmetry was found. The data were compared with model calculations. The aspect of isospin symmetry breaking is studied.

  16. Rapid and accurate detection of Arcobacter contamination in commercial chicken products and wastewater samples by real-time polymerase chain reaction.

    Science.gov (United States)

    González, Ana; Suski, Jan; Ferrús, Maria A

    2010-03-01

    An SYBR Green real-time polymerase chain reaction (PCR) assay was developed for Arcobacter detection in food and wastewater samples. The assay was applied to 36 chicken and 33 wastewater samples, and the results were compared with those obtained for conventional PCR, multiplex PCR, and culture isolation. Isolates were identified by multiplex PCR and restriction fragment length polymorphism analysis of PCR-amplified DNA fragment, and typed by randomly amplified polymorphic DNA. Arcobacter sp. was detected in 25 of the 26 chicken carcasses (96%) and in 4 of the 10 liver samples (40%) by real-time PCR. Twenty-five chicken samples were positive also by conventional PCR, but in most of them the detection was only possible after 48-h enrichment. Arcobacter butzleri was the most frequently detected species. Twenty-four Arcobacter isolates were obtained from chicken samples, where A. butzleri is the only identified species. All the wastewater samples (100%) were positive for Arcobacter sp. by real-time PCR without enrichment. A. butzleri and Arcobacter cryaerophilus were detected by multiplex PCR. Fifteen samples were found to be positive by culture. Thirty-six isolates were obtained; all of them were identified as A. butzleri by multiplex PCR. However, by PCR-restriction fragment length polymorphism, 34 were identified as A. butzleri, 1 as A. cryaerophilus, and another 1 as Arcobacter skirrowii. A great genetic heterogeneity was observed by randomly amplified polymorphic DNA-PCR profiling. The real-time PCR assay developed in this work showed better detection levels than conventional PCR, together with shorter times of testing samples. Therefore, it could be used as a rapid and accurate instrument for monitoring Arcobacter contamination levels in food and water samples.

  17. Reaction product imaging

    Energy Technology Data Exchange (ETDEWEB)

    Chandler, D.W. [Sandia National Laboratories, Livermore, CA (United States)

    1993-12-01

    Over the past few years the author has investigated the photochemistry of small molecules using the photofragment imaging technique. Bond energies, spectroscopy of radicals, dissociation dynamics and branching ratios are examples of information obtained by this technique. Along with extending the technique to the study of bimolecular reactions, efforts to make the technique as quantitative as possible have been the focus of the research effort. To this end, the author has measured the bond energy of the C-H bond in acetylene, branching ratios in the dissociation of HI, the energetics of CH{sub 3}Br, CD{sub 3}Br, C{sub 2}H{sub 5}Br and C{sub 2}H{sub 5}OBr dissociation, and the alignment of the CD{sub 3} fragment from CD{sub 3}I photolysis. In an effort to extend the technique to bimolecular reactions the author has studied the reaction of H with HI and the isotopic exchange reaction between H and D{sub 2}.

  18. an overview on the application of polymerase chain reaction (pcr)

    African Journals Online (AJOL)

    DR. AMINU

    Bayero Journal of Pure and Applied Sciences, 2(1): 109 - 114 ... Keywords: Polymerase chain reaction, Diagnosis, Bacteria, Infections .... A brain abscess is a localized pyogenic bacterial ... as encephalitis and skin rash. ... Streptococcus.

  19. Integrating product design into the supply chain

    DEFF Research Database (Denmark)

    Khan, Omera; Stolte, Terje; Creazza, Alessandro

    2016-01-01

    of opportunities and challenges when integrating product design and the supply chain and subsequently a step-by-step guide is developed to address these. Practical Implications: The research provides key recommendations to companies on how to create competitive capabilities by integrating product design...... into the supply chain. Originality/Value: This paper provides novel insights to both practitioners and researchers. For practitioners detailed recommendations are given on how they can maximise benefits through integrating product design into the supply chain. The RBV has been harnessed to highlight how......Purpose: The aim of the research is to illustrate how companies can create competitive capabilities through integration of product design into the supply chain. In doing so the paper reveals the challenges and the opportunities that companies face when integrating product design and supply chain...

  20. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  1. A noncontact temperature measurement method in polymerase chain reaction reactors

    Science.gov (United States)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.

    2016-04-01

    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  2. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    Science.gov (United States)

    Lorenz, Todd C

    2012-05-22

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  3. Generalized crested products of Markov chains

    CERN Document Server

    D'Angeli, Daniele

    2010-01-01

    We define a finite Markov chain, called generalized crested product, which naturally appears as a generalization of the first crested product of Markov chains. A complete spectral analysis is developed and the $k$-step transition probability is given. It is important to remark that this Markov chain describes a more general version of the classical Ehrenfest diffusion model. As a particular case, one gets a generalization of the classical Insect Markov chain defined on the ultrametric space. Finally, an interpretation in terms of representation group theory is given, by showing the correspondence between the spectral decomposition of the generalized crested product and the Gelfand pairs associated with the generalized wreath product of permutation groups.

  4. Microbial production of short chain diols.

    Science.gov (United States)

    Jiang, Yudong; Liu, Wei; Zou, Huibin; Cheng, Tao; Tian, Ning; Xian, Mo

    2014-12-10

    Short chain diols (propanediols, butanediols, pentanediols) have been widely used in bulk and fine chemical industries as fuels, solvents, polymer monomers and pharmaceutical precursors. The chemical production of short chain diols from fossil resources has been developed and optimized for decades. Consideration of the exhausting fossil resources and the increasing environment issues, the bio-based process to produce short chain diols is attracting interests. Currently, a variety of biotechnologies have been developed for the microbial production of the short chain diols from renewable feed-stocks. In order to efficiently produce bio-diols, the techniques like metabolically engineering the production strains, optimization of the fermentation processes, and integration of a reasonable downstream recovery processes have been thoroughly investigated. In this review, we summarized the recent development in the whole process of bio-diols production including substrate, microorganism, metabolic pathway, fermentation process and downstream process.

  5. product chain collaboration and environmental innovations

    DEFF Research Database (Denmark)

    Remmen, Arne; Mosgaard, Mette

    2004-01-01

    The paper  builds upon a case study from a number of electronic companies in Denmark and describes from an organisational perspective how organisations make environmental innovations in the product chain....

  6. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle

    2014-12-01

    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  7. A Universal Polymerase Chain Reaction Developer.

    Science.gov (United States)

    Valentini, Paola; Pompa, Pier Paolo

    2016-02-05

    The versatility of PCR, the gold standard for amplification of DNA targets, is hampered by the laborious, multi-step detection based on gel electrophoresis. We propose a one-step, one-tube method for the rapid (5 min) naked-eye detection of PCR products, based on controlled aggregation of gold nanoparticles. Our method is universal, instrument-free, and ultra-sensitive, as it could detect as low as 0.01 zeptomoles of HIV template DNA in an excess of interfering human genomic DNA.

  8. Investigation on detection of Haemophilus ducreyi by Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xibao(张锡宝); FEI Shi(费实); DENG Wenguo(邓文国); CAO wenlig(曹文苓); ZHU huilan(朱慧兰); MENG jinxiu(孟锦秀); YAN jinglan(颜景兰)

    2002-01-01

    Objective:To investigate the application of polymerase chain reaction (PCR) detection of Haemophilus ducreyi in clinical diagnosis of chancroid.Methods: Nucleotide sequences of 16srRNA gene specific for H. Dureyi were used to develop primer sets for amplification of two strains. The amplified products were tested via PCR and sequenced by electrophoresis in a 1.5 % gel.These products were compared with those of heterogeneous species or related bacteria to test the specificity of the PCR assay. PCR amplification with different concentrations of H.ducreyi was performed to test its sensitivity.Results: PCR amplification of two strains of H. Ducreyi produced a single band of expected 438bp length. The sequence was identified with genomic DNA. None of the other 19 reference species amplified under the same conditions gave this result. The highest sensitivity of PCR assay in the present test was 10ng/L.Conclusions: PCR assay for detection of H. Ducreyi is a rapid, specific, and sensitive detection method. If laboratory conditions are strictly controlled, PCR assay is a potentially useful laboratory test for H. Ducreyi infection diagnosis.

  9. Identifying of meat species using polymerase chain reaction (PCR)

    Science.gov (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  10. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  11. Selection vector for direct cloning of proof reading polymerase chain reaction products based on the lethal ccdB gene in Escherichia Coli

    OpenAIRE

    Weibel, Pascal; Ender, Miriam; Madon, Jerzy; Zinkernagel, Annelies; Schuepbach, Reto

    2013-01-01

    Introducing PCR products into plasmids vectors is key for molecular techniques. Ideally cloning vectors are easy to construct, modify and propagate, neither require advanced techniques nor special equipment or reagents and efficiently incorporate PCR products at close to zero empty vector background. We provide an easy to engineer self-made cloning vector, neither requiring sophisticated tools or techniques nor advanced cloning knowledge. Through recombination we obtained the pUC18ccdB vector...

  12. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe

    2013-01-01

    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his s...

  13. Determination of gender in cetaceans by the polymerase chain reaction

    NARCIS (Netherlands)

    Palsboll, PJ; Vader, A; Bakke, P; El-Gewely, MR

    1992-01-01

    We determined the gender of a variety of cet can species, including both ondotocetes and mysticetes, using the polymerase chain reaction for amplification of the sex chromosome specific regions ZFY/ZFX and SRY. This quick and simple method requires extremely small amounts of tissue, and therefore al

  14. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    Science.gov (United States)

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  15. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional ... If one can see or know where microbes in soil live, what roles in soil .... extraction buffer allowed both soil DNA and total soil RNA ... genomic DNA contamination in the RNA sample is trouble-.

  16. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2015-01-01

    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the en

  17. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  18. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2015-01-01

    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the

  19. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique|info:eu-repo/dai/nl/176957529; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2015-01-01

    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the en

  20. Mathematics analysis of polymerase chain reaction kinetic curves.

    Science.gov (United States)

    Sochivko, D G; Fedorov, A A; Varlamov, D A; Kurochkin, V E; Petrov, R V

    2016-01-01

    The paper reviews different approaches to the mathematical analysis of polymerase chain reaction (PCR) kinetic curves. The basic principles of PCR mathematical analysis are presented. Approximation of PCR kinetic curves and PCR efficiency curves by various functions is described. Several PCR models based on chemical kinetics equations are suggested. Decision criteria for an optimal function to describe PCR efficiency are proposed.

  1. MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

    Science.gov (United States)

    The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

  2. MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

    Science.gov (United States)

    The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

  3. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  4. Polymerase chain reaction amplification of genomic fragments of bovine herpesvirus-1

    OpenAIRE

    Cândido AL; ED Bontempo; Resende M.

    2000-01-01

    Especial conditions were developed for the amplification of five DNA segments from US region of BHV-1 by polymerase chain reaction. In order to eliminate most nonspecific products it was found that addition of three cosolvents DMSO, glycerol and NP 40 was a simple method for increasing the specificity of amplification.

  5. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    Science.gov (United States)

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices.

  6. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    Science.gov (United States)

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  7. Brucella contamination in raw milk by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2016-10-01

    Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

  8. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维

    2003-01-01

    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  9. Entropy production fluctuations of finite Markov chains

    Science.gov (United States)

    Jiang, Da-Quan; Qian, Min; Zhang, Fu-Xi

    2003-09-01

    For almost every trajectory segment over a finite time span of a finite Markov chain with any given initial distribution, the logarithm of the ratio of its probability to that of its time-reversal converges exponentially to the entropy production rate of the Markov chain. The large deviation rate function has a symmetry of Gallavotti-Cohen type, which is called the fluctuation theorem. Moreover, similar symmetries also hold for the rate functions of the joint distributions of general observables and the logarithmic probability ratio.

  10. Soluble Polyimides Bearing Long-Chain Alkyl Groups on Their Side Chain via Polymer Reaction

    Directory of Open Access Journals (Sweden)

    Yusuke Tsuda

    2012-01-01

    Full Text Available Novel soluble polyimides having long-chain alkyl groups on their side chain were synthesized via polymer reaction with the polyimides having phenolic OH groups and 3,4,5-tris(dodecyloxybenzoic acid (12GA using N,N′-dicyclohexylcarbodiimide (DCC as a dehydration reagent. The polyimides having phenolic OH groups were synthesized from the tetracarboxylic dianhydrides such as 5-(2,5-dioxotetrahydrofuryl-3-methyl-3-cyclohexene-1,2-dicarboxylic anhydride (cyclohexene-DA, 4,4′-hexafluoroisopropylidendi(phthalic anhydride (6FDA, and 3,3′,4,4′-diphenylsulfone tetracarboxylic dianhydride (DSDA and aromatic diamines such as 4,4′-diamino-3,3′-dihydroxybiphenyl (HAB. The polymer reactions were carried out in NMP and the progresses of polymer reactions were quantitatively monitored by 1H NMR measurements (conversion; 12.2–98.7%. The obtained polyimides bearing long-chain alkyl groups have enough molecular weights, good film-forming ability, good solubility for various organic solvents, and enough thermal stability. The water contact angles of the polyimide films were investigated, and it is noted that the introduction of long-chain alkyl groups increases the hydrophobicity of polyimide surface. These polyimides are expected to be applicable as the functional materials for microelectronics such as the alignment layers of LCDs.

  11. Reaction products of chlorine dioxide.

    Science.gov (United States)

    Stevens, A A

    1982-01-01

    Inspection of the available literature reveals that a detailed investigation of the aqueous organic chemistry of chlorine dioxide and systematic identification of products formed during water disinfection has not been considered. This must be done before an informed assessment can be made of the relative safety of using chlorine dioxide as a disinfectant alternative to chlorine. Although trihalomethanes are generally not formed by the action of chlorine dioxide, the products of chlorine dioxide treatment of organic materials are oxidized species, some of which also contain chlorine. The relative amounts of species types may depend on the amount of chlorine dioxide residual maintained and the concentration and nature of the organic material present in the source water. The trend toward lower concentrations of chlorinated by-products with increasing ClO2 concentration, which was observed with phenols, has not been observed with natural humic materials as measured by the organic halogen parameter. Organic halogen concentrations have been shown to increase with increasing chlorine dioxide dose, but are much lower than those observed when chlorine is applied. Aldehydes have been detected as apparent by-products of chlorine dioxide oxidation reactions in a surface water that is a drinking water source. Some other nonchlorinated products of chlorine dioxide treatment may be quinones and epoxides. The extent of formation of these moieties within the macromolecular humic structure is also still unknown. PMID:7151750

  12. Soluble Polyimides Bearing Long-Chain Alkyl Groups on Their Side Chain via Polymer Reaction

    OpenAIRE

    2012-01-01

    Novel soluble polyimides having long-chain alkyl groups on their side chain were synthesized via polymer reaction with the polyimides having phenolic OH groups and 3,4,5-tris(dodecyloxy)benzoic acid (12GA) using N,N′-dicyclohexylcarbodiimide (DCC) as a dehydration reagent. The polyimides having phenolic OH groups were synthesized from the tetracarboxylic dianhydrides such as 5-(2,5-dioxotetrahydrofuryl)-3-methyl-3-cyclohexene-1,2-dicarboxylic anhydride (cyclohexene-DA), 4,4′-hexafluoroisoprop...

  13. Production chain of CMS pixel modules

    CERN Document Server

    2006-01-01

    The pictures show the production chain of pixel modules for the CMS detector. Fig.1: overview of the assembly procedure. Fig.2: bump bonding with ReadOut Chip (ROC) connected to the sensor. Fig.3: glueing a raw module onto the baseplate strips. Fig.4: glueing of the High Density Interconnect (HDI) onto a raw module. Fig.5: pull test after heat reflow. Fig.6: wafer sensor processing, Indium evaporation.

  14. Environmental Management Initiatives in Product Chains

    DEFF Research Database (Denmark)

    Forman, Marianne; Hansen, Anne Grethe; Jørgensen, Michael Søgaard

    The Environmental Council for Cleaner Products in 2000-2001 initiated a collection of experience from the environmental co-operation in 25 product chains. This collection of experience was to elucidate the concrete co-operation between suppliers, enterprises and purchasers, to go through tools an...... carried out by 4 different consultancy firms for the Danish Environmental Protection Agency, but using different methods and different weighting. The material thus represents a large pool of knowledge, but great caution with its heterogeneity should be taken....

  15. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    Energy Technology Data Exchange (ETDEWEB)

    Ling, Jiajie, E-mail: jjling@bnl.gov [Brookhaven National Laboratory, Upton, NY 11973 (United States); Bishai, Mary; Diwan, Milind; Dolph, Jeffrey; Kettell, Steve; Sexton, Kenneth; Sharma, Rahul; Simos, Nikolaos; Stewart, James [Brookhaven National Laboratory, Upton, NY 11973 (United States); Tanaka, Hidekazu [Brookhaven National Laboratory, Upton, NY 11973 (United States); Kamioka Observatory, Institute for Cosmic Ray Research, The University of Tokyo, 456 Higashi-Mozumi, Kamioka, Hida, Gifu 506-1205 (Japan); Viren, Brett [Brookhaven National Laboratory, Upton, NY 11973 (United States); Arnold, Douglas; Tabor, Philip; Turner, Stephen [Naval Undersea Warfare Center, Newport, RI 02841 (United States); Benson, Terry; Wahl, Daniel; Wendt, Christopher [University of Wisconsin-Madison, WI 53706 (United States); Hahn, Alan; Kaducak, Marc; Mantsch, Paul [Fermi National Accelerator Laboratory, Batavia, IL 60510 (United States); and others

    2013-11-21

    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves.

  16. Exploring the e-Supply Chain of Information Products

    OpenAIRE

    Raafat George Saadé

    2012-01-01

    Digital information product producers have not taken advantage of the e-supply chain paradigm of today. However, in this information-based sector, a different set of supply chain management challenges exist. Very little research has been done in the supply chain of information products. This study focuses on the process analysis of the supply chain paradigm for digital information products. A framework for digital information products production in e-learning is proposed followed by an exampl...

  17. POSSIBILITIES OF THE POLYMERASE CHAIN REACTION IN THE HUMAN IDENTIFICATION

    Directory of Open Access Journals (Sweden)

    Zoran Budimlija

    2001-05-01

    Full Text Available Biological traces can be found in various forms. The basic question to deal withduring the biological traces' analysis is the one about their origin, that is, the questionof identity of the person to whom such samples belong. Up to now the most precisemethod of the DNA is the PCR of Polymerase Chain Reaction.The generalassumptions about applying the method for the purpose of human identification aredescribed, namely, the one that is used in the Institute for Forensic Medicine in NoviSad.

  18. Automated polymerase chain reaction in capillary tubes with hot air.

    Science.gov (United States)

    Wittwer, C T; Fillmore, G C; Hillyard, D R

    1989-06-12

    We describe a simple, compact, inexpensive thermal cycler that can be used for the polymerase chain reaction. Based on heat transfer with air to samples in sealed capillary tubes, the apparatus resembles a recirculating hair dryer. The temperature is regulated via thermocouple input to a programmable set-point process controller that provides proportional output to a solid state relay controlling a heating coil. For efficient cooling after the denaturation step, the controller activates a solenoid that opens a door to vent hot air and allows cool air to enter. Temperature-time profiles and amplification results approximate those obtained using water baths and microfuge tubes.

  19. HLA-B27 Determination by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    D. C. Kilpatrick

    1996-01-01

    Full Text Available A method for determining the presence or absence of HLA-827 by selective amplification of a region in the third exon of the HLA-B27 gene common to B*270 I to B*2705 inclusive, was evaluated. This polymerase chain reaction/sequence specific primer (PCR-SSP method gave perfect correlation with serological typing on 40 individuals of previously determined HLA type and on 50 further clinical samples elaluated blind. It was concluded that HLA-B27 determination by PCR-SSP is simple, reliable. cost-effectile and convient for laboratory staff.

  20. HLA-B27 Determination by Polymerase Chain Reaction

    OpenAIRE

    Kilpatrick, D C

    1996-01-01

    A method for determining the presence or absence of HLA-827 by selective amplification of a region in the third exon of the HLA-B27 gene common to B*270 I to B*2705 inclusive, was evaluated. This polymerase chain reaction/sequence specific primer (PCR-SSP) method gave perfect correlation with serological typing on 40 individuals of previously determined HLA type and on 50 further clinical samples elaluated blind. It was concluded that HLA-B27 determination by PCR-SSP is simple, reliable. cost...

  1. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    Science.gov (United States)

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

  2. Automated microdroplet platform for sample manipulation and polymerase chain reaction.

    Science.gov (United States)

    Chabert, Max; Dorfman, Kevin D; de Cremoux, Patricia; Roeraade, Johan; Viovy, Jean-Louis

    2006-11-15

    We present a fully automated system performing continuous sampling, reagent mixing, and polymerase chain reaction (PCR) in microdroplets transported in immiscible oil. Sample preparation and analysis are totally automated, using an original injection method from a modified 96-well plate layered with three superimposed liquid layers and in-capillary laser-induced fluorescence endpoint detection. The process is continuous, allowing sample droplets to be carried uninterruptedly into the reaction zone while new drops are aspirated from the sample plate. Reproducible amplification, negligible cross-contamination, and detection of low sample concentrations were demonstrated on numerous consecutive sample drops. The system, which opens the route to strong reagents and labor savings in high-throughput applications, was validated on the clinically relevant quantification of progesterone receptor gene expression in human breast cancer cell lines.

  3. APPLICATION OF POLYMERASE CHAIN REACTION FOR DIAGNOSING AMEBIC LIVER ABSCESS

    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏

    1996-01-01

    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  4. Toxoplasma polymerase chain reaction on experimental blood samples.

    Science.gov (United States)

    Joss, A W; Chatterton, J M; Evans, R; Ho-Yen, D O

    1993-01-01

    A two-stage polymerase chain reaction (PCR) assay employing oligonucleotide primers from the B1 gene of Toxoplasma gondii was developed and assessed for sensitivity and specificity. It was able to detect T. gondii DNA from as little as one parasite/sample in mock-infected rat or mouse leucocyte preparations. Parasitaemia was also identified in animals at five stages between 16 and 66 h after infection with the virulent RH strain, and at 12 stages between 2 and 38 days after infection with the cyst-forming Beverley strain. In the latter case, PCR was more sensitive than animal culture. No cross-reactions were observed in samples containing various opportunist pathogens which may also be found in the blood of immunocompromised patients.

  5. Taylor dispersion in polymerase chain reaction in a microchannel

    Science.gov (United States)

    Lee, Jinkee; Kulla, Elejdis; Chauhan, Anuj; Tripathi, Anubhav

    2008-09-01

    Polymerase chain reaction (PCR) is commonly used for a wide range of DNA applications such as disease detection, genetic fingerprinting, and paternity testing. The importance of PCR has led to an increased interest in performing PCR in a microfluidic platform with a high throughput while using very small DNA quantities. In this paper we solve convection-diffusion equations for the DNA and deoxynucleoside triphosphate (dNTP) under conditions suitable for PCR operation in a microchip. These include pressure driven flow accompanied by temporal temperature changes that lead to an amplification reaction, which is modeled as a first order reaction. The convection-diffusion-reaction equations are solved by using the method of multiple time scales to yield average equations that can be solved to obtain the long time evolution of the concentration profiles. The results obtained by solving the averaged equations agree well with full numerical solutions. The averaged equations are also solved to simulate the PCR to illustrate some interesting aspects of this operation in a microfluidic device. It is shown that insufficient nucleotide concentrations can lead to complete depletion of NTP at certain axial locations, which leads to termination of DNA amplification at these locations, resulting in formation of a plateau in DNA concentration.

  6. Production chain and innovative technologies for living

    Directory of Open Access Journals (Sweden)

    Eugenio Arbizzani

    2012-10-01

    Full Text Available The continued growth of residential demand, coupled with the significant decline of the housing market, is encouraging the development of many procedural and constructive experiments on the theme of affordable housing for a range of users increasingly unable to access home ownership. The spread of an approach to planning that is socially, economically and technologically sustainable, represents a culture of quality that is once more measurable, which makes it possible today to define innovative building models for the industrial and production chain. The use of innovative and integrated industrialised building systems may be one of the supporting factors in the achievement of the objectives of social housing.

  7. Determination of penicillin susceptibility of Streptococcus pneumoniae using the polymerase chain reaction.

    OpenAIRE

    Jalal, H; Organji, S.; Reynolds, J.; Bennett, D; O'Mason, E.; Millar, M R

    1997-01-01

    AIM: To develop a polymerase chain reaction (PCR) based method to detect penicillin susceptibility in isolates of Streptococcus pneumoniae (SP). METHOD: PCR primers were designed to amplify differential nucleotide sequences of the penicillin-binding protein (PBP) genes 2b, 2x, and 1a in penicillin susceptible and resistant strains of SP. Primers derived from the PBP 2x and 2b genes were designed to amplify products from penicillin susceptible S pneumoniae (PSSP), whereas primers derived from ...

  8. A reverse transcription-polymerase chain reaction assay for the detection of avian pneumovirus (Colorado strain).

    Science.gov (United States)

    Ali, A; Reynolds, D L

    1999-01-01

    A reverse transcription-polymerase chain reaction assay was developed for the detection of avian pneumovirus (Colorado strain) (APV-Col). The specific primers were designed from the published sequence of the matrix protein gene of APV-Col. The primers amplified a product of 631 nucleotides from APV-Col. The assay identified only APV-Col and did not react with Newcastle disease virus and infectious bronchitis virus.

  9. Cyclic polyesters prepared by poly(oxypropylene oxymaloyl ring-chain reactions

    Directory of Open Access Journals (Sweden)

    2007-01-01

    Full Text Available The synthesis of cyclic polyesters of poly(oxypropylene oxymaloyl from a ring-chain reaction was carried out at 40°C with 'Maghnite' an acid exchanged montmorillonite as acid solid ecocatalyst (Mag–H+. 'Maghnite' is already used as catalyst for polymerization of many vinylic and heterocyclic monomers [1]. The effect of amount of catalyst on yield and molecular weight of polymer was studied.A typical reaction product was analyzed by gel permeation chromatography (GPC as well as by nuclear magnetic resonance spectroscopy (1H-NMR and the existence of cyclic species was proven.

  10. Exploring chain length selectivity in HIC-catalyzed polycondensation reactions.

    Science.gov (United States)

    Feder, David; Gross, Richard A

    2010-03-08

    Polyester synthesis activity of immobilized Humicola insolens (HiC) was systematically studied with three-series of substrates varying in (i) omega-hydroxyalkanoic acid (omegaHA), (ii) alpha,omega-n-alkane diol, and (iii) alpha,omega-n-alkane diacid chain length. Covalent immobilization of HiC on Amberzyme oxirane (AO) resin (i.e., AO-HiC) was prepared. HiC-AO's activity for omegaHA substrates with 6, 10, 12, and 16 carbons was C16 > C12, where C10-omegaHA and C6-omegaHA were not polymerized. In contrast, N435's activity for omegaHA substrates was C16 = C12 > C10, where C6-omegaHA was not polymerized. HiC-AO activity for copolymerization of sebacic acid (C10-diacid) with alpha,omega-n-alkane diols with 3-, 4-, 5-, 6-, and 8-carbon chain lengths was C8 > C6, where C3, C4, and C5 diols were not polymerized. N435's relative activity for diol substrates was C8 = C6 = C5 > C4 > C3. HiC-AO activity for copolymerizations of 1,8-octanediol with alpha,omega-n-alkane diacids with 6-, 8-, 9-, 10-, and 13-carbon chain lengths was C13 = C10, where HiC showed little activity for C6, C8, and C9 diacid copolymerization. N435 displayed similar activity for all these diacid chain lengths. Thus, N435 has a broader substrate promiscuity than HiC-AO. This is most apparent for shorter chain length omegaHA, diol, and diacid monomers. These trends were similarly observed for a series of small molecule esterification reactions. Comparison of HiC-AO- and N435-catalyzed C16-HA homopolymerization at 8 h gave polymers with M(n) 40.4 and 25.5 kg/mol, respectively. Furthermore, HiC-AO- and N435-catalyzed copolymerization of 1,8-octanediol/C13-diacid polymerizations at 8 h gave polymers with M(n) of 11.0 and 9.6 kg/mol, respectively.

  11. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  12. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed

    2012-03-01

    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  13. Nested methylation-specific polymerase chain reaction cancer detection method

    Science.gov (United States)

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  14. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  15. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy

    2015-09-01

    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:http://dx.doi.org/10.1016/j.ab.2015.03.033, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  16. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...... amplified sequences, Southern hybridization, or dot blot analysis. The PCR assay was optimized and, after 40 cycles of amplification with primer set II, demonstrated a sensitivity of 10(-17) g of DNA, which corresponds to the detection of one copy of the plasmid. Because of the high sensitivity, we...... developed a closed system in which airborne contamination was minimized. Analysis of 228 clinical samples tested by cell culture, IDEIA enzyme immunosorbent assay (Medico-Nobel, Boots-Celltech Ltd., Berkshire, United Kingdom), and PCR showed a sensitivity of 100%, a specificity of 93% when PCR was compared...

  17. Aqueous humor polymerase chain reaction in uveitis - utility and safety.

    Science.gov (United States)

    Chronopoulos, Argyrios; Roquelaure, Daniel; Souteyrand, Georges; Seebach, Jörg Dieter; Schutz, James Scott; Thumann, Gabriele

    2016-10-28

    To study the value and safety of aqueous humor polymerase chain reaction (PCR) analysis for Herpes simplex, varicella zoster, cytomegalovirus, Epstein-Barr virus and Toxoplasma gondii in patients with uveitis. Records of 45 consecutive patients with anterior and posterior uveitis who underwent AC paracentesis with PCR were reviewed. The main outcome measure was frequency of PCR positivity. Secondary outcomes were alteration of treatment, safety of paracentesis, and correlation of keratitic precipitates with PCR positivity, RESULTS: The overall PCR positivity was 48.9 % (22/45). Therapy was changed because of the PCR results in 14/45 patients (37.7 %). One patient experienced a paracentesis related complication (1/45, 2.2 %) without long-term sequelae. Aqueous PCR altered the diagnosis and treatment in over a third of our patients and was relatively safe. Aqueous PCR should be considered for uveitis of atypical clinical appearance, recurrent severe uveitis of uncertain etiology, and therapy refractory cases.

  18. Markov chain aggregation and its applications to combinatorial reaction networks.

    Science.gov (United States)

    Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz

    2014-09-01

    We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.

  19. Simplified procedures for applying the polymerase chain reaction to routinely fixed paraffin wax sections.

    Science.gov (United States)

    Coates, P J; d'Ardenne, A J; Khan, G; Kangro, H O; Slavin, G

    1991-02-01

    The polymerase chain reaction was applied to the analysis of DNA contained in archival paraffin wax embedded material. DNA suitable for the reaction was obtained from these tissues by simple extraction methods, without previous dewaxing of tissue sections. When compared with unfixed material, the reaction efficiency was compromised, so that an increased number of amplification cycles were required to produce equivalent amounts of amplified product. This in turn led to an increase in amplification artefacts, which can be minimised by a simple modification of the standard reaction. Amplification of relatively large DNA fragments was not always successful, and it seems prudent to bear this in mind when designing oligonucleotide primers which are to be used for the amplification of archival material. The efficiency of the procedure can be improved by dividing the amplification cycles into two parts: this reduces the amount of reagent needed, is relatively simple and inexpensive, and can be performed in one working day.

  20. Future of Supply Chain Management in Various food Production.

    Directory of Open Access Journals (Sweden)

    Suhail Tyagi,

    2015-10-01

    Full Text Available This paper analyse the case of any production system and the structure of supply chain has evolved progressively over the time of sequential supply chain, to global supply chain. This evolution has reflected the change in business environment from static to dynamic. So the purpose of this paper is to propose an agenda for future research in supply chain management. We also measure the effect of FDI in India to the existing production industries in India.

  1. Thermal reactions of polymer chains with coal structures

    Energy Technology Data Exchange (ETDEWEB)

    P. Straka; J. Nahunkova [Academy of Sciences of the Czech Republic, Prague (Czech Republic). Institute of Rock Structure and Mechanics

    2003-07-01

    The thermal decompositions of polyethylene, polystyrene and polyamide 6 in the presence of coal was studied by DSC and TGA methods and reactions of these polymers with coal were described. Tars and cokes obtained were characterized and mass balance of the process expressed. Polyethylene decomposes by a free radical mechanism and the major products are 1-alkenes, {alpha},{omega}-alkadienes and n-alkanes. In the presence of coal, formed unsaturated products are adsorbed on the inner surface of coal and semicoke. Maximum weight losses of the coal-polyethylene mixture occur at higher temperature in comparison with that from the decomposition of polyethylene alone. Further, thermal reactions of coal with polystyrene were studied. In the range of 410 490{sup o}C a thermal degradation of coal proceeded, simultaneously, with decomposition of polystyrene. Because coal is a strong H-donor, unsaturated products of polystyrene decomposition (mainly styrene) was hydrogenated by coal. Some aromatic products of polystyrene decomposition reacted with the coal tar structures and new aromatics were formed. That is why the conversion time of polystyrene decomposition was much higher in the presence of coal. The yields of tar from copyrolysis with styrene polymers are higher in comparison with pyrolysis of coal alone. Also composition of tar is changed. Finally, reactions of coal with polyamide 6 were investigated. During the thermal degradation of coal the decomposition of polyamide 6 occurs and {epsilon}-caprolactam and the cyclic dimer are formed. The {epsilon}-caprolactam formation is promoted by water and hydrogen from coal degradation as due to high content of hydrogen coal acts as a strong H- and water donor. Under high-temperature conditions of copyrolysis beside a-caprolactam mainly carbon oxides, methane, aliphatic hydrocarbons, simple aromatics and stable oil are formed. 8 refs., 3 figs., 7 tabs.

  2. Diagnostic challenges of tuberculous lymphadenitis using polymerase chain reaction analysis: a case study.

    Science.gov (United States)

    Taniguchi, Hirokazu; Nakamura, Masahiko; Shimokawa, Kazuki; Kamiseki, Fumi; Ishizawa, Shin; Abo, Hitoshi; Furuse, Hideaki; Tsuda, Takeshi; Masaki, Yasuaki; Suzuki, Kensuke

    2015-01-01

    This report presents a case of tuberculous lymphadenitis that was difficult to diagnose using polymerase chain reaction analysis. An 80-year-old Japanese female was hospitalized due to swollen cervical lymph nodes. Her lymph node tests revealed paradoxical polymerase chain reaction results. Polymerase chain reaction analysis of two biopsy tissues using the Cobas TaqMan revealed a positive result for Mycobacterium avium and a negative result for Mycobacterium tuberculosis. However, polymerase chain reaction analysis of a cultured colony of acid-fast bacteria from biopsy tissue using the Cobas TaqMan and an alternative polymerase chain reaction analysis of biopsy tissue yielded discordant results. The patient was diagnosed as having tuberculous lymphadenitis. She was treated with antitubercular drugs and subsequently had a reduction in cervical lymph node swelling. Polymerase chain reaction analysis is not 100% accurate; hence, its use as a diagnostic tool for mycobacterial infection requires increased attention.

  3. Combination Primer Polymerase Chain Reaction for Multi-Site Mutagenesis of Close Proximity Sites

    OpenAIRE

    Jensen, Pia Hønnerup; Weilguny, Dietmar

    2005-01-01

    We describe a rapid and efficient polymerase chain reaction procedure for multi-site-directed mutagenesis for cases in which the sites to be mutated are in close proximity. The combination primer polymer chain reaction method is based on a multi-site directed mutagenesis protocol together with a splicing by overlapping extension polymerase chain reaction protocol. several different combinations of multiple mutations were successfully performed with this method and are reported in this study.

  4. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng

    2015-05-01

    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  5. A diagnostic polymerase chain reaction assay for Zika virus.

    Science.gov (United States)

    Balm, Michelle N D; Lee, Chun Kiat; Lee, Hong Kai; Chiu, Lily; Koay, Evelyn S C; Tang, Julian W

    2012-09-01

    Zika virus (ZIKV) is a mosquito-borne flavivirus. Infection results in a dengue-like illness with fever, headache, malaise, and a maculopapular rash. Nearly all cases are mild and self-limiting but in 2007, a large outbreak of ZIKV was reported from the island of Yap (in Micronesia, northwest of Indonesia). Singapore is already endemic for dengue, and its impact on public health and economic burden is significant. Other dengue-like infections (e.g., Chikungunya virus) are present. Yet only 10% of reported dengue cases have laboratory confirmation. The identification and control of other dengue-like, mosquito-transmitted infections is thus important for the health of Singapore's population, as well as its economy. Given that ZIKV shares the same Aedes mosquito vector with both dengue and Chikungunya, it is possible that this virus is present in Singapore and causing some of the mild dengue-like illness. A specific and sensitive one-step, reverse transcription polymerase chain reaction (RT-PCR) with an internal control (IC) was designed and tested on 88 archived samples of dengue-negative, Chikungunya-negative sera from patients presenting to our hospital with a dengue-like illness, to determine the presence of ZIKV in Singapore. The assay was specific for detection of ZIKV and displayed a lower limit of detection (LoD) of 140 copies viral RNA/reaction when tested on synthetic RNA standards prepared using pooled negative patient plasma. Of the 88 samples tested, none were positive for ZIKV RNA, however, the vast majority of these were from patients admitted to hospital and further study may be warranted in community-based environments.

  6. Extended kinetic model of real-time polymerase chain reaction process

    Science.gov (United States)

    Fedorov, A. A.; Sochivko, D. G.; Varlamov, D. A.; Kurochkin, V. E.

    2016-11-01

    Real-time polymerase chain reaction (real-time PCR) is the main molecular genetic method used for qualitative and quantitative analysis of specific nucleic acid sequences in many areas of biomedical research. Theoretical study of pCr models allows to estimate the influence of various reaction components and parameters, and to determine the unknown parameter values by approximating the experimental real-time PCR curves. An extended kinetic model of real-time PCR is presented. The model takes into account the enzyme activity based on Michaelis-Menten kinetics, the hybridization of complementary DNA fragments, the presence of a fluorescent probe used for detection of the reaction products, and the temperature dependence of primers and probe hybridization.

  7. Integrated polymerase chain reaction chips utilizing digital microfluidics.

    Science.gov (United States)

    Chang, Yi-Hsien; Lee, Gwo-Bin; Huang, Fu-Chun; Chen, Yi-Yu; Lin, Jr-Lung

    2006-09-01

    This study reports an integrated microfluidic chip for polymerase chain reaction (PCR) applications utilizing digital microfluidic chip (DMC) technology. Several crucial procedures including sample transportation, mixing, and DNA amplification were performed on the integrated chip using electro-wetting-on-dielectric (EWOD) effect. An innovative concept of hydrophobic/hydrophilic structure has been successfully demonstrated to integrate the DMC chip with the on-chip PCR device. Sample droplets were generated, transported and mixed by the EWOD-actuation. Then the mixture droplets were transported to a PCR chamber by utilizing the hydrophilic/hydrophobic interface to generate required surface tension gradient. A micro temperature sensor and two micro heaters inside the PCR chamber along with a controller were used to form a micro temperature control module, which could perform precise PCR thermal cycling for DNA amplification. In order to demonstrate the performance of the integrated DMC/PCR chips, a detection gene for Dengue II virus was successfully amplified and detected. The new integrated DMC/PCR chips only required an operation voltage of 12V(RMS) at a frequency of 3 KHz for digital microfluidic actuation and 9V(DC) for thermal cycling. When compared to its large-scale counterparts for DNA amplification, the developed system consumed less sample and reagent and could reduce the detection time. The developed chips successfully demonstrated the feasibility of Lab-On-a-Chip (LOC) by utilizing EWOD-based digital microfluidics.

  8. Nucleic acid amplification: Alternative methods of polymerase chain reaction.

    Science.gov (United States)

    Fakruddin, Md; Mannan, Khanjada Shahnewaj Bin; Chowdhury, Abhijit; Mazumdar, Reaz Mohammad; Hossain, Md Nur; Islam, Sumaiya; Chowdhury, Md Alimuddin

    2013-10-01

    Nucleic acid amplification is a valuable molecular tool not only in basic research but also in application oriented fields, such as clinical medicine development, infectious diseases diagnosis, gene cloning and industrial quality control. A comperehensive review of the literature on the principles, applications, challenges and prospects of different alternative methods of polymerase chain reaction (PCR) was performed. PCR was the first nucleic acid amplification method. With the advancement of research, a no of alternative nucleic acid amplification methods has been developed such as loop mediated isothermal amplification, nucleic acid sequence based amplification, strand displacement amplification, multiple displacement amplification. Most of the alternative methods are isothermal obviating the need for thermal cyclers. Though principles of most of the alternate methods are relatively complex than that of PCR, they offer better applicability and sensitivity in cases where PCR has limitations. Most of the alternate methods still have to prove themselves through extensive validation studies and are not available in commercial form; they pose the potentiality to be used as replacements of PCR. Continuous research is going on in different parts of the world to make these methods viable technically and economically.

  9. The Future of Digital Polymerase Chain Reaction in Virology.

    Science.gov (United States)

    Vynck, Matthijs; Trypsteen, Wim; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2016-10-01

    Driven by its potential benefits over currently available methods, and the recent development of commercial platforms, digital polymerase chain reaction (dPCR) has received increasing attention in virology research and diagnostics as a tool for the quantification of nucleic acids. The current technologies are more precise and accurate, but may not be much more sensitive, compared with quantitative PCR (qPCR) applications. The most promising applications with the current technology are the analysis of mutated sequences, such as emerging drug-resistant mutations. Guided by the recent literature, this review focuses on three aspects that demonstrate the potential of dPCR for virology researchers and clinicians: the applications of dPCR within both virology research and clinical virology, the benefits of the technique over the currently used real-time qPCR, and the importance and availability of specific data analysis approaches for dPCR. Comments are provided on current drawbacks and often overlooked pitfalls that need further attention to allow widespread implementation of dPCR as an accurate and precise tool within the field of virology.

  10. Nested polymerase chain reaction for early diagnosis of typhoid fever.

    Science.gov (United States)

    Sultana, S; Hossain, M A; Alam, M A; Paul, S K; Mahmud, C; Kabir, M R; Haque, N; Yesmin, T; Kayes, M T; Maruf, A A; Kobayashi, N

    2012-01-01

    Typhoid fever, caused by Salmonella typhi, is an important cause of morbidity and mortality in many developing countries. A rapid and sensitive method for the detection of S. typhi is essential for early diagnosis. This was a study to prospectively evaluate the sensitivity and specificity of nested polymerase chain reaction (PCR) to identify the S. typhi using flagellin gene related primers. The study was carried out in the department of Microbiology, Mymensingh Medical College, Mymensingh between July, 2010 and June, 2011, including 82 individuals of different age and sex. Of them, 62 were clinically suspected cases of typhoid fever and remaining 20 were apparently healthy controls. Cultures as well as PCR of blood specimens were performed for each of the cases. Among the 62 suspected typhoid fever cases, 8(12.9%) were blood culture positive and 55(88.7%) were PCR positive for S. typhi. All culture positive cases were positive by PCR and among 54 culture negative cases, 47(87%) were positive by PCR. Neither of the healthy controls was positive by PCR or blood culture. The sensitivity, specificity, positive predictive value and negative predictive value of PCR using blood culture as gold standard were 88.7%, 100%, 100% and 74% respectively for typhoid fever. In this study, the PCR appears highly specific, very sensitive and superior to blood culture for the early diagnosis of typhoid fever.

  11. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    Science.gov (United States)

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count <1800/mm(3) was observed in 60%, and positive C-reactive protein in 46%. Thirty neonates had positive blood culture, and Klebsiella pneumoniae (22%) was the predominant organism. Nested urine PCR was positive in 38 (76%) and detected bacterial DNA in 8 neonates with negative blood cultures. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents.

  12. Fluorescence-based temperature control for polymerase chain reaction.

    Science.gov (United States)

    Sanford, Lindsay N; Wittwer, Carl T

    2014-03-01

    The ability to accurately monitor solution temperature is important for the polymerase chain reaction (PCR). Robust amplification during PCR is contingent on the solution reaching denaturation and annealing temperatures. By correlating temperature to the fluorescence of a passive dye, noninvasive monitoring of solution temperatures is possible. The temperature sensitivity of 22 fluorescent dyes was assessed. Emission spectra were monitored and the change in fluorescence between 45 and 95°C was quantified. Seven dyes decreased in intensity as the temperature increased, and 15 were variable depending on the excitation wavelength. Sulforhodamine B (monosodium salt) exhibited a fold change in fluorescence of 2.85. Faster PCR minimizes cycling times and improves turnaround time, throughput, and specificity. If temperature measurements are accurate, no holding period is required even at rapid speeds. A custom instrument using fluorescence-based temperature monitoring with dynamic feedback control for temperature cycling amplified a fragment surrounding rs917118 from genomic DNA in 3min and 45s using 35 cycles, allowing subsequent genotyping by high-resolution melting analysis. Gold-standard thermocouple readings and fluorescence-based temperature differences were 0.29±0.17 and 0.96±0.26°C at annealing and denaturation, respectively. This new method for temperature cycling may allow faster speeds for PCR than currently considered possible.

  13. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  14. Monitoring infection: from blood culture to polymerase chain reaction (PCR).

    Science.gov (United States)

    Book, Malte; Lehmann, Lutz Eric; Zhang, XiangHong; Stüber, Frank

    2013-06-01

    In patients with sepsis, diagnosis of blood stream infection (BSI) is a key concern to the therapist. Direct verification of pathogens in the blood stream executed by blood cultures (BC) still is regarded as the gold standard up to date. The quickest possible initiation of an appropriate antimicrobial therapy is a cornerstone of an effective therapy. Moreover, in this view BC can also serve to identify antimicrobial agents to target the pathogen. However, when employing BC the time needed until microbiological results are available ranges from 24 up to 72 h. Moreover, infections caused by multiple pathogens often remain undetected and concurrent antibiotic therapy may lower the overall sensitivity. Alternative pathogen characterization can be performed by polymerase chain reaction (PCR) based amplification methods. Results using PCR can be obtained within 6-8 h. Therefore, the time delay until an appropriate therapy can be reduced enormously. Moreover, these methods have the potential to enhance the sensitivity in the diagnosis of blood stream infections. Therefore, PCR based methods might be a valuable adjunct to present procedures of diagnosing bacteraemia.

  15. Analysis of human cytomegalovirus using the polymerase chain reaction.

    Science.gov (United States)

    Mendelson, M

    2000-01-01

    As with numerous other branches of science, the study of human cytomegalovirus (HCMV) infection has been revolutionized by the polymerase chain reaction (PCR) method first devised by Mullis and Faloona (1). PCR allows the in vitro amplification of HCMV DNA sequences by the simultaneous primer extension of complementary DNA strands. Similarly, reverse transcription-PCR (RT-PCR) allows the study of targeted gene expression, by reverse transcription of RNA to complementary DNA (cDNA), followed by amplification of target DNA using predetermined primers. The PCR method is used in the clinical diagnosis of HCMV infection, particularly in the setting of transplantation medicine and in those patients infected with the human immunodeficiency virus (HIV). In addition, the advent of PCR and RT-PCR has transformed our understanding of the pathogenesis of HCMV infection, central to which is the definition of the sites of latency, the degree and type of gene expression within the latently infected cell, and the factors influencing both the maintenance of latency and reactivation of the virus during immunosuppression.

  16. Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

    Directory of Open Access Journals (Sweden)

    Anupam Berwal

    2017-01-01

    Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

  17. Quantitative polymerase chain reaction analysis by deconvolution of internal standard.

    Science.gov (United States)

    Hirakawa, Yasuko; Medh, Rheem D; Metzenberg, Stan

    2010-04-29

    Quantitative Polymerase Chain Reaction (qPCR) is a collection of methods for estimating the number of copies of a specific DNA template in a sample, but one that is not universally accepted because it can lead to highly inaccurate (albeit precise) results. The fundamental problem is that qPCR methods use mathematical models that explicitly or implicitly apply an estimate of amplification efficiency, the error of which is compounded in the analysis to unacceptable levels. We present a new method of qPCR analysis that is efficiency-independent and yields accurate and precise results in controlled experiments. The method depends on a computer-assisted deconvolution that finds the point of concordant amplification behavior between the "unknown" template and an admixed amplicon standard. We apply the method to demonstrate dexamethasone-induced changes in gene expression in lymphoblastic leukemia cell lines. This method of qPCR analysis does not use any explicit or implicit measure of efficiency, and may therefore be immune to problems inherent in other qPCR approaches. It yields an estimate of absolute initial copy number of template, and controlled tests show it generates accurate results.

  18. Quantitative polymerase chain reaction analysis by deconvolution of internal standard

    Directory of Open Access Journals (Sweden)

    Metzenberg Stan

    2010-04-01

    Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a collection of methods for estimating the number of copies of a specific DNA template in a sample, but one that is not universally accepted because it can lead to highly inaccurate (albeit precise results. The fundamental problem is that qPCR methods use mathematical models that explicitly or implicitly apply an estimate of amplification efficiency, the error of which is compounded in the analysis to unacceptable levels. Results We present a new method of qPCR analysis that is efficiency-independent and yields accurate and precise results in controlled experiments. The method depends on a computer-assisted deconvolution that finds the point of concordant amplification behavior between the "unknown" template and an admixed amplicon standard. We apply the method to demonstrate dexamethasone-induced changes in gene expression in lymphoblastic leukemia cell lines. Conclusions This method of qPCR analysis does not use any explicit or implicit measure of efficiency, and may therefore be immune to problems inherent in other qPCR approaches. It yields an estimate of absolute initial copy number of template, and controlled tests show it generates accurate results.

  19. Use of Polymerase Chain Reaction To Detect the Take-All Fungus, Gaeumannomyces graminis, in Infected Wheat Plants

    OpenAIRE

    Schesser, Kurt; Luder, Andreas; Henson, Joan M.

    1991-01-01

    Gaeumannomyces graminis, the causative agent of take-all disease of wheat, barley, and oats, was detected in infected wheat seedlings by using the polymerase chain reaction to amplify Gaeumannomyces-specific DNA fragments. Nested primers and two rounds of amplification were used to amplify two fragments, approximately 287 and 188 bp in size, from G. graminis-infected wheat seedlings. The use of nested primers greatly decreased the number of nonspecific amplification products. Polymerase chain...

  20. Performance evaluation on aquatic product cold-chain logistics

    Directory of Open Access Journals (Sweden)

    Wenbing Wu

    2015-11-01

    Full Text Available Purpose: The requirements for high quality and diversification aquatic products are increasing with the improvement of Chinese living standard. However, the distribution between place of production and place of consumption are uneven, which results in large cold-chain logistics demand for aquatic products. At present, the low-level development of cold chain logistics has a bad impact on the circulation of aquatic products in China. So it is very urgent to develop cold-chain logistics in China. Design/methodology/approach: In order to do this, we apply performance evaluation, a well-known management tool, to study Chinese aquatic product cold-chain logistics. In this paper we first propose SISP(Subjects, Indexes, Standards, and Phases of performance evaluation model and ACSSN model(Aquatic product, Customer, Supply Chain, Society, and Node enterprises of supply chain for aquatic products cold-chain logistics performance evaluation. Then an ANP-Fuzzy method is proposed to evaluate the operational performance of Shandong Oriental Ocean Sci-Tech Co., Ltd. Furthermore, a system dynamic model is built to simulate the impact of temperature on the profits in aquatic products cold-chain sales section. Findings: We find out within a reasonable temperature range, lower temperature brings higher profit level. Also, performance improvement methods are proposed and the simulation of performance evaluation system is developed. Practical implications: Our findings can help to improve the level of aquatic product cold-chain logistics in China. Originality/value: The paper proposes the SISP (Subjects, Indexes, Standards, and Phases of performance evaluation model and ACSSN model (Aquatic product, Customer, Supply Chain, Society, and Node enterprises of supply chain for aquatic products cold-chain logistics performance evaluation.

  1. Reaction products of chlorine dioxide.

    OpenAIRE

    Stevens, A A

    1982-01-01

    Inspection of the available literature reveals that a detailed investigation of the aqueous organic chemistry of chlorine dioxide and systematic identification of products formed during water disinfection has not been considered. This must be done before an informed assessment can be made of the relative safety of using chlorine dioxide as a disinfectant alternative to chlorine. Although trihalomethanes are generally not formed by the action of chlorine dioxide, the products of chlorine dioxi...

  2. Reaction products of chlorine dioxide.

    OpenAIRE

    Stevens, A. A.

    1982-01-01

    Inspection of the available literature reveals that a detailed investigation of the aqueous organic chemistry of chlorine dioxide and systematic identification of products formed during water disinfection has not been considered. This must be done before an informed assessment can be made of the relative safety of using chlorine dioxide as a disinfectant alternative to chlorine. Although trihalomethanes are generally not formed by the action of chlorine dioxide, the products of chlorine dioxi...

  3. Challenges for bio-based products in sustainable value chains

    OpenAIRE

    L. Cardon; Lin, J.W.; De Groote, M.; Ragaert, K.; Kopecka, J.A.; Koster, R.P.

    2011-01-01

    This work concerns studies related to strategic development of products in which bio-based plastics are or will be applied, referred to as bio-based products. The studies cover (1) current and potential benefits of bio-based products in extended value chains including activities after end-of-life of products, (2) value communication between stakeholders in extended value chains, and (3) creating an integrated development approach for optimized bio-based products. Most existing models for valu...

  4. Snake antivenoms: adverse reactions and production technology

    Directory of Open Access Journals (Sweden)

    VM Morais

    2009-01-01

    Full Text Available Antivenoms have been widely used for more than a century for treating snakebites and other accidents with poisonous animals. Despite their efficacy, the use of heterologous antivenoms involves the possibility of adverse reactions due to activation of the immune system. In this paper, alternatives for antivenom production already in use were evaluated in light of their ability to minimize the occurrence of adverse reactions. These effects were classified according to their molecular mechanism as: anaphylactic reactions mediated by IgE, anaphylactoid reactions caused by complement system activation, and pyrogenic reactions produced mainly by the presence of endotoxins in the final product. In the future, antivenoms may be replaced by humanized antibodies, specific neutralizing compounds or vaccination. Meanwhile, improvements in antivenom quality will be focused on the obtainment of a more purified and specific product in compliance with good manufacturing practices and at an affordable cost.

  5. Application of polymerase chain reaction (PCR) for diagnosis of equine herpes virus-1 (EHV-1).

    Science.gov (United States)

    Gupta, A K; Singh, B K; Yadav, M P

    1996-11-01

    Fifty aborted foetus samples were diagnosed for the presence of equine herpes virus-1 (EHV-1) by polymerase chain reaction (PCR) technique. Specific primer pair for amplification of a particular segment of EHV-1 DNA in gc region having 3 Hae III restriction endonuclease sites was used. A 409 base pair segment obtained as PCR amplification product in 9 samples was digested with Hae III to confirm the presence of EHV-1 as the infectious agent in aborted tissues. It was observed that PCR technique was more sensitive, specific and rapid than the conventional virological diagnostic methods.

  6. Critical analysis: use of polymerase chain reaction to diagnose leprosy

    Directory of Open Access Journals (Sweden)

    Flaviane Granero Maltempe

    Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.

  7. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  8. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M

    2012-02-03

    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  9. The insurability of product recall in food supply chains

    NARCIS (Netherlands)

    Meuwissen, M.P.M.; Valeeva, N.I.; Velthuis, A.G.J.; Huirne, R.B.M.

    2006-01-01

    Insurers face growing difficulties with insuring food-related risks among others due to an increasing number of product recalls and an increasing amount of claims being pushed back into the chain. This paper focuses on the risk of product recall in dairy supply chains. The paper aims at providing

  10. Production planning and control of closed-loop supply chains

    NARCIS (Netherlands)

    K. Inderfurth (Karl); R.H. Teunter (Ruud)

    2001-01-01

    textabstractMore and more supply chains emerge that include a return flow of materials. Many original equipment manufacturers are nowadays engaged in the remanufacturing business. In many process industries, production defectives and by-products are reworked. These closed-loop supply chains deserve

  11. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO

    1993-01-01

    of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib......CP-specific B lymphocytes were isolated by antigen-coated immunomagnetic beads. After the purification, at least 98% of the immunoglobulin-secreting recovered cells were HibCP specific. The RNA was isolated and amplified by cDNA synthesis using a kappa constant region primer followed by polymerase chain...... reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...

  12. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO

    1993-01-01

    reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody......CP-specific B lymphocytes were isolated by antigen-coated immunomagnetic beads. After the purification, at least 98% of the immunoglobulin-secreting recovered cells were HibCP specific. The RNA was isolated and amplified by cDNA synthesis using a kappa constant region primer followed by polymerase chain...... of the B lymphocytes activated in vivo. Here, we present a method for rapid analysis of the rearranged kappa light chain genes used by human circulating antigen-specific B lymphocytes. After vaccination with Haemophilus influenzae type b capsular polysaccharide (HibCP) conjugated with protein, the Hib...

  13. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  14. Optimalization of production inside logistics chain for 21st century

    Directory of Open Access Journals (Sweden)

    Drago Pupavac

    2006-12-01

    Full Text Available In today’s world numerous logistics chains exist, competing for similar jobs in different markets throughout the world. By connecting the supply and demand, i.e. production and consumption, logistics chains create national, regional and global logistics network which task is to maximise total generated value. Generated valueis defined as the difference between the price of finished product or service and the input necessary to create such products. The chain profitability is shown by the difference between the income obtained through sale of products or services and total expenditure in that chain. Accordingly, this scientific debate researches the possibilityof production optimisation within logistic chain by application of dynamic programming method with emphasis on information technologies.

  15. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou

    2008-01-01

    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  16. 食品中化脓链球菌的PCR检测方法的建立%Establishment of Polymerase Chain Reaction Assay for Detection of Streptococcus Pyogenes in Food Products

    Institute of Scientific and Technical Information of China (English)

    杨学明; 巢强国; 葛宇; 熊薇; 曲勤凤

    2008-01-01

    化脓链球菌是一种常见的食源性致病菌,从19世纪80年代起,化脓链球菌引起的感染在全球范围内呈逐步上升之势并发展成为人类重要致病茵之一.通过已公布的13株化脓链球菌的基因组序列找出具有种特异性的基因序列.运用BLAST(Basic Local Alignment Search Tool,基本局部比对工具)在GenBank中进行序列对库的比对结果表明:化脓链球菌的某些基因(SmeZ,emm,spyM51755)具有种特异性.以这些基因为目的基因,共设计七对引物.经PCR(Polymerase Chain Reaction,聚合酶链式反应)检测发现spvM引物对(spyM51755F,spyM51755R)具有很高的特异性.利用该引物对,建立可快速且灵敏地检测食品中化脓链球菌的PCR方法,其灵敏度达到10 cfu/g样品.

  17. Dynamical Model of Weak Pion Production Reactions

    CERN Document Server

    Sato, T; Lee, T S H

    2003-01-01

    The dynamical model of pion electroproduction has been extended to investigate the weak pion production reactions. The predicted cross sections of neutrino-induced pion production reactions are in good agreement with the existing data. We show that the renormalized(dressed) axial N-$\\Delta$ form factor contains large dynamical pion cloud effects and this renormalization effects are crucial in getting agreement with the data. We conclude that the N-$\\Delta$ transitions predicted by the constituent quark model are consistent with the existing neutrino induced pion production data in the $\\Delta$ region.

  18. Applying the means-end chain concept to product development

    DEFF Research Database (Denmark)

    Søndergaard, Helle Alsted

    This paper proposes that the means-end chain (MEC) approach can influence the use of market information and inter-functional communication in new product development (NPD). The central question is whether market information represented by means-end chain data can be a vehicle for inter-functional......This paper proposes that the means-end chain (MEC) approach can influence the use of market information and inter-functional communication in new product development (NPD). The central question is whether market information represented by means-end chain data can be a vehicle for inter...

  19. The Cold Chain Logistics for Perishable Agricultural Products in China

    Directory of Open Access Journals (Sweden)

    Hou Yanfang

    2015-07-01

    Full Text Available This study introduces concepts of the agricultural product cold chain logistics and domestic and international researches. Also, the study discusses issues of Chinese agricultural cold chain logistics in the development process as the following aspects: the dividing of cold chain logistics market, refrigeration hardware facilities, third-party cold chain logistics development, the level of cold chain technologies, cold chain logistics professionals and the legal system and the standard system. Next, this study focuses on the countermeasures to solve problems of the agricultural cold chain logistics development by some ways as followings: increasing investments in technology, accelerating the improvement of the cold chain logistics facilities, strengthening the cultivation of third-party cold chain logistics enterprise, encouraging the training of personnel, promoting the cold chain logistics informatization and improving relevant laws, regulations and standards. Combining with the cold chain logistics of Mengniu Dairy, this study analyzes and proposes countermeasures. Finally, this study summarizes the developments in Chinese agricultural chain logistics, which needs to be strengthened in many aspects for suiting Chinese situation.

  20. Dynamics of interfacial reactions between O(3 P) atoms and long-chain liquid hydrocarbons

    Science.gov (United States)

    Allan, Mhairi; Bagot, Paul A. J.; Köhler, Sven P. K.; Reed, Stewart K.; Westacott, Robin E.; Costen, Matthew L.; McKendrick, Kenneth G.

    2007-09-01

    Recent progress that has been made towards understanding the dynamics of collisions at the gas-liquid interface is summarized briefly. We describe in this context a promising new approach to the experimental study of gas-liquid interfacial reactions that we have introduced. This is based on laser-photolytic production of reactive gas-phase atoms above the liquid surface and laser-spectroscopic probing of the resulting nascent products. This technique is illustrated for reaction of O(3P) atoms at the surface of the long-chain liquid hydrocarbon squalane (2,6,10,15,19,23-hexamethyltetracosane). Laser-induced fluorescence detection of the nascent OH has revealed mechanistically diagnostic correlations between its internal and translational energy distributions. Vibrationally excited OH molecules are able to escape the surface. At least two contributions to the product rotational distributions are identified, confirming and extending previous hypotheses of the participation of both direct and trapping-desorption mechanisms. We speculate briefly on future experimental and theoretical developments that might be necessary to address the many currently unanswered mechanistic questions for this, and other, classes of gas-liquid interfacial reaction.

  1. Bottleneck on Supply Chain of Organic Agricultural Products and Countermeasures

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xin-min

    2012-01-01

    Organic agriculture is one of successful models of low-carbon agriculture, and plays an important role in alleviating and adapting to climate change. However, the development of supply chain of organic agricultural products lags behind, which seriously restricts development of organic agricultural product market. In this paper, major models and bottleneck of supply chain of organic agricultural products are analyzed, and finally countermeasures are put forward.

  2. Ligase chain reaction amplification for sensitive electrochemiluminescent detection of single nucleotide polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Ying; Yang, Mengli; Xiang, Yun, E-mail: yunatswu@swu.edu.cn; Yuan, Ruo, E-mail: yuanruo@swu.edu.cn; Chai, Yaqin

    2013-09-24

    Graphical abstract: -- Highlights: •Ligase chain reaction amplification (LCR) is employed to sensitively detect single nucleotide polymorphisms. •During LCR, the mutant target gene is recycled and duplicated exponentially to achieve dramatic signal amplification. •The method shows a selectivity factor of 10{sup 3} toward the mutant target gene against the interfering wild target gene. -- Abstract: Single nucleotide polymorphisms are the most common type of genetic variations among human beings and can serve as biomarkers for various types of diseases. In this work, based on ligase chain reaction amplification for the production of massive hemin/G-quadruplex DNAzymes to quench the electrochemiluminescent (ECL) emission of quantum dots (QDs), a universal and sensitive single nucleotide polymorphism detection method is described. During the ligase chain reaction process, the mutant K-ras target gene is recycled and exponentially duplicated, leading to the attachment of numerous G-rich sequences on the QD-embedded sensing surface. Upon the addition of the assistant sequences and hemin, numerous hemin/G-quadruplex DNAzymes are formed, which consume the dissolved oxygen in the detection buffer and result in significant quenching of QD ECL emission for sensitive single nucleotide polymorphism determination. The developed method shows a linear range of 50 fM to 50 pM and an estimated detection limit of 45 fM for the mutant K-ras gene. The proposed strategy also exhibits high selectivity towards the mutant K-ras gene against the co-existence of 10{sup 3}-fold excess of the wild-type K-ras gene, which makes our method a useful addition to the alternatives for single nucleotide polymorphism monitoring.

  3. A comparison of the cytotoxicity and proinflammatory cytokine production of EndoSequence root repair material and ProRoot mineral trioxide aggregate in human osteoblast cell culture using reverse-transcriptase polymerase chain reaction.

    Science.gov (United States)

    Ciasca, Maria; Aminoshariae, Anita; Jin, Ge; Montagnese, Thomas; Mickel, Andre

    2012-04-01

    The purpose of this study was to compare the cytotoxicity and cytokine expression profiles of EndoSequence Root Repair Material (ERRM; Brasseler, Savannah, GA) putty, ERRM flowable, and ProRoot mineral trioxide aggregate (MTA; Dentsply Tulsa Dental, Johnson City, TN) using osteoblast cells (MG-63). Four millimeters in diameter of each material was placed in the center of a 6-well culture plate, and a 2-mL suspension (10(5) cells/mL) of human osteoblasts was seeded in each well. Photomicrograph images were used to evaluate cytotoxicity as evidenced by the lack of osteoblast cell growth in relation to the materials with AH-26 (Dentsply Tulsa Dental) as the positive control. In addition, reverse-transcriptase polymerase chain reaction (RT-PCR) was used to evaluate the expression of interleukin (IL)-1β, IL-6, IL-8, and tumor necrosis factor-α (TNF-α). Cytokine expression of MG-63 cells upon lipopolysaccharide treatment was used as controls. RT-PCR results were normalized by the expression of the housekeeping gene β-actin and were used to measure cytokine expression. Statistical analysis was performed using analysis of variance. Results showed that ERRM putty and MTA exhibited minimal levels of cytotoxicity; however, ERRM was slightly more cytotoxic although not statistically significant. The expression of IL-1β, IL-6, and IL-8 was detected in all samples with minimal TNF-α expression. We concluded that ERRM and MTA showed similar cytotoxicity and cytokine expressions. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  4. Identification of duck plague virus by polymerase chain reaction

    Science.gov (United States)

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  5. Molecular mechanisms of superoxide production by the mitochondrial respiratory chain

    NARCIS (Netherlands)

    Drose, S.; Brandt, U.

    2012-01-01

    The mitochondrial respiratory chain is a major source of reactive oxygen species (ROS) in eukaryotic cells. Mitochondrial ROS production associated with a dysfunction of respiratory chain complexes has been implicated in a number of degenerative diseases and biological aging. Recent findings suggest

  6. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Science.gov (United States)

    Liang, Gaofeng; Ma, Chao; Zhu, Yanliang; Li, Shuchun; Shao, Youhua; Wang, Yong; Xiao, Zhongdang

    2011-12-01

    Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA). The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  7. Value Chain Structures that Define European Cellulosic Ethanol Production

    DEFF Research Database (Denmark)

    Gregg, Jay Sterling; Bolwig, Simon; Hansen, Teis

    2017-01-01

    production plants across Europe from a global value chain (GVC) perspective. We find that most CE production plants in the EU focus largely on intellectual property and are therefore only at the pilot or demonstration scale. Crescentino, the largest CE production facility in Europe, is also more interested...... petroleum markets and higher financial risks. We argue that, to increase CE production, policies should consider value chains, promote the wider bio-economy of products and focus on economies of scope. Whereas the EU and its member states have ethanol quotas and blending targets, a more effective policy...

  8. Comparison of analytic methods for quantitative real-time polymerase chain reaction data.

    Science.gov (United States)

    Chen, Ping; Huang, Xuelin

    2015-11-01

    Polymerase chain reaction (PCR) is a laboratory procedure to amplify and simultaneously quantify targeted DNA molecules, and then detect the product of the reaction at the end of all the amplification cycles. A more modern technique, real-time PCR, also known as quantitative PCR (qPCR), detects the product after each cycle of the progressing reaction by applying a specific fluorescence technique. The quantitative methods currently used to analyze qPCR data result in varying levels of estimation quality. This study compares the accuracy and precision of the estimation achieved by eight different models when applied to the same qPCR dataset. Also, the study evaluates a newly introduced data preprocessing approach, the taking-the-difference approach, and compares it to the currently used approach of subtracting the background fluorescence. The taking-the-difference method subtracts the fluorescence in the former cycle from that in the latter cycle to avoid estimating the background fluorescence. The results obtained from the eight models show that taking-the-difference is a better way to preprocess qPCR data compared to the original approach because of a reduction in the background estimation error. The results also show that weighted models are better than non-weighted models, and that the precision of the estimation achieved by the mixed models is slightly better than that achieved by the linear regression models.

  9. Use of Polymerase Chain Reaction To Detect the Take-All Fungus, Gaeumannomyces graminis, in Infected Wheat Plants.

    Science.gov (United States)

    Schesser, K; Luder, A; Henson, J M

    1991-02-01

    Gaeumannomyces graminis, the causative agent of take-all disease of wheat, barley, and oats, was detected in infected wheat seedlings by using the polymerase chain reaction to amplify Gaeumannomyces-specific DNA fragments. Nested primers and two rounds of amplification were used to amplify two fragments, approximately 287 and 188 bp in size, from G. graminis-infected wheat seedlings. The use of nested primers greatly decreased the number of nonspecific amplification products. Polymerase chain reaction products were not obtained with DNA from seedlings infected with several other phytopathogenic fungi or with DNA from uninfected seedlings. Amplified products were visualized on agarose gels, and their identities were confirmed by DNA hybridization. This method did not require culturing the fungus and has potential for detecting G. graminis in infested wheat, barley, or oat fields.

  10. Particle production in antiproton induced nuclear reactions

    CERN Document Server

    Feng, Zhao-Qing

    2014-01-01

    The quantum molecular dynamics model has been improved to investigate the reaction dynamics induced by antiprotons. The reaction channels of elastic scattering, annihilation, charge exchange and inelastic collisions have been included in the model. Dynamics on particle production, in particular pions, kaons, antikaons and hyperons, is investigated in collisions of $\\overline{p}$ on $^{12}$C, $^{20}$Ne, $^{40}$Ca, $^{112}$Sn, $^{181}$Ta, $^{197}$Au and $^{238}$U from a low to high incident momentum. The rapidity and momentum distributions of $\\pi^{+}$ and protons from the LEAR measurements can be well reproduced. The impacts of system size and incident momentum on particle emissions are investigated from the inclusive spectra, transverse momentum and rapidity distributions. It is found that the annihilations of $\\overline{p}$ on nucleons are of importance on the particle production. Hyperons are mainly produced via meson induced reactions on nucleons and strangeness exchange collisions when the incident moment...

  11. Effective sourcing strategies for perishable product supply chains

    NARCIS (Netherlands)

    Rijpkema, W.A.; Rossi, R.; Vorst, van der J.G.A.J.

    2014-01-01

    Purpose – The purpose of this paper is to assess whether an existing sourcing strategy can effectively supply products of appropriate quality with acceptable levels of product waste if applied to an international perishable product supply chain. The authors also analyse whether the effectiveness of

  12. Challenges for bio-based products in sustainable value chains

    NARCIS (Netherlands)

    Cardon, L.; Lin, J.W.; De Groote, M.; Ragaert, K.; Kopecka, J.A.; Koster, R.P.

    2011-01-01

    This work concerns studies related to strategic development of products in which bio-based plastics are or will be applied, referred to as bio-based products. The studies cover (1) current and potential benefits of bio-based products in extended value chains including activities after end-of-life of

  13. Challenges for bio-based products in sustainable value chains

    NARCIS (Netherlands)

    Cardon, L.; Lin, J.W.; De Groote, M.; Ragaert, K.; Kopecka, J.A.; Koster, R.P.

    2011-01-01

    This work concerns studies related to strategic development of products in which bio-based plastics are or will be applied, referred to as bio-based products. The studies cover (1) current and potential benefits of bio-based products in extended value chains including activities after end-of-life of

  14. Effective sourcing strategies for perishable product supply chains

    NARCIS (Netherlands)

    Rijpkema, W.A.; Rossi, R.; Vorst, van der J.G.A.J.

    2014-01-01

    Purpose – The purpose of this paper is to assess whether an existing sourcing strategy can effectively supply products of appropriate quality with acceptable levels of product waste if applied to an international perishable product supply chain. The authors also analyse whether the effectiveness of

  15. Reconfiguring The Supply Chain For Complex Engineered Products

    DEFF Research Database (Denmark)

    Wæhrens, Brian Vejrum; Asmussen, Jesper Normann

    2016-01-01

    Supply chains are faced by increasingly challenging requirements, exemplified by shorter time to market, cost pressure, increased variance and quality requirements This poses a number of challenges to the overall demand for SC management to ensure a systematic fit between the configuration...... of the SC, the product and market requirements. This paper seeks to investigate the factors which create a need for supply chain reconfiguration in the context of the Complex Product Systems, together with the enablers and barriers for successfully realizing supply chain improvements through reconfiguration....

  16. A study of Hodgkin/Reed-Sternberg cells using single cell polymerase chain reaction.

    Science.gov (United States)

    Deng, F; Liao, L; Lü, G; Li, G; Yang, G

    2000-01-01

    To investigate the characteristics of Hodgkin/Reed-Stemberg (H/R-S) cells found in patients with various types of Hodgkin's disease (HD). H/R-S cells were micropicked from frozen sections of tissues affected by HD. The DNA from these cells was amplified by polymerase chain reaction (PCR) using immunoglobulin heavy chain gene FR III a/JH primers and light chain gene family-specific primers. A total of 52/135 (35.8%) isolated cells showed the specific products in the reactions. IgH and V kappa 4 rearrangements were repeatedly found in many cells from a lymphocyte predominance type sample; repeated V kappa 4 and individual IgH/V kappa 2,4 rearrangements and individual IgH, V lambda 3/ V kappa 4 rearrangements were found in two different cases of the nodular sclerosis type; repeated IgH/ V lambda 3 and individual V lambda 2,4 rearrangements, repeated V kappa 2,4 rearrangements, repeated V kappa 4 and individual IgH/ V kappa 3 rearrangements, repeated IgH and individual V kappa 3/ V lambda 4 rearrangements were detected in 3 cases of the mixed cellularity type. Repeated and individual IgH rearrangements were found in other 2 cases. The H/R-S cells isolated from the lymphocyte predominance subtypes of HD have IgH and V lambda 4 gene rearrangements. This suggests that the lymphocyte predominance type is a proliferation of neoplastic B cells. The cells isolated from the mixed cellularity and nodular sclerosis types derive from B lineage cells at various stages of differentiation because of the presence of their IgH, kappa and/or lambda gene rearrangements. To our knowledge, this is the first time that the lambda gene rearrangement was detected in H/R-S cells.

  17. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    Energy Technology Data Exchange (ETDEWEB)

    Garrison, W.M.

    1983-11-01

    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the ..cap alpha..,..cap alpha..'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included.

  18. Environmental innovations in the product chain

    DEFF Research Database (Denmark)

    Remmen, Arne; Holgaard, Jette Egelund

    2004-01-01

    The article gives an overview of different positions within innovation and network theory, and highlights how enterprises within the organic dairy industry and fish processing industry have made environmental innovations related to their processes and products.......The article gives an overview of different positions within innovation and network theory, and highlights how enterprises within the organic dairy industry and fish processing industry have made environmental innovations related to their processes and products....

  19. Stereoselective synthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-ulose via autoxidation reaction

    Institute of Scientific and Technical Information of China (English)

    LIU Hong-Min; ZHANG Fuyi; TAO Jing-Chao

    2004-01-01

    Many different approaches for synthesis of branched chain sugars have beenestablished,1 because they are very useful intermediates for synthesis of other non-sugar chiralmolecules, and usually occur in nature. Branched chain glycosidulose can be used for construction offive- and six-membered carbocyclic rings to which two chiral carbons of sugar are incorporated byintramolecular aldol condensation and Robinson annulation,2 Therefore they are useful in thesynthesis of natural products which consist of annulated carbohydrates or where a highlyfunctionalised enantiomerically pure cyclopentane or cyclohexane is required. Also, this type ofbranched chain sugar can be considered as the synthons of monoterpenoid natural products of theiridoid class which have the cyclopentan-(c)-pyran structure. In view of the importance of branchedchain glycosiduloses, it is desirable to have a general, convenient methodology to their synthesis.However, none of the literature methods was reported on their synthesis by a nuclephilic addition toa partially protected glycosidulose, due to the fact that these glycosiduloses are very difficult tosynthesize selectively and unstable;3 and what is more, one-step synthesis branched chainglycosidulose using this method is almost impossible.In this paper, we report on a general, convenient method for stereoselective syntheses of2,2-bis(C-branched-chain)glucopyranosid-3-uloses by the new reaction of 1 with various activemethylene compounds. The generality of this method was examined in detail. The optimumtemperature was 18-25℃. The solvent DMF was better than the others. In all cases he yields werehigher than 60%.All the 2,2-bis(C-branched-chain)glucopyranosid-3-uloses were characterized by X-raycrystallographic analyses. In addition, the important iintermediate in this reaction was isolated,which is the product of autoxidation of 1 at C-3 position. Thus the reaction mechanism for thesynthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-uloses

  20. 76 FR 41525 - Hewlett Packard Global Parts Supply Chain, Global Product Life Cycles Management Unit Including...

    Science.gov (United States)

    2011-07-14

    ... Employment and Training Administration Hewlett Packard Global Parts Supply Chain, Global Product Life Cycles... Chain, Global Product Life Cycles Management Unit, including teleworkers reporting to Houston, Texas... Parts Supply Chain, Global Product Life Cycles Management Unit, including teleworkers reporting to...

  1. Chains, necklaces and weaving chain-link grids from self-assembly reactions.

    Science.gov (United States)

    Alvariño, Cristina; Simond, Damien; Lorente, Pau Moneva; Besnard, Céline; Williams, Alan F

    2015-06-08

    Assembly of two ditopic units, a phenanthroline substituted by 4-ethynyl pyridines at the 2-and 9-positions and a dimetallic paddlewheel, gives a linear chain polymer rather than a closed cyclic species, which would appear equally possible. The chain may be decorated by binding a copper-containing macrocycle around the phenanthroline units to form a polypseudorotaxane. When two phenanthroline ligands are assembled in a first step around copper(I), the paddlewheel acceptor can link them in a second step to form a two-dimensional interwoven grid that resembles the form of a chain-link fence. Each copper(I) centre in this structure is chiral, and the crystal shows complete homochirality, implying selection during the assembly process.

  2. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    Science.gov (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR.

  3. Product and supply chain design using a taboo search

    OpenAIRE

    El Hadj Khalaf, Radwan; Agard, Bruno; Penz, Bernard

    2009-01-01

    International audience; An assemble to order policy considers a tradoff between the size of product portfolio and assembly lead time. The concept of modular design is often used to implement the assemble to order policy. Modular design impacts assembly of products and the supply chain. In particular storage, transportation and production are affected by the selected modular structure. For a determined assembly lead time, a module composition that minimizes assembly and production costs is dif...

  4. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  5. Treponema pallidum and Haemophilus ducreyi DNA detection by A Multi-Nested Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    郑和平; SylviaBruisten; 何玉山; 黄进梅; 吴兴中

    2004-01-01

    Objectives: To develop a multi-nested polymerase chain reaction in an assay to detect early Treponema pallidum and Haemophilus ducreyi DNA in the swabs of genital ulcers. Methods: Four pairs of outer and inner primers, specific to the basic membrane protein gene of Treponema pallidum and to the 16s rRNA gene of H ducreyi were synthesized. The multi-nested PCR was developed and applied to detect Treponema pallidum and Haemophilus dicreyi in clinical swabs. Result: The two samples of standard strains of Haemophilus ducreyi and one Treponema pallidum were amplified and showed 309-bp rRNA gene of Haemophilus ducreyi and 506-bp DNA of Treponema palidum, respectively. Out of 51 samples of genital ulcer detected, 29 showed Treponemapallidum positive product and noHaemophilus ducreyi DNA was found. Conclusion: The multi-nested PCR for Treponema pallidum and Haemophilus ducreyi could be useful for early detection and distinguishing diagnosis between syphilis and chancroid.

  6. Gene analysis of multiple oral bacteria by the polymerase chain reaction coupled with capillary polymer electrophoresis.

    Science.gov (United States)

    Liu, Chenchen; Yamaguchi, Yoshinori; Sekine, Shinichi; Ni, Yi; Li, Zhenqing; Zhu, Xifang; Dou, Xiaoming

    2016-03-01

    Capillary polymer electrophoresis is identified as a promising technology for the analysis of DNA from bacteria, virus and cell samples. In this paper, we propose an innovative capillary polymer electrophoresis protocol for the quantification of polymerase chain reaction products. The internal standard method was modified and applied to capillary polymer electrophoresis. The precision of our modified internal standard protocol was evaluated by measuring the relative standard deviation of intermediate capillary polymer electrophoresis experiments. Results showed that the relative standard deviation was reduced from 12.4-15.1 to 0.6-2.3%. Linear regression tests were also implemented to validate our protocol. The modified internal standard method showed good linearity and robust properties. Finally, the ease of our method was illustrated by analyzing a real clinical oral sample using a one-run capillary polymer electrophoresis experiment.

  7. Polymerase Chain Reaction Identification of a Hymenopteran Insect in the Cornea: a Case Report

    Directory of Open Access Journals (Sweden)

    Hsien-Chung Lin

    2006-03-01

    Full Text Available The type of corneal injuries associated with insect encounters is related to the composition of the foreign body. However, previous reports on corneal foreign bodies as insects were rarely based on scientific evidence. Here, we report on a 49-year-old male who was stung in his left eye by an unknown insect. Emergent keratotomy was performed to remove the embedded corneal foreign body. The removed foreign body was observed under light microscopy, and a fragment of insect was suspected. The sample was sent for molecular analysis. The polymerase chain reaction product was sequenced, subjected to a BLAST search, and identified as an ichneumonoid member of the insect order Hymenoptera.

  8. Quantitative Analysis of Periodontal Pathogens Using Real-Time Polymerase Chain Reaction (PCR).

    Science.gov (United States)

    Marin, Mª José; Figuero, Elena; Herrera, David; Sanz, Mariano

    2017-01-01

    The quantitative polymerase chain reaction (qPCR) is a variant of PCR aimed to detect and quantify a targeted DNA molecule through the addition of probes labeled with fluorescent molecules that emit fluorescence within each amplification cycle, what results in fluorescence values proportional to the amount of accumulated PCR product. This chapter presents the detailed procedures for quantification of different periodontal pathogens (Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Tannerella forsythia, Campylobacter rectus, and Fusobacterium spp.) using qPCR. It also includes the description of the most frequent problems encountered and how to solve them. In addition, a detailed protocol for multiplex qPCR to detect and quantify P. gingivalis and A. actinomycetemcomitans is included.

  9. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    1994-01-01

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  10. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  11. A new polymerase chain reaction (PCR) assay for the trinucleotide repeat that is unstable and expanded on Huntington's disease chromosomes.

    Science.gov (United States)

    Warner, J P; Barron, L H; Brock, D J

    1993-06-01

    The Huntington's Disease (HD) Collaborative Research Group has recently published the sequence of a new cDNA, IT15, containing a polymorphic trinucleotide (CAG)n repeat that is expanded and unstable on HD chromosomes. There is a correlation between the repeat size and the age of onset of symptoms. The suggested polymerase chain reaction (PCR) assay of the (CAG)n repeat requires unusual reaction components and primer concentrations and the use of 5% polyacrylamide sequencing gels to resolve the amplification products. We present a simple PCR assay that produces a smaller product using standard reaction conditions. This gives better resolution of the (CAG)n expansion observed on HD chromosomes by acrylamide gel electrophoresis and allows sufficient product to be obtained to perform assays using agarose gels. This will allow diagnostic labs to do rapid and accurate presymptomatic testing of HD in high risk families.

  12. Economic modelling of pork production-marketing chains.

    NARCIS (Netherlands)

    den Ouden, M.

    1996-01-01

    The research described in this thesis was focused on the development of economic simulation and optimization computer models to support decision making with respect to pork production- marketing chains. The models include three production stages: pig farrowing, pig fattening and pig slaughtering inc

  13. Economic optimization of surveillance in livestock production chains

    NARCIS (Netherlands)

    Guo, X.

    2015-01-01

    Abstract Hazard surveillance in livestock production chains is an essential activity that is usually conducted by surveillance organizations. Its importance has been highlighted by the major crises that occurred in the field of livestock production and food safety during the last

  14. Economic optimization of surveillance in livestock production chains

    NARCIS (Netherlands)

    Guo, X.

    2015-01-01

    Abstract Hazard surveillance in livestock production chains is an essential activity that is usually conducted by surveillance organizations. Its importance has been highlighted by the major crises that occurred in the field of livestock production and food safety during the last d

  15. Economic modelling of pork production-marketing chains

    NARCIS (Netherlands)

    Ouden, den M.

    1996-01-01

    The research described in this thesis was focused on the development of economic simulation and optimization computer models to support decision making with respect to pork production- marketing chains. The models include three production stages: pig farrowing, pig fattening and pig slaughtering

  16. Traceability: a demand of agro industrial chain for special products

    Directory of Open Access Journals (Sweden)

    José Verissimo Foggiatto Silveira

    2007-10-01

    Full Text Available The inclusion of agricultural products with different nutritional features has altered the relationship, the upstream and the downstream of enterprises that produce and commercialize them. Coordination in the Agro Industrial System is demanded, including traceability as a way to guarantee the conformity of products, attending external clients and agricultural industries that require quality certification. This quality tool enables the identification of some details in the productive chain, such as seeds, farming, harvesting, storage, transportation and industrialization of products. Thus, this essay describes the concept of traceability and provides information of special products from a cooperative from Paraná, which has controlled process in the productive chain, demanded by contractual partnerships done with enterprises that provide fertilizers and food processors. It was identified that this cooperative commercializes three products that need traceability: two special kinds of corn and the regular kind of soybean.

  17. The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

    Energy Technology Data Exchange (ETDEWEB)

    Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

    2013-06-28

    Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures that typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.

  18. Applying the means-end chain concept to product development

    DEFF Research Database (Denmark)

    Søndergaard, Helle Alsted

    This paper proposes that the means-end chain (MEC) approach can influence the use of market information and inter-functional communication in new product development (NPD). The central question is whether market information represented by means-end chain data can be a vehicle for inter......-functional communication. This paper describes a PhD project - that through case studies and action research in two companies - aims at investigating the effects on communication and attitudes to communication by those involved when introducing means-end chain data as market information in NPD....

  19. Environmental innovations in the product chain

    DEFF Research Database (Denmark)

    Remmen, Arne; Holgaard, Jette Egelund

    2003-01-01

    The paper gives a brief overview of different positions within innovation and network theory, and on that basis a framework is developed and discussed in relation to environmental innovations.The paper also highlights how enterprises within two different trades in the Danish food industry have ma...... environmental innovations related to their processes and products.......The paper gives a brief overview of different positions within innovation and network theory, and on that basis a framework is developed and discussed in relation to environmental innovations.The paper also highlights how enterprises within two different trades in the Danish food industry have made...

  20. Accuracy of the serological ELISA test compared with the polymerase chain reaction for the diagnosis of cytomegalovirus infection in pregnancy

    Directory of Open Access Journals (Sweden)

    Silvana Varella Parmigiani

    Full Text Available CONTEXT: The most frequently used methods for detecting antibodies are the indirect immunofluorescence test and the enzymatic immunoassay (ELISA. The polymerase chain reaction is a molecular biology technique in which the production of large amounts of specific DNA fragments is induced from very low concentrations of complex substrates aloowing the detection of very low amounts of viral particles. OBJECTIVE: To assess the accuracy of serological/ELISA tests in comparison with the polymerase chain reaction in maternal blood to diagnose cytomegalovirus infection. DESIGN: A descriptive study was performed. SETTING: High-risk outpatient clinic of Campinas University (Unicamp. PARTICIPANTS: We selected 243 pregnant women. All of them had been indicated for blood sampling because of suspicions of cytomegalovirus infection and also because of other infections. MAIN MEASUREMENTS: The group was tested for cytomegalovirus. Serological tests were run and compared to the polymerase chain reaction, which was considered to be the gold standard. Status analyses were done using Fisher's exact test, via the SAS software. RESULTS: The previous cytomegalovirus infection rate was 94.6%. The main reasons for inclusion in the study were fetal nervous system malformation (25.5%, maternal toxoplasmosis (25.5% and Rh isoimmunization (14.8%. Only two women were included because of positive serological immunoglobulin M test for cytomegalovirus. The sensitivity and specificity of the serological tests were 94% and 6% for immunoglobulin G. CONCLUSION: Serological tests had lower sensitivity in comparison with the polymerase chain reaction test when diagnosing cytomegalovirus infection. The consequences of positive polymerase chain reaction and negative immunoglobulin M in women remain unknown.

  1. Laser-Initiated Free Radical Chain Reactions: Synthesis Of Hydroperoxides

    Science.gov (United States)

    Bray, R. G.; Chou, M. S.

    1984-05-01

    We have investigated the advantages of using laser-initiation for the synthesis of cumenehydroperoxide and t-butylhydroperoxide. Laser-initiation significantly improves the oxidation rates of cumene in the liquid phase and iso-butane in the vapor phase (using HBr promoters) with moderate photoefficiencies (418 and 490 respectively). The primary effect of laser-initiation is to reduce the induction period of the reaction. For the oxidation of cumene the beneficial effect of laser initiation is strongly dependent on laser wavelength, alternately enhancing (at 351 nm) or inhibiting (at 249 nm) the oxidation rate. For isobutane oxidation, laser-initiation also minimizes the HBr depletion rate relative to oxidation rate.

  2. Influence of transesterification reaction temperature on biodiesel production

    Energy Technology Data Exchange (ETDEWEB)

    Pighinelli, Anna Leticia Montenegro Turtelli; Zorzeto, Thais Queiroz; Park, Kil Jin [Universidade Estadual de Campinas (FEAGRI/UNICAMP), SP (Brazil). Fac. de Engenharia Agricola], E-mail: annalets@agr.unicamp.br; Bevilaqua, Gabriela [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Quimica

    2008-07-01

    Brazilian government policy has authorized the introduction of biodiesel into the national energy matrix, law no.11.097 of January 13th, 2005. It is necessary, like any new product, to invest in research which is able to cover its entire production chain (planting of oilseeds, vegetable oils extraction and chemical reactions), providing data and relevant information in order to optimize the process and solve critical issues. The objective of this work was to study the effects of temperature on crude sunflower transesterification reaction with ethanol. A central composite experimental design with five variation levels (25 deg, 32 deg, 47.5 deg, 64 deg and 70 deg C) was used and response surface methodology applied for the data analysis. The statistical analysis of the results showed that the production suffered the influence of temperature (linear and quadratic effects) and reaction time (linear and quadratic). The generated models did not show significant regression. The model generated was not well suited to the experimental data and the value of the coefficient of determination (R{sup 2}=0.52) was low. Consequently it was not possible to build the response surface. (author)

  3. Significance of salmonella in pork production chain

    Directory of Open Access Journals (Sweden)

    Karabasil Neđeljko

    2008-01-01

    Full Text Available Animals, feed, meat and meat products are often transported across long distances, being an important part of international trade, which enables a dissemination of salmonella, including even of some resistant strains. Pigs are animals which are difficult to manipulate because of their temperament, build, sharp teeth, irritability, good sense of smell, bad sight and their sensitivity to stress. Animals coming from different farms should be separated in stock yards to prevent both contamination with pathogens such as salmonella and their irritation and aggressiveness caused by contacts with other pigs. These animals are usually a significant reservoir of salmonella which are 'inside' the gastrointestinal tract and gut associated lymph tissue. In contrast to our country, in the EU, even countries which have always had low salmonella prevalence, e.g. Finland, have a control program. The program has to be based on a guarantee that all relevant factors will participate in the prevention of salmonella contamination.

  4. Detection of human papillomaviruses by polymerase chain reaction and ligation reaction on universal microarray.

    Directory of Open Access Journals (Sweden)

    Jarmo Ritari

    Full Text Available Sensitive and specific detection of human papillomaviruses (HPV in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93% gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.

  5. Detection of human papillomaviruses by polymerase chain reaction and ligation reaction on universal microarray.

    Science.gov (United States)

    Ritari, Jarmo; Hultman, Jenni; Fingerroos, Rita; Tarkkanen, Jussi; Pullat, Janne; Paulin, Lars; Kivi, Niina; Auvinen, Petri; Auvinen, Eeva

    2012-01-01

    Sensitive and specific detection of human papillomaviruses (HPV) in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear) as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93%) gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.

  6. Highly Sensitive and Reliable Detection of EGFR Exon 19 Deletions by Droplet Digital Polymerase Chain Reaction.

    Science.gov (United States)

    Oskina, Natalya; Oscorbin, Igor; Khrapov, Evgeniy; Boyarskikh, Ulyana; Subbotin, Dmitriy; Demidova, Irina; Imyanitov, Evgeny; Filipenko, Maxim

    2017-06-06

    Analysis of EGFR mutations is becoming a routine clinical practice but the optimal EGFR mutation testing method is still to be determined. We determined the nucleotide sequence of deletions located in exon 19 of the EGFR gene in lung tumor samples of patients residing in different regions of Russia (153 tumor DNA specimens), using Sanger sequencing. We developed a droplet digital polymerase chain reaction assay capable of detecting all common EGFR deletions in exon 19. We also compared the therascreen amplification refractory mutation system assay with a droplet digital polymerase chain reaction assay for the detection of all the deletions in our study. The droplet digital polymerase chain reaction assay demonstrated 100% sensitivity against polymerase chain reaction fragment length analysis and detected all possible types of deletions revealed in our study (22 types). At the same time, the therascreen EGFR RGQ PCR Kit was not able to detect deletions c.2252-2276>A and c.2253-2276 and showed low performance for another long deletion. Thus, we can conclude that the extraordinary length of deletions and their atypical locations (shift at the 3'-region compared to known deletions) could be problematic for the therascreen EGFR RGQ PCR Kit and should be taken into account during targeted mutation test development. However, droplet digital polymerase chain reaction is a promising and reliable assay that can be used as a diagnostic tool to genotype formalin-fixed paraffin-embedded cancer samples for EGFR or another clinically relevant somatic mutation.

  7. Pattern on Total Productive Maintenance in Supply Chain

    Institute of Scientific and Technical Information of China (English)

    汪蓉; 黄培; 季建华

    2003-01-01

    Defined as total productive maintenance carried out by all cooperators in Supply Chain, Total Operational Maintenance (TOM) focuses on adapting to collaborative business environment in virtue of Internet & Intranet. It focuses on the managerial ideology of embedded with Quick Response (QR),Total Productive Maintenance (TPM) and Supply Chain. And the theoretical architecture and implementation is also described. It offers emphatically that it is necessary to exceed competitive advantage of the enterprises by optimizing reliability, empowerment and Overall Facilities Effectiveness (OFE) applying TOM together into the strategic improvement plan.

  8. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    Science.gov (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  9. Improved polymerase chain reaction conditions for quick diagnostics of Huntington disease.

    Science.gov (United States)

    Culjković, B; Ruzdijić, S; Rakić, L; Romac, S

    1997-12-01

    Huntington disease (HD) belongs to a growing list of neurodegenerative disorders (fragile X syndrome [6], myotonic dystrophy [1], spino-bulbar muscular atrophy [2] etc.) characterized by unstable expanded trinucleotide repeats (so-called 'dynamic mutations'). The dynamic mutation causing HD represents the expansion of CAG triplets in the first exon of a gene IT15 (chromosome 4) coding for huntington. This trinucleotide stretch is varying in the range of 11-34 in normal chromosomes and 39-121 in HD chromosomes. The most direct diagnostic approach is to amplify the proximal region of IT15 gene (from patients genomic DNA) by polymerase chain reaction (PCR) and estimate the number of CAG triplets. All protocols published to date are difficult to reproduce because amplification is inefficient giving additional non-specific products. The strategy of our experiment is shown in Fig. 1. We designed one new primer, primer No. 2 (another primer was primer No. 1) and novel PCR conditions. Primer No. 2 is located closer to CAG triplets and its extension is not including the GC rich region. PCR amplified products, using primer Nos. 1 and 2, thus do not include the GC rich region and, therefore, are much more efficiently amplified (compared to the products of amplification with primer Nos. 1 and 3).

  10. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2007-01-23

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  11. Molecular probes and the polymerase chain reaction for detection and typing of Leishmania species in Mexico.

    Science.gov (United States)

    Monroy-Ostria, Amalia; Sanchez-Tejeda, Gustavo

    2002-04-01

    Leishmaniasis in Mexico is a public health problem because all the clinical forms have been recorded in most Mexican states. We studied patients showing clinical symptoms of any form of leishmaniasis, from several endemic areas. Bone marrow samples, aspirates or skin biopsies were taken and deoxyribonucleic acid (DNA) was extracted and amplified by the polymerase chain reaction (PCR) with universal primers AJS1 and DeB8, specific for the Leishmania subgenus Leishmania. The PCR products were then hybridized by dot- or Southern blotting and probed with probe 9.2, specific for the L. mexicana complex. If hybridization did not occur, the DNA was amplified with primers D1 and D2, specific for members of the L. donovani complex, and PCR products were hybridized with probe B4Rsa, also specific for the L. donovani complex. DNA was also amplified with primers B1 and B2, specific for the subgenus Viannia, and the PCR products were hybridized with probe B18, specific for the L. braziliensis complex. It was found that in Tabasco and Veracruz, Mexico, localized cutaneous leishmaniasis (LCL) is caused by infection with members of the L. mexicana complex, whereas in the states of Nayarit and Campeche it was due to infection with the L. mexicana and/or L. braziliensis complexes. Visceral leishmaniasis was caused by L. (L.) chagasi, mainly in the states of Chiapas and Guerrero, and by L. (L.) mexicana in one immunocompromised patient from Tabasco.

  12. DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

    Energy Technology Data Exchange (ETDEWEB)

    East, L.V.

    1994-05-01

    A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms.

  13. The skew product Markov chain%Markov-双链

    Institute of Scientific and Technical Information of China (English)

    张王月; 张金洪; 邹健

    2001-01-01

    就随机环境下的 Markov-链,介绍了 Markov-双链的构造,并证明了以已给 P(θ )为转移概率的 Markov-双链的存在性 .当环境空间和状态空间均可数时,希望通过对 Markov-双链的研究,进而实现对随机环境下的 Markov-链的研究 .%The process of the construction of the skew product Markov Chain on the basic of the Markov Chain in random environments is introduced and the existence of the skew product Markov Chain is proven, taking the given P(θ ) as the transition probability. The Markov Chain in random environments by studying the skew product Markov chain , can be studied when the environment space and the state space are countable.

  14. Specific primer design for the polymerase chain reaction.

    Science.gov (United States)

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2013-10-01

    The design of primers has a major impact on the success of PCR in relation to the specificity and yield of the amplified product. Here, we introduce the applications of PCR as well as the definition and characteristics for PCR primer design. Recent primer design tools based on Primer3, along with several computational intelligence-based primer design methods which have been applied in primer design, are also reviewed. In addition, characteristics of population-based methods used in primer design are discussed in detail.

  15. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction

    Science.gov (United States)

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant

    2004-09-01

    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  16. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Cobbs Gary

    2012-08-01

    Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the

  17. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao

    2005-01-01

    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.

  18. Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism

    Directory of Open Access Journals (Sweden)

    Gildo Almeida da Silva

    Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.

  19. Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction.

    Science.gov (United States)

    Chen, Ruey-Shyang; Tsay, Jwu-Guh; Huang, Yu-Fen; Chiou, Robin Y Y

    2002-05-01

    The Aspergillus flavus group covers species of A. flavus and Aspergillus parasiticus as aflatoxin producers and Aspergillus oryzae and Aspergillus sojae as koji molds. Genetic similarity among these species is high, and aflatoxin production of a culture may be affected by cultivation conditions and substrate composition. Therefore, a polymerase chain reaction (PCR)-mediated method of detecting the aflatoxin-synthesizing genes to indicate the degree of risk a genotype has of being a phenotypic producer was demonstrated. In this study, 19 strains of the A. flavus group, including A. flavus, A. parasiticus, A. oryzae, A. sojae, and one Aspergillus niger, were subjected to PCR testing in an attempt to detect four genes, encoding for norsolorinic acid reductase (nor-1), versicolorin A dehydrogenase (ver-1), sterigmatocystin O-methyltransferase (omt-1), and a regulatory protein (apa-2), involved in aflatoxin biosynthesis. Concurrently, the strains were cultivated in yeast-malt (YM) broth for aflatoxin detection. Fifteen strains were shown to possess the four target DNA fragments. With regard to aflatoxigenicity, all seven aflatoxigenic strains possessed the four DNA fragments, and five strains bearing less than the four DNA fragments did not produce aflatoxin. When peanut kernels were artificially contaminated with A. parasiticus and A. niger for 7 days, the contaminant DNA was extractable from a piece of cotyledon (ca. 100 mg), and when subjected to multiplex PCR testing using the four pairs of primers coding for the above genes, they were successfully detected. The target DNA fragments were detected in the kernels infected with A. parasiticus, and none was detected in the sound (uninoculated) kernels or in the kernels infected with A. niger.

  20. Modes of environmental management in transnational product chains

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard; Jørgensen, Ulrik; Hendriksen, Kåre

    2007-01-01

    opportunities by being present in the country where the sourcing takes place. The paper discusses different modes of environmental management in such transnational product chains based on a number of cases, and explores the links to the business strategy of the companies and national and international......Many companies in industrialised countries are outsourcing production or sourcing materials and products in countries with lower environmental protection than the companies’ countries of origin. The background is access to special materials and/or lower costs, but some times also the market...... regulation and standards. The roles of the involved nation states are often limited. In some cases international regulatory initiatives may shape the environmental management in product chains. The interpretative elements in ISO 14001 imply that some companies are sceptical about this kind of management...

  1. Identifying Sustainability Issues for Soymeal and Beef Production Chains

    NARCIS (Netherlands)

    Pashaei Kamali, F.; Meuwissen, M.P.M.; Boer, de I.J.M.; Stolz, H.; Jahrl, I.; Garibay, S.V.; Jacobsen, R.; Driesen, T.; Oude Lansink, A.G.J.M.

    2014-01-01

    The expansion of livestock production throughout the world has led to increased demand for high protein animal feed. This expansion has created economic benefits for livestock farmers and other actors in the chain, but also resulted in environmental and social side effects. This study aims to identi

  2. The Milk and Milk Products Value Chain in Ethiopia

    NARCIS (Netherlands)

    S. Drost (Sarah); J.C.A.C. van Wijk (Jeroen)

    2011-01-01

    textabstractThis report investigates the dynamics of a multi-stakeholder platform (named: Coordination Group, or CG) for stakeholders of the milk and milk products value chains in Ethiopia. The CG was initiated by the Dutch development organisation SNV in 2005 as part of a broader programme to

  3. In Chains? Automotive Suppliers and Their Product Development Activities

    NARCIS (Netherlands)

    F. von Corswant; J.Y.F. Wynstra (Finn); M. Wetzels (Alex)

    2003-01-01

    textabstractA conceptual framework is developed and tested in which supplier downstream position in the supply chain, supplier innovation strategy and customer development commitment are seen as the antecedents of supplier product development activity. Using partial least squares (PLS), we analyze t

  4. MRSA CC398 in the pig production chain

    NARCIS (Netherlands)

    Broens, E.M.; Graat, E.A.M.; Wolf, van der P.J.; Giessen, van de A.W.; Duijkeren, van E.; Wagenaar, J.A.; Nes, van A.; Mevius, D.J.; Jong, de M.C.M.

    2011-01-01

    In 2005, a distinct clone of methicillin resistant Staphylococcus aureus (MRSA CC398) was found in pigs and people in contact with pigs. The structure of the pig production chain in high technology pig husbandry enables pathogens to spread during animal trading, with an increasing prevalence in herd

  5. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5...

  6. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Directory of Open Access Journals (Sweden)

    Figueiredo Luiz Tadeu M

    1997-01-01

    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  7. Salmonella detection in poultry meat and meat products by the Vitek immunodiagnostic assay system easy Salmonella method, a LightCycler polymerase chain reaction system, and the International Organization for Standardization method 6579.

    Science.gov (United States)

    Temelli, S; Eyigor, A; Carli, K T

    2012-03-01

    This study was conducted to evaluate the capability of the Vitek immunodiagnostic assay system easy Salmonella (VIDAS ESLM) method and a specific real-time PCR system (LightCycler, LCPCR) to complement the International Organization for Standardization Method 6579 (ISO) in detecting Salmonella from a total of 105 naturally contaminated samples comprised of poultry meat and poultry meat products. The detection limit of ISO and LCPCR was 9 cfu/mL for both poultry meat and poultry meat products, whereas that of VIDAS ESLM with both sample types was determined to be 90 cfu/mL. Twelve (33.33%), 11 (30.55%), and 18 (50.00%) out of 36 poultry meat samples were positive for Salmonella by ISO, VIDAS ESLM, and LCPCR, respectively. Salmonella detection rates from poultry meat products were 5.80% for ISO and 8.69% for LCPCR, whereas none of these products tested positive by VIDAS ESLM. In poultry meat samples, VIDAS ESLM and LCPCR detection results were in substantial agreement with ISO, with the relative accuracy, sensitivity, and specificity rates of 97.2, 91.7, and 100%, respectively, for VIDAS ESLM and 83.3, 100, and 75%, respectively, for LCPCR. This is the first report on the evaluation of both VIDAS ESLM and LCPCR to complement ISO for the rapid detection of Salmonella in poultry meat and meat products. We determined that both VIDAS ESLM and LCPCR have the potential to complement the ISO standard culture method in the rapid screening of Salmonella from naturally contaminated poultry meats. For the poultry meat products, VIDAS ESLM and LCPCR can be used for rapid primary screening, and they should be complemented absolutely by ISO. Although LCPCR can preferentially be used for initial screening poultry meat products, the results should definitely be confirmed by ISO. Also, the VIDAS ESLM did not seem to be a suitable method for detecting Salmonella in poultry meat products.

  8. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  9. Random Mutagenesis by Error-Prone Polymerase Chain Reaction Using a Heavy Water Solvent.

    Science.gov (United States)

    Minamoto, Toshifumi

    2017-01-01

    Heavy water is a form of water that contains a heavier isotope of hydrogen ((2)H, also known as deuterium, D) or oxygen ((17)O or (18)O). When using heavy water as a solvent, error-prone polymerase chain reaction (epPCR) can induce random mutations independent of the polymerase used or the composition of the PCR reaction mixture. This relatively new method can easily be combined with the existing epPCR methods to increase the rate of mutations.

  10. DETECTION OF PHENOL DEGRADING BACTERIA AND PSEUDOMONAS PUTIDA IN ACTIVATED SLUDGE BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen

    2009-04-01

    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  11. Evaluation of IgG anti-toxoplasma avidity and polymerase chain reaction in the postnatal diagnosis of congenital toxoplasmosis.

    Science.gov (United States)

    Torres, Elizabeth; Rivera, Raul; Cardona, Nestor; Sanchez, Victor; Lora, Fabiana; Gómez-Marín, Jorge Enrique

    2013-06-01

    Confirmatory tests for congenital toxoplasmosis were evaluated in 23 infected and 31 uninfected newborns. Conventional polymerase chain reaction was better than real-time polymerase chain reaction, but did not identify additional cases. Avidity tests added 2 new cases that were not identified by other criteria. Overall sensitivity was 82.6%. Avidity assay, but not polymerase chain reaction, increased the sensitivity of confirmatory assays in congenital toxoplasmosis.

  12. Wicked problems: a value chain approach from Vietnam's dairy product.

    Science.gov (United States)

    Khoi, Nguyen Viet

    2013-12-01

    In the past few years, dairy industry has become one of the fastest growing sectors in the packaged food industry of Vietnam. However, the value-added creation among different activities in the value chain of Vietnam dairy sector is distributed unequally. In the production activities, the dairy farmers gain low value-added rate due to high input cost. Whereas the processing activities, which managed by big companies, generates high profitability and Vietnamese consumers seem to have few choices due to the lack of dairy companies in the market. These wicked problems caused an unsustainable development to the dairy value chain of Vietnam. This paper, therefore, will map and analyze the value chain of the dairy industry in Vietnam. It will also assess the value created in each activity in order to imply solutions for a sustainable development of Vietnam's dairy industry. M10, M11.

  13. Value Chain Structures that Define European Cellulosic Ethanol Production

    Directory of Open Access Journals (Sweden)

    Jay Sterling Gregg

    2017-01-01

    Full Text Available Production of cellulosic ethanol (CE has not yet reached the scale envisaged by the literature and industry. This study explores CE production in Europe to improve understanding of the motivations and barriers associated with this situation. To do this, we conduct a case study-based analysis of CE production plants across Europe from a global value chain (GVC perspective. We find that most CE production plants in the EU focus largely on intellectual property and are therefore only at the pilot or demonstration scale. Crescentino, the largest CE production facility in Europe, is also more interested in technology licensing than producing ethanol. Demonstration-scale plants tend to have a larger variety of feedstocks, whereas forestry-based plants have more diversity of outputs. As scale increases, the diversity of feedstocks and outputs diminishes, and firms struggle with feedstock provisioning, global petroleum markets and higher financial risks. We argue that, to increase CE production, policies should consider value chains, promote the wider bio-economy of products and focus on economies of scope. Whereas the EU and its member states have ethanol quotas and blending targets, a more effective policy would be to seek to reduce the risks involved in financing capital projects, secure feedstock provisioning and support a diversity of end products.

  14. RAPID DETECTION OF Salmonella IN SHRIMP BY POLYMERASE CHAIN REACTION [Deteksi Cepat Salmonella pada Udang dengan Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ulfah Amalia

    2014-06-01

    Full Text Available Shrimp is an important non-oil commodity for foreign trade in Indonesia. However, rejection of shrimp exports by the importing countries is still commonly encountered. In 2011, the USFDA recorded two cases of Salmonella spp. contamination in shrimp products from two shrimp processing companies in Indonesia. Analysis of Salmonella spp. in seafood is generally performed using a conventional method which takes at least 5 days. The objective of the study is to get a Salmonellae rapid detection method in shrimp by PCR. In this study, optimization of PCR protocol method to detect Salmonella invA gene was conducted using six different annealing temperatures (59, 59.5, 60.8, 62, 64 and 64.5°C. The results showed that 64°C was the optimum annealing temperature to detect the 284 bp fragment of Salmonella invA gene. The PCR based detection method has a DNA detection limit of 27.81ug/mL and 10°CFU/mL of viable salmonellae with 100% specificity. The PCR protocol is capable of detecting six different Salmonella serovars (S. Enteritidis, S. Hadar, S. Heidelberg, S. Kentucky, S. Paratyphi and S. Typhimurium but none of the non salmonellae isolates. Application of the PCR assay on Salmonella in shrimp after the selective enrichment step suggested that all 16 samples were positive for Salmonella. At the same time, the conventional method could only detected 3 samples for Salmonella positive.

  15. Haemophilus ducreyi detection by polymerase chain reaction in oesophageal lesions of HIV patients.

    Science.gov (United States)

    Borges, M C; Colares, J K B; Lima, D M; Fonseca, B A L

    2009-04-01

    HIV patients frequently have opportunistic oesophageal infections. We report Haemophilus ducreyi genetic material detected by polymerase chain reaction in biopsies of oesophageal lesions in three HIV-1-infected patients. This finding may be an indication of its aetiopathological role in oesophageal lesions of HIV patients.

  16. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal

  17. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    Science.gov (United States)

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  18. POTATO RING ROT PATHOGEN DETECTION BY POLYMERASE CHAIN REACTION IN POTATO TUBERS

    Directory of Open Access Journals (Sweden)

    Shafikova T.N.

    2008-10-01

    Full Text Available Bacterial ring rot caused by Clavibacter michiganensis ssp. sepedonicus is a widespread disease of potato resulting in significant economic lost in agriculture and seed growing. A latent form of this infection makes difficulties for diagnostics and facilitates the quick disease propagation. Polymerase chain reaction is the best method for the disease control.

  19. Use of enrichment real time-Polymerase Chain Reaction to enumerate Salmonella on chicken parts

    Science.gov (United States)

    Salmonella that survive cooking and that cross-contaminate other food during meal preparation and serving represent primary routes of consumer exposure to this pathogen from chicken. Consequently, the present study was undertaken to use enrichment real time-polymerase chain reaction (RT-PCR) to enu...

  20. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    Science.gov (United States)

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  1. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  2. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  3. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    Science.gov (United States)

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  4. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  5. HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

    DEFF Research Database (Denmark)

    Cowland, J B; Madsen, H O; Morling, N

    1995-01-01

    A total of 280 persons were HLA-DQA1 typed by two different polymerase chain reaction (PCR) based methods; (i) a reverse dot-blot (RDB) method, which can differentiate between six alleles, and (ii) a combined PCR-restriction fragment length polymorphism (PCR-RFLP) and allele-specific amplification...

  6. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  7. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...

  8. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.;

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...

  9. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    Science.gov (United States)

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  10. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction

    NARCIS (Netherlands)

    J. Fan (Jun); W.Y. Zhang (Wen); Y.Y. Wu (Yu); X.Y. Jing (Xiou); E.C.J. Claas (Eric)

    1993-01-01

    textabstractThe aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The resul

  11. Sustaines high throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue serotype 8

    NARCIS (Netherlands)

    Rijn, van P.A.; Heutink, C.G.; Boonstra, J.; Kramps, J.A.; Gennip, van H.G.P.

    2012-01-01

    A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic

  12. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction

    NARCIS (Netherlands)

    J. Fan (Jun); W.Y. Zhang (Wen); Y.Y. Wu (Yu); X.Y. Jing (Xiou); E.C.J. Claas (Eric)

    1993-01-01

    textabstractThe aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The

  13. [Application of the polymerase chain reaction for detecting respiratory syncytial virus].

    Science.gov (United States)

    Sarmiento, L; Chacón, D; Valdivia, A; Savón, C; Goyenechea, A

    1997-01-01

    The polymerase chain reaction (PCR) was developed in order to identify the respiratory syncytial virus by using the reference strain. The high sensitivity and specificity obtained show the PCR utility for detecting the RSV genoma and its application on the diagnosis.

  14. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    OpenAIRE

    Marcela Agne Alves Valones; Rafael Lima Guimarães; Lucas André Cavalcanti Brandão; Paulo Roberto Eleutério de Souza; Alessandra Albuquerque Tavares de Carvalho; Sergio Crovela

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques,...

  15. [Software and hardware design for the temperature control system of quantitative polymerase chain reaction].

    Science.gov (United States)

    Qiu, Xian-bo; Yuan, Jing-qi; Li, Qi

    2005-07-01

    A temperature control system for quantitive polymerase chain reaction (PCR) is presented in the paper with both software and hardware configuration. The performance of the control system has been improved by optimizing the software and hardware design according to the system's properties. The control system has been proven to have a good repeatability and reliability as well as high control precision.

  16. Specific Detection of Campylobacter Jejuni and Campylobacter Coli by Using Polymerase Chain Reaction

    Science.gov (United States)

    1992-10-01

    D2676 CDC C. cryaerophila ( Arcobacter cryoaerophilus) 1 D2792 (type strain) CDC C. hyoinestinilis 3 D2189 CDC D2411 (porcine) CDC D1932 (type...polymerase descriptions and proposal of Arcobacter gen. nov. Int. J. Syst. chain reaction for the detection of Mycobacterium leprae. 1. Bacteriol. 41:451-455

  17. Diversity of Enterococcus faecalis Genotypes from Multiple Oral Sites Associated with Endodontic Failure Using Repetitive Sequence-based Polymerase Chain Reaction and Arbitrarily Primed Polymerase Chain Reaction.

    Science.gov (United States)

    Delboni, Maraísa G; Gomes, Brenda P F A; Francisco, Priscila A; Teixeira, Fabrício B; Drake, David

    2017-03-01

    The aim of this study was to evaluate the diversity and similarity of Enterococcus faecalis genotype isolates from multiple oral sites using repetitive sequence-based polymerase chain reaction and arbitrarily primed polymerase chain reaction (AP-PCR). Forty-two endodontically treated teeth with apical periodontitis were selected. A total of 126 microbial samples were collected from 3 different sites (saliva, pulp chamber, and root canals, all n = 42) during the nonsurgical retreatment procedures. After growth on m-Enterococcus agar, the colonies were isolated, characterized as gram-positive catalase negative cocci, and identified using an API 20 Strep kit (bioMérieux, Marcy-l'Etoile, France). Seventy-four colonies from 10 patients were confirmed as E. faecalis by polymerase chain reaction (16S ribosomal RNA). Repetitive sequence-based polymerase chain reactions using ERIC and AP-PCR using RW3A primers were performed in all 74 colonies. Fingerprints were analyzed and separated into genotypic groups based on the Dice coefficient percentage of similarity (82% or greater) as determined by ERIC reproducibility assays involving E. faecalis controls. Seven different E. faecalis genotypes (GTs) (GT1 = 27%, GT2 = 17.6%, GT3 = 1.3%, GT4 = 18.9%, GT5 = 9.5%, GT6 = 14.9%, and GT7 = 10.8%) were observed in different subjects and oral sites associated with endodontic failure. Remarkably, in 4 of 5 patients, the same GTs present in the infected root canals were also isolated from either the pulp chamber or the saliva samples. In particular, GT6 was detected in all 3 oral sites of patient 37. E. faecalis GTs isolated from saliva, the pulp chamber, and the root canal were similar using the Rep-PCR and AP-PCR methods. These findings suggest that coronal microleakage is a conceivable cause of endodontic failure. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  18. Amphiphilic Polyphosphazene with Poly(ethylene oxide) Side Chains Prepared through the Decker-Forster Reaction

    Institute of Scientific and Technical Information of China (English)

    LIU Chengmei; HU Fuzhen; QIU Jinjun; LEI Guofu; BAO Rui

    2006-01-01

    Poly(4-methylphenoxyphosphazene)-graft-poly(ethylene oxide) (PPZ-g-PEO), a novel amphiphilic grafting polymer was prepared via the Decker-Forster reaction. It is found that the graft efficiency increased with extension of reaction time. Low molecular weight of poly(ethylene oxide) favored the grafting reaction. The grafted polymer has two different glass transition temperatures(Tg) with those of pure poly(4-methylphenoxy-phopsphazene) and PEO. The emulsifying ability of grafted polymer was studied with benzene-water mixture. The emulsifying volumes increased with the decreasing of PEO's molecular weight. The contact angle of film forming from grafted polymer decreased after introduction of PEO grafting chain.

  19. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Institute of Scientific and Technical Information of China (English)

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou

    2005-01-01

    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  20. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Science.gov (United States)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-01

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  1. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)

    2016-05-06

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  2. Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus

    Science.gov (United States)

    Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.

    1990-01-01

    The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.

  3. Matrix product states for su(2) invariant quantum spin chains

    Science.gov (United States)

    Zadourian, Rubina; Fledderjohann, Andreas; Klümper, Andreas

    2016-08-01

    A systematic and compact treatment of arbitrary su(2) invariant spin-s quantum chains with nearest-neighbour interactions is presented. The ground-state is derived in terms of matrix product states (MPS). The fundamental MPS calculations consist of taking products of basic tensors of rank 3 and contractions thereof. The algebraic su(2) calculations are carried out completely by making use of Wigner calculus. As an example of application, the spin-1 bilinear-biquadratic quantum chain is investigated. Various physical quantities are calculated with high numerical accuracy of up to 8 digits. We obtain explicit results for the ground-state energy, entanglement entropy, singlet operator correlations and the string order parameter. We find an interesting crossover phenomenon in the correlation lengths.

  4. Stackelberg Game for Product Renewal in Supply Chain

    Directory of Open Access Journals (Sweden)

    Yong Luo

    2013-01-01

    Full Text Available The paper studied the process of product renewal in a supply chain, which is composed of one manufacturer and one retailer. There are original product and renewal product in the supply chain. A market share shift model for renewal product was firstly built on a increment function and a shift function. Based on the model, the decision-making plane consisting of two variables was divided into four areas. Since the process of product renewal was divided into two stages, Stackelberg-Nash game model and Stackelberg-merger game model could be built to describe this process. The optimal solutions of product pricing strategy of two games were obtained. The relationships between renewal rate, cost, pricing strategy, and profits were got by numerical simulation. Some insights were obtained from this paper. Higher renewal rate will make participants’ profits and total profit increase at the same margin cost. What is more important, the way of the optimal decision making of the SC was that RP comes onto the market with a great price differential between OP and RP.

  5. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism.

    Science.gov (United States)

    Srinivasa, Chandrashekar; Sharanaiah, Umesha; Shivamallu, Chandan

    2012-03-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens. Ralstonia solanacearum, Xanthomoans axonopodis pv. vesicatoria, and Xanthomonas oryzae pv. oryzae are phytopathogenic bacteria, which can infect vegetables, cause severe yield loss. PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA. The technique of PCR-SSCP is being exploited so far, only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi. Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials. In this study, we developed PCR-SSCP technique to identify phytopathogenic bacteria. The PCR product was denatured and separated on a non-denaturing polyacrylamide gel. SSCP banding patterns were detected by silver staining of nucleic acids. We tested over 56 isolates of R. solanacearum, 44 isolates of X. axonopodis pv. vesicatoria, and 20 isolates of X. oryzae pv. oryzae. With the use of universal primer 16S rRNA, we could discriminate such species at the genus and species levels. Species-specific patterns were obtained for bacteria R. solanacearum, X. axonopodis pv. vesicatoria, and X. oryzae pv. oryzae. The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  6. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  7. Analysis of polymorphism in the bovine casein genes by use of the polymerase chain reaction.

    Science.gov (United States)

    Pinder, S J; Perry, B N; Skidmore, C J; Savva, D

    1991-01-01

    Methods have been devised for detecting polymorphisms in the bovine beta- and kappa-casein genes using the polymerase chain reaction (PCR) followed either by restriction enzyme digestion (to reveal a restriction fragment length polymorphism (RFLP] or by hybridization of an allele-specific oligonucleotide. These methods, as well as being faster and more sensitive than traditional RFLP methods, are of more general applicability since they can detect any change in DNA sequence. They require only a small sample of blood or semen and are applicable to animals of any age or sex. These methods make possible large-scale screening and thus selection for alleles at these loci. Typing of blood DNA can give erroneous results when the animal concerned is a twin; however, this can be overcome by retesting using milk or semen. Analysis of the kappa-casein genotype of Holstein-Friesian bulls gives frequencies for the A and B alleles of 0.80 and 0.20 respectively. Selection in favour of the B allele, which is superior for cheese production, could thus have a large effect. The A3 and B alleles at the beta-casein locus have been shown to be rare in the Holstein-Friesian population. Linkage disequilibrium exists between beta-casein B and kappa-casein B.

  8. Isolation and polymerase chain reaction-based identification of Riemerella anatipestifer from ducks in Kerala, India

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2014-10-01

    Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.

  9. Detection of horses infected naturally with equine infectious anemia virus by nested polymerase chain reaction.

    Science.gov (United States)

    Nagarajan, M M; Simard, C

    2001-05-01

    A nested polymerase chain reaction (PCR) amplifying a region of the gag gene of equine infectious anemia virus (EIAV) was developed for the rapid and direct detection of proviral DNA from the peripheral blood of naturally infected horses and was compared with the Coggins test. DNA prepared from white blood cells of 122 field horses from 15 stables with reported cases of EIAV and one seronegative stable were analysed. Amplifications of expected size fragments were obtained by nested PCR for 88 horses using two different sets of primers targeting the gag region. The specificity of the amplified products was confirmed by hybridization using a digoxigenin-labeled probe. Gag-nested PCR-restriction fragment length polymorphism analysis distinguished two different subtypes of gag gene, A and B. Subtype A was found to be the most prevalent among the infected horses that were tested. The PCR-gag amplified sequence of subtype A shared 84.6% nucleotide and 93% deduced amino acid sequence identities with the prototype Wyoming strain whereas subtype B sequence was almost 100% identical to the prototype. Sequence analysis of gag subtype A suggests the presence of a novel EIAV variant among infected horses in Canada. The nested PCR assay developed in the present study detected more EIAV positive animals and was found as specific as the agar gel immunodiffusion (Coggins) assay and offers great potential a diagnostic test for the detection of EIAV infections in field horses.

  10. [The applications of thermostable ligase chain reaction in facilitating DNA recombination].

    Science.gov (United States)

    Xiangda, Zhou; Xiao, Song; Cong, Huai; Haiyan, Sun; Hongyan, Chen; Daru, Lu

    2016-02-01

    The traditional Type Ⅱ restriction enzyme-based method is restricted by the purification steps, and therefore, cannot be applied to specific DNA assembly in chaotic system. To solve this problem, Thermostable Ligase Chain Reaction (TLCR) was introduced in the process of DNA assembly and capture. This technique combines the feature of thermostable DNA ligase and sequence specific oligo ligation template, "Helper", to achieve specific assembly of target fragments and exponential increase of products in multiple thermocyclings. Two plasmid construction experiments were carried out in order to test the feasibility and practical performance of TLCR. One was that, TLCR was used to specifically capture a 1.5 kb fragment into vector from an unpurified chaotic system which contained 7 different sizes of fragments. The results showed that the capturing accuracy was around 80%, which proved the feasibility and accuracy of using TLCR to specific assembly of DNA fragments in a complicated mixed system. In the other experiment, TLCR was used to capture two fragments (total length was 27 kb) from Hind Ⅲ digestion of Lambda genome into vector by order. The results also showed an accuracy of around 80%. As demonstrated in the results, TLCR can simplify the process of DNA recombination experiments and is suitable for the assembly of multiple and large DNA fragments. This technique can provide convenience to biological experiments.

  11. Development and application of polymerase chain reaction test for detection of Conidiobolus lamprauges

    Directory of Open Access Journals (Sweden)

    Marcelo M. Silveira

    2013-12-01

    Full Text Available Conidiobolomycosis is a granulomatous disease caused by the fungus Conidiobolus spp. in humans and animals. Traditional technique for diagnosis of the disease is isolation of the agent associated with the presence of typical clinical signs and pathological conditions. The aim of this study was to describe the development of a specific polymerase chain reaction (PCR test for Conidiobolus lamprauges to detect the fungus in clinical samples. Samples from suspected animals were collected and submitted to isolation, histopathological analysis and amplification by PCR. DNA from tissues was subjected to PCR with fungi universal primers 18S rDNA gene, and specific primers were designed based on the same gene in C. lamprauges that generated products of about 540 bp and 222 bp respectively. The culture was positive in 26.6% of clinical samples. The PCR technique for C. lamprauges showed amplification of DNA from fresh tissues (80% and paraffin sections (44.4%. In conclusion, the PCR technique described here demonstrated a high sensitivity and specificity for detection of fungal DNA in tissue samples, providing a tool for the rapid diagnosis of C. lamprauges.

  12. Detection of Leuconostoc strains at a meat processing plant using polymerase chain reaction.

    Science.gov (United States)

    Goto, Seitaro; Takahashi, Hajime; Kawasaki, Susumu; Kimura, Bon; Fujii, Tateo; Nakatsuji, Miki; Watanabe, Itaru

    2004-02-01

    To simplify the labor-intensive conventional routine testing of samples to detect Leuconostoc at a meat processing plant, we developed polymerase chain reaction (PCR) primers specific for Leuconostoc from 16S rRNA gene sequences. These primers did not detect other common lactic acid bacteria such as Lactobacillus plantarum, Lact. sake, Lact. fermentum, Lact. acidophilus and Weissella viridescens. PCR with this primer detected all Leuconostoc species tested (Leu. mesenteroides subsp. mesenteroides, Leu. pseudomesenteroides, Leu. carnosum, Leu. lactic, Leu. citreum, Leu. amelibiosum, Leu. gelidum), except for Leu. fallax, and no other lactic acid bacteria on agarose gel electrophoresis. The method could identify areas contaminated with Leuconostoc in a large-scale industrial meat processing plant. Of 69 samples analyzed, 34 were positive for Leuconostoc according to the conventional culture method (isolation of LAB producing dextran) and PCR, whereas 29 were negative according to both. Six samples were culture-negative but positive by PCR. No false negative results were generated by PCR. The method is rapid and simple, is useful for routinely monitoring areas contaminated with Leuconostoc in meat processing plants, and could help to prevent the spoilage of meat products.

  13. Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction.

    Science.gov (United States)

    Khamlor, Trisadee; Pongpiachan, Petai; Sangsritavong, Siwat; Chokesajjawatee, Nipa

    2014-10-01

    Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR) assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP) gene and sex-determining region Y (SRY) were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99%) comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05). The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90%) as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.

  14. Gene-expression analysis of single cells-nested polymerase chain reaction afte laser microdissection

    Institute of Scientific and Technical Information of China (English)

    Xin Shi; Jorg Kleeff; Zhao-Wen Zhu; Bruno Schmied; Wen-Hao Tang; Arthur Zimmermann; Markus W. Bucher; Helmut Friess

    2003-01-01

    AIM: The structural and functional characteristics of cells are dependent on the specific gene expression profile. The ability to study and compare gene expression at the cellular level will therefore provide valuable insights into cell physiology and pathophysiology. METHODS: Individual cells were isolated from frozen colon tissue sections using laser microdissection. DNA as well as RNA were extracted, and total RNA was reversely transcribed to complementary DNA (cDNA). Both DNA and cDNA were analyzed by nested polymerase chain reaction (PCR). The quality of isolated DNA and RNA was satisfactory. RESULTS: Single cells were successfully microdissected using an ultraviolet laser micromanipulator. Nested PCR amplification products of DNA and cDNA of single cells could clearly be visualized by agarose gel electrophoresis. CONCLUSION: The combined use of laser microdissection and nested-PCR provides an opportunity to analyze geneexpression in single cells. This method allows the analysisand identification of specific genes which are involved inphysiological and pathophysiological processes in a complexof variable cell phenotypes.

  15. Detection of Alternaria fungal contamination in cereal grains by a polymerase chain reaction-based assay.

    Science.gov (United States)

    Zur, Gideon; Shimoni, Eyal; Hallerman, Eric; Kashi, Yechezkel

    2002-09-01

    Alternaria sp. are important fungal contaminants of grain products; they secrete four structural classes of compounds that are toxic or carcinogenic to plants and animals and cause considerable economic losses to growers and the food-processing industry. Alternaria toxins have been detected by high-performance liquid chromatography (HPLC), enzyme-linked immunosorbent assay, and other techniques. Here, we report the development of a polymerase chain reaction (PCR)-based method for the detection of Alternaria DNA. PCR primers were designed to anneal to the ITS1 and ITS2 regions of the 5.8S rDNA gene of Alternaria alternata or Alternaria solani but not to other microbial or plant DNA. We compared the sensitivity of PCR in detecting Alternaria DNA, that of the HPLC method in detecting Alternaria alternariol and alternariol methyl ether toxins, and that of the morphological examination of mycelia and conidia in experimentally infested corn samples. The sensitivity of toxin detection for HPLC was above the level of contamination in a set of commercially obtained grain samples, resulting in negative scores for all samples, while the PCR-based method and mold growth plating followed by morphological identification of Alternaria gave parallel, positive results for 8 of 10 samples. The PCR assay required just 8 h, enabling the rapid and simultaneous testing of many samples at a low cost. PCR-based evidence for the presence of Alternaria DNA followed by positive assay results for Alternaria toxins would support the rejection of a shipment of grain.

  16. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  17. A novel technique for measuring variations in DNA copy-number: competitive genomic polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Nakagawara Akira

    2007-07-01

    Full Text Available Background Changes in genomic copy number occur in many human diseases including cancer. Characterization of these changes is important for both basic understanding and diagnosis of these diseases. Microarrays have recently become the standard technique and are commercially available. However, it is useful to have an affordable technique to complement them. Results We describe a novel polymerase chain reaction (PCR-based technique, termed competitive genomic PCR (CGP. The main characteristic of CGP is that different adaptors are added to the sample and control genomic DNAs after appropriate restriction enzyme digestion. These adaptor-supplemented DNAs are subjected to competitive PCR using an adaptor-primer and a locus-specific primer. The amplified products are then separated according to size differences between the adaptors. CGP eliminates the tedious steps inherent in quantitative PCR and achieves moderate throughput. Assays with different X chromosome numbers showed that it can provide accurate quantification. High-resolution analysis of neuroblastoma cell lines around the MYCN locus revealed novel junctions for amplification, which were not detected by a commercial array. Conclusion CGP is a moderate throughput technique for analyzing changes in genomic copy numbers. Because CGP can measure any genomic locus using PCR primers, it is especially useful for detailed analysis of a genomic region of interest.

  18. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics.

    Science.gov (United States)

    Li, Yuyuan; Xing, Da; Zhang, Chunsun

    2009-02-01

    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  19. MULTI INFEKSI PADA UDANG Litopenaeus vannamei : DIAGNOSIS DENGAN POLYMERASE CHAIN REACTION (PCR DAN REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION (RT-PCR

    Directory of Open Access Journals (Sweden)

    Isti Koesharyani

    2012-04-01

    Full Text Available Penelitian ini dilakukan karena adanya masalah yang dihadapi seperti pertumbuhan udang yang tidak seragam (ukuran bervariasi, penampakan klinis yang abnormal dan organ yang tidak sempurna. Gejala tersebut akibat dari infeksi penyakit yang disebabkan oleh virus. Untuk mengetahui jenis virus yang menyerang udang tersebut, maka dilakukan analisis Polymerase Chain Reaction (PCR dan Reverse TranscriptasePolymerase Chain Reaction (RT-PCR menggunakan berbagai jenis spesifik primer WSSV, IHHNV, MBV, TSV, IMNV, dan PvNV. Sampel udang yang secara visual normal dan abnormal diambil lalu disimpan dalam larutan pengawet 90% Ethanol dan RNAlater kemudian dianalisis di laboratorium dengan metode yang sudah dikembangkan oleh Pusat Penelitian dan Pengembangan Perikanan Budidaya. Hasilnya menunjukkan bahwa udang yang tumbuh lambat dan mempunyai rostrum bengkok dan warna otot daging memutih ternyata tidak hanya diserang oleh satu virus namun dua virus IHHNV dan IMNV. Hasil penelitian ini juga mengindikasikan bahwa udang yang terserang IHHNV akan tumbuh lambat walaupun tidak mematikan, sedangkan udang yang diserang IMNV otot daging di tubuh memutih terutama pada bagian punggung dan dapat menimbulkan kematian.

  20. Brazilian chicken meat production chain:a 10-year overview

    Directory of Open Access Journals (Sweden)

    IA Nääs

    2015-03-01

    Full Text Available Brazil is the world's largest broiler meat exporter. Health control, knowledge and technology, as well as the natural aspects of the country are pointed out as the keys for the success of that product in the market. Brazilian broiler production grew significantly in the last decade; it creates jobs and has a significant social role in Brazilian economy. This study aimed at evaluating the Brazilian broiler meat supply chain from 2000 to 2010 using the social network analysis (SNA. Data from governmental and private sources were organized and analyzed. The focus of this study was the broiler production supply chain segment involving the hatchery, the broiler farm, the feed mill, the processing plant, and the government. The inputs considered were one-day-old chicks, pullet, feedstuff, and the infrastructure; and the outputs were broiler meat and taxes paid. The software UCINET was applied for calculating the structural attributes and indicators of the network. Results showed a relatively disorganized network in 2000 with the strongest tie between the farmer and the processing plant. The structural organization of the network improved until 2010. The density of the ties in the broiler meat production network increased steadily from 2000 to 2010 within a vertical cohesive supply chain structure. The success of Brazilian broiler meat production is attributed to the abundance of land, fertile soil, favorable climate, and the effort and investments in research and development by innovative companies in the last few years. The results of the present study showed that Brazilian broiler production evolved positively in the last ten years, and it was weakly influenced by international challenges.

  1. Evaluation of Neutron Induced Reactions for 32 Fission Products

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyeong Il

    2007-02-15

    Neutron cross sections for 32 fission products were evaluated in the neutron-incident energy range from 10{sup -5} eV to 20 MeV. The list of fission products consists of the priority materials for several applications, extended to cover complete isotopic chains for three elements. The full list includes 8 individual isotopes, {sup 95}Mo, {sup 101}Ru, {sup 103}Rh, {sup 105}Pd, {sup 109}Ag, {sup 131}Xe, {sup 133}Cs, {sup 141}Pr, and 24 isotopes in complete isotopic chains for Nd (8), Sm (9) and Dy (7). Our evaluation methodology covers both the low energy region and the fast neutron region.In the low energy region, our evaluations are based on the latest data published in the Atlas of Neutron Resonances. This resource was used to infer both the thermal values and the resolved resonance parameters that were validated against the capture resonance integrals. In the unresolved resonance region we performed the additional evaluation by using the averages of the resolved resonances and adjusting them to the experimental data.In the fast neutron region our evaluations are based on the nuclear reaction model code EMPIRE-2.19 validated against the experimental data. EMPIRE is the modular system of codes consisting of many nuclear reaction models, including the spherical and deformed Optical Model, Hauser-Feshbach theory with the width fluctuation correction and complete gamma-ray emission cascade, DWBA, Multi-step Direct and Multi-step Compound models, and several versions of the phenomenological preequilibrium models. The code is equipped with a power full GUI, allowing an easy access to support libraries such as RIPL and CSISRS, the graphical package, as well the utility codes for formatting and checking. In general, in our calculations we used the Reference Input Parameter Library, RIPL, for the initial set model parameters. These parameters were properly adjusted to reproduce the available experimental data taken from the CSISRS library. Our evaluations cover cross

  2. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjærg, Lars Stubbe; Hansen, J-ES; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...... hybridization. It was not possible to detect any viral antigen production in the cultures, and attempts to recover virus by highly sensitive coculture techniques were unsuccessful, indicating that the infection was latent. The PCR technique provides a simple approach to the study of viral infection in cases...

  3. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjaerg, L L; Hansen, J E; Dalbøge, H

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...... hybridization. It was not possible to detect any viral antigen production in the cultures, and attempts to recover virus by highly sensitive coculture techniques were unsuccessful, indicating that the infection was latent. The PCR technique provides a simple approach to the study of viral infection in cases...

  4. Markov Chain for Reuse Strategies of Product Families

    Institute of Scientific and Technical Information of China (English)

    LUO Jia; JIANG Lan

    2007-01-01

    A methodology is presented to plan reuse strategies of common modules in a product family by using the concepts of function degradation, reliability, function requirement, cost and life time. Markov chain model is employed to predict function degradation and reliability. A utility model is used to evaluate the preference between used modules and new modules. An example of cascading-requirment product family illustrates the main ideas of our work. The Markov models are used effectively to predict function degradation and reliability. Utility theory is helpful to evaluate the reuse options of common modules.

  5. Sequencing on products of Oncomelania hupensis through simple sequence repeat anchored polymerase chain reaction amplification%湖北钉螺微卫星锚定PCR产物序列分析

    Institute of Scientific and Technical Information of China (English)

    郭俊涛; 周艺彪; 韦建国; 赵根明

    2008-01-01

    目的 分析4个种群湖北钉螺中微卫星序列及其两侧序列的特点.方法 以(CA)8RY为引物对湖北钉螺基因组DNA进行微卫星锚定PCR(SSR-PCR)扩增,对全部159个扩增产物进行T克隆并测定其中82个片段的核苷酸序列.结果 SSR-PCR的扩增产物是湖北钉螺基因组DNA上的散在区域,不是微卫星序列,但扩增产物中含有微卫星序列,测序的82个片段中36个克隆片段含有微卫星序列.微卫星序列其侧翼序列有一定的保守性,同一个微卫星的侧翼序列多数情况下是相同的.(GA/CT)n、(TTAGGG/CCCTAA)n两类微卫星在4个钉螺种群中均有发现,(CAA)n仅在福建福清种群中发现,(TCTCTG)n仅在安徽贵池种群中发现,(GAA~TTC)n、(CAA/TTG)n、(CAT)n三种微卫星序列仅在四川普格种群中发现.结论 SSR-PCR扩增的不是微卫星,其结果的分析应当类似于随机扩增多态性DNA.因此SSR-PCR不能十分有效体现微卫星作为分子标记的优势,应当根据微卫星的侧翼序列设计针对微卫星的引物,对微卫星进行PCR扩增并进行分析.%Objective To analyze the sequence of microsatellite and the flanking sequence from four populations of Oncomelania hupensis. Methods We cloned 159 SSR-PCR amplification products of a commonly used primer, (CA)8RY, using O. hupensis genomie DNA as template, and sequenced 82 products Results The sequences obtained were novel O. hupensis genomic sequences but not repeat simple sequence. It was observed that 36 out of 82 clones contained microsatellites between priming sites.The flanking sequences of certain microsatellite were invariant. Both (GA/CT). and (TTAGGG/CCCAA)n were found in four populations of O. hupensis. However, (CAA)n were found only in O. hupensis from Fuqing,Fujian province and (TCTCTG), were found only in O. hupensis from Guichi,Anhui province and (GAA/TTC)n, (CAA/TTG)n, (CAT), were found only in O.hupensis from Puge,Sichuan province. Conclusion The results obtained by

  6. Transesterification reaction between medium- and long-chain fatty acid triglycerides using surfactant-modified lipase.

    Science.gov (United States)

    Mogi, K; Nakajima, M; Mukataka, S

    2000-03-05

    Transesterification between medium-chain fatty acid triglycerides (MCT) and long-chain fatty acid triglycerides (LCT) in a nonsolvent system was investigated using surfactant modified lipase which is a complex of lipase, Rhizopus japonicus and surfactant, sorbitan monostearate. 74% conversion of was obtained after a 48-h reaction period, and the triglyceride composition was well described by the 1, 3-random 2-random stochastic model. The transesterification reaction between MCT and LCT closely followed the simple kinetic model, and the change in MCT and LCT contents could be simulated using one parameter. The effects of the water activity (A(w)) of modified lipase, the water content of the reaction system and the reaction temperature on the reaction rate were studied. A modified lipase A(w) of 0.35 and a water content of the reaction system at 0.09 wt % showed the highest activity. Inactivation did not occur below 60 degrees C, however, the activity decreased at temperatures over 70 degrees C. Copyright 2000 John Wiley & Sons, Inc.

  7. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  8. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... sample (100 to 2000 ng/5 μl) with one of the following 45 μl PCR cocktails: (i) 5 μl 10x PCR buffer, 1...

  9. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    Science.gov (United States)

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  10. Comparison of different polymerase chain reaction-based approaches for clonality assessment of immunoglobulin heavy-chain gene rearrangements in B-cell neoplasia

    NARCIS (Netherlands)

    Derksen, P W; Langerak, A W; Kerkhof, E; Wolvers-Tettero, I L; Boor, P P; Mulder, A H; Vrints, L W; Coebergh, J W; van Krieken, J H; Schuuring, E; Kluin, P M; van Dongen, J J

    1999-01-01

    Several frequently applied polymerase chain reaction strategies for analysis of immunoglobulin heavy-chain gene rearrangements were compared by analyzing 70 B-cell lymphoproliferative disorders and 24 reactive lymphoid lesions. Southern blot analysis was used as the "gold standard" for clonality ass

  11. The shaping of environmental concern in product chains: analysing Danish case studies on environmental aspects in product chain relations

    DEFF Research Database (Denmark)

    Forman, Marianne; Hansen, Anne Grethe; Jørgensen, Michael Søgaard

    Environmental Protection Agency has supported a number of greening activities in the 1990s. On the background of ten case studies of greening activities within the textile sector, the mechanisms of emergence and stabilisation of environmental concerns and practices are analysed and the interaction between...... the systems of production, consumption, knowledge and regulation are discussed. The role of boundary objects is discussed with eco-labelling as case. The role of and the impact on the product chain relations are analysed as part of these mechanisms. From the case studies, green innovations in the product...... and development of the market conditions for greener products. The analysis also shows a number of environmental consequences of textile production and consumption not addressed by either company initiatives or governmental environmental and industrial policy. The paper was presented at EGOS (European Group...

  12. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Santos, M S; Souza, E S; S Junior, R M; Talhari, S; Souza, J V B

    2010-08-01

    Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP). More specifically: a) to evaluate 3 different amplification regions, b) to investigate 3 different restriction enzymes, and c) to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2) were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel) produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas--FMTAM) were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  13. THE METHOD OF POLYMERASE CHAIN REACTION FOR SEX DETERMINATION IN HUCHEN (HUCHO HUCHO

    Directory of Open Access Journals (Sweden)

    Yu. Rud

    2013-12-01

    Full Text Available Purpose. To analyse the nucleotide sequences of salmonids Y chromosome and to determine the fragment for specific primers selection and also to develop the PCR based method for sex determination in huchen H. hucho. Methodology. Using the ClustalW algorithm in MEGA 5.2, the nucleotide sequences of salmonids Y chromosome were analysed. For developing of method for rapid diagnostic of huchen sex the polymerase chain reaction (PCR assay was used. Tne nucleotide sequences of amplified products were investigated by sequencing. Findings. Using PCR assay the method of sex determination in huchen H. hucho was developed. It was shown that specific PCR products in size of 450 nucleotides were visible in huchen males only. In addition we showed that selected primers can be used in sex determination of rainbow trout Oncorhynchus mykiss and this fact is proved the high rate of sdY locus similarity and its wide destribution in salmonids. Originality. The nucleotide sequences of salmonids Y chromosome were analysed and highly conservative region of sdY locus for specific primers selection, which covers sex-linked marker, was identified. Practical Value. Rapid sex determination in huchen by the developed method will allow to identify reversal males in process of gormonal sex reversion. At the stage of reversal males screening, this method will allow to identify the genotypic males (XY in experimental group and discard them because only phenotypic males with XX genotype (reversal males must be used in the crosses with native femelas for getting of 100 % all-females stock.

  14. Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

    Energy Technology Data Exchange (ETDEWEB)

    Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru [Ioffe Institute (Russian Federation)

    2016-09-15

    It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

  15. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene.

    Science.gov (United States)

    Brakstad, O G; Aasbakk, K; Maeland, J A

    1992-07-01

    Synthetic oligonucleotide primers of 21 and 24 bases, respectively, were used in the polymerase chain reaction (PCR) to amplify a sequence of the nuc gene, which encodes the thermostable nuclease of Staphylococcus aureus. A DNA fragment of approximately 270 bp was amplified from lysed S. aureus cells or isolated DNA. The PCR product was detected by agarose gel electrophoresis or Southern blot analysis by using a 33-mer internal nuc gene hybridization probe. With S. aureus cells the lower detection limit was less than 10 CFU, and with the isolated target the lower detection limit was 0.69 pg of DNA. The primers recognized 90 of 90 reference or clinical S. aureus strains. Amplification was not recorded when 80 strains representing 16 other staphylococcal species were tested or when 20 strains representing 9 different nonstaphylococcal species were tested. Some of the non-S. aureus staphylococci produced thermostable nucleases but were PCR negative. The PCR product was generated when in vitro-cultured S. aureus was used to prepare simulated clinical specimens of blood, urine, cerebrospinal fluid, or synovial fluid. No PCR product was generated when the sterile body fluids were tested. However, the sensitivity of the PCR was reduced when S. aureus in blood or urine was tested in comparison with that when bacteria in saline were tested. With the bacteria in blood, the detection limit of the PCR was 10(3) CFU. A positive PCR result was recorded when a limited number of clinical samples from wounds verified to be infected with S. aureus were tested, while the PCR product was not detected in materials from infections caused by other bacteria. Generation of PCR products was not affected by exposure of S. aureus to bactericidal agents, including cloxacillin and gentamicin, prior to testing, but was affected by exposure to UV radiation. The PCR for amplification of the nuc gene has potential for the rapid diagnosis of S. aureus infections by direct testing of clinical

  16. Long-chain alkane production by the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Buijs, Nicolaas A; Zhou, Yongjin J; Siewers, Verena; Nielsen, Jens

    2015-06-01

    In the past decade industrial-scale production of renewable transportation biofuels has been developed as an alternative to fossil fuels, with ethanol as the most prominent biofuel and yeast as the production organism of choice. However, ethanol is a less efficient substitute fuel for heavy-duty and maritime transportation as well as aviation due to its low energy density. Therefore, new types of biofuels, such as alkanes, are being developed that can be used as drop-in fuels and can substitute gasoline, diesel, and kerosene. Here, we describe for the first time the heterologous biosynthesis of long-chain alkanes by the yeast Saccharomyces cerevisiae. We show that elimination of the hexadecenal dehydrogenase Hfd1 and expression of a redox system are essential for alkane biosynthesis in yeast. Deletion of HFD1 together with expression of an alkane biosynthesis pathway resulted in the production of the alkanes tridecane, pentadecane, and heptadecane. Our study provides a proof of principle for producing long-chain alkanes in the industrial workhorse S. cerevisiae, which was so far limited to bacteria. We anticipate that these findings will be a key factor for further yeast engineering to enable industrial production of alkane based drop-in biofuels, which can allow the biofuel industry to diversify beyond bioethanol.

  17. Effect of Pozzolanic Reaction Products on Alkali-silica Reaction

    Institute of Scientific and Technical Information of China (English)

    WEI Fengyan; LAN Xianghui; LV Yinong; XU Zhongzi

    2006-01-01

    The effect of fly ash on controlling alkali-silica reaction (ASR) in simulated alkali solution was studied. The expansion of mortar bars and the content of Ca(OH)2 in cement paste cured at 80 ℃ for 91 d were measured. Transmission electron microscopy (TEM) and high-resolution transmission electron microscopy (HRTEM) were employed to study the microstructure of C-S-H. TEM/energy dispersive spectroscopy (EDS) was then used to determine the composition of C-S-H. The pore structure of the paste was analyzed by mercury intrusion porosimetry (MIP). The results show that the contents of fly ash of 30% and 45% can well inhibit ASR. And the content of Ca(OH)2 decreases with the increase of fly ash. That fly ash reacted with Ca(OH)2 to produce C-S-H with a low Ca/Si molar ratio could bind more Na+ and K+ ions, and produce a reduction in the amount of soluble alkali available for ASR. At the same time, the C-S-H produced by pozzolanic reaction converted large pores to smaller ones (gel pores smaller than 10 nm) to densify the pore structure. Perhaps that could inhibit alkali transport to aggregate for ASR.

  18. Quantitative interpretation to the chain mechanism of free radical reactions in cyclohexane pyrolysis

    Institute of Scientific and Technical Information of China (English)

    Yingxian Zhao; Bo Shen; Feng Wei

    2011-01-01

    Pyrolysis of cyclohexane was conducted with a plug flow tube reactor in the temperature range of 873-973 K.Based on the experimental data,the mechanism and kinetic model of cyclohexane pyrolysis reaction were proposed.The kinetic analysis shows that overall conversion of cyclohexane is a first order reaction,of which the rate constant increased from 0.0086 to 0.0225 to 0.0623 s- 1 with the increase of temperature from 873 to 923 to 973 K,and the apparent activation energy was determined to be 155.0+1.0 kJ.mo1-1.The mechanism suggests that the cyclohexane is consumed by four processes:the homolysis of C-C bond (Path Ⅰ),the homolysis of C-H bond (Path Ⅱ) in reaction chain initiation,the H-abstraction of various radicals from the feed molecules in reaction chain propagation (Path Ⅲ),and the process associated with coke formation (Path Ⅳ).The reaction path probability (RPP) ratio of Xpath Ⅰ ∶ Xpath Ⅱ∶ XPath Ⅲ ∶ XPath Ⅳ was 0.5420 ∶ 0.0045 ∶ 0.3897 ∶ 0.0638 at 873 K,and 0.4336 ∶ 0.0061 ∶ 0.4885 ∶ 0.0718 at 973 K,respectively.

  19. Instability Criterion of One-Dimensional Detonation Wave with Three-Step Chain Branching Reaction Model

    Institute of Scientific and Technical Information of China (English)

    TENG Hong-Hui; JIANG Zong-Lin

    2011-01-01

    @@ One-dimensional detonation waves are simulated with the three-step chain branching reaction model, and the instability criterion is studied.The ratio of the induction zone length and the reaction zone length may be used to decide the instability, and the detonation becomes unstable with the high ratio.However, the ratio is not invariable with different heat release values.The critical ratio, corresponding to the transition from the stable detonation to the unstable detonation, has a negative correlation with the heat release.An empirical relation of the Chapman-Jouguet Mach number and the length ratio is proposed as the instability criterion.

  20. Polymerase chain reaction-based molecular diagnosis of cutaneous infections in dermatopathology.

    Science.gov (United States)

    Swick, Brian L

    2012-12-01

    Conventional methods, including microscopy, culture, and serologic studies, are a mainstay in the diagnosis of cutaneous infection. However, owing to limitations associated with these techniques, such as low sensitivity for standard microscopy and in the case of culture delay in diagnosis, polymerase chain-reaction based molecular techniques have taken on an expanding role in the diagnosis of infectious processes in dermatopathology. In particular, these assays are a useful adjunct in the diagnosis of cutaneous tuberculosis, atypical mycobacterial infection, leprosy, Lyme disease, syphilis, rickettsioses, leishmaniasis, and some fungal and viral infections. Already in the case of tuberculosis and atypical mycobacterial infection, standardized polymerase chain-reaction assays are commonly used for diagnostic purposes. With time, additional molecular-based techniques will decrease in cost and gain increased standardization, thus delivering rapid diagnostic confirmation for many difficult-to-diagnose cutaneous infections from standard formalin-fixed paraffin-embedded tissue specimens.

  1. Exploiting the tetrazine-norbornene reaction for single polymer chain collapse.

    Science.gov (United States)

    Hansell, Claire F; Lu, Annhelen; Patterson, Joseph P; O'Reilly, Rachel K

    2014-04-21

    Single chain polymer nanoparticles (SCNPs) have been formed using polystyrenes decorated with pendent norbornenes and a bifunctional tetrazine crosslinker. Characterisation by size exclusion chromatography and (1)H NMR gives evidence for the formation of SCNPs by the tetrazine-norbornene reaction, whilst light scattering, neutron scattering, transmission electron microscopy and atomic force microscopy show that discrete well-defined nanoparticles are formed and their size in solution calculated.

  2. Global stability of enzymatic chains of full reversible Michaelis-Menten reactions.

    Science.gov (United States)

    Belgacem, Ismail; Gouzé, Jean-Luc

    2013-09-01

    We consider a chain of metabolic reactions catalyzed by enzymes, of reversible Michaelis-Menten type with full dynamics, i.e. not reduced with any quasi-steady state approximations. We study the corresponding dynamical system and show its global stability if the equilibrium exists. If the system is open, the equilibrium may not exist. The main tool is monotone systems theory. Finally we study the implications of these results for the study of coupled genetic-metabolic systems.

  3. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  4. Comparison of polimerase chain reaction and serological methods in the diagnosis of hepatitis C virus infection

    OpenAIRE

    Kaya, Selçuk; Arıdoğan, Buket Cicioğlu; Çetin, Emel Sesli; Adiloğlu, Ali K.; Demirci, Mustafa

    2009-01-01

    SüleymanDemirel Üniversitesi TIP FAKÜLTESİ DERGİSİ: 2007 Mart; 14(1) Comparison of polimerase chain reaction and serological methods in the diagnosis of hepatitis C virus infection Selçuk Kaya, Buket Cicioğlu-Arıdoğan, Emel Sesli Çetin, Ali K. Adiloğlu, Mustafa Demirci Süleyman Demirel University Medical School Medical Microbiology Department, Isparta, Turkey. Özet Hepatit C Virus inf...

  5. Compact-like kink in a real electrical reaction-diffusion chain

    Energy Technology Data Exchange (ETDEWEB)

    Comte, J.C. [Laboratoire de Physiopathologie des Reseaux Neuronaux du Cycle Veille-Sommeil, CNRS UMR 5167, Faculte de Medecine Laennec 7, Rue Guillaume Paradin, 69372 Lyon Cedex 08 (France)]. E-mail: comtejc@sommeil.univ-lyon1.fr; Marquie, P. [Laboratoire d' Electronique, Informatique et Image (LE2i) UMR CNRS 5158, Aile des Sciences de l' Ingenieur, BP 47870, 21078 Dijon Cedex (France)

    2006-07-15

    We demonstrate experimentally the compact-like kinks existence in a real electrical reaction-diffusion chain. Our measures show that such entities are strictly localized and consequently present a finite spatial extent. We show equally that the kink velocity is threshold-dependent. A theoretical quantification of the critical coupling under which propagation fails is also achieved and reveals that nonlinear coupling leads to a propagation failure reduction.

  6. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

    OpenAIRE

    Lester J Pérez; Heidy Díaz de Arce

    2009-01-01

    Aujeszky's disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved v...

  7. High-speed droplet-allele-specific polymerase chain reaction for genotyping of single nucleotide polymorphisms.

    Science.gov (United States)

    Matsuda, Kazuyuki; Honda, Takayuki

    2015-01-01

    Single nucleotide alternations such as single nucleotide polymorphisms (SNPs) or single nucleotide mutations are useful genetic markers for molecular diagnosis, prognosis, drug response, and predisposition to diseases. Rapid identification of SNPs or mutations is clinically important, especially for determining drug responses and selection of molecular-targeted therapy. Here, we describe a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) by using our droplet-PCR machine (droplet-AS-PCR).

  8. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    OpenAIRE

    Li Jiang; Matthew Mancuso; Zhengda Lu; Gunkut Akar; Ethel Cesarman; David Erickson

    2014-01-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics ...

  9. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard;

    2015-01-01

    Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...

  10. Differentiation of Giardia duodenalis from other Giardia spp. by using polymerase chain reaction and gene probes.

    OpenAIRE

    Mahbubani, M H; Bej, A K; Perlin, M H; Schaefer, F W; Jakubowski, W.; Atlas, R M

    1992-01-01

    Giardia spp. are waterborne organisms that are the most commonly identified pathogenic intestinal protozoans in the United States. Current detection techniques for Giardia species in water include microscopy and immunofluorescence techniques. Species of the genus Giardia are classified on the basis of taxonomic criteria, such as cell morphology, and on host specificity. We have developed a polymerase chain reaction- and gene probe-based detection system specific for Giardia spp., which can di...

  11. STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Honcharova S.Y.

    2015-08-01

    Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

  12. Supply Chain Management of a Modular Product with Returns

    DEFF Research Database (Denmark)

    Ulku, M. Ali; Hsuan, Juliana; Yu, Dennis

    Modularity and returns relate to sustainability. In a retailer-manufacturer setting and when the demand for a returnable product depends on both price and modularity level, we develop a profit-maximizing stochastic model. The solution includes optimal expressions for the price, and the order quan...... quantity. We derive managerial insights from our structural and numerical results relating to the management of such a perishable product and its implications on sustainable supply chain management.......Modularity and returns relate to sustainability. In a retailer-manufacturer setting and when the demand for a returnable product depends on both price and modularity level, we develop a profit-maximizing stochastic model. The solution includes optimal expressions for the price, and the order...

  13. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  14. Metabolically engineered Saccharomyces cerevisiae for branched-chain ester productions.

    Science.gov (United States)

    Yuan, Jifeng; Mishra, Pranjul; Ching, Chi Bun

    2016-12-10

    Medium branched-chain esters can be used not only as a biofuel but are also useful chemicals with various industrial applications. The development of economically feasible and environment friendly bio-based fuels requires efficient cell factories capable of producing desired products in high yield. Herein, we sought to use a number of strategies to engineer Saccharomyces cerevisiae for high-level production of branched-chain esters. Mitochondrion-based expression of ATF1 gene in a base strain with an overexpressed valine biosynthetic pathway together with expression of mitochondrion-relocalized α-ketoacid decarboxylase (encoded by ARO10) and alcohol dehydrogenase (encoded by ADH7) not only produced isobutyl acetate, but also 3-methyl-1-butyl acetate and 2-methyl-1-butyl acetate. Further segmentation of the downstream esterification step into the cytosol to utilize the cytosolic acetyl-CoA pool for acetyltransferase (ATF)-mediated condensation enabled an additional fold improvement of ester productions. The best titre attained in the present study is 260.2mg/L isobutyl acetate, 296.1mg/L 3-methyl-1-butyl acetate and 289.6mg/L 2-methyl-1-butyl acetate.

  15. An overview on the Brazilian orange juice production chain

    Directory of Open Access Journals (Sweden)

    Renato Marcio dos Santos

    2013-03-01

    Full Text Available Brazil is the world's largest producer of oranges and uses more than 70% of the harvested fruits in the production of juices. The amount of processed orange is growing about 10% per year, confirming the trend of the Brazilian citrus for juice production. This research aimed to investigate the Brazilian orange juice production chain from 2005 to 2009. Data from the amount of frozen juice produced and exported, international price of orange juice, and intermediate transactions were assessed in order to make possible selection of all interveners involved in the chain. The study using the Social Network Analysis (SNA showed that the densest relationships in the network are from exporters to importers and from orange growers to the orange processing industry. No difference was found in the values of the network geodesic distance or the clustering coefficients from 2005 to 2009. The degree of centrality increased steadily throughout the years indicating that the processing industry attempts to minimize the risks by centralizing the actions. A decrease in export of orange juice from 2007 (2.07 10(6 t to 2008 (2.05 10(6 t was found, probably due to the world's financial crisis with recovery in 2009. Since 2004, there has been an increase of nearly 10% per year in the market preference of concentrate juice (OFCJ when compared to the "not from concentrated" juice (NFC. Nowadays the NFC market represents nearly 50% of all Brazilian export which impacted in the logistic distribution and transportation issues.

  16. Dynamics of interfacial reactions between O({sup 3} P) atoms and long-chain liquid hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Allan, Mhairi [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Bagot, Paul A J [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Koehler, Sven P K [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Reed, Stewart K [Department of Physics and Astronomy, University of Edinburgh, The King' s Buildings, Edinburgh EH9 3JZ (United Kingdom); Westacott, Robin E [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Costen, Matthew L [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); McKendrick, Kenneth G [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom)

    2007-09-15

    Recent progress that has been made towards understanding the dynamics of collisions at the gas-liquid interface is summarized briefly. We describe in this context a promising new approach to the experimental study of gas-liquid interfacial reactions that we have introduced. This is based on laser-photolytic production of reactive gas-phase atoms above the liquid surface and laser-spectroscopic probing of the resulting nascent products. This technique is illustrated for reaction of O({sup 3}P) atoms at the surface of the long-chain liquid hydrocarbon squalane (2,6,10,15,19,23-hexamethyltetracosane). Laser-induced fluorescence detection of the nascent OH has revealed mechanistically diagnostic correlations between its internal and translational energy distributions. Vibrationally excited OH molecules are able to escape the surface. At least two contributions to the product rotational distributions are identified, confirming and extending previous hypotheses of the participation of both direct and trapping-desorption mechanisms. We speculate briefly on future experimental and theoretical developments that might be necessary to address the many currently unanswered mechanistic questions for this, and other, classes of gas-liquid interfacial reaction.

  17. Detection of pathogenic Leptospira spp. By polymerase chain reaction reaction (PCR targeting ligB gene

    Directory of Open Access Journals (Sweden)

    Fariba Fotohi

    2014-10-01

    Full Text Available Background: Leptospirosis is an emerging infectious disease and is considered to be the most widespread zoonotic disease in the world. LigB is an immunogenic outer membrane protein. The leptospiral ligB gene expressed only in pathogenic Leptospira spp. The aim of this study was molecular diagnosis of pathogen Leptospires by PCR based on ligB gene. Materials and Methods: Five pathogenic Leptospires: L. canicola, L. grippotyphosa, L. pomona, L. icterohaemorrhagiae, L. serjoe hardjo and saprophytic L. biflexa were used in this study. The bacteria were inoculated into the selective culture medium and extraction of the genomic DNA was performed by standard Phenol-Chlorophorm method. The specific primers for proliferation of ligB gene were designed. The specificity and sensitivity of PCR method was evaluated. Results: PCR product was 1041bp which indicated proliferation of ligB gene which was supported using electrophoresis. The PCR based on ligB gene detected all pathogenic reference serovars of Leptospira spp. tested. No PCR products were amplified from the non-pathogenic L. biflexa. Conclusion: Considering the spread of Leptosperosis in moderate and hot areas which have high rate of fall, a proper molecular diagnostic test with high specificity and sensitivity such as PCR is essential. PCR assay with high specificity and sensitivity may prove to be a rapid method for diagnosing acute leptospirosis. The results suggested that the PCR based on ligB gene can be used for detection of pathogenic leptospires.

  18. Bromine atom production and chain propagation during springtime Arctic ozone depletion events in Barrow, Alaska

    Science.gov (United States)

    Thompson, Chelsea R.; Shepson, Paul B.; Liao, Jin; Huey, L. Greg; Cantrell, Chris; Flocke, Frank; Orlando, John

    2017-03-01

    Ozone depletion events (ODEs) in the Arctic are primarily controlled by a bromine radical-catalyzed destruction mechanism that depends on the efficient production and recycling of Br atoms. Numerous laboratory and modeling studies have suggested the importance of heterogeneous recycling of Br through HOBr reaction with bromide on saline surfaces. On the other hand, the gas-phase regeneration of bromine atoms through BrO-BrO radical reactions has been assumed to be an efficient, if not dominant, pathway for Br reformation and thus ozone destruction. Indeed, it has been estimated that the rate of ozone depletion is approximately equal to twice the rate of the BrO self-reaction. Here, we use a zero-dimensional, photochemical model, largely constrained to observations of stable atmospheric species from the 2009 Ocean-Atmosphere-Sea Ice-Snowpack (OASIS) campaign in Barrow, Alaska, to investigate gas-phase bromine radical propagation and recycling mechanisms of bromine atoms for a 7-day period during late March. This work is a continuation of that presented in Thompson et al. (2015) and utilizes the same model construct. Here, we use the gas-phase radical chain length as a metric for objectively quantifying the efficiency of gas-phase recycling of bromine atoms. The gas-phase bromine chain length is determined to be quite small, at BrO self-reaction is not a sufficient estimate for the rate of O3 depletion.

  19. The moderating effect of product complexity on new product development and supply chain management integration

    NARCIS (Netherlands)

    Caniato, F.; Grössler, A.

    2015-01-01

    The purpose of this study is to investigate whether product complexity moderates the impact of integration programs in both new product development (NPD) and supply chain (SC) management on operational performance. Results are based on statistical analyses of data collected from an international

  20. The moderating effect of product complexity on new product development and supply chain management integration

    NARCIS (Netherlands)

    Caniato, F.; Grössler, A.

    2015-01-01

    The purpose of this study is to investigate whether product complexity moderates the impact of integration programs in both new product development (NPD) and supply chain (SC) management on operational performance. Results are based on statistical analyses of data collected from an international sam

  1. Shielding effects in polymer-polymer reactions. V. Concentration dependence of contact formation between star-branched and linear chains.

    Science.gov (United States)

    Nardai, Michael M; Zifferer, Gerhard

    2013-07-19

    By use of the Dissipative Particle Dynamics (DPD) simulation technique mixtures of star-branched (arm number F = 4) and linear chains in athermal (good) solvent are analyzed regarding probabilities for intermolecular contacts of various reactive sites within different polymer coils. The accompanying sterical hindrances are described in the framework of shielding factors in order to investigate reactions and side reactions in radical polymerization and other techniques that involve polymer-polymer coupling. The shielding factors are studied as a function of total concentration from high dilution up to the bulk for different chain lengths of star-shaped and linear chains. Results indicate that their concentration dependence can be described by a power law for systems above the overlap concentration, whereas the chain length dependence vanishes when extrapolating to infinite chain lengths in that concentration range. Also the influence of the ratio of star chains and linear chains is studied for various concentrations.

  2. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  3. Maillard reaction products in pet foods

    OpenAIRE

    Rooijen, van, J.

    2015-01-01

    Pet dogs and cats around the world are commonly fed processed commercial foods throughout their lives. Often heat treatments are used during the processing of these foods to improve nutrient digestibility, shelf life, and food safety. Processing is known to induce the Maillard reaction, in which a reducing sugar binds to a free reactive amino group of an amino acid. In intact proteins, the ε-amino group of lysine is the most abundant free amino group. The reaction reduces the bioavail...

  4. Heavy quark production in neutrino-nucleon reactions

    Energy Technology Data Exchange (ETDEWEB)

    Aguiar, C.E.M. de; Simoes, J.A.M. (Rio de Janeiro Univ. (Brazil). Inst. de Fisica); Garcia Canal, C.A. (La Plata Univ. Nacional (Argentina))

    1982-05-01

    The heavy quark production (charm and bottom) in neutrino-nucleon reactions is discussed. The greater interest is in the leptonic channels, in particular in the production of two charged leptons in the final state.

  5. Research on Nuclear Reaction Network Equation for Fission Product Nuclides

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    Nuclear Reaction Network Equation calculation system for fission product nuclides was developed. With the system, the number of the fission product nuclides at different time can be calculated in the different neutron field intensity and neutron energy spectra

  6. Collaborative production planning between supply chain partners by Lagrangian relaxation

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A collaborative planning framework based on the Lagrangian Relaxation was developed to coordinate and optimize the production planning of independent partners in multiple tier supply chains. Linking constraints and dependent demand constraints were added to the monolithic Multi-Level, multi-item Capacitated Lot Sizing Problem (MLCLSP). MLCLSP was Lagrangian relaxed and decomposed into facility-separable subproblems.Surrogate gradient algorithm was used to update Lagrangian multipliers, which coordinate decentralized decisions of the facilities. Production planning of independent partners could be appropriately coordinated and optimized by this framework without intruding their decision authorities and private information. Experimental results show that the proposed coordination mechanism and procedure come close to optimal results as obtained by central coordination.

  7. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend

    1993-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...

  8. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend

    1991-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...

  9. Effect of parity on productivity and sustainability of Lotka-Volterra food chains: bounded orbits in food chains.

    Science.gov (United States)

    Massarelli, Nicole; Hoffman, Kathleen; Previte, Joseph P

    2014-12-01

    Hairston, Slobodkin, and Smith conjectured that top down forces act on food chains, which opposed the previously accepted theory that bottom up forces exclusively dictate the dynamics of populations. We model food chains using the Lotka-Volterra predation model and derive sustainability constants which determine which species will persist or go extinct. Further, we show that the productivity of a sustainable food chain with even trophic levels is predator regulated, or top down, while a sustainable food chain with odd trophic levels is resource limited, which is bottom up, which is consistent with current ecological theory.

  10. Novel assay of competitively differentiated polymerase chain reaction for screening point mutation of hepatitis B virus

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Xue-Juan Chen; Jian-Guo Li; Lin Gu; Yang-Su Huang; Zhi-Liang Gao

    2003-01-01

    AIM: Point mutation, one of the commonest gene mutations,is the most important molecular pathogenesis of cancer and chronic infection. The commonest methods for detection of point mutation are based on polymerase chain reaction (PCR). These techniques, however, cannot be used in large scale screening since they are neither accurate nor simple.For this reason, this study established a novel method of competitively differentiated PCR (CD-PCR) for screening point mutation in clinical practice.METHODS: Two competitively differentiated primers for mutant-type and wild-type templates respectively with an identically complemented region in 3′ end except for last 2base pairs and a different non-complemented region in 5′end were designed. Thus, competitive amplification might be carried out at a lower annealing temperature at first, and then differentiated amplification at a higher annealing temperature when primers could not combine with initial templates. The amplification was performed in one-tube.The products of CD-PCR were detected using microplate hybridization assay. CD-PCR was evaluated by detecting G1896A variant of hepatitis B virus (HBV) in form of recombinant plasmids and in sera from patients with hepatitis B, and compared with allele-specific PCR (AS-PCR) and competitive AS-PCR.RESULTS: CD-PCR was successfully established. It could clearly distinguish wild-type and mutant-type plasmid DNA of G1896A variant when the amount of plasmid DNA was between 102-108copies/reaction, while for AS-PCR and competitive AS-PCR, the DNA amount was between 102-104copies/reaction. CD-PCR could detect one copy of G1896A variant among 10-100 copies of wild-type plasmid DNA. The specificity of CD-PCR was higher than those of AS-PCR and competitive AS-PCR in the detection of HBV G1896A variant in sera from patients with hepatitis B. CD-PCR was independent of the amount of HBV DNA in serum. HBV G1896A variant was more often found in HBeAg (-) patients with a lower level of

  11. The Heck reaction in the production of fine chemicals

    NARCIS (Netherlands)

    Vries, Johannes G. de

    2001-01-01

    An overview is given of the use of the Heck reaction for the production of fine chemicals. Five commercial products have been identified that are produced on a scale in excess of 1 ton/year. The herbicide Prosulfuron™ is produced via a Matsuda reaction of 2-sulfonatobenzenediazonium on 3,3,3-trifluo

  12. Stream of Reaction Products behind the Detonation Wave Front

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Embedded copper foils in a high explosive charge allow to see the stream of the reaction products behind the detonation front. With three individual firings in front of FXR it can be shown that the reaction products behind the detonation front are immediately going in the direction of the detonation front. But then the rarefaction fans are influencing strongly the further displacements.

  13. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wei-Ping Qian; Li-Ka Shing; Yue-Qiu Tan; Ying Chen; Ying Peng; Zhi Li; Guang-Xiu Lu; Marie C. Lin; Hsiang-Fu Kung; Ming-Ling He

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen.METHODS: Hepatitis B viral DNA was isolated from HBV carriers' semen and sera using phenol extraction method and QTAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction.RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5×107 and 1.67×107 copies of HBV DNA per mL in two HBV infected patients' sera, while 2.L4×105 and 3.02×105 copies of HBV DNA per mL in the semen.CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen.

  14. An optimized polymerase chain reaction assay to identify avian virus vaccine contamination with Chicken anemia virus.

    Science.gov (United States)

    Amer, Haitham M; Elzahed, Hanan M; Elabiare, Elham A; Badawy, Ahmed A; Yousef, Ausama A

    2011-01-01

    The use of embryonating chicken eggs in preparation of avian virus vaccines is the principle cause for contamination with Chicken anemia virus (CAV). Identification of CAV in contaminated vaccines relies on the expensive, tedious, and time-consuming practice of virus isolation in lymphoblastoid cell lines. The experience of the last 2 decades indicates that polymerase chain reaction is extending to replace most of the classic methods for detection of infectious agents. In the present report, a simple, rapid, and accurate polymerase chain reaction method for detection of CAV in poultry vaccines is described. Oligonucleotide primers homologous to highly conserved sequences of the VP1 gene were used to amplify a fragment of 676 bp. The developed assay was specific for detecting CAV from different sources, with no cross reactivity with many avian viruses. No inter- and intra-assay variations were observed. The analytical sensitivity of the test was high enough to detect 5 TCID(50) (50% tissue culture infective dose) of the virus per reaction; however, different factors related to the vaccine matrix showed considerable effects on the detection limit. In conclusion, this method may represent a suitable alternative to virus isolation for identification of CAV contamination of poultry virus vaccines.

  15. Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

    Directory of Open Access Journals (Sweden)

    Wen-Pin Chou

    2017-02-01

    Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

  16. How will Smart City Production Systems Transform Supply Chain Design: a Product-level investigation

    OpenAIRE

    Kumar, M.; Graham, G; Hennelly, P; Srai, J. S.

    2016-01-01

    This is the accepted manuscript. It is currently embargoed pending publication. This paper is a first step to understand the role that a smart city with a distributed production system could have in changing the nature and form of supply chain design. Since the end of the Second World War most supply chain systems for manufactured products have been based on “scale economies” and “bigness”; in our paper we challenge this traditional view. Our fundamental research question is: how could a s...

  17. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    Science.gov (United States)

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2016-04-01

    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay.

  18. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    Science.gov (United States)

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society.

  19. Maillard reaction products in pet foods

    NARCIS (Netherlands)

    Rooijen, van C.

    2015-01-01

    Pet dogs and cats around the world are commonly fed processed commercial foods throughout their lives. Often heat treatments are used during the processing of these foods to improve nutrient digestibility, shelf life, and food safety. Processing is known to induce the Maillard reaction, in which a

  20. Maillard reaction products in pet foods

    NARCIS (Netherlands)

    Rooijen, van C.

    2015-01-01

    Pet dogs and cats around the world are commonly fed processed commercial foods throughout their lives. Often heat treatments are used during the processing of these foods to improve nutrient digestibility, shelf life, and food safety. Processing is known to induce the Maillard reaction, in which a r

  1. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping, E-mail: dianping.tang@fzu.edu.cn

    2013-06-14

    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling.

  2. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    1993-01-01

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  3. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline;

    2015-01-01

    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma...

  4. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  5. Pesticide governance in export supply chains: the case of vegetable and fruit production in Vietnam

    NARCIS (Netherlands)

    Pham Van Hoi,; Mol, A.P.J.; Oosterveer, P.J.M.

    2010-01-01

    We analyze the role of international agrofood supply chains in greening vegetable and fruit products and production in Vietnam. Mainly through contract-based procurement, the export- oriented vegetable and fruit supply chain is better structured and organized than the domestic supply chain. Exporter

  6. The Chain Information Model: a systematic approach for food product development

    NARCIS (Netherlands)

    Benner, M.

    2005-01-01

    The chain information model has been developed to increase the success rate of new food products. The uniqueness of this approach is that it approaches the problem from a chain perspective and starts with the consumer. The model can be used to analyse the production chain in a systematic way. This

  7. The Chain Information Model: a systematic approach for food product development

    NARCIS (Netherlands)

    Benner, M.

    2005-01-01

    The chain information model has been developed to increase the success rate of new food products. The uniqueness of this approach is that it approaches the problem from a chain perspective and starts with the consumer. The model can be used to analyse the production chain in a systematic way. This r

  8. Rapid diagnosis of invasive pulmonary aspergillosis by quantitative polymerase chain reaction using bronchial lavage fluid.

    Science.gov (United States)

    Kawazu, Masahito; Kanda, Yoshinobu; Goyama, Susumu; Takeshita, Masataka; Nannya, Yasuhito; Niino, Miyuki; Komeno, Yukiko; Nakamoto, Tetsuya; Kurokawa, Mineo; Tsujino, Shiho; Ogawa, Seishi; Aoki, Katsunori; Chiba, Shigeru; Motokura, Toru; Ohishi, Nobuya; Hirai, Hisamaru

    2003-01-01

    Polymerase chain reaction (PCR) is a sensitive method for detection of Aspergillus DNA in bronchoalveolar lavage fluid, but it has not yet been able to distinguish infection from contamination. We have established a technique to quantify Aspergillus DNA using a real-time PCR method to resolve this problem, and we report herein a successful application of real-time PCR to diagnose invasive pulmonary aspergillosis by comparing the amount of Aspergillus DNA in bronchial lavage fluid from an affected area to that from an unaffected area. This novel tool will provide rapid, sensitive, and specific diagnosis of pulmonary aspergillosis.

  9. Toxocara polymerase chain reaction on ocular fluids in bilateral granulomatous chorioretinitis

    Directory of Open Access Journals (Sweden)

    Tian JX

    2015-05-01

    Full Text Available Jenny Xue Tian,1 Stephen O’Hagan2 1Ophthalmology Department, Cairns Base Hospital, Cairns, QLD, Australia; 2Ophthalmology, James Cook University, Cairns, QLD, Australia Abstract: To report a rare case of bilateral granulomatous chorioretinitis complicated by bilateral peripapillary choroidal neovascular membranes. This is the first reported case in Australia where intravitreal injections of anti-vascular endothelial growth factor ranibizumab were used to successfully treat choroidal neovascular membrane caused by granulomatous chorioretinitis. This is also the first reported case in Australia of Toxocara polymerase chain reaction being performed on intraocular fluids. Keywords: granulomatous chorioretinitis, ocular toxocariasis, neovascular membrane, anti-VEGF

  10. Low predictive value of polymerase chain reaction for diagnosis of cytomegalovirus disease in liver transplant recipients.

    Science.gov (United States)

    Delgado, R; Lumbreras, C; Alba, C; Pedraza, M A; Otero, J R; Gómez, R; Moreno, E; Noriega, A R; Payá, C V

    1992-07-01

    The polymerase chain reaction (PCR) and viral culture techniques were prospectively compared for the detection of cytomegalovirus (CMV) in blood samples from 24 liver transplant recipients. Nine patients had one or more episodes of viremia, seven of which were clinically symptomatic infections. All samples in which CMV was isolated by culture were positive by the PCR. However, the PCR result was also positive for one or more samples from 11 patients who never developed CMV-related symptoms. Although the PCR is a very sensitive technique for CMV detection in blood samples from liver transplant recipients, it is not useful as a marker of symptomatic CMV disease.

  11. [Detection of leptospirosis reservoirs in Madagascar using the polymerase chain reaction technique].

    Science.gov (United States)

    Ralaiarijaona, R L; Bellenger, E; Chanteau, S; Roger, F; Pérolat, P; Rasolofo Razanamparany, V

    2001-01-01

    A polymerase chain reaction (PCR) technique was used for detection of the Leptospira interrogans rrs gene in kidney tissue from 115 rats, 50 zebu cattles and 13 pigs in an attempt to identify a possible animal reservoir of leptospirosis in Madagascar. In addition, serological testing of 105 individuals in close contact with animals was carried out. The PCR analysis was negative for all the samples tested and only one person was found seropositive at a low titer. The findings suggest that leptospirosis, if prevalent in Madagascar, is likely rare.

  12. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    Science.gov (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples.

  13. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  14. Multiplex polymerase chain reaction tests for detection of pathogens associated with gastroenteritis.

    Science.gov (United States)

    Zhang, Hongwei; Morrison, Scott; Tang, Yi-Wei

    2015-06-01

    A wide range of enteric pathogens can cause infectious gastroenteritis. Conventional diagnostic algorithms are time-consuming and often lack sensitivity and specificity. Advances in molecular technology have provided new clinical diagnostic tools. Multiplex polymerase chain reaction (PCR)-based testing has been used in gastroenterology diagnostics in recent years. This article presents a review of recent laboratory-developed multiplex PCR tests and current commercial multiplex gastrointestinal pathogen tests. It focuses on two commercial syndromic multiplex tests: Luminex xTAG Gastrointestinal Pathogen Panel and BioFire FilmArray gastrointestinal test. Multiplex PCR tests have shown superior sensitivity to conventional methods for detection of most pathogens.

  15. DNA from oral bacteria by sodium hydroxide-paper method suitable for polymerase chain reaction.

    Science.gov (United States)

    Lefimil, Claudia; Lozano, Carla; Morales-Bozo, Irene; Plaza, Anita; Maturana, Cristian; Urzúa, Blanca

    2013-02-15

    In the oral cavity, we can find a complex mixture of microorganisms, commensals, and pathogens. The studies of normal oral microbiota, as well as the studies of much oral pathology (e.g., caries, periodontitis), involve the isolation and cultivation of these microorganisms and their molecular analysis. The aim of this study was to validate a quick, easy, efficient, and inexpensive DNA extraction method for the recovery of genomic DNA from gram-positive and gram-negative oral bacteria to be used in polymerase chain reaction amplification. This method worked great with all samples analyzed, providing an approach to extract DNA for different microorganisms. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. [Identification of the causative agents of glanders and melioidosis by polymerase chain reaction].

    Science.gov (United States)

    Tkachenko, G A; Antonov, V A; Zamaraev, V S; Iliukhin, V I

    2003-01-01

    Burkholderia mallei and B. pseudomallei are causative agents of glanders and melioidosis, respectively, i.e. severe and fatal infection diseases of man and animal. The computer-based analysis of the 23S rRNA gene sites was used for selecting the primers. Two pairs of primers were chosen for the identification of B. mallei and Bpseudomallei. DNAs from 48 B. pseudomallei and 15 strains of B. mallei, unlike from other geterological bacteria, were positively amplified. Therefore, the method of polymerase chain reaction can be used in laboratory diagnosis of glanders and melioidosis.

  17. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan

    2004-01-01

    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  18. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...... and efficient method for switching the liquid flow between the PT and PCR chamber. Purification of human genomic DNA from EDTA-treated blood and multiplex PCR were successfully carried out on-chip using the developed lab-on-a-chip system....

  19. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  20. Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.

    Science.gov (United States)

    Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck

    2013-01-01

    Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

  1. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    Science.gov (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland.

  2. Development and validation of a Myxoma virus real-time polymerase chain reaction assay

    OpenAIRE

    Albini, S; Sigrist, B; Guttinger, R; Schelling, C; Hoop, R K; Vogtlin, A

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  3. Study on Inventory of Supply Chain of Supermarket-oriented Agricultural Products

    Institute of Scientific and Technical Information of China (English)

    Hong; HUO; Xin; SHEN; Zhipeng; Huang

    2013-01-01

    Using principle and method of the system dynamics,this paper takes a qualitative analysis on the inventory of supply chain of supermarket-oriented agricultural products,and compares with the supply chain of wholesale-oriented agricultural products. Two inventory models are established for these two different modes of supply chain. Through simulation of two models in the case of random demand and quantitative analysis of results,it is found that the inventory of supply chain of supermarket-oriented agricultural products has smaller fluctuation than that of wholesaler-oriented agricultural products. Besides,both the inventory level and bullwhip effect of above chain are lowered.

  4. Production of Radioactive Nuclides in Inverse Reaction Kinematics

    CERN Document Server

    Traykov, E; Dendooven, P; Dermois, O C; Jungmann, K; Onderwater, G; Rogachevskiy, A; Sohani, M; Willmann, L; Wilschut, H W; Young, A R

    2006-01-01

    Efficient production of short-lived radioactive isotopes in inverse reaction kinematics is an important technique for various applications. It is particularly interesting when the isotope of interest is only a few nucleons away from a stable isotope. In this article production via charge exchange and stripping reactions in combination with a magnetic separator is explored. The relation between the separator transmission efficiency, the production yield, and the choice of beam energy is discussed. The results of some exploratory experiments will be presented.

  5. Identifiability of parameters and behaviour of MCMC chains: a case study using the reaction norm model.

    Science.gov (United States)

    Shariati, M M; Korsgaard, I R; Sorensen, D

    2009-04-01

    Markov chain Monte Carlo (MCMC) enables fitting complex hierarchical models that may adequately reflect the process of data generation. Some of these models may contain more parameters than can be uniquely inferred from the distribution of the data, causing non-identifiability. The reaction norm model with unknown covariates (RNUC) is a model in which unknown environmental effects can be inferred jointly with the remaining parameters. The problem of identifiability of parameters at the level of the likelihood and the associated behaviour of MCMC chains were discussed using the RNUC as an example. It was shown theoretically that when environmental effects (covariates) are considered as random effects, estimable functions of the fixed effects, (co)variance components and genetic effects are identifiable as well as the environmental effects. When the environmental effects are treated as fixed and there are other fixed factors in the model, the contrasts involving environmental effects, the variance of environmental sensitivities (genetic slopes) and the residual variance are the only identifiable parameters. These different identifiability scenarios were generated by changing the formulation of the model and the structure of the data and the models were then implemented via MCMC. The output of MCMC sampling schemes was interpreted in the light of the theoretical findings. The erratic behaviour of the MCMC chains was shown to be associated with identifiability problems in the likelihood, despite propriety of posterior distributions, achieved by arbitrarily chosen uniform (bounded) priors. In some cases, very long chains were needed before the pattern of behaviour of the chain may signal the existence of problems. The paper serves as a warning concerning the implementation of complex models where identifiability problems can be difficult to detect a priori. We conclude that it would be good practice to experiment with a proposed model and to understand its features

  6. Massive production of nanoparticles via mist reaction

    Science.gov (United States)

    Liu, Ran; Liu, Lei; Liu, Jing

    2009-06-01

    A novel conceptual nanoparticle fabrication method is proposed in this paper. It can be easily implemented for the preparation of micro or nanoparticles through a reaction between mists with different specific chemical compounds produced by ultrasonic atomization technology. Ultrasonic atomization is an established technology that easily atomizes liquid to produce very small droplets-in the orders of tens to hundreds of micrometers. The results reveal that metal oxide nanoparticles, such as iron oxide can be massively produced via reactions between metal chlorides and sodium carbonate in an experimental set-up based on physical and chemical principles. The density of the nanoparticle distribution is also investigated and determined to be dependent on the amount of mist reacted and the collection time. Moreover, since the vibrational frequency of ultrasound can be adjusted, we can control the size of micro-droplets of reactants, hence producing particles of different dimensions. Given that the double mist reaction method is easily controllable, environmentally friendly and extremely low in cost, it can potentially become a significant method for making micro/nano particles in the newly emerging field of nanofabrication and integration.

  7. Torrefaction of residues and by-products from sunflower chain

    Directory of Open Access Journals (Sweden)

    G. Riva

    2013-09-01

    Full Text Available The high heterogeneity of some residual biomasses makes rather difficult their energy use and standardisation is a key aspect for these fuel products. Torrefaction is an interesting process used to improve the quality of ligno-cellulosic biomasses and to achieve standardisation. In the present study torrefaction has been employed on residues and by-products deriving from sunflower production chain, in particular sunflower stalks and oil press cake. The thermal behaviour of materials has been studied at first by thermo-gravimetric analysis in order to identify torrefaction temperatures range. Different residence time and torrefaction temperatures have been employed in a bench top torrefaction reactor afterwards. Analyses of raw and torrefied materials have been carried out to assess the influence of the process. As a consequence of torrefaction, the carbon and ash contents increase while the volatilisation range is reduced making the material more stable and standardised. Mass yield, energy yield and energy densification reach values of about 60 %, 80 % and 1.33 for sunflower stalks and 64 %, 85 % and 1.33 for sunflower oil press cake respectively. As highlighted by results, torrefaction is more interesting for sunflower stalks than oil cake and husks because of the different starting characteristics. Untreated oil cake and husks already show a good high heating value and the eventual torrefaction should be mild. On the contrary for sunflower stalks the process is more useful and could be more severe.

  8. Scenarios for the milk production chain in Brazil in 2020

    Directory of Open Access Journals (Sweden)

    Renata Giovinazzo Spers

    2013-06-01

    Full Text Available Brazilian milk production has grown steadily and in 2004 the country became self-sufficient in dairy production. This article develops possible scenarios for the milk production chain in Brazil for the year 2020 in order to contribute to decisions that must be made by stakeholders. A literature review on foresight and the use of scenarios was conducted, and a scenario writing approach based on Wright and Spers (2006 was adopted, which includes the use of the Delphi method, Michael Porter's Five Competitive Forces model, Interpretative Structural Modeling (ISM (WRIGHT, 1991 and quantitative projections. This methodology provided four scenarios, with quantitative and qualitative elements: two exploratory scenarios ("milk, the new agribusiness star" and "a wasted future", a most probable scenario ("continuous but uneven growth" and a desired scenario ("competitive family agriculture". Overall, it is possible to note many market opportunities, as well as niche markets and the strengthening of cooperatives. Future prospects are also favorable to the dairy industry in general, but nearly all scenarios point to a concentration in the industrial sphere.

  9. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  10. Amplification refractory mutation system polymerase chain reaction versus optimized polymerase chain reaction restriction-fragment length polymorphism for apolipoprotein E genotyping of majorly depressed patients.

    Science.gov (United States)

    You, Hongmin; Chen, Jin; Zhou, Jingjing; Huang, Hua; Pan, Junxi; Wang, Ziye; Lv, Lin; Zhang, Lujun; Li, Juan; Qin, Bin; Yang, Yongtao; Xie, Peng

    2015-11-01

    Major depressive disorder (MDD) is a prevalent, debilitating mood disorder that has been associated with several genetic polymorphisms. One such polymorphism, namely that of apolipoprotein E (APOE), has three allelic forms (ε2, ε3 and ε4) that encode for six unique isoforms of the APOE protein. A growing number of techniques have been developed for APOE genotyping; however, not all polymerase chain reaction (PCR)‑based genotyping techniques are equally accurate or cost‑effective. In order to find a more accurate and cost‑effective APOE genotyping method for MDD screening in large populations, the present study comparatively evaluated two genotyping methods, amplification refractory mutation system PCR (ARMS‑PCR) and optimized PCR restriction‑fragment length polymorphism (PCR‑RFLP), in blood samples taken from a population of 708 MDD patients. Although either of the two methods were able to detect all six unique APOE genotypes, comparisons of the two methods with Sanger sequencing demonstrated that ARMS‑PCR (94%) was significantly more accurate than optimized PCR‑RFLP (82%). ARMS‑PCR should prove useful in quickly verifying ambiguous results obtained by other APOE genotyping methods and can be cost-effectively performed in the setting of a small laboratory or a population-based screening program.

  11. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  12. Comparison of a conventional polymerase chain reaction with real-time polymerase chain reaction for the detection of neurotropic viruses in cerebrospinal fluid samples

    Directory of Open Access Journals (Sweden)

    M Ramamurthy

    2011-01-01

    Full Text Available Purpose : To compare a conventional polymerase chain reaction (PCR and real-time PCR for the detection of neurotropic DNA viruses. Materials and Methods : A total of 147 cerebrospinal fluid (CSF samples was collected from patients attending a tertiary care hospital in South India for a period from 2005 to 2008. All these samples were tested using a conventional multiplex/uniplex PCR and a real-time multiplex/uniplex PCR. This technique was used to detect a large number of herpes viruses responsible for central nervous system infections, including HSV-1, HSV-2, VZV, CMV and EBV and the polyoma virus JCV. Results : Overall, in the entire set of samples, the real-time PCR yielded 88 (59.9% positives and conventional PCR had six (4.1% positives. Conclusion : Our results suggest that the real-time PCR assay was more sensitive compared with the conventional PCR. The advantage of real-time PCR is that it can be performed much faster than conventional PCR. Real-time PCR is less time-consuming, less labour-intensive and also reduces the chance of contamination as there is no post-amplification procedure. In the entire study population, the major viruses detected using real-time PCR were EBV (34%, HSV-2 (10.8% and VZV (6.8%.

  13. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility

    Science.gov (United States)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young

    2008-06-01

    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  14. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan

    2001-01-01

    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......) x s(-1)) > backbone amides (10-10(-3) M(-1) x s(-1)) > Gln(0.03 M(-1) x s(-1)) approximately Asn (0.03 M(-1) x s(-1)). The rate constants for reaction of HOCl with backbone amides (peptide bonds) vary by 4 orders of magnitude with uncharged peptide bonds reacting more readily with HOCl than those...

  15. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  16. SWOT Analysis of Agricultural Producers in the Supply Chain of Chinese Agro-products

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    On the basis of defining the producers in the supply chain of agricultural products,the SWOT analysis is adopted to analyze the advantages,disadvantages,opportunities and threats of producers in the supply chain of Chinese agricultural products.The paper analyzes the advantages of producers in the supply chain of agricultural products from three aspects including land resources,technology level of producers and input costs.The disadvantages of producers in the supply chain of agricultural products are analyzed from three aspects including scale level,mechanization and technology level and profit level.The opportunities of producers in the supply chain of agricultural products are analyzed from the aspects of laws,policies,capitals and technologies.The threats confronted by the producers in the supply chain of agricultural products are analyzed from foreign producers,negotiation control of supply chain of agricultural chain,environment protection and quality safety standard.On the basis of the analysis,the relevant suggestions on facilitating the interests of producers in the supply chain of Chinese agricultural products are put forward,including fully displaying the advantages of land resources;improving the knowledge and technology level of supply chain of agricultural production;establishing the alliances of producers of agricultural products to expand production scale;improving the quality of agricultural products to satisfy the relevant safety quality standard and environmental protection standard.

  17. Effective Supply Chain Management Strategy for Food Products: An Insight to Linked Partnerships

    OpenAIRE

    Witaya Krajaysri

    2010-01-01

    This paper explores and extends the supply chain management strategy for food products effectively and efficiently through analysis of insights to linked partnerships within the supply chain due to the possibility of a global food crisis. The required solution is a collaboration of all parties in the supply chain since an effective supply chain management strategy (ESCMS) for food products is through proper insight between linked partnerships, including customer satisfaction through service q...

  18. Construction of Network Management Information System of Agricultural Products Supply Chain Based on 3PLs

    OpenAIRE

    Gao, Shujin; Yang, Qiangxian

    2010-01-01

    The necessity to construct the network management information system of 3PLs agricultural supply chain is analyzed, showing that 3PLs can improve the overall competitive advantage of agricultural supply chain. 3PLs changes the homogeneity management into specialized management of logistics service and achieves the alliance of the subjects at different nodes of agricultural products supply chain. Network management information system structure of agricultural products supply chain based on 3PL...

  19. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.

    2009-01-01

    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  20. Multivariate High Order Statistics of Measurements of the Temporal Evolution of Fission Chain-Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Mattingly, J.K.

    2001-03-08

    The development of high order statistical analyses applied to measurements of the temporal evolution of fission chain-reactions is described. These statistics are derived via application of Bayes' rule to conditional probabilities describing a sequence of events in a fissile system beginning with the initiation of a chain-reaction by source neutrons and ending with counting events in a collection of neutron-sensitive detectors. Two types of initiating neutron sources are considered: (1) a directly observable source introduced by the experimenter (active initiation), and (2) a source that is intrinsic to the system and is not directly observable (passive initiation). The resulting statistics describe the temporal distribution of the population of prompt neutrons in terms of the time-delays between members of a collection (an n-tuplet) of correlated detector counts, that, in turn, may be collectively correlated with a detected active source neutron emission. These developments are a unification and extension of Rossi-a, pulsed neutron, and neutron noise methods, each of which measure the temporal distribution of pairs of correlated events, to produce a method that measures the temporal distribution of n-tuplets of correlated counts of arbitrary dimension n. In general the technique should expand present capabilities in the analysis of neutron counting measurements.

  1. PEMERIKSAAN BAKTERI LEPTOSPIRA PADA SAMPEL DARAH MANUSIA SUSPECT LEPTOSPIROSIS MENGGUNAKAN METODE PCR (POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Sefrita Tri Utami

    2014-01-01

    Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR

  2. Solving the SAT problem using a DNA computing algorithm based on ligase chain reaction.

    Science.gov (United States)

    Wang, Xiaolong; Bao, Zhenmin; Hu, Jingjie; Wang, Shi; Zhan, Aibin

    2008-01-01

    A new DNA computing algorithm based on a ligase chain reaction is demonstrated to solve an SAT problem. The proposed DNA algorithm can solve an n-variable m-clause SAT problem in m steps and the computation time required is O (3m+n). Instead of generating the full-solution DNA library, we start with an empty test tube and then generate solutions that partially satisfy the SAT formula. These partial solutions are then extended step by step by the ligation of new variables using Taq DNA ligase. Correct strands are amplified and false strands are pruned by a ligase chain reaction (LCR) as soon as they fail to satisfy the conditions. If we score and sort the clauses, we can use this algorithm to markedly reduce the number of DNA strands required throughout the computing process. In a computer simulation, the maximum number of DNA strands required was 2(0.48n) when n=50, and the exponent ratio varied inversely with the number of variables n and the clause/variable ratio m/n. This algorithm is highly space-efficient and error-tolerant compared to conventional brute-force searching, and thus can be scaled-up to solve large and hard SAT problems.

  3. Process Reengineering of Cold Chain Logistics of Agricultural Products Based on Low-carbon Economy

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    Through the process analysis of cold chain logistics of agricultural products,we find that cold chain logistics of agricultural products contradict the development model of low-carbon economy to some extent.We apply the development idea of low-carbon economy,introduce the thirdparty logistics companies,establish distribution center of cold chain logistics of agricultural products,and strengthen information sharing,to reengineer the process of cold chain logistics of agricultural products in China.The results show that applying low-carbon economy to process reengineering of cold chain logistics of agricultural products,has advantages of increasing added value of products,promoting scale merit and abating lag,plays a role in promoting emission reduction,high efficiency and environmental protection in the process of cold chain logistics of agricultural products in China.

  4. Rapid method utilizing the polymerase chain reaction for detection of canine parvovirus in feces of diarrheic dogs.

    Science.gov (United States)

    Uwatoko, K; Sunairi, M; Nakajima, M; Yamaura, K

    1995-03-01

    By using primers based on the sequence of the VP2 gene of canine parovirus (CPV), we established a rapid and specific assay for identification of the virus from fecal specimens based on the polymerase chain reaction (PCR). By use of a pair of primers, a specific 226-bp sequence was amplified by the PCR. All strains of CPV tested gave a specific amplification product by the PCR, while neither porcine parovirus nor host cell did so. The PCR assay can detect fewer particles of CPV than the conventional methods, being able to detect CPV from fecal specimens in a rapid manner, provided that gel filtration of the samples through a spun column was done to remove inhibitory substances from the fecal specimens. These results suggest that the PCR assay can detect the presence of CPV in dogs early enough to prevent secondary infection by CPV in veterinary hospitals.

  5. Quantification of Porcine Follicle-stimulating Hormone Receptor Messenger Ribonucleic Acid by Reverse Transcription-competitive Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    An easy and reliable method was developed for construction and quantification of competitive templates, which shared the same sequence as the amplified target DNA except for a 20-bp insertion in the middle by recombinant polymerase chain reaction (PCR). Among the advantages of competitive PCR is that any predictable or unpredictable variable that affects amplification has the same effect on both target and competitor species and that the final ratio of amplified products reflects exactly the initial targets. The utilization of a thermostable reverse transcriptase in the RT step was proposed to overcome the problem of the efficiency of target cDNA synthesis. In addition, to obtain reliable measurements, it was recommended to perform four PCR with amounts of competitive template flanking the concentration of the target mRNA.

  6. Evaluation of Chlamydophila abortus DNA extraction protocols for polymerase chain reaction diagnosis in paraffin-embedded tissues.

    Science.gov (United States)

    Ortega, Nieves; Navarro, José A; Nicolás, Laura; Buendía, Antonio J; Caro, María R; Del Río, Laura; Martínez, Carlos M; Cuello, Francisco; Salinas, Jesús; Gallego, María C

    2007-07-01

    Polymerase chain reaction (PCR) has gained increasing importance as a tool for directly demonstrating the presence of Chlamydophila in the placentas of aborted sheep and goats. However, because of the zoonotic potential of the disease, it is advisable to use fixed materials. To evaluate 4 different DNA extraction protocols in paraffin-embedded sections for PCR, previously immunohistochemically diagnosed placental samples from outbreaks of abortions in goats and sheep were used. The samples were also used to evaluate the effect of the duration of fixation in formalin on PCR. A protocol that uses Tris-HCl pH 8.5 with EDTA and subsequent digestion with proteinase K was found to be an easy protocol for obtaining excellent PCR products for Chlamydophila abortus diagnosis from formalin-fixed and paraffin-embedded specimens. It was also found that if samples are fixed in formalin for more than 2 weeks, the PCR technique is affected more adversely than immunohistochemical methods.

  7. Products of the Benzene + O(3P) Reaction

    Energy Technology Data Exchange (ETDEWEB)

    Taatjes, Craig A.; Osborn, David L.; Selby, Talitha M.; Meloni, Giovanni; Trevitt, Adam J.; Epifanovsky, Evgeny; Krylov, Anna I.; Sirjean, Baptiste; Dames, Enoch; Wang, Hai

    2009-12-21

    The gas-phase reaction of benzene with O(3P) is of considerable interest for modeling of aromatic oxidation, and also because there exist fundamental questions concerning the prominence of intersystem crossing in the reaction. While its overall rate constant has been studied extensively, there are still significant uncertainties in the product distribution. The reaction proceeds mainly through the addition of the O atom to benzene, forming an initial triplet diradical adduct, which can either dissociate to form the phenoxy radical and H atom, or undergo intersystem crossing onto a singlet surface, followed by a multiplicity of internal isomerizations, leading to several possible reaction products. In this work, we examined the product branching ratios of the reaction between benzene and O(3P) over the temperature range of 300 to 1000 K and pressure range of 1 to 10 Torr. The reactions were initiated by pulsed-laser photolysis of NO2 in the presence of benzene and helium buffer in a slow-flow reactor, and reaction products were identified by using the multiplexed chemical kinetics photoionization mass spectrometer operating at the Advanced Light Source (ALS) of Lawrence Berkeley National Laboratory. Phenol and phenoxy radical were detected and quantified. Cyclopentadiene and cyclopentadienyl radical were directly identified for the first time. Finally, ab initio calculations and master equation/RRKM modeling were used to reproduce the experimental branching ratios, yielding pressure-dependent rate expressions for the reaction channels, including phenoxy + H, phenol, cyclopentadiene + CO, which are proposed for kinetic modeling of benzene oxidation.

  8. Quantitation of Maillard reaction products in commercially available pet foods

    NARCIS (Netherlands)

    Rooijen, van C.; Bosch, G.; Poel, van der A.F.B.; Wierenga, P.A.; Alexander, L.; Hendriks, W.H.

    2014-01-01

    During processing of pet food, the Maillard reaction occurs, which reduces the bioavailability of essential amino acids such as lysine and results in the formation of advanced Maillard reaction products (MRPs). The aim of this study was to quantitate MRPs (fructoselysine (FL), carboxymethyllysine

  9. Isolation and identification of Mycoplasma agalactiae by culture and polymerase chain reaction (PCR) from affected sheep to Contagious agalactia of Khuzestan province, Iran

    OpenAIRE

    Pooladgar, A.R.; Looni, R.,; Ghaemmaghami, Sh.; Pourbakhsh, A.; Ashtari, A.; Ali Shirudi, A.

    2015-01-01

    Mycoplasma agalactiae (M. agalactiae) is one of the main causes of contagious agalactia, an infectious syndrome of sheep and goats in Khuzestan province –southwest of Iran that is characterized by mastitis and subsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. This study was carried out to isolation and identification of M. agalactiae with culture and polymerase chain reaction (PCR) method from sheep in Khuzestan province, Iran. A total of 91 samples were col...

  10. Studies on Absorption and Elimination of Dietary Maillard Reaction Products

    National Research Council Canada - National Science Library

    FÖRSTER, ANKE; KÜHNE, YVONNE; HENLE, T.OMAS

    2005-01-01

    A bstract : A nine‐day dietary study involving 18 healthy volunteers was performed in order to investigate the influence of nutrition on the urinary excretion of the Maillard reaction products (MRPs...

  11. Cyclometalation reactions five-membered ring products as universal reagents

    CERN Document Server

    Omae, Iwao

    2014-01-01

    Offering unrivalled breadth of coverage on the topic, this review of cyclometalation reactions and organometallic intramolecular-coordination five-membered ring products includes discussion of vital commercial aspects such as synthetic applications.

  12. ISOLASI Campylobacter DARI KARKAS AYAM MENGGUNAKAN METODE KONVENSIONAL DAN POLYMERASE CHAIN REACTIONS [Isolation of Campylobacter from Poultry Carcasses using Conventional and Polymerase Chain Reaction Methods

    Directory of Open Access Journals (Sweden)

    Surachmi Setiyaningsih2

    2013-06-01

    Full Text Available Campylobacter jejuni and Campylobacter coli are two spesies of Campylobacter sp. frequently found as pathogenic bacteria causing human gastrointestinal infections. Contaminated chicken carcasses have been reported as the source of human campylobacteriosis. In this study, Campylobacter were isolated from chicken carcasses sold in traditional markets and supermarkets. In traditional markets, chicken carcasses are sold without proper packaging or in an open space and stored at room temperature (25-30°C for prolonged period allowing pathogenic bacteria to grow. While at supermarkets, chicken carcasses are openly displayed or enclosed in plastic wrappings and stored in a refrigerator (4-8°C. A total of 298 samples of chicken carcasses from traditional markets and supermarkets in the area of DKI Jakarta, West Java (Bogor and Sukabumi and Central Java (Kudus and Demak were collected. Isolation and identification using conventional and Polymerase Chain Reactions (PCR methods were done to determine the prevalence of C. jejuni and C. coli contamination in poultry. The results showed that chicken carcasses sold in the sampling area, both traditional markets and supermarkets, were contaminated with C. jejuni and C. coli. The contamination rate of Campylobacter sp. in chicken carcasses sold in supermarkets, were 14.1% by conventional methods and 29.5% by PCR. This was higher than those in traditional markets, i.e. 5.7 and 12.1%, respectively. It is also confirmed that the prevalence for contamination of C. jejuni was higher than C. coli in 298 samples, i.e. 16.1% and 3.7% by conventional method and 23.5% and 18.1% by PCR method respectively.

  13. Charmonium production in p̄-induced reactions on nuclei

    Directory of Open Access Journals (Sweden)

    Larionov Alexei

    2014-01-01

    Full Text Available The production of charmonia in the antiproton-nucleus reactions at plab = 3 − 10 GeV/c is studied within the Glauber model and the generalized eikonal approximation. The main reaction channel is charmonium formation in an antiproton-proton collision. The target mass dependence of the charmonium transparency ratio allows to determine the charmonium-nucleon cross section. The polarization effects in the production of χc2 states are evaluated.

  14. Charmonium production in $\\bar p$-induced reactions on nuclei

    CERN Document Server

    Larionov, Alexei; Gillitzer, Albrecht; Strikman, Mark

    2014-01-01

    The production of charmonia in the antiproton-nucleus reactions at $p_{\\rm lab}=3-10$ GeV/c is studied within the Glauber model and the generalized eikonal approximation. The main reaction channel is charmonium formation in an antiproton-proton collision. The target mass dependence of the charmonium transparency ratio allows to determine the charmonium-nucleon cross section. The polarization effects in the production of $\\chi_{c2}$ states are evaluated.

  15. 肉制品中牛源性成分荧光定量聚合酶链式反应方法的建立与应用%Establish and Application of a Real-Time Fluorescence-Based Polymerase Chain Reaction Assay for Detection of Bovine-Derived Materials in Meat Products

    Institute of Scientific and Technical Information of China (English)

    苗丽; 李志娟; 王珊; 张秀平; 陈静

    2015-01-01

    A real-time fluorescence-based polymerase chain reaction (PCR) assay that enables rapid and accurate identification of adulterated beef products was developed usingTaqMan probe for the rapid and effective detection of bovine-derived materials in meat products. A pair of specific primers andTaqMan probe was designed according to the conserved sequence of the bovine β-actingene. PCR reaction conditions were optimized using pMD-18T-96-beef plasmid as standard. The results showed that the pMD-18T-96-beef plasmid was confirmed to be valid by PCR, sequencing and enzyme digestion and the developed standard curve produced a good linear relationship betweenCt value and initial amounts of total DNA with correlation coefficient and slope of 0.98 and−3.345, respectively. The sensitivity was 46.1 copies/µL. No cross-reactions were found in specimens containing pork, mutton, chicken, duck and goose. The intra- and inter-assay variable coefficients were less than 0.98% and 0.33%, respectively, suggesting good repeatability. A total of 40 beef product samples from the market were measured by this method and the routine real-time PCR method from the industry standard SN/T 2051—2008. Of the 40 samples, 3 were detected as positive as consistently indicated by the two assays. This real-time PCR method with strong specificity and high sensitivity could provide a useful approach for the identification of meat adulteration.%为了能够快速准确检测出市场中掺假牛肉制品,采用TaqMan探针法,建立一种用于快速有效检测牛肉制品中牛源性成分的荧光定量聚合酶链式反应(polymerase chain reaction,PCR)方法。选择GenBank中牛β-actin基因的保守序列,设计并合成特异性引物及TaqMan探针,以构建的pMD-18T-96-beef质粒为标准品,优化反应条件。结果表明:重组质粒标准品经PCR、测序和酶切鉴定正确,建立的标准曲线Ct值与模板拷贝数对数值之间呈良好的线

  16. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  17. Identification of aflatoxigenic fungi using polymerase chain reaction-based assay

    Directory of Open Access Journals (Sweden)

    Šošo Vladislava M.

    2014-01-01

    Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009

  18. Construction of an antimyoglobin single-chain variable fragment with rapid reaction kinetics.

    Science.gov (United States)

    Jang, Jun-Hyuck; Kim, Dong-Hyung; Paek, Se-Hwan; Woo, Eui-Jeon; Kim, Young-Wan

    2016-01-01

    Antibodies with rapid reaction kinetics (high association and dissociation rates), named reversible antibodies, are used to perform continuous monitoring of sensitive disease biomarkers. In cases of acute myocardial infarction (AMI), continuous monitoring and early diagnosis are important. Human myoglobin (Myo) is a useful biomarker for AMI during the early stage after the onset of symptoms. In this study, a single-chain variable fragment (scFv) specific to Myo was derived from an IgG antibody that has rapid reaction kinetics. Enzyme-linked immunosorbent assay revealed that recombinant scFv exhibited 3.8-fold reduced affinity compared with the parent IgG antibody based on the antibody concentration necessary for 50% of the maximum signal. The scFv retained the rapid reaction kinetic mode with average kon and koff of 2.63 × 10(5) M(-1) Sec(-1) and 3.25 × 10(-3) Sec(-1) , respectively, which were reduced to 10- and 2.3-fold compared with those of the parent antibody. The equilibrium constant for the association of the scFv (KA = 8.09 × 10(7) M(-1) ) was 4.6-fold lower than that of its parent IgG antibody. This scFv may be a starting point for further mutagenesis/kinetic and structural analyses providing valuable insight into the mechanism of reversible antibodies.

  19. High-throughput Procedure for Single Pollen Grain Collection and Polymerase Chain Reaction in Plants

    Institute of Scientific and Technical Information of China (English)

    Ping-Hua Chen; Yong-Bao Pan; Ru-Kai Chen

    2008-01-01

    Single pollen grain polymersse chain reaction (PCR) has succeeded in several species, however only limited numbers of pollen grains were involved due to difficulties in pollen isolation and lysis. This has limited its application in genetic analysis and mapping studies in plants. A high-throughput (HT) procedure for collecting and detecting genetic variation in a large number of individual pollen grains by PCR is reported. The HT procedure involved the collection of Individual pollen grains by a pair of special forceps and the lysis of pollen grains in a heated alkali/detergent solution followed by neutralization with a tris-ethylenediamine tetraacetic acid (TE) buffer. These resulting template solutions yielded PCR reactions involving the 5S ribosomal RNA intergenic spacers, randomly amplified polymorphic DNA, and simple sequence repeats markers. Using this procedure, one person with experience could collect and process up to 288 single pollen grain PCR reactions per day. The method worked well on sugarcane, corn, Miscanthus spp., snap bean, sorghum, and tomato. The ability to collect and conduct PCR on individual pollen grains on a large scale offers a new approach to genetic analyses and mapping studies in an easily controllable environment with a considerable cost reduction. The method will also significantly benefit studies in species that are difficult subjects for classical genetic research.

  20. Cutin-derived CuO reaction products from purified cuticles and tree leaves

    Science.gov (United States)

    Goñi, Miguel A.; Hedges, John I.

    1990-11-01

    Long chain (C 16-C 18) hydroxy fatty acids are obtained among the nonlignin-derived reaction products from the CuO oxidation of a variety of geochemical samples. In order to investigate the origin of these acids, the CuO reaction products of isolated cuticles and whole leaves were investigated. The reaction products from the CuO oxidation of purified apple ( Malus pumila) cuticle include 16-hydroxy-hexadecanoic acid, 10,16-dihydroxyhexadecanoic acid, 9,10,18-trihydroxyoctadec-12-enoic acid, and 9,10,18-trihydroxyoctadecanoic acid as major components. The distribution of these cutin-derived CuO reaction products is similar to the monomer compositions deduced from traditional methods of cutin analysis. Oxidation of whole English Holly ( Ilex aquifolium) leaves yields cutin-derived acidic reaction products (in addition to lignin-derived phenols) similar to those obtained from oxidation of the corresponding isolated cuticles, indicating that CuO oxidation of bulk plant tissue is a viable procedure of cutin analysis in geochemical applications.

  1. PRODUCTION OF MEDIUM-CHAIN ACYLGLYCEROLS BY LIPASE ESTERIFICATION IN PACKED BED REACTOR: PROCESS OPTIMIZATION BY RESPONSE SURFACE METHODOLOGY

    Directory of Open Access Journals (Sweden)

    ZANARIAH MOHD DOM

    2014-06-01

    Full Text Available Medium-chain acylglycerols (or glycerides are formed of mono-, di- and triacylglycerol classes. In this study, an alternative method to produce MCA from esterifying palm oil fatty acid distillate (PFAD with the presence of oil palm mesocarp lipase (OPML which is a plant-sourced lipase and PFAD is also cheap by-product is developed in a packed bed reactor. The production of medium-chain acylglycerols (MCA by lipase-catalysed esterification of palm oil fatty acid distillate with glycerol are optimize in order to determine the factors that have significant effects on the reaction condition and high yield of MCA. Response surface methodology (RSM was applied to optimize the reaction conditions. The reaction conditions, namely, the reaction time (30-240 min, enzyme load (0.5-1.5 kg, silica gel load (0.2-1.0 kg, and solvent amount (200-600 vol/wt. Reaction time, enzyme loading and solvent amount strongly effect MCA synthesis (p0.05 influence on MCA yield. Best-fitting models were successfully established for MCA yield (R 2 =0.9133. The optimum MCA yield were 75% from the predicted value and 75.4% from the experimental data for 6 kg enzyme loading, a reaction time of 135min and a solvent amount of 350 vol/wt at 65ºC reaction temperature. Verification of experimental results under optimized reaction conditions were conducted, and the results agreed well with the predicted range. Esterification products (mono-, di- and triacylglycerol from the PBR were identified using Thin Layer Chromatography method. The chromatograms showed the successful fractionation of esterified products in this alternative method of process esterification.

  2. Reactant-Product Quantum Coherence in Electron Transfer Reactions

    CERN Document Server

    Kominis, I K

    2012-01-01

    We investigate the physical meaning of quantum superposition states between reactants and products in electron transfer reactions. We show that such superpositions are strongly suppressed and to leading orders of perturbation theory do not pertain in electron transfer reactions. This is because of the intermediate manifold of states separating the reactants from the products. We provide an intuitive description of these considerations with Feynman diagrams. We also discuss the relation of such quantum coherences to understanding the fundamental quantum dynamics of spin-selective radical-ion-pair reactions.

  3. Adoption of GM technology in livestock production chains: an integrating framework

    NARCIS (Netherlands)

    Novoselova, T.; Meuwissen, M.P.M.; Huirne, R.B.M.

    2007-01-01

    This paper presents an integrating framework for analysing the adoption of new technologies in food chains. We review the literature on the adoption of genetic modification in livestock production chains and conclude that an integrated chain approach is currently lacking. Such an approach is, howeve

  4. Cloning and sequencing of human lambda immunoglobulin genes by the polymerase chain reaction.

    Science.gov (United States)

    Songsivilai, S; Bye, J M; Marks, J D; Hughes-Jones, N C

    1990-12-01

    Universal oligonucleotide primers, designed for amplifying and sequencing genes encoding the rearranged human lambda immunoglobulin variable region, were validated by amplification of the lambda light chain genes from four human heterohybridoma cell lines and in the generation of a cDNA library of human V lambda sequences from Epstein-Barr virus-transformed human peripheral blood lymphocytes. This technique allows rapid cloning and sequencing of human immunoglobulin genes, and has potential applications in the rescue of unstable human antibody-producing cell lines and in the production of human monoclonal antibodies.

  5. Validity of the polymerase chain reaction in the diagnosis of clinically suspected cases of American visceral leishmaniasis.

    Science.gov (United States)

    Pedrosa, Celia Maria Silva; Ximenes, Ricardo Arraes de Alencar; Almeida, Wendell Alexandre Pinheiro de; Rocha, Eliana Maria Mauricio da

    2013-01-01

    To test the validity of the polymerase chain reaction for diagnosing American visceral leishmaniasis, 88 suspected cases were studied. Diagnosis was confirmed in 47 (53.5%) and ruled out in 41 (46.5%) patients. Samples of bone marrow and peripheral blood were processed by polymerase chain reaction to evaluate the sensitivity and specificity of the test and its agreement beyond chance with microscopy examination. The polymerase chain reaction was positive in bone marrow of 100% of the patients with amastigotes seen with microscopy examination, and in 59.5% in those where no parasite were seen. Agreement beyond chance between visualization of the parasite in bone marrow aspirates and polymerase chain reaction was considered weak (Kappa=0.41). Concordance between polymerase chain reaction of bone marrow aspirates and of peripheral blood was considered excellent (Kappa=0.88). The test turned out positive in all bone marrow aspirates of those with the disease and whereas the positivity rate was 58.5% among those without the disease, with specificity rate of 41.5%.

  6. DNA Polymer Brush Patterning through Photocontrollable Surface-Initiated DNA Hybridization Chain Reaction.

    Science.gov (United States)

    Huang, Fujian; Zhou, Xiang; Yao, Dongbao; Xiao, Shiyan; Liang, Haojun

    2015-11-18

    The fabrication of DNA polymer brushes with spatial resolution onto a solid surface is a crucial step for biochip research and related applications, cell-free gene expression study, and even artificial cell fabrication. Here, for the first time, a DNA polymer brush patterning method is reported based on the photoactivation of an ortho-nitrobenzyl linker-embedded DNA hairpin structure and a subsequent surface-initiated DNA hybridization chain reaction (HCR). Inert DNA hairpins are exposed to ultraviolet light irradiation to generate DNA duplexes with two active sticky ends (toeholds) in a programmable manner. These activated DNA duplexes can initiate DNA HCR to generate multifunctional patterned DNA polymer brushes with complex geometrical shapes. Different multifunctional DNA polymer brush patterns can be fabricated on certain areas of the same solid surface using this method. Moreover, the patterned DNA brush surface can be used to capture target molecules in a desired manner.

  7. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  8. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    Science.gov (United States)

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  9. Specific and sensitive detection of Trichomonas tenax by the polymerase chain reaction.

    Science.gov (United States)

    Kikuta, N; Yamamoto, A; Fukura, K; Goto, N

    1997-03-01

    A polymerase chain reaction (PCR) protocol was developed for specific detection of Trichomonas tenax by using a pair of primers designed for its 18S rRNA gene. The detection was specific for T. tenax, since no amplification was detected with DNAs from Trichomonas vaginalis, which belongs to the same genus as T. tenax, in addition to various species of oral protists, fungi and bacteria, and human leukocytes. This method had a detection limit of 100 fg for T. tenax genomic DNA and could detect T. tenax cells in dental plaque at a concentration of as low as 5 cells per PCR mixture. Direct detection from clinical dental plaque samples was also possible; therefore, the present PCR procedure could provide a simple and rapid detection method of T. tenax in dental plaque.

  10. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra

    2016-08-01

    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  11. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi

    2014-12-01

    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  12. Acanthamoeba can be differentiated by the polymerase chain reaction and simple plating assays.

    Science.gov (United States)

    Khan, N A; Jarroll, E L; Paget, T A

    2001-09-01

    Acanthamoeba are opportunistic pathogens with invasive and noninvasive species. For clinical purposes it is important to differentiate potentially pathogenic from nonpathogenic isolates. For the rapid and sensitive identification of Acanthamoeba at the genus level, we used a polymerase chain reaction (PCR)-based method which detected as few as five cells. Further, we tested nine isolates of Acanthamoeba for their ability to produce cytopathic effects (CPE) on corneal epithelial cells. On the basis of the results, Acanthamoeba were divided into pathogenic or nonpathogenic groups. However, because CPE assays are not available to every diagnostic laboratory, we developed a simple plating assay based on osmotolerance which correlated well with the CPE assays. Pathogenic Acanthamoeba showed growth on higher osmolarity (agar plates containing one molar mannitol), while growth of nonpathogens was inhibited on these plates. In conclusion, we have developed methods for the rapid identification and differentiation of Acanthamoeba.

  13. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    Science.gov (United States)

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-06-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted.

  14. Diagnosis of Progressive Spinal Muscular Atrophy by Using Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    姚娟; 丁新生; 陈克连; 程虹; 邓晓萱; 沈鸣九; 王颖

    2001-01-01

    Objective To understand the deletion in the survival motor neuron gene (SMN) of childhood-onset spinal muscular atrophy (SMA) in Chinese, and the value of diagnosis of SMA using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)method. Methods Deletions of SMN gene of exon 7 and 8 in 10 cases of presumed SMA, and 20 normal controls from 6 families and 30 unrelated controls were performed by PCR-RFLP analysis. Results Deletions of SMN gene detected in 9 of 10 (90%) cases of presumed SMA . No deletions of SMN in the telomere were found in the other members of families and controls.Conclusion PCR-RFLP is a sensitive, specific and simple method in diagnosis of SMA.

  15. Polymerase chain reaction-based assays for the diagnosis of human brucellosis.

    Science.gov (United States)

    Wang, Ying; Wang, Zhanli; Zhang, Yaxian; Bai, Liyun; Zhao, Yue; Liu, Chunfang; Ma, An; Yu, Hui

    2014-08-01

    Polymerase chain reaction (PCR) is an in vitro technique for the nucleic acid amplification, which is commonly used to diagnose infectious diseases. The use of PCR for pathogens detection, genotyping and quantification has some advantages, such as high sensitivity, high specificity, reproducibility and technical ease. Brucellosis is a common zoonosis caused by Brucella spp., which still remains as a major health problem in many developing countries around the world. The direct culture and immunohistochemistry can be used for detecting infection with Brucella spp. However, PCR has the potential to address limitations of these methods. PCR are now one of the most useful assays for the diagnosis in human brucellosis. The aim of this review was to summarize the main PCR techniques and their applications for diagnosis and follow-up of patients with brucellosis. Moreover, advantages or limitation of the different PCR methods as well as the evaluation of PCR results for treatment and follow-up of human brucellosis were also discussed.

  16. Validation study of HPV DNA detection from stained FNA smears by polymerase chain reaction

    DEFF Research Database (Denmark)

    Channir, Hani Ibrahim; Grønhøj Larsen, Christian; Ahlborn, Lise Barlebo;

    2016-01-01

    BACKGROUND: Human papillomavirus (HPV)-related oropharyngeal squamous cell carcinoma (OPSCC) often presents with cystic cervical metastasis and a small primary tumor localized in the palatine tonsils or base of the tongue, which is diagnostically challenging. Testing for HPV DNA in fine......-needle aspiration (FNA) smears from metastases may facilitate a targeted diagnostic workup for identifying the primary tumor. This study was designed to assess the ability to detect HPV DNA in FNA smears with polymerase chain reaction (PCR). METHODS: May-Grünvald-Giemsa (MGG)-stained FNA smears from metastases...... and corresponding surgical specimens were collected from 71 patients with known HPV-positive OPSCC, 12 patients with oral squamous cell carcinoma (OSCC), 20 patients with branchial cleft cysts, and 20 patients with Warthin tumors. Thirty-eight patients with OPSCC and 7 patients with OSCC had FNA smears available...

  17. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S

    2012-02-03

    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  18. Detection of Fasciola gigantica infection in snails by polymerase chain reaction.

    Science.gov (United States)

    Velusamy, R; Singh, B P; Raina, O K

    2004-02-26

    Polymerase chain reaction (PCR) was used to detect Fasciola gigantica infection in the snail intermediate host. Fasciola specific primers amplified a 124 bp fragment in PCR when the genomic DNA isolated from F. gigantica infected Lymnaea auricularia snails was used as template. In addition to the 124 bp amplicon, a ladder of DNA fragments representing amplification of the 124 bp repetitive sequences was observed. Genomic DNA of the parasite was used as a positive control, which also gave an amplification of the 124 bp fragment. DNA isolated from non-infected snails was used as a negative control and no amplification of this sequence was observed. This technique is highly specific and sensitive and possesses fairly good prospects of its utility as an epidemiological tool for ascertaining the infectivity status in ubiquitous snail populations.

  19. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P

    2004-01-01

    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  20. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    Institute of Scientific and Technical Information of China (English)

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  1. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction

    Science.gov (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-08-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

  2. Quantitative Profiling of Long-Chain Bases by Mass Tagging and Parallel Reaction Monitoring

    DEFF Research Database (Denmark)

    Ejsing, Christer S; Bilgin, Mesut; Fabregat, Andreu

    2015-01-01

    Long-chain bases (LCBs) are both intermediates in sphingolipid metabolism and potent signaling molecules that control cellular processes. To understand how regulation of sphingolipid metabolism and levels of individual LCB species impinge upon physiological and pathophysiological processes requires...... sensitive and specific assays for monitoring these molecules. Here we describe a shotgun lipidomics method for quantitative profiling of LCB molecules. The method employs a "mass-tag" strategy where LCBs are chemically derivatized with deuterated methyliodide (CD3I) to produce trimethylated derivatives...... having a positively charged quaternary amine group. This chemical derivatization minimizes unwanted in-source fragmentation of LCB analytes and prompts a characteristic trimethylaminium fragment ion that enables sensitive and quantitative profiling of LCB molecules by parallel reaction monitoring...

  3. Epidemiological Investigation of Salmonella Tilene by Pulsed-Field Gel Electrophoresis and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Chandar M Anand

    1997-01-01

    Full Text Available Pulsed-field gel electrophoresis (PFGE and DNA fingerprinting by the polymerase chain reaction (PCR were performed on 11 isolates of Salmonella tilene. Five strains were from a cluster of human patients, six from sugar gliders and pygmy hedgehogs kept as family pets or from local pet retailers, and one isolate from the first North American case of S tilene described in Washington State in 1994. The PFGE restriction patterns showed all isolates to be similar. However, PCR using primers to the 16S and 23S rRNA genes of Escherichia coli demonstrated that the Washington State isolate differed from the rest of the other isolates, which were all similar based upon their DNA fingerprint. This study indicates that reliance on one technique alone may be insufficient to show nuances between strains that are, in many respects, closely related.

  4. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Science.gov (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  5. Total chemical synthesis of a thermostable enzyme capable of polymerase chain reaction.

    Science.gov (United States)

    Xu, Weiliang; Jiang, Wenjun; Wang, Jiaxing; Yu, Linping; Chen, Ji; Liu, Xianyu; Liu, Lei; Zhu, Ting F

    2017-01-01

    Polymerase chain reaction (PCR) has been a defining tool in modern biology. Towards realizing mirror-image PCR, we have designed and chemically synthesized a mutant version of the 352-residue thermostable Sulfolobus solfataricus P2 DNA polymerase IV with l-amino acids and tested its PCR activity biochemically. To the best of our knowledge, this enzyme is the largest chemically synthesized protein reported to date. We show that with optimization of PCR conditions, the fully synthetic polymerase is capable of amplifying template sequences of up to 1.5 kb. The establishment of this synthetic route for chemically synthesizing DNA polymerase IV is a stepping stone towards building a d-enzyme system for mirror-image PCR, which may open up an avenue for the creation of many mirror-image molecular tools such as mirror-image systematic evolution of ligands by exponential enrichment.

  6. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  7. Use of polymerase chain reaction (PCR for detection of Chlamydia trachomatis infection in cervical swab samples

    Directory of Open Access Journals (Sweden)

    Mania-Pramanik Jayanti

    2001-09-01

    Full Text Available A polymerase chain reaction (PCR based method has been set up for detection of Chlamydia trachomatis (C. trachomatis infection in single cervical swab samples. A primer pair specific to the major outer membrane protein (MOMP gene common to all serotypes of C. trachomatis was used. This method was validated for its sensitivity as well as specificity. A minimum Ing of DNA could be used for detection of the infection. Specificity of the method was confirmed by carrying out a sample dilution curve. The cervical swab samples analysed in the present study were in coded form for validation of the PCR with an established commercial ELISA (Chlamydiazyme. Both the sensitivity and specificity of PCR was 100% when the ELISA results of these samples were decoded. Thus, this PCR technique could be used for better diagnosis of C. trachomatis infection in comparison to the commercially available ELISA technique.

  8. A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

    Directory of Open Access Journals (Sweden)

    Elisa Morganti

    2011-01-01

    Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

  9. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR)

    Science.gov (United States)

    Fukui, Kenji; Bessho, Yoshitaka; Shimada, Atsuhiro; Yokoyama, Shigeyuki; Kuramitsu, Seiki

    2013-01-01

    Polymerase chain reaction (PCR)-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3′ end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science. PMID:23519109

  10. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  11. Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Joshua E Lane

    2003-04-01

    Full Text Available The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

  12. A simple multiplex polymerase chain reaction to determine ABO blood types of rhesus macaques (Macaca mulatta).

    Science.gov (United States)

    Premasuthan, A; Kanthaswamy, S; Satkoski, J; Smith, D G

    2011-06-01

    Rhesus macaques are the most common nonhuman primate model organism used in biomedical research. Their increasingly frequent use as subjects in studies involving transplantation requires that blood and other tissue antigens of donors and recipients be compatible. We report here an easy and rapid multiplex polymerase chain reaction (PCR) to determine the ABO blood group phenotypes of rhesus macaques that can be performed with only small amounts of DNA. We phenotyped 78 individuals and found this species to exhibit the A, B and AB phenotypes in frequencies that vary by geographic region. The probability of randomly pairing rhesus macaque donors and recipients that exhibit major ABO phenotype incompatibility is approximately 0.35 and 0.45 for Indian and Chinese rhesus macaques, respectively.

  13. Prevalence of Dirofilaria immitis infection in dogs from Celestun, Mexico, using polymerase chain reaction test.

    Science.gov (United States)

    Caro-Gonzalez, Johny Antonio; Bolio-Gonzalez, Manuel Emilio; Escobedo-Ortegón, Francisco Javier; Manrique-Saide, Pablo; Rodriguez-Vivas, Roger Ivan; Rodriguez-Buenfil, Jorge Carlos; Sauri-Arceo, Carlos Humberto

    2011-02-01

    The aim of this study was to determine the prevalence of Dirofilaria immitis in dogs and to analyze risk factors associated with infection at Celestun, a coastal locality in southeast Mexico. Blood samples were collected from 279 asymptomatic individuals between August 2007 and March 2008 and analyzed by polymerase chain reaction technique. The association between D. immitis infection and sex, age group, and distance of residence from a wetland of dogs was statistically analyzed. Prevalence of D. immitis infection was of 59.8%. Age of individuals (>2 years) was a risk factor for infection with D. immitis (odds ratio 2.49, confidence interval 1.47-4.23, p=0.001). In conclusion, Celestun can be considered a focus of D. immitis infection with high levels of transmission among the local dog population, as confirmed by the high prevalence reported and the association of age (dogs >2 years) as a risk associated with infection.

  14. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R

    2003-01-01

    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  15. Detection of Helicobactor pylori by polymerase chain reaction: A comparison in sample preparation

    Directory of Open Access Journals (Sweden)

    Murugesan R

    2005-01-01

    Full Text Available Gastric biopsy samples obtained from 14 patients with upper abdominal pain, clinically diagnosed as acid peptic disease, were analysed for the presence of Helicobacter pylori (H. pylori by Polymerase Chain Reaction (PCR using partially (template A and completely purified DNA (template B. Antigen specific primer was used to analyse the sample by PCR method. The presence of H. pylori in the samples was confirmed by running a positive control. The presence of H. pylori was also detected by urease method using standard protocol. Among the 14 samples studied, 8 showed the presence of H. pylori with both templates A and B. Among these 8 samples only 3 showed positive for the presence of H. pylori with urease method. The present work discusses the results obtained in the detection of H. pylori in template A and B by PCR method.

  16. Discrepancies between Antigen and Polymerase Chain Reaction Tests for the Detection of Rotavirus and Norovirus.

    Science.gov (United States)

    Kim, Hyun Soo; Kim, Jae-Seok

    2016-05-01

    We compared the results of an antigen test (ELISA) with those of polymerase chain reaction (PCR) for the detection of rotavirus and norovirus in stool specimens. Rotavirus and norovirus antigen-positive stool specimens were collected, and rotavirus and norovirus PCRs were performed on these specimens. Of the 325 rotavirus antigen-positive specimens, 200 were positive for both assays and 125 were PCR negative. Of 286 norovirus antigen-positive specimens, 51 were PCR negative. Comparison of the lower limit of detection showed that rotavirus PCR was 16 times more sensitive and norovirus PCR was over 4,000 times more sensitive than the ELISA. Discrepant results between ELISA and PCR were common, and the possibility of false-positive and false-negative results should be considered with rotavirus and norovirus assays.

  17. Detection of gonorrhea among HIV infected patients by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Pragya Poudel

    2015-07-01

    Full Text Available Objective: To determine the burden of gonorrhea among HIV patients using PCR technique. Methods: A cross sectional study was carried out in a HIV clinic of Sparsha Nepal from January to March, 2011. Standard microbiological procedures were followed during collection and processing of urine samples. DNA amplification, isolation and detection were carried out. Gonorrhoea diagnosis was done by multiplex polymerase chain reaction. Results: Among the 119 HIV positive patients, 12 (10.08% were positive for N. gonorrheae. The cases were more among the males than in females. The age of patients ranged from 20- 45 years and the highest prevalence was among the age group 20-35 years. The distribution of gonorrhea infected patients according to marital status revealed that 8 cases were among the married patients. Conclusions: This study revealed that the incidence of gonorrhoea was higher in males and in married people. So, the control measures should be targeted to these groups of people.

  18. Chain reaction. History of the atomic bomb; Kettenreaktion. Die Geschichte der Atombombe

    Energy Technology Data Exchange (ETDEWEB)

    Mania, Hubert

    2010-07-01

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  19. Polymerase chain reaction of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia in primary endodontic infections.

    Science.gov (United States)

    Gomes, Brenda P F A; Montagner, Francisco; Jacinto, Rogério Castilho; Zaia, Alexandre A; Ferraz, Caio Cezar Randi; Souza-Filho, Francisco J

    2007-09-01

    The aim of this study was to investigate the correlation between endodontic clinical signs and symptoms and the presence of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia or their association by nested polymerase chain reaction assay. Microbial samples were taken from 50 cases with necrotic pulp tissues in primary infections. DNA was extracted from the samples, which were analyzed for the presence of three endodontic pathogens by using species-specific primers. P gingivalis, T denticola, and T forsythia were detected in 46%, 38%, and 22% of the symptomatic cases, respectively. The bacterial complex composed by T forsythia, P gingivalis, and T denticola was found in 14% of the cases with spontaneous pain, tenderness to percussion, swelling, and pain on palpation. The high prevalence of P gingivalis, T denticola, and T forsythia in the samples examined suggests that these bacteria are related to the etiology of symptomatic periradicular diseases.

  20. Performance indicators in agri-food production chains

    NARCIS (Netherlands)

    Aramyan, L.H.; Ondersteijn, C.J.M.; Kooten, van O.; Oude Lansink, A.G.J.M.

    2006-01-01

    The last decade has seen an increasing interest in indicators of supply-chain performance. A large number of various performance indicators have been used to characterize supply chains, ranging from highly qualitative indicators like customer or employee satisfaction to quantitative indicators like

  1. Toxicity of aerosols of sodium reaction products.

    Science.gov (United States)

    Zwicker, G M; Allen, M D; Stevens, D L

    1979-01-01

    Sodium is used as the heat transfer medium in several new energy technologies such as liquid-metal fast-breeder reactors and solar-thermal collection systems. Because sodium burns in air and reacts violently with water, the potential exists for an airborne release of sodium combustion products and subsequent human exposure. To help evaluate the potential short-term hazard from an accidental sodium fire, male juvenile or adult Wistar rats were exposed to sodium aerosols for 2 hours to determine the dose at which 50 percent of the animals were affected (ED50) for each age group. The estimated ED50 of 510 microgram/l for adults was not significantly different from the estimated ED50 of 489 microgram/l for juveniles. The incidence of acute laryngitis, attributed to exposure, was three times higher for juvenile rats than for adults, and the degree of severity of this lesion was significantly (P less than 0.05) higher for juveniles.

  2. Sustainable Rent-Based Closed-Loop Supply Chain for Fashion Products

    OpenAIRE

    Zhi-Hua Hu; Qing Li; Xian-Juan Chen; Yan-Feng Wang

    2014-01-01

    The textile and clothing industry generates much pollution and consumes a large amount of resources. Improper uses and disposal of clothing products make the problems much more severe. Fast fashion products shorten the valid lifecycle and generate more waste than regular clothing products. Considering the features of fashion products, a system of a rent-based closed-loop supply chain is developed to improve the sustainability of fashion products. The supply chain processes (fashion design and...

  3. Product Variety, Supply Chain Structure, and Firm Performance: Analysis of the U.S. Bicycle Industry

    OpenAIRE

    Taylor Randall; Karl Ulrich

    2001-01-01

    Using data from the U.S. bicycle industry, we examine the relation among product variety, supply chain structure, and firm performance. Variety imposes two types of costs on a supply chain: production costs and market mediation costs. Production costs include, among other costs, the incremental fixed investments associated with providing additional product variants. Market mediation costs arise because of uncertainty in product demand created by variety. In the presence of demand uncertainty,...

  4. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang

    2006-01-01

    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  5. Hybridization chain reaction-based fluorescence immunoassay using DNA intercalating dye for signal readout.

    Science.gov (United States)

    Deng, Yan; Nie, Ji; Zhang, Xiao-hui; Zhao, Ming-Zhe; Zhou, Ying-Lin; Zhang, Xin-Xiang

    2014-07-07

    A novel format of fluorescence immunosorbent assay based on the hybridization chain reaction (HCR) using a DNA intercalating dye for signal readout was constructed for the sensitive detection of targets, both in competitive and sandwich modes. In this platform, the capture and recognition processes are based on immunoreactions and the signal amplification depends on the enzyme-free, isothermal HCR-induced labelling event. After a competitive or a sandwich immunoreaction, a biotinylated capture DNA was bound to a biotinylated signal antibody through avidin, and triggered the HCR by two specific hairpins into a nicked double helix. Gene Finder (GF), a fluorescent probe for double-strand DNA, was intercalated in situ into the amplified chain to produce the fluorescence signal. The limit of detection (LOD) for rabbit IgG in competitive mode by HCR/GF immunoassay was improved at least 100-fold compared with the traditional fluorescence immunoassay using the fluorescein isothiocyanate-labelled-streptavidin or fluorescein isothiocyanate-labelled second antibody as the signal readout. The proposed fluorescence immunoassay was also demonstrated by using α-fetoprotein as the model target in sandwich mode, and showed a wide linear range from 28 ng mL(-1) to 20 μg mL(-1) with a LOD of 6.0 ng mL(-1). This method also showed satisfactory analysis in spiked human serum, which suggested that it might have great potential for versatile applications in life science and point-of-care diagnostics.

  6. Variance-reduced simulation of lattice discrete-time Markov chains with applications in reaction networks

    Science.gov (United States)

    Maginnis, P. A.; West, M.; Dullerud, G. E.

    2016-10-01

    We propose an algorithm to accelerate Monte Carlo simulation for a broad class of stochastic processes. Specifically, the class of countable-state, discrete-time Markov chains driven by additive Poisson noise, or lattice discrete-time Markov chains. In particular, this class includes simulation of reaction networks via the tau-leaping algorithm. To produce the speedup, we simulate pairs of fair-draw trajectories that are negatively correlated. Thus, when averaged, these paths produce an unbiased Monte Carlo estimator that has reduced variance and, therefore, reduced error. Numerical results for three example systems included in this work demonstrate two to four orders of magnitude reduction of mean-square error. The numerical examples were chosen to illustrate different application areas and levels of system complexity. The areas are: gene expression (affine state-dependent rates), aerosol particle coagulation with emission and human immunodeficiency virus infection (both with nonlinear state-dependent rates). Our algorithm views the system dynamics as a "black-box", i.e., we only require control of pseudorandom number generator inputs. As a result, typical codes can be retrofitted with our algorithm using only minor changes. We prove several analytical results. Among these, we characterize the relationship of covariances between paths in the general nonlinear state-dependent intensity rates case, and we prove variance reduction of mean estimators in the special case of affine intensity rates.

  7. Duff reaction on phenols: Characterization of non steam volatile products

    Digital Repository Service at National Institute of Oceanography (India)

    Wahidullah, S.; DeSouza, L.; Bhattacharya, J.

    New products having structures 1 and 2 have been characterized in the Duff reaction thymol arid carvacrol. These products have been identified as 2.6'-dithymylmethane 1 and 5.5' -dicarvacryl methane 2 respectively on the basis of spectral data...

  8. Kinetics and mechanism of the chain reaction between N-phenyl-1,4-benzoquinone monoimine and thiophenol

    Science.gov (United States)

    Varlamov, V. T.; Gadomsky, S. Ya.

    2017-05-01

    The kinetics of the reaction between N-phenyl-1,4-benzoquinone monoimine (quinone monoimine) and thiophenol is studied in chlorobenzene at 343 K. The reaction has the same mechanism proposed earlier for a similar reaction involving N,N'-diphenyl-1,4-benzoquinone diimine (quinone diimine). This mechanism has two paths: chain and nonchain. An important difference between the kinetics of the two reactions is the apparent reversible nature of the chain reaction in the quinone monoimine + thiophenol system. This nature reveals itself when the concentrations of thiophenol are comparable to or slightly higher than the concentrations of quinone imine. In light of this, kinetic research is conducted under conditions where the concentrations of thiophenol are significantly higher than those of quinone monoimine, allowing us to simplify the kinetic features and obtain interpretable data. The rate constants of the reaction's elementary steps are estimated and found to be three to five times lower for the reaction involving quinone monoamine than for the one involving quinone diimine. Both reactions have relatively short chains whose lengths do not exceed several tens of units.

  9. How is entropy production rate related to chemical reaction rate?

    CERN Document Server

    Banerjee, Kinshuk

    2013-01-01

    The entropy production rate is a key quantity in irreversible thermodynamics. In this work, we concentrate on the realization of entropy production rate in chemical reaction systems in terms of the experimentally measurable reaction rate. Both triangular and linear networks have been studied. They attain either thermodynamic equilibrium or a non-equilibrium steady state, under suitable external constraints. We have shown that the entropy production rate is proportional to the square of the reaction velocity only around equilibrium and not any arbitrary non-equilibrium steady state. This feature can act as a guide in revealing the nature of a steady state, very much like the minimum entropy production principle. A discussion on this point has also been presented.

  10. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.

    1999-01-01

    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot......), the glycerophospholipid:cholestrol acetyltransferase protein (GCAT), and the 16S rRNA (16S rDNA). All the atypical A. salmonicida isolates could be assigned to 4 PCR groups. Group 1 comprised 45 strains which rested positive for PCR amplification, using the 16S rDNA, GCAT2, Sprot2, and AP primer-sets. Group 2 comprised...... 88 strains with produced PCR products using the 16S rDNA, GCAT2 and AP primer-sets. Group 3 comprised 21 strains which produced PCR products using 16S rDNA, GCAT2 and Sprot2 primer-sets, and group 4 comprised 51 strains which produced PCR products using the 16S rDNA and GCAT2 primer-sets only. A...

  11. Probing chain-end functionalization reactions in living anionic polymerization via matrix-assisted laser desorption ionization time-of-flight mass spectrometry

    Science.gov (United States)

    Arnould, Mark A.; Polce, Michael J.; Quirk, Roderic P.; Wesdemiotis, Chrys

    2004-11-01

    Matrix-assisted laser desorption ionization (MALDI) time-of-flight (TOF) mass spectrometry (MS) is applied to examine the products arising upon the preparation of chain-end functional polymers via living anionic polymerization techniques. Both post-polymerization functionalizations as well as the use of functionalized initiators are investigated. MALDI-TOF MS is shown to be a sensitive probe for the qualitative analysis of the major and minor oligomers from novel functionalization reactions whose mechanisms are not yet well established. The method is particularly valuable for the identification of the end groups of the minor, and often unexpected, distributions that may be undetectable by other analytical means. Complete characterization of all oligomers generated during functionalization reactions provides an essential tool to the synthetic chemist for understanding the corresponding mechanisms. This insight is necessary for selecting alternative routes or making modifications to the reaction conditions. It is demonstrated that MALDI-TOF MS can convey quantitative information about the yields of the chain-end groups introduced during functionalization. From the cases presented it is evident that post-polymerization reactions allow for better control of chain-end functionality and molecular weight than functionalization with the limited number of currently available protected functionalized initiators.

  12. Chemical Characterization and Reactivity of Fuel-Oxidizer Reaction Product

    Science.gov (United States)

    David, Dennis D.; Dee, Louis A.; Beeson, Harold D.

    1997-01-01

    Fuel-oxidizer reaction product (FORP), the product of incomplete reaction of monomethylhydrazine and nitrogen tetroxide propellants prepared under laboratory conditions and from firings of Shuttle Reaction Control System thrusters, has been characterized by chemical and thermal analysis. The composition of FORP is variable but falls within a limited range of compositions that depend on three factors: the fuel-oxidizer ratio at the time of formation; whether the composition of the post-formation atmosphere is reducing or oxidizing; and the reaction or post-reaction temperature. A typical composition contains methylhydrazinium nitrate, ammonium nitrate, methylammonium nitrate, and trace amounts of hydrazinium nitrate and 1,1-dimethylhydrazinium nitrate. Thermal decomposition reactions of the FORP compositions used in this study were unremarkable. Neither the various compositions of FORP, the pure major components of FORP, nor mixtures of FORP with propellant system corrosion products showed any unusual thermal activity when decomposed under laboratory conditions. Off-limit thruster operations were simulated by rapid mixing of liquid monomethylhydrazine and liquid nitrogen tetroxide in a confined space. These tests demonstrated that monomethylhydrazine, methylhydrazinium nitrate, ammonium nitrate, or Inconel corrosion products can induce a mixture of monomethylhydrazine and nitrogen tetroxide to produce component-damaging energies. Damaging events required FORP or metal salts to be present at the initial mixing of monomethylhydrazine and nitrogen tetroxide.

  13. Researches on Risk Evaluation of Green Agro-product Closed Supply Chain

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    Closed supply chain is a superior form of management model of chain supply and an effective means of improving the modernization of agro-product circulation. Based on the research results of the current literatures on supply chain risk and agro-product supply chain, related subjects of the agro-product closed supply chain involving production, management and consumption are studied and analyzed and the primary risking factors in the supply chain system are classified as environmental risk, system risk, information risk, management risk and quality risk. Risk of agro-product closed supply chain is evaluated by using the method of fuzzy comprehensive evaluation and the values are acquired. The result shows that risk of agro-product closed supply chain is moderate with relatively high risk, which basically accords with the present actual situations. It can be seen from the index weights of various levels that the key first-level indices influencing the risks are system risk, information risk, quality and safety risk and the key second-level are the coordinating and controlling ability of core enterprises, the implementation of information traceability and the construction of quality safety system. Therefore, risk of agro-product closed supply chain should be reduced by taking prevention and controlling measures mainly from these aspects.

  14. Operating Analysis of the Closed Supply Chain of Green Agricultural Products Based on Logistics Center

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    This thesis gives the overview of concept and constitution of the closed supply chain of green agricultural products based on logistics center,and the necessity of regarding logistics center as core enterprise.Meanwhile,it analyzes the function of logistics center of agricultural products,namely functions of exchange,collection,distribution,storage and transportation.It also poses the prerequisites of logistics center.The logistics center of agricultural products must have stable profit expectancy,prominent scale,strong appealing power,capacity of bearing market risk and basic thoughts of supply chain management.The functional design of the closed supply chain of green agricultural products has been discussed in 5 aspects,namely logistics center,production base,providers of means of production,retailer and consumer.The operating thoughts of the closed supply chain of green agricultural products based on logistics center are put forward on the basis of the research of operating objective and service target of supply chain as follows:first,based on local principal agricultural products,the logistics center mainly distributes the massed agricultural products;second,it is necessary to choose appropriate strategic cooperative partners to sign contract;third,the operating procedure of supply chain entails bringing in professional managerial talents of supply chain;finally,the relationships of supply chain should be maintained.

  15. O2O - Based Agricultural Products Supply Chain Process Integration Optimization Based on Internet +

    Directory of Open Access Journals (Sweden)

    Li Huijuan

    2017-01-01

    Full Text Available Traditional wholesale and retail, electricity supplier of agricultural products supply chain have many difficulties. The O2O supply chain of agricultural products of “Internet+”, committed to the integration of online and offline advantage process, has become the main direction of the agricultural products supply chain transformation. Practice operation results show that O2O supply chain can effectively play the advantages of online and offline process integration, but its further development is still subject to the logistics, information flow of the dispersion, fracture and high cost. The integrated optimization of various regions and various enterprises and all sectors of the supply chain process is the key to optimize the process Internet plus era of agricultural products supply chain.

  16. Ultrasensitive detection of DNA and RNA based on enzyme-free click chemical ligation chain reaction on dispersed gold nanoparticles.

    Science.gov (United States)

    Kato, Daiki; Oishi, Motoi

    2014-10-28

    An ultrasensitive colorimetric DNA and RNA assay using a combination of enzyme-free click chemical ligation chain reaction (CCLCR) on dispersed gold nanoparticles (GNPs) and a magnetic separation process has been developed. The click chemical ligation between an azide-containing probe DNA-modified GNP and a dibenzocyclooctyne-containing probe biotinyl DNA occurred through hybridization with target DNA (RNA) to form the biotinyl-ligated GNPs (ligated products). Eventually, both the biotinyl-ligated GNPs and target DNA (RNA) were amplified exponentially using thermal cycling. After separation of the biotinyl-ligated GNPs using streptavidin-modified magnetic beads, the change in intensity of the surface plasmon band at 525 nm in the supernatants was observed by UV/vis measurement and was also evident visually. The CCLCR assay provides ultrasensitive detection (50 zM: several copies) of target DNA that is comparable to PCR-based approaches. Note that target RNA could also be detected with similar sensitivity without the need for reverse transcription to the corresponding cDNA. The amplification efficiency of the CCLCR assay was as high as 82% due to the pseudohomogeneous reaction behavior of CCLCR on dispersed GNPs. In addition, the CCLCR assay was able to discriminate differences in single-base mismatches and to specifically detect target DNA and target RNA from the cell lysate.

  17. Polymerase chain reaction-restriction fragment length polymorphism analysis of a 16S rRNA gene fragment for authentication of four clam species.

    Science.gov (United States)

    Fernandez, Alicia; García, Teresa; Gonzalez, Isabel; Asensio, Luis; Rodriguez, Miguel Angel; Hernández, Pablo E; Martin, Rosario

    2002-04-01

    Specific identification of four clam species, Ruditapes decussatus (grooved carpet shell), Venerupis pullastra (pullet carpet shell), Ruditapes philippinarum (Japanese carpet shell), and Venerupis rhomboides (yellow carpet shell), was achieved by polymerase chain reaction-restriction fragment length polymorphism analysis of a fragment of the mitochondrial 16S rRNA gene. Amplification of DNA isolated from the foot muscle produced fragments of 511 bp for V. pullastra, 523 bp for R. decussatus, 545 bp for R. philippinarum, and 502 bp for V. rhomboides. The restriction profiles obtained by agarose gel electrophoresis when amplicons were digested with endonucleases BsmAI and BsrI allowed unequivocal identification of the four clam species. This approach would be less costly, simpler, and quicker than conventional sequencing of polymerase chain reaction products followed by detailed comparison of individual sequences, especially when large numbers of samples need to be analyzed.

  18. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    Science.gov (United States)

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  19. The Impact of Supply Chain Cost on the Price of the Final Product

    Directory of Open Access Journals (Sweden)

    Indrė Lapinskaitė

    2014-06-01

    Full Text Available Nowadays, as consumption and production are growing enormously fast, companies are seeking for costs reduction aimed at ensuring competitiveness. In manufacturing companies, supply chain expenses play a colossal role in the cost of the final product. This paper focuses on the main processes in the logistics chain and their components. The authors analyse the relationship between the sup- ply chain expenses and the price of the final product, the classification of logistics chain costs and their minimization as an assumption for the competitiveness of the final price.

  20. ESTIMATION OF CHAIN REACTION BANKRUPTCY STRUCTURE BY CHANCE DISCOVERY METHOD- WITH TIME ORDER METHOD AND DIRECTED KEYGRAPH

    Institute of Scientific and Technical Information of China (English)

    Shinichi GODA; Yukio OHSAWA

    2007-01-01

    Chain reaction bankruptcy is regarded as common phenomenon and its effect is to be taken into account when credit risk portfolio is analyzed. But consideration and modeling of its effect leave much room for improvement. That is mainly because method for grasping relations among companies with limited data is underdeveloped. In this article, chance discovery method is applied to estimate industrial relations that are to include companies' relations that transmit chain reaction of bankruptcy.Time order method and directed KeyGraph are newly introduced to distinguish and express the time order among defaults that is essential information for the analysis of chain reaction bankruptcy. The steps for the data analysis are introduced and result of example analysis with default data in Kyushu,Japan, 2005 is presented. The structure estimated by the new method is compared with the structure of actual account receivable holders of bankrupted companies for evaluation.

  1. Kinetics and reaction mechanism of yeast alcohol dehydrogenase with long-chain primary alcohols.

    Science.gov (United States)

    Schöpp, W; Aurich, H

    1976-01-01

    Kinetic studies of yeast alcohol dehydrogenase with NAD+ and ethanol, hexanol or decanol as substrates invariably result in non-linear Lineweaver-Burk plots if the alcohol is the variable substrate. The kinetic coefficients determined from secondary plots are consistent with an 'equilibrium random-order' mechanism for extremely low alcohol concentrations and for all alcohols, the transformation of the ternary complexes being the rate-limiting step of the reaction. This mechanism also applies to long-chain substrates at high concentrations, whereas the rate of the ethanol-NAD+ reaction at high ethanol concentrations is determined by the dissociation of the enzyme-NADH complex. The dissociation constants for the enzyme-NAD+ complex and for the enzyme-alcohol complexes obtained from the kinetic quotients satisfactorily correspond to the dissociation constants obtained by use of other techniques. It is suggested that the non-linear curves may be attributed to a structural change in the enzyme itself, caused by the alcohol. PMID:183740

  2. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation.

    Science.gov (United States)

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K

    2016-08-01

    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA.

  3. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF

    2000-01-01

    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  4. A new method for quantitative real-time polymerase chain reaction data analysis.

    Science.gov (United States)

    Rao, Xiayu; Lai, Dejian; Huang, Xuelin

    2013-09-01

    Quantitative real-time polymerase chain reaction (qPCR) is a sensitive gene quantification method that has been extensively used in biological and biomedical fields. The currently used methods for PCR data analysis, including the threshold cycle method and linear and nonlinear model-fitting methods, all require subtracting background fluorescence. However, the removal of background fluorescence can hardly be accurate and therefore can distort results. We propose a new method, the taking-difference linear regression method, to overcome this limitation. Briefly, for each two consecutive PCR cycles, we subtract the fluorescence in the former cycle from that in the latter cycle, transforming the n cycle raw data into n-1 cycle data. Then, linear regression is applied to the natural logarithm of the transformed data. Finally, PCR amplification efficiencies and the initial DNA molecular numbers are calculated for each reaction. This taking-difference method avoids the error in subtracting an unknown background, and thus it is more accurate and reliable. This method is easy to perform, and this strategy can be extended to all current methods for PCR data analysis.

  5. A multiplex real-time polymerase chain reaction assay to diagnose Epiphyas postvittana (Lepidoptera: Tortricidae).

    Science.gov (United States)

    Barr, N B; Ledezma, L A; Farris, R E; Epstein, M E; Gilligan, T M

    2011-10-01

    A molecular assay for diagnosis of light brown apple moth, Epiphyas postvittana (Walker) (Lepidoptera: Tortricidae), in North America is reported. The assay multiplexes two TaqMan real-time polymerase chain reaction (RT-PCR) probe systems that are designed to target DNA segments of the internal transcribed spacer region 2 (ITS2) and 18S rRNA gene. The RT-PCR probe designed for the 18S target recognizes a DNA sequence conserved in all of the moths included in the study and functions as a control in the assay. The second probe recognizes a segment of the ITS2 specifically found in E. postvittana and not found in the other moths included in the study, i.e., this segment is not conserved. Inclusion of the two markers in a single multiplex reaction did not affect assay performance. The assay was tested against 637 moths representing > 90 taxa in 15 tribes in all three subfamilies in the Tortricidae. The assay generated no false negatives based on analysis of 355 E. postvittana collected from California, Hawaii, England, New Zealand, and Australia. Analysis of a data set including 282 moths representing 41 genera generated no false positives. Only three inconclusive results were generated from the 637 samples. Spike experiments demonstrated that DNA contamination in the assay can affect samples differently. Contaminated samples analyzed with the ITS2 RT-PCR assay and DNA barcode methodology by using the cytochrome oxidase I gene can generate contradictory diagnoses.

  6. Continuous reaction performances of benzene alkylation with long chain olefins catalyzed by ionic liquid

    Institute of Scientific and Technical Information of China (English)

    Congzhen QIAO; Chengyue LI

    2008-01-01

    Based on a compulsive mixing-reacting-sepa-rating-recycling small experimental setup,the continuous reaction performances of benzene alkylation with long chain olefins catalyzed by [BMIM]Cl-AlCl3 ionic liquid were investigated. Three different situations including normal continuous operation mode (reagent materials), sidetrack feeding from different axial positions along the static mixing reactor (reagent materials) and normal con-tinuous alkylation using industrial paraffin and olefins materials were examined. Even under the relatively hype-critical reaction conditions, the single pass conversion of pure 1-dodecene could reach to nearly 100.0%, and the selectivity of 2-phenyl isomer was higher than 37.7%. Although the positions along the reactor for sidetrack feeding were different, the 100.0% single pass conversion of 1-dodecene was also attained before the outlet of the reactor. The refined industrial olefins as raw material could meet with the requirements of continuous alkyla-tion. The influences of impurities such as di-olefins and non-benzene aromatics on the catalytic activity and stability should be studied further.

  7. Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction.

    Science.gov (United States)

    Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František

    2017-05-01

    The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml(-1) while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml(-1). It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml(-1) by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg(2+) ions. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  9. Greenhouse gas emissions in milk and dairy product chains: Improving the carbon footprint of dairy products

    Energy Technology Data Exchange (ETDEWEB)

    Flysjoe, A.M.

    2012-11-01

    The present PhD project has focused on some of the most critical methodological aspects influencing GHG emission estimates of milk and dairy products and how the methodology can be improved. In addition, the Carbon Footprint (CF) for different types of dairy products has been analysed. Based on these results, mitigation options have been identified along the entire dairy value chain. The key methodological challenges analysed in the present study are: estimation of CH{sub 4} and N{sub 2}O emissions, assessment of CO{sub 2} emissions from land use change (LUC), co-product handling, and definition of the functional unit. Estimates of the biogenic emissions CH{sub 4} and N{sub 2}O are associated with large uncertainties due to the complexity and natural variation in biological processes. Accounting for these variations resulted in a {+-}30-50% variation in the CF for milk in Sweden and New Zealand (excluding emissions from LUC). The inclusion of emissions from LUC can drastically affect the CF of dairy products, and different models can even provide contradictory results. Thus, it is suggested that emissions associated with LUC are reported separately and that underlying assumptions are clearly explained. Accounting for the by-product beef is decisive for the CF of milk, and when designing future strategies for the dairy sector, milk and meat production needs to be addressed in an integrated approach. It is shown that an increase in milk yield per cow does not necessarily result in a lower CF of milk, when taking into account the alternative production of the by-product beef. This demonstrates that it is important to investigate interactions between different product chains, i.e. to apply system thinking. The CF of dairy products from Arla Foods analysed in the present study range from: 1.2-5.5 kg CO{sub 2}e per kg fresh dairy products, 7.3-10.9 kg CO{sub 2}e per kg butter and butter blends, 4.5-9.9 kg CO{sub 2}e per kg cheese, and 1.0-17.4 kg CO{sub 2}e per kg milk

  10. A mutation specific polymerase chain reaction for detecting hepatitis B virus genome mutations at nt551

    Institute of Scientific and Technical Information of China (English)

    Chun-Ling Ma; De-Xing Fang; Hua-Biao Chen; Fa-Qing Li; Hui-Ying Jin; Su-Qin Li; Wei-Guo Tan

    2003-01-01

    AIM: The hepatitis B surface antigen (HBsAg) is considered to be one of the best markers for the diagnosis of acute and chronic HBV infection. But in some patients, this antigen cannot be detected by routine serological assays despite the presence of virus. One of the most important explanations for the lack of detectable HBsAg is that mutations which occur within the "a" determinant of HBV S gene can alter expression of HBsAg and lead to changes of antigenicity and immunogenicity of HBsAg accordingly. As a result, these mutants cannot be detected by diagnosis assays. Thus, it is essential to find out specific and sensitive methods to test the new mutants and further investigate their distribution. This study is to establish a method to investigate the distribution of the HBsAg mutant at nt551.METHODS: A mutation specific polymerase chain reaction (msPCR) was established for amplifying HBV DNA with a mutation at nt551. Four sets of primer pairs, P551A-PPS,P551G-PPS, P551C-PPS and P551T-PPS, with the same sequences except for one base at 3' terminus were designed and synthesized according to the known HBV genome sequences and the popular HBV subtypes, adr and adw, in China. At the basis of regular PCR method, we explored the specific conditions for amplifying HBV DNAs with a mutation at nt551 by regulating annealing temperature and the concentration of these primers. 126 serum samples from patients of hepatitis B were collected, among which 16 were positive for HBV S DNA in the nested PCR amplification. These 16 HBV S DNAs were detected by using the msPCR method.RESULTS: When the annealing temperature was raised to 71 °C, nt551A and nt551G were amplified specifically by P551A-PPS and P551G-PPS; At 72 °C and 5 pmole of the primers (each) in reaction of 25 μl volume, nt551C and nt551T were amplified specifically by P551C-PPS and P551TPPS. 16 of HBV S gene fragments were characterized by using this method. 14 of them were positive for nt551A, one was positive for nt

  11. Game Analysis and Countermeasures on Increasing Prices of Agricultural Products under Triple Supply Chain

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    From the perspective of supply chain of agricultural products,by establishing Stackelberg game model based on triple supply chain,this paper researches the price formation and profit distribution mechanism of agricultural products under circumstance of non-cooperation and cooperation.The results show the main factors responsible for the hiking of prices of agricultural products as follows:the cost of agricultural products climbs incessantly;the circulation cost hovers at high level;the factor inputs of agricultural products are short;inflation pressure is incessantly mounting;the profit distribution of supply chain is irrational.Finally,corresponding countermeasures are put forward.

  12. Simulation and optimization of agricultural product supply chain system based on Witness

    Directory of Open Access Journals (Sweden)

    Jiandong Liu

    2017-03-01

    Full Text Available Researches on agricultural product supply chain have important implications for improving the efficiency of agricultural products circulation, strengthening the construction of agricultural market system, promoting agricultural modernization and solving the three rural issues. Agricultural product supply chain system has begun to be optimized through simulation technique. In this paper, agricultural product supply chain system is reasonably simplified and assumed. A simulation model was developed by using the simulation software Wit-ness to study agricultural product supply chain. Through the analysis of the simulation output data, improvement suggestions were also proposed as follows: improving the organization degree of agricultural products, improving the agricultural products processing, establishing strategic partnership and scientifically developing agricultural products logistics.

  13. 76 FR 34271 - Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles Management Unit, Including...

    Science.gov (United States)

    2011-06-13

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF LABOR Employment and Training Administration Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles... workers of Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles Management Unit...

  14. Chain elongation of acetate and ethanol in an upflow anaerobic filter for high rate MCFA production

    NARCIS (Netherlands)

    Grootscholten, T.I.M.; Steinbusch, K.J.J.; Hamelers, H.V.M.; Buisman, C.J.N.

    2013-01-01

    Recently, interest has regained for medium chain fatty acids (MCFAs) as a low cost feedstock for bio-based chemical and fuel production processes. To become cost-effective, the volumetric MCFA production rate by chain elongation should increase to comparable rates of other fermentation processes. We

  15. Chain elongation of acetate and ethanol in an upflow anaerobic filter for high rate MCFA production

    NARCIS (Netherlands)

    Grootscholten, T.I.M.; Steinbusch, K.J.J.; Hamelers, H.V.M.; Buisman, C.J.N.

    2013-01-01

    Recently, interest has regained for medium chain fatty acids (MCFAs) as a low cost feedstock for bio-based chemical and fuel production processes. To become cost-effective, the volumetric MCFA production rate by chain elongation should increase to comparable rates of other fermentation processes. We

  16. The roles of productivity and ecosystem size in determining food chain length in tropical terrestrial ecosystems.

    Science.gov (United States)

    Young, Hillary S; McCauley, Douglas J; Dunbar, Robert B; Hutson, Michael S; Ter-Kuile, Ana Miller; Dirzo, Rodolfo

    2013-03-01

    Many different drivers, including productivity, ecosystem size, and disturbance, have been considered to explain natural variation in the length of food chains. Much remains unknown about the role of these various drivers in determining food chain length, and particularly about the mechanisms by which they may operate in terrestrial ecosystems, which have quite different ecological constraints than aquatic environments, where most food chain length studies have been thus far conducted. In this study, we tested the relative importance of ecosystem size and productivity in influencing food chain length in a terrestrial setting. We determined that (1) there is no effect of ecosystem size or productive space on food chain length; (2) rather, food chain length increases strongly and linearly with productivity; and (3) the observed changes in food chain length are likely achieved through a combination of changes in predator size, predator behavior, and consumer diversity along gradients in productivity. These results lend new insight into the mechanisms by which productivity can drive changes in food chain length, point to potential for systematic differences in the drivers of food web structure between terrestrial and aquatic systems, and challenge us to consider how ecological context may control the drivers that shape food chain length.

  17. Efficient combinatorial filtering for desired molecular properties of reaction products.

    Science.gov (United States)

    Shi, S; Peng, Z; Kostrowicki, J; Paderes, G; Kuki, A

    2000-01-01

    Two combinatorial filtering methods for efficiently selecting reaction products with desired properties are presented. The first, "direct reactants" method is applicable only to those molecular properties that are strictly additive or approximately additive, with relatively small interference between neighboring fragments. This method uses only the molecular properties of reactants. The second, "basis products" method can be used to filter not only the strictly additive properties but also the approximately additive molecular properties where a certain degree of mutual influence occurs between neighboring fragments. This method requires the molecular properties of the "basis products," which are the products formed by combining all the reactants for a given reaction component with the simplest set of complementary reactant partners. There is a one-to-one correspondence between the reactants and the "basis products." The latter is a product representation of the former. High efficiency of both methods is enhanced further by a tree-sorting and hierarchical selection algorithm, which is performed on the reaction components in a limited space determined systematically from the filtering criteria. The methods are illustrated with product logPs, van der Waals volumes, solvent accessible surface areas, and other product properties. Good results are obtained when filtering for a number of important molecular properties in a virtual library of 1.5 billion.

  18. Detection of Paragonimus heterotremus eggs in experimentally infected cats by a polymerase chain reaction-based method.

    Science.gov (United States)

    Intapan, Pewpan M; Wongkham, Chaisiri; Imtawil, Kanokwan J; Pumidonming, Wilawan; Prasongdee, Thidarat K; Miwa, Masanao; Maleewong, Wanchai

    2005-02-01

    A polymerase chain reaction (PCR) procedure for the detection of Paragonimus heterotremus eggs in stool samples was developed and compared with Stoll's egg count method. The primers were designed on the basis of a previously constructed pPH-13-specific DNA probe, which produced an approximate 0.5-kb amplified product. This PCR method could detect as few as 5 eggs in 0.6 g of artificially inoculated feces of a healthy control cat or as little as 1 x 10(-4) ng of P. heterotremus genomic DNA. The assay had 100% sensitivity in all infected cats. The method did not yield an approximate 0.5-kb product with DNA from other parasites such as Gnathostoma spinigerum, Trichinella spiralis, Fasciola gigantica, Echinostoma malayanum, Opisthorchis viverrini, Dirofilaria immitis, and Taenia saginata; exceptions were Paragonimus siamensis and Paragonimus westermani. In addition, no genomic DNA from Escherichia coli, Burkholderia pseudomallei, Acinetobacter anitratus, Mycobacterium tuberculosis, Staphylococcus aureus, beta-Streptococcus grA, and Proteus mirabilis or from the vertebrate and invertebrate hosts of P. heterotremus was amplified in the PCR assay. This assay has great potential for application in clinical epidemiological studies.

  19. Application of polymerase chain reaction to differentiate herpes simplex virus 1 and 2 serotypes in culture negative intraocular aspirates

    Directory of Open Access Journals (Sweden)

    Shyamal G

    2005-01-01

    Full Text Available Purpose: To standardize and apply a polymerase chain reaction (PCR on the glycoprotein D gene to differentiate Herpes simplex virus (HSV 1 & 2 serotypes in culture negative intraocular specimens. Methods: Twenty-one intraocular fluids collected from 19 patients were subjected to cultures for HSV and uniplex PCR (uPCR for DNA polymerase gene. To differentiate HSV serotypes, as 1 & 2, a seminested PCR (snPCR targeting the glycoprotein D gene was standardised and applied onto 21 intraocular fluids. The specificity of the snPCR was verified by application onto ATCC strains of HSV 1 and 2, clinical isolates and DNA sequencing of the amplified products. All specimens were also tested for the presence of cytomegalovirus (CMV and varicella zoster virus (VZV by nucleic acid amplification methods. Results: Four of the 21 intraocular fluids were positive for HSV by uPCR. snPCR detected HSV in three additional specimens (total of seven specimens, and identified three as HSV 1 and four as HSV 2. DNA sequencing of PCR products showed 100% homology with the standard strains of HSV 1 and 2 respectively. None of the samples were positive in culture. Among the other patients, CMV DNA was detected in two and VZV DNA in five others. Conclusions: The standardized snPCR can be applied directly onto the culture negative specimens for rapid differentiation of HSV serotypes.

  20. [Differentiation of Entamoeba histolytica from Entamoeba dispar using Gal/GalNAc-lectin and polymerase chain reaction].

    Science.gov (United States)

    López, Omaira Y; López, Myriam C; Corredor, Vladimir; Echeverri, M Clara; Pinilla, Análida E

    2012-04-01

    Entamoeba histolytica and Entamoeba dispar are morphologically identical. However, the former is highly pathogenic and the latter is not. To differentiate Entamoeba histolytica from Entamoeba dispar through ELISA and PCR techniques in Colombian isolates from feces. Descriptive study of Colombian fecal samples from 53 males and 47 women, that were positive for the complex E. histolytica/E. dispar on light microscopy. Positive samples were cultured on Robinson medium to isolate trophozoites. The presence of specific Gal/ GalNAc-lectin was determined by ELISA and polymerase chain reaction in genomic DNA, using the combination of three nucleotides that recognize a variable region of 16S small subunit ribosomal RNA, generating a 166 base pair (bp) product for E. histolytica and 752 pb product for E. dispar. After verification, only eight of the 100 samples were positive for the complex E. histolytica/E. dispar and were cultivated. Isolates were obtained in six cultures, one corresponded to E. histolytica and six to E. dispar. The presence of E. histolytica/E. dispar complex was largely overestimated with light microscopy. In the few samples where isolates were obtained, the technique described differentiated between both strains.

  1. A multiplex reverse transcription-polymerase chain reaction assay for Newcastle disease virus and avian pneumovirus (Colorado strain).

    Science.gov (United States)

    Ali, A; Reynolds, D L

    2000-01-01

    Newcastle disease virus (NDV) and avian pneumovirus (APV) cause Newcastle disease and rhinotracheitis respectively, in turkeys. Both of these viruses infect the respiratory system. A one-tube, multiplex, reverse transcription-polymerase chain reaction (RT-PCR) assay for the detection of both NDV and Colorado strain of APV (APV-Col) was developed and evaluated. The primers, specific for each virus, were designed from the matrix protein gene of APV-Col and the fusion protein gene of NDV to amplify products of 631 and 309 nucleotides, respectively. The multiplex RT-PCR assay, for detecting both viruses simultaneously, was compared with the single-virus RT-PCR assays for its sensitivity and specificity. The specific primers amplified products of predicted size from each virus in the multiplex as well as the single-virus RT-PCR assays. The multiplex RT-PCR assay was determined to be equivalent to the single-virus RT-PCR assays for detecting both NDV and APV-Col. This multiplex RT-PCR assay proved to be a sensitive method for the simultaneous and rapid detection of NDV and APV-Col. This assay has the potential for clinical diagnostic applications.

  2. Role of myosin light chain and myosin light chain kinase in advanced glycation end product-induced endothelial hyperpermeability in vitro and in vivo.

    Science.gov (United States)

    Wu, Fan; Guo, Xiaohua; Xu, Jing; Wang, Weiju; Li, Bingling; Huang, Qiaobing; Su, Lei; Xu, Qiulin

    2016-03-01

    We have previously reported that advanced glycation end products activated Rho-associated protein kinase and p38 mitogen-activated protein kinase, causing endothelial hyperpermeability. However, the mechanisms involved were not fully clarified. Here, we explored the role of myosin light chain kinase in advanced glycation end product-induced endothelial hyperpermeability. Myosin light chain phosphorylation significantly increased by advanced glycation end products in endothelial cells in a time- and dose-dependent manner, indicating that myosin light chain phosphorylation is involved in the advanced glycation end product pathway. Advanced glycation end products also induced myosin phosphatase-targeting subunit 1 phosphorylation, and small interfering RNA knockdown of the receptor for advanced glycation end products, or blocking myosin light chain kinase with its inhibitor, ML-7, or small interfering RNA abated advanced glycation end product-induced myosin light chain phosphorylation. Advanced glycation end product-induced F-actin rearrangement and endothelial hyperpermeability were also diminished by inhibition of receptor for advanced glycation end product or myosin light chain kinase signalling. Moreover, inhibiting myosin light chain kinase with ML-7 or blocking receptor for advanced glycation end product with its neutralizing antibody attenuated advanced glycation end product-induced microvascular hyperpermeability. Our findings suggest a novel role for myosin light chain and myosin light chain kinase in advanced glycation end product-induced endothelial hyperpermeability.

  3. Product branching ratio of the HCCO + NO reaction

    Energy Technology Data Exchange (ETDEWEB)

    Rim, K.T.; Hershberger, J.F.

    2000-01-20

    The reaction of HCCO radicals with NO was studied at room temperature by excimer laser photolysis of ketene precursor molecules followed by infrared absorption spectroscopic detection of CO and CO{sub 2} product molecules. After quantification of product yields and consideration of secondary chemistry, the authors obtain the following product branching ratios (1{sigma} error bars) at 296 K: 0.12 {+-} 0.04 for CO{sub 2} + (HCN) and 0.88 {+-} 0.04 for CO + (HCNO). In addition, they estimate a relative quantum yield for HCCO production in the 193 nm photolysis of CH{sub 2}CO to be 0.17 {+-} 0.02.

  4. Development of a Droplet Digital Polymerase Chain Reaction for Rapid and Simultaneous Identification of Common Foodborne Pathogens in Soft Cheese.

    Science.gov (United States)

    Cremonesi, Paola; Cortimiglia, Claudia; Picozzi, Claudia; Minozzi, Giulietta; Malvisi, Michela; Luini, Mario; Castiglioni, Bianca

    2016-01-01

    Dairy products can harbor various microorganisms (e.g., Campylobacter spp., Salmonella spp., Listeria monocytogenes, verocytotoxin-producing Escherichia coli) arising from animal reservoirs, and which can become important sources of foodborne illness. Therefore, early detection of food pathogens is crucial to prevent diseases. We wished to develop an accurate quantitative protocol based on a droplet digital polymerase chain reaction (ddPCR) involving eight individual TaqMan™ reactions to detect simultaneously, without selective enrichment, Listeria spp., L. monocytogenes, Salmonella spp., verocytotoxin-producing E. coli and Campylobacter spp. in cheese. ddPCR (a "third-generation PCR") provides absolute quantification of target DNAs without requirement of a standard curve, which simplifies experimentation and data comparability. The accuracy, specificity and sensitivity of the developed ddPCR system were assessed using purified DNA from 50 reference pathogenic and non-pathogenic strains from international or Italian collections and analyzing soft cheese samples artificially contaminated with serial dilutions (from 4 × 10(6) to 4 × 10(1) CFU/g) of pure cultures from the American Type Culture Collection. Finally, the performance of our ddPCR system was compared by parallel testing with quantitative PCR: it gave higher sensitivity (10(2) CFU/g for the Listeria spp. assay) without the necessity of a standard curve. In conclusion, this is the first ddPCR system developed for simultaneous detection of common foodborne pathogens in cheese using a single set of amplification conditions. As such, it could become a useful strategy for high-throughput screening of microorganisms to evaluate the quality and safety of food products.

  5. Development of a droplet digital polymerase chain reaction for rapid and simultaneous identification of common foodborne pathogens in soft cheese

    Directory of Open Access Journals (Sweden)

    Paola Cremonesi

    2016-10-01

    Full Text Available Dairy products can harbor various microorganisms (e.g., Campylobacter spp., Salmonella spp., Listeria monocytogenes, verocytotoxin-producing Escherichia coli arising from animal reservoirs, and which can become important sources of foodborne illness. Therefore, early detection of food pathogens is crucial to prevent diseases. We wished to develop an accurate quantitative protocol based on a droplet digital polymerase chain reaction (ddPCR involving eight individual TaqMan™ reactions to detect simultaneously, without selective enrichment, Listeria spp., L. monocytogenes, Salmonella spp., verocytotoxin-producing E. coli and Campylobacter spp. in cheese. ddPCR (a third-generation PCR provides absolute quantification of target DNAs without requirement of a standard curve, which simplifies experimentation and data comparability. The accuracy, specificity and sensitivity of the developed ddPCR system were assessed using purified DNA from 50 reference pathogenic and non-pathogenic strains from international or Italian collections and analyzing soft cheese samples artificially contaminated with serial dilutions (from 4×106 to 4×101 CFU/g of pure cultures from the American Type Culture Collection.Finally, the performance of our ddPCR system was compared by parallel testing with quantitative PCR: it gave higher sensitivity (102 CFU/g for the Listeria spp. assay without the necessity of a standard curve.In conclusion, this is the first ddPCR system developed for simultaneous detection of common foodborne pathogens in cheese using a single set of amplification conditions. As such, it could become a useful strategy for high-throughput screening of microorganisms to evaluate the quality and safety of food products.

  6. Detection of hblA and bal Genes in Bacillus cereus Isolates From Cheese Samples Using the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Molayi Kohneshahri

    2016-03-01

    Full Text Available Background Bacillus cereus is a Gram-positive spore-forming bacterium, which causes food poisoning. Spores enable the persistence of B. cereus in the environment, and B. cereus strains can tolerate adverse environmental conditions, such as temperature and insufficient nutrients. B. cereus causes food poisoning via the production of two enterotoxins. Most isolates produce toxins leading to diarrhea (enterotoxins and vomiting (emetic forms. Diarrhea is caused by the production of three different heat-labile enterotoxins: HBL, NHE, and cytotoxin K. A heat-stable toxin, cereulide, is responsible for emesis. Objectives This study aimed to detect enterotoxigenic B. cereus isolates in cheese samples using the polymerase chain reaction (PCR. Materials and Methods Two-hundred pasteurized (n = 100 and nonpasteurized (n = 100 cheese samples were collected. The initial isolation was performed on PEMBA specific medium. Antibiotic susceptibility testing was performed using several antibiotic disks, according to the guidelines of the Clinical Laboratory and Standards Institute. Specific primers amplifying the hblA enterotoxin-encoding gene and bal hemolysin-encoding gene were used for the molecular detection of the toxins. Results Ten samples were positive for the presence of B. cereus, with both Gram staining and biochemical reactions. All the isolates were resistant to penicillin and ampicillin but susceptible to vancomycin, erythromycin, and ciprofloxacin. Six and three isolates were resistant to tetracycline and trimethoprim-sulfamethoxazole, respectively. The hblA and bal genes were amplified in all the B. cereus isolates. Conclusions The prevalence of B. cereus among the cheese samples was low. All the isolates were positive for genes encoding the hblA enterotoxin and bal toxin.

  7. Kinematic chain reactions on trunk and dynamic postural steadiness in subjects with recurrent low back pain.

    Science.gov (United States)

    Sung, Paul S; Maxwell, Michael J

    2017-07-05

    Although subjects with recurrent low back pain (LBP) demonstrate altered trunk control, the kinematic and kinetic responses of the trunk have not been carefully investigated. This study was conducted to compare the standing time, spine range of motion (ROM), and dynamic postural steadiness index (DPSI) based on visual condition between subjects with and without recurrent LBP during upright one leg standing. Sixty-three individuals participated in the study, including 34 control subjects and 29 subjects with recurrent LBP. The DPSI was a composite of the medio-lateral (MLSI), anterior-posterior (APSI), and vertical steadiness indices (VSI) on a force platform. The control group demonstrated longer standing time (s) during the eyes-open condition than the LBP group (26.82±6.03 vs. 19.87±9.36; t=2.96, p=0.01). Regarding spine ROM, visual condition was significantly different between groups (F=7.09, p=0.01) and demonstrated interactions with spine region and group (F=5.53, p=0.02). For the kinetic measures, there was a significant interaction between visual conditions and indices (F=25.30, p=0.001). In the LBP group, the DPSI was significantly correlated with the MLSI (r=0.59, p=0.002), APSI (r=0.44, p=0.03), and VSI (r=0.98, p=0.01) in the eyes-closed condition. Overall, the results of this study indicated that the LBP group decreased thorax and lumbar spine rotations during the eyes-closed condition. The LBP group also demonstrated positive correlations with the kinetic indices, enhancing dynamic postural steadiness in the eyes-closed condition in order to possibly avoid pain or further injury. This dynamic postural steadiness strategy is necessary to improve kinetic and kinematic chain reactions in the LBP group. This compensatory pattern supports the development of optimal postural correction strategies to prevent LBP recurrence and might represent a chain reaction to protect trunk control without visual input. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Detection of human papillomavirus DNA by in situ hybridization and polymerase chain reaction in human papillomavirus equivocal and dysplastic cervical biopsies.

    Science.gov (United States)

    Shroyer, K R; Lovelace, G S; Abarca, M L; Fennell, R H; Corkill, M E; Woodard, W D; Davilla, G H

    1993-09-01

    One hundred twenty-one paraffin-embedded cervical biopsy specimens were tested for the presence of human papillomavirus (HPV) DNA by in situ hybridization and polymerase chain reaction. By in situ hybridization using probes for HPV types 6/11, 16/18, 31/33/35, 42/43/44, 51/52, and 45/56, HPV DNA was found in none of 20 normal/squamous metaplasia biopsy specimens, in one of 76 HPV equivocal biopsy specimens, in seven of 12 condyloma/mild dysplasia biopsy specimens, and in 12 of 13 moderate/severe dysplasia biopsy specimens. Polymerase chain reaction using HPV L1 consensus sequence primers followed by filter hybridization of the amplification products was positive for HPV DNA in two of 20 normal/squamous metaplasia biopsy specimens, in 23 of 76 HPV equivocal biopsy specimens, in eight of 12 condyloma/mild dysplasia biopsy specimens, and in 12 of 13 moderate/severe dysplasia biopsy specimens. Among biopsies that tested positive by polymerase chain reaction but that were negative by in situ hybridization, the most commonly identified HPV was type 16. We conclude that although HPV equivocal biopsy specimens contain HPV DNA more frequently than histologically normal tissue, the majority of biopsy specimens in this category test negative for HPV DNA. The clinical significance of a positive test for HPV, in the absence of unequivocal histologic changes, remains to be determined.

  9. On Construction of Supply Chain System for China’s Modern Agricultural Products

    Institute of Scientific and Technical Information of China (English)

    Wanjiang; WANG

    2015-01-01

    In view of drawbacks in supply chain of China’s traditional agricultural products,this paper proposed building supply chain system for modern agricultural products: taking informationization as basis,channel system as core,organization system as support,and service system and safety system as guarantee,to promote high efficient operation of the supply chain system. The channel system stresses alliance and integration of channel system,informationization of channel management,and terminalization of channel operation; the organization system stresses organization,large scale,group,and brand of participant entities; service system stresses construction of service means,service platform,and operation mechanism; safety system stresses building quality safety based agricultural product supply chain management mode. In order to ensure high efficient operation of supply chain for modern agricultural products,it is required to straighten out supply chain management system,actively cultivate core enterprises of supply chain,strengthen information construction of supply chain,select suitable supply chain mode,and improve benefit allocation mechanism.

  10. Strangeness production and hypernucleus formation in antiproton induced reactions

    CERN Document Server

    Feng, Zhao-Qing

    2015-01-01

    Formation mechanism of fragments with strangeness in collisions of antiprotons on nuclei has been investigated within the Lanzhou quantum molecular dynamics (LQMD) transport approach combined with a statistical model (GEMINI) for describing the decays of excited fragments. Production of strange particles in the antiproton induced nuclear reactions is modeled within the LQMD model, in which all possible reaction channels such as elastic scattering, annihilation, charge exchange and inelastic scattering in antibaryon-baryon, baryon-baryon and meson-baryon collisions have been included. A coalescence approach is developed for constructing hyperfragments in phase space after de-excitation of nucleonic fragments. The combined approach could describe the production of fragments in low-energy antiproton induced reactions. Hyperfragments are formed within the narrower rapidities and lower kinetic energies. It has advantage to produce heavier hyperfragments and hypernuclides with strangeness s=-2 (double-$\\Lambda$ fra...

  11. Fission-product SiC reaction in HTGR fuel

    Energy Technology Data Exchange (ETDEWEB)

    Montgomery, F.

    1981-07-13

    The primary barrier to release of fission product from any of the fuel types into the primary circuit of the HTGR are the coatings on the fuel particles. Both pyrolytic carbon and silicon carbide coatings are very effective in retaining fission gases under normal operating conditions. One of the possible performance limitations which has been observed in irradiation tests of TRISO fuel is chemical interaction of the SiC layer with fission products. This reaction reduces the thickness of the SiC layer in TRISO particles and can lead to release of fission products from the particles if the SiC layer is completely penetrated. The experimental section of this report describes the results of work at General Atomic concerning the reaction of fission products with silicon carbide. The discussion section describes data obtained by various laboratories and includes (1) a description of the fission products which have been found to react with SiC; (2) a description of the kinetics of silicon carbide thinning caused by fission product reaction during out-of-pile thermal gradient heating and the application of these kinetics to in-pile irradiation; and (3) a comparison of silicon carbide thinning in LEU and HEU fuels.

  12. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  13. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  14. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Science.gov (United States)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  15. Real time polymerase chain reaction (rt-pcr for mycobacterium tuberculosis in serpiginous choroiditis- A study of 29 cases

    Directory of Open Access Journals (Sweden)

    RadhaAnnamalai, Jyotirmay Biswas, Sudharshan S, Gayathri R, Lily Therese, Viswanathan S, NamithaBhuvaneswari

    2014-07-01

    Full Text Available Purpose: A study of real time Polymerase Chain Reaction for Mycobacterium tuberculosis (M. tuberculosis DNA in 29 cases of active serpiginous choroiditis. Design: Case control study. Methods: DNA extraction from the aqueous humor was carried out using QIAMP DNA extraction kit. Real- time Polymerase Chain reaction (RT-PCR for MTB was carried out using Genosen’s Mtb complex quantitative Real time PCR kit. All patients were also subjected to complete blood count, venereal disease research laboratory test, chest radiograph, QuantiFERON TB Gold test on the blood and polymerase chain reaction on a sample of aqueous humor. Results: Aqueous aspirate showed copies of mycobacterium tuberculosis DNA in one out of twenty nine cases of serpiginous choroiditis. Direct smear and culture for mycobacteria was negative in all cases. Conclusion: RT-PCR identifies MTB DNA in suspected latent tuberculosis in serpiginous choroiditis with high specificity. Serpiginous choroiditis and multifocal choroiditis due to tuberculosis may resemble each other clinically but have distinct clinical features which can be confirmed by real time polymerase chain reaction performed on the aqueous humor The association between serpiginous choroiditis and tuberculosis would be a chance association or if present a rare association.

  16. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    Science.gov (United States)

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence.

  17. An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

    NARCIS (Netherlands)

    Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

    2010-01-01

    The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30 minut

  18. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;

    2007-01-01

    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR...

  19. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjaerg, L L; Hansen, J E; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...

  20. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.;

    1999-01-01

    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot...