WorldWideScience

Sample records for chain reaction products

  1. Chain reaction

    International Nuclear Information System (INIS)

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  2. Detection and analysis of polymerase chain reaction products by mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  3. Preparative isolation of polymerase chain reaction products using mixed-mode chromatography.

    Science.gov (United States)

    Matos, T; Silva, G; Queiroz, J A; Bülow, L

    2015-11-15

    The polymerase chain reaction (PCR) has become one of the most useful techniques in molecular biology laboratories around the world. The purification of the target DNA product is often challenging, however, and most users are restricted to employing available commercial kits. The recent developments in mixed-mode chromatography have shown higher selectivity for a variety of nucleic acid-containing samples. Capto Adhere is a mixed-mode chromatography resin that offers a high-selectivity ligand and is here applied for the purification of amplified DNAs from PCR mixtures in a 10-min single step, with yields above 95%, high linearity, and high precision for different concentrations.

  4. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying

    2007-01-01

    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  5. Polymerase chain reaction

    OpenAIRE

    Gaurav Solanki

    2015-01-01

    The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation...

  6. Sequencing of simple sequence repeat anchored polymerase chain reaction amplification products of Biomphalaria glabrata

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2002-01-01

    Full Text Available Simple sequence repeat anchored polymerase chain reaction amplification (SSR-PCR is a genetic typing technique based on primers anchored at the 5' or 3' ends of microsatellites, at high primer annealing temperatures. This technique has already been used in studies of genetic variability of several organisms, using different primer designs. In order to conduct a detailed study of the SSR-PCR genomic targets, we cloned and sequenced 20 unique amplification products of two commonly used primers, CAA(CT6 and (CA8RY, using Biomphalaria glabrata genomic DNA as template. The sequences obtained were novel B. glabrata genomic sequences. It was observed that 15 clones contained microsatellites between priming sites. Out of 40 clones, seven contained complex sequence repetitions. One of the repeats that appeared in six of the amplified fragments generated a single band in Southern analysis, indicating that the sequence was not widespread in the genome. Most of the annealing sites for the CAA(CT6 primer contained only the six repeats found within the primer sequence. In conclusion, SSR-PCR is a useful genotyping technique. However, the premise of the SSR-PCR technique, verified with the CAA(CT6 primer, could not be supported since the amplification products did not result necessarily from microsatellite loci amplification.

  7. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    Science.gov (United States)

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis.

  8. Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Gaurav Solanki

    2012-10-01

    Full Text Available The polymerase chain reaction (PCR is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation and diagnosis of a growing number of diseases. PCR is also used in forensics laboratories. PCR can identify genes that have been implicated in the development of cancer. The present paper is an attempt to review basics of PCR in relation to its methods, application and use.

  9. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    Science.gov (United States)

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  10. Acyl chains of phospholipase D transphosphatidylation products in Arabidopsis cells: a study using multiple reaction monitoring mass spectrometry.

    Directory of Open Access Journals (Sweden)

    Dominique Rainteau

    Full Text Available BACKGROUND: Phospholipases D (PLD are major components of signalling pathways in plant responses to some stresses and hormones. The product of PLD activity is phosphatidic acid (PA. PAs with different acyl chains do not have the same protein targets, so to understand the signalling role of PLD it is essential to analyze the composition of its PA products in the presence and absence of an elicitor. METHODOLOGY/PRINCIPAL FINDINGS: Potential PLD substrates and products were studied in Arabidopsis thaliana suspension cells treated with or without the hormone salicylic acid (SA. As PA can be produced by enzymes other than PLD, we analyzed phosphatidylbutanol (PBut, which is specifically produced by PLD in the presence of n-butanol. The acyl chain compositions of PBut and the major glycerophospholipids were determined by multiple reaction monitoring (MRM mass spectrometry. PBut profiles of untreated cells or cells treated with SA show an over-representation of 160/18:2- and 16:0/18:3-species compared to those of phosphatidylcholine and phosphatidylethanolamine either from bulk lipid extracts or from purified membrane fractions. When microsomal PLDs were used in in vitro assays, the resulting PBut profile matched exactly that of the substrate provided. Therefore there is a mismatch between the acyl chain compositions of putative substrates and the in vivo products of PLDs that is unlikely to reflect any selectivity of PLDs for the acyl chains of substrates. CONCLUSIONS: MRM mass spectrometry is a reliable technique to analyze PLD products. Our results suggest that PLD action in response to SA is not due to the production of a stress-specific molecular species, but that the level of PLD products per se is important. The over-representation of 160/18:2- and 16:0/18:3-species in PLD products when compared to putative substrates might be related to a regulatory role of the heterogeneous distribution of glycerophospholipids in membrane sub-domains.

  11. Supply chain reaction

    International Nuclear Information System (INIS)

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  12. Development of a polymerase chain reaction assay for species identification of goose and mule duck in foie gras products.

    Science.gov (United States)

    Rodrı X0301 Guez, Miguel A; Garcı X0301 A, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martı X0301 N, Rosario

    2003-12-01

    Polymerase chain reaction amplification of a conserved region of the α-actin gene has been used for the specific identification of goose (Anser anser) and mule duck (Anas platyrhynchos×Cairina moschata) foie gras. Universal primers were used for the amplification of a DNA fragment containing three introns and four exons of the α-actin gene in goose and mule duck. Sequence analysis of the amplified fragments was necessary for the design of forward species-specific primers in the goose and mule duck α-actin genes. The use of species-specific forward primers, together with a reverse universal primer, produced amplicons of different length, allowing clear identification of goose and mule duck foie gras samples. Analysis of experimental mixtures demonstrated that 1% of duck can be easily detected in goose foie gras using the PCR method developed here. This genetic marker can be very useful for the accurate identification of these two species in foie gras products.

  13. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    Science.gov (United States)

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  14. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase.

    Science.gov (United States)

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

    2013-11-01

    An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies.

  15. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan); Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki [System Instruments Co., Ltd., 776-2 Komiya-cho, Hachioji, Tokyo 192-0031 (Japan); Noda, Mamoru; Igimi, Shizunobu [Division of Biomedical Food Research, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Ikebukuro, Kazunori, E-mail: ikebu@cc.tuat.ac.jp [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan)

    2013-11-01

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 10{sup 6} copies.

  16. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 106 copies

  17. Partial strands synthesizing leads to inevitable aborting and complicated products in consecutive polymerase chain reactions (PCRs)

    Institute of Scientific and Technical Information of China (English)

    LUO Rui; ZHANG DaMing

    2007-01-01

    Various abnormal phenomena have been observed during PCR so far. The present study performed a series of consecutive PCRs (including many rounds of re-amplification continuously) and found that the abortion of re-amplification was inevitable as long as a variety of complicated product appeared.The aborting stages varied, according to the lengths of targets. Longer targets reached the abortion earlier than the shorter ones, marked by appearance of the complex that was immobile in electrophoresis. Denatured gel-electrophoresis revealed that the complex was mainly made up of shorter or partially synthesized strands, together with small amounts of full-length ones. Able to be digested by S1 nuclease but unable by restriction endonucleases (REs), the complex was proved to consist of both single regions and double-helix regions that kept the complex stable thermodynamically. Simulations gave evidence that partial strands, even at lower concentration, could disturb re-amplification effectively and lead to the abortion of re-amplifications finally. It was pointed out that the partial strands formed chiefly via polymerase's infidelity, and hence the solution to lighten the abnormality was also proposed.

  18. Partial strands synthesizing leads to inevitable aborting and complicated products in consecutive polymerase chain reactions (PCRs)

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Various abnormal phenomena have been observed during PCR so far. The present study performed a series of consecutive PCRs (including many rounds of re-amplification continuously) and found that the abortion of re-amplification was inevitable as long as a variety of complicated product appeared. The aborting stages varied, according to the lengths of targets. Longer targets reached the abortion earlier than the shorter ones, marked by appearance of the complex that was immobile in electropho-resis. Denatured gel-electrophoresis revealed that the complex was mainly made up of shorter or partially synthesized strands, together with small amounts of full-length ones. Able to be digested by S1 nuclease but unable by restriction endonucleases (REs), the complex was proved to consist of both single regions and double-helix regions that kept the complex stable thermodynamically. Simulations gave evidence that partial strands, even at lower concentration, could disturb re-amplification effec- tively and lead to the abortion of re-amplifications finally. It was pointed out that the partial strands formed chiefly via polymerase’s infidelity, and hence the solution to lighten the abnormality was also proposed.

  19. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product) with beef and buffalo meat through multiplex polymerase chain reaction

    OpenAIRE

    M. Mansoor Bhat; Mir Salahuddin; Imtiyaz A. Mantoo; Sheikh Adil; Henna Jalal; M. Ashraf Pal

    2016-01-01

    Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan), the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA) based multiplex polymerase chain reaction (PCR) method under laboratory conditions. Materia...

  20. Double Gene Targeting Multiplex Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay Discriminates Beef, Buffalo, and Pork Substitution in Frankfurter Products.

    Science.gov (United States)

    Hossain, M A Motalib; Ali, Md Eaqub; Abd Hamid, Sharifah Bee; Asing; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Zaidul, I S M

    2016-08-17

    Beef, buffalo, and pork adulteration in the food chain is an emerging and sensitive issue. Current molecular techniques to authenticate these species depend on polymerase chain reaction (PCR) assays involving long and single targets which break down under natural decomposition and/or processing treatments. This novel multiplex polymerase chain reaction-restriction fragment length polymorphism assay targeted two different gene sites for each of the bovine, buffalo, and porcine materials. This authentication ensured better security, first through a complementation approach because it is highly unlikely that both sites will be missing under compromised states, and second through molecular fingerprints. Mitochondrial cytochrome b and ND5 genes were targeted, and all targets (73, 90, 106, 120, 138, and 146 bp) were stable under extreme boiling and autoclaving treatments. Target specificity and authenticity were ensured through cross-amplification reaction and restriction digestion of PCR products with AluI, EciI, FatI, and CviKI-1 enzymes. A survey of Malaysian frankfurter products revealed rampant substitution of beef with buffalo but purity in porcine materials. PMID:27501408

  1. The chain re-action

    CERN Multimedia

    2009-01-01

    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  2. Polymerase Chain Reaction on a Viral Nanoparticle.

    Science.gov (United States)

    Carr-Smith, James; Pacheco-Gómez, Raúl; Little, Haydn A; Hicks, Matthew R; Sandhu, Sandeep; Steinke, Nadja; Smith, David J; Rodger, Alison; Goodchild, Sarah A; Lukaszewski, Roman A; Tucker, James H R; Dafforn, Timothy R

    2015-12-18

    The field of synthetic biology includes studies that aim to develop new materials and devices from biomolecules. In recent years, much work has been carried out using a range of biomolecular chassis including α-helical coiled coils, β-sheet amyloids and even viral particles. In this work, we show how hybrid bionanoparticles can be produced from a viral M13 bacteriophage scaffold through conjugation with DNA primers that can template a polymerase chain reaction (PCR). This unprecedented example of a PCR on a virus particle has been studied by flow aligned linear dichroism spectroscopy, which gives information on the structure of the product as well as a new protototype methodology for DNA detection. We propose that this demonstration of PCR on the surface of a bionanoparticle is a useful addition to ways in which hybrid assemblies may be constructed using synthetic biology.

  3. Concurrent Product & Supply Chain Creation

    DEFF Research Database (Denmark)

    Gubi, Ebbe

    it is a structural premise. We also know that logistics costs generally are estimated 15-20% of total product costs. Accordingly, it stands to reason that a company can reduce costs, and thereby gain an edge on its competitors, by tailoring the supply chain in question to an individual product or product family; i......The purpose of this thesis is to increase the understanding of interplays between products and supply chains. In academia, there seem to be an acknowledgement that the nature of a given product has a major influence on the performance of the supply chain associated with it – for one.......e. by creating Focused Supply Chains. At the same time, customer satisfaction can be increased. As a second means to achieving a better fit between product and supply chain, the firm can deploy Design for Logistics, the discipline of considering the supply chain during product creation. The thesis sets out...

  4. Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

    Science.gov (United States)

    Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2010-06-01

    Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons <150 base pairs) of the mitochondrial 12S rRNA gene, and an endogenous control primer pair that amplifies a 141-bp fragment of the nuclear 18S rRNA gene from eukaryotic DNA. Analysis of experimental raw and heat-treated binary mixtures as well as of commercial meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

  5. Environmental Management in Product Chains

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard; Forman, Marianne

    2009-01-01

    ). An overview of examples from our own research and from literature of the type and the role of environmental issues and initiatives in product chains (fourth section). A typology for characterizing corporate strategies as part of environmental management in product chains and characterizing those competencies......The chapter aims at giving background to companies, consultants, governmental regulators, NGOs etc. for the analysis and planning of environmental management in specific product chains through: A framework for understanding environmental management in product chains as shaped by the interaction...... between existing resources, norms and values and external pressures for environmental management (second section). A model for the types of corporate network relations that need to be mapped and understood in order to analyze and/or develop environmental management in a product chain (third section...

  6. Product Classification in Supply Chain

    OpenAIRE

    Xing, Lihong; Xu, Yaoxuan

    2010-01-01

    Oriflame is a famous international direct sale cosmetics company with complicated supply chain operation but it lacks of a product classification system. It is vital to design a product classification method in order to support Oriflame global supply planning and improve the supply chain performance. This article is aim to investigate and design the multi-criteria of product classification, propose the classification model, suggest application areas of product classification results and intro...

  7. A-T linker adapter polymerase chain reaction for determining flanking sequences by rescuing inverse PCR or thermal asymmetric interlaced PCR products.

    Science.gov (United States)

    Trinh, Quoclinh; Zhu, Pengyu; Shi, Hui; Xu, Wentao; Hao, Junran; Luo, Yunbo; Huang, Kunlun

    2014-12-01

    The polymerase chain reaction (PCR)-based genome walking method has been extensively used to isolate unknown flanking sequences, whereas nonspecific products are always inevitable. To resolve these problems, we developed a new strategy to isolate the unknown flanking sequences by combining A-T linker adapter PCR with inverse PCR (I-PCR) or thermal asymmetric interlaced PCR (TAIL-PCR). The result showed that this method can be efficiently achieved with the flanking sequence from the Arabidopsis mutant and papain gene. Our study provides researchers with an additional method for determining genomic DNA flanking sequences to identify the target band from bulk of bands and to eliminate the cloning step for sequencing.

  8. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity...

  9. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  10. Polymerase Chain Reaction for Educational Settings.

    Science.gov (United States)

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  11. Target-selective joint polymerase chain reaction: A robust and rapid method for high-throughput production of recombinant monoclonal antibodies from single cells

    Directory of Open Access Journals (Sweden)

    Isobe Masaharu

    2011-07-01

    Full Text Available Abstract Background During the development of a therapeutic antibody, large numbers of monoclonal antibodies are required to screen for those that are best suited for the desired activity. Although the single cell-based immunoglobulin variable gene cloning technique is a powerful tool, the current methods remain an obstacle to the rapid production of large numbers of recombinant antibodies. Results We have developed a novel overlap extension polymerase chain reaction, the target-selective joint polymerase chain reaction (TS-jPCR, and applied it to the generation of linear immunoglobulin gene expression constructs. TS-jPCR is conducted using a PCR-amplified immunoglobulin variable gene and an immunoglobulin gene-selective cassette (Ig-cassette that contains all essential elements for antibody expression and overlapping areas of immunoglobulin gene-specific homology. The TS-jPCR technique is simple and specific; the 3'-random nucleotide-tailed immunoglobulin variable gene fragment and the Ig-cassette are assembled into a linear immunoglobulin expression construct, even in the presence of nonspecifically amplified DNA. We also developed a robotic magnetic beads handling instrument for single cell-based cDNA synthesis to amplify immunoglobulin variable genes by rapid amplification of 5' cDNA ends PCR. Using these methods, we were able to produce recombinant monoclonal antibodies from large numbers of single plasma cells within four days. Conclusion Our system reduces the burden of antibody discovery and engineering by rapidly producing large numbers of recombinant monoclonal antibodies in a short period of time.

  12. Environmental management in product chains

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard; Forman, Marianne; Hansen, Anne Grethe

    of environmental initiatives, a number of recommendations for governmental regulation, which can support the further diffusion of environmental management in product chains, are developed. Furthermore, the report describes a number of theoretical perspectives from sociology of technology, organisation theory......, network theory, innovation theory, competence development and political science, which are proposed as focus in future capacity development as part of governmental strategies, which aim at supporting emergence and stabilisation of environmental concerns as part of product chain dynamics....

  13. The polymerase chain reaction (PCR): general methods.

    Science.gov (United States)

    Waters, Daniel L E; Shapter, Frances M

    2014-01-01

    The polymerase chain reaction (PCR) converts very low quantities of DNA into very high quantities and is the foundation of many specialized techniques of molecular biology. PCR utilizes components of the cellular machinery of mitotic cell division in vitro which respond predictably to user inputs. This chapter introduces the principles of PCR and discusses practical considerations from target sequence definition through to optimization and application.

  14. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product) with beef and buffalo meat through multiplex polymerase chain reaction

    Science.gov (United States)

    Bhat, M. Mansoor; Salahuddin, Mir; Mantoo, Imtiyaz A.; Adil, Sheikh; Jalal, Henna; Pal, M. Ashraf

    2016-01-01

    Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan), the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA) based multiplex polymerase chain reaction (PCR) method under laboratory conditions. Materials and Methods: Three experimental trials were conducted wherein the products were prepared from pure mutton, beef and buffalo meat, and their admixtures in the ratios of 60:20:20, 80:10:10, 90:05:05 and 98:01:01, respectively. Results: The primers used in the study amplified the cyt b gene fragments of sizes 124 bp, 472 bp and 585 bp for buffalo, cattle and sheep, respectively. It was possible to detect cattle and buffalo meat at the level of 1% in the mixed meat cooked Rista. The multiplex PCR successfully amplified cyt b gene fragments of mtDNA of the target species and thus produced characteristic band pattern for each species. The band intensities of cattle and buffalo in the mixed meat Rista progressively decreased corresponding to their decreasing level from 20% to 1%. Processing, cooking (moist heating) and non-meat formulation ingredients had no effect on detection of meat species adulteration. Conclusion: The multiplex PCR procedure standardized and developed in this study is simple, efficient, sensitive, reliable and highly specific for detecting falsification of cooked mutton product with beef and buffalo meat up to 1% level. PMID:27057103

  15. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product with beef and buffalo meat through multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    M. Mansoor Bhat

    2016-03-01

    Full Text Available Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan, the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA based multiplex polymerase chain reaction (PCR method under laboratory conditions. Materials and Methods: Three experimental trials were conducted wherein the products were prepared from pure mutton, beef and buffalo meat, and their admixtures in the ratios of 60:20:20, 80:10:10, 90:05:05 and 98:01:01, respectively. Results: The primers used in the study amplified the cyt b gene fragments of sizes 124 bp, 472 bp and 585 bp for buffalo, cattle and sheep, respectively. It was possible to detect cattle and buffalo meat at the level of 1% in the mixed meat cooked Rista. The multiplex PCR successfully amplified cyt b gene fragments of mtDNA of the target species and thus produced characteristic band pattern for each species. The band intensities of cattle and buffalo in the mixed meat Rista progressively decreased corresponding to their decreasing level from 20% to 1%. Processing, cooking (moist heating and non-meat formulation ingredients had no effect on detection of meat species adulteration. Conclusion: The multiplex PCR procedure standardized and developed in this study is simple, efficient, sensitive, reliable and highly specific for detecting falsification of cooked mutton product with beef and buffalo meat up to 1% level.

  16. Transformational leadership: a cascading chain reaction.

    Science.gov (United States)

    Murphy, Lorraine

    2005-03-01

    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment. PMID:15720482

  17. [The contamination under polymerase chain reaction studies: problems and solutions].

    Science.gov (United States)

    Titov, V N; Ameliushkina, V A; Rozhkova, T A

    2015-01-01

    The study was carried out to determine risk factors of false positive and false negative results under polymerase chain reaction-analysis of clinical material. The samples with high viral load can be the source of false positive results. The contamination with nucleic acids can occur at any section of polymerase chain reaction analysis. The study data permitted to establish that the most sensitive stage is isolation and purification of nucleic acids especially under manual mode of operation. The detection of positive signal in most samples of one setting indicates total contamination. The cases when only several samples are polluted are special challenge. The presence of sample with high concentration of viral nucleic acid and several samples with low concentration in one setting means necessity of repeated analysis beginning with stage of isolation of nucleic acid. The analysis of curves of accumulation of products of amplification, their forms and positioning on chart is the obligatory stage of polymerase chain reaction study in real time regimen. These actions permit to exclude the readouts of false negative testing results to departments. The study conclusions are equipotent for polymerase chain reaction testing of any nucleic acid targets.

  18. Reaction chain modeling of denitrification reactions during a push-pull test

    Science.gov (United States)

    Boisson, A.; de Anna, P.; Bour, O.; Le Borgne, T.; Labasque, T.; Aquilina, L.

    2013-05-01

    Field quantitative estimation of reaction kinetics is required to enhance our understanding of biogeochemical reactions in aquifers. We extended the analytical solution developed by Haggerty et al. (1998) to model an entire 1st order reaction chain and estimate the kinetic parameters for each reaction step of the denitrification process. We then assessed the ability of this reaction chain to model biogeochemical reactions by comparing it with experimental results from a push-pull test in a fractured crystalline aquifer (Ploemeur, French Brittany). Nitrates were used as the reactive tracer, since denitrification involves the sequential reduction of nitrates to nitrogen gas through a chain reaction (NO3- → NO2- → NO → N2O → N2) under anaerobic conditions. The kinetics of nitrate consumption and by-product formation (NO2-, N2O) during autotrophic denitrification were quantified by using a reactive tracer (NO3-) and a non-reactive tracer (Br-). The formation of reaction by-products (NO2-, N2O, N2) has not been previously considered using a reaction chain approach. Comparison of Br- and NO3- breakthrough curves showed that 10% of the injected NO3- molar mass was transformed during the 12 h experiment (2% into NO2-, 1% into N2O and the rest into N2 and NO). Similar results, but with slower kinetics, were obtained from laboratory experiments in reactors. The good agreement between the model and the field data shows that the complete denitrification process can be efficiently modeled as a sequence of first order reactions. The 1st order kinetics coefficients obtained through modeling were as follows: k1 = 0.023 h- 1, k2 = 0.59 h- 1, k3 = 16 h- 1, and k4 = 5.5 h- 1. A next step will be to assess the variability of field reactivity using the methodology developed for modeling push-pull tracer tests.

  19. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  20. [Polymerase chain reaction and its application].

    Science.gov (United States)

    Sárosi, I; Gerald, E; Girish, V N

    1992-07-01

    The polymerase chain reaction (PCR) is one of the most important new methods in molecular biology. It is widely used in genetic and anthropologic basic research, in oncology and virology, in all those fields, where molecular biologic methods can give answers to the questions raised. The procedure enables one to multiply with extreme precision targeted pieces of amounts as little as one target molecule of DNA or RNA by five to six logs, making them easy to be handled and examined by routine molecular biological methods. The method is presented through one possible application field, that is of great importance in the study of hepatocarcinogenesis. Sensitivity of PCR in detection of hepatitis B virus DNA is greater by four logs than animal inoculation, the last most sensitive method known.

  1. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo

    2012-01-01

    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  2. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    Science.gov (United States)

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  3. Double Pion Production Reactions

    CERN Document Server

    Oset, E; Cano, F; Hernández, E; Kamalov, S S; Nacher, J C; Tejedor, J A G

    1999-01-01

    We report on reactions producing two pions induced by real and virtual photons or nucleons. The role of different resonances in these reactions is emphasized. Novel results on coherent two pion photoproduction in nuclei are also reported.

  4. Single-species reactions on a random catalytic chain

    Energy Technology Data Exchange (ETDEWEB)

    Oshanin, G [Laboratoire de Physique Theorique des Liquides, Universite Paris 6, 4 Place Jussieu, 75252 Paris (France); Burlatsky, S F [United Technologies Research Center, United Technologies Corporation, 411 Silver Lane, 129-21 East Hartford, CT (United States)

    2002-11-29

    We present an exact solution for a catalytically activated annihilation A+A {yields} 0 reaction taking place on a one-dimensional chain in which some segments (placed at random, with mean concentration p) possess special, catalytic properties. An annihilation reaction takes place as soon as any two A particles land from the reservoir onto two vacant sites at the extremities of the catalytic segment, or when any A particle lands onto a vacant site on a catalytic segment while the site at the other extremity of this segment is already occupied by another A particle. We find that the disorder-average pressure P{sup (quen)} per site of such a chain is given by P{sup (quen)} P{sup (Lan)} + {beta}{sup -1}F, where P{sup (Lan)}={beta}{sup -1} ln(1+z) is the Langmuir adsorption pressure, (z being the activity and {beta}{sup -1} the temperature), while {beta}{sup -1}F is the reaction-induced contribution, which can be expressed, under appropriate change of notation, as the Lyapunov exponent for the product of 2x2 random matrices, obtained exactly by Derrida and Hilhorst (1983 J. Phys. A: Math. Gen. 16 2641). Explicit asymptotic formulae for the particle mean density and the compressibility are also presented. (letter to the editor)

  5. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  6. Marzipan: polymerase chain reaction-driven methods for authenticity control.

    Science.gov (United States)

    Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus

    2011-11-23

    According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

  7. Meson production in + reactions

    Indian Academy of Sciences (India)

    H Machner; M Betigeri; J Bojowald; A Budzanowski; A Chatterjee; J Ernst; L Freindl; D Frekers; W Garske; K Grewer; A Hamacher; J Ilieva; L Jarczyk; K Kilian; S Kliczewski; W Klimala; D Kolev; T Kutsarova; J Lieb; H Machner; A Magiera; H Nann; L Pentchev; H S Plendl; D Protić; B Razen; P Von Rossen; B J Roy; R Siudak; J Smyrski; R V Srikantiah; A Strzałkowski; R Tsenov; K Zwoll

    2001-08-01

    Total and differential cross sections for the reactions $p+d → 3He + 0 with = ; and + → 3H + + were measured with the GEM detector at COSY for beam momenta between threshold and the maximum of the corresponding baryon resonance. For both reactions a strong forward–backward asymmetry was found. The data were compared with model calculations. The aspect of isospin symmetry breaking is studied.

  8. Detection of Francisella tularensis in blood by polymerase chain reaction.

    OpenAIRE

    Long, G W; Oprandy, J J; Narayanan, R. B.; Fortier, A H; Porter, K R; Nacy, C.A.

    1993-01-01

    We developed a polymerase chain reaction-based assay for Francisella tularensis which we evaluated by using spiked blood samples and experimentally infected mice. The assay detected both type A and type B F. tularensis at levels equivalent to one CFU/microliter of spiked blood. Results from polymerase chain reaction-based assay of limiting dilutions of blood from mice infected with the live vaccine strain agreed closely with results from blood culture.

  9. Reaction product imaging

    Energy Technology Data Exchange (ETDEWEB)

    Chandler, D.W. [Sandia National Laboratories, Livermore, CA (United States)

    1993-12-01

    Over the past few years the author has investigated the photochemistry of small molecules using the photofragment imaging technique. Bond energies, spectroscopy of radicals, dissociation dynamics and branching ratios are examples of information obtained by this technique. Along with extending the technique to the study of bimolecular reactions, efforts to make the technique as quantitative as possible have been the focus of the research effort. To this end, the author has measured the bond energy of the C-H bond in acetylene, branching ratios in the dissociation of HI, the energetics of CH{sub 3}Br, CD{sub 3}Br, C{sub 2}H{sub 5}Br and C{sub 2}H{sub 5}OBr dissociation, and the alignment of the CD{sub 3} fragment from CD{sub 3}I photolysis. In an effort to extend the technique to bimolecular reactions the author has studied the reaction of H with HI and the isotopic exchange reaction between H and D{sub 2}.

  10. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  11. A noncontact temperature measurement method in polymerase chain reaction reactors

    Science.gov (United States)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.

    2016-04-01

    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  12. Integrating product design into the supply chain

    DEFF Research Database (Denmark)

    Khan, Omera; Stolte, Terje; Creazza, Alessandro;

    2016-01-01

    Purpose: The aim of the research is to illustrate how companies can create competitive capabilities through integration of product design into the supply chain. In doing so the paper reveals the challenges and the opportunities that companies face when integrating product design and supply chain...... of opportunities and challenges when integrating product design and the supply chain and subsequently a step-by-step guide is developed to address these. Practical Implications: The research provides key recommendations to companies on how to create competitive capabilities by integrating product design...... into the supply chain. Originality/Value: This paper provides novel insights to both practitioners and researchers. For practitioners detailed recommendations are given on how they can maximise benefits through integrating product design into the supply chain. The RBV has been harnessed to highlight how...

  13. Environmental Management Initiatives in Product Chains

    DEFF Research Database (Denmark)

    Forman, Marianne; Hansen, Anne Grethe; Jørgensen, Michael Søgaard

    The Environmental Council for Cleaner Products in 2000-2001 initiated a collection of experience from the environmental co-operation in 25 product chains. This collection of experience was to elucidate the concrete co-operation between suppliers, enterprises and purchasers, to go through tools...... and to report on opportunities and barriers for environmental efforts in the entire product chain. This paper aims at giving a comprehensive analysis of the experiences, on the basis of the reporting of the 25 companies and their supply chains (reported by Ettrup and Bauer in 2002. The 25 case studies have been...

  14. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle

    2014-12-01

    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  15. A Universal Polymerase Chain Reaction Developer.

    Science.gov (United States)

    Valentini, Paola; Pompa, Pier Paolo

    2016-02-01

    The versatility of PCR, the gold standard for amplification of DNA targets, is hampered by the laborious, multi-step detection based on gel electrophoresis. We propose a one-step, one-tube method for the rapid (5 min) naked-eye detection of PCR products, based on controlled aggregation of gold nanoparticles. Our method is universal, instrument-free, and ultra-sensitive, as it could detect as low as 0.01 zeptomoles of HIV template DNA in an excess of interfering human genomic DNA.

  16. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe

    2013-01-01

    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his...... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  17. Generalized crested products of Markov chains

    CERN Document Server

    D'Angeli, Daniele

    2010-01-01

    We define a finite Markov chain, called generalized crested product, which naturally appears as a generalization of the first crested product of Markov chains. A complete spectral analysis is developed and the $k$-step transition probability is given. It is important to remark that this Markov chain describes a more general version of the classical Ehrenfest diffusion model. As a particular case, one gets a generalization of the classical Insect Markov chain defined on the ultrametric space. Finally, an interpretation in terms of representation group theory is given, by showing the correspondence between the spectral decomposition of the generalized crested product and the Gelfand pairs associated with the generalized wreath product of permutation groups.

  18. product chain collaboration and environmental innovations

    DEFF Research Database (Denmark)

    Remmen, Arne; Mosgaard, Mette

    2004-01-01

    The paper  builds upon a case study from a number of electronic companies in Denmark and describes from an organisational perspective how organisations make environmental innovations in the product chain....

  19. Investigation on detection of Haemophilus ducreyi by Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xibao(张锡宝); FEI Shi(费实); DENG Wenguo(邓文国); CAO wenlig(曹文苓); ZHU huilan(朱慧兰); MENG jinxiu(孟锦秀); YAN jinglan(颜景兰)

    2002-01-01

    Objective:To investigate the application of polymerase chain reaction (PCR) detection of Haemophilus ducreyi in clinical diagnosis of chancroid.Methods: Nucleotide sequences of 16srRNA gene specific for H. Dureyi were used to develop primer sets for amplification of two strains. The amplified products were tested via PCR and sequenced by electrophoresis in a 1.5 % gel.These products were compared with those of heterogeneous species or related bacteria to test the specificity of the PCR assay. PCR amplification with different concentrations of H.ducreyi was performed to test its sensitivity.Results: PCR amplification of two strains of H. Ducreyi produced a single band of expected 438bp length. The sequence was identified with genomic DNA. None of the other 19 reference species amplified under the same conditions gave this result. The highest sensitivity of PCR assay in the present test was 10ng/L.Conclusions: PCR assay for detection of H. Ducreyi is a rapid, specific, and sensitive detection method. If laboratory conditions are strictly controlled, PCR assay is a potentially useful laboratory test for H. Ducreyi infection diagnosis.

  20. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  1. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  2. Identifying of meat species using polymerase chain reaction (PCR)

    Science.gov (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  3. The generalised self-sustaining chain reaction theory about ADS

    International Nuclear Information System (INIS)

    The basic connotation of ADS (accelerator driven system) is investigated from the point of view of generalized self-sustaining chain reaction. The ADS is composed of proton accelerator, neutron producing target and the subcritical reactor. This system can be viewed entirely as a generalized self sustaining chain reaction system. In this view of point, the accelerator with target, as a part of ADS, can be viewed as an energy-neutron transformer (energy be fed to accelerator to produce medium energy protons, neutrons be produced in the heavy target as a result of proton-heavy nucleus spallation reaction). In this generalized self-sustaining chain reaction system, the number of neutrons produced after a fission event is not only the fission neutrons but also the neutrons produced by the energy-neutron transformer. That is, the ADS has more effective secondary neutrons after a fission event. It is just these additional neutrons, the ADS can be in state of self-sustaining chain reaction (criticality), although the reactor part of ADS is in state of sub-criticality. The critical equation of the generalized self-sustaining chain reaction system is presented. The relationship between the effective multiplication factors of ADS and subcritical reactor part of ADS is also presented. The power output of ADS is represented by a function of the proton current, the subcritical reactivity of the reactor in ADS, the number of neutrons produced in spallation process per proton and etc. At last, the probable application of ADS in the future is investigated

  4. Detection of Listeria monocytogenes by using the polymerase chain reaction

    International Nuclear Information System (INIS)

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with 32P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains

  5. Robust regression methods for real-time polymerase chain reaction

    NARCIS (Netherlands)

    Trypsteen, Wim; De Neve, Jan; Bosman, Kobus; Nijhuis, Monique; Thas, Olivier; Vandekerckhove, Linos; De Spiegelaere, Ward

    2015-01-01

    Current real-time polymerase chain reaction (PCR) data analysis methods implement linear least squares regression methods for primer efficiency estimation based on standard curve dilution series. This method is sensitive to outliers that distort the outcome and are often ignored or removed by the en

  6. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  7. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    Science.gov (United States)

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  8. Mathematics analysis of polymerase chain reaction kinetic curves.

    Science.gov (United States)

    Sochivko, D G; Fedorov, A A; Varlamov, D A; Kurochkin, V E; Petrov, R V

    2016-01-01

    The paper reviews different approaches to the mathematical analysis of polymerase chain reaction (PCR) kinetic curves. The basic principles of PCR mathematical analysis are presented. Approximation of PCR kinetic curves and PCR efficiency curves by various functions is described. Several PCR models based on chemical kinetics equations are suggested. Decision criteria for an optimal function to describe PCR efficiency are proposed.

  9. Selection vector for direct cloning of proof reading polymerase chain reaction products based on the lethal ccdB gene in Escherichia Coli

    OpenAIRE

    Weibel, Pascal; Ender, Miriam; Madon, Jerzy; Zinkernagel, Annelies; Schuepbach, Reto

    2013-01-01

    Introducing PCR products into plasmids vectors is key for molecular techniques. Ideally cloning vectors are easy to construct, modify and propagate, neither require advanced techniques nor special equipment or reagents and efficiently incorporate PCR products at close to zero empty vector background. We provide an easy to engineer self-made cloning vector, neither requiring sophisticated tools or techniques nor advanced cloning knowledge. Through recombination we obtained the pUC18ccdB vector...

  10. Decay Chain Deduction of Uranium Fission Products.

    Science.gov (United States)

    Guo, Huiping; Tian, Chenyang; Wang, Xiaotian; Lv, Ning; Ma, Meng; Wei, Yingguang

    2016-07-01

    Delayed gamma spectrum is the fingerprint of uranium materials in arms control verification technology. The decay chain is simplified into basic state linear chain and excitation state linear chain to calculate and analyze the delayed gamma spectra of fission products. Formulas of the changing rule for nuclide number before and after zero-time are deduced. The C program for calculating the delayed gamma ray spectra data is constructed, and related experiments are conducted to verify this theory. Through analysis of the delayed gamma counts of several nuclides, the calculated results are found to be consistent with experimental values. PMID:27218290

  11. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  12. MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

    Science.gov (United States)

    The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

  13. Specifics in the chosen production chain?

    Directory of Open Access Journals (Sweden)

    L. Pánková

    2010-12-01

    Full Text Available It is possible to consider the production chain as a highly complicated system, within the framework of whichdifferent links and mutual relations function. Therefore it is necessary to analyze the complexity of theproduction chain functioning for the purpose of enhanced knowledge on the existence and the regularitiesfunctioning among different production elements. The contribution deals with an analysis of the pricetransmission in the production chain of cereals, within which only certain partial parts have been earmarked. Cointegrationanalysis, VECM and impulse-response analysis have been used for the price transmission analysis.Information mentioned in the paper resulted from the solution of a research intention VZ MSM 6046070906„The Economics of resources of Czech agriculture and their efficient use in framework of multifunctional agrifoodsystems“.

  14. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    Science.gov (United States)

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  15. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维

    2003-01-01

    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  16. Enteroviral pharyngitis diagnosed by reverse transcriptase-polymerase chain reaction.

    OpenAIRE

    Sharland, M.; Hodgson, J.; Davies, E G; Booth, J.; Jeffery, S

    1996-01-01

    The role of enteroviruses in childhood pharyngitis was investigated using enteroviral specific reverse transcriptase-polymerase chain reaction (RT-PCR). Viral/bacterial throat swabs were taken from 50 children with acute pharyngitis and 26 controls. A positive culture was identified in only 26% of children with pharyngitis (adenovirus 10%, group A streptococci 2%), and none of the controls. Enteroviral RT-PCR was positive in 8% of the pharyngitis group and none of the controls. Enteroviruses ...

  17. Convective polymerase chain reaction around micro immersion heater

    Science.gov (United States)

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  18. Robust quantification of polymerase chain reactions using global fitting.

    Directory of Open Access Journals (Sweden)

    Ana C Carr

    Full Text Available BACKGROUND: Quantitative polymerase chain reactions (qPCR are used to monitor relative changes in very small amounts of DNA. One drawback to qPCR is reproducibility: measuring the same sample multiple times can yield data that is so noisy that important differences can be dismissed. Numerous analytical methods have been employed that can extract the relative template abundance between samples. However, each method is sensitive to baseline assignment and to the unique shape profiles of individual reactions, which gives rise to increased variance stemming from the analytical procedure itself. PRINCIPAL FINDINGS: We developed a simple mathematical model that accurately describes the entire PCR reaction profile using only two reaction variables that depict the maximum capacity of the reaction and feedback inhibition. This model allows quantification that is more accurate than existing methods and takes advantage of the brighter fluorescence signals from later cycles. Because the model describes the entire reaction, the influences of baseline adjustment errors, reaction efficiencies, template abundance, and signal loss per cycle could be formalized. We determined that the common cycle-threshold method of data analysis introduces unnecessary variance because of inappropriate baseline adjustments, a dynamic reaction efficiency, and also a reliance on data with a low signal-to-noise ratio. SIGNIFICANCE: Using our model, fits to raw data can be used to determine template abundance with high precision, even when the data contains baseline and signal loss defects. This improvement reduces the time and cost associated with qPCR and should be applicable in a variety of academic, clinical, and biotechnological settings.

  19. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    International Nuclear Information System (INIS)

    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves

  20. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain...

  1. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    Science.gov (United States)

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  2. Automated polymerase chain reaction in capillary tubes with hot air.

    Science.gov (United States)

    Wittwer, C T; Fillmore, G C; Hillyard, D R

    1989-06-12

    We describe a simple, compact, inexpensive thermal cycler that can be used for the polymerase chain reaction. Based on heat transfer with air to samples in sealed capillary tubes, the apparatus resembles a recirculating hair dryer. The temperature is regulated via thermocouple input to a programmable set-point process controller that provides proportional output to a solid state relay controlling a heating coil. For efficient cooling after the denaturation step, the controller activates a solenoid that opens a door to vent hot air and allows cool air to enter. Temperature-time profiles and amplification results approximate those obtained using water baths and microfuge tubes.

  3. Identification of Erwinia stewartii by a ligase chain reaction assay.

    OpenAIRE

    Wilson, W.J.; Wiedmann, M; Dillard, H. R.; Batt, C A

    1994-01-01

    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed...

  4. Simultaneous Removal of Multiple DNA Segments by Polymerase Chain Reactions.

    Science.gov (United States)

    Krishnamurthy, Vishnu; Zhang, Kai

    2017-01-01

    Precise DNA manipulation is a key enabling technology for synthetic biology. Approaches based on restriction digestion are often limited by the presence of certain restriction enzyme recognition sites. Recent development of restriction-free cloning approaches has greatly enhanced the flexibility and speed of molecular cloning. Most restriction-free cloning methods focus on DNA assembly. Much less work has been dedicated towards DNA removal. Here we introduce a protocol that allows simultaneous removal of multiple DNA segments from a plasmid using polymerase chain reactions (PCR). Our approach will be beneficial to applications in multiple sites mutagenesis, DNA library construction, genetic and protein engineering, and synthetic biology. PMID:27671942

  5. A chain reaction approach to modelling gene pathways.

    Science.gov (United States)

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  6. Production chain of CMS pixel modules

    CERN Multimedia

    2006-01-01

    The pictures show the production chain of pixel modules for the CMS detector. Fig.1: overview of the assembly procedure. Fig.2: bump bonding with ReadOut Chip (ROC) connected to the sensor. Fig.3: glueing a raw module onto the baseplate strips. Fig.4: glueing of the High Density Interconnect (HDI) onto a raw module. Fig.5: pull test after heat reflow. Fig.6: wafer sensor processing, Indium evaporation.

  7. APPLICATION OF POLYMERASE CHAIN REACTION FOR DIAGNOSING AMEBIC LIVER ABSCESS

    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏

    1996-01-01

    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  8. SUPPLY CHAINS IN AGRICULTURE AND FOOD PRODUCTION

    Directory of Open Access Journals (Sweden)

    Liliana CONDRAȚCHI

    2014-06-01

    Full Text Available The role of production and supply chain is increasing worldwide due of the growing consumer concerns over foodsafety and quality together with retailer demands for large volumes of consistent and reliable product. In developedcountries, product losses (post harvest losses are generally small during processing, storage and handling becauseof the efficiency of the equipment, better storage facilities, and control of critical variables by a skilled and trainedstaff. Recently, the concept of Agricultural and Food production has been under development as more effective andefficient management system is required for the food production planning, physical collection of primary producefrom fields and homesteads, processing and storage at various levels, handling, packaging, and distribution of finalproduct.

  9. Exploring the e-Supply Chain of Information Products

    OpenAIRE

    Raafat George Saadé

    2012-01-01

    Digital information product producers have not taken advantage of the e-supply chain paradigm of today. However, in this information-based sector, a different set of supply chain management challenges exist. Very little research has been done in the supply chain of information products. This study focuses on the process analysis of the supply chain paradigm for digital information products. A framework for digital information products production in e-learning is proposed followed by an exampl...

  10. A reverse transcription-polymerase chain reaction assay for the detection of avian pneumovirus (Colorado strain).

    Science.gov (United States)

    Ali, A; Reynolds, D L

    1999-01-01

    A reverse transcription-polymerase chain reaction assay was developed for the detection of avian pneumovirus (Colorado strain) (APV-Col). The specific primers were designed from the published sequence of the matrix protein gene of APV-Col. The primers amplified a product of 631 nucleotides from APV-Col. The assay identified only APV-Col and did not react with Newcastle disease virus and infectious bronchitis virus.

  11. Production chain and innovative technologies for living

    Directory of Open Access Journals (Sweden)

    Eugenio Arbizzani

    2012-10-01

    Full Text Available The continued growth of residential demand, coupled with the significant decline of the housing market, is encouraging the development of many procedural and constructive experiments on the theme of affordable housing for a range of users increasingly unable to access home ownership. The spread of an approach to planning that is socially, economically and technologically sustainable, represents a culture of quality that is once more measurable, which makes it possible today to define innovative building models for the industrial and production chain. The use of innovative and integrated industrialised building systems may be one of the supporting factors in the achievement of the objectives of social housing.

  12. Cyclic polyesters prepared by poly(oxypropylene oxymaloyl ring-chain reactions

    Directory of Open Access Journals (Sweden)

    2007-01-01

    Full Text Available The synthesis of cyclic polyesters of poly(oxypropylene oxymaloyl from a ring-chain reaction was carried out at 40°C with 'Maghnite' an acid exchanged montmorillonite as acid solid ecocatalyst (Mag–H+. 'Maghnite' is already used as catalyst for polymerization of many vinylic and heterocyclic monomers [1]. The effect of amount of catalyst on yield and molecular weight of polymer was studied.A typical reaction product was analyzed by gel permeation chromatography (GPC as well as by nuclear magnetic resonance spectroscopy (1H-NMR and the existence of cyclic species was proven.

  13. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy

    2015-09-01

    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:http://dx.doi.org/10.1016/j.ab.2015.03.033, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  14. Nested methylation-specific polymerase chain reaction cancer detection method

    Science.gov (United States)

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  15. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  16. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed

    2012-03-01

    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  17. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  18. Simplified procedures for applying the polymerase chain reaction to routinely fixed paraffin wax sections.

    Science.gov (United States)

    Coates, P J; d'Ardenne, A J; Khan, G; Kangro, H O; Slavin, G

    1991-02-01

    The polymerase chain reaction was applied to the analysis of DNA contained in archival paraffin wax embedded material. DNA suitable for the reaction was obtained from these tissues by simple extraction methods, without previous dewaxing of tissue sections. When compared with unfixed material, the reaction efficiency was compromised, so that an increased number of amplification cycles were required to produce equivalent amounts of amplified product. This in turn led to an increase in amplification artefacts, which can be minimised by a simple modification of the standard reaction. Amplification of relatively large DNA fragments was not always successful, and it seems prudent to bear this in mind when designing oligonucleotide primers which are to be used for the amplification of archival material. The efficiency of the procedure can be improved by dividing the amplification cycles into two parts: this reduces the amount of reagent needed, is relatively simple and inexpensive, and can be performed in one working day.

  19. Controlling Hybridization Chain Reactions with pH.

    Science.gov (United States)

    Idili, Andrea; Porchetta, Alessandro; Amodio, Alessia; Vallée-Bélisle, Alexis; Ricci, Francesco

    2015-08-12

    By taking inspiration from nature, where self-organization of biomolecular species into complex systems is finely controlled through different stimuli, we propose here a rational approach by which the assembly and disassembly of DNA-based concatemers can be controlled through pH changes. To do so we used the hybridization chain reaction (HCR), a process that, upon the addition of an initiator strand, allows to create DNA-based concatemers in a controlled fashion. We re-engineered the functional units of HCR through the addition of pH-dependent clamp-like triplex-forming domains that can either inhibit or activate the polymerization reaction at different pHs. This allows to finely regulate the HCR-induced assembly and disassembly of DNA concatemers at either basic or acidic pHs in a reversible way. The strategies we present here appear particularly promising as novel tools to achieve better spatiotemporal control of self-assembly processes of DNA-based nanostructures. PMID:26177980

  20. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    Science.gov (United States)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  1. Semi-arid development: competitiveness factors in biodiesel productive chain

    OpenAIRE

    Breno Barros Telles do Carmo; Dmontier Pinheiro Aragão; Heráclito Lopes Jaguaribe Pontes; Bruno Magalhães Ribeiro; Marcos Ronaldo Albertin

    2009-01-01

    The new global market competitiveness considerer the competition between productive chains (PC) or supply chains, not just between enterprises. In this case, it can be observed collaboration and cooperation enterprises that dispute with others productives chain. The PC competitiveness can be impaired if is subject by inhibitors factors, that can impairer the performance. This paper analyses these competitiveness factors inhibitors in biodiesel productive chain (CPB) in semi-arid area: exporte...

  2. Rapid analysis of rearranged kappa light chain genes of circulating polysaccharide-specific B lymphocytes by means of immunomagnetic beads and the polymerase chain reaction

    DEFF Research Database (Denmark)

    Hougs, L; Barington, T; Madsen, HO;

    1993-01-01

    CP-specific B lymphocytes were isolated by antigen-coated immunomagnetic beads. After the purification, at least 98% of the immunoglobulin-secreting recovered cells were HibCP specific. The RNA was isolated and amplified by cDNA synthesis using a kappa constant region primer followed by polymerase chain...... reaction (PCR) using in addition a degenerate kappa light chain signal peptide region primer. The PCR product was cloned into the M13mp18 phage. The cloning efficiency was 100-600 clones/ml of blood. Of the 86 clones sequenced, 90% represented rearranged kappa light chain genes from different antibody...

  3. Thermal reactions of polymer chains with coal structures

    Energy Technology Data Exchange (ETDEWEB)

    P. Straka; J. Nahunkova [Academy of Sciences of the Czech Republic, Prague (Czech Republic). Institute of Rock Structure and Mechanics

    2003-07-01

    The thermal decompositions of polyethylene, polystyrene and polyamide 6 in the presence of coal was studied by DSC and TGA methods and reactions of these polymers with coal were described. Tars and cokes obtained were characterized and mass balance of the process expressed. Polyethylene decomposes by a free radical mechanism and the major products are 1-alkenes, {alpha},{omega}-alkadienes and n-alkanes. In the presence of coal, formed unsaturated products are adsorbed on the inner surface of coal and semicoke. Maximum weight losses of the coal-polyethylene mixture occur at higher temperature in comparison with that from the decomposition of polyethylene alone. Further, thermal reactions of coal with polystyrene were studied. In the range of 410 490{sup o}C a thermal degradation of coal proceeded, simultaneously, with decomposition of polystyrene. Because coal is a strong H-donor, unsaturated products of polystyrene decomposition (mainly styrene) was hydrogenated by coal. Some aromatic products of polystyrene decomposition reacted with the coal tar structures and new aromatics were formed. That is why the conversion time of polystyrene decomposition was much higher in the presence of coal. The yields of tar from copyrolysis with styrene polymers are higher in comparison with pyrolysis of coal alone. Also composition of tar is changed. Finally, reactions of coal with polyamide 6 were investigated. During the thermal degradation of coal the decomposition of polyamide 6 occurs and {epsilon}-caprolactam and the cyclic dimer are formed. The {epsilon}-caprolactam formation is promoted by water and hydrogen from coal degradation as due to high content of hydrogen coal acts as a strong H- and water donor. Under high-temperature conditions of copyrolysis beside a-caprolactam mainly carbon oxides, methane, aliphatic hydrocarbons, simple aromatics and stable oil are formed. 8 refs., 3 figs., 7 tabs.

  4. Semi-arid development: competitiveness factors in biodiesel productive chain

    Directory of Open Access Journals (Sweden)

    Breno Barros Telles do Carmo

    2009-04-01

    Full Text Available The new global market competitiveness considerer the competition between productive chains (PC or supply chains, not just between enterprises. In this case, it can be observed collaboration and cooperation enterprises that dispute with others productives chain. The PC competitiveness can be impaired if is subject by inhibitors factors, that can impairer the performance. This paper analyses these competitiveness factors inhibitors in biodiesel productive chain (CPB in semi-arid area: exported product, market knowledge, competitiveness position, opportunities to aggregate value in chain, cooperation between enterprises, enterprises way of thinking and paternalism by government. It was done this analyses to compare CPB with the world.

  5. Cylindrical polymer brushes with dendritic side chains by iterative anionic reactions

    KAUST Repository

    Zhang, Hefeng

    2015-05-01

    We report in this paper an easy method for the synthesis of cylindrical polymer brushes with dendritic side chains through anionic reaction. The synthesis is accomplished by iteratively grafting a living block copolymer, polyisoprene-. b-polystyrenyllithium (PI-. b-PSLi), to the main chain and subsequently to the branches in a divergent way. PI segment is short and serves as a precursor for multifunctional branching unit. The grafting reaction involves two successive steps: i) epoxidation of internal double bonds of PI segments, either in main chain or side chains; ii) ring-opening addition to the resulting epoxy group by the living PI-. b-PSLi. Repeating the two steps affords a series of cylindrical polymer brushes with up to 3rd generation and extremely high molecular weight. The branching multiplicity depends on the average number of oxirane groups per PI segment, usually ca. 8 in the present work. The high branching multiplicity leads to tremendous increase in molecular weights of the cylindrical products with generation growth. Several series of cylindrical polymer brushes with tunable aspect ratios are prepared using backbones and branches with controlled lengths. Shape anisotropy is investigated in dilute solution using light scattering technique. Worm-like single molecular morphology with large persistence length is observed on different substrates by atomic force microscopy.

  6. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    OpenAIRE

    2012-01-01

    AIM: To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).

  7. Supply chain management in product development.

    OpenAIRE

    Tzortzopoulos, Patricia; Kagioglou, Mike; Cooper, Rachel; Dyson, E

    2009-01-01

    Mounting emphasis on construction supply chain management (CSCM) is due to both global sourcing of materials and a shortage of labor. These factors force increasing amounts of value-added work to be conducted off-site deep in the supply chain. Construction Supply Chain Management Handbookcompiles in one comprehensive source an overview of the diverse research and examples of construction supply chain practice around the world.Reflecting the emergence of CSCM as an important area of multi-nati...

  8. Future of Supply Chain Management in Various food Production.

    Directory of Open Access Journals (Sweden)

    Suhail Tyagi,

    2015-10-01

    Full Text Available This paper analyse the case of any production system and the structure of supply chain has evolved progressively over the time of sequential supply chain, to global supply chain. This evolution has reflected the change in business environment from static to dynamic. So the purpose of this paper is to propose an agenda for future research in supply chain management. We also measure the effect of FDI in India to the existing production industries in India.

  9. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  10. Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

    Science.gov (United States)

    Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

    2015-08-01

    This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count <1800/mm(3) was observed in 60%, and positive C-reactive protein in 46%. Thirty neonates had positive blood culture, and Klebsiella pneumoniae (22%) was the predominant organism. Nested urine PCR was positive in 38 (76%) and detected bacterial DNA in 8 neonates with negative blood cultures. The sensitivity, specificity, positive predictive value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents.

  11. Fluorescence-based temperature control for polymerase chain reaction.

    Science.gov (United States)

    Sanford, Lindsay N; Wittwer, Carl T

    2014-03-01

    The ability to accurately monitor solution temperature is important for the polymerase chain reaction (PCR). Robust amplification during PCR is contingent on the solution reaching denaturation and annealing temperatures. By correlating temperature to the fluorescence of a passive dye, noninvasive monitoring of solution temperatures is possible. The temperature sensitivity of 22 fluorescent dyes was assessed. Emission spectra were monitored and the change in fluorescence between 45 and 95°C was quantified. Seven dyes decreased in intensity as the temperature increased, and 15 were variable depending on the excitation wavelength. Sulforhodamine B (monosodium salt) exhibited a fold change in fluorescence of 2.85. Faster PCR minimizes cycling times and improves turnaround time, throughput, and specificity. If temperature measurements are accurate, no holding period is required even at rapid speeds. A custom instrument using fluorescence-based temperature monitoring with dynamic feedback control for temperature cycling amplified a fragment surrounding rs917118 from genomic DNA in 3min and 45s using 35 cycles, allowing subsequent genotyping by high-resolution melting analysis. Gold-standard thermocouple readings and fluorescence-based temperature differences were 0.29±0.17 and 0.96±0.26°C at annealing and denaturation, respectively. This new method for temperature cycling may allow faster speeds for PCR than currently considered possible.

  12. Monitoring infection: from blood culture to polymerase chain reaction (PCR).

    Science.gov (United States)

    Book, Malte; Lehmann, Lutz Eric; Zhang, XiangHong; Stüber, Frank

    2013-06-01

    In patients with sepsis, diagnosis of blood stream infection (BSI) is a key concern to the therapist. Direct verification of pathogens in the blood stream executed by blood cultures (BC) still is regarded as the gold standard up to date. The quickest possible initiation of an appropriate antimicrobial therapy is a cornerstone of an effective therapy. Moreover, in this view BC can also serve to identify antimicrobial agents to target the pathogen. However, when employing BC the time needed until microbiological results are available ranges from 24 up to 72 h. Moreover, infections caused by multiple pathogens often remain undetected and concurrent antibiotic therapy may lower the overall sensitivity. Alternative pathogen characterization can be performed by polymerase chain reaction (PCR) based amplification methods. Results using PCR can be obtained within 6-8 h. Therefore, the time delay until an appropriate therapy can be reduced enormously. Moreover, these methods have the potential to enhance the sensitivity in the diagnosis of blood stream infections. Therefore, PCR based methods might be a valuable adjunct to present procedures of diagnosing bacteraemia.

  13. Analysis of human cytomegalovirus using the polymerase chain reaction.

    Science.gov (United States)

    Mendelson, M

    2000-01-01

    As with numerous other branches of science, the study of human cytomegalovirus (HCMV) infection has been revolutionized by the polymerase chain reaction (PCR) method first devised by Mullis and Faloona (1). PCR allows the in vitro amplification of HCMV DNA sequences by the simultaneous primer extension of complementary DNA strands. Similarly, reverse transcription-PCR (RT-PCR) allows the study of targeted gene expression, by reverse transcription of RNA to complementary DNA (cDNA), followed by amplification of target DNA using predetermined primers. The PCR method is used in the clinical diagnosis of HCMV infection, particularly in the setting of transplantation medicine and in those patients infected with the human immunodeficiency virus (HIV). In addition, the advent of PCR and RT-PCR has transformed our understanding of the pathogenesis of HCMV infection, central to which is the definition of the sites of latency, the degree and type of gene expression within the latently infected cell, and the factors influencing both the maintenance of latency and reactivation of the virus during immunosuppression.

  14. Time-resolved FTIR [Fourier transform infrared] emission studies of laser photofragmentation and chain reactions

    International Nuclear Information System (INIS)

    Recent progress is described resulting from the past three years of DOE support for studies of combustion-related photofragmentation dynamics, energy transfer, and reaction processes using a time-resolved Fourier transform infrared (FTIR) emission technique. The FTIR is coupled to a high repetition rate excimer laser which produces radicals by photolysis to obtain novel, high resolution measurements on vibrational and rotational state dynamics. The results are important for the study of numerous radical species relevant to combustion processes. The method has been applied to the detailed study of photofragmentation dynamics in systems such as acetylene, which produces C2H; chlorofluoroethylene to study the HF product channel; vinyl chloride and dichloroethylene, which produce HCl; acetone, which produces CO and CH3; and ammonia, which produces NH2. In addition, we have recently demonstrated use of the FTIR technique for preliminary studies of energy transfer events under near single collision conditions, radical-radical reactions, and laser-initiated chain reaction processes

  15. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  16. Performance evaluation on aquatic product cold-chain logistics

    Directory of Open Access Journals (Sweden)

    Wenbing Wu

    2015-11-01

    Full Text Available Purpose: The requirements for high quality and diversification aquatic products are increasing with the improvement of Chinese living standard. However, the distribution between place of production and place of consumption are uneven, which results in large cold-chain logistics demand for aquatic products. At present, the low-level development of cold chain logistics has a bad impact on the circulation of aquatic products in China. So it is very urgent to develop cold-chain logistics in China. Design/methodology/approach: In order to do this, we apply performance evaluation, a well-known management tool, to study Chinese aquatic product cold-chain logistics. In this paper we first propose SISP(Subjects, Indexes, Standards, and Phases of performance evaluation model and ACSSN model(Aquatic product, Customer, Supply Chain, Society, and Node enterprises of supply chain for aquatic products cold-chain logistics performance evaluation. Then an ANP-Fuzzy method is proposed to evaluate the operational performance of Shandong Oriental Ocean Sci-Tech Co., Ltd. Furthermore, a system dynamic model is built to simulate the impact of temperature on the profits in aquatic products cold-chain sales section. Findings: We find out within a reasonable temperature range, lower temperature brings higher profit level. Also, performance improvement methods are proposed and the simulation of performance evaluation system is developed. Practical implications: Our findings can help to improve the level of aquatic product cold-chain logistics in China. Originality/value: The paper proposes the SISP (Subjects, Indexes, Standards, and Phases of performance evaluation model and ACSSN model (Aquatic product, Customer, Supply Chain, Society, and Node enterprises of supply chain for aquatic products cold-chain logistics performance evaluation.

  17. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M

    2012-02-03

    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  18. Novel Haloperoxidase Reaction: Synthesis of Dihalogenated Products

    OpenAIRE

    Geigert, John; Neidleman, Saul L.; Dalietos, Demetrios J.; DeWitt, Susanne K.

    1983-01-01

    The enzymatic synthesis of vicinal, dihalogenated products from alkenes and alkynes is described. The enzymatic reaction required an alkene or alkyne, dilute hydrogen peroxide, a haloperoxidase, and molar amounts of halide ions. Vicinal dichloro, dibromo, and diiodo products could be formed. A hydroxyl group on the carbon adjacent to the carbon-carbon double or triple bond lowered the halide ion concentration needed to produce the dihalo product. This reaction offers one explanation for the o...

  19. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    OpenAIRE

    Liang Gaofeng; Ma Chao; Zhu Yanliang; Li Shuchun; Shao Youhua; Wang Yong; Xiao Zhongdang

    2010-01-01

    Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase ...

  20. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...

  1. Reaction products of chlorine dioxide.

    OpenAIRE

    Stevens, A A

    1982-01-01

    Inspection of the available literature reveals that a detailed investigation of the aqueous organic chemistry of chlorine dioxide and systematic identification of products formed during water disinfection has not been considered. This must be done before an informed assessment can be made of the relative safety of using chlorine dioxide as a disinfectant alternative to chlorine. Although trihalomethanes are generally not formed by the action of chlorine dioxide, the products of chlorine dioxi...

  2. Snake antivenoms: adverse reactions and production technology

    Directory of Open Access Journals (Sweden)

    VM Morais

    2009-01-01

    Full Text Available Antivenoms have been widely used for more than a century for treating snakebites and other accidents with poisonous animals. Despite their efficacy, the use of heterologous antivenoms involves the possibility of adverse reactions due to activation of the immune system. In this paper, alternatives for antivenom production already in use were evaluated in light of their ability to minimize the occurrence of adverse reactions. These effects were classified according to their molecular mechanism as: anaphylactic reactions mediated by IgE, anaphylactoid reactions caused by complement system activation, and pyrogenic reactions produced mainly by the presence of endotoxins in the final product. In the future, antivenoms may be replaced by humanized antibodies, specific neutralizing compounds or vaccination. Meanwhile, improvements in antivenom quality will be focused on the obtainment of a more purified and specific product in compliance with good manufacturing practices and at an affordable cost.

  3. Design for environment: The greening of product and supply chain

    OpenAIRE

    K Soylu; Dumville, J. C.

    2011-01-01

    This research aims to analyze specifically three disciplines, which are design for environment; design for supportability; and design for supply chain, to assess particularly their interactions and collaborations in the new product development, and to explain briefly how their activities can green new products and supply chains. Experience and a comprehensive review of literature associated with concurrent engineering, supply chain, and environmental management can present a theoretical model...

  4. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou

    2008-01-01

    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  5. Optimalization of production inside logistics chain for 21st century

    Directory of Open Access Journals (Sweden)

    Drago Pupavac

    2006-12-01

    Full Text Available In today’s world numerous logistics chains exist, competing for similar jobs in different markets throughout the world. By connecting the supply and demand, i.e. production and consumption, logistics chains create national, regional and global logistics network which task is to maximise total generated value. Generated valueis defined as the difference between the price of finished product or service and the input necessary to create such products. The chain profitability is shown by the difference between the income obtained through sale of products or services and total expenditure in that chain. Accordingly, this scientific debate researches the possibilityof production optimisation within logistic chain by application of dynamic programming method with emphasis on information technologies.

  6. 食品中化脓链球菌的PCR检测方法的建立%Establishment of Polymerase Chain Reaction Assay for Detection of Streptococcus Pyogenes in Food Products

    Institute of Scientific and Technical Information of China (English)

    杨学明; 巢强国; 葛宇; 熊薇; 曲勤凤

    2008-01-01

    化脓链球菌是一种常见的食源性致病菌,从19世纪80年代起,化脓链球菌引起的感染在全球范围内呈逐步上升之势并发展成为人类重要致病茵之一.通过已公布的13株化脓链球菌的基因组序列找出具有种特异性的基因序列.运用BLAST(Basic Local Alignment Search Tool,基本局部比对工具)在GenBank中进行序列对库的比对结果表明:化脓链球菌的某些基因(SmeZ,emm,spyM51755)具有种特异性.以这些基因为目的基因,共设计七对引物.经PCR(Polymerase Chain Reaction,聚合酶链式反应)检测发现spvM引物对(spyM51755F,spyM51755R)具有很高的特异性.利用该引物对,建立可快速且灵敏地检测食品中化脓链球菌的PCR方法,其灵敏度达到10 cfu/g样品.

  7. Dynamics of interfacial reactions between O(3 P) atoms and long-chain liquid hydrocarbons

    Science.gov (United States)

    Allan, Mhairi; Bagot, Paul A. J.; Köhler, Sven P. K.; Reed, Stewart K.; Westacott, Robin E.; Costen, Matthew L.; McKendrick, Kenneth G.

    2007-09-01

    Recent progress that has been made towards understanding the dynamics of collisions at the gas-liquid interface is summarized briefly. We describe in this context a promising new approach to the experimental study of gas-liquid interfacial reactions that we have introduced. This is based on laser-photolytic production of reactive gas-phase atoms above the liquid surface and laser-spectroscopic probing of the resulting nascent products. This technique is illustrated for reaction of O(3P) atoms at the surface of the long-chain liquid hydrocarbon squalane (2,6,10,15,19,23-hexamethyltetracosane). Laser-induced fluorescence detection of the nascent OH has revealed mechanistically diagnostic correlations between its internal and translational energy distributions. Vibrationally excited OH molecules are able to escape the surface. At least two contributions to the product rotational distributions are identified, confirming and extending previous hypotheses of the participation of both direct and trapping-desorption mechanisms. We speculate briefly on future experimental and theoretical developments that might be necessary to address the many currently unanswered mechanistic questions for this, and other, classes of gas-liquid interfacial reaction.

  8. Applying the means-end chain concept to product development

    DEFF Research Database (Denmark)

    Søndergaard, Helle Alsted

    This paper proposes that the means-end chain (MEC) approach can influence the use of market information and inter-functional communication in new product development (NPD). The central question is whether market information represented by means-end chain data can be a vehicle for inter-functional......This paper proposes that the means-end chain (MEC) approach can influence the use of market information and inter-functional communication in new product development (NPD). The central question is whether market information represented by means-end chain data can be a vehicle for inter...

  9. Identification of duck plague virus by polymerase chain reaction

    Science.gov (United States)

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  10. Dynamical Model of Weak Pion Production Reactions

    CERN Document Server

    Sato, T; Lee, T S H

    2003-01-01

    The dynamical model of pion electroproduction has been extended to investigate the weak pion production reactions. The predicted cross sections of neutrino-induced pion production reactions are in good agreement with the existing data. We show that the renormalized(dressed) axial N-$\\Delta$ form factor contains large dynamical pion cloud effects and this renormalization effects are crucial in getting agreement with the data. We conclude that the N-$\\Delta$ transitions predicted by the constituent quark model are consistent with the existing neutrino induced pion production data in the $\\Delta$ region.

  11. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Directory of Open Access Journals (Sweden)

    Liang Gaofeng

    2011-01-01

    Full Text Available Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR. Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA. The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  12. Optimization Model of Close Supply Chain of Green Agricultural Products

    OpenAIRE

    Wang, Duo-hong; Li, Yu; Zhao, Hong-Xia; Zhang, Jiang-quan

    2009-01-01

    Close supply chain of green agricultural products is defined, consisting of the supplier, manufacturer, distributor, retailer and consumer (customer). Cost structure of distributor is analyzed, mainly including the order activity-based cost, the inventory cost and the supply transportation cost of agricultural products in upstream and downstream enterprises. Based on this, conceptual model of the close supply chain of green agricultural products is established. According to the idea of dynami...

  13. Bottleneck on Supply Chain of Organic Agricultural Products and Countermeasures

    Institute of Scientific and Technical Information of China (English)

    ZHANG Xin-min

    2012-01-01

    Organic agriculture is one of successful models of low-carbon agriculture, and plays an important role in alleviating and adapting to climate change. However, the development of supply chain of organic agricultural products lags behind, which seriously restricts development of organic agricultural product market. In this paper, major models and bottleneck of supply chain of organic agricultural products are analyzed, and finally countermeasures are put forward.

  14. Snake antivenoms: adverse reactions and production technology

    OpenAIRE

    VM Morais; H Massaldi

    2009-01-01

    Antivenoms have been widely used for more than a century for treating snakebites and other accidents with poisonous animals. Despite their efficacy, the use of heterologous antivenoms involves the possibility of adverse reactions due to activation of the immune system. In this paper, alternatives for antivenom production already in use were evaluated in light of their ability to minimize the occurrence of adverse reactions. These effects were classified according to their molecular mechanism ...

  15. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat...

  16. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae.

    OpenAIRE

    1991-01-01

    We report a set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae. The results of this assay on strains of V. cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe. The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells. The polymerase chain reaction method could directly detect...

  17. Reactions analysis of di-pions production

    International Nuclear Information System (INIS)

    After a discussion of ambiguities in the methods used to obtain informations on the ππ diffusion from the reaction π-p→π+π-n with unpolarized targets, a model-independent method is proposed to determine experimentally the cross section for the S-wave production in the reaction π+p→π+π-Δ++. Comparing the S-wave di-pion production in the ζ-mass region from the recent experimental results on the reactions π+p→π=π-Δ++ and π-p→π-π+n on a polarized target, it is found that the amount of S-wave production is generally consistent with the lower bound obtained from the di-pion decay moments

  18. Product Line Pricing in a Supply Chain

    OpenAIRE

    Lingxiu Dong; Chakravarthi Narasimhan; Kaijie Zhu

    2009-01-01

    A vertically integrated channel would prefer to coordinate the pricing of its products. In this paper, we investigate drivers of product line pricing decisions in a bilateral monopoly where a manufacturer produces and sells two substitutable or complementary products to a retailer. In a two-stage game, each firm commits credibly in the first stage to a pricing scheme within its own organization: product line pricing (PLP) or nonproduct line pricing (NPLP). In the second stage, depending on th...

  19. High energy photons production in nuclear reactions

    International Nuclear Information System (INIS)

    Hard photon production, in nucleus-nucleus collisions, were studied at beam energies between 10 and 125 MeV. The main characteristics of the photon emission are deduced. They suggest that the neutron-proton collisions in the early stage of the reaction are the main source of high energy gamma-rays. An overview of the theoretical approaches is given and compared with experimental results. Theoretical attempts to include the contribution of charged pion exchange currents to photon production, in calculations of proton-nucleus-gamma and nucleus-nucleus-gamma reactions, showed suitable fitting with experimental data

  20. Reaction mechanisms in the radiolysis of peptides, polypeptides and proteins II reactions at side-chain loci in model systems

    International Nuclear Information System (INIS)

    The major emphasis in radiation biology at the molecular level has been on the nucleic acid component of the nucleic acid-protein complex because of its primary genetic importance. But there is increasing evidence that radiation damage to the protein component also has important biological implications. Damage to capsid protein now appears to be a major factor in the radiation inactivation of phage and other viruses. And, there is increasing evidence that radiation-chemical change in the protein component of chromation leads to changes in the stability of the repressor-operator complexes involved in gene expression. Knowledge of the radiation chemistry of protein is also of importance in other fields such as the application of radiation sterilization to foods and drugs. Recent findings that a class of compounds, the α,α'-diaminodicarboxylic acids, not normally present in food proteins, are formed in protein radiolysis is of particular significance since certain of their peptide derivatives have been showing to exhibit immunological activity. The purpose of this review is to bring together and to correlate our present knowledge of products and mechanisms in the radiolysis of peptides, polypeptides and proteins both aqueous and solid-state. In part 1 we presented a discussion of the radiation-induced reactions of the peptide main-chain in model peptide and polypeptide systems. Here in part 2 the emphasis is on the competing radiation chemistry at side-chain loci of peptide derivatives of aliphatic, aromatic-unsaturated and sulfur-containing amino acids in similar systems. Information obtained with the various experimental techniques of product analysis, competition kinetics, spin-trapping, pulse radiolysis, and ESR spectroscopy are included

  1. Stereoselective synthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-ulose via autoxidation reaction

    Institute of Scientific and Technical Information of China (English)

    LIU Hong-Min; ZHANG Fuyi; TAO Jing-Chao

    2004-01-01

    Many different approaches for synthesis of branched chain sugars have beenestablished,1 because they are very useful intermediates for synthesis of other non-sugar chiralmolecules, and usually occur in nature. Branched chain glycosidulose can be used for construction offive- and six-membered carbocyclic rings to which two chiral carbons of sugar are incorporated byintramolecular aldol condensation and Robinson annulation,2 Therefore they are useful in thesynthesis of natural products which consist of annulated carbohydrates or where a highlyfunctionalised enantiomerically pure cyclopentane or cyclohexane is required. Also, this type ofbranched chain sugar can be considered as the synthons of monoterpenoid natural products of theiridoid class which have the cyclopentan-(c)-pyran structure. In view of the importance of branchedchain glycosiduloses, it is desirable to have a general, convenient methodology to their synthesis.However, none of the literature methods was reported on their synthesis by a nuclephilic addition toa partially protected glycosidulose, due to the fact that these glycosiduloses are very difficult tosynthesize selectively and unstable;3 and what is more, one-step synthesis branched chainglycosidulose using this method is almost impossible.In this paper, we report on a general, convenient method for stereoselective syntheses of2,2-bis(C-branched-chain)glucopyranosid-3-uloses by the new reaction of 1 with various activemethylene compounds. The generality of this method was examined in detail. The optimumtemperature was 18-25℃. The solvent DMF was better than the others. In all cases he yields werehigher than 60%.All the 2,2-bis(C-branched-chain)glucopyranosid-3-uloses were characterized by X-raycrystallographic analyses. In addition, the important iintermediate in this reaction was isolated,which is the product of autoxidation of 1 at C-3 position. Thus the reaction mechanism for thesynthesis of 2,2-bis(C-branched-chain) glucopyranosid-3-uloses

  2. Challenges for bio-based products in sustainable value chains

    NARCIS (Netherlands)

    Cardon, L.; Lin, J.W.; De Groote, M.; Ragaert, K.; Kopecka, J.A.; Koster, R.P.

    2011-01-01

    This work concerns studies related to strategic development of products in which bio-based plastics are or will be applied, referred to as bio-based products. The studies cover (1) current and potential benefits of bio-based products in extended value chains including activities after end-of-life of

  3. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    Science.gov (United States)

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR.

  4. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  5. A Novel Nested Polymerase Chain Reaction (n-PCR Assay for Identifying Sorghum nitidum

    Directory of Open Access Journals (Sweden)

    Shasha WEI

    2011-11-01

    Full Text Available This work developed a novel nested polymerase chain reaction (n-PCR assay to identify Sorghum nitidum (S. nitidum. It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band at ~873 bp in gel spectra, while other relatives, including Sorghum halepense, Sorghum almum, Sorghum bicolor, Sorghum propinum and Sorghum sudanse exhibited negative amplifications. This assay was able to specifically identify S. nitidum fast and effectively, which could be applied widely in field inspection, agriculture production and plant protection.

  6. Treponema pallidum and Haemophilus ducreyi DNA detection by A Multi-Nested Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    郑和平; SylviaBruisten; 何玉山; 黄进梅; 吴兴中

    2004-01-01

    Objectives: To develop a multi-nested polymerase chain reaction in an assay to detect early Treponema pallidum and Haemophilus ducreyi DNA in the swabs of genital ulcers. Methods: Four pairs of outer and inner primers, specific to the basic membrane protein gene of Treponema pallidum and to the 16s rRNA gene of H ducreyi were synthesized. The multi-nested PCR was developed and applied to detect Treponema pallidum and Haemophilus dicreyi in clinical swabs. Result: The two samples of standard strains of Haemophilus ducreyi and one Treponema pallidum were amplified and showed 309-bp rRNA gene of Haemophilus ducreyi and 506-bp DNA of Treponema palidum, respectively. Out of 51 samples of genital ulcer detected, 29 showed Treponemapallidum positive product and noHaemophilus ducreyi DNA was found. Conclusion: The multi-nested PCR for Treponema pallidum and Haemophilus ducreyi could be useful for early detection and distinguishing diagnosis between syphilis and chancroid.

  7. Design of Multiplex Polymerase Chain Reaction (PCR Method for Molecular Detection of Yersinia pestis Bacterium

    Directory of Open Access Journals (Sweden)

    Mohammad Soleimani

    2010-01-01

    Full Text Available Objective: Yersinia pestis, the causative agent of the zoonotic plague infection, is a majorpublic health concern both as a threat and potential bioweapon. The objective of thepresent study was to establish a uniplex and multiplex - polymerase chain reaction (PCRtest for the specific detection of Y. pestis.Materials and Methods: PCR reactions performed by three pair primers which targetedthe caf1 and pla genes located on the pFra and pPst plasmids and the irp2 chromosomalgene located on the ‘pathogenicity island’. After TA cloning of the PCR products, the test’slimit of detection (LOD was determined. For evaluating the specificity, PCR reactionswere performed with negative control bacteria.Results: Assays were performed with the genome of Y. pestis which produced three DNAfragments of the expected sizes 300, 400 and 520 bp which corresponded to the irp2,caf1 and pla genes, respectively. The lower LoD was 370 copy numbers for the caf1 geneand 21 for the pla gene. In PCR reactions that used negative control bacteria, detectablefragments were not observed.Conclusion: Our method clearly discriminated Y. pestis DNA. The rapidity, specificityand sensitivity of this procedure suggest that it can serve as a useful alternative methodfor the inoculation of laboratory animals or the use of specific culture media for routineplaque surveillance and outbreak investigations. Another vital result of this study was theestablishment of Y. pestis molecular detection technique in Iran.

  8. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    1994-01-01

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  9. Transgenes monitoring in an industrial soybean oil processing by conventional and real-time polymerase chain reaction

    OpenAIRE

    Costa, J; Mafra, I; Amaral, J S; Oliveira, M. B. P. P.

    2009-01-01

    In recent years a great effort has been devoted to the development of new methods for the qualitative and quantitative detection of transgenic sequences in food. Most of the developed analytical methods for GMO detection are DNA-based, since protein-based assays are not suitable for processed food. For that purpose, polimerase chain reaction (PCR) and real-time quantitative PCR have been successfully applied. Since the approval of Roundup Ready (RR) soybean in Europe, the production of soybea...

  10. Differentiation of Neisseria gonorrhoeae strains by polymerase chain reaction and restriction fragment length polymorphism of outer membrane protein IB genes.

    OpenAIRE

    Lau, Q C; Chow, V T; Poh, C. L.

    1995-01-01

    OBJECTIVES--To employ polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis for the rapid differentiation of Neisseria gonorrhoeae protein IB (PIB) isolates and to compare its usefulness with the widely accepted auxotype/serovar classification scheme. METHODS--The outer membrane protein IB genes of 47 gonococcal isolates belonging to 10 different serovars were amplified by PCR. The approximately 1 kb DNA products were then digested separately with restri...

  11. Environmental innovations in the product chain

    DEFF Research Database (Denmark)

    Remmen, Arne; Holgaard, Jette Egelund

    2004-01-01

    The article gives an overview of different positions within innovation and network theory, and highlights how enterprises within the organic dairy industry and fish processing industry have made environmental innovations related to their processes and products.......The article gives an overview of different positions within innovation and network theory, and highlights how enterprises within the organic dairy industry and fish processing industry have made environmental innovations related to their processes and products....

  12. Amplifying genes using the polymerase chain reaction: A promising diagnostic tool

    International Nuclear Information System (INIS)

    The power to amplify genetic material several millionfold using the polymerase chain reaction (PCR) has greatly enhanced the ability of molecular biologists to examine and manipulate genes. We have used the PCR reaction to detect bluetongue virus (BTV) in infected animals and are currently able to serogroup, serotype and determine the geographic origin of a BTV isolate. Similarly, using a combination of hybridization analyses and direct sequencing of the PCR products we can rapidly detect avian influenza virus, Newcastle disease virus and Mycoplasma and predict if we have nucleic acid sequences that are characteristic of a virulent or avirulent isolate. The ability to manipulate genetic information has made it possible to generate proteins containing deletions or create chimeric proteins which contain additions to their sequences. Such studies are important for the understanding of immune responses to various protein epitopes. Besides its sensitivity, PCR has the advantage of speed over some other detection systems. A comprehensive detection and diagnosis can be done in a few hours compared with several weeks previously required for virus isolations. However, there are disadvantages to using PCR. Because of its ability to amplify a sequence several millionfold, contaminants other than the target species may be amplified and since the DNA polymerase used in PCR has no editing or proofreading functions, errors may be quickly incorporated into the final PCR product. 13 refs, 8 figs

  13. 76 FR 41525 - Hewlett Packard Global Parts Supply Chain, Global Product Life Cycles Management Unit Including...

    Science.gov (United States)

    2011-07-14

    ... Parts Supply Chain, Global Product Life Cycles Management Unit, including teleworkers reporting to... Employment and Training Administration Hewlett Packard Global Parts Supply Chain, Global Product Life Cycles... Chain, Global Product Life Cycles Management Unit, including teleworkers reporting to Houston,...

  14. Environmental innovations in the product chain

    DEFF Research Database (Denmark)

    Remmen, Arne; Holgaard, Jette Egelund

    2003-01-01

    The paper gives a brief overview of different positions within innovation and network theory, and on that basis a framework is developed and discussed in relation to environmental innovations.The paper also highlights how enterprises within two different trades in the Danish food industry have made...... environmental innovations related to their processes and products....

  15. Modes of environmental management in transnational product chains

    DEFF Research Database (Denmark)

    Jørgensen, Michael Søgaard; Jørgensen, Ulrik; Hendriksen, Kåre;

    2007-01-01

    Many companies in industrialised countries are outsourcing production or sourcing materials and products in countries with lower environmental protection than the companies’ countries of origin. The background is access to special materials and/or lower costs, but some times also the market...... regulation and standards. The roles of the involved nation states are often limited. In some cases international regulatory initiatives may shape the environmental management in product chains. The interpretative elements in ISO 14001 imply that some companies are sceptical about this kind of management...... in supply chains and practice in stead direct control based on more specific demands. More analyses of environmental management in transnational product chains is needed, including the role of general and more specific international guidelines and standards in combination with initiatives like customers...

  16. Applying the means-end chain concept to product development

    DEFF Research Database (Denmark)

    Søndergaard, Helle Alsted

    This paper proposes that the means-end chain (MEC) approach can influence the use of market information and inter-functional communication in new product development (NPD). The central question is whether market information represented by means-end chain data can be a vehicle for inter......-functional communication. This paper describes a PhD project - that through case studies and action research in two companies - aims at investigating the effects on communication and attitudes to communication by those involved when introducing means-end chain data as market information in NPD....

  17. In Chains? Automotive Suppliers and Their Product Development Activities

    OpenAIRE

    Corswant, F.; Wynstra, Finn; Wetzels, Alex

    2003-01-01

    textabstractA conceptual framework is developed and tested in which supplier downstream position in the supply chain, supplier innovation strategy and customer development commitment are seen as the antecedents of supplier product development activity. Using partial least squares (PLS), we analyze the results of a survey of 161 Swedish automotive suppliers and test a series of nested models to test our hypotheses. We demonstrate that the position of the supplier in the supply chain and its st...

  18. Traceability: a demand of agro industrial chain for special products

    Directory of Open Access Journals (Sweden)

    José Verissimo Foggiatto Silveira

    2007-10-01

    Full Text Available The inclusion of agricultural products with different nutritional features has altered the relationship, the upstream and the downstream of enterprises that produce and commercialize them. Coordination in the Agro Industrial System is demanded, including traceability as a way to guarantee the conformity of products, attending external clients and agricultural industries that require quality certification. This quality tool enables the identification of some details in the productive chain, such as seeds, farming, harvesting, storage, transportation and industrialization of products. Thus, this essay describes the concept of traceability and provides information of special products from a cooperative from Paraná, which has controlled process in the productive chain, demanded by contractual partnerships done with enterprises that provide fertilizers and food processors. It was identified that this cooperative commercializes three products that need traceability: two special kinds of corn and the regular kind of soybean.

  19. Elongase reactions as control points in long-chain polyunsaturated fatty acid synthesis.

    Directory of Open Access Journals (Sweden)

    Melissa K Gregory

    Full Text Available BACKGROUND: Δ6-Desaturase (Fads2 is widely regarded as rate-limiting in the conversion of dietary α-linolenic acid (18:3n-3; ALA to the long-chain omega-3 polyunsaturated fatty acid docosahexaenoic acid (22:6n-3; DHA. However, increasing dietary ALA or the direct Fads2 product, stearidonic acid (18:4n-3; SDA, increases tissue levels of eicosapentaenoic acid (20:5n-3; EPA and docosapentaenoic acid (22:5n-3; DPA, but not DHA. These observations suggest that one or more control points must exist beyond ALA metabolism by Fads2. One possible control point is a second reaction involving Fads2 itself, since this enzyme catalyses desaturation of 24:5n-3 to 24:6n-3, as well as ALA to SDA. However, metabolism of EPA and DPA both require elongation reactions. This study examined the activities of two elongase enzymes as well as the second reaction of Fads2 in order to concentrate on the metabolism of EPA to DHA. METHODOLOGY/PRINCIPAL FINDINGS: The substrate selectivities, competitive substrate interactions and dose response curves of the rat elongases, Elovl2 and Elovl5 were determined after expression of the enzymes in yeast. The competitive substrate interactions for rat Fads2 were also examined. Rat Elovl2 was active with C(20 and C(22 polyunsaturated fatty acids and this single enzyme catalysed the sequential elongation reactions of EPA→DPA→24:5n-3. The second reaction DPA→24:5n-3 appeared to be saturated at substrate concentrations not saturating for the first reaction EPA→DPA. ALA dose-dependently inhibited Fads2 conversion of 24:5n-3 to 24:6n-3. CONCLUSIONS: The competition between ALA and 24:5n-3 for Fads2 may explain the decrease in DHA levels observed after certain intakes of dietary ALA have been exceeded. In addition, the apparent saturation of the second Elovl2 reaction, DPA→24:5n-3, provides further explanations for the accumulation of DPA when ALA, SDA or EPA is provided in the diet. This study suggests that Elovl2 will be

  20. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    Science.gov (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  1. Method of carbon chain extension using novel aldol reaction

    Energy Technology Data Exchange (ETDEWEB)

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  2. Molecular probes and the polymerase chain reaction for detection and typing of Leishmania species in Mexico.

    Science.gov (United States)

    Monroy-Ostria, Amalia; Sanchez-Tejeda, Gustavo

    2002-04-01

    Leishmaniasis in Mexico is a public health problem because all the clinical forms have been recorded in most Mexican states. We studied patients showing clinical symptoms of any form of leishmaniasis, from several endemic areas. Bone marrow samples, aspirates or skin biopsies were taken and deoxyribonucleic acid (DNA) was extracted and amplified by the polymerase chain reaction (PCR) with universal primers AJS1 and DeB8, specific for the Leishmania subgenus Leishmania. The PCR products were then hybridized by dot- or Southern blotting and probed with probe 9.2, specific for the L. mexicana complex. If hybridization did not occur, the DNA was amplified with primers D1 and D2, specific for members of the L. donovani complex, and PCR products were hybridized with probe B4Rsa, also specific for the L. donovani complex. DNA was also amplified with primers B1 and B2, specific for the subgenus Viannia, and the PCR products were hybridized with probe B18, specific for the L. braziliensis complex. It was found that in Tabasco and Veracruz, Mexico, localized cutaneous leishmaniasis (LCL) is caused by infection with members of the L. mexicana complex, whereas in the states of Nayarit and Campeche it was due to infection with the L. mexicana and/or L. braziliensis complexes. Visceral leishmaniasis was caused by L. (L.) chagasi, mainly in the states of Chiapas and Guerrero, and by L. (L.) mexicana in one immunocompromised patient from Tabasco.

  3. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2007-01-23

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  4. Preparation of End Grafted Polyacrylonitrile Brushes through Surface Confined Radical Chain Transfer Reaction

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    End grafted polyacrylonitrile (PAN) brush was prepared through surface initiated polymerization via the chain transfer process. The thiol-terminated monolayer and PAN brushes were characterized by FTIR, X-ray photoelectron spectroscopy (XPS), atomic force microscopy (AFM), ellipsometry and contact angle measurements ete. It is demonstrated that radical chain transfer reaction and surface initiated precipitate polymerization can be used to prepare end-grafted polymer brushes.

  5. Significance of salmonella in pork production chain

    Directory of Open Access Journals (Sweden)

    Karabasil Neđeljko

    2008-01-01

    Full Text Available Animals, feed, meat and meat products are often transported across long distances, being an important part of international trade, which enables a dissemination of salmonella, including even of some resistant strains. Pigs are animals which are difficult to manipulate because of their temperament, build, sharp teeth, irritability, good sense of smell, bad sight and their sensitivity to stress. Animals coming from different farms should be separated in stock yards to prevent both contamination with pathogens such as salmonella and their irritation and aggressiveness caused by contacts with other pigs. These animals are usually a significant reservoir of salmonella which are 'inside' the gastrointestinal tract and gut associated lymph tissue. In contrast to our country, in the EU, even countries which have always had low salmonella prevalence, e.g. Finland, have a control program. The program has to be based on a guarantee that all relevant factors will participate in the prevention of salmonella contamination.

  6. Influence of transesterification reaction temperature on biodiesel production

    Energy Technology Data Exchange (ETDEWEB)

    Pighinelli, Anna Leticia Montenegro Turtelli; Zorzeto, Thais Queiroz; Park, Kil Jin [Universidade Estadual de Campinas (FEAGRI/UNICAMP), SP (Brazil). Fac. de Engenharia Agricola], E-mail: annalets@agr.unicamp.br; Bevilaqua, Gabriela [Universidade Estadual de Campinas (UNICAMP), SP (Brazil). Inst. de Quimica

    2008-07-01

    Brazilian government policy has authorized the introduction of biodiesel into the national energy matrix, law no.11.097 of January 13th, 2005. It is necessary, like any new product, to invest in research which is able to cover its entire production chain (planting of oilseeds, vegetable oils extraction and chemical reactions), providing data and relevant information in order to optimize the process and solve critical issues. The objective of this work was to study the effects of temperature on crude sunflower transesterification reaction with ethanol. A central composite experimental design with five variation levels (25 deg, 32 deg, 47.5 deg, 64 deg and 70 deg C) was used and response surface methodology applied for the data analysis. The statistical analysis of the results showed that the production suffered the influence of temperature (linear and quadratic effects) and reaction time (linear and quadratic). The generated models did not show significant regression. The model generated was not well suited to the experimental data and the value of the coefficient of determination (R{sup 2}=0.52) was low. Consequently it was not possible to build the response surface. (author)

  7. Stepwise kinetic equilibrium models of quantitative polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Cobbs Gary

    2012-08-01

    Full Text Available Abstract Background Numerous models for use in interpreting quantitative PCR (qPCR data are present in recent literature. The most commonly used models assume the amplification in qPCR is exponential and fit an exponential model with a constant rate of increase to a select part of the curve. Kinetic theory may be used to model the annealing phase and does not assume constant efficiency of amplification. Mechanistic models describing the annealing phase with kinetic theory offer the most potential for accurate interpretation of qPCR data. Even so, they have not been thoroughly investigated and are rarely used for interpretation of qPCR data. New results for kinetic modeling of qPCR are presented. Results Two models are presented in which the efficiency of amplification is based on equilibrium solutions for the annealing phase of the qPCR process. Model 1 assumes annealing of complementary targets strands and annealing of target and primers are both reversible reactions and reach a dynamic equilibrium. Model 2 assumes all annealing reactions are nonreversible and equilibrium is static. Both models include the effect of primer concentration during the annealing phase. Analytic formulae are given for the equilibrium values of all single and double stranded molecules at the end of the annealing step. The equilibrium values are then used in a stepwise method to describe the whole qPCR process. Rate constants of kinetic models are the same for solutions that are identical except for possibly having different initial target concentrations. Analysis of qPCR curves from such solutions are thus analyzed by simultaneous non-linear curve fitting with the same rate constant values applying to all curves and each curve having a unique value for initial target concentration. The models were fit to two data sets for which the true initial target concentrations are known. Both models give better fit to observed qPCR data than other kinetic models present in the

  8. Effective sourcing strategies for perishable product supply chains

    OpenAIRE

    Rijpkema, Willem A.; Rossi, Roberto; Van Der Vorst, Jack G.A.J.

    2014-01-01

    Purpose – The purpose of this paper is to assess whether an existing sourcing strategy can effectively supply products of appropriate quality with acceptable levels of product waste if applied to an international perishable product supply chain. The authors also analyse whether the effectiveness of this sourcing strategy can be improved by including costs for expected shelf life losses while generating order policies. Design/methodology/approach – The performance of sourcing strategies is exa...

  9. An overview on the Brazilian orange juice production chain

    OpenAIRE

    Renato Marcio dos Santos; Irenilza de Alencar Nääs; Mario Mollo Neto; Oduvaldo Vendrametto

    2013-01-01

    Brazil is the world's largest producer of oranges and uses more than 70% of the harvested fruits in the production of juices. The amount of processed orange is growing about 10% per year, confirming the trend of the Brazilian citrus for juice production. This research aimed to investigate the Brazilian orange juice production chain from 2005 to 2009. Data from the amount of frozen juice produced and exported, international price of orange juice, and intermediate transactions were assessed in ...

  10. Scenarios for the milk production chain in Brazil in 2020

    OpenAIRE

    Renata Giovinazzo Spers; James Terence Coulter Wright; André de Azevedo Amedomar

    2013-01-01

    Brazilian milk production has grown steadily and in 2004 the country became self-sufficient in dairy production. This article develops possible scenarios for the milk production chain in Brazil for the year 2020 in order to contribute to decisions that must be made by stakeholders. A literature review on foresight and the use of scenarios was conducted, and a scenario writing approach based on Wright and Spers (2006) was adopted, which includes the use of the Delphi method, Michael Porter's F...

  11. Integrated Lot Sizing in Serial Supply Chains with Production Capacities

    OpenAIRE

    Romero-Morales, Dolores; Wagelmans, Albert; Romeijn, H. Edwin; Hoesel, Stan van

    2005-01-01

    We consider a model for a serial supply chain in which production, inventory, and transportation decisions are integrated in the presence of production capacities and concave cost functions. The model we study generalizes the uncapacitated serial single-item multilevel economic lot-sizing model by adding stationary production capacities at the manufacturer level. We present algorithms with a running time that is polynomial in the planning horizon when all cost functions are concave. In additi...

  12. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao

    2005-01-01

    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.

  13. Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction.

    Science.gov (United States)

    Chen, Ruey-Shyang; Tsay, Jwu-Guh; Huang, Yu-Fen; Chiou, Robin Y Y

    2002-05-01

    The Aspergillus flavus group covers species of A. flavus and Aspergillus parasiticus as aflatoxin producers and Aspergillus oryzae and Aspergillus sojae as koji molds. Genetic similarity among these species is high, and aflatoxin production of a culture may be affected by cultivation conditions and substrate composition. Therefore, a polymerase chain reaction (PCR)-mediated method of detecting the aflatoxin-synthesizing genes to indicate the degree of risk a genotype has of being a phenotypic producer was demonstrated. In this study, 19 strains of the A. flavus group, including A. flavus, A. parasiticus, A. oryzae, A. sojae, and one Aspergillus niger, were subjected to PCR testing in an attempt to detect four genes, encoding for norsolorinic acid reductase (nor-1), versicolorin A dehydrogenase (ver-1), sterigmatocystin O-methyltransferase (omt-1), and a regulatory protein (apa-2), involved in aflatoxin biosynthesis. Concurrently, the strains were cultivated in yeast-malt (YM) broth for aflatoxin detection. Fifteen strains were shown to possess the four target DNA fragments. With regard to aflatoxigenicity, all seven aflatoxigenic strains possessed the four DNA fragments, and five strains bearing less than the four DNA fragments did not produce aflatoxin. When peanut kernels were artificially contaminated with A. parasiticus and A. niger for 7 days, the contaminant DNA was extractable from a piece of cotyledon (ca. 100 mg), and when subjected to multiplex PCR testing using the four pairs of primers coding for the above genes, they were successfully detected. The target DNA fragments were detected in the kernels infected with A. parasiticus, and none was detected in the sound (uninoculated) kernels or in the kernels infected with A. niger.

  14. Pattern on Total Productive Maintenance in Supply Chain

    Institute of Scientific and Technical Information of China (English)

    汪蓉; 黄培; 季建华

    2003-01-01

    Defined as total productive maintenance carried out by all cooperators in Supply Chain, Total Operational Maintenance (TOM) focuses on adapting to collaborative business environment in virtue of Internet & Intranet. It focuses on the managerial ideology of embedded with Quick Response (QR),Total Productive Maintenance (TPM) and Supply Chain. And the theoretical architecture and implementation is also described. It offers emphatically that it is necessary to exceed competitive advantage of the enterprises by optimizing reliability, empowerment and Overall Facilities Effectiveness (OFE) applying TOM together into the strategic improvement plan.

  15. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Peter McInerney

    2014-01-01

    Full Text Available As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.

  16. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase.

    Science.gov (United States)

    McInerney, Peter; Adams, Paul; Hadi, Masood Z

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition. PMID:25197572

  17. Evaluation of IgG anti-toxoplasma avidity and polymerase chain reaction in the postnatal diagnosis of congenital toxoplasmosis.

    Science.gov (United States)

    Torres, Elizabeth; Rivera, Raul; Cardona, Nestor; Sanchez, Victor; Lora, Fabiana; Gómez-Marín, Jorge Enrique

    2013-06-01

    Confirmatory tests for congenital toxoplasmosis were evaluated in 23 infected and 31 uninfected newborns. Conventional polymerase chain reaction was better than real-time polymerase chain reaction, but did not identify additional cases. Avidity tests added 2 new cases that were not identified by other criteria. Overall sensitivity was 82.6%. Avidity assay, but not polymerase chain reaction, increased the sensitivity of confirmatory assays in congenital toxoplasmosis.

  18. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples.

    Science.gov (United States)

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.

    1998-03-01

    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  19. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  20. DETECTION OF PHENOL DEGRADING BACTERIA AND PSEUDOMONAS PUTIDA IN ACTIVATED SLUDGE BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen

    2009-04-01

    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  1. In Chains? Automotive Suppliers and Their Product Development Activities

    NARCIS (Netherlands)

    F. von Corswant; J.Y.F. Wynstra (Finn); M. Wetzels (Alex)

    2003-01-01

    textabstractA conceptual framework is developed and tested in which supplier downstream position in the supply chain, supplier innovation strategy and customer development commitment are seen as the antecedents of supplier product development activity. Using partial least squares (PLS), we analyze t

  2. Identifying Sustainability Issues for Soymeal and Beef Production Chains

    NARCIS (Netherlands)

    Pashaei Kamali, F.; Meuwissen, M.P.M.; Boer, de I.J.M.; Stolz, H.; Jahrl, I.; Garibay, S.V.; Jacobsen, R.; Driesen, T.; Oude Lansink, A.G.J.M.

    2014-01-01

    The expansion of livestock production throughout the world has led to increased demand for high protein animal feed. This expansion has created economic benefits for livestock farmers and other actors in the chain, but also resulted in environmental and social side effects. This study aims to identi

  3. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    Science.gov (United States)

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  4. HLA-DQA1 typing in Danes by two polymerase chain reaction (PCR) based methods

    DEFF Research Database (Denmark)

    Cowland, J B; Madsen, H O; Morling, N

    1995-01-01

    A total of 280 persons were HLA-DQA1 typed by two different polymerase chain reaction (PCR) based methods; (i) a reverse dot-blot (RDB) method, which can differentiate between six alleles, and (ii) a combined PCR-restriction fragment length polymorphism (PCR-RFLP) and allele-specific amplification...

  5. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    Science.gov (United States)

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  6. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...

  7. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.;

    2008-01-01

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple...

  8. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  9. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction

    NARCIS (Netherlands)

    J. Fan (Jun); W.Y. Zhang (Wen); Y.Y. Wu (Yu); X.Y. Jing (Xiou); E.C.J. Claas (Eric)

    1993-01-01

    textabstractThe aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The resul

  10. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  11. RAPID DETECTION OF Salmonella IN SHRIMP BY POLYMERASE CHAIN REACTION [Deteksi Cepat Salmonella pada Udang dengan Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ulfah Amalia

    2014-06-01

    Full Text Available Shrimp is an important non-oil commodity for foreign trade in Indonesia. However, rejection of shrimp exports by the importing countries is still commonly encountered. In 2011, the USFDA recorded two cases of Salmonella spp. contamination in shrimp products from two shrimp processing companies in Indonesia. Analysis of Salmonella spp. in seafood is generally performed using a conventional method which takes at least 5 days. The objective of the study is to get a Salmonellae rapid detection method in shrimp by PCR. In this study, optimization of PCR protocol method to detect Salmonella invA gene was conducted using six different annealing temperatures (59, 59.5, 60.8, 62, 64 and 64.5°C. The results showed that 64°C was the optimum annealing temperature to detect the 284 bp fragment of Salmonella invA gene. The PCR based detection method has a DNA detection limit of 27.81ug/mL and 10°CFU/mL of viable salmonellae with 100% specificity. The PCR protocol is capable of detecting six different Salmonella serovars (S. Enteritidis, S. Hadar, S. Heidelberg, S. Kentucky, S. Paratyphi and S. Typhimurium but none of the non salmonellae isolates. Application of the PCR assay on Salmonella in shrimp after the selective enrichment step suggested that all 16 samples were positive for Salmonella. At the same time, the conventional method could only detected 3 samples for Salmonella positive.

  12. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    Science.gov (United States)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  13. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    Institute of Scientific and Technical Information of China (English)

    Hwai-Jeng Lin; Wen-Ching Lo; Chin-Lin Perng; Guan-Ying Tseng; Anna Fen-Yau Li; Yueh-Hsing Ou

    2005-01-01

    AIM: Helicobacter pylori(Hpylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma.Conventional invasive tests are less sensitive than noninvasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers.METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test,histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of Hpylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2),iceA1,iceA2 and cag A.RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%)and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity,positive predictive value and diagnostic accuracy of mucosal polymerase reaction for Hpylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79%and 81%) than in

  14. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    Science.gov (United States)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-01

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  15. [The applications of thermostable ligase chain reaction in facilitating DNA recombination].

    Science.gov (United States)

    Xiangda, Zhou; Xiao, Song; Cong, Huai; Haiyan, Sun; Hongyan, Chen; Daru, Lu

    2016-02-01

    The traditional Type Ⅱ restriction enzyme-based method is restricted by the purification steps, and therefore, cannot be applied to specific DNA assembly in chaotic system. To solve this problem, Thermostable Ligase Chain Reaction (TLCR) was introduced in the process of DNA assembly and capture. This technique combines the feature of thermostable DNA ligase and sequence specific oligo ligation template, "Helper", to achieve specific assembly of target fragments and exponential increase of products in multiple thermocyclings. Two plasmid construction experiments were carried out in order to test the feasibility and practical performance of TLCR. One was that, TLCR was used to specifically capture a 1.5 kb fragment into vector from an unpurified chaotic system which contained 7 different sizes of fragments. The results showed that the capturing accuracy was around 80%, which proved the feasibility and accuracy of using TLCR to specific assembly of DNA fragments in a complicated mixed system. In the other experiment, TLCR was used to capture two fragments (total length was 27 kb) from Hind Ⅲ digestion of Lambda genome into vector by order. The results also showed an accuracy of around 80%. As demonstrated in the results, TLCR can simplify the process of DNA recombination experiments and is suitable for the assembly of multiple and large DNA fragments. This technique can provide convenience to biological experiments.

  16. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    Science.gov (United States)

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  17. Development and application of polymerase chain reaction test for detection of Conidiobolus lamprauges

    Directory of Open Access Journals (Sweden)

    Marcelo M. Silveira

    2013-12-01

    Full Text Available Conidiobolomycosis is a granulomatous disease caused by the fungus Conidiobolus spp. in humans and animals. Traditional technique for diagnosis of the disease is isolation of the agent associated with the presence of typical clinical signs and pathological conditions. The aim of this study was to describe the development of a specific polymerase chain reaction (PCR test for Conidiobolus lamprauges to detect the fungus in clinical samples. Samples from suspected animals were collected and submitted to isolation, histopathological analysis and amplification by PCR. DNA from tissues was subjected to PCR with fungi universal primers 18S rDNA gene, and specific primers were designed based on the same gene in C. lamprauges that generated products of about 540 bp and 222 bp respectively. The culture was positive in 26.6% of clinical samples. The PCR technique for C. lamprauges showed amplification of DNA from fresh tissues (80% and paraffin sections (44.4%. In conclusion, the PCR technique described here demonstrated a high sensitivity and specificity for detection of fungal DNA in tissue samples, providing a tool for the rapid diagnosis of C. lamprauges.

  18. Isolation and polymerase chain reaction-based identification of Riemerella anatipestifer from ducks in Kerala, India

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2014-10-01

    Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.

  19. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  20. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  1. A novel technique for measuring variations in DNA copy-number: competitive genomic polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Nakagawara Akira

    2007-07-01

    Full Text Available Background Changes in genomic copy number occur in many human diseases including cancer. Characterization of these changes is important for both basic understanding and diagnosis of these diseases. Microarrays have recently become the standard technique and are commercially available. However, it is useful to have an affordable technique to complement them. Results We describe a novel polymerase chain reaction (PCR-based technique, termed competitive genomic PCR (CGP. The main characteristic of CGP is that different adaptors are added to the sample and control genomic DNAs after appropriate restriction enzyme digestion. These adaptor-supplemented DNAs are subjected to competitive PCR using an adaptor-primer and a locus-specific primer. The amplified products are then separated according to size differences between the adaptors. CGP eliminates the tedious steps inherent in quantitative PCR and achieves moderate throughput. Assays with different X chromosome numbers showed that it can provide accurate quantification. High-resolution analysis of neuroblastoma cell lines around the MYCN locus revealed novel junctions for amplification, which were not detected by a commercial array. Conclusion CGP is a moderate throughput technique for analyzing changes in genomic copy numbers. Because CGP can measure any genomic locus using PCR primers, it is especially useful for detailed analysis of a genomic region of interest.

  2. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics.

    Science.gov (United States)

    Li, Yuyuan; Xing, Da; Zhang, Chunsun

    2009-02-01

    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  3. Analysis of polymorphism in the bovine casein genes by use of the polymerase chain reaction.

    Science.gov (United States)

    Pinder, S J; Perry, B N; Skidmore, C J; Savva, D

    1991-01-01

    Methods have been devised for detecting polymorphisms in the bovine beta- and kappa-casein genes using the polymerase chain reaction (PCR) followed either by restriction enzyme digestion (to reveal a restriction fragment length polymorphism (RFLP] or by hybridization of an allele-specific oligonucleotide. These methods, as well as being faster and more sensitive than traditional RFLP methods, are of more general applicability since they can detect any change in DNA sequence. They require only a small sample of blood or semen and are applicable to animals of any age or sex. These methods make possible large-scale screening and thus selection for alleles at these loci. Typing of blood DNA can give erroneous results when the animal concerned is a twin; however, this can be overcome by retesting using milk or semen. Analysis of the kappa-casein genotype of Holstein-Friesian bulls gives frequencies for the A and B alleles of 0.80 and 0.20 respectively. Selection in favour of the B allele, which is superior for cheese production, could thus have a large effect. The A3 and B alleles at the beta-casein locus have been shown to be rare in the Holstein-Friesian population. Linkage disequilibrium exists between beta-casein B and kappa-casein B.

  4. Chemicals in the process chain from raw material to product

    International Nuclear Information System (INIS)

    As described in this presentation, chemicals are added at various points along the physical flow from oil/gas well to sold products. They have several functions and are added in different amounts. The chemicals may have a negative impact on the environment by emission to sea. But they can also reduce the regularity of the processing equipment and the prices of the products. Therefore, Statoil has begun a research project that aims to develop improved methods and tools for the prediction of the distribution of chemicals in the process chain and the unwanted effects they might have on the environment, on downstream installations and on the products. 4 refs., 11 figs

  5. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

    OpenAIRE

    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

    2014-01-01

    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients.

  6. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.;

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  7. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjærg, Lars Stubbe; Hansen, J-ES; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...... hybridization. It was not possible to detect any viral antigen production in the cultures, and attempts to recover virus by highly sensitive coculture techniques were unsuccessful, indicating that the infection was latent. The PCR technique provides a simple approach to the study of viral infection in cases...

  8. Reactions of uranium hexafluoride photolysis products

    Science.gov (United States)

    Lyman, John L.; Laguna, Glenn; Greiner, N. R.

    1985-01-01

    This paper confirms that the ultraviolet photolysis reactions of UF6 in the B band spectral region is simple bond cleavage to UF5 and F. The photolysis products may either recombine to UF6 or the UF5 may dimerize, and ultimately polymerize, to solid UF5 particles. We use four methods to set an upper limit for the rate constant for recombination of kr<2.0×10-12cm3 molecule-1 s-1. We measure the rate constant for UF5 dimerization to be kd=(1.0±0.2)×10-11 cm3 molecule-1 s-1. The principal method employed in these studies is the use of diode lasers to monitor, in real time, the changes in density of the species UF6 and UF5 after laser photolysis of the UF6 gas sample.

  9. Comparison of different polymerase chain reaction-based approaches for clonality assessment of immunoglobulin heavy-chain gene rearrangements in B-cell neoplasia

    NARCIS (Netherlands)

    Derksen, P W; Langerak, A W; Kerkhof, E; Wolvers-Tettero, I L; Boor, P P; Mulder, A H; Vrints, L W; Coebergh, J W; van Krieken, J H; Schuuring, E; Kluin, P M; van Dongen, J J

    1999-01-01

    Several frequently applied polymerase chain reaction strategies for analysis of immunoglobulin heavy-chain gene rearrangements were compared by analyzing 70 B-cell lymphoproliferative disorders and 24 reactive lymphoid lesions. Southern blot analysis was used as the "gold standard" for clonality ass

  10. Matrix product states for su(2) invariant quantum spin chains

    Science.gov (United States)

    Zadourian, Rubina; Fledderjohann, Andreas; Klümper, Andreas

    2016-08-01

    A systematic and compact treatment of arbitrary su(2) invariant spin-s quantum chains with nearest-neighbour interactions is presented. The ground-state is derived in terms of matrix product states (MPS). The fundamental MPS calculations consist of taking products of basic tensors of rank 3 and contractions thereof. The algebraic su(2) calculations are carried out completely by making use of Wigner calculus. As an example of application, the spin-1 bilinear-biquadratic quantum chain is investigated. Various physical quantities are calculated with high numerical accuracy of up to 8 digits. We obtain explicit results for the ground-state energy, entanglement entropy, singlet operator correlations and the string order parameter. We find an interesting crossover phenomenon in the correlation lengths.

  11. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend;

    1991-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...... was minimized. The polymerase chain reaction detected a higher number of Chlamydia trachomatis infections among both symptomatic and asymptomatic females and males, and it also detected Chlamydia trachomatis at an earlier stage of infection when compared to cell culture. The polymerase chain reaction did...

  12. Evaluation of urogenital Chlamydia trachomatis infections by cell culture and the polymerase chain reaction using a closed system

    DEFF Research Database (Denmark)

    Østergaard, Lars; Traulsen, J; Birkelund, Svend;

    1993-01-01

    Two hundred and fifty-four specimens from males and females consulting a clinic for sexually transmitted diseases were analyzed for genital Chlamydia trachomatis infection. Each clinical sample was tested by the cell culture technique and the polymerase chain reaction using a closed system. When...... the two test systems were compared, the overall sensitivity of the polymerase chain reaction was 96% and the specificity 94% when compared to the cell culture technique. By use of a closed system for DNA extraction and sample transfer for the polymerase chain reaction, contamination of the samples...... was minimized. The polymerase chain reaction detected a higher number of Chlamydia trachomatis infections among both symptomatic and asymptomatic females and males, and it also detected Chlamydia trachomatis at an earlier stage of infection when compared to cell culture. The polymerase chain reaction did...

  13. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    Science.gov (United States)

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  14. Product Chain Action Plan tomato production in Kenya and Tanzania

    NARCIS (Netherlands)

    Visser, de C.L.M.

    2007-01-01

    With the importance of the field vegetable sector for Africa in mind and the constraints attached to that sector, the AfriVeg project (“Development of commercial field vegetable production, distribution and marketing for the East African market”) was developed by Wageningen UR to contribute to actio

  15. Sustainable Palm Oil Production For Bioenergy Supply Chain

    OpenAIRE

    Ng, Wai Kiat

    2009-01-01

    A bioenergy supply chain is formed by many parts which from the raw material, biomass feedstock until the distribution and utilisation. The upstream activity is always managed in a sustainable way in order to be capable enough to support the downstream activity. In this dissertation, the sustainable production of palm oil is focused and researched through problem identification and solving by using the operation management perspective and practices. At first, the global biomass industry is st...

  16. Single product scheduling and transportation optimization in a supply chain

    OpenAIRE

    Mouloua, Zérouk; Portmann, Marie-Claude

    2006-01-01

    In this paper we consider a basic supply chain composed of one or several suppliers that provide components needed by a manufacturer. The manufacturer has to deliver finished products to only one customer before given delivery dates. We first verify if the associated decision problem is feasible or not with unlimited transportation capacities. At this decision level we assume that for the components, the delivery dates and the associated quantities are known. We further integrate progressivel...

  17. Stackelberg Game for Product Renewal in Supply Chain

    Directory of Open Access Journals (Sweden)

    Yong Luo

    2013-01-01

    Full Text Available The paper studied the process of product renewal in a supply chain, which is composed of one manufacturer and one retailer. There are original product and renewal product in the supply chain. A market share shift model for renewal product was firstly built on a increment function and a shift function. Based on the model, the decision-making plane consisting of two variables was divided into four areas. Since the process of product renewal was divided into two stages, Stackelberg-Nash game model and Stackelberg-merger game model could be built to describe this process. The optimal solutions of product pricing strategy of two games were obtained. The relationships between renewal rate, cost, pricing strategy, and profits were got by numerical simulation. Some insights were obtained from this paper. Higher renewal rate will make participants’ profits and total profit increase at the same margin cost. What is more important, the way of the optimal decision making of the SC was that RP comes onto the market with a great price differential between OP and RP.

  18. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Santos, M S; Souza, E S; S Junior, R M; Talhari, S; Souza, J V B

    2010-08-01

    Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP). More specifically: a) to evaluate 3 different amplification regions, b) to investigate 3 different restriction enzymes, and c) to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2) were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel) produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas--FMTAM) were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  19. Sequencing on products of Oncomelania hupensis through simple sequence repeat anchored polymerase chain reaction amplification%湖北钉螺微卫星锚定PCR产物序列分析

    Institute of Scientific and Technical Information of China (English)

    郭俊涛; 周艺彪; 韦建国; 赵根明

    2008-01-01

    目的 分析4个种群湖北钉螺中微卫星序列及其两侧序列的特点.方法 以(CA)8RY为引物对湖北钉螺基因组DNA进行微卫星锚定PCR(SSR-PCR)扩增,对全部159个扩增产物进行T克隆并测定其中82个片段的核苷酸序列.结果 SSR-PCR的扩增产物是湖北钉螺基因组DNA上的散在区域,不是微卫星序列,但扩增产物中含有微卫星序列,测序的82个片段中36个克隆片段含有微卫星序列.微卫星序列其侧翼序列有一定的保守性,同一个微卫星的侧翼序列多数情况下是相同的.(GA/CT)n、(TTAGGG/CCCTAA)n两类微卫星在4个钉螺种群中均有发现,(CAA)n仅在福建福清种群中发现,(TCTCTG)n仅在安徽贵池种群中发现,(GAA~TTC)n、(CAA/TTG)n、(CAT)n三种微卫星序列仅在四川普格种群中发现.结论 SSR-PCR扩增的不是微卫星,其结果的分析应当类似于随机扩增多态性DNA.因此SSR-PCR不能十分有效体现微卫星作为分子标记的优势,应当根据微卫星的侧翼序列设计针对微卫星的引物,对微卫星进行PCR扩增并进行分析.%Objective To analyze the sequence of microsatellite and the flanking sequence from four populations of Oncomelania hupensis. Methods We cloned 159 SSR-PCR amplification products of a commonly used primer, (CA)8RY, using O. hupensis genomie DNA as template, and sequenced 82 products Results The sequences obtained were novel O. hupensis genomic sequences but not repeat simple sequence. It was observed that 36 out of 82 clones contained microsatellites between priming sites.The flanking sequences of certain microsatellite were invariant. Both (GA/CT). and (TTAGGG/CCCAA)n were found in four populations of O. hupensis. However, (CAA)n were found only in O. hupensis from Fuqing,Fujian province and (TCTCTG), were found only in O. hupensis from Guichi,Anhui province and (GAA/TTC)n, (CAA/TTG)n, (CAT), were found only in O.hupensis from Puge,Sichuan province. Conclusion The results obtained by

  20. Brazilian chicken meat production chain:a 10-year overview

    Directory of Open Access Journals (Sweden)

    IA Nääs

    2015-03-01

    Full Text Available Brazil is the world's largest broiler meat exporter. Health control, knowledge and technology, as well as the natural aspects of the country are pointed out as the keys for the success of that product in the market. Brazilian broiler production grew significantly in the last decade; it creates jobs and has a significant social role in Brazilian economy. This study aimed at evaluating the Brazilian broiler meat supply chain from 2000 to 2010 using the social network analysis (SNA. Data from governmental and private sources were organized and analyzed. The focus of this study was the broiler production supply chain segment involving the hatchery, the broiler farm, the feed mill, the processing plant, and the government. The inputs considered were one-day-old chicks, pullet, feedstuff, and the infrastructure; and the outputs were broiler meat and taxes paid. The software UCINET was applied for calculating the structural attributes and indicators of the network. Results showed a relatively disorganized network in 2000 with the strongest tie between the farmer and the processing plant. The structural organization of the network improved until 2010. The density of the ties in the broiler meat production network increased steadily from 2000 to 2010 within a vertical cohesive supply chain structure. The success of Brazilian broiler meat production is attributed to the abundance of land, fertile soil, favorable climate, and the effort and investments in research and development by innovative companies in the last few years. The results of the present study showed that Brazilian broiler production evolved positively in the last ten years, and it was weakly influenced by international challenges.

  1. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene.

    Science.gov (United States)

    Brakstad, O G; Aasbakk, K; Maeland, J A

    1992-07-01

    Synthetic oligonucleotide primers of 21 and 24 bases, respectively, were used in the polymerase chain reaction (PCR) to amplify a sequence of the nuc gene, which encodes the thermostable nuclease of Staphylococcus aureus. A DNA fragment of approximately 270 bp was amplified from lysed S. aureus cells or isolated DNA. The PCR product was detected by agarose gel electrophoresis or Southern blot analysis by using a 33-mer internal nuc gene hybridization probe. With S. aureus cells the lower detection limit was less than 10 CFU, and with the isolated target the lower detection limit was 0.69 pg of DNA. The primers recognized 90 of 90 reference or clinical S. aureus strains. Amplification was not recorded when 80 strains representing 16 other staphylococcal species were tested or when 20 strains representing 9 different nonstaphylococcal species were tested. Some of the non-S. aureus staphylococci produced thermostable nucleases but were PCR negative. The PCR product was generated when in vitro-cultured S. aureus was used to prepare simulated clinical specimens of blood, urine, cerebrospinal fluid, or synovial fluid. No PCR product was generated when the sterile body fluids were tested. However, the sensitivity of the PCR was reduced when S. aureus in blood or urine was tested in comparison with that when bacteria in saline were tested. With the bacteria in blood, the detection limit of the PCR was 10(3) CFU. A positive PCR result was recorded when a limited number of clinical samples from wounds verified to be infected with S. aureus were tested, while the PCR product was not detected in materials from infections caused by other bacteria. Generation of PCR products was not affected by exposure of S. aureus to bactericidal agents, including cloxacillin and gentamicin, prior to testing, but was affected by exposure to UV radiation. The PCR for amplification of the nuc gene has potential for the rapid diagnosis of S. aureus infections by direct testing of clinical

  2. Polymerase chain reaction assay for detection of Staphylococcus aureus in buffalo milk

    Directory of Open Access Journals (Sweden)

    V.K. Jain

    2010-02-01

    Full Text Available In India, Haryana has the world’s best dairy type buffalo, the Murrah capable of milk yields as high as 35 kg a day. Clinical and Sub clinical mastitis exerts a negative impact on milk quality, quantity and animal health and profits. In India, Staphylococci are the main causative agents responsible for mastitis of economic importance. Therefore, a suitable and specific test is required for the rapid diagnosis of Staphylococcus aureus. For definitive diagnosis of Staphylococcus aureus in mastitic milk, a polymerase chain reaction assay was developed using target sequence of 16S to 23S rRNA spacer region. This test can be performed within hours and avoids cumbersome and lengthy steps involved in microbiological culture of milk and biochemical tests. Polymerase chain reaction assay can be used as a screening test for a large herd to detect Staphylococcus aureus in milk.

  3. Polymerase chain reaction-based molecular diagnosis of cutaneous infections in dermatopathology.

    Science.gov (United States)

    Swick, Brian L

    2012-12-01

    Conventional methods, including microscopy, culture, and serologic studies, are a mainstay in the diagnosis of cutaneous infection. However, owing to limitations associated with these techniques, such as low sensitivity for standard microscopy and in the case of culture delay in diagnosis, polymerase chain-reaction based molecular techniques have taken on an expanding role in the diagnosis of infectious processes in dermatopathology. In particular, these assays are a useful adjunct in the diagnosis of cutaneous tuberculosis, atypical mycobacterial infection, leprosy, Lyme disease, syphilis, rickettsioses, leishmaniasis, and some fungal and viral infections. Already in the case of tuberculosis and atypical mycobacterial infection, standardized polymerase chain-reaction assays are commonly used for diagnostic purposes. With time, additional molecular-based techniques will decrease in cost and gain increased standardization, thus delivering rapid diagnostic confirmation for many difficult-to-diagnose cutaneous infections from standard formalin-fixed paraffin-embedded tissue specimens.

  4. Detection of Helicobacter pylori using nested polymerase chain reaction in gastric biopsy samples.

    Science.gov (United States)

    Mahajan, Divya; Jain, Anju; Singh, Varsha; Jain, A K; Rao, G R K; Nath, Gopal

    2008-07-01

    Helicobacter pylori remains a controversial organism with regards to humans, its epidemiology still unclear nearly two decades after discovery. The present study was undertaken to estimate the prevalence of the organism in the gastrointestinal tract in symptomatic and asymptomatic subjects to understand its precise natural history in India. A total of 154 specimens were a part of the study. These included gastric biopsies from peptic ulcer disease and Non ulcer dyspepsia subjects, as visualized on endoscopy, saliva and stool samples from apparently normal healthy adults. Nested polymerase chain reaction was performed using the primers Hp1, Hp2, Hp3 targeting 16S rRNA gene. A prevalence of 65.1%, 100%, 66.7%, and 73.3% respectively was observed by polymerase chain reaction. No association was observed between the H.pylori status and the disease condition of the patient. PMID:23105762

  5. Quantitative interpretation to the chain mechanism of free radical reactions in cyclohexane pyrolysis

    Institute of Scientific and Technical Information of China (English)

    Yingxian Zhao; Bo Shen; Feng Wei

    2011-01-01

    Pyrolysis of cyclohexane was conducted with a plug flow tube reactor in the temperature range of 873-973 K.Based on the experimental data,the mechanism and kinetic model of cyclohexane pyrolysis reaction were proposed.The kinetic analysis shows that overall conversion of cyclohexane is a first order reaction,of which the rate constant increased from 0.0086 to 0.0225 to 0.0623 s- 1 with the increase of temperature from 873 to 923 to 973 K,and the apparent activation energy was determined to be 155.0+1.0 kJ.mo1-1.The mechanism suggests that the cyclohexane is consumed by four processes:the homolysis of C-C bond (Path Ⅰ),the homolysis of C-H bond (Path Ⅱ) in reaction chain initiation,the H-abstraction of various radicals from the feed molecules in reaction chain propagation (Path Ⅲ),and the process associated with coke formation (Path Ⅳ).The reaction path probability (RPP) ratio of Xpath Ⅰ ∶ Xpath Ⅱ∶ XPath Ⅲ ∶ XPath Ⅳ was 0.5420 ∶ 0.0045 ∶ 0.3897 ∶ 0.0638 at 873 K,and 0.4336 ∶ 0.0061 ∶ 0.4885 ∶ 0.0718 at 973 K,respectively.

  6. Instability Criterion of One-Dimensional Detonation Wave with Three-Step Chain Branching Reaction Model

    Institute of Scientific and Technical Information of China (English)

    TENG Hong-Hui; JIANG Zong-Lin

    2011-01-01

    @@ One-dimensional detonation waves are simulated with the three-step chain branching reaction model, and the instability criterion is studied.The ratio of the induction zone length and the reaction zone length may be used to decide the instability, and the detonation becomes unstable with the high ratio.However, the ratio is not invariable with different heat release values.The critical ratio, corresponding to the transition from the stable detonation to the unstable detonation, has a negative correlation with the heat release.An empirical relation of the Chapman-Jouguet Mach number and the length ratio is proposed as the instability criterion.

  7. Digital polymerase chain reaction in an array of femtoliter polydimethylsiloxane microreactors.

    Science.gov (United States)

    Men, Yongfan; Fu, Yusi; Chen, Zitian; Sims, Peter A; Greenleaf, William J; Huang, Yanyi

    2012-05-15

    We developed a simple, compact microfluidic device to perform high dynamic-range digital polymerase chain reaction (dPCR) in an array of isolated 36-femtoliter microreactors. The density of the microreactors exceeded 20000/mm(2). This device, made from polydimethylsiloxane (PDMS), allows the samples to be loaded into all microreactors simultaneously. The microreactors are completely sealed through the deformation of a PDMS membrane. The small volume of the microreactors ensures a compact device with high reaction efficiency and low reagent and sample consumption. Future potential applications of this platform include multicolor dPCR and massively parallel dPCR for next generation sequencing library preparation. PMID:22482776

  8. Evaluation of Neutron Induced Reactions for 32 Fission Products

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyeong Il

    2007-02-15

    Neutron cross sections for 32 fission products were evaluated in the neutron-incident energy range from 10{sup -5} eV to 20 MeV. The list of fission products consists of the priority materials for several applications, extended to cover complete isotopic chains for three elements. The full list includes 8 individual isotopes, {sup 95}Mo, {sup 101}Ru, {sup 103}Rh, {sup 105}Pd, {sup 109}Ag, {sup 131}Xe, {sup 133}Cs, {sup 141}Pr, and 24 isotopes in complete isotopic chains for Nd (8), Sm (9) and Dy (7). Our evaluation methodology covers both the low energy region and the fast neutron region.In the low energy region, our evaluations are based on the latest data published in the Atlas of Neutron Resonances. This resource was used to infer both the thermal values and the resolved resonance parameters that were validated against the capture resonance integrals. In the unresolved resonance region we performed the additional evaluation by using the averages of the resolved resonances and adjusting them to the experimental data.In the fast neutron region our evaluations are based on the nuclear reaction model code EMPIRE-2.19 validated against the experimental data. EMPIRE is the modular system of codes consisting of many nuclear reaction models, including the spherical and deformed Optical Model, Hauser-Feshbach theory with the width fluctuation correction and complete gamma-ray emission cascade, DWBA, Multi-step Direct and Multi-step Compound models, and several versions of the phenomenological preequilibrium models. The code is equipped with a power full GUI, allowing an easy access to support libraries such as RIPL and CSISRS, the graphical package, as well the utility codes for formatting and checking. In general, in our calculations we used the Reference Input Parameter Library, RIPL, for the initial set model parameters. These parameters were properly adjusted to reproduce the available experimental data taken from the CSISRS library. Our evaluations cover cross

  9. Markov Chain for Reuse Strategies of Product Families

    Institute of Scientific and Technical Information of China (English)

    LUO Jia; JIANG Lan

    2007-01-01

    A methodology is presented to plan reuse strategies of common modules in a product family by using the concepts of function degradation, reliability, function requirement, cost and life time. Markov chain model is employed to predict function degradation and reliability. A utility model is used to evaluate the preference between used modules and new modules. An example of cascading-requirment product family illustrates the main ideas of our work. The Markov models are used effectively to predict function degradation and reliability. Utility theory is helpful to evaluate the reuse options of common modules.

  10. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  11. STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Honcharova S.Y.

    2015-08-01

    Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

  12. Exploiting the tetrazine-norbornene reaction for single polymer chain collapse.

    Science.gov (United States)

    Hansell, Claire F; Lu, Annhelen; Patterson, Joseph P; O'Reilly, Rachel K

    2014-04-21

    Single chain polymer nanoparticles (SCNPs) have been formed using polystyrenes decorated with pendent norbornenes and a bifunctional tetrazine crosslinker. Characterisation by size exclusion chromatography and (1)H NMR gives evidence for the formation of SCNPs by the tetrazine-norbornene reaction, whilst light scattering, neutron scattering, transmission electron microscopy and atomic force microscopy show that discrete well-defined nanoparticles are formed and their size in solution calculated.

  13. A polymerase chain reaction assay to determine infection of Aedes polynesiensis by Wuchereria bancrofti

    OpenAIRE

    Nicolas, L.; Luquiaud, P.; Lardeux, Frédéric; Mercer, D.R.

    1996-01-01

    The sensitivity of a previously described polymerase chain reaction (PCR) assay was improved to detect a single mosquito, infected by as few as 1-2 microfilariae of #Wuchereria bancrofti$, among 20-50 uninfected mosquitoes. Wild-caught #Aedes polynesiensis$ were used to compare assessment of infection by dissection of individuals with the PCR assay of pools of mosquitoes. The PCR assay was at least as sensitive as dissection for detection of mosquitoes infected with #W. bancrofti$. (Résumé d'...

  14. High-speed droplet-allele-specific polymerase chain reaction for genotyping of single nucleotide polymorphisms.

    Science.gov (United States)

    Matsuda, Kazuyuki; Honda, Takayuki

    2015-01-01

    Single nucleotide alternations such as single nucleotide polymorphisms (SNPs) or single nucleotide mutations are useful genetic markers for molecular diagnosis, prognosis, drug response, and predisposition to diseases. Rapid identification of SNPs or mutations is clinically important, especially for determining drug responses and selection of molecular-targeted therapy. Here, we describe a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) by using our droplet-PCR machine (droplet-AS-PCR).

  15. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard;

    2015-01-01

    Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...

  16. Preliminary evaluation of the ligase chain reaction for specific detection of Neisseria gonorrhoeae.

    OpenAIRE

    Birkenmeyer, L; Armstrong, A S

    1992-01-01

    Rapid identification of Neisseria gonorrhoeae in clinical specimens is essential for effective control. Traditional culture requires a minimum of 24 h, and for some specimens harboring gonococci, the gonococci fail to grow or are misidentified. The recently described ligase chain reaction (LCR) is a highly specific and sensitive DNA amplification technique which was evaluated as an alternative to routine culture. Three LCR probe sets were used. Two of the probe sets were directed against the ...

  17. Chosen aspects of evaluation of productive processes on the example of productive chains of gear

    Directory of Open Access Journals (Sweden)

    M. Roszak

    2005-12-01

    Full Text Available Purpose: The purpose of the study was to present an original approach to evaluation of the real productive chains, including its utilization as a benchmarking method.Design/methodology/approach: In the paper an analysis of value in the productive chains with account of activities based costs was used. The evaluation of the effectivity was made by econometric coefficients.Findings: The paper presents obtained particular results of the analysis of value in the productive chains indicating effectivity of their solutions’ realization.Research limitations/implications: Limitations of the study are associated with particularity of defining of costs of particular operations.Practical implications: Presented method of evaluation of the productive chains gives possibility to assess effectivity of the realized activities.Originality/value: This method is based on the methodology by L.D.Miles and M.E.Porter.

  18. Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

    International Nuclear Information System (INIS)

    Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

  19. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  20. Detection of variable DNA repeats in diverse eukaryotic microorganisms by a single set of polymerase chain reaction primers.

    Science.gov (United States)

    Riley, D E; Samadpour, M; Krieger, J N

    1991-12-01

    We cloned and sequenced a variable DNA repeat from Trichomonas vaginalis, a flagellated protozoan parasite. Targeting of this repeat in the polymerase chain reaction resulted in complex and intense product patterns for a wide variety of eukaryotic microorganisms, including the pathogenic protozoan parasites T. vaginalis, Giardia lamblia, Leishmania donovani, three species of Trypanosoma, and four species of Acanthamoeba; the nonpathogenic protozoans, Paramecium tetraurelia and Tetrahymena thermophilia; and a yeast, Saccharomyces cerevisiae. Each microorganism exhibited a distinctive pattern of repeats. For example, a characteristic pattern was exhibited by six clinical T. vaginalis isolates. Eight G. lamblia isolates exhibited either one of two characteristic pattern types. There was no reaction with human DNA or DNA from the prokaryotes Ureaplasma urealyticum and Mycoplasma hominis. This approach may facilitate detection of a wide variety of eukaryotic microorganisms by use of a single primer set and holds promise for the development of typing schemes for both T. vaginalis and G. lamblia. PMID:1757544

  1. Long-chain alkane production by the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Buijs, Nicolaas A; Zhou, Yongjin J; Siewers, Verena; Nielsen, Jens

    2015-06-01

    In the past decade industrial-scale production of renewable transportation biofuels has been developed as an alternative to fossil fuels, with ethanol as the most prominent biofuel and yeast as the production organism of choice. However, ethanol is a less efficient substitute fuel for heavy-duty and maritime transportation as well as aviation due to its low energy density. Therefore, new types of biofuels, such as alkanes, are being developed that can be used as drop-in fuels and can substitute gasoline, diesel, and kerosene. Here, we describe for the first time the heterologous biosynthesis of long-chain alkanes by the yeast Saccharomyces cerevisiae. We show that elimination of the hexadecenal dehydrogenase Hfd1 and expression of a redox system are essential for alkane biosynthesis in yeast. Deletion of HFD1 together with expression of an alkane biosynthesis pathway resulted in the production of the alkanes tridecane, pentadecane, and heptadecane. Our study provides a proof of principle for producing long-chain alkanes in the industrial workhorse S. cerevisiae, which was so far limited to bacteria. We anticipate that these findings will be a key factor for further yeast engineering to enable industrial production of alkane based drop-in biofuels, which can allow the biofuel industry to diversify beyond bioethanol.

  2. Effect of Pozzolanic Reaction Products on Alkali-silica Reaction

    Institute of Scientific and Technical Information of China (English)

    WEI Fengyan; LAN Xianghui; LV Yinong; XU Zhongzi

    2006-01-01

    The effect of fly ash on controlling alkali-silica reaction (ASR) in simulated alkali solution was studied. The expansion of mortar bars and the content of Ca(OH)2 in cement paste cured at 80 ℃ for 91 d were measured. Transmission electron microscopy (TEM) and high-resolution transmission electron microscopy (HRTEM) were employed to study the microstructure of C-S-H. TEM/energy dispersive spectroscopy (EDS) was then used to determine the composition of C-S-H. The pore structure of the paste was analyzed by mercury intrusion porosimetry (MIP). The results show that the contents of fly ash of 30% and 45% can well inhibit ASR. And the content of Ca(OH)2 decreases with the increase of fly ash. That fly ash reacted with Ca(OH)2 to produce C-S-H with a low Ca/Si molar ratio could bind more Na+ and K+ ions, and produce a reduction in the amount of soluble alkali available for ASR. At the same time, the C-S-H produced by pozzolanic reaction converted large pores to smaller ones (gel pores smaller than 10 nm) to densify the pore structure. Perhaps that could inhibit alkali transport to aggregate for ASR.

  3. Dynamics of interfacial reactions between O({sup 3} P) atoms and long-chain liquid hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Allan, Mhairi [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Bagot, Paul A J [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Koehler, Sven P K [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Reed, Stewart K [Department of Physics and Astronomy, University of Edinburgh, The King' s Buildings, Edinburgh EH9 3JZ (United Kingdom); Westacott, Robin E [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); Costen, Matthew L [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom); McKendrick, Kenneth G [School of Engineering and Physical Sciences, Heriot-Watt University, Edinburgh EH14 4AS (United Kingdom)

    2007-09-15

    Recent progress that has been made towards understanding the dynamics of collisions at the gas-liquid interface is summarized briefly. We describe in this context a promising new approach to the experimental study of gas-liquid interfacial reactions that we have introduced. This is based on laser-photolytic production of reactive gas-phase atoms above the liquid surface and laser-spectroscopic probing of the resulting nascent products. This technique is illustrated for reaction of O({sup 3}P) atoms at the surface of the long-chain liquid hydrocarbon squalane (2,6,10,15,19,23-hexamethyltetracosane). Laser-induced fluorescence detection of the nascent OH has revealed mechanistically diagnostic correlations between its internal and translational energy distributions. Vibrationally excited OH molecules are able to escape the surface. At least two contributions to the product rotational distributions are identified, confirming and extending previous hypotheses of the participation of both direct and trapping-desorption mechanisms. We speculate briefly on future experimental and theoretical developments that might be necessary to address the many currently unanswered mechanistic questions for this, and other, classes of gas-liquid interfacial reaction.

  4. Inhibition of zinc-dependent peptidases by Maillard reaction products

    OpenAIRE

    Missagia de Marco, Leticia

    2015-01-01

    The Maillard reaction is a network of different non-enzymatic reactions between carbonyl groups of reducing sugars and amino groups from amino acids, peptides, or proteins, which progresses in three major stages and originates a very heterogeneous mixture of reaction products. It is also known as non-enzymatic browning, due to the brown macromolecular pigments formed in the final stage of the reaction. The chemistry underlying the Maillard reaction is complex. It encloses not only one reactio...

  5. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  6. Supply Chain Management of a Modular Product with Returns

    DEFF Research Database (Denmark)

    Ulku, M. Ali; Hsuan, Juliana; Yu, Dennis

    Modularity and returns relate to sustainability. In a retailer-manufacturer setting and when the demand for a returnable product depends on both price and modularity level, we develop a profit-maximizing stochastic model. The solution includes optimal expressions for the price, and the order quan...... quantity. We derive managerial insights from our structural and numerical results relating to the management of such a perishable product and its implications on sustainable supply chain management.......Modularity and returns relate to sustainability. In a retailer-manufacturer setting and when the demand for a returnable product depends on both price and modularity level, we develop a profit-maximizing stochastic model. The solution includes optimal expressions for the price, and the order...

  7. An overview on the Brazilian orange juice production chain

    Directory of Open Access Journals (Sweden)

    Renato Marcio dos Santos

    2013-03-01

    Full Text Available Brazil is the world's largest producer of oranges and uses more than 70% of the harvested fruits in the production of juices. The amount of processed orange is growing about 10% per year, confirming the trend of the Brazilian citrus for juice production. This research aimed to investigate the Brazilian orange juice production chain from 2005 to 2009. Data from the amount of frozen juice produced and exported, international price of orange juice, and intermediate transactions were assessed in order to make possible selection of all interveners involved in the chain. The study using the Social Network Analysis (SNA showed that the densest relationships in the network are from exporters to importers and from orange growers to the orange processing industry. No difference was found in the values of the network geodesic distance or the clustering coefficients from 2005 to 2009. The degree of centrality increased steadily throughout the years indicating that the processing industry attempts to minimize the risks by centralizing the actions. A decrease in export of orange juice from 2007 (2.07 10(6 t to 2008 (2.05 10(6 t was found, probably due to the world's financial crisis with recovery in 2009. Since 2004, there has been an increase of nearly 10% per year in the market preference of concentrate juice (OFCJ when compared to the "not from concentrated" juice (NFC. Nowadays the NFC market represents nearly 50% of all Brazilian export which impacted in the logistic distribution and transportation issues.

  8. Dietary Maillard reaction products: implications for human health and disease

    OpenAIRE

    Ames, Jenny

    2009-01-01

    When foods are heat processed, the sugars and lipids react with the proteins they contain via the Maillard and related reactions to form a wide range of products. As a result, the sensory, safety, nutritional and health-promoting attributes of the foods are affected. Reaction products include advanced glycation/lipoxidation endproducts (AGE/ALEs), acrylamide and heterocyclic amines (HAA), all of which may impact on human health and disease. Furthermore, some Maillard reaction products affect ...

  9. Novel assay of competitively differentiated polymerase chain reaction for screening point mutation of hepatitis B virus

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Xue-Juan Chen; Jian-Guo Li; Lin Gu; Yang-Su Huang; Zhi-Liang Gao

    2003-01-01

    AIM: Point mutation, one of the commonest gene mutations,is the most important molecular pathogenesis of cancer and chronic infection. The commonest methods for detection of point mutation are based on polymerase chain reaction (PCR). These techniques, however, cannot be used in large scale screening since they are neither accurate nor simple.For this reason, this study established a novel method of competitively differentiated PCR (CD-PCR) for screening point mutation in clinical practice.METHODS: Two competitively differentiated primers for mutant-type and wild-type templates respectively with an identically complemented region in 3′ end except for last 2base pairs and a different non-complemented region in 5′end were designed. Thus, competitive amplification might be carried out at a lower annealing temperature at first, and then differentiated amplification at a higher annealing temperature when primers could not combine with initial templates. The amplification was performed in one-tube.The products of CD-PCR were detected using microplate hybridization assay. CD-PCR was evaluated by detecting G1896A variant of hepatitis B virus (HBV) in form of recombinant plasmids and in sera from patients with hepatitis B, and compared with allele-specific PCR (AS-PCR) and competitive AS-PCR.RESULTS: CD-PCR was successfully established. It could clearly distinguish wild-type and mutant-type plasmid DNA of G1896A variant when the amount of plasmid DNA was between 102-108copies/reaction, while for AS-PCR and competitive AS-PCR, the DNA amount was between 102-104copies/reaction. CD-PCR could detect one copy of G1896A variant among 10-100 copies of wild-type plasmid DNA. The specificity of CD-PCR was higher than those of AS-PCR and competitive AS-PCR in the detection of HBV G1896A variant in sera from patients with hepatitis B. CD-PCR was independent of the amount of HBV DNA in serum. HBV G1896A variant was more often found in HBeAg (-) patients with a lower level of

  10. An optimized polymerase chain reaction assay to identify avian virus vaccine contamination with Chicken anemia virus.

    Science.gov (United States)

    Amer, Haitham M; Elzahed, Hanan M; Elabiare, Elham A; Badawy, Ahmed A; Yousef, Ausama A

    2011-01-01

    The use of embryonating chicken eggs in preparation of avian virus vaccines is the principle cause for contamination with Chicken anemia virus (CAV). Identification of CAV in contaminated vaccines relies on the expensive, tedious, and time-consuming practice of virus isolation in lymphoblastoid cell lines. The experience of the last 2 decades indicates that polymerase chain reaction is extending to replace most of the classic methods for detection of infectious agents. In the present report, a simple, rapid, and accurate polymerase chain reaction method for detection of CAV in poultry vaccines is described. Oligonucleotide primers homologous to highly conserved sequences of the VP1 gene were used to amplify a fragment of 676 bp. The developed assay was specific for detecting CAV from different sources, with no cross reactivity with many avian viruses. No inter- and intra-assay variations were observed. The analytical sensitivity of the test was high enough to detect 5 TCID(50) (50% tissue culture infective dose) of the virus per reaction; however, different factors related to the vaccine matrix showed considerable effects on the detection limit. In conclusion, this method may represent a suitable alternative to virus isolation for identification of CAV contamination of poultry virus vaccines.

  11. Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wei-Ping Qian; Li-Ka Shing; Yue-Qiu Tan; Ying Chen; Ying Peng; Zhi Li; Guang-Xiu Lu; Marie C. Lin; Hsiang-Fu Kung; Ming-Ling He

    2005-01-01

    AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen.METHODS: Hepatitis B viral DNA was isolated from HBV carriers' semen and sera using phenol extraction method and QTAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction.RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5×107 and 1.67×107 copies of HBV DNA per mL in two HBV infected patients' sera, while 2.L4×105 and 3.02×105 copies of HBV DNA per mL in the semen.CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen.

  12. Is the Reaction of C3N(-) with C2H2 a Possible Process for Chain Elongation in Titan's Ionosphere?

    Science.gov (United States)

    Lindén, Fredrik; Alcaraz, Christian; Ascenzi, Daniela; Guillemin, Jean-Claude; Koch, Leopold; Lopes, Allan; Polášek, Miroslav; Romanzin, Claire; Žabka, Jan; Zymak, Illia; Geppert, Wolf D

    2016-07-14

    The reaction of C3N(-) with acetylene was studied using three different experimental setups, a triple quadrupole mass spectrometer (Trento), a tandem quadrupole mass spectrometer (Prague), and the "CERISES" guided ion beam apparatus at Orsay. The process is of astrophysical interest because it can function as a chain elongation mechanism to produce larger anions that have been detected in Titan's ionosphere by the Cassini Plasma Spectrometer. Three major products of primary processes, C2H(-), CN(-), and C5N(-), have been identified, whereby the production of the cyanide anion is probably partly due to collisional induced dissociation. The formations of all these products show considerable reaction thresholds and also display comparatively small cross sections. Also, no strong signals of anionic products for collision energies lower than 1 eV have been observed. Ab initio calculations have been performed to identify possible pathways leading to the observed products of the title reaction and to elucidate the thermodynamics of these processes. Although the productions of CN(-) and C5N(-) are exoergic, all reaction pathways have considerable barriers. Overall, the results of these computations are in agreement with the observed reaction thresholds. Due to the existence of considerable reaction energy barriers and the small observed cross sections, the title reaction is not very likely to play a major role in the buildup of large anions in cold environments like the interstellar medium or planetary and satellite ionospheres. PMID:27135984

  13. The moderating effect of product complexity on new product development and supply chain management integration

    NARCIS (Netherlands)

    Caniato, F.; Grössler, A.

    2015-01-01

    The purpose of this study is to investigate whether product complexity moderates the impact of integration programs in both new product development (NPD) and supply chain (SC) management on operational performance. Results are based on statistical analyses of data collected from an international sam

  14. Effect of parity on productivity and sustainability of Lotka-Volterra food chains: bounded orbits in food chains.

    Science.gov (United States)

    Massarelli, Nicole; Hoffman, Kathleen; Previte, Joseph P

    2014-12-01

    Hairston, Slobodkin, and Smith conjectured that top down forces act on food chains, which opposed the previously accepted theory that bottom up forces exclusively dictate the dynamics of populations. We model food chains using the Lotka-Volterra predation model and derive sustainability constants which determine which species will persist or go extinct. Further, we show that the productivity of a sustainable food chain with even trophic levels is predator regulated, or top down, while a sustainable food chain with odd trophic levels is resource limited, which is bottom up, which is consistent with current ecological theory. PMID:24362648

  15. Effect of parity on productivity and sustainability of Lotka-Volterra food chains: bounded orbits in food chains.

    Science.gov (United States)

    Massarelli, Nicole; Hoffman, Kathleen; Previte, Joseph P

    2014-12-01

    Hairston, Slobodkin, and Smith conjectured that top down forces act on food chains, which opposed the previously accepted theory that bottom up forces exclusively dictate the dynamics of populations. We model food chains using the Lotka-Volterra predation model and derive sustainability constants which determine which species will persist or go extinct. Further, we show that the productivity of a sustainable food chain with even trophic levels is predator regulated, or top down, while a sustainable food chain with odd trophic levels is resource limited, which is bottom up, which is consistent with current ecological theory.

  16. Collaborative production planning between supply chain partners by Lagrangian relaxation

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    A collaborative planning framework based on the Lagrangian Relaxation was developed to coordinate and optimize the production planning of independent partners in multiple tier supply chains. Linking constraints and dependent demand constraints were added to the monolithic Multi-Level, multi-item Capacitated Lot Sizing Problem (MLCLSP). MLCLSP was Lagrangian relaxed and decomposed into facility-separable subproblems.Surrogate gradient algorithm was used to update Lagrangian multipliers, which coordinate decentralized decisions of the facilities. Production planning of independent partners could be appropriately coordinated and optimized by this framework without intruding their decision authorities and private information. Experimental results show that the proposed coordination mechanism and procedure come close to optimal results as obtained by central coordination.

  17. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    1993-01-01

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  18. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline;

    2015-01-01

    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma...

  19. Maillard reaction products in pet foods

    OpenAIRE

    Rooijen, van, J.

    2015-01-01

    Pet dogs and cats around the world are commonly fed processed commercial foods throughout their lives. Often heat treatments are used during the processing of these foods to improve nutrient digestibility, shelf life, and food safety. Processing is known to induce the Maillard reaction, in which a reducing sugar binds to a free reactive amino group of an amino acid. In intact proteins, the ε-amino group of lysine is the most abundant free amino group. The reaction reduces the bioavail...

  20. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping, E-mail: dianping.tang@fzu.edu.cn

    2013-06-14

    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling.

  1. Genome editing. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations.

    Science.gov (United States)

    Gantz, Valentino M; Bier, Ethan

    2015-04-24

    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype, whereas individuals homozygous for two copies of the allele will display a mutant phenotype. We have developed a method called the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome-editing system for generating autocatalytic mutations, to produce homozygous loss-of-function mutations. In Drosophila, we found that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome, thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  2. Diagnosis of Dengue by Using Reverse Transcriptase-Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Miagostovich Marize Pereira

    1997-01-01

    Full Text Available A rapid identification of dengue viruses from clinical samples by using a nested reverse transcriptase-polymerase chain reaction (RT-PCR procedure was carried out for diagnostic and epidemiological purposes. RT-PCR identified DEN-1 and DEN-2 viruses in 41% (41/100 of previously confirmed cases and provided an accurate confirmation of DHF in four fatal cases. RT-PCR was also useful for detecting and typing dengue viruses in suspected cases, allowing a rapid identification of new serotypes in endemic areas

  3. A polymerase chain reaction protocol for the detection of various geographical isolates of white spot virus.

    Science.gov (United States)

    Tapay, L M; Nadala, E C; Loh, P C

    1999-09-01

    Polymerase chain reaction (PCR) primers were designed based on the sequence of a cloned fragment of the white spot virus (WSV) genome and were used to detect at least four geographic isolates of WSV from both experimentally- and naturally-infected shrimp. In addition to high specificity, the one-step and two-step PCR protocols were determined to have sensitivities of 10-100 pg and 100 femtograms respectively. The two-step PCR protocol is recommended as a very sensitive and specific alternative protocol to Western blot assay for the detection of WSV.

  4. Characterization of a nested polymerase chain reaction assay for detection of parvovirus B19.

    OpenAIRE

    Patou, G.; Pillay, D.; Myint, S; Pattison, J.

    1993-01-01

    The characterization and application of a nested polymerase chain reaction (PCR) assay for the detection of human parvovirus B19 DNA is described. The assay was evaluated with 149 diagnostic serum samples (collected up to 150 days after the onset of symptoms) previously tested by dot blot hybridization for B19 DNA and by class-specific capture radioimmunoassays for the detection of B19 immunoglobulin M (IgM) and IgG. B19 DNA was detectable by the PCR in 70% of the sera. There was a statistica...

  5. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    OpenAIRE

    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini

    2008-01-01

    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  6. [Detection of leptospirosis reservoirs in Madagascar using the polymerase chain reaction technique].

    Science.gov (United States)

    Ralaiarijaona, R L; Bellenger, E; Chanteau, S; Roger, F; Pérolat, P; Rasolofo Razanamparany, V

    2001-01-01

    A polymerase chain reaction (PCR) technique was used for detection of the Leptospira interrogans rrs gene in kidney tissue from 115 rats, 50 zebu cattles and 13 pigs in an attempt to identify a possible animal reservoir of leptospirosis in Madagascar. In addition, serological testing of 105 individuals in close contact with animals was carried out. The PCR analysis was negative for all the samples tested and only one person was found seropositive at a low titer. The findings suggest that leptospirosis, if prevalent in Madagascar, is likely rare.

  7. [Identification of the causative agents of glanders and melioidosis by polymerase chain reaction].

    Science.gov (United States)

    Tkachenko, G A; Antonov, V A; Zamaraev, V S; Iliukhin, V I

    2003-01-01

    Burkholderia mallei and B. pseudomallei are causative agents of glanders and melioidosis, respectively, i.e. severe and fatal infection diseases of man and animal. The computer-based analysis of the 23S rRNA gene sites was used for selecting the primers. Two pairs of primers were chosen for the identification of B. mallei and Bpseudomallei. DNAs from 48 B. pseudomallei and 15 strains of B. mallei, unlike from other geterological bacteria, were positively amplified. Therefore, the method of polymerase chain reaction can be used in laboratory diagnosis of glanders and melioidosis.

  8. Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

    DEFF Research Database (Denmark)

    Skøt, J; Lerche, A G; Kolmos, H J;

    1995-01-01

    To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

  9. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan

    2004-01-01

    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  10. Development and validation of a Myxoma virus real-time polymerase chain reaction assay

    OpenAIRE

    Albini, S.; Sigrist, B; Guttinger, R; Schelling, C.; Hoop, R K; Vogtlin, A

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  11. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    Science.gov (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  12. Use of polymerase chain reaction for detection of Listeria monocytogenes in food.

    OpenAIRE

    Niederhauser, C; Candrian, U; Höfelein, C; M. Jermini; Bühler, H P; Lüthy, J

    1992-01-01

    A previously described polymerase chain reaction (PCR) assay (B. Furrer, U. Candrian, C. Höfelein, and J. Lüthy, J. Appl. Bacteriol. 70:372-379, 1991) was used to analyze food for the presence of Listeria monocytogenes. Food samples were artificially contaminated to develop two procedures to detect the organism following enrichment steps. Procedure A was based on dilution of the enrichment broth followed by lysis of the bacteria and direct analysis of the lysate with PCR. With procedure A and...

  13. Rapid detection of Helicobacter pylori in gastric biopsy material by polymerase chain reaction.

    OpenAIRE

    Hammar, M.; Tyszkiewicz, T; Wadström, T.; O'Toole, P W

    1992-01-01

    By using primers based on the sequence of a species-specific antigen of Helicobacter pylori (P. O'Toole, S.M. Logan, M. Kostrzynska. T. Wadström, and T.J. Trust, J. Bacteriol. 173:505-513, 1991), a protocol was established for detection of this microorganism in gastric biopsy samples by the polymerase chain reaction (PCR). A single primer pair was used to specifically amplify a 298-bp sequence in a rapid two-step PCR. The primers exhibited the same specificity in PCR as that which we reported...

  14. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    Science.gov (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples.

  15. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction

    OpenAIRE

    Alexandrakis, G.; JALALI, S; Gloor, P

    1998-01-01

    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In o...

  16. A Novel Nested Polymerase Chain Reaction (n-PCR) Assay for Identifying Sorghum nitidum

    OpenAIRE

    Wei, Shasha; Zhirui DENG; Liping YIN; Yi, Jianping; Renqi WU; Qin CHEN

    2011-01-01

    This work developed a novel nested polymerase chain reaction (n-PCR) assay to identify Sorghum nitidum (S. nitidum). It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band ...

  17. Specific detection of the toxic shock syndrome toxin-1 gene using the polymerase chain reaction.

    Science.gov (United States)

    Jaulhac, B; Prevost, G; Piemont, Y

    1991-08-01

    A rapid and specific assay for toxic shock syndrome toxin-1 gene (tst gene) detection in Staphylococcus aureus was developed using the polymerase chain reaction. A two-primer set and an oligonucleotide detection probe were synthesized. After 40 cycles of amplification, detection of a 160-bp amplified DNA fragment was carried out by agarose gel electrophoresis and Southern blot hybridization. This assay was sensitive since it was able to detect 1-10 bacteria. It was also specific since no amplification was documented with DNAs from enterotoxigenic S. aureus or Gram-negative bacteria devoid of the tst gene.

  18. Heavy quark production in neutrino-nucleon reactions

    Energy Technology Data Exchange (ETDEWEB)

    Aguiar, C.E.M. de; Simoes, J.A.M. (Rio de Janeiro Univ. (Brazil). Inst. de Fisica); Garcia Canal, C.A. (La Plata Univ. Nacional (Argentina))

    1982-05-01

    The heavy quark production (charm and bottom) in neutrino-nucleon reactions is discussed. The greater interest is in the leptonic channels, in particular in the production of two charged leptons in the final state.

  19. Process Reengineering of Cold Chain Logistics of Agricultural Products Based on Low-carbon Economy

    OpenAIRE

    Guo, Hong-xia; Shao, Ming

    2012-01-01

    Through the process analysis of cold chain logistics of agricultural products, we find that cold chain logistics of agricultural products contradict the development model of low-carbon economy to some extent. We apply the development idea of low-carbon economy, introduce the third-party logistics companies, establish distribution center of cold chain logistics of agricultural products, and strengthen information sharing, to reengineer the process of cold chain logistics of agricultural produc...

  20. Identifiability of parameters and behaviour of MCMC chains: a case study using the reaction norm model.

    Science.gov (United States)

    Shariati, M M; Korsgaard, I R; Sorensen, D

    2009-04-01

    Markov chain Monte Carlo (MCMC) enables fitting complex hierarchical models that may adequately reflect the process of data generation. Some of these models may contain more parameters than can be uniquely inferred from the distribution of the data, causing non-identifiability. The reaction norm model with unknown covariates (RNUC) is a model in which unknown environmental effects can be inferred jointly with the remaining parameters. The problem of identifiability of parameters at the level of the likelihood and the associated behaviour of MCMC chains were discussed using the RNUC as an example. It was shown theoretically that when environmental effects (covariates) are considered as random effects, estimable functions of the fixed effects, (co)variance components and genetic effects are identifiable as well as the environmental effects. When the environmental effects are treated as fixed and there are other fixed factors in the model, the contrasts involving environmental effects, the variance of environmental sensitivities (genetic slopes) and the residual variance are the only identifiable parameters. These different identifiability scenarios were generated by changing the formulation of the model and the structure of the data and the models were then implemented via MCMC. The output of MCMC sampling schemes was interpreted in the light of the theoretical findings. The erratic behaviour of the MCMC chains was shown to be associated with identifiability problems in the likelihood, despite propriety of posterior distributions, achieved by arbitrarily chosen uniform (bounded) priors. In some cases, very long chains were needed before the pattern of behaviour of the chain may signal the existence of problems. The paper serves as a warning concerning the implementation of complex models where identifiability problems can be difficult to detect a priori. We conclude that it would be good practice to experiment with a proposed model and to understand its features

  1. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  2. Amplification refractory mutation system polymerase chain reaction versus optimized polymerase chain reaction restriction-fragment length polymorphism for apolipoprotein E genotyping of majorly depressed patients.

    Science.gov (United States)

    You, Hongmin; Chen, Jin; Zhou, Jingjing; Huang, Hua; Pan, Junxi; Wang, Ziye; Lv, Lin; Zhang, Lujun; Li, Juan; Qin, Bin; Yang, Yongtao; Xie, Peng

    2015-11-01

    Major depressive disorder (MDD) is a prevalent, debilitating mood disorder that has been associated with several genetic polymorphisms. One such polymorphism, namely that of apolipoprotein E (APOE), has three allelic forms (ε2, ε3 and ε4) that encode for six unique isoforms of the APOE protein. A growing number of techniques have been developed for APOE genotyping; however, not all polymerase chain reaction (PCR)‑based genotyping techniques are equally accurate or cost‑effective. In order to find a more accurate and cost‑effective APOE genotyping method for MDD screening in large populations, the present study comparatively evaluated two genotyping methods, amplification refractory mutation system PCR (ARMS‑PCR) and optimized PCR restriction‑fragment length polymorphism (PCR‑RFLP), in blood samples taken from a population of 708 MDD patients. Although either of the two methods were able to detect all six unique APOE genotypes, comparisons of the two methods with Sanger sequencing demonstrated that ARMS‑PCR (94%) was significantly more accurate than optimized PCR‑RFLP (82%). ARMS‑PCR should prove useful in quickly verifying ambiguous results obtained by other APOE genotyping methods and can be cost-effectively performed in the setting of a small laboratory or a population-based screening program.

  3. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  4. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  5. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan

    2001-01-01

    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1......) x s(-1)) > backbone amides (10-10(-3) M(-1) x s(-1)) > Gln(0.03 M(-1) x s(-1)) approximately Asn (0.03 M(-1) x s(-1)). The rate constants for reaction of HOCl with backbone amides (peptide bonds) vary by 4 orders of magnitude with uncharged peptide bonds reacting more readily with HOCl than those...

  6. Stream of Reaction Products behind the Detonation Wave Front

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Embedded copper foils in a high explosive charge allow to see the stream of the reaction products behind the detonation front. With three individual firings in front of FXR it can be shown that the reaction products behind the detonation front are immediately going in the direction of the detonation front. But then the rarefaction fans are influencing strongly the further displacements.

  7. Determination of the number of radicals in the initial chain reactions by mathematical methods

    Directory of Open Access Journals (Sweden)

    Pejović Branko B.

    2009-01-01

    Full Text Available Starting from the fact that the real mechanism in a chemical equation takes places through a certain number of radicals which participate in simultaneous reactions and initiate chain reactions according to a particular pattern, the aim of this study is to determine their number in the first couple of steps of the reaction. Based on this, the numbers of radicals were determined in the general case, in the form of linear difference equations, which, by certain mathematical transformations, were reduced to one equation that satisfies a particular numeric series, entirely defined if its first members are known. The equation obtained was solved by a common method developed in the theory of numeric series, in which its solutions represent the number of radicals in an arbitrary step of the reaction observed, in the analytical form. In the final part of the study, the method was tested and verified using two characteristic examples from general chemistry. The study also gives a suggestion of a more efficient procedure by reducing the difference equation to a lower order.

  8. The Chain Information Model: a systematic approach for food product development

    NARCIS (Netherlands)

    Benner, M.

    2005-01-01

    The chain information model has been developed to increase the success rate of new food products. The uniqueness of this approach is that it approaches the problem from a chain perspective and starts with the consumer. The model can be used to analyse the production chain in a systematic way. This r

  9. 76 FR 34271 - Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles Management Unit, Including...

    Science.gov (United States)

    2011-06-13

    ... workers of Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles Management Unit... Employment and Training Administration Hewlett Packard, Global Parts Supply Chain, Global Product Life Cycles... Supply Chain Group, including leased workers from QFlex, North America Logistics and UPS...

  10. Pesticide governance in export supply chains: the case of vegetable and fruit production in Vietnam

    NARCIS (Netherlands)

    Pham Van Hoi,; Mol, A.P.J.; Oosterveer, P.J.M.

    2010-01-01

    We analyze the role of international agrofood supply chains in greening vegetable and fruit products and production in Vietnam. Mainly through contract-based procurement, the export- oriented vegetable and fruit supply chain is better structured and organized than the domestic supply chain. Exporter

  11. Maillard reaction products in pet foods

    NARCIS (Netherlands)

    Rooijen, van C.

    2015-01-01

    Pet dogs and cats around the world are commonly fed processed commercial foods throughout their lives. Often heat treatments are used during the processing of these foods to improve nutrient digestibility, shelf life, and food safety. Processing is known to induce the Maillard reaction, in which a r

  12. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B. (Univ. of Illinois, Chicago (USA)); Wunder, J.S.; Andrulis, I.L. (Mount Sinai Hospital, Toronto, Ontario (Canada)); Gazdar, A.F. (National Cancer Inst., Bethesda, MD (USA)); Willman, C.L.; Griffith, B. (Univ. of New Mexico, Albuquerque (USA)); Von Hoff, D.D. (Univ. of Texas, San Antonio (USA))

    1990-09-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy.

  13. Multivariate High Order Statistics of Measurements of the Temporal Evolution of Fission Chain-Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Mattingly, J.K.

    2001-03-08

    The development of high order statistical analyses applied to measurements of the temporal evolution of fission chain-reactions is described. These statistics are derived via application of Bayes' rule to conditional probabilities describing a sequence of events in a fissile system beginning with the initiation of a chain-reaction by source neutrons and ending with counting events in a collection of neutron-sensitive detectors. Two types of initiating neutron sources are considered: (1) a directly observable source introduced by the experimenter (active initiation), and (2) a source that is intrinsic to the system and is not directly observable (passive initiation). The resulting statistics describe the temporal distribution of the population of prompt neutrons in terms of the time-delays between members of a collection (an n-tuplet) of correlated detector counts, that, in turn, may be collectively correlated with a detected active source neutron emission. These developments are a unification and extension of Rossi-a, pulsed neutron, and neutron noise methods, each of which measure the temporal distribution of pairs of correlated events, to produce a method that measures the temporal distribution of n-tuplets of correlated counts of arbitrary dimension n. In general the technique should expand present capabilities in the analysis of neutron counting measurements.

  14. Solving the SAT problem using a DNA computing algorithm based on ligase chain reaction.

    Science.gov (United States)

    Wang, Xiaolong; Bao, Zhenmin; Hu, Jingjie; Wang, Shi; Zhan, Aibin

    2008-01-01

    A new DNA computing algorithm based on a ligase chain reaction is demonstrated to solve an SAT problem. The proposed DNA algorithm can solve an n-variable m-clause SAT problem in m steps and the computation time required is O (3m+n). Instead of generating the full-solution DNA library, we start with an empty test tube and then generate solutions that partially satisfy the SAT formula. These partial solutions are then extended step by step by the ligation of new variables using Taq DNA ligase. Correct strands are amplified and false strands are pruned by a ligase chain reaction (LCR) as soon as they fail to satisfy the conditions. If we score and sort the clauses, we can use this algorithm to markedly reduce the number of DNA strands required throughout the computing process. In a computer simulation, the maximum number of DNA strands required was 2(0.48n) when n=50, and the exponent ratio varied inversely with the number of variables n and the clause/variable ratio m/n. This algorithm is highly space-efficient and error-tolerant compared to conventional brute-force searching, and thus can be scaled-up to solve large and hard SAT problems. PMID:17904730

  15. Study on Inventory of Supply Chain of Supermarket-oriented Agricultural Products

    Institute of Scientific and Technical Information of China (English)

    Hong; HUO; Xin; SHEN; Zhipeng; Huang

    2013-01-01

    Using principle and method of the system dynamics,this paper takes a qualitative analysis on the inventory of supply chain of supermarket-oriented agricultural products,and compares with the supply chain of wholesale-oriented agricultural products. Two inventory models are established for these two different modes of supply chain. Through simulation of two models in the case of random demand and quantitative analysis of results,it is found that the inventory of supply chain of supermarket-oriented agricultural products has smaller fluctuation than that of wholesaler-oriented agricultural products. Besides,both the inventory level and bullwhip effect of above chain are lowered.

  16. High energy gamma-ray production in nuclear reactions

    International Nuclear Information System (INIS)

    Experimental techniques used to study high energy gamma-ray production in nuclear reactions are reviewed. High energy photon production in nucleus-nucleus collisions is discussed. Semi-classical descriptions of the nucleus-nucleus gamma reactions are introduced. Nucleon-nucleon gamma cross sections are considered, including theoretical aspects and experimental data. High energy gamma ray production in proton-nucleus reactions is explained. Theoretical explanations of photon emission in nucleus-nucleus collisions are treated. The contribution of charged pion currents to photon production is mentioned

  17. Improving the quality of pork and pork products for the consumer : development of innovative, integrated, and sustainable food production chains of high quality pork products matching consumer demands

    NARCIS (Netherlands)

    Heimann, B.; Christensen, M.; Rosendal Rasmussen, S.; Bonneau, M.; Grunert, K.G.; Arnau, J.; Trienekens, J.H.; Oksbjerg, N.; Greef, de K.H.; Petersen, B.

    2012-01-01

    Improving the quality of pork and pork products for the consumer: development of innovative, integrated, and sustainable food production chains of high quality pork products matching consumer demands.

  18. Quantification of Porcine Follicle-stimulating Hormone Receptor Messenger Ribonucleic Acid by Reverse Transcription-competitive Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    An easy and reliable method was developed for construction and quantification of competitive templates, which shared the same sequence as the amplified target DNA except for a 20-bp insertion in the middle by recombinant polymerase chain reaction (PCR). Among the advantages of competitive PCR is that any predictable or unpredictable variable that affects amplification has the same effect on both target and competitor species and that the final ratio of amplified products reflects exactly the initial targets. The utilization of a thermostable reverse transcriptase in the RT step was proposed to overcome the problem of the efficiency of target cDNA synthesis. In addition, to obtain reliable measurements, it was recommended to perform four PCR with amounts of competitive template flanking the concentration of the target mRNA.

  19. SWOT Analysis of Agricultural Producers in the Supply Chain of Chinese Agro-products

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    On the basis of defining the producers in the supply chain of agricultural products,the SWOT analysis is adopted to analyze the advantages,disadvantages,opportunities and threats of producers in the supply chain of Chinese agricultural products.The paper analyzes the advantages of producers in the supply chain of agricultural products from three aspects including land resources,technology level of producers and input costs.The disadvantages of producers in the supply chain of agricultural products are analyzed from three aspects including scale level,mechanization and technology level and profit level.The opportunities of producers in the supply chain of agricultural products are analyzed from the aspects of laws,policies,capitals and technologies.The threats confronted by the producers in the supply chain of agricultural products are analyzed from foreign producers,negotiation control of supply chain of agricultural chain,environment protection and quality safety standard.On the basis of the analysis,the relevant suggestions on facilitating the interests of producers in the supply chain of Chinese agricultural products are put forward,including fully displaying the advantages of land resources;improving the knowledge and technology level of supply chain of agricultural production;establishing the alliances of producers of agricultural products to expand production scale;improving the quality of agricultural products to satisfy the relevant safety quality standard and environmental protection standard.

  20. Scenarios for the milk production chain in Brazil in 2020

    Directory of Open Access Journals (Sweden)

    Renata Giovinazzo Spers

    2013-06-01

    Full Text Available Brazilian milk production has grown steadily and in 2004 the country became self-sufficient in dairy production. This article develops possible scenarios for the milk production chain in Brazil for the year 2020 in order to contribute to decisions that must be made by stakeholders. A literature review on foresight and the use of scenarios was conducted, and a scenario writing approach based on Wright and Spers (2006 was adopted, which includes the use of the Delphi method, Michael Porter's Five Competitive Forces model, Interpretative Structural Modeling (ISM (WRIGHT, 1991 and quantitative projections. This methodology provided four scenarios, with quantitative and qualitative elements: two exploratory scenarios ("milk, the new agribusiness star" and "a wasted future", a most probable scenario ("continuous but uneven growth" and a desired scenario ("competitive family agriculture". Overall, it is possible to note many market opportunities, as well as niche markets and the strengthening of cooperatives. Future prospects are also favorable to the dairy industry in general, but nearly all scenarios point to a concentration in the industrial sphere.

  1. Modeling and Optimization of Inventory-Distribution Routing Problem for Agriculture Products Supply Chain

    OpenAIRE

    Li Liao; Jianfeng Li; Yaohua Wu

    2013-01-01

    Mathematical models of inventory-distribution routing problem for two-echelon agriculture products distribution network are established, which are based on two management modes, franchise chain and regular chain, one-to-many, interval periodic order, demand depending on inventory, deteriorating treatment cost of agriculture products, start-up costs of vehicles and so forth. Then, a heuristic adaptive genetic algorithm is presented for the model of franchise chain. For the regular chain model,...

  2. Study on Inventory of Supply Chain of Supermarket-oriented Agricultural Products

    OpenAIRE

    Huo, Hong; Shen, Xin; Huang, Zhipeng

    2013-01-01

    Using principle and method of the system dynamics, this paper takes a qualitative analysis on the inventory of supply chain of supermarket-oriented agricultural products, and compares with the supply chain of wholesale-oriented agricultural products. Two inventory models are established for these two different modes of supply chain. Through simulation of two models in the case of random demand and quantitative analysis of results, it is found that the inventory of supply chain of supermarket-...

  3. ISOLASI Campylobacter DARI KARKAS AYAM MENGGUNAKAN METODE KONVENSIONAL DAN POLYMERASE CHAIN REACTIONS [Isolation of Campylobacter from Poultry Carcasses using Conventional and Polymerase Chain Reaction Methods

    Directory of Open Access Journals (Sweden)

    Surachmi Setiyaningsih2

    2013-06-01

    Full Text Available Campylobacter jejuni and Campylobacter coli are two spesies of Campylobacter sp. frequently found as pathogenic bacteria causing human gastrointestinal infections. Contaminated chicken carcasses have been reported as the source of human campylobacteriosis. In this study, Campylobacter were isolated from chicken carcasses sold in traditional markets and supermarkets. In traditional markets, chicken carcasses are sold without proper packaging or in an open space and stored at room temperature (25-30°C for prolonged period allowing pathogenic bacteria to grow. While at supermarkets, chicken carcasses are openly displayed or enclosed in plastic wrappings and stored in a refrigerator (4-8°C. A total of 298 samples of chicken carcasses from traditional markets and supermarkets in the area of DKI Jakarta, West Java (Bogor and Sukabumi and Central Java (Kudus and Demak were collected. Isolation and identification using conventional and Polymerase Chain Reactions (PCR methods were done to determine the prevalence of C. jejuni and C. coli contamination in poultry. The results showed that chicken carcasses sold in the sampling area, both traditional markets and supermarkets, were contaminated with C. jejuni and C. coli. The contamination rate of Campylobacter sp. in chicken carcasses sold in supermarkets, were 14.1% by conventional methods and 29.5% by PCR. This was higher than those in traditional markets, i.e. 5.7 and 12.1%, respectively. It is also confirmed that the prevalence for contamination of C. jejuni was higher than C. coli in 298 samples, i.e. 16.1% and 3.7% by conventional method and 23.5% and 18.1% by PCR method respectively.

  4. Process Reengineering of Cold Chain Logistics of Agricultural Products Based on Low-carbon Economy

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    Through the process analysis of cold chain logistics of agricultural products,we find that cold chain logistics of agricultural products contradict the development model of low-carbon economy to some extent.We apply the development idea of low-carbon economy,introduce the thirdparty logistics companies,establish distribution center of cold chain logistics of agricultural products,and strengthen information sharing,to reengineer the process of cold chain logistics of agricultural products in China.The results show that applying low-carbon economy to process reengineering of cold chain logistics of agricultural products,has advantages of increasing added value of products,promoting scale merit and abating lag,plays a role in promoting emission reduction,high efficiency and environmental protection in the process of cold chain logistics of agricultural products in China.

  5. High-throughput Procedure for Single Pollen Grain Collection and Polymerase Chain Reaction in Plants

    Institute of Scientific and Technical Information of China (English)

    Ping-Hua Chen; Yong-Bao Pan; Ru-Kai Chen

    2008-01-01

    Single pollen grain polymersse chain reaction (PCR) has succeeded in several species, however only limited numbers of pollen grains were involved due to difficulties in pollen isolation and lysis. This has limited its application in genetic analysis and mapping studies in plants. A high-throughput (HT) procedure for collecting and detecting genetic variation in a large number of individual pollen grains by PCR is reported. The HT procedure involved the collection of Individual pollen grains by a pair of special forceps and the lysis of pollen grains in a heated alkali/detergent solution followed by neutralization with a tris-ethylenediamine tetraacetic acid (TE) buffer. These resulting template solutions yielded PCR reactions involving the 5S ribosomal RNA intergenic spacers, randomly amplified polymorphic DNA, and simple sequence repeats markers. Using this procedure, one person with experience could collect and process up to 288 single pollen grain PCR reactions per day. The method worked well on sugarcane, corn, Miscanthus spp., snap bean, sorghum, and tomato. The ability to collect and conduct PCR on individual pollen grains on a large scale offers a new approach to genetic analyses and mapping studies in an easily controllable environment with a considerable cost reduction. The method will also significantly benefit studies in species that are difficult subjects for classical genetic research.

  6. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  7. Independent Verification of Element 114 Production in the 48Ca+242Pu Reaction

    International Nuclear Information System (INIS)

    Independent verification of the production of element 114 in the reaction of 244-MeV 48Ca with 242Pu is presented. Two chains of time- and position-correlated decays have been assigned to 286114 and 287114. The observed decay modes, half-lives, and decay energies agree with published results. The measured cross sections at a center-of-target energy of 244 MeV for the 242Pu(48Ca,3-4n)287,286114 reactions were 1.4-1.2+3.2 pb each, which are lower than the reported values.

  8. 肉制品中牛源性成分荧光定量聚合酶链式反应方法的建立与应用%Establish and Application of a Real-Time Fluorescence-Based Polymerase Chain Reaction Assay for Detection of Bovine-Derived Materials in Meat Products

    Institute of Scientific and Technical Information of China (English)

    苗丽; 李志娟; 王珊; 张秀平; 陈静

    2015-01-01

    A real-time fluorescence-based polymerase chain reaction (PCR) assay that enables rapid and accurate identification of adulterated beef products was developed usingTaqMan probe for the rapid and effective detection of bovine-derived materials in meat products. A pair of specific primers andTaqMan probe was designed according to the conserved sequence of the bovine β-actingene. PCR reaction conditions were optimized using pMD-18T-96-beef plasmid as standard. The results showed that the pMD-18T-96-beef plasmid was confirmed to be valid by PCR, sequencing and enzyme digestion and the developed standard curve produced a good linear relationship betweenCt value and initial amounts of total DNA with correlation coefficient and slope of 0.98 and−3.345, respectively. The sensitivity was 46.1 copies/µL. No cross-reactions were found in specimens containing pork, mutton, chicken, duck and goose. The intra- and inter-assay variable coefficients were less than 0.98% and 0.33%, respectively, suggesting good repeatability. A total of 40 beef product samples from the market were measured by this method and the routine real-time PCR method from the industry standard SN/T 2051—2008. Of the 40 samples, 3 were detected as positive as consistently indicated by the two assays. This real-time PCR method with strong specificity and high sensitivity could provide a useful approach for the identification of meat adulteration.%为了能够快速准确检测出市场中掺假牛肉制品,采用TaqMan探针法,建立一种用于快速有效检测牛肉制品中牛源性成分的荧光定量聚合酶链式反应(polymerase chain reaction,PCR)方法。选择GenBank中牛β-actin基因的保守序列,设计并合成特异性引物及TaqMan探针,以构建的pMD-18T-96-beef质粒为标准品,优化反应条件。结果表明:重组质粒标准品经PCR、测序和酶切鉴定正确,建立的标准曲线Ct值与模板拷贝数对数值之间呈良好的线

  9. Resonance production in γγ reactions

    International Nuclear Information System (INIS)

    Experimental results on the exclusive production of resonances in γγ collisions are reviewed. These include new measurements of the radiative widths of the pseudoscalar (eta,eta') and the tensor mesons (f, A2, f'). A comparison of these results with SU(3) is made. Upper limits for other states than f in γγ -> ππ are given. The searches for γγ production of the states iota and theta as well as etasub(c) are presented and upper limits are given. Finally a limit is given for the rare decay f -> π+π-2π0. (orig.)

  10. Effects of ionization mode on charge-site-remote and related fragmentation reactions of long-chain quaternary ammonium ions.

    Science.gov (United States)

    Seto, C; Grossert, J S; Waddell, D S; Curtis, J M; Boyd, R K

    2001-05-01

    Comparison of collisionally activated fragment spectra of long-chain quaternary ammonium ions, formed by liquid-assisted secondary ion mass spectrometry (LSIMS) and electrospray ionization (ESI), shows the latter are dominated by radical cations while the former yield mainly even-electron charge-site-remote (CSR) fragments, similar to the report for different precursors by Cheng et al., J. Am. Soc. Mass Spectrom. 1998, 9, 840. Here, mixed-site fragmentation products (formal loss of a radical directly bonded to the nitrogen plus a radical derived from the long chain) are of comparable importance for both ionization techniques. These observations are difficult to understand if the CSR ions are formed by a concerted rearrangement-elimination reaction, since precollision internal energies of the ESI ions are much lower than those of the ions from LSIMS. Alternatively, if one discards the concerted mechanism for high-energy CA, and assumes that the even-electron fragments are predominantly formed via homolytic bond cleavage, the colder radical cations from ESI survive to the detector while the more energized counterparts from LSIMS preferentially lose a hydrogen atom to yield the CSR ions, as proposed by Wysocki and Ross (Int. J. Mass Spectrom. Ion Processes 1991, 104, 179). The present work also attempts to reconcile discrepancies involving critical energies and known structures for neutral fragments. PMID:11349955

  11. Validity of the polymerase chain reaction in the diagnosis of clinically suspected cases of American visceral leishmaniasis.

    Science.gov (United States)

    Pedrosa, Celia Maria Silva; Ximenes, Ricardo Arraes de Alencar; Almeida, Wendell Alexandre Pinheiro de; Rocha, Eliana Maria Mauricio da

    2013-01-01

    To test the validity of the polymerase chain reaction for diagnosing American visceral leishmaniasis, 88 suspected cases were studied. Diagnosis was confirmed in 47 (53.5%) and ruled out in 41 (46.5%) patients. Samples of bone marrow and peripheral blood were processed by polymerase chain reaction to evaluate the sensitivity and specificity of the test and its agreement beyond chance with microscopy examination. The polymerase chain reaction was positive in bone marrow of 100% of the patients with amastigotes seen with microscopy examination, and in 59.5% in those where no parasite were seen. Agreement beyond chance between visualization of the parasite in bone marrow aspirates and polymerase chain reaction was considered weak (Kappa=0.41). Concordance between polymerase chain reaction of bone marrow aspirates and of peripheral blood was considered excellent (Kappa=0.88). The test turned out positive in all bone marrow aspirates of those with the disease and whereas the positivity rate was 58.5% among those without the disease, with specificity rate of 41.5%.

  12. The mutagenic chain reaction: a method for converting heterozygous to homozygous mutations

    Science.gov (United States)

    Gantz, Valentino M.; Bier, Ethan

    2015-01-01

    An organism with a single recessive loss-of-function allele will typically have a wild-type phenotype while individuals homozygous for two copies of the allele will display a mutant phenotype. Here, we develop a method that we refer to as the mutagenic chain reaction (MCR), which is based on the CRISPR/Cas9 genome editing system for generating autocatalytic mutations to generate homozygous loss-of-function mutations. We demonstrate in Drosophila that MCR mutations efficiently spread from their chromosome of origin to the homologous chromosome thereby converting heterozygous mutations to homozygosity in the vast majority of somatic and germline cells. MCR technology should have broad applications in diverse organisms. PMID:25908821

  13. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  14. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR

    Directory of Open Access Journals (Sweden)

    Seiki Kuramitsu

    2013-03-01

    Full Text Available Polymerase chain reaction (PCR-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3' end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science.

  15. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra

    2016-08-01

    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  16. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi

    2014-12-01

    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  17. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    Science.gov (United States)

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  18. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S

    2012-02-03

    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  19. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  20. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Science.gov (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  1. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  2. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  3. Detection of Trypanosoma cruzi DNA within murine cardiac tissue sections by in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Joshua E Lane

    2003-04-01

    Full Text Available The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.

  4. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  5. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur P

    2004-01-01

    Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  6. Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Dastur R

    2003-01-01

    Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

  7. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    Institute of Scientific and Technical Information of China (English)

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  8. A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

    Directory of Open Access Journals (Sweden)

    Elisa Morganti

    2011-01-01

    Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

  9. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications.

    Science.gov (United States)

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav

    2004-02-01

    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  10. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  11. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    Science.gov (United States)

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-06-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted.

  12. DNA Polymer Brush Patterning through Photocontrollable Surface-Initiated DNA Hybridization Chain Reaction.

    Science.gov (United States)

    Huang, Fujian; Zhou, Xiang; Yao, Dongbao; Xiao, Shiyan; Liang, Haojun

    2015-11-18

    The fabrication of DNA polymer brushes with spatial resolution onto a solid surface is a crucial step for biochip research and related applications, cell-free gene expression study, and even artificial cell fabrication. Here, for the first time, a DNA polymer brush patterning method is reported based on the photoactivation of an ortho-nitrobenzyl linker-embedded DNA hairpin structure and a subsequent surface-initiated DNA hybridization chain reaction (HCR). Inert DNA hairpins are exposed to ultraviolet light irradiation to generate DNA duplexes with two active sticky ends (toeholds) in a programmable manner. These activated DNA duplexes can initiate DNA HCR to generate multifunctional patterned DNA polymer brushes with complex geometrical shapes. Different multifunctional DNA polymer brush patterns can be fabricated on certain areas of the same solid surface using this method. Moreover, the patterned DNA brush surface can be used to capture target molecules in a desired manner.

  13. Diagnosis of Progressive Spinal Muscular Atrophy by Using Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    姚娟; 丁新生; 陈克连; 程虹; 邓晓萱; 沈鸣九; 王颖

    2001-01-01

    Objective To understand the deletion in the survival motor neuron gene (SMN) of childhood-onset spinal muscular atrophy (SMA) in Chinese, and the value of diagnosis of SMA using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)method. Methods Deletions of SMN gene of exon 7 and 8 in 10 cases of presumed SMA, and 20 normal controls from 6 families and 30 unrelated controls were performed by PCR-RFLP analysis. Results Deletions of SMN gene detected in 9 of 10 (90%) cases of presumed SMA . No deletions of SMN in the telomere were found in the other members of families and controls.Conclusion PCR-RFLP is a sensitive, specific and simple method in diagnosis of SMA.

  14. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction.

    Science.gov (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-01-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples. PMID:27534372

  15. A product study of the isoprene+NO3 reaction

    Directory of Open Access Journals (Sweden)

    A. Hansel

    2009-02-01

    Full Text Available Oxidation of isoprene through reaction with NO3 is a significant sink for isoprene that persists after dark. The products of the reaction are multifunctional nitrates. These nitrates constitute a significant NOx sink in the nocturnal boundary layer and they likely play an important role in formation of secondary organic aerosol. Products of the isoprene+NO3 reaction will, in many locations, be abundant enough to affect nighttime radical chemistry and to persist into daytime where they may represent a source of NOx. Product formation in the isoprene+NO3 reaction was studied in a smog chamber at Purdue University. Isoprene nitrates and other hydrocarbon products were observed using Proton Transfer Reaction-Mass Spectrometry (PTR-MS and reactive nitrogen products were observed using Thermal Dissociation–Laser Induced Fluorescence (TD-LIF. The organic nitrate yield is found to be 62±6% and the combined yield of MACR+MVK is found to be ~10%. Additional hydrocarbon products, thought to be primarily C4 and C5 carbonyl compounds, were observed by the PTR-MS at various m/z ratios and their yields quantified. These other oxidation products are used as additional constraints on the reaction mechanism.

  16. A product study of the isoprene+NO3 reaction

    Directory of Open Access Journals (Sweden)

    R. C. Cohen

    2009-07-01

    Full Text Available Oxidation of isoprene through reaction with NO3 radicals is a significant sink for isoprene that persists after dark. The main products of the reaction are multifunctional nitrates. These nitrates constitute a significant NOx sink in the nocturnal boundary layer and they likely play an important role in formation of secondary organic aerosol. Products of the isoprene+NO3 reaction will, in many locations, be abundant enough to affect nighttime radical chemistry and to persist into daytime where they may represent a source of NOx. Product formation in the isoprene + NO3 reaction was studied in a smog chamber at Purdue University. Isoprene nitrates and other hydrocarbon products were observed using Proton Transfer Reaction-Mass Spectrometry (PTR-MS and reactive nitrogen products were observed using Thermal Dissociation–Laser Induced Fluorescence (TD-LIF. The organic nitrate yield is found to be 65±12% of which the majority was nitrooxy carbonyls and the combined yield of methacrolein and methyl vinyl ketone (MACR+MVK is found to be ∼10%. PTR-MS measurements of nitrooxy carbonyls and TD-LIF measurements of total organic nitrates agreed well. The PTR-MS also observed a series of minor oxidation products which were tentatively identified and their yields quantified These other oxidation products are used as additional constraints on the reaction mechanism.

  17. Products of the Benzene + O(3P) Reaction

    Energy Technology Data Exchange (ETDEWEB)

    Taatjes, Craig A.; Osborn, David L.; Selby, Talitha M.; Meloni, Giovanni; Trevitt, Adam J.; Epifanovsky, Evgeny; Krylov, Anna I.; Sirjean, Baptiste; Dames, Enoch; Wang, Hai

    2009-12-21

    The gas-phase reaction of benzene with O(3P) is of considerable interest for modeling of aromatic oxidation, and also because there exist fundamental questions concerning the prominence of intersystem crossing in the reaction. While its overall rate constant has been studied extensively, there are still significant uncertainties in the product distribution. The reaction proceeds mainly through the addition of the O atom to benzene, forming an initial triplet diradical adduct, which can either dissociate to form the phenoxy radical and H atom, or undergo intersystem crossing onto a singlet surface, followed by a multiplicity of internal isomerizations, leading to several possible reaction products. In this work, we examined the product branching ratios of the reaction between benzene and O(3P) over the temperature range of 300 to 1000 K and pressure range of 1 to 10 Torr. The reactions were initiated by pulsed-laser photolysis of NO2 in the presence of benzene and helium buffer in a slow-flow reactor, and reaction products were identified by using the multiplexed chemical kinetics photoionization mass spectrometer operating at the Advanced Light Source (ALS) of Lawrence Berkeley National Laboratory. Phenol and phenoxy radical were detected and quantified. Cyclopentadiene and cyclopentadienyl radical were directly identified for the first time. Finally, ab initio calculations and master equation/RRKM modeling were used to reproduce the experimental branching ratios, yielding pressure-dependent rate expressions for the reaction channels, including phenoxy + H, phenol, cyclopentadiene + CO, which are proposed for kinetic modeling of benzene oxidation.

  18. Cloning and sequencing of human lambda immunoglobulin genes by the polymerase chain reaction.

    Science.gov (United States)

    Songsivilai, S; Bye, J M; Marks, J D; Hughes-Jones, N C

    1990-12-01

    Universal oligonucleotide primers, designed for amplifying and sequencing genes encoding the rearranged human lambda immunoglobulin variable region, were validated by amplification of the lambda light chain genes from four human heterohybridoma cell lines and in the generation of a cDNA library of human V lambda sequences from Epstein-Barr virus-transformed human peripheral blood lymphocytes. This technique allows rapid cloning and sequencing of human immunoglobulin genes, and has potential applications in the rescue of unstable human antibody-producing cell lines and in the production of human monoclonal antibodies.

  19. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang

    2006-01-01

    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  20. Variance-reduced simulation of lattice discrete-time Markov chains with applications in reaction networks

    Science.gov (United States)

    Maginnis, P. A.; West, M.; Dullerud, G. E.

    2016-10-01

    We propose an algorithm to accelerate Monte Carlo simulation for a broad class of stochastic processes. Specifically, the class of countable-state, discrete-time Markov chains driven by additive Poisson noise, or lattice discrete-time Markov chains. In particular, this class includes simulation of reaction networks via the tau-leaping algorithm. To produce the speedup, we simulate pairs of fair-draw trajectories that are negatively correlated. Thus, when averaged, these paths produce an unbiased Monte Carlo estimator that has reduced variance and, therefore, reduced error. Numerical results for three example systems included in this work demonstrate two to four orders of magnitude reduction of mean-square error. The numerical examples were chosen to illustrate different application areas and levels of system complexity. The areas are: gene expression (affine state-dependent rates), aerosol particle coagulation with emission and human immunodeficiency virus infection (both with nonlinear state-dependent rates). Our algorithm views the system dynamics as a "black-box", i.e., we only require control of pseudorandom number generator inputs. As a result, typical codes can be retrofitted with our algorithm using only minor changes. We prove several analytical results. Among these, we characterize the relationship of covariances between paths in the general nonlinear state-dependent intensity rates case, and we prove variance reduction of mean estimators in the special case of affine intensity rates.

  1. The use of polymerase chain reaction for early diagnosis of tuberculosis in Mycobacterium tuberculosis culture

    Directory of Open Access Journals (Sweden)

    M. Chagas

    2010-06-01

    Full Text Available Early diagnosis plays a vital role in controlling tuberculosis. The conventional methodology is slow, with results taking several weeks, in addition to having low sensitivity, especially in clinical paucibacillary samples. The objective of this study was to evaluate the use of polymerase chain reaction (PCR on solid medium culture for a rapid diagnosis of tuberculosis, mainly in cases of negative sputum smears. Forty sputum samples were collected from inpatients with tuberculosis treated for less than 2 days. Bacilloscopy, PCR for sputum, culture on Löwestein-Jensen (LJ solid medium, and daily PCR from culture were performed on each sample. DNA extracted from the BCG vaccine, which contains attenuated bacillus Calmette-Guérin, was used as the positive control. Smear microscopy showed 68.6% sensitivity, 80% specificity, 96% positive predictive value, and 26.7% negative predictive value, with culture on LJ medium as the gold standard. Culture at day 28 showed 74.3% sensitivity and 100% specificity. PCR of DNA extracted from sputum amplified a 1027-bp fragment of the 16s RNA gene, showing 22.9% sensitivity and 60% specificity. PCR performed with DNA extracted from daily culture showed that, from the 17th to the 40th day, the sensitivity (85.7% and specificity (60% were constant. We conclude that a 17-day culture is a good choice for rapid diagnosis and to interfere with the transmission chain of tuberculosis.

  2. Effective use of product quality information in food supply chain logistics

    OpenAIRE

    Rijpkema, W.A.

    2014-01-01

    Food supply chains have inherent characteristics, such as variability in product quality and quality decay, which put specific demands on logistics decision making. Furthermore, food supply chain organization and control has changed significantly in the past decades by factors such as scale intensification and globalization. In practice, these characteristics and developments frequently lead to supply chain problems, such as high levels of product waste, product quality problems, and high log...

  3. PRODUCTION OF MEDIUM-CHAIN ACYLGLYCEROLS BY LIPASE ESTERIFICATION IN PACKED BED REACTOR: PROCESS OPTIMIZATION BY RESPONSE SURFACE METHODOLOGY

    Directory of Open Access Journals (Sweden)

    ZANARIAH MOHD DOM

    2014-06-01

    Full Text Available Medium-chain acylglycerols (or glycerides are formed of mono-, di- and triacylglycerol classes. In this study, an alternative method to produce MCA from esterifying palm oil fatty acid distillate (PFAD with the presence of oil palm mesocarp lipase (OPML which is a plant-sourced lipase and PFAD is also cheap by-product is developed in a packed bed reactor. The production of medium-chain acylglycerols (MCA by lipase-catalysed esterification of palm oil fatty acid distillate with glycerol are optimize in order to determine the factors that have significant effects on the reaction condition and high yield of MCA. Response surface methodology (RSM was applied to optimize the reaction conditions. The reaction conditions, namely, the reaction time (30-240 min, enzyme load (0.5-1.5 kg, silica gel load (0.2-1.0 kg, and solvent amount (200-600 vol/wt. Reaction time, enzyme loading and solvent amount strongly effect MCA synthesis (p0.05 influence on MCA yield. Best-fitting models were successfully established for MCA yield (R 2 =0.9133. The optimum MCA yield were 75% from the predicted value and 75.4% from the experimental data for 6 kg enzyme loading, a reaction time of 135min and a solvent amount of 350 vol/wt at 65ºC reaction temperature. Verification of experimental results under optimized reaction conditions were conducted, and the results agreed well with the predicted range. Esterification products (mono-, di- and triacylglycerol from the PBR were identified using Thin Layer Chromatography method. The chromatograms showed the successful fractionation of esterified products in this alternative method of process esterification.

  4. [Analysis of the vegetable productive chain in Ribeirão Preto, SP].

    Science.gov (United States)

    Takayanagui, Osvaldo M; Capuano, Divani M; Oliveira, Carlos A D; Bergamini, Alzira M M; Okino, Madalena H T; Castro e Silva, Ana A M C; Oliveira, Maria A; Ribeiro, Eliana G A; Takayanagui, Angela M M

    2006-01-01

    With the aim of assessing the cumulative risk of lettuce contamination, 45 production chains were investigated. The presence of thermotolerant coliforms, Salmonella and/or parasites was detected in 69% of these, in all steps of the production chain. Quality control in all steps of the lettuce production process should be intensified. PMID:16699655

  5. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Energy Technology Data Exchange (ETDEWEB)

    Liu Dayu, E-mail: ruark@126.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Zhou Xiaomian, E-mail: zhouximi@yahoo.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China)

    2012-03-09

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil-water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: Black-Right-Pointing-Pointer Droplet formation in a capillary. Black-Right-Pointing-Pointer Transport the droplet using oscillation-flow. Black-Right-Pointing-Pointer Oscillation droplet PCR. Black-Right-Pointing-Pointer Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil-water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 {mu}L) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to

  6. Adoption of GM technology in livestock production chains: an integrating framework

    NARCIS (Netherlands)

    Novoselova, T.; Meuwissen, M.P.M.; Huirne, R.B.M.

    2007-01-01

    This paper presents an integrating framework for analysing the adoption of new technologies in food chains. We review the literature on the adoption of genetic modification in livestock production chains and conclude that an integrated chain approach is currently lacking. Such an approach is, howeve

  7. DETECTION OF PHENOL DEGRADING BACTERIA AND PSEUDOMONAS PUTIDA IN ACTIVATED SLUDGE BY POLYMERASE CHAIN REACTION

    OpenAIRE

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen

    2009-01-01

    Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Pu...

  8. Pion Production in High-Energy Neutrino Reactions with Nuclei

    CERN Document Server

    Mosel, Ulrich

    2015-01-01

    [Background] A quantitative understanding of neutrino interactions with nuclei is needed for precision era neutrino long baseline experiments (MINOS, NOvA, LBNE) which all use nuclear targets. Pion production is the dominant reaction channel at the energies of these experiments. [Purpose] Investigate the influence of nuclear effects on neutrino-induced pion production cross sections and compare predictions for pion-production with available data. [Method] The Giessen Boltzmann--Uehling--Uhlenbeck (GiBUU) model is used for the description of all incohrent channels in neutrino-nucleus reactions. [Results] Differential cross sections for charged and neutral pion production for the MINER$\

  9. Probing chain-end functionalization reactions in living anionic polymerization via matrix-assisted laser desorption ionization time-of-flight mass spectrometry

    Science.gov (United States)

    Arnould, Mark A.; Polce, Michael J.; Quirk, Roderic P.; Wesdemiotis, Chrys

    2004-11-01

    Matrix-assisted laser desorption ionization (MALDI) time-of-flight (TOF) mass spectrometry (MS) is applied to examine the products arising upon the preparation of chain-end functional polymers via living anionic polymerization techniques. Both post-polymerization functionalizations as well as the use of functionalized initiators are investigated. MALDI-TOF MS is shown to be a sensitive probe for the qualitative analysis of the major and minor oligomers from novel functionalization reactions whose mechanisms are not yet well established. The method is particularly valuable for the identification of the end groups of the minor, and often unexpected, distributions that may be undetectable by other analytical means. Complete characterization of all oligomers generated during functionalization reactions provides an essential tool to the synthetic chemist for understanding the corresponding mechanisms. This insight is necessary for selecting alternative routes or making modifications to the reaction conditions. It is demonstrated that MALDI-TOF MS can convey quantitative information about the yields of the chain-end groups introduced during functionalization. From the cases presented it is evident that post-polymerization reactions allow for better control of chain-end functionality and molecular weight than functionalization with the limited number of currently available protected functionalized initiators.

  10. Production and Characterization of Recombinant Light Chain and Carboxyterminal Heavy Chain Fragments of Tetanus Toxin

    OpenAIRE

    Yousefi, Mehdi; Khosravi-Eghbal, Roya; Hemmati, Azam; Shokri, Fazel

    2013-01-01

    Background Light chain (LC) and heavy chain carboxyterminal subdomain (HCC) fragments are the most important parts of tetanus neurotoxin (TeNT) which play key roles in toxicity and binding of TeNT, respectively. In the present study, these two fragments were cloned and expressed in a prokaryotic system and their identity was confirmed using anti-TeNT specific polyclonal and monoclonal antibodies. Methods LC and HCC gene segments were amplified from Clostridium tetani genomic DNA by PCR, clone...

  11. Identification of mosquito-borne flavivirus sequences using universal primers and reverse transcription/polymerase chain reaction.

    Science.gov (United States)

    Pierre, V; Drouet, M T; Deubel, V

    1994-01-01

    A reverse transcription/polymerase chain reaction (RT/PCR) protocol for the rapid detection and identification of flaviviruses was developed using a set of universal oligonucleotide primers. These primers correspond to sequences in the 3' non-coding region and in the NS5 gene which are highly conserved among the mosquito-borne flaviviruses. The sequences of the resulting amplified products were analysed for dengue 1, dengue 2, dengue 3, dengue 4, Japanese encephalitis, West Nile, yellow fever and Zika viruses, and compared with the published sequences of other flaviviruses. The 291-297 nucleotides corresponding to the C-terminus of NS5 gene showed 56 to 76% similarity, whereas the 3' non-coding region (190 to 421 nucleotides) showed only 20 to 36% similarity. Genetic classification of the Zika virus supported its traditional serological grouping. Recombinant plasmids containing the flavivirus sequences were used in a nucleic acid hybridization test to identify the RT/PCR products derived from viral RNA extracted from experimentally infected mosquitoes. The plasmids were dotted on a strip of nitrocellulose membrane and incubated with the RT/PCR product labelled with digoxigenin during the PCR step. This is a valuable method for the rapid and specific identification of mosquito-borne flaviviruses in biological specimens and for subsequent sequence analysis.

  12. ESTIMATION OF CHAIN REACTION BANKRUPTCY STRUCTURE BY CHANCE DISCOVERY METHOD- WITH TIME ORDER METHOD AND DIRECTED KEYGRAPH

    Institute of Scientific and Technical Information of China (English)

    Shinichi GODA; Yukio OHSAWA

    2007-01-01

    Chain reaction bankruptcy is regarded as common phenomenon and its effect is to be taken into account when credit risk portfolio is analyzed. But consideration and modeling of its effect leave much room for improvement. That is mainly because method for grasping relations among companies with limited data is underdeveloped. In this article, chance discovery method is applied to estimate industrial relations that are to include companies' relations that transmit chain reaction of bankruptcy.Time order method and directed KeyGraph are newly introduced to distinguish and express the time order among defaults that is essential information for the analysis of chain reaction bankruptcy. The steps for the data analysis are introduced and result of example analysis with default data in Kyushu,Japan, 2005 is presented. The structure estimated by the new method is compared with the structure of actual account receivable holders of bankrupted companies for evaluation.

  13. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  14. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip

    Science.gov (United States)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang

    2008-02-01

    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  15. Continuous reaction performances of benzene alkylation with long chain olefins catalyzed by ionic liquid

    Institute of Scientific and Technical Information of China (English)

    Congzhen QIAO; Chengyue LI

    2008-01-01

    Based on a compulsive mixing-reacting-sepa-rating-recycling small experimental setup,the continuous reaction performances of benzene alkylation with long chain olefins catalyzed by [BMIM]Cl-AlCl3 ionic liquid were investigated. Three different situations including normal continuous operation mode (reagent materials), sidetrack feeding from different axial positions along the static mixing reactor (reagent materials) and normal con-tinuous alkylation using industrial paraffin and olefins materials were examined. Even under the relatively hype-critical reaction conditions, the single pass conversion of pure 1-dodecene could reach to nearly 100.0%, and the selectivity of 2-phenyl isomer was higher than 37.7%. Although the positions along the reactor for sidetrack feeding were different, the 100.0% single pass conversion of 1-dodecene was also attained before the outlet of the reactor. The refined industrial olefins as raw material could meet with the requirements of continuous alkyla-tion. The influences of impurities such as di-olefins and non-benzene aromatics on the catalytic activity and stability should be studied further.

  16. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation.

    Science.gov (United States)

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K

    2016-08-01

    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA. PMID:27393216

  17. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF

    2000-01-01

    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  18. Fluctuation theorem for entropy production in a chemical reaction channel

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Fluctuation theorem for entropy production in a mesoscopic chemical reaction network is discussed. When the system size is sufficiently large, it is found that, by defining a kind of coarse-grained dissipation function, the entropy production in a reversible reaction channel can be approximately described by a type of detailed fluctuation theorem. Such a fluctuation relation has been successfully tested by direct simulations in a linear reaction model consisting of two reversible channels and in an oscillatory model wherein only one channel is reversible.

  19. Estimation and Preparation of the Hypervariable Regions I/II Templates for Mitochondrial DNA Typing From Human Bones and Teeth Remains Using Singleplex Quantitative Polymerase Chain Reaction.

    Science.gov (United States)

    Le, Thien Ngoc; Van Phan, Hieu; Dang, Anh Tuan Mai; Nguyen, Vy Thuy

    2016-09-01

    A method was designed for estimating and sequencing of mitochondrial DNA (mtDNA) that effectively and more quickly provides a complete mtDNA profile. In this context, we have developed this novel strategy for typing mtDNA from 10 bones and teeth remains (3 months to 44 years). The quantification of mtDNA was achieved by singleplex real-time polymerase chain reaction of the hypervariable region I fragment (445 bp) and hypervariable region II fragment (617 bp). Combined with the melting curve analysis, we have determined as little as 10 pg of mtDNA template that is suitable for sequence analysis. Furthermore, quantitative polymerase chain reaction products were directly used for following step of mtDNA typing by Sanger sequencing. This method allows the profile to be completely provided for faster human identification. PMID:27356010

  20. Performance indicators in agri-food production chains

    NARCIS (Netherlands)

    Aramyan, L.H.; Ondersteijn, C.J.M.; Kooten, van O.; Oude Lansink, A.G.J.M.

    2006-01-01

    The last decade has seen an increasing interest in indicators of supply-chain performance. A large number of various performance indicators have been used to characterize supply chains, ranging from highly qualitative indicators like customer or employee satisfaction to quantitative indicators like

  1. Detection of hepatitis C virus sequences in sera with controversial serology by nested polymerase chain reaction.

    Science.gov (United States)

    Lazizi, Y; Elfassi, E; Pillot, J

    1992-04-01

    The specificity of first-generation enzyme-linked immunosorbent assays (ELIAs) for antibody detection in individuals with hepatitis C virus (HCV) infection has been questioned in some pathological situations. We observed a surprisingly high prevalence of anti-HCV antibodies in alcoholic patients, and thus, false-positive reactions in anti-HCV tests were strongly suspected. The introduction of new epitopes, particularly a core protein, C22 (second-generation tests), seems to increase the sensitivity of anti-HCV detection. In order to study the specificity of the second-generation tests, 60 serum samples from alcoholic patients found to be positive by the first-generation anti-HCV ELISA (Ortho) were reexamined by a second-generation anti-HCV enzyme immunoassay (Abbott) and a recombinant immunoblot assay (RIBA II; Chiron). Fifteen serum samples gave contradictory results when they were tested by the two assays. We performed nested polymerase chain reactions (PCRs) to confirm that the discrepancies that we observed could be due to the presence of low levels of anti-HCV antibodies, which were detected by a more sensitive test, or to unspecific positive reactions. Nested PCR revealed the presence of HCV RNA sequences in all anti-HCV-positive sera or sera that were weakly positive by ELISA. Anti-HCV positive by RIBA II was always correlated with the presence of viral RNA in serum, but HCV RNA was detected in RIBA II-negative sera. These results indicate that the specificity of the second-generation tests is an important improvement but that an HCV infection can still persist without detectable antibodies. PCR remains the reference assay to clear up controversial serology results and to detect HCV infection in patients with no anti-HCV-detectable immune response. PMID:1315339

  2. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    Science.gov (United States)

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  3. HEALTH CONCERNS ON FISHERY PRODUCTS: ANTIBIOTIC RESISTANCE AND PARASITE RISK ASSESSMENT IN FISH PRODUCTION VALUE CHAINS

    OpenAIRE

    Smaldone, Giorgio

    2014-01-01

    Capture fisheries and aquaculture supplied the world with about 148 million tonnes of fish in 2010, of which about 128 million tonnes were utilized as food for people. The fishery market is becoming much more complex and stratified, with greater diversification among species and product forms and for this reason food safety remains a major concern facing the seafood industry. Along fish value chain there are a lot of concern regarding public health and for this reason the aim of this work was...

  4. Researches on Risk Evaluation of Green Agro-product Closed Supply Chain

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    Closed supply chain is a superior form of management model of chain supply and an effective means of improving the modernization of agro-product circulation. Based on the research results of the current literatures on supply chain risk and agro-product supply chain, related subjects of the agro-product closed supply chain involving production, management and consumption are studied and analyzed and the primary risking factors in the supply chain system are classified as environmental risk, system risk, information risk, management risk and quality risk. Risk of agro-product closed supply chain is evaluated by using the method of fuzzy comprehensive evaluation and the values are acquired. The result shows that risk of agro-product closed supply chain is moderate with relatively high risk, which basically accords with the present actual situations. It can be seen from the index weights of various levels that the key first-level indices influencing the risks are system risk, information risk, quality and safety risk and the key second-level are the coordinating and controlling ability of core enterprises, the implementation of information traceability and the construction of quality safety system. Therefore, risk of agro-product closed supply chain should be reduced by taking prevention and controlling measures mainly from these aspects.

  5. Operating Analysis of the Closed Supply Chain of Green Agricultural Products Based on Logistics Center

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    This thesis gives the overview of concept and constitution of the closed supply chain of green agricultural products based on logistics center,and the necessity of regarding logistics center as core enterprise.Meanwhile,it analyzes the function of logistics center of agricultural products,namely functions of exchange,collection,distribution,storage and transportation.It also poses the prerequisites of logistics center.The logistics center of agricultural products must have stable profit expectancy,prominent scale,strong appealing power,capacity of bearing market risk and basic thoughts of supply chain management.The functional design of the closed supply chain of green agricultural products has been discussed in 5 aspects,namely logistics center,production base,providers of means of production,retailer and consumer.The operating thoughts of the closed supply chain of green agricultural products based on logistics center are put forward on the basis of the research of operating objective and service target of supply chain as follows:first,based on local principal agricultural products,the logistics center mainly distributes the massed agricultural products;second,it is necessary to choose appropriate strategic cooperative partners to sign contract;third,the operating procedure of supply chain entails bringing in professional managerial talents of supply chain;finally,the relationships of supply chain should be maintained.

  6. Kaon production in heavy ion reactions at intermediate energies

    CERN Document Server

    Fuchs, C

    2006-01-01

    The article reviews the physics related to kaon and antikaon production in heavy ion reactions at intermediate energies. Chiral dynamics predicts substantial modifications of the kaon properties in a dense nuclear environment. The status of the theoretical predictions as well as experimental evidences for medium effects such as repulsive/attractive mass shifts for $K^+/K^-$ are reviewed. In the vicinity of the thresholds, and even more pronounced below threshold, the production of strangeness is a highly collective process. Starting from elementary reaction channels the phenomenology of $K^+$ and $K^-$ production, i.e. freeze-out densities, time scales etc. as derived from experiment and theoretical transport calculations is presented. Below threshold kaon production shows a high sensitivity on the nuclear compression reached in heavy ion reactions. This allows to put constraints on the nuclear equation-of-state which are finally discussed.

  7. Chemical Characterization and Reactivity of Fuel-Oxidizer Reaction Product

    Science.gov (United States)

    David, Dennis D.; Dee, Louis A.; Beeson, Harold D.

    1997-01-01

    Fuel-oxidizer reaction product (FORP), the product of incomplete reaction of monomethylhydrazine and nitrogen tetroxide propellants prepared under laboratory conditions and from firings of Shuttle Reaction Control System thrusters, has been characterized by chemical and thermal analysis. The composition of FORP is variable but falls within a limited range of compositions that depend on three factors: the fuel-oxidizer ratio at the time of formation; whether the composition of the post-formation atmosphere is reducing or oxidizing; and the reaction or post-reaction temperature. A typical composition contains methylhydrazinium nitrate, ammonium nitrate, methylammonium nitrate, and trace amounts of hydrazinium nitrate and 1,1-dimethylhydrazinium nitrate. Thermal decomposition reactions of the FORP compositions used in this study were unremarkable. Neither the various compositions of FORP, the pure major components of FORP, nor mixtures of FORP with propellant system corrosion products showed any unusual thermal activity when decomposed under laboratory conditions. Off-limit thruster operations were simulated by rapid mixing of liquid monomethylhydrazine and liquid nitrogen tetroxide in a confined space. These tests demonstrated that monomethylhydrazine, methylhydrazinium nitrate, ammonium nitrate, or Inconel corrosion products can induce a mixture of monomethylhydrazine and nitrogen tetroxide to produce component-damaging energies. Damaging events required FORP or metal salts to be present at the initial mixing of monomethylhydrazine and nitrogen tetroxide.

  8. Early diagnosis of primary human herpesvirus 6 infection in childhood: Serology, polymerase chain reaction, and virus load

    OpenAIRE

    Chiu, SS; Peiris, M.; Tse, CYC; Cheung, CY

    1998-01-01

    Qualitative and quantitative polymerase chain reaction (PCR) for human herpesvirus 6 (HHV-6) DNA in whole blood and plasma was correlated with serology and clinical assessment in 143 children hospitalized for undifferentiated febrile illness to evaluate options for diagnosis of primary HHV-6 infection on the acute blood specimen. PCR and serology for HHV-7 were done in parallel to define serologic cross-reactions. Using HHV-6 seroconversion as the reference standard, detection of HHV-6 DNA in...

  9. Detection of Paragonimus heterotremus eggs in experimentally infected cats by a polymerase chain reaction-based method.

    Science.gov (United States)

    Intapan, Pewpan M; Wongkham, Chaisiri; Imtawil, Kanokwan J; Pumidonming, Wilawan; Prasongdee, Thidarat K; Miwa, Masanao; Maleewong, Wanchai

    2005-02-01

    A polymerase chain reaction (PCR) procedure for the detection of Paragonimus heterotremus eggs in stool samples was developed and compared with Stoll's egg count method. The primers were designed on the basis of a previously constructed pPH-13-specific DNA probe, which produced an approximate 0.5-kb amplified product. This PCR method could detect as few as 5 eggs in 0.6 g of artificially inoculated feces of a healthy control cat or as little as 1 x 10(-4) ng of P. heterotremus genomic DNA. The assay had 100% sensitivity in all infected cats. The method did not yield an approximate 0.5-kb product with DNA from other parasites such as Gnathostoma spinigerum, Trichinella spiralis, Fasciola gigantica, Echinostoma malayanum, Opisthorchis viverrini, Dirofilaria immitis, and Taenia saginata; exceptions were Paragonimus siamensis and Paragonimus westermani. In addition, no genomic DNA from Escherichia coli, Burkholderia pseudomallei, Acinetobacter anitratus, Mycobacterium tuberculosis, Staphylococcus aureus, beta-Streptococcus grA, and Proteus mirabilis or from the vertebrate and invertebrate hosts of P. heterotremus was amplified in the PCR assay. This assay has great potential for application in clinical epidemiological studies.

  10. A multiplex reverse transcription-polymerase chain reaction assay for Newcastle disease virus and avian pneumovirus (Colorado strain).

    Science.gov (United States)

    Ali, A; Reynolds, D L

    2000-01-01

    Newcastle disease virus (NDV) and avian pneumovirus (APV) cause Newcastle disease and rhinotracheitis respectively, in turkeys. Both of these viruses infect the respiratory system. A one-tube, multiplex, reverse transcription-polymerase chain reaction (RT-PCR) assay for the detection of both NDV and Colorado strain of APV (APV-Col) was developed and evaluated. The primers, specific for each virus, were designed from the matrix protein gene of APV-Col and the fusion protein gene of NDV to amplify products of 631 and 309 nucleotides, respectively. The multiplex RT-PCR assay, for detecting both viruses simultaneously, was compared with the single-virus RT-PCR assays for its sensitivity and specificity. The specific primers amplified products of predicted size from each virus in the multiplex as well as the single-virus RT-PCR assays. The multiplex RT-PCR assay was determined to be equivalent to the single-virus RT-PCR assays for detecting both NDV and APV-Col. This multiplex RT-PCR assay proved to be a sensitive method for the simultaneous and rapid detection of NDV and APV-Col. This assay has the potential for clinical diagnostic applications.

  11. Game Analysis and Countermeasures on Increasing Prices of Agricultural Products under Triple Supply Chain

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    From the perspective of supply chain of agricultural products,by establishing Stackelberg game model based on triple supply chain,this paper researches the price formation and profit distribution mechanism of agricultural products under circumstance of non-cooperation and cooperation.The results show the main factors responsible for the hiking of prices of agricultural products as follows:the cost of agricultural products climbs incessantly;the circulation cost hovers at high level;the factor inputs of agricultural products are short;inflation pressure is incessantly mounting;the profit distribution of supply chain is irrational.Finally,corresponding countermeasures are put forward.

  12. Enhanced production of branched-chain fatty acids by replacing β-ketoacyl-(acyl-carrier-protein) synthase III (FabH).

    Science.gov (United States)

    Jiang, Wen; Jiang, Yanfang; Bentley, Gayle J; Liu, Di; Xiao, Yi; Zhang, Fuzhong

    2015-08-01

    Branched-chain fatty acids (BCFAs) are important precursors for the production of advanced biofuels with improved cold-flow properties. Previous efforts in engineering type II fatty acid synthase (FAS) for BCFA production suffered from low titers and/or the co-production of a large amount of straight-chain fatty acids (SCFAs), making it nearly impossible for further conversion of BCFAs to branched biofuels. Synthesis of both SCFAs and BCFAs requires FabH, the only β-ketoacyl-(acyl-carrier-protein) synthase in Escherichia coli that catalyzes the initial condensation reaction between malonyl-ACP and a short-chain acyl-CoA. In this study, we demonstrated that replacement of the acetyl-CoA-specific E. coli FabH with a branched-chain-acyl-CoA-specific FabH directed the flux to the synthesis of BCFAs, resulting in a significant enhancement in BCFA titer compared to a strain containing both acetyl-CoA- and branched-chain-acyl-CoA-specific FabHs. We further demonstrated that the composition of BCFAs can be tuned by engineering the upstream pathway to control the supply of different branched-chain acyl-CoAs, leading to the production either even-chain-iso-, odd-chain-iso-, or odd-chain-anteiso-BCFAs separately. Overall, the top-performing strain from this study produced BCFAs at 126 mg/L, comprising 52% of the total free fatty acids. PMID:25788017

  13. Effects of climate change on food safety hazards in the dairy production chain

    NARCIS (Netherlands)

    Spiegel, van der M.; Fels-Klerx, van der H.J.; Marvin, H.J.P.

    2012-01-01

    The aim of this study is to analyse the effect of climate change on emerging food safety hazards in the dairy production chain. For this purpose, a holistic approach was used to select critical factors from inside and outside the production chain that are affected by climatic factors. An expert judg

  14. The causes and determination of safety stocks in upstream supply chains for mass production of customized products

    OpenAIRE

    CAMISULLIS, Carole; Giard, Vincent; Mendy-Bilek, Gisele

    2010-01-01

    In an upstream supply chain dedicated to the mass production of customized products, many sources create production instability: the level and structure of production in the final assembly line, variability of lead times, quality issues, packaging and loading constraints on transportation, demand anticipation, and the synchronization of the flows of components sent, received, and produced. For periodic replenishment systems, each member of the supply chain must have two different safety stock...

  15. Greenhouse gas emissions in milk and dairy product chains: Improving the carbon footprint of dairy products

    Energy Technology Data Exchange (ETDEWEB)

    Flysjoe, A.M.

    2012-11-01

    The present PhD project has focused on some of the most critical methodological aspects influencing GHG emission estimates of milk and dairy products and how the methodology can be improved. In addition, the Carbon Footprint (CF) for different types of dairy products has been analysed. Based on these results, mitigation options have been identified along the entire dairy value chain. The key methodological challenges analysed in the present study are: estimation of CH{sub 4} and N{sub 2}O emissions, assessment of CO{sub 2} emissions from land use change (LUC), co-product handling, and definition of the functional unit. Estimates of the biogenic emissions CH{sub 4} and N{sub 2}O are associated with large uncertainties due to the complexity and natural variation in biological processes. Accounting for these variations resulted in a {+-}30-50% variation in the CF for milk in Sweden and New Zealand (excluding emissions from LUC). The inclusion of emissions from LUC can drastically affect the CF of dairy products, and different models can even provide contradictory results. Thus, it is suggested that emissions associated with LUC are reported separately and that underlying assumptions are clearly explained. Accounting for the by-product beef is decisive for the CF of milk, and when designing future strategies for the dairy sector, milk and meat production needs to be addressed in an integrated approach. It is shown that an increase in milk yield per cow does not necessarily result in a lower CF of milk, when taking into account the alternative production of the by-product beef. This demonstrates that it is important to investigate interactions between different product chains, i.e. to apply system thinking. The CF of dairy products from Arla Foods analysed in the present study range from: 1.2-5.5 kg CO{sub 2}e per kg fresh dairy products, 7.3-10.9 kg CO{sub 2}e per kg butter and butter blends, 4.5-9.9 kg CO{sub 2}e per kg cheese, and 1.0-17.4 kg CO{sub 2}e per kg milk

  16. Detection of hblA and bal Genes in Bacillus cereus Isolates From Cheese Samples Using the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Molayi Kohneshahri

    2016-03-01

    Full Text Available Background Bacillus cereus is a Gram-positive spore-forming bacterium, which causes food poisoning. Spores enable the persistence of B. cereus in the environment, and B. cereus strains can tolerate adverse environmental conditions, such as temperature and insufficient nutrients. B. cereus causes food poisoning via the production of two enterotoxins. Most isolates produce toxins leading to diarrhea (enterotoxins and vomiting (emetic forms. Diarrhea is caused by the production of three different heat-labile enterotoxins: HBL, NHE, and cytotoxin K. A heat-stable toxin, cereulide, is responsible for emesis. Objectives This study aimed to detect enterotoxigenic B. cereus isolates in cheese samples using the polymerase chain reaction (PCR. Materials and Methods Two-hundred pasteurized (n = 100 and nonpasteurized (n = 100 cheese samples were collected. The initial isolation was performed on PEMBA specific medium. Antibiotic susceptibility testing was performed using several antibiotic disks, according to the guidelines of the Clinical Laboratory and Standards Institute. Specific primers amplifying the hblA enterotoxin-encoding gene and bal hemolysin-encoding gene were used for the molecular detection of the toxins. Results Ten samples were positive for the presence of B. cereus, with both Gram staining and biochemical reactions. All the isolates were resistant to penicillin and ampicillin but susceptible to vancomycin, erythromycin, and ciprofloxacin. Six and three isolates were resistant to tetracycline and trimethoprim-sulfamethoxazole, respectively. The hblA and bal genes were amplified in all the B. cereus isolates. Conclusions The prevalence of B. cereus among the cheese samples was low. All the isolates were positive for genes encoding the hblA enterotoxin and bal toxin.

  17. Game Analysis and Countermeasures on Increasing Prices of Agricultural Products under Triple Supply Chain

    OpenAIRE

    Liu, Tao

    2011-01-01

    From the perspective of supply chain of agricultural products, by establishing Stackelberg game model based on triple supply chain, this paper researches the price formation and profit distribution mechanism of agricultural products under circumstance of non-cooperation and cooperation. The results show the main factors responsible for the hiking of prices of agricultural products as follows: the cost of agricultural products climbs incessantly; the circulation cost hovers at high level; the ...

  18. Thermochemical Reactions for Solar Energy Storage and Fuel Production

    OpenAIRE

    Roeb, Martin; Sattler, Christian

    2013-01-01

    Thermochemical multistep processes are promising options to face future energy problems. Such reactions can be used to enhance the availability of solar energy in terms of energy transport, of energy demand/supply management and of potential energy related applications. Coupling concentrated sunlight to suitable sequences of thermochemical reaction enables the production of hydrogen, syngas and other fuels derived from those precursors by water- and CO2-splitting as well as the storage of sol...

  19. Detection of human papillomavirus DNA by in situ hybridization and polymerase chain reaction in human papillomavirus equivocal and dysplastic cervical biopsies.

    Science.gov (United States)

    Shroyer, K R; Lovelace, G S; Abarca, M L; Fennell, R H; Corkill, M E; Woodard, W D; Davilla, G H

    1993-09-01

    One hundred twenty-one paraffin-embedded cervical biopsy specimens were tested for the presence of human papillomavirus (HPV) DNA by in situ hybridization and polymerase chain reaction. By in situ hybridization using probes for HPV types 6/11, 16/18, 31/33/35, 42/43/44, 51/52, and 45/56, HPV DNA was found in none of 20 normal/squamous metaplasia biopsy specimens, in one of 76 HPV equivocal biopsy specimens, in seven of 12 condyloma/mild dysplasia biopsy specimens, and in 12 of 13 moderate/severe dysplasia biopsy specimens. Polymerase chain reaction using HPV L1 consensus sequence primers followed by filter hybridization of the amplification products was positive for HPV DNA in two of 20 normal/squamous metaplasia biopsy specimens, in 23 of 76 HPV equivocal biopsy specimens, in eight of 12 condyloma/mild dysplasia biopsy specimens, and in 12 of 13 moderate/severe dysplasia biopsy specimens. Among biopsies that tested positive by polymerase chain reaction but that were negative by in situ hybridization, the most commonly identified HPV was type 16. We conclude that although HPV equivocal biopsy specimens contain HPV DNA more frequently than histologically normal tissue, the majority of biopsy specimens in this category test negative for HPV DNA. The clinical significance of a positive test for HPV, in the absence of unequivocal histologic changes, remains to be determined.

  20. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  1. Identification of related DNA sequences in Borrelia burgdorferi and two strains of Leptospira interrogans by using polymerase chain reaction.

    OpenAIRE

    Kron, M A; Gupta, A; Mackenzie, C. D.

    1991-01-01

    The suitability of a polymerase chain reaction assay for Borrelia burgdorferi in epidemiological studies of infected tick populations was evaluated by using 28 strains of Leptospira interrogans and lysates of fixed adult Ixodes tick tissues. Two false positives representing leptospires were differentiated from B. burgdorferi by using an oligonucleotide probe.

  2. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjaerg, L L; Hansen, J E; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot...

  3. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    Science.gov (United States)

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence.

  4. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;

    2007-01-01

    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR...

  5. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  6. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Johansen, Markku; Jorsal, Sven Erik Lind;

    2014-01-01

    obtained by averaging test results from individual fecal samples in relation to a quantitative polymerase chain reaction (qPCR) test for Lawsonia intracellularis. Ten diarrheic and 10 normal fecal samples were submitted from each of 43 Danish swine herds (n = 860 fecal samples). Pools (n = 43), each...

  7. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    Science.gov (United States)

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  8. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.;

    1999-01-01

    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot...

  9. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Science.gov (United States)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  10. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    Science.gov (United States)

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  11. Testing vaccines in human experimental malaria: statistical analysis of parasitemia measured by a quantitative real-time polymerase chain reaction.

    NARCIS (Netherlands)

    Hermsen, C.C.; Vlas, S.J. de; Gemert, G.J.A. van; Telgt, D.S.C.; Verhage, D.F.; Sauerwein, R.W.

    2004-01-01

    Clinical trials are an essential step in evaluation of safety and efficacy of malaria vaccines, and human experimental malaria infections have been used for evaluation of protective immunity of Plasmodium falciparum malaria. In this study, a quantitative real-time polymerase chain reaction was used

  12. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    Institute of Scientific and Technical Information of China (English)

    Yuhki Sakuraoka; Tokihiko Sawada; Takayuki Shiraki; Kyunghwa Park; Yuhichiro Sakurai; Naohisa Tomosugi; Keiichi Kubota

    2012-01-01

    AIM:TO establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).METHODS:Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC.Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years.Quantitative PCR was performed.Immunohistochemistry and in situ hybridization for hepcidin were also performed.RESULTS:Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully.The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues.A method of in situ hybridization for hepcidin was established successfully,and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue.CONCLUSION:We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  13. Modeling the Manipulation of Natural Populations by the Mutagenic Chain Reaction.

    Science.gov (United States)

    Unckless, Robert L; Messer, Philipp W; Connallon, Tim; Clark, Andrew G

    2015-10-01

    The use of recombinant genetic technologies for population manipulation has mostly remained an abstract idea due to the lack of a suitable means to drive novel gene constructs to high frequency in populations. Recently Gantz and Bier showed that the use of CRISPR/Cas9 technology could provide an artificial drive mechanism, the so-called mutagenic chain reaction (MCR), which could lead to rapid fixation of even a deleterious introduced allele. We establish the near equivalence of this system to other gene drive models and review the results of simple models showing that, when there is a fitness cost to the MCR allele, an internal equilibrium may exist that is usually unstable. In this case, introductions must be at a frequency above this critical point for the successful invasion of the MCR allele. We obtain estimates of fixation and invasion probabilities for the appropriate scenarios. Finally, we discuss how polymorphism in natural populations may introduce sources of natural resistance to MCR invasion. These modeling results have important implications for application of MCR in natural populations. PMID:26232409

  14. Detection of herpesviral sequences in tissues of green turtles with fibropapilloma by polymerase chain reaction.

    Science.gov (United States)

    Lu, Y; Wang, Y; Yu, Q; Aguirre, A A; Balazs, G H; Nerurkar, V R; Yanagihara, R

    2000-01-01

    An alpha-herpesvirus has been associated recently with green turtle fibropapilloma (FP). To further clarify the role of this newfound green turtle herpesvirus (GTHV) in the pathogenesis of FP, various normal-appearing tissues and organs (including skin, eye, brain, heart, liver, spleen, intestine, lung, kidney, nerve, gonad, tongue, gall bladder, urinary bladder, thyroid and peripheral blood mononuclear cells (PBMC) from blood) and tumor tissues from 19 green turtles (Chelonia mydas) with FP, and tissues from three green turtles without FP, collected during 1997 to 1999 in the Hawaiian Islands, were tested for GTHV sequences by nested polymerase chain reaction (PCR), using GTHV-specific oligonuclotide primers. GTHV sequences were detected in all tumors (51/51) and most tissues (133/167) of tumored turtles. By contrast, such sequences were undetectable in tissues (0/28) of three non-tumored turtles. Analysis of GTHV sequences detected in different tissues and tumors revealed a low degree of genetic diversity (green turtles and its absence in tissues of non-tumored turtles, argues for an etiologic role in FP.

  15. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Science.gov (United States)

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  16. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Laure F Pittet

    Full Text Available Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR. In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old, formerly diagnosed as Bordetella pertussis (IS481+. No B. holmesii (IS481+, IS1001-, hIS1001+ was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  17. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens

    Directory of Open Access Journals (Sweden)

    Adriana Antônia da Cruz Furini

    2013-12-01

    Full Text Available OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens.METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results.RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard, we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively.CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis.

  18. Improvement of Temperature Uniformity for Polymerase Chain Reaction Chip with Heat Spreader

    Science.gov (United States)

    Chen, Rong-Sheng; Mao, Chao-Yang; Chen, Yung-Shieng

    2007-11-01

    For polymerase chain reaction (PCR) applications, a uniform temperature field in the microreactor is crucial. In this paper, we report on the electrothermal and computational fluid dynamics (CFD) simulations performed with the aim of optimizing the temperature distribution by heat spreaders for PCR application. Firstly, the equivalent resistivity of the microresistor heater is evaluated, and a conformable result is then verified by comparing with the experimental result using a prototype PCR chip. Secondly, the temperature distribution at 94 °C in the PCR chip is investigated. Furthermore, a heat spreader is inserted into the PCR chip to reduce the temperature difference in the DNA sample and thus improve the temperature uniformity effectively. The results demonstrated that the effective volume percentage and the energy consumption in the chamber are positively related to the thickness of the heat spreader, while the temperature difference is inversely related to the thickness of the heat spreader. Finally, the (b)-design is better than the (a)-design in terms of both the increase in effective volume percentage of the DNA sample and the decrease in energy consumption. In other words, the (b)-design is recognized as having better temperature uniformity.

  19. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Science.gov (United States)

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  20. Analysis of adult otitis media: polymerase chain reaction versus culture for bacteria and viruses.

    Science.gov (United States)

    Liederman, E M; Post, J C; Aul, J J; Sirko, D A; White, G J; Buchman, C A; Ehrlich, G D

    1998-01-01

    Recent studies using the polymerase chain reaction (PCR) have identified bacterial and viral genomic sequences in culture-negative pediatric middle ear effusions. To evaluate this technique in adults, 19 effusions were analyzed to compare bacterial and viral culture and PCR detection of Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and adenovirus. Effusions from 4 subjects positive for human immunodeficiency virus (HIV) were analyzed by PCR for HIV virus. Three of 19 effusions were culture-positive for bacteria, and 0 of 19 for viruses. Fifteen of 19 effusions were PCR-positive for bacterial genomic sequences, and 0 of 19 for adenovirus. Thirteen of 15 PCR-positive specimens demonstrated S pneumoniae, 5 of 15 H influenzae, and 0 of 13 M catarrhalis. All 4 effusions from HIV-positive subjects were PCR-positive for HIV. No effusion was culture-positive and PCR-negative. These results confirm that culture-negative middle ear effusions contain genomic sequences from bacterial pathogens. Finding of HIV RNA and DNA in effusion from HIV-positives suggests replicating virus in this fluid.

  1. Improving Nuclear Safety of Fast Reactors by Slowing Down Fission Chain Reaction

    Directory of Open Access Journals (Sweden)

    G. G. Kulikov

    2014-01-01

    Full Text Available Light materials with small atomic mass (light or heavy water, graphite, and so on are usually used as a neutron reflector and moderator. The present paper proposes using a new, heavy element as neutron moderator and reflector, namely, “radiogenic lead” with dominant content of isotope 208Pb. Radiogenic lead is a stable natural lead. This isotope is characterized by extremely low micro cross-section of radiative neutron capture (~0.23 mb for thermal neutrons, which is smaller than graphite and deuterium cross-sections. The reflector-converter for a fast reactor core is the structure capable of transforming some part of prompt neutrons leaked from the core into the reflected neutrons with properties similar to those of delayed neutrons, that is, sufficiently large contribution to reactivity at the level of effective fraction of delayed neutrons and relatively long lifetime, comparable with lifetimes of radionuclides-emitters of delayed neutrons. It is evaluated that the use of radiogenic lead makes it possible to slow down the chain fission reaction on prompt neutrons in the fast reactor. This can improve the fast reactor safety and reduce some requirements to the technologies used to fabricate fuel for the fast reactor.

  2. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    Directory of Open Access Journals (Sweden)

    Parvin Hassanzadeh

    2012-03-01

    Full Text Available Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain reaction (PCR. The aim of this study was to evaluate the prevalence of Chlamydia trachomatis infection in pregnant women referred to a teaching hospital affiliated to Shiraz University of Medical Sciences. Urine samples were obtained from 210 pregnant women and investigated microscopically and macroscopically by urinalysis. Precipitants were also used for DNA extraction and PCR test for detecting Chlamydia trachomatis. Among 210 urine specimens from women aged 15-39 years, none were positive for Chlamydia trachomatis by PCR. In spite of the high sensitivity and specificity of PCR, and the elimination of inhibitory effects on PCR test, no pregnant woman was positive for Chlamydia trachomatis. Here, we suggest that a larger sample should be studied and other sensitive methods could also be used in the future.

  3. Human papillomavirus infection in lung vs. oral squamous cell carcinomas: a polymerase chain reaction study.

    Science.gov (United States)

    Halimi, M; Morshedi Asl, S

    2011-06-01

    The role of Human Papillomavirus (HPV) has been suspected in pathogenesis of various malignancies; however, the available data are not conclusive. This study aimed to determine and compare the frequency of HPV infection in oral and lung Squamous Cell Carcinoma (SCC) by a sensitive method. Sixty specimens of oral and lung SCC (30 cases each one) were reevaluated in Tabriz Imam Reza Centre in a 24 month period. Following genomic DNA extract, the Polymerase Chain Reaction (PCR) amplification was performed in presence of specific MY11 and MY09 primers for HPV infection. Three cervical specimens and a combination of PCR solution lacking DNA plus healthy persons' DNA samples were employed as positive and negative controls, respectively. The oral group was significantly older than the lung group (68.90 vs. 56.67 y, p infection in the oral and lung groups were comparable (20 vs. 10%, respectively; p = 0.47). Majority of patients with HPV infection were older than 60 years (88.9%) or male (88.9%). In the oral group, all these cases were well differentiated and the majority was of lower lip origin (83.3%). In the lung group, 66.7% of these specimens were moderately differentiated and the origin was bronchus in all cases. In conclusion, the rate of HPV infection in lung and oral SCC samples is rather lower than the previous reports in the literature. This rate is apparently higher in the oral than the lung SCC specimens. PMID:22235505

  4. Design, construction, and validation of a modular library of sequence diversity standards for polymerase chain reaction.

    Science.gov (United States)

    Baum, Paul D; Young, Jennifer J; Zhang, Qianjun; Kasakow, Zeljka; McCune, Joseph M

    2011-04-01

    Methods to measure the sequence diversity of polymerase chain reaction (PCR)-amplified DNA lack standards for use as assay calibrators and controls. Here we present a general and economical method for developing customizable DNA standards of known sequence diversity. Standards ranging from 1 to 25,000 sequences were generated by directional ligation of oligonucleotide "words" of standard length and GC content and then amplified by PCR. The sequence accuracy and diversity of the library were validated using AmpliCot analysis (DNA hybridization kinetics) and Illumina sequencing. The library has the following features: (i) pools containing tens of thousands of sequences can be generated from the ligation of relatively few commercially synthesized short oligonucleotides; (ii) each sequence differs from all others in the library at a minimum of three nucleotide positions, permitting discrimination between different sequences by either sequencing or hybridization; (iii) all sequences have identical length, GC content, and melting temperature; (iv) the identity of each standard can be verified by restriction digestion; and (v) once made, the ends of the library may be cleaved and replaced with sequences to match any PCR primer pair. These standards should greatly improve the accuracy and reproducibility of sequence diversity measurements.

  5. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    Science.gov (United States)

    Souza, M T; Carvalho-Zilse, G A

    2014-01-01

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species. PMID:25117306

  6. Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.

    Science.gov (United States)

    Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin

    2010-03-01

    Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.

  7. Salmonellae in fish feces analyzed by in situ hybridization and quantitative polymerase chain reaction.

    Science.gov (United States)

    Sha, Qiong; Forstner, Michael R J; Bonner, Timothy H; Hahn, Dittmar

    2013-09-01

    The potential of fish to transfer salmonellae from heterogeneous aquatic biofilms into feces was assessed in controlled aquarium studies with Suckermouth Catfish Hypostomus plecostomus and with biofilms inoculated with salmonellae. Neither the presence of catfish nor inoculation with salmonellae had detectable effects on the abundance of the microbial community. Densities of the microbial community were about 10(5) cells/mL in the water during a 1-week period, whereas densities of the microbial community increased 10-fold (10(6) to 10(7) cells/mg) in catfish feces during the same period. Salmonellae were detected by both quantitative polymerase chain reaction (qPCR) and situ hybridization in water samples immediately after inoculation, in numbers of about 10(4) cells/mL, representing up to 20% of the cells of the microbial community. Numbers decreased by three orders of magnitude within the first 3 d of the study, which represented only 0.01% of the community, and became undetectable after day 5. In catfish feces, numbers of Salmonella initially increased to up to 6% of the cells of the community but then declined. These results suggest that Salmonella are not biomagnified during gut passage, and thus, fish only provide a means for the translocation of this pathogen.

  8. Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction.

    Science.gov (United States)

    Hough, Angela J; Harbison, Sally-Ann; Savill, Marion G; Melton, Laurence D; Fletcher, Graham

    2002-08-01

    A quantitative real-time polymerase chain reaction (PCR) detection method specific for Listeria monocytogenes was developed, and studies involving pure culture showed that the response of the assay was linear over 7 log10 (log) cycles. The method was then applied to the detection of L. monocytogenes artificially inoculated onto cabbage, a vegetable chosen because it is a major component of coleslaw, which has been associated with an outbreak of listeriosis. After being allowed to attach to the food, cells were washed from the cabbage leaf surface and recovered by centrifugation. The DNA was purified by an organic solvent extraction technique and analyzed by real-time PCR. In this matrix, the method again produced a linear response over 7 log cycles from 1.4 x 10(2) to 1.4 x 10(9) CFU of L. monocytogenes in 25 g of cabbage, and analysis of the reproducibility of the system showed that log differences in L. monocytogenes numbers added to cabbage could be reliably distinguished. The system allowed quantitative results to be obtained within 8 h and was relatively inexpensive, showing good potential for routine analytical use. PMID:12182489

  9. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  10. Improved Multiplex Polymerase Chain Reaction for Rapid Staphylococcus Aureus Detection in Meat and Milk Matrices

    Directory of Open Access Journals (Sweden)

    Šramková Zuzana

    2016-06-01

    Full Text Available Staphylococcal food poisoning represents one of the most frequently occurring intoxications, caused by staphylococcal enterotoxins (SE-s and staphylococcal enterotoxin-like proteins (SEl-s. Therefore, there is a need for rapid, sensitive and specific detection method for this human pathogen and its toxin genes in food matrices. The present work is focused on Staphylococcus aureus detection by a nonaplex polymerase chain reaction, which targets the 23S rRNA gene for identification of S. aureus at the species level, genes for classical SE-s (SEA, SEC, SED, new SE-s (SEH, SEI, SEl-s (SEK, SEL and tsst-1 gene (toxic shock syndrome toxin. Primers were properly designed to avoid undesirable interactions and to create a reliably identifiable profile of amplicons when visualized in agarose gel. According to obtained results, this approach is able to reach the detection sensitivity of 12 colony forming units from milk and meat matrices without prior culturing and DNA extraction.

  11. The utility of the polymerase chain reaction assay for aetiologic definition of unspecified bacterial meningitis cases

    Directory of Open Access Journals (Sweden)

    Mari Tuyama

    2008-03-01

    Full Text Available Most patients with acute suppurative meningitis are otherwise healthy individuals with regard to immune mechanisms against invasive bacterial disease. This medical emergency is among the most dramatic and potentially ravaging diseases that affect humans, particularly young children. The illness often strikes suddenly, and can either result in death or leave the survivors with significant neurological dysfunctions. The demonstration of a bacterial aetiology is necessary for decisions regarding treatment and prophylaxis. Conventional bacteriological methods frequently fail to identify an agent, as a result of administration of antibiotics or delayed lumbar punctures. We investigated the major aetiologic sources of unspecified bacterial meningitis cases (G00.9, ISCD-10 by polymerase chain reaction (PCR-based identification of Neisseria meningitidis (crgA, Streptococcus pneumoniae (ply and Haemophilus influenzae (bexA in cerebrospinal fluid samples. The multiplex PCR detected N. meningitidis in 92%, S. pneumoniae in 4% and H. influenzae in 1% of the 192 clinical samples assayed; 3% were negative for all three DNA targets. Bacterial DNA detection was found to be a valuable adjunct to enhance bacterial meningitis surveillance when the yield of specimens by culture is reduced. The implementation of PCR assays as a diagnostic procedure in Public Health Laboratories is perceived to be a significant advance in the investigation of bacterial meningitis.

  12. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Science.gov (United States)

    Costa, Daniela Camargos; Madureira, Ana Paula; Amaral, Lara Cotta; Sanchez, Bruno Antônio Marinho; Gomes, Luciano Teixeira; Fontes, Cor Jésus Fernandes; Limongi, Jean Ezequiel; Brito, Cristiana Ferreira Alves de; Carvalho, Luzia Helena

    2014-02-01

    The polymerase chain reaction (PCR)-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene) were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34) of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  13. Mechanisms of Propidium Monoazide Inhibition of Polymerase Chain Reaction and implications for Propidium Monoazide Applications

    Science.gov (United States)

    Lee, C. M.; Darrach, H.; Ponce, A.; McFarland, E.; Laymon, C.; Fingland, N. K.

    2015-12-01

    PMA-qPCR is a laboratory technique that can be used to identify viable microbes by employing the use of propidium monoazide (PMA), a DNA-intercalating dye, and quantitative polymerase chain reaction (qPCR). The current model of PMA-qPCR operates under the assumption that PMA is only capable of entering membrane-compromised cells, where it irreversibly cross-links to DNA and makes it unavailable for amplification via qPCR. However, the exact mechanism behind PMA's entry into the cell and its interaction with genetic material is not well understood. To better understand PMA's capabilities, we have examined the effect PMA has on enzyme binding and processivity using endonucleases and exonucleases. Our results suggest that the current model behind PMA-qPCR inhibition is incomplete, in that rather than precipitating the entirety of the DNA, PMA also inhibits enzyme binding and/or processivity in soluble DNA. These results have important implications for studying the viable community of microorganisms in various applications, such as environmental monitoring, planetary protection and bioburden assessment, and biohazard detection.

  14. Laboratory reporting accuracy of polymerase chain reaction testing for avian polyomavirus.

    Science.gov (United States)

    Fitzgerald, Brenna; Olsen, Geoff; Speer, Brian

    2013-03-01

    Polymerase chain reaction (PCR) assays are available for detection of birds infected with avian polyomavirus (APV). Several laboratories offer this diagnostic assay in the United States, but little information is available regarding assay sensitivity, specificity, and accuracy. In this study, known APV-positive and APV-negative samples (each n = 10, 5 undiluted and 5 diluted) were sent to 5 commercial laboratories. A significant difference in reporting accuracy was found among laboratories, most notably for dilute APV-positive samples. Two out of 5 laboratories provided 100% accurate results, 1 had an accuracy of 90%, and 2 reported 80% and 75% accuracy, respectively. The accuracies of the last 2 laboratories were negatively affected by test sensitivities of 60% and 50%, respectively. These findings show that although accurate results were reported by most laboratories, both false-positive and false-negative results were reported by at least 3 laboratories, and false-negative results reported for dilute APV-positive samples predominated. These study findings illustrate a need for veterinary diagnostic laboratories to institute improved voluntary quality control measures.

  15. Genital infection caused by Entamoeba histolytica confirmed by polymerase chain reaction analyses.

    Science.gov (United States)

    Asano, Hiroshi; Kaneuchi, Masanori; Furuta, Itsuko; Yamaya, Yukie; Hatanaka, Kanako C; Takeda, Mahito; Matsuno, Yoshihiro; Sakuragi, Noriaki

    2014-05-01

    Entamoeba histolytica is estimated to infect approximately 1% of the global population. In Japan, the prevalence of amebic dysentery has been increasing, with more than 800 patients newly diagnosed annually. However, genital infection with E. histolytica is uncommon even in endemic areas. We present a case of vaginitis caused by E. histolytica. A 50-year-old Japanese woman without history of overseas travel presented to a nearby clinic with increased vaginal discharge. She had hemorrhagic erosion at the uterine cervix with yellowish vaginal discharge, and was referred to our hospital for exclusion of malignancy. Cervical cytology revealed periodic acid-Schiff-positive protozoa not aggregating around squamous cells, and thus amebic vaginitis was suspected. We performed polymerase chain reaction (PCR) analyses and identified E. histolytica. The vaginitis was treated with metronidazole, and the disappearance of amebic protozoa was confirmed by cytology and PCR. Therefore, it may be important to obtain early diagnosis by cervical cytology and PCR.

  16. Polymerase chain reaction and real-time PCR for diagnosing of Leishmania infantum chagasi in dogs.

    Science.gov (United States)

    Ramos, Rafael Antonio do Nascimento; Ramos, Carlos Alberto do Nascimento; Jusi, Márcia Mariza Gomes; de Araújo, Flábio Ribeiro; Machado, Rosangela Zacarias; Faustino, Maria Aparecida da Glória; Alves, Leucio Câmara

    2012-01-01

    The importance of dogs as a reservoir for Leishmania infantumchagasi in urban environments has stimulated numerous studies assessing diagnostic techniques. When performed properly, such procedures are an important step in preventing leishmaniasis in humans. Molecular methods have become prominent for this purpose. The aim of the present study was to determine the performance of the polymerase chain reaction (PCR) and real-time PCR (qPCR) for diagnosing of canine visceral leishmaniasis (CVL) using different biological samples. For this, 35 dogs from an area endemic for CVL were used. Bone marrow aspirate and lymph node and spleen fragments from these dogs were used for the molecular diagnosis. In the present study, qPCR was able to detect a greater number of positive animals than seen with PCR. Among the different biological samples used, there was no significant difference in L. infantumchagasi DNA detection between PCR and qPCR. However, considering that lymph nodes are easy to acquire, these can be considered to be the best samples for making molecular diagnoses of L. infantum chagasi infection.

  17. DIFFERENTIATION OF PSEUDOCONDYLOMA OF VULVA AND CONDYLOMA ACUMINATA BY DOT BLOT HYBRIDIZATION AND POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿

    1996-01-01

    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  18. DETECTION OF PATHOGENS CAUSING GENITAL ULCER DISEASE BY MULTIPLEX POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    Ai-ying Liu; Ming-jun Jiang; Yue-ping Yin; Jiang-fang Sun

    2005-01-01

    Objective To establish a multiplex polymerase chain reaction (M-PCR) assay for simultaneous detection of pathogens causing genital ulcer disease (GUD).Methods Based on the gene-specific region of the following pathogens: Chlamydia trachomatis ompl/ompb, herpes simplex virus (HSV) DNA polymerase, Treponema pallidum tpp47, Haemophilus ducreyi 16s rRNA, four sets of primers were designed and an M-PCR assay was developed to detect four pathogens in one test. The assay was evaluated with diagnostic result of golden standard for each pathogen.Results Of the 51 clinical samples, M-PCR showed slightly higher positive rate (47.1%) of HSV than cell culture (23.6%).Meanwhile, the positive rate of T. p allidum detected by M-PCR and dark-field microscopy was 19.6% ( 10/51) and 15.7% (8/51),respectively. Only one sample was positive for H. ducreyiand no sample was positive for C. trachomatis detected by both M-PCR assay and culture.Conclusion This primary study indicated that M-PCR assay can simultaneously and rapidly detect the four etiologic pathogens causing GUD.

  19. Molecular sexing of birds: A comparative review of polymerase chain reaction (PCR)-based methods.

    Science.gov (United States)

    Morinha, F; Cabral, J A; Bastos, E

    2012-09-01

    Accurate identification of sex in birds is important for the management and conservation of avian wildlife in several ways, namely in the development of population, behavioral and ecological studies, as well as in the improvement of ex situ captive breeding programs. In general, nestlings, juveniles and adult birds of a wide number of sexually monomorphic species cannot be sexed based on phenotypic traits. The development of molecular methodologies for avian sexing overcame these difficulties, allowing a reliable gender differentiation for these species. The polymerase chain reaction (PCR)-based methods have been widely applied in molecular sexing of birds, using a large diversity of sex-linked markers. During the last 15 yrs, there was a continuous improvement in the PCR-based protocols for bird sexing, increasing the accuracy, speed and high-throughput applicability of these techniques. The recent advances in real-time PCR platforms and whole genome analysis methods provided new resources for the detection and analysis of novel specific markers and protocols. This review presents a comparative guide of classical and recent advances in PCR-based methods for avian molecular sexing, highlighting its strengths and limitations. Future research opportunities in this field are also addressed.

  20. Diagnosis of Streptococcus pneumoniae meningitis by polymerase chain reaction amplification of the gene for pneumolysin

    Directory of Open Access Journals (Sweden)

    Juliana de A Matos

    2006-08-01

    Full Text Available Diagnosis of bacterial meningitis has long been based on classical methods of Gram stain, serological tests, and culture of cerebrospinal fluid (CSF. The performance of these methods, especially culture and direct smear, is thwarted by failure to detect bacteria following administration of antimicrobial agents and reluctance to performance lumbar punctures at admission. Indeed, patients with meningitis frequently receive antibiotics orally or by injection before the diagnosis is suspected or established. Thus an alternative method has become necessary to help clinicians and epidemiologists to management and control of bacterial meningitis. We evaluate the application of a polymerase chain reaction-based (PCR assay for amplification of pneumolysin gene (ply to diagnosis of Streptococcus pneumoniae meningitis. The PCR assay sensitivity for CSF was 96% (95% confidence interval, CI, 90-99% compared to a sensitivity of 59% for culture (95% CI 49-69%, 66% for Gram stain (95% CI 56-74%, and 78% for latex agglutination test (95% CI 69-86%; PCR specificity was 100% (95% CI 83-100%. PCR results were available within 4 h of the start of the assay. This molecular approach proved to be reliable and useful to identify this bacterium compared with other classical laboratory methods for identification of bacterial meningitis pathogens.

  1. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan

    2014-02-01

    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  2. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction.

    Science.gov (United States)

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T

    1997-01-01

    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244

  3. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185

  4. Use of neuropathological tissue for molecular genetic studies: parameters affecting DNA extraction and polymerase chain reaction.

    Science.gov (United States)

    Kösel, S; Graeber, M B

    1994-01-01

    Nuclear and mitochondrial DNA were extracted from gray matter of human cerebral cortex which had either been formalin-fixed and embedded into paraffin or stored in formalin for up to 26 years. Extraction conditions were optimized for proteinase K digestion, i.e., enzyme concentration, digestion temperature and incubation time. Using the polymerase chain reaction (PCR), DNA was successfully amplified from archival material and sequenced employing a direct nonradioactive cycle sequencing protocol. In general, tissue embedded into paraffin following brief fixation in formalin gave good quantitative results, i.e., up to 1 microgram DNA/mg tissue were extracted. This yield was at least one order of magnitude higher than that obtained with tissue stored in formalin. However, paraffin-embedded neuropathological material was found to contain an as-yet-unidentified PCR inhibitor, and a deleterious effect of long-term fixation in unbuffered low-grade formalin was clearly detectable. Importantly, both paraffin-embedded tissue blocks and human brain that had been stored in formalin for many years yielded DNA sufficient for qualitative analysis. The implications of these findings for the use of neuropathological material in molecular genetic studies are discussed.

  5. Spatiotemporal Patterns in a Ratio-Dependent Food Chain Model with Reaction-Diffusion

    Directory of Open Access Journals (Sweden)

    Lei Zhang

    2014-01-01

    Full Text Available Predator-prey models describe biological phenomena of pursuit-evasion interaction. And this interaction exists widely in the world for the necessary energy supplement of species. In this paper, we have investigated a ratio-dependent spatially extended food chain model. Based on the bifurcation analysis (Hopf and Turing, we give the spatial pattern formation via numerical simulation, that is, the evolution process of the system near the coexistence equilibrium point (u2*,v2*,w2*, and find that the model dynamics exhibits complex pattern replication. For fixed parameters, on increasing the control parameter c1, the sequence “holes → holes-stripe mixtures → stripes → spots-stripe mixtures → spots” pattern is observed. And in the case of pure Hopf instability, the model exhibits chaotic wave pattern replication. Furthermore, we consider the pattern formation in the case of which the top predator is extinct, that is, the evolution process of the system near the equilibrium point (u1*,v1*,0, and find that the model dynamics exhibits stripes-spots pattern replication. Our results show that reaction-diffusion model is an appropriate tool for investigating fundamental mechanism of complex spatiotemporal dynamics. It will be useful for studying the dynamic complexity of ecosystems.

  6. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    Science.gov (United States)

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. PMID:25827436

  7. Detection of helicobacter pylori in benign laryngeal lesions by polymerase chain reaction: a cross sectional study

    Directory of Open Access Journals (Sweden)

    Izadi Farzad

    2012-04-01

    Full Text Available Abstract Background Although Helicobacter Pylori (HP was detected in some cases of chronic laryngitis, the results were not confirmed by polymerase chain reaction (PCR. By this time, it has not been found in laryngeal lesions by in house PCR, the most sensitive method for detecting the genome tracks. Regarding the previous results and also few numbers of studies about the presence of HP in benign laryngeal lesions, specifically by PCR, we aimed to investigate the presence of HP in benign laryngeal lesions by in-house PCR. Methods The samples were taken from 55 patients with benign laryngeal lesions and frozen in −20°C. One milliliter (ml of lysis buffer was added to 100 mg (mg of each sample and the tube was placed in 56°C overnight. Then DNA extraction was carried out. Results To find HP DNA, in-house PCR was performed that revealed 5 positive results among 55 patients with benign laryngeal lesions. Of them, 3 were polyp, 1 was nodule and 1 was papilloma. Conclusion Although the number of positive results was not a lot in this study, it was in contrast with previous studies which could not find any HP tracks in benign laryngeal lesions by other methods. More studies about the prevalence of HP in benign laryngeal lesions improve judging about the effect of this infection on benign laryngeal lesions.

  8. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  9. BORRELIA BURGDORFERI DNA IN BIOLOGICAL SAMPLES FROM PATIENTS WITH SARCOIDOSIS USING THE POLYMERASE CHAIN REACTION TECHNIQUE

    Institute of Scientific and Technical Information of China (English)

    连伟; 罗慰慈

    1995-01-01

    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  10. Detecting of Mycoplasma genitalium in male patients with urethritis symptoms in Turkey by polymerase chain reaction

    International Nuclear Information System (INIS)

    The aim of this study was to investigate the incidence of Mycoplasma genitalium in the urine samples of 63 male patients who had urethritis symptoms. Along with Neisseria gonorrhoeae (N. gonorrhoeae) and Chlamydia trachomatis (C. trachomatis). We also investigated Mycoplasma hominis (M. hominis) and Ureaplasma urealyticum (U. urealyticum), both of which are known to cause urethritis. Microorganisms were investigated in urine samples of the patients with polymerase chain reaction. The study was conducted between September 2003 - February 2004 at the Department of Microbiology and Clinical Microbiology Ankara University School of Medicine, Ankara, Turkey. A total of 63 urine samples were analyzed and 6 (9.52%) patients had N. gonorrhoeae, 4 (6.34%) had C. trachomatis, while 4 (6.34%) urines were positive in terms of M. genitalium. Nevertheless, 3 (4.76%) patients had U. urealyticum and 2 (3.17%) patients had M. hominis. One urine sample was positive in terms of both N. gonorrhoeae and U. urealyticum, and another urine sample was positive in terms of both M. hominis and U. urealyticum. The results were compared with the control group and found no statistically significant difference. Mycoplasma species are found in normal flora of urogenital system and also as an agent of urogenital infection. In our study, we found low microorganism rates when compared with Europe and America. This difference may be due to the conservative sexual behavior in Turkey. (author)

  11. Hepatitis C virus-polymerase chain reaction of routinely processed liver biopsies.

    Science.gov (United States)

    el-Batanony, M H; Savage, K; Jacobs, R; el-Refaie, A O; Squadrito, G G; Brown, D; Saleh, S M; Raouf, A A; Amer, K M; Dusheiko, G M

    1994-08-01

    The aim of the study was to evaluate the specificity and sensitivity of detection of hepatitis C virus (HCV)-RNA in formalin-fixed paraffin-embedded (FFPE) liver biopsies by polymerase chain reaction (PCR). Routinely processed FFPE diagnostic needle liver biopsies as well as stored serum samples from 43 patients with liver disease were tested for HCV-RNA by reverse transcription-nested PCR using the same sets of primers and following strict anticontamination measures. Twenty-nine cases were positive and 14 were negative for serum HCV-RNA. Tissue HCV-RNA was detected in 17 out of the 29 serum HCV-RNA-positive cases but not in any of the 14 serum HCV-RNA-negative cases. Compared to serum-PCR, tissue-PCR was 100% specific, 58.6% sensitive, and 72% efficient. HCV-RNA was detected more frequently in biopsies stored for less than 1 year, than in those stored for more than 1 year (P = 0.046). In biopsies stored for up to 1 year detection of HCV-RNA by PCR was 81.8% sensitive and 90.9% efficient. Short ( 0.5 cm) ones. It is concluded that following strict anticontamination measures, HCV-RNA detection by PCR in routinely fixed, processed, and stored diagnostic liver biopsies provides a valuable adjunct to diagnosis of HCV infection. In this study, this option was free from contamination problems, even though routine batch histological processing schedules were used. PMID:7964648

  12. Differentiation of Helicobacter pylori isolates by polymerase chain reaction-restriction fragment length polymorphism

    Institute of Scientific and Technical Information of China (English)

    SHI Li; SUN Yong; ZHANG Ya-li; ZHANG Zhen-shu; ZHOU Dian-yuan

    2002-01-01

    Objective: To investigate the association between the diversity of urease gene and urease activity of clinical isolates of Helicobacter pylori (H. pylori). Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of urease gene and rapid urease activity test were used to study the urease activity of different clinical isolates of H. pylori. Results: H. pylori clinical isolates were divided into 4types according to their PCR-RFLP results of urease gene and urease activity. Type I , possessing strong urease activity (0. 11) and presented 1 fragment of 1.7 kb by PCR-RFLP, had close relations with gastric ulcer; type Ⅱ , with the weakest urease activity (0. 07) and 2 fragments (1.3 and 0. 4 kb respectively), was associated with duodenal bulb ulcer; type Ⅱ , with the strongest urease activity (0. 12) and 2 fragments (0. 4and 0. 17 kb) with or without 1 fragment (0. 23 or 0. 37 kb) , was responsible for gastritis; type Ⅳ, with weak urease activity (0. 09) and 2 fragments (1.5 and 0. 2 kb), was shown to be related to both gastric and duodenal bulb ulcers. Conclusion: The diversity of urease gene decides different urease activities of different clinical isolates of H. pylori, hence the different possibilities of pathogenesis due to this bacteria.

  13. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    Directory of Open Access Journals (Sweden)

    Daniela Camargos Costa

    2014-02-01

    Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  14. Polymerase chain reaction with lesion scrapping for the diagnosis of human American tegumentary leishmaniasis

    Directory of Open Access Journals (Sweden)

    Eneide Aparecida Sabaini Venazzi

    2006-06-01

    Full Text Available The objective of this work was to compare the polymerase chain reaction (PCR using lesion scrapping with other conventional techniques for the diagnosis of the American tegumentary leishmaniasis (ATL. For this, patients with cutaneous lesions suspected to be ATL were studied. The DNA was amplified with the MP1L/MP3H primers. From the 156 studied patients, 79 (50.6% presented positive parasite direct search (PD, 81 (51.9% had positive Montenegro skin test (MST, and 90 (57.7% presented PD and/or MST positive. The PCR was positive in all of the positive-PD patients (100% sensitivity, in 91.1% of the positive PD and/or MST patients, and in 27.3% of the patients that presented negative PD and positive MST. The PCR positivity was similar to the PD (P = 0.2482 and inferior to the MST (P = 0.0455, and to the PD/MST association (P = 0.0133. The high PCR sensitivity, and positivity in those cases where the PD was negative, highlights the importance of this technique as an auxiliary tool for the diagnosis of ATL.

  15. Polymerase chain reaction-based screening for the ceftriaxone-resistant Neisseria gonorrhoeae F89 strain.

    Science.gov (United States)

    Goire, N; Lahra, M M; Ohnishi, M; Hogan, T; Liminios, A E; Nissen, M D; Sloots, T P; Whiley, D M

    2013-04-04

    Emergence and spread of Neisseria gonorrhoeae resistant to extended spectrum cephalosporins is a major problem threatening treatment of gonorrhoea and is further highlighted by the recent report of a second ceftriaxone-resistant N. gonorrhoeae strain (F89) in Europe, initially observed in France and subsequently identified in Spain. N. gonorrhoeae antimicrobial resistance (AMR) surveillance has acquired new importance and molecular tools have the potential to enhance bacterial culture-based methods. In this study, we established a polymerase chain reaction (PCR) protocol for direct detection of the F89 strain. A key component of this screening protocol was the development of a hybridisation probe-based melting curve analysis assay (mosaic501-hybPCR) to detect the presence of an A501P substitution on the N. gonorrhoeae mosaic penicillin binding protein 2 (PBP2) sequence, an important characteristic of the F89 strain. The mosaic501-hybPCR was evaluated using plasmid-derived positive controls (n=3) and characterised gonococcal (n=33) and non-gonococcal (n=58) isolates. The protocol was then applied to 159 clinical specimens from Sydney, Australia, collected during the first half of the year 2012 that were N. gonorrhoeae PCR-positive. Overall, the results indicate that the PCR-based protocol is suitable for direct detection of the N. gonorrhoeae F89 strain in non-cultured clinical samples. It therefore provides an additional tool to aid investigations into the potential spread of F89 strain throughout Europe and elsewhere.

  16. Alkyl chain length-dependent surface reaction of dodecahydro-N-alkylcarbazoles on Pt model catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Gleichweit, Christoph; Amende, Max; Bauer, Udo; Schernich, Stefan; Höfert, Oliver; Lorenz, Michael P. A.; Zhao, Wei; Bachmann, Philipp; Papp, Christian, E-mail: christian.papp@fau.de [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Müller, Michael; Koch, Marcus [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Wasserscheid, Peter [Lehrstuhl für Chemische Reaktionstechnik, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Libuda, Jörg; Steinrück, Hans-Peter [Lehrstuhl für Physikalische Chemie II, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany); Erlangen Catalysis Resource Center, Friedrich-Alexander-Universität Erlangen-Nürnberg, Egerlandstrasse 3, 91058 Erlangen (Germany)

    2014-05-28

    The concept of liquid organic hydrogen carriers (LOHC) holds the potential for large scale chemical storage of hydrogen at ambient conditions. Herein, we compare the dehydrogenation and decomposition of three alkylated carbazole-based LOHCs, dodecahydro-N-ethylcarbazole (H{sub 12}-NEC), dodecahydro-N-propylcarbazole (H{sub 12}-NPC), and dodecahydro-N-butylcarbazole (H{sub 12}-NBC), on Pt(111) and on Al{sub 2}O{sub 3}-supported Pt nanoparticles. We follow the thermal evolution of these systems quantitatively by in situ high-resolution X-ray photoelectron spectroscopy. We show that on Pt(111) the relevant reaction steps are not affected by the different alkyl substituents: for all LOHCs, stepwise dehydrogenation to NEC, NPC, and NBC is followed by cleavage of the C–N bond of the alkyl chain starting at 380–390 K. On Pt/Al{sub 2}O{sub 3}, we discern dealkylation on defect sites already at 350 K, and on ordered, (111)-like facets at 390 K. The dealkylation process at the defects is most pronounced for NEC and least pronounced for NBC.

  17. [Allergic reaction to products made of natural rubber].

    Science.gov (United States)

    Antczak, M; Kuna, P; Cieślewicz, G

    In the previous few years, there has been a startling escalation in intraoperative and radiologic anaphylactic episodes, some of them lethal, that have been assigned to rubber exposure. Immediate hypersensitivity reactions to natural rubber pose a significant risk to patient with spina bifida and urogenital abnormalities, health care workers, and rubber industry workers. It has been estimated that 2% to 10% of physicians and nursing personnel are latex allergic. The clinical syndromes associated with reactions to latex may be divided into three broad categories a) contact dermatitis--limited to skin directly in contact with latex, b) contact urticaria syndrome a broad spectrum of contact reactions including not only immediate wheal and flare reactions, but also dyshidrotic vesiculation, and accelerated contact reactions including erythema, burning or pruritus occurring within 10-30 minutes after contact, c) systemic allergic reactions-including generalized urticaria or pruritus, rhinoconjunctivitis or asthma, as well as the multiple presentations of anaphylaxis. Contact dermatitis reactions are thought to be a T-cell mediated type IV reaction, systemic reactions to latex appear to be an IgE-mediated phenomenon. Contact urticaria syndrome seems to be a heterogeneous group of reactions. Diagnosis of latex allergy is made on clinical grounds, however, history alone is insufficient to recognize all patients at risk, and conscientious testing materials are not yet available. Prick tests utilizing extracts from latex gloves or from raw latex preparation can be used but the specificity of this test remains unknown. Skin prick testing must be considered experimental and should be only done by experienced physician. Serologic testing for latex allergy remains a safe alternative, although the sensitivity and specificity of this procedure is still undefined. Prophylactic regimes to avoid rubber exposure and decrease the antigen content of natural rubber products by the rubber

  18. Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

    Directory of Open Access Journals (Sweden)

    Raden Wasito

    2015-05-01

    Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

  19. Identification of bovine material in porcine spray-dried blood derivatives using the Polymerase Chain Reaction technique

    Directory of Open Access Journals (Sweden)

    Sánchez A.

    2004-01-01

    Full Text Available Due to the widely supported theory of bovine spongiform encephalopathy (BSE spread in cattle by contaminated animal feeds, screening of feed products has become essential. For many years, manufacturers have used blood and plasma proteins as high quality ingredients of foods for both pets and farm animals. However, in Europe, the Commission Regulation 1234/2003/EC temporally bans the use of processed animal proteins, including blood-derivative products, in feedstuffs for all farm animals which are fattened or bred for the production of food. This regulation has some exceptions, such as the use of non ruminant blood products into the feed of farm fish. Authorization of the re-introduction of these proteins into animal feed formulations, especially non ruminant proteins into the feed for non ruminant farm animals, is expected when adequate control methods to discriminate ruminant proteins exist. Currently, the number of validated methods to differentiate the species of origin for most of the animal by-products is limited. Here we report the development of a rapid and sensitive polymerase chain reaction (PCR-based assay, which allows detection of bovine or porcine specific mitochondrial DNAfrom spray-dried blood derivate products (plasma, whole blood and red cells, as a marker for bovine contamination in porcine products. Sample extracts, suitable for PCR, were easily and quickly obtained with the commercial PrepManTM Ultra reagent (Applied Biosystems. To confirm the porcine origin of the samples, primers targeting a specific region of 134 bp of the porcine cytochrome b coding sequence were designed (cytbporc1-F and cytbporc2-R. Previously published PCR primers (L8129 and H8357, specific for a 271 bp fragment of the bovine mitochondrial ATPase 8-ATPase 6 genes, were chosen to accomplish amplification of bovine DNA. The limit of detection (LOD of the bovine PCR assay was at least of 0.05% (v/v of bovine inclusion in spray-dried porcine plasma or red

  20. On Construction of Supply Chain System for China’s Modern Agricultural Products

    Institute of Scientific and Technical Information of China (English)

    Wanjiang; WANG

    2015-01-01

    In view of drawbacks in supply chain of China’s traditional agricultural products,this paper proposed building supply chain system for modern agricultural products: taking informationization as basis,channel system as core,organization system as support,and service system and safety system as guarantee,to promote high efficient operation of the supply chain system. The channel system stresses alliance and integration of channel system,informationization of channel management,and terminalization of channel operation; the organization system stresses organization,large scale,group,and brand of participant entities; service system stresses construction of service means,service platform,and operation mechanism; safety system stresses building quality safety based agricultural product supply chain management mode. In order to ensure high efficient operation of supply chain for modern agricultural products,it is required to straighten out supply chain management system,actively cultivate core enterprises of supply chain,strengthen information construction of supply chain,select suitable supply chain mode,and improve benefit allocation mechanism.

  1. A Theoretical Investigation on the Reaction Mechanism of the C8H+·10 Side-Chain Decomposition Processes

    Institute of Scientific and Technical Information of China (English)

    CHENG Xue-Li; ZHAO Yan-Yun; LI Feng

    2008-01-01

    The dissociation of ethylbenzene cation C8H+·10 served as a prototype to investigate the decompasition mechanisms of alkylbenzene cations.The reactions of C8H+·10 decomposition reaction system have been studied extensively at the B3L YP/6-311++G** level with Gaussion 98 package.The chain reaction of C8H+·10 dissociation is initiated by C-H bond rupture.All reaction channels were fully investigated with the vibrational mode analysis to confirm the transition states and reveal the reaction mechanism.The energetically most favorable pathway is C8H+·10→TS4→·P2+H· and the channel ieading to C8H+·10 and C2H4 is also competitive.

  2. Food safety management systems performance in the lamb production chain

    NARCIS (Netherlands)

    Oses, S.M.; Luning, P.A.; Jacxsens, L.; Jaime, I.; Rovira, J.

    2012-01-01

    This study describes a performance measurement of implemented food safety management system (FSMS) along the lamb chain using an FSMS-diagnostic instrument (FSMS-DI) and a Microbiological Assessment Scheme (MAS). Three slaughterhouses, 1 processing plant and 5 butcher shops were evaluated. All the a

  3. Perfluorooctane sulphonate (PFOS) throughout the food production chain

    NARCIS (Netherlands)

    Asselt, van E.D.; Rietra, R.P.J.J.; Romkens, P.F.A.M.; Fels-Klerx, van der H.J.

    2011-01-01

    Perfluorooctane sulphonate (PFOS) is a persistent organic pollutant with adverse effects on human health. Since dietary intake plays an important role in human exposure, the transfer of PFOS throughout the food chain needs further investigation. The aim of this paper is to give an overview of PFOS c

  4. Acid-catalyzed reactions of hexanal on sulfuric acid particles: Identification of reaction products

    Science.gov (United States)

    Garland, Rebecca M.; Elrod, Matthew J.; Kincaid, Kristi; Beaver, Melinda R.; Jimenez, Jose L.; Tolbert, Margaret A.

    While it is well established that organics compose a large fraction of the atmospheric aerosol mass, the mechanisms through which organics are incorporated into atmospheric aerosols are not well understood. Acid-catalyzed reactions of compounds with carbonyl groups have recently been suggested as important pathways for transfer of volatile organics into acidic aerosols. In the present study, we use the aerodyne aerosol mass spectrometer (AMS) to probe the uptake of gas-phase hexanal into ammonium sulfate and sulfuric acid aerosols. While both deliquesced and dry non-acidic ammonium sulfate aerosols showed no organic uptake, the acidic aerosols took up substantial amounts of organic material when exposed to hexanal vapor. Further, we used 1H-NMR, Fourier transform infrared (FTIR) spectroscopy and GC-MS to identify the products of the acid-catalyzed reaction of hexanal in acidic aerosols. Both aldol condensation and hemiacetal products were identified, with the dominant reaction products dependent upon the initial acid concentration of the aerosol. The aldol condensation product was formed only at initial concentrations of 75-96 wt% sulfuric acid in water. The hemiacetal was produced at all sulfuric acid concentrations studied, 30-96 wt% sulfuric acid in water. Aerosols up to 88.4 wt% organic/11.1 wt% H 2SO 4/0.5 wt% water were produced via these two dimerization reaction pathways. The UV-VIS spectrum of the isolated aldol condensation product, 2-butyl 2-octenal, extends into the visible region, suggesting these reactions may impact aerosol optical properties as well as aerosol composition. In contrast to previous suggestions, no polymerization of hexanal or its products was observed at any sulfuric acid concentration studied, from 30 to 96 wt% in water.

  5. Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

    Science.gov (United States)

    Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

    Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

  6. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  7. Detection of gastrin mRNA in fresh human colonic carcinomas by reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Monges, G; Biagini, P; Cantaloube, J F; Chicheportiche, C; Frances, V; Brandini, D; Parc, P; Seitz, J F; Giovannini, M; Sauvan, R

    1993-10-01

    To investigate the hypothesis that gastrin might be synthesized by tumour tissues in cancer of the colon, samples from six human colon tumours, one hepatic metastasis, four normal colonic mucosal samples and two antral and one fundic gastric mucosal samples from nine patients were analysed to determine whether gastrin mRNA was present. RNA was extracted from surgical specimens by ultracentrifugation on a CsCl cushion, purified using the guanidinium thiocyanate method, reverse-transcribed and amplified by polymerase chain reaction. Gastrin mRNA was detected in each colonic carcinoma sample (including the hepatic metastasis), while no such signal was observed in normal colon biopsies. Positive and negative controls (gastric antrum and fundus respectively) gave the expected results. In each of the positive samples, the chemiluminescent revelation of amplified products after Southern blotting corresponded to gastrin mRNA without the intron. These findings demonstrate the ability of primary and metastatic human colonic tumours to produce gastrin mRNA. Since malignant cell lines have been reported to produce gastrin peptide, and since gastrin receptors were present in some cases, our results support the idea that gastrin may be involved in an autocrine mechanism. PMID:7507679

  8. Quantitation of mule duck in goose foie gras using TaqMan real-time Polymerase Chain Reaction.

    Science.gov (United States)

    Rodríguez, Miguel A; García, Teresa; González, Isabel; Asensio, Luis; Hernández, Pablo E; Martín, Rosario

    2004-03-24

    A real-time quantitative Polymerase Chain Reaction (PCR) method has been developed for the quantitation of mule duck (Anas platyrhynchos x Cairina moschata) in binary duck/goose foie gras mixtures. The method combines the use of real-time PCR with duck-specific and endogenous control "duck + goose" primers to measure duck content and total foie gras content, respectively. Both PCR systems (duck-specific and duck + goose) were designed on the mitochondrial 12S ribosomal RNA gene (rRNA). The duck-specific system amplifies a 96 bp fragment from duck DNA, whereas the duck + goose system amplifies a 120 bp fragment from duck and goose DNA. The method measures PCR product accumulation through a FAM-labeled fluorogenic probe (TaqMan). The C(t) (threshold cycle) values obtained from the duck + goose system are used to normalize the ones obtained from the duck-specific system. Analysis of experimental duck/goose foie gras binary mixtures demonstrated the suitability of the assay for the detection and quantitation of duck in the range of 1-25%. This genetic marker can be very useful to avoid mislabeling or fraudulent species substitution of goose by duck in foie gras.

  9. Development of a polymerase chain reaction (PCR) test for the detection of virulent forms of Vibrio parahaemolyticus.

    Science.gov (United States)

    Kadhim, H M; Miah, A; Munn, C B; Gilpin, M L

    2012-04-01

    Vibrio parahaemolyticus is a marine bacterium and some strains cause gastroenteritis in humans. Clinical isolates are thought to possess virulence factors that are absent from the majority of environmental isolates. Use of randomly amplified polymorphic DNA (RAPD)-PCR produced a unique 600 bp amplicon (band Y) in the majority of clinical isolates and rarely in environmental isolates tested. The DNA from band Y was cloned and sequenced and found to code for an outer membrane protein (OMP). Two polymerase chain reaction (PCR) primers were designed to specifically amplify a 200 bp unique sequence from presumptive virulent strains (PCR-OMP). The virulence of 23 clinical and 32 environmental isolates was assessed in cytotoxicity tests by treatment of Caco-2 cells with extracellular products (ECPs). All but two of the clinical isolates (91%) were positive for the 200 bp PCR-OMP and their ECPs produced a significantly higher (p PCR-OMP is strongly correlated with virulence, as determined by the cytotoxicity assay, and identified virulent forms better than current PCR tests for tdh, trh or T3SS2.

  10. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    P. D. Luka

    2014-10-01

    Full Text Available Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction from FFT for African swine fever virus (ASFV detection. The modified conventional method gave a higher quality DNA when compared with commercially available DNA extraction kits (QIAamp® DNA Mini Kit, DNeasy® Blood and Tissue Kit, and ZR Genomic DNA™ Tissue MiniPrep. Results: An average A260/A280 DNA purity of 0.86-1.68 and 3.22-5.32 μg DNA/mg for formalin fixed and non-fixed tissues, respectively using a conventional method. In a reproducible and three times repeat PCR, the ASFV DNA expected product size of 278 bp was obtained from the DNA extract of the conventional method but not from the DNA extract of the commercial kits. Conclusion: The present study has demonstrated that the conventional method extracts ASFV genome better than commercial kit. In summary, the commercial kit extraction appeared not suitable to purify ASFV DNA from FFT. We, therefore, recommend that the use of the conventional method be considered for African swine fever DNA extraction from FFT.

  11. Development of a nested polymerase chain reaction method to detect oncogenic Marek's disease virus from feather tips.

    Science.gov (United States)

    Murata, Shiro; Chang, Kyung-Soo; Lee, Sung-Il; Konnai, Satoru; Onuma, Misao; Ohashi, Kazuhiko

    2007-09-01

    For the easy survey of Marek's disease virus (MDV), feather tip-derived DNA from MDV-infected chickens can be used because feather tips are easy to collect and feather follicle epithelium is known to be the only site of productive replication of cell-free MDV. To develop a diagnostic method to differentiate highly virulent strains of MDV from the attenuated MDV vaccine strain, CVI988, which is widely used, nested polymerase chain reaction (PCR) was performed to detect a segment of the meq gene in feather tip samples of chickens experimentally infected with MDV. In chickens infected with Md5, a strain of oncogenic MDV, the meq gene was consistently detected, whereas the L-meq gene, in which a 180-base pair (180-bp) sequence is inserted into the meq gene, was detected in CVI988-infected chickens. Moreover, the meq gene was mainly detected even in chickens co-infected with both Md5 and CVI988. These results suggest that this method is appropriate for the surveillance of the highly virulent MDV infection in the field.

  12. Identification of roots of woody species using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis

    Science.gov (United States)

    Bobowski; Hole; Wolf; Bryant

    1999-03-01

    Within the last two decades, substantial progress has been made in understanding seed-bank dynamics and the contribution of the soil seed bank to a postdisturbance plant community. There has been relatively little progress, however, in understanding perennial bud-bank dynamics and the contribution of the soil bud bank to secondary succession. This lack of information is due primarily to the inability to reliably identify roots, rhizomes and lignotubers that lie dormant beneath the soil surface. This investigation addressed the issue of identification of below-ground woody structures. The first objective was to develop a method that used molecular tools to identify woody plant species from subsoil tissue samples. The second objective was to develop a key in which molecular markers served as criteria for the identification and differentiation of selected tree and shrub species common to the mountains of northeast Oregon and southeast Washington. Application of restriction fragment length polymorphism (RFLP) analysis of polymerase chain reaction (PCR)-amplified rbcL appears to be a reliable method to identify and differentiate 15 plants to the genus level. Two restriction enzymes, DpnII and HhaI, provided restriction site polymorphisms in the PCR product. The fragment number and length were used to develop an identification key. However, plants not analysed in this 'exploratory key' might share the same banding patterns, resulting in a false identification of unknowns. PMID:10199009

  13. A survey of polymerase chain reaction (PCR) amplification studies of unicellular protists using single-cell PCR.

    Science.gov (United States)

    Lynn, Denis H; Pinheiro, Marcel

    2009-01-01

    We surveyed a variety of studies that have used single-cell polymerase chain reaction (SC-PCR) to examine the gene sequences of a diversity of unicellular protists. Representatives of all the Super-Groups of eukaryotes have been subjected to SC-PCR with ciliates and dinoflagellates being most commonly examined. The SC-PCR was carried out either by directly amplifying a single lysed cell or by first extracting DNA and following this with amplification of the DNA extract. Cell lysis methods included heating, freezing, mechanical rupture, and enzyme digestion. Cells fixed or preserved with ethanol, methanol, and Lugol's have also been used successfully. Heminested or seminested PCR might follow the initial PCR, whose products were then directly sequenced or cloned and then sequenced. The methods are not complicated. This should encourage protistologists to use SC-PCR in the description of new or revised taxa, especially rare and unculturable forms, and it should also enable the probing of gene expression in relation to life history stages.

  14. Measurement of exclusive eta' production in γγ reactions

    International Nuclear Information System (INIS)

    We observe γγ->eta' production in the reaction e+e- -> e+e-π+π-γ. We measure the product GAMMAsub(γγ)(eta')B(eta' -> rho0γ) to be 1.14+-0.08+-0.11 keV. A first measurement of the γγ->eta' transition form factor is made for Q2 up to 1 GeV2. (orig.)

  15. Stochastic aspects of multiparticle production in relativistic nuclear reactions

    International Nuclear Information System (INIS)

    Midrapidity multiparticle production process in ordinary hadron and heavy-ion induced reactions at sufficiently high incident energies are analyzed. It is shown that stochastic aspects of multiparticle production process in relativistic range plays a dominating role in understanding the observable phenomena. The basic idea and the main results of the multisource model for hadron-nucleus and nucleus-nucleus collisions are shown. The concept of the NES (number of effective sources) scaling is discussed. 16 refs.; 7 figs

  16. Approach to molecular characterization of different strains of Fasciola hepatica using random amplified polymorphic DNA polymerase chain reaction.

    Science.gov (United States)

    Scarcella, S; Miranda-Miranda, E; Solana, M V; Solana, H

    2015-04-01

    The aim of the present study was to genetically characterize Fasciola hepatica strains from diverse ecogeographical regions (America and Europe), susceptible and resistant to Triclabendazole, using the random amplified polymorphic DNA fragments (RAPDs-PCR) technique to elucidate genetic variability between the different isolates. Ten different oligonucleotide primers of 10 bases with GC content varying from 50-70% were used. A polymerase chain reaction (PCR) was carried out in 25 μl of total volume. Duplicate PCR reactions on each individual template DNA were performed to test the reproducibility of the individual DNA bands. The size of the RAPD-PCR fragments was determined by the reciprocal plot between the delay factors (Rf) versus the logarithm of molecular weight ladder. The phenogram obtained showed three main clusters, the major of which contained European Strains (Cullompton and Sligo) showing a genetic distance of 27.2 between them. The American strains (Cedive and Cajamarca) on the other hand formed each their distinctive group but clearly maintaining a closer genetic relationship among them than that to their European counterparts, with which showed a distance of 33.8 and 37.8, respectively. This polymorphism would give this species enhanced adaptability against the host, as well as the environment. The existence of genetically different populations of F. hepatica could allow, against any selection pressure, natural or artificial (for use fasciolicides products and/or control measures), one or more populations of F. hepatica to be able to survive and create resistance or adaptability to such selective pressure.

  17. Evaluation of medium-chain-length polyhydroxyalkanoate production by Pseudomonas putida LS46 using biodiesel by-product streams.

    Science.gov (United States)

    Fu, Jilagamazhi; Sharma, Umesh; Sparling, Richard; Cicek, Nazim; Levin, David B

    2014-07-01

    Medium-chain-length polyhydroxyalkanoate (mcl-PHA) production by Pseudomonas putida LS46 was analyzed in shake-flask-based batch reactions, using pure chemical-grade glycerol (PG), biodiesel-derived "waste" glycerol (WG), and biodiesel-derived "waste" free fatty acids (WFA). Cell growth, substrate consumption, mcl-PHA accumulation within the cells, and the monomer composition of the synthesized biopolymers were monitored. The patterns of mcl-PHA synthesis in P. putida LS46 cells grown on PG and WG were similar but differed from that of cells grown with WFA. Polymer accumulation in glycerol-based cultures was stimulated by nitrogen limitation and plateaued after 48 h in both PG and WG cultures, with a total accumulation of 17.9% cell dry mass and 16.3% cell dry mass, respectively. In contrast, mcl-PHA synthesis was independent of nitrogen concentration in P. putida LS46 cells cultured with WFA, which accumulated to 29% cell dry mass. In all cases, the mcl-PHAs synthesized consisted primarily of 3-hydroxyoctanoate (C(8)) and 3-hydroxydecanoate (C(10)). WG and WFA supported similar or greater cell growth and mcl-PHA accumulation than PG under the experimental conditions used. These results suggest that biodiesel by-product streams could be used as low-cost carbon sources for sustainable mcl-PHA production.

  18. Strangeness production and hypernucleus formation in antiproton induced reactions

    CERN Document Server

    Feng, Zhao-Qing

    2015-01-01

    Formation mechanism of fragments with strangeness in collisions of antiprotons on nuclei has been investigated within the Lanzhou quantum molecular dynamics (LQMD) transport approach combined with a statistical model (GEMINI) for describing the decays of excited fragments. Production of strange particles in the antiproton induced nuclear reactions is modeled within the LQMD model, in which all possible reaction channels such as elastic scattering, annihilation, charge exchange and inelastic scattering in antibaryon-baryon, baryon-baryon and meson-baryon collisions have been included. A coalescence approach is developed for constructing hyperfragments in phase space after de-excitation of nucleonic fragments. The combined approach could describe the production of fragments in low-energy antiproton induced reactions. Hyperfragments are formed within the narrower rapidities and lower kinetic energies. It has advantage to produce heavier hyperfragments and hypernuclides with strangeness s=-2 (double-$\\Lambda$ fra...

  19. Optimal Financing Decisions of Two Cash-Constrained Supply Chains with Complementary Products

    OpenAIRE

    Yuting Li; Tong Chen; Baogui Xin

    2016-01-01

    In recent years; financing difficulties have been obsessed small and medium enterprises (SMEs); especially emerging SMEs. Inter-members’ joint financing within a supply chain is one of solutions for SMEs. How about members’ joint financing of inter-supply chains? In order to answer the question, we firstly employ the Stackelberg game to propose three kinds of financing decision models of two cash-constrained supply chains with complementary products. Secondly, we analyze qualitatively these m...

  20. Supply chain in brazilian automobile industry: production organization, performance and innovations

    OpenAIRE

    Mario Sacomano Neto; Silvio Roberto Ignacio Pires

    2007-01-01

    This Paper presents the main results of a recent research on Supply Chain Management within the Brazilian Automotive Industry. The research aimed to study how the different forms of configuration of the Automaker’s Supply Chain influence the organization forms of production, the performance measures and the innovations in the Supply Chain Management. The research involves an automaker, two first tier suppliers and two second tier suppliers and it has been conducted through interviews with exe...

  1. Direct reactions involving pion production in hot nuclear matter

    Energy Technology Data Exchange (ETDEWEB)

    Voskresenskii, D.N.; Kolomeitsev, E.E. [Moscow Institute of Engineering Physics (Russian Federation)

    1995-01-01

    Probabilities and differential cross sections for the production of {pi}{sup {minus}} mesons in direct NN {yields} NN{pi}{sup {minus}lk} reactions are calculated with allowance for a change in the NN interaction in nuclear matter. The results are obtained in an analytic form for arbitrary temperatures of matter and arbitrary energies and momenta of pions. 13 refs.

  2. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q

    2015-06-01

    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  3. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio

    2010-11-01

    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  4. Use of pooled samples for the detection of Salmonella in feces by polymerase chain reaction.

    Science.gov (United States)

    Singer, Randall S; Cooke, Cara L; Maddox, Carol W; Isaacson, Richard E; Wallace, Richard L

    2006-07-01

    Many epidemiological studies of Salmonella rely on conventional bacteriological culture methods to detect Salmonella in fecal samples. These culture-based methods are inefficient for epidemiological studies in populations with a low prevalence of Salmonella. The objective of this study was to optimize a protocol that uses pooled Salmonella enrichment broth cultures of bovine feces and polymerase chain reaction (PCR) for the detection of the invA gene of Salmonella in feces. In one field trial, 196 animals were sampled, and all samples were tested by culture, invA PCR on individual samples, invA PCR on pools of 5 samples, and BAX PCR on individual samples. All assays showed a high agreement on individual samples (kappa > or = 0.75). The invA PCR was run on each of 40 pools and detected 19 of 22 culture-positive pools. In another field trial, 152 samples were taken from 4 dairies, and the invA PCR was performed on pools of 5 samples in addition to bacteriological culture of individual samples. Salmonella was detected in 5 of the 32 pools (7 total positive samples) by both PCR and culture. One pool was PCR-positive but culture-negative. Pooling did not dramatically affect the performance of the invA PCR; most of the culture-positive samples were detected, including all of the samples when there were 4 or more Salmonella colonies on the agar plate. Based on these field trials, invA PCR on pooled samples appears to be an efficient method of Salmonella detection as long as Salmonella loads are not extremely low.

  5. Application of the polymerase chain reaction and molecular probe technology for the diagnosis of tuberculosis

    International Nuclear Information System (INIS)

    Conventional methods for the diagnosis of tubercolosis based on microscopic examination and in vitro culture is both time consuming and tedious. Molecular methods of diagnosis have been suggested as an alternative which may provide the clinical laboratory with a means for rapid diagnosis. The present study was carried out to determined the feasibility of this approach for the detection of mycobacteria. Clinical specimens received from patients with suspected diagnosis of tuberculous infection were used. All specimens were examined microscopically and those that were smear positive were cultured. An aliquot of each specimen were kept for analysis by in vitro amplification using the polymerase chain reaction (PCR). The primers used for PCR were 20-mers specific for the insertion element IS986, which is restricted to the M. tuberculosis complex group. All specimens were analysed in quintriplicate, with 2 samples unspiked and 3 sampled spiked with M. tuberculosis. Appropriate positive and negative controls were included in all essays. Following amplification, the specimens were analysed by agarose gel electrophoresis (AGE). All specimens were further subject to hybridization studies using a specific radiolabelled probe. The sensitivity of the amplification assay coupled with visualization of the amplified targets using eithidium bromide staining was found to be about 1 fg of DNA. A total of 40 smear positive specimens were analyzed, 29 of which were culture positive. Twenty-eight of the 29 culture positive specimens tested positive by PCR/hybridization analysis. Of the 11 culture negative specimens, 9 were positive by PCR. Overall 37/40 (92.5%) specimens were positive by PCR/hybridization analysis. (author). 13 refs, 1 tab

  6. Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

    Science.gov (United States)

    Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

    2014-09-01

    Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures.

  7. Use of polymerase chain reaction in the diagnosis of Whipple's disease.

    Science.gov (United States)

    Kono, Masanori; Yamamoto, Kei; Nagamatsu, Maki; Kutsuna, Satoshi

    2015-12-01

    Whipple's disease, a systemic, chronic infectious disease caused by Tropheryma whipplei, is extremely rare in Asian populations. A correct diagnosis is necessary due to its high mortality rate. Unfortunately, patients are apt to be misdiagnosed with connective tissue diseases since they typically present with arthritis or arthralgia. There are three diagnostic tools for Whipple's disease using intestinal tissues: 1) periodic acid-Schiff (PAS)-positive macrophages; 2) electron microscopic observation; and 3) polymerase chain reaction (PCR). It is challenging to diagnose this disease in the absence of histological findings, especially in Japan, where the clinical protocol currently used to make the diagnosis needs improvement, although symptomology and PCR results may be sufficient. Herein, we investigated a 24-year-old Japanese woman who had suffered from intermittent fever, migratory arthralgia, and watery diarrhea for several months. Her biopsied intestinal tissue was negative for foamy macrophages and PAS-positive cells, and electron microscopy did not provide diagnostic insight. PCR amplification of the specimens, however, successfully revealed T. whipplei. Whipple's disease was diagnosed based on a positive PCR result and strong clinical suspicion. The patient was treated parenterally with ceftriaxone (2 g daily) for two weeks, followed by oral treatment with 160 mg trimethoprim and 800 mg sulfamethoxazole twice per day. After one month of treatment, her symptoms disappeared and inflammatory markers returned to normal levels. This case illustrates the practicality and effectiveness of a PCR-based diagnostic test in combination with clinical suspicion to correctly diagnose Whipple's disease, especially in cases when a histological examination does not provide insight.

  8. Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri

    Directory of Open Access Journals (Sweden)

    Grace Q. Chen

    2010-01-01

    Full Text Available Problem statement: In transgenic plants, the number of transgene copies could greatly influence the level of expression and genetic stability of the target gene, thus it is important to develop an efficient method for accurate estimation of transgene copies. The quantitative Polymerase Chain Reaction (qPCR technique is becoming more efficient nowadays to determine copy numbers of transgenes in transgenic plants, being used here, for the first time in quantifying copy numbers of transgenes in Lesquerella fendleri. Approach: The system utilized a known one copy gene, LfKCS4/5, from L. fendleri as an endogenous calibrator and the threshold Crossing point (Ct measured by Applied Biosystem 7500 system to calculate the copy numbers of transgenes in primary transgenic lines (T0 generation. Results: The qPCR condition was optimized and each primer set had a PCR efficiency of 0.99 or 1.01. Our data demonstrated unambiguous 2-fold discrimination of the copy number of β-glucuronidase gene (gusA and hygromycine phosphotransferase II (hptII genes in 12 T0 lines. Most of the lines contained one or two copies of each gene. Eight out of 12 samples (66.7% showed more copies of gusA gene than that of hptII gene, suggesting rearrangements of the Transferred (T-DNA. Possible modifications of the T-DNA cassette in L. fendleri are discussed based on main models of T-DNA integration in the plant genome. Conclusion: The qPCR described in this study is an efficient method and it is particularly useful in identification and selection of transgenic plants with desirable copy numbers at early stage.

  9. Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Jong Gyun Ahn

    2012-11-01

    Full Text Available &lt;B&gt;Purpose:&lt;/B&gt; Methods for quick and reliable detection of &lt;I&gt;Streptococcus pneumoniae&lt;/I&gt; are needed for the diagnosis of pneumococcal disease and vaccine studies. This study aimed to show that sequential multiplex polymerase chain reaction (PCR is more efficient than conventional culture in achieving &lt;I&gt;S. pneumoniae -positive&lt;/i&gt; results. &lt;B&gt;Methods:&lt;/B&gt; Nasopharyngeal (NP secretions were obtained from 842 pediatric patients admitted with lower respiratory infections at Severance Children’s Hospital in Korea between March 2009 and June 2010. For identification and serotype determination of pneumococci from the NP secretions, the secretions were evaluated via multiplex PCR technique with 35 serotype-specific primers arranged in 8 multiplex PCR sets and conventional bacteriological culture technique. &lt;B&gt;Results:&lt;/B&gt; Among the results for 793 samples that underwent both bacterial culture and PCR analysis for pneumococcal detection, 153 (19.3% results obtained by PCR and 81 (10.2% results obtained by conventional culture technique were positive for S. pneumoniae. The predominant serotypes observed, in order of decreasing frequency, were 19A (23%, 6A/B (16%, 19F (11%, 15B/C (5%, 15A (5%, and 11A (4%; further, 26% of the isolates were non-typeable. &lt;B&gt;Conclusion:&lt;/B&gt; As opposed to conventional bacteriological tests, PCR analysis can accurately and rapidly identify pneumococcal serotypes.

  10. [Value of polymerase chain reaction in serum for the diagnosis of enteroviral meningitis].

    Science.gov (United States)

    Marque Juillet, S; Lion, M; Pilmis, B; Tomini, E; Dommergues, M-A; Laporte, S; Foucaud, P

    2013-06-01

    Enteroviruses (EV) are a common cause of aseptic meningitis in children. Virological diagnosis of EV meningitis is currently based on the detection of the viral genome in the cerebrospinal fluid (CSF). This study attempted to determine the correlation and the temporality of the polymerase chain reaction (PCR) assay in serum and CSF and to evaluate the possibility of diagnosing EV infection only on the serum PCR. The EV genome was sought by RT real-time PCR (Smart Cycler EV Primer and Probe Set(®), Cepheid) in CSF and serum, collected at the same time, for all children who underwent a lumbar puncture for suspected meningitis, between 1 June and 31 July 2010 at the Versailles Hospital. Forty-four patients were included in the study. EV infection was documented for 22 of them. In 10 patients, the EV genome was detected in CSF only; in 3 patients in serum only, and in 9 patients in both. Among patients with acute EV neurological infection, viremic children were significantly younger (1.6 months versus 5.8 years; P3 months, clinical and biological compatibility with a viral infection, no previous antibiotic therapy, time from symptom onset to blood sampling <30 h, PCR in serum analyzed within 3h), PCR in serum, when positive, is a possible alternative. Therefore, it may be possible to diagnose EV infection without performing a lumbar puncture in a limited number of young children (11.4% of our suspected cases). This study needs to be reinforced by a multicenter study with a broader panel of patients.

  11. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine

    Directory of Open Access Journals (Sweden)

    K.R. Caleffi

    2012-02-01

    Full Text Available Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT and dapsone, rifampicin and clofazimine for borderline (BB and lepromatous (LL forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients’ urine samples was successfully amplified by PCR-Pra in 46.6% (34/73 of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306. In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386. PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033. Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

  12. Biosynthetic enhancement of the detection of bacteria by the polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Julie S Do

    Full Text Available Molecular viability testing (MVT was previously reported to specifically detect viable bacterial cells in complex samples. In MVT, brief nutritional stimulation induces viable cells, but not non-viable cells, to produce abundant amounts of species-specific ribosomal RNA precursors (pre-rRNA. Quantitative polymerase chain reaction (qPCR is used to quantify specific pre-rRNAs in a stimulated aliquot relative to a non-stimulated control. In addition to excluding background signal from non-viable cells and from free DNA, we report here that MVT increases the analytical sensitivity of qPCR when detecting viable cells. Side-by-side limit-of-detection comparisons showed that MVT is 5-fold to >10-fold more sensitive than standard (static DNA-targeted qPCR when detecting diverse bacterial pathogens (Aeromonas hydrophila, Acinetobacter baumannii, Listeria monocytogenes, Mycobacterium avium, and Staphylococcus aureus in serum, milk, and tap water. Sensitivity enhancement may come from the elevated copy number of pre-rRNA relative to genomic DNA, and also from the ratiometric measurement which reduces ambiguity associated with weak or borderline signals. We also report that MVT eliminates false positive signals from bacteria that have been inactivated by moderately elevated temperatures (pasteurization, a condition that can confound widely-used cellular integrity tests that utilize membrane-impermeant compounds such as propidium iodide (PI or propidium monoazide (PMA to differentiate viable from inactivated bacteria. MVT enables the sensitive and specific detection of very small numbers of viable bacteria in complex matrices.

  13. Polymerase chain reaction targeting insertion sequence for the diagnosis of extrapulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    V Makeshkumar

    2014-01-01

    Full Text Available Background & objectives: Diagnosis of extrapulmonary tuberculosis (EPTB is difficult using conventional diagnostic methods. This study was conducted to evaluate the use of polymerase chain reaction (PCR in diagnosis of definitive and probable extrapulmonary tuberculosis patients, and to assess the performance of insertion sequence (IS 6110 based PCR assay as compared to conventional culture by Lowenstein-Jensen (LJ method for the diagnosis of EPTB. Methods: A total of 178 non repeated clinical specimens were collected from clinically suspected extrapulmonary tuberculosis patients. The specimens included 59 ascitic fluid, 54 pleural fluid, 25 cerebrospinal fluid (CSF, 12 fine needle aspiration (FNA, 8 urine, 7 pus, 6 synovial fluid, 2 skin tissue, one pericardial fluid, one liver abscess, one pancreatic cyst fluid, one omental biopsy and one semen sample. All these clinical samples were subjected to Ziehl-Neelsen staining (ZN for acid fast bacilli (AFB and culture on LJ medium. PCR was performed by targeting 123bp fragment of insertion sequence IS6110 of Mycobacterium tuberculosis (MTB. Results: Of the 178 specimens, 10 (5.61% were ZN smear positive for AFB, six (3.37% were L-J culture positive from 10 AFB smear positive cases and 48 (26.96% were PCR IS 6110 positive for M. tuberculosis. Interpretation & conclusions: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis. False positive PCR IS6110 in three CSF samples may be due to latent TB infection which was limitation in this study.

  14. Polymerase chain reaction with two molecular targets in mucosal leishmaniasis' diagnosis: a validation study

    Directory of Open Access Journals (Sweden)

    Clemencia Ovalle Bracho

    2007-08-01

    Full Text Available We validated the polymerase chain reaction (PCR with a composite reference standard in 61 patients clinically suspected of having mucosal leishmaniasis, 36 of which were cases and 25 were non-cases according to this reference standard. Patient classification and test application were carried out independently by two blind observers. One pair of primers was used to amplify a fragment of 120 bp in the conserved region of kDNA and another pair was used to amplify the internal transcript spacers (ITS rDNA. PCR showed 68.6% (95% CI 59.2-72.6 sensitivity and 92% (95% CI 78.9-97.7 specificity; positive likelihood ratio: 8.6 (95% CI 2.8-31.3 and negative likelihood ratio: 0.3 (95% CI 0.3-0.5, when kDNA molecular target was amplified. The test performed better on sensitivity using this target compared to the ITS rDNA molecular target which showed 40% (95% CI 31.5-42.3 sensitivity and 96% (95% CI 84.1-99.3 specificity; positive likelihood ratio: 10 (95% CI 2.0-58.8 and negative likelihood ratio: 0.6 (95% CI 0.6-0.8. The inter-observer agreement was excellent for both tests. Based upon results obtained and due to low performance of conventional methods for diagnosing mucosal leishmaniasis, we consider PCR with kDNA as molecular target is a useful diagnostic test and the ITS rDNA molecular target is useful when the aim is to identify species.

  15. Comparison of nasopharyngeal culture, polymerase chain reaction (PCR) and serological test for diagnosis of pertussis.

    Science.gov (United States)

    Cengiz, Ali Bülent; Yildirim, Inci; Ceyhan, Mehmet; Seçmeer, Gülten; Gür, Deniz; Kara, Ateş

    2009-01-01

    This prospective study, which was designed to compare nasopharyngeal culture, polymerase chain reaction (PCR) and serology in the diagnosis of pertussis, covered 35 children aged between 0 and 16 who were admitted to Hacettepe University Ihsan Doğramaci Children's Hospital between 1 March 2005 and 31 August 2006 with coughing for 7 days or longer, paroxysmal cough of any duration, or cough with inspiratory whoop and/or vomiting (or apnea) after coughs. The demographic data and vaccination history of the patients were recorded. During the initial examination, samples were taken from the posterior nasopharynx for Bordetella pertussis (B. pertussis) culture and PCR analysis. In order to determine antibody positivity and antibody levels against B. pertussis antigens, serum samples were taken during the initial examination (acute phase) and two weeks later (convalescent phase). In the first serum sample, immunoglobulin M (IgM) was determined against pertussis toxin. In the first and second samples, IgA and IgG antibodies were evaluated against pertussis toxin and filamentous hemagglutinin. Culture yielded negative results in all of the patients. PCR was positive in two cases (5.7%). In the PCR-positive patients, IgM, IgA and IgG type anti-pertussis antibodies were found to be positive in the first serum samples, and IgA and IgG antibodies were found to be positive in the second serum samples. Therefore, it was considered that serology could be as sensitive as PCR when type IgM, IgA and IgG antibodies were found to be positive against a minimum of two antigens of B. pertussis. In conclusion, both PCR and serologic tests--if evaluating all types of antibodies to a minimum of two antigens of B. pertussis obtained in both acute and convalescent sera--could be more sensitive than culture in the diagnosis of pertussis.

  16. Detection and traceability of genetically modified organisms in the food production chain.

    Science.gov (United States)

    Miraglia, M; Berdal, K G; Brera, C; Corbisier, P; Holst-Jensen, A; Kok, E J; Marvin, H J P; Schimmel, H; Rentsch, J; van Rie, J P P F; Zagon, J

    2004-07-01

    Both labelling and traceability of genetically modified organisms are current issues that are considered in trade and regulation. Currently, labelling of genetically modified foods containing detectable transgenic material is required by EU legislation. A proposed package of legislation would extend this labelling to foods without any traces of transgenics. These new legislations would also impose labelling and a traceability system based on documentation throughout the food and feed manufacture system. The regulatory issues of risk analysis and labelling are currently harmonised by Codex Alimentarius. The implementation and maintenance of the regulations necessitates sampling protocols and analytical methodologies that allow for accurate determination of the content of genetically modified organisms within a food and feed sample. Current methodologies for the analysis of genetically modified organisms are focused on either one of two targets, the transgenic DNA inserted- or the novel protein(s) expressed- in a genetically modified product. For most DNA-based detection methods, the polymerase chain reaction is employed. Items that need consideration in the use of DNA-based detection methods include the specificity, sensitivity, matrix effects, internal reference DNA, availability of external reference materials, hemizygosity versus homozygosity, extrachromosomal DNA, and international harmonisation. For most protein-based methods, enzyme-linked immunosorbent assays with antibodies binding the novel protein are employed. Consideration should be given to the selection of the antigen bound by the antibody, accuracy, validation, and matrix effects. Currently, validation of detection methods for analysis of genetically modified organisms is taking place. In addition, new methodologies are developed, including the use of microarrays, mass spectrometry, and surface plasmon resonance. Challenges for GMO detection include the detection of transgenic material in materials

  17. Detection and traceability of genetically modified organisms in the food production chain.

    Science.gov (United States)

    Miraglia, M; Berdal, K G; Brera, C; Corbisier, P; Holst-Jensen, A; Kok, E J; Marvin, H J P; Schimmel, H; Rentsch, J; van Rie, J P P F; Zagon, J

    2004-07-01

    Both labelling and traceability of genetically modified organisms are current issues that are considered in trade and regulation. Currently, labelling of genetically modified foods containing detectable transgenic material is required by EU legislation. A proposed package of legislation would extend this labelling to foods without any traces of transgenics. These new legislations would also impose labelling and a traceability system based on documentation throughout the food and feed manufacture system. The regulatory issues of risk analysis and labelling are currently harmonised by Codex Alimentarius. The implementation and maintenance of the regulations necessitates sampling protocols and analytical methodologies that allow for accurate determination of the content of genetically modified organisms within a food and feed sample. Current methodologies for the analysis of genetically modified organisms are focused on either one of two targets, the transgenic DNA inserted- or the novel protein(s) expressed- in a genetically modified product. For most DNA-based detection methods, the polymerase chain reaction is employed. Items that need consideration in the use of DNA-based detection methods include the specificity, sensitivity, matrix effects, internal reference DNA, availability of external reference materials, hemizygosity versus homozygosity, extrachromosomal DNA, and international harmonisation. For most protein-based methods, enzyme-linked immunosorbent assays with antibodies binding the novel protein are employed. Consideration should be given to the selection of the antigen bound by the antibody, accuracy, validation, and matrix effects. Currently, validation of detection methods for analysis of genetically modified organisms is taking place. In addition, new methodologies are developed, including the use of microarrays, mass spectrometry, and surface plasmon resonance. Challenges for GMO detection include the detection of transgenic material in materials

  18. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

    Science.gov (United States)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

    1998-01-01

    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  19. Study on the Dynamic Pricing Revenue Distribution Model of Fresh Agricultural Products Supply Chain

    Directory of Open Access Journals (Sweden)

    Haoran Shi

    2013-12-01

    Full Text Available This study divides the sales cycle of fresh agricultural products into two stages according to the features of fresh agricultural products, establishes two pricing strategies according to its sales and through constructing an centralized-control model of supply chain under the constraints of revenue sharing contract and through analyzing different prices in the two stages, it summarizes the sales strategies of retailers and supplier and the anticipated sales, proposes to coordinate the operation of fresh agricultural products supply chain by adjusting the revenue coefficient in the revenue sharing contract. After comparing the revenue of decentralized-control supply chain model and centralized-control supply chain model, this study concludes that centralized-control supply chain model will have higher revenue.

  20. PARTICULARITIES AND MANAGEMENT OF THE DISTRIBUTION CHAIN FOR FISH AND FISHERY PRODUCTS

    Directory of Open Access Journals (Sweden)

    Carmen Georgeta NICOLAE

    2015-10-01

    Full Text Available The total quality principles implementation contributes to the improving in meeting the consumer needs, essential reduction of costs and increasing sales. The total quality is a concept that assures the total satisfaction of clients on the entire distribution chain, including all the actors in this chain. The aquaculture and fisheries are very diverse sectors which use different breeding and fishing technologies and provide a wide variety of specific products. This induces a real complexity of the supply and distribution chain for fish and fishery products, including the links from the production point (fishery or farm to the final consumer. The components of the distribution chain differ with the geographic areas, type of farms, transportation, information on the fishery market and management systems. Implementing the total food quality system for fishery products involves the quality specification in all marketing stages for all products, along the entire distribution chain. The present work was focused on identifying the distribution chain for fish and fishery products with the identification of the specificity of this type of chain form farm to end consumer, which is the first step in the implementation of total quality concept in aquaculture, with all the benefits that come with it.

  1. Two-stage medium chain fatty acid (MCFA) production from municipal solid waste and ethanol

    NARCIS (Netherlands)

    Grootscholten, T.I.M.; Strik, D.P.B.T.B.; Steinbusch, K.J.J.; Buisman, C.J.N.; Hamelers, B.

    2014-01-01

    Chain elongation is an anaerobic fermentation that produces medium chain fatty acids (MCFAs) from volatile fatty acids and ethanol. These MCFAs can be used as biochemical building blocks for fuel production and other chemical processes. Producing MCFAs from the organic fraction of municipal solid wa

  2. Effective use of product quality information in food supply chain logistics

    NARCIS (Netherlands)

    Rijpkema, W.A.

    2014-01-01

    Food supply chains have inherent characteristics, such as variability in product quality and quality decay, which put specific demands on logistics decision making. Furthermore, food supply chain organization and control has changed significantly in the past decades by factors such as scale intensif

  3. Large-Scale Refolding and Enzyme Reaction of Human Preproinsulin for Production of Human Insulin.

    Science.gov (United States)

    Kim, Chang-Kyu; Lee, Seung-Bae; Son, Young-Jin

    2015-10-28

    Human insulin is composed of 21 amino acids of an A-chain and 30 amino acids of a B-chain. This is the protein hormone that has the role of blood sugar control. When the recombinant human proinsulin is expressed in Escherichia coli, a serious problem is the formation of an inclusion body. Therefore, the inclusion body must be denatured and refolded under chaotropic agents and suitable reductants. In this study, H27R-proinsulin was refolded from the denatured form with β-mercaptoethanol and urea. The refolding reaction was completed after 15 h at 15°C, whereas the reaction at 25°C was faster than that at 15°C. The refolding yield at 15°C was 17% higher than that at 25°C. The refolding reaction could be carried out at a high protein concentration (2 g/l) using direct refolding without sulfonation. The most economical and optimal refolding condition for human preproinsulin was 1.5 g/l protein, 10 mM glycine buffer containing 0.6 M urea, pH 10.6, and 0.3 mM β-mercaptoethanol at 15°C for 16 h. The maximum refolding yield was 74.8% at 15°C with 1.5 g/l protein. Moreover, the refolded preproinsulin could be converted into normal mature insulin with two enzymes. The average amount of human insulin was 138.2 g from 200 L of fermentation broth after enzyme reaction with H27R-proinsulin. The direct refolding process for H27R-proinsulin was successfully set up without sulfonation. The step yields for refolding and enzyme reaction were comparatively high. Therefore, our refolding process for production of recombinant insulin may be beneficial to the large-scale production of other biologically active proteins. PMID:26139616

  4. Pea (Pisum sativum) genes involved in symbiosis with nitrogen-fixing bacteria.1.Analysis of the expression of the early nodulin gene ENOD12 using the polymerase chain-reaction

    NARCIS (Netherlands)

    Zalenskii, A.O.; Kozik, A.V.; Scheres, B.J.G.; Bisseling, A.; Tikhonovich, I.A.

    1991-01-01

    The polymerase chain reaction (PCR) was used to detect the transcription products of the early nodulin gene in the pea. Single-stranded DNA copies were prepared using a primer corresponding to the terminal part of a previously sequenced cDNA clone and a total RNA isolate. The presence of amplificati

  5. Open charm and beauty production in hadron reactions

    Energy Technology Data Exchange (ETDEWEB)

    Lykasov, G.I.; Lyubushkin, V.V.; Bednyakov, V.A. [Joint Institute for Nuclear Research, 141980, Dubna, Moscow region (Russian Federation)

    2010-01-15

    The production of charmed and beauty hadrons in proton-proton and proton-antiproton collisions at high energies is analyzed within the modified quark-gluon string model (QGSM) including the internal motion of quarks in colliding hadrons. It is shown that using both the QGSM and NLO QCD one can describe these experimental data rather successfully in a wide region of transverse momenta. We also present some predictions for the future experiments on the beauty baryon production in pp collisions at LHC energies and on the charmed meson production in p-bar p reactions at GSI energies.

  6. Meson productions in heavy ion reactions in CSR energy region

    CERN Document Server

    Jiang Huan Qing

    2002-01-01

    It is important to measure meson productions in heavy ion collisions in order to understand the dynamics of heavy ion reactions and the properties of nuclear matter. The authors review the characteristic and present status of meson productions near the threshold energies in heavy ion collisions. Especially the pion and K sup + productions are discussed. The authors point out that it is meaningful and possible to carry out the experimental studies at the CSR. It is necessary to carry out timely the experimental and the relevant theoretical studies

  7. In vitro degradation and total gas production of byproducts generated in the biodiesel production chain

    Directory of Open Access Journals (Sweden)

    Raissa Kiara oliveira de Morais

    2015-05-01

    Full Text Available This study aimed to evaluate the in vitro degradation and total gas production of different oil seed press cakes from a biodiesel production chain gas through the use of a semi-automatic technique of gas production in vitro. The treatments consisted of substituting elephant grass in increasing levels, 0%, 30, 50 and 70%, with the byproducts of Gossyypium hirsutum, Ricinus communis, Moringa oleifeira, Jatropha curcas and Helianthus annus. The oil seed press cakes of Moringa oleifeira had the highest rate of in vitro degradation of dry matter compared with other foods but did not result in a higher final volume of gases production. Gossyypium hirsutum, Pinhão manso curcas and Ricinus communis showed a higher in vitro degradability of similar dry matter. The highest total gas production was obtained by the oil seed press cakes of Helianthus annus. The oil seed press cakes of Moringa oleifeira can replace elephant grass up to 70% and therefore reduce both greenhouse gas emissions and energy loss for the animal.

  8. Construction of Network Management Information System of Agricultural Products Supply Chain Based on 3PLs

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The necessity to construct the network management information system of 3PLs agricultural supply chain is analyzed,showing that 3PLs can improve the overall competitive advantage of agricultural supply chain.3PLs changes the homogeneity management into specialized management of logistics service and achieves the alliance of the subjects at different nodes of agricultural products supply chain.Network management information system structure of agricultural products supply chain based on 3PLs is constructed,including the four layers (the network communication layer,the hardware and software environment layer,the database layer,and the application layer) and 7 function modules (centralized control,transportation process management,material and vehicle scheduling,customer relationship,storage management,customer inquiry,and financial management).Framework for the network management information system of agricultural products supply chain based on 3PLs is put forward.The management of 3PLs mainly includes purchasing management,supplier relationship management,planning management,customer relationship management,storage management and distribution management.Thus,a management system of internal and external integrated agricultural enterprises is obtained.The network management information system of agricultural products supply chain based on 3PLs has realized the effective sharing of enterprise information of agricultural products supply chain at different nodes,establishing a long-term partnership revolving around the 3PLs core enterprise,as well as a supply chain with stable relationship based on the supply chain network system,so as to improve the circulation efficiency of agricultural products,and to explore the sales market for agricultural products.

  9. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    Science.gov (United States)

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain.

  10. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    Science.gov (United States)

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain. PMID:26169291

  11. Identification of HIV-1 Genotypic Resistance in Patients on First-line Antiretroviral Therapy Using Polymerase Chain Reaction and Sequencing

    Institute of Scientific and Technical Information of China (English)

    Jiang Xiao; Gui-ju Gao; Hong-xin Zhao; Yan-mei Li; Ying-xiu Huang; Wen Zhang; Wen-jing Su; Wei Zhang; Ning Han; Di Yang; Xin Li

    2013-01-01

    Objective The aim of the study was to evaluate the characteristics of HIV drug-genotypic resistance among patients taking ifrst-line ARV regimens using polymerase chain reaction and sequencing, and guide to design optimal ARV regimens for these patients. Methods HIV reverse transcriptase-encoded gene was ampliifed with RT-PCR and ampliifed PCR products were aligned and comparatively analyzed with HIV resistance database to ifnd drug-resistance mutations. Results Twenty-eight PCR products were amplified and sequenced successfully in 30 serum samples of recruited HIV-infected patients with virologic failure. The resistance rate was 96%, mutations in NRT region were found in 26 patients (93%), while mutations in NNRT region were found in 27 patients (96%). M184V was the most common mutation (86%), K65R was selected in 14%of recruited individuals and TAMs occurred in 50%of patients, which resulted in resistance to NRTIs. Y181C and V179D were the most common mutations in NNRTIs and prevalence was 43%(12/28) and 36%(10/28), respectively, which resulted in cross-resistance to NNRTIs due to low-genetic barrier. Conclusions Virologic failure may occur in long-term administration of ifrst-line ARV regimens, and drug-resistance mutations can be found in these patients, which resulted in resistance to ifrst-line ARV regimens. We emphasized that HIV viral load assay and resistance assay were important tools to guide healthcare workers to design an optimal second-line ARV regimens for HAART-experienced individuals with virologic failure.

  12. Chain extension and branching of poly(L-lactic acid produced by reaction with a DGEBA-based epoxy resin

    Directory of Open Access Journals (Sweden)

    2007-11-01

    Full Text Available Dicarboxylated poly(L-lactic acid (PLLA was synthesized by reacting succinic anhydride with L-lactic acid prepolymer prepared by melt polycondensation. PLLA and epoxy resin based on diglycidyl ether of bisphenol A (DGEBA copolymers were prepared by chain extension of dicarboxylated PLLA with DGEBA. Infrared spectra confirmed the formation of dicarboxylated PLLA and PLLA/DGEBA copolymer. Influences of reaction temperature, reaction time, and the amount of DGEBA on the molecular weight and gel content of PLLA/DGEBA copolymer were studied. The viscosity average molecular weight of PLLA/DGEBA copolymer reached 87 900 when reaction temperature, reaction time, and mol ratio of dicarboxylated PLLA to DGEBA is 150°C, 30 min, and 1:1 respectively, while gel content of PLLA/DGEBA copolymer is almost zero.

  13. Sorption enhanced reaction process (SERP) for production of hydrogen

    Energy Technology Data Exchange (ETDEWEB)

    Sircar, S.; Anand, M.; Carvill, B. [Air Products and Chemicals, Inc., Allentown, PA (United States)] [and others

    1995-09-01

    Sorption Enhanced Reaction (SER) is a novel process that is being developed for the production of lower cost hydrogen by steam-methane reforming (SMR). In this process, the reaction of methane with steam is carried out in the presence of an admixture of a catalyst and a selective adsorbent for carbon dioxide. The consequences of SER are: (1) reformation reaction at a significantly lower temperature (300-500{degrees}C) than conventional SMR (800-1100{degrees}C), while achieving the same conversion of methane to hydrogen, (2) the product hydrogen is obtained at reactor pressure (200-400 psig) and at 99+% purity directly from the reactor (compared to only 70-75% H{sub 2} from conventional SMR reactor), (3) downstream hydrogen purification step is either eliminated or significantly reduced in size. The early focus of the program will be on the identification of an adsorbent/chemisorbent for CO{sub 2} and on the demonstration of the SER concept for SMR in our state-of-the-art bench scale process. In the latter stages, a pilot plant will be built to scale-up the technology and to develop engineering data. The program has just been initiated and no significant results for SMR will be reported. However, results demonstrating the basic principles and process schemes of SER technology will be presented for reverse water gas shift reaction as the model reaction. If successful, this technology will be commercialized by Air Products and Chemicals, Inc. (APCI) and used in its existing hydrogen business. APCI is the world leader in merchant hydrogen production for a wide range of industrial applications.

  14. Analysis of Product Complexity considering Disruption Cost in Fast Fashion Supply Chain

    Directory of Open Access Journals (Sweden)

    Shaheen Sardar

    2015-01-01

    Full Text Available Outsourcing in the textile industry has been playing an important role in the global economy for six decades. Recently, reshoring is an emerging trend due to various complexities involved in supply chain management. As compared with basic textile and apparel products, fast fashion products are complex in their own way. A single assortment contains several new styles, colors, and sizes with unpredictable demand and urgent deadlines. Numerous assortments run simultaneously in the supply chain. For each assortment, the garment manufacturer has to source various types of fabrics and materials from different suppliers and then manufacture the garments to ship within the deadlines. This complexity contributes to supply chain disruption. This paper develops a model to estimate supply chain disruption cost as a function of fast fashion product complexity in the global outsourcing environment. Estimation of disruption cost will help us to increase visibility and eliminate the bottlenecks in supply chain. Model conclusions are used to develop a method to manage the level of product complexity from the global supply chain perspective. Several strategies are proposed to manage the impact of product complexity on supply chain design.

  15. Identification of four squid species by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Ye, Jian; Feng, Junli; Liu, Shasha; Zhang, Yanping; Jiang, Xiaona; Dai, Zhiyuan

    2016-02-01

    Squids are distributed worldwide, including many species of commercial importance, and they are often made into varieties of flavor foods. The rapid identification methods for squid species especially their processed products, however, have not been well developed. In this study, quantitative real-time PCR (qPCR) systems based on specific primers and TaqMan probes have been established for rapid and accurate identification of four common squid species (Ommastrephes bartramii, Dosidicus gigas, Illex argentinus, Todarodes pacificus) in Chinese domestic market. After analyzing mitochondrial genes reported in GenBank, the mitochondrial cytochrome b (Cytb) gene was selected for O. bartramii detection, cytochrome c oxidase subunit I (COI) gene for D. gigas and T. Pacificus detection, ATPase subunit 6 (ATPase 6) gene for I. Argentinus detection, and 12S ribosomal RNA (12S rDNA) gene for designing Ommastrephidae-specific primers and probe. As a result, all the TaqMan systems are of good performance, and efficiency of each reaction was calculated by making standard curves. This method could detect target species either in single or mixed squid specimen, and it was applied to identify 12 squid processed products successfully. Thus, it would play an important role in fulfilling labeling regulations and squid fishery control. PMID:26772407

  16. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

    Science.gov (United States)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

    2016-04-01

    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  17. Predators of Anopheles gambiae sensu lato (Diptera: Culicidae) larvae in wetlands, western Kenya: confirmation by polymerase chain reaction method.

    Science.gov (United States)

    Ohba, Shin-Ya; Kawada, Hitoshi; Dida, Gabriel O; Juma, Duncan; Sonye, Gorge; Minakawa, Noboru; Takagi, Masahiro

    2010-09-01

    Polymerase chain reaction analysis was performed to determine whether mosquito predators in wetland habitats feed on Anopheles gambiae sensu lato (s.l.) larvae. Aquatic mosquito predators were collected from six wetlands near Lake Victoria in Mbita, Western Kenya. This study revealed that the whole positive rate of An. gambiae s.l. from 330 predators was 54.2%. The order of positive rate was the highest in Odonata (70.2%), followed by Hemiptera (62.8%), Amphibia (41.7%), and Coleoptera (18%). This study demonstrates that the polymerase chain reaction method can determine whether aquatic mosquito predators feed on An. gambiae s.l. larvae if the predators have undigested An. gambiae s.l. in their midgut or stomach. PMID:20939371

  18. Technical manual for basic version of the Markov chain nest productivity model (MCnest)

    Science.gov (United States)

    The Markov Chain Nest Productivity Model (or MCnest) integrates existing toxicity information from three standardized avian toxicity tests with information on species life history and the timing of pesticide applications relative to the timing of avian breeding seasons to quantit...

  19. A Novel Evaluation Indicator System and Evaluation Method for Supply Chain Performance of Food Production

    Directory of Open Access Journals (Sweden)

    Zhai Xiyao

    2015-02-01

    Full Text Available Supply chain performance evaluation is a research hotspot and lies in the core status in supply chain management. The study presents a new evaluation indicator system and evaluation algorithm for supply chain performance. First, the balanced score card is used to construct an evaluation indicator system for supply chain performance evaluation through analyzing the basic principle and connotation characteristics of supply chain management; Second analytic hierarchy process and fuzzy comprehensive evaluation algorithms are combined to satisfy the dynamic, subjective and transitional characteristics of evaluation indicators and improve evaluation accuracy. Thirdly the evaluation indicator system and evaluation algorithm are used in supply chain performance evaluation of fresh food products and the experimental results shows that the presented evaluation indicator system and evaluation algorithm has satisfied validity and feasibility.

  20. Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

    DEFF Research Database (Denmark)

    Abdulmawjood, A.; Bulte, M.; Roth, S.;

    2004-01-01

    A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The...... selectivity of the assay was evaluated against 155 strains, including 32 E. coli O157, 38 E. coli non-O157, and 85 non-E. coli. It was shown to be highly inclusive (100%) and exclusive (100%). The assay has a 100% detection probability of approximately 2 x 10(3) cells per reaction....