WorldWideScience

Sample records for chain reaction pcr

  1. Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

    OpenAIRE

    İLHAK, O. İrfan; Arslan, Ali

    2007-01-01

    The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

  2. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    Energy Technology Data Exchange (ETDEWEB)

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  3. Identifying of meat species using polymerase chain reaction (PCR)

    Science.gov (United States)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  4. Identifying of meat species using polymerase chain reaction (PCR)

    International Nuclear Information System (INIS)

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

  5. Identifying of meat species using polymerase chain reaction (PCR)

    Energy Technology Data Exchange (ETDEWEB)

    Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  6. Multiplex polymerase chain reaction (PCR) on a SU-8 chip

    DEFF Research Database (Denmark)

    Christensen, Troels Balmer; Bang, Dang Duong; Wolff, Anders

    2008-01-01

    We present the detection of Campylobacter at species level using multiplex PCR in a micro fabricated PCR chip. The chip is based on the polymer SU-8 that allows integration with different microfluidic components, e.g., sample pre-treatment before PCR, and DNA detection simultaneously with or after...... the PCR. The chip performs very well with respect to heating and cooling rates with values up to around 40 °C/s and 20 °C/s, respectively, and has low power consumption (0.5–2.5 W depending on temperature). Multiplex DNA amplification by PCR for the detection of Campylobacter at species level...... was performed successfully on the chip with results comparable to conventional PCR methods. Microsystems often show serious PCR inhibition due to a high surface to volume ratio which causes an increased proclivity of the PCR mix ingredients to stick to the surfaces. To avoid this, a simple method of dynamic...

  7. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  8. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Science.gov (United States)

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... sample (100 to 2000 ng/5 μl) with one of the following 45 μl PCR cocktails: (i) 5 μl 10x PCR buffer, 1...

  9. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    International Nuclear Information System (INIS)

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  10. On-Chip integration of sample pretreatment and Multiplex polymerase chain reaction (PCR) for DNA analysis

    DEFF Research Database (Denmark)

    Brivio, Monica; Snakenborg, Detlef; Søgaard, E.; Ahlford, A.; Syvänen, A.-C; Kutter, Jörg Peter; Wolff, Anders

    In this paper we present a modular lab-on-a-chip system for integrated sample pre-treatment (PT) by magnetophoresis and DNA amplification by polymerase chain reaction (PCR). It consists of a polymer-based microfluidic chip mounted on a custom-made thermocycler (Figure 1) and includes a simple and...

  11. Detection of hepatopancreatic parvovirus (HPV) in wild shrimp from India by nested polymerase chain reaction (PCR).

    Science.gov (United States)

    Manjanaik, B; Umesha, K R; Karunasagar, Indrani; Karunasagar, Iddya

    2005-02-28

    The prevalence of hepatopancreatic parvovirus (HPV) in wild penaeid shrimp samples from India was studied by nested polymerase chain reaction (PCR) using primers designed in our laboratory. The virus could be detected in 9 out of 119 samples by non-nested PCR. However, by nested PCR 69 out of 119 samples were positive. The PCR results were confirmed by hybridization with digoxigenin-labelled DNA probe. Shrimp species positive by non-nested PCR included Penaeus monodon, Penaeus indicus and Penaeus semisulcatus and by nested PCR Parapenaeopsis stylifera, Penaeus japonicus, Metapenaeus monoceros, M. affinis, M. elegans, M. dobsoni, M. ensis and Solenocera choprai. This is the first report on the prevalence of HPV in captured wild shrimp from India. PMID:15819441

  12. A Novel Nested Polymerase Chain Reaction (n-PCR) Assay for Identifying Sorghum nitidum

    OpenAIRE

    Wei, Shasha; Zhirui DENG; Liping YIN; Yi, Jianping; Renqi WU; Qin CHEN

    2011-01-01

    This work developed a novel nested polymerase chain reaction (n-PCR) assay to identify Sorghum nitidum (S. nitidum). It has been designed a set of specific n-PCR inner primers Snit5/Snit2 and outer primers Nout1/Nout2 based on a conserved nucleotide sequence of adh1-like gene of S. nitidum. Fourteen samples of sorghum were used to investigate the specificity of the primers and the n-PCR assay. The result showed that 9 samples of S. nitidum displayed a positive strong, specific amplified band ...

  13. Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

    International Nuclear Information System (INIS)

    Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

  14. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    Science.gov (United States)

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  15. Ultra sensitive detection of Listeria monocytogenes in milk by the polymerase chain reaction (PCR).

    Science.gov (United States)

    Starbuck, M A; Hill, P J; Stewart, G S

    1992-12-01

    The polymerase chain reaction (PCR) has been used to detect Listeria monocytogenes in whole milk at a level of 0.1 cfu per 30 ml. This high degree of sensitivity has been achieved following enzymatic digestion, polysulphonone membrane filtration and amplification of a nucleotide sequence within the promoter region of hlyA. Key elements of the procedure are the absence of enrichment culture and a complete solubilization of the membrane filter, ensuring total nucleic acid recovery. The simplicity of the protocol coupled with high sample volumes and exquisite sensitivity extends the relevance of PCR within food and environmental microbiology. PMID:1368996

  16. Effect of fungal and plant secondary metabolites on polimerase chain reaction (PCR)

    OpenAIRE

    Thaler, Nejc; Bajc, Marko

    2013-01-01

    Secondary metabolites are organic compounds that can be found in both fungi and plants, where they play an important role as defensive and signal molecules, or provide other kinds of advantage in natural selection, but are not directly involved in normal growth, development and reproduction of an organism. When working with DNA techniques, it is the secondary metabolites that most often affect the efficiency of polymerase chain reaction (PCR), either by hindering cell lysis, causing ...

  17. Implementation of polymerase chain reaction (PCR and Real-Time PCR in quick identification of bovine herpesvirus 1

    Directory of Open Access Journals (Sweden)

    Milić Nenad

    2010-01-01

    Full Text Available Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these cell lines. The application of polymerize chain reaction (PCR using a primer for glucoprotein B and thymidine - kinasis, established the presence of bovine herpes virus 1 nucleic acid in one sample of a bovine nasal smear, while the presence of this virus was established in three samples in an examination of the nasal smear samples using the Real-Time PCR method.

  18. Design of Multiplex Polymerase Chain Reaction (PCR Method for Molecular Detection of Yersinia pestis Bacterium

    Directory of Open Access Journals (Sweden)

    Mohammad Soleimani

    2010-01-01

    Full Text Available Objective: Yersinia pestis, the causative agent of the zoonotic plague infection, is a majorpublic health concern both as a threat and potential bioweapon. The objective of thepresent study was to establish a uniplex and multiplex - polymerase chain reaction (PCRtest for the specific detection of Y. pestis.Materials and Methods: PCR reactions performed by three pair primers which targetedthe caf1 and pla genes located on the pFra and pPst plasmids and the irp2 chromosomalgene located on the ‘pathogenicity island’. After TA cloning of the PCR products, the test’slimit of detection (LOD was determined. For evaluating the specificity, PCR reactionswere performed with negative control bacteria.Results: Assays were performed with the genome of Y. pestis which produced three DNAfragments of the expected sizes 300, 400 and 520 bp which corresponded to the irp2,caf1 and pla genes, respectively. The lower LoD was 370 copy numbers for the caf1 geneand 21 for the pla gene. In PCR reactions that used negative control bacteria, detectablefragments were not observed.Conclusion: Our method clearly discriminated Y. pestis DNA. The rapidity, specificityand sensitivity of this procedure suggest that it can serve as a useful alternative methodfor the inoculation of laboratory animals or the use of specific culture media for routineplaque surveillance and outbreak investigations. Another vital result of this study was theestablishment of Y. pestis molecular detection technique in Iran.

  19. Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

    International Nuclear Information System (INIS)

    A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

  20. Thermostable Mismatch-Recognizing Protein MutS Suppresses Nonspecific Amplification during Polymerase Chain Reaction (PCR

    Directory of Open Access Journals (Sweden)

    Seiki Kuramitsu

    2013-03-01

    Full Text Available Polymerase chain reaction (PCR-related technologies are hampered mainly by two types of error: nonspecific amplification and DNA polymerase-generated mutations. Here, we report that both errors can be suppressed by the addition of a DNA mismatch-recognizing protein, MutS, from a thermophilic bacterium. Although it had been expected that MutS has a potential to suppress polymerase-generated mutations, we unexpectedly found that it also reduced nonspecific amplification. On the basis of this finding, we propose that MutS binds a mismatched primer-template complex, thereby preventing the approach of DNA polymerase to the 3' end of the primer. Our simple methodology improves the efficiency and accuracy of DNA amplification and should therefore benefit various PCR-based applications, ranging from basic biological research to applied medical science.

  1. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    Energy Technology Data Exchange (ETDEWEB)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  2. Nanoscale superstructures assembled by polymerase chain reaction (PCR): programmable construction, structural diversity, and emerging applications.

    Science.gov (United States)

    Kuang, Hua; Ma, Wei; Xu, Liguang; Wang, Libing; Xu, Chuanlai

    2013-11-19

    Polymerase chain reaction (PCR) is an essential tool in biotechnology laboratories and is becoming increasingly important in other areas of research. Extensive data obtained over the last 12 years has shown that the combination of PCR with nanoscale dispersions can resolve issues in the preparation DNA-based materials that include both inorganic and organic nanoscale components. Unlike conventional DNA hybridization and antibody-antigen complexes, PCR provides a new, effective assembly platform that both increases the yield of DNA-based nanomaterials and allows researchers to program and control assembly with predesigned parameters including those assisted and automated by computers. As a result, this method allows researchers to optimize to the combinatorial selection of the DNA strands for their nanoparticle conjugates. We have developed a PCR approach for producing various nanoscale assemblies including organic motifs such as small molecules, macromolecules, and inorganic building blocks, such as nanorods (NRs), metal, semiconductor, and magnetic nanoparticles (NPs). We start with a nanoscale primer and then modify that building block using the automated steps of PCR-based assembly including initialization, denaturation, annealing, extension, final elongation, and final hold. The intermediate steps of denaturation, annealing, and extension are cyclic, and we use computer control so that the assembled superstructures reach their predetermined complexity. The structures assembled using a small number of PCR cycles show a lower polydispersity than similar discrete structures obtained by direct hybridization between the nanoscale building blocks. Using different building blocks, we assembled the following structural motifs by PCR: (1) discrete nanostructures (NP dimers, NP multimers including trimers, pyramids, tetramers or hexamers, etc.), (2) branched NP superstructures and heterochains, (3) NP satellite-like superstructures, (4) Y-shaped nanostructures and DNA

  3. Pilot Study of COBAS PCR and Ligase Chain Reaction for Detection of Rectal Infections Due to Chlamydia trachomatis

    OpenAIRE

    Matthew R Golden; Astete, Sabina G.; Galvan, Rosa; Lucchetti, Aldo; Sanchez, Jorge; Celum, Connie L.; Whittington, William L. H.; Stamm, Walter E.; Holmes, King K.; Totten, Patricia A.

    2003-01-01

    We tested rectal specimens from men who have sex with men for Chlamydia trachomatis by using COBAS PCR (Roche Diagnostics) and ligase chain reaction LCR (Abbott laboratories) and compared three PCR specimen-processing procedures. Chlamydiae were detected by one or more procedures in 22 of 186 specimens. All three PCR tests were positive for 17 specimens, all of which also tested positive by LCR.

  4. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  5. Polymerase chain reaction as a succesful biotechnological application. Ways we use PCR in the fields of bioinformatics forensics and genetics

    OpenAIRE

    Λάζαρη, Σπυριδούλα

    2011-01-01

    Molecular genetics use molecular methods that amplify specific fragments of DNA. Today, the molecular techniques which were developed for amplification and detection of specific sequences of nucleic acids helped in a great deal to understand the structure of many diseases. Polymerase chain reaction or PCR is a technique that is used for isolation and amplification of a specific sequence of DNA. PCR is an in vitro method that exploits the in vivo procedure of replication of DNA. DNA polyme...

  6. Leptospira spp detection by Polymerase Chain Reaction (PCR) in clinical samples of captive black-capped Capuchin monkey (Cebus apella)

    OpenAIRE

    Scarcelli Eliana; Piatti Rosa Maria; Fedullo José Daniel Luzes; Simon Faiçal; Cardoso Maristela Vasconcellos; Castro Vanessa; Miyashiro Simone; Genovez Margareth Élide

    2003-01-01

    Leptospirosis is a widely distributed zoonosis that affects domestic and wild animals, and that has the man as the end point of its epidemiological chain. Leptospirosis diagnosis in primates is more difficult than in other animal species, as clinical signs and lesions are less evident and antibody response is detected only for short periods. The aim of this article was to describe the detection of Leptospira spp using polymerase chain reaction (PCR), in clinical samples from one captive black...

  7. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.; Heum, M.; Thornton, J.M.; Powell, R.

    1999-01-01

    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot......-sets only. A. salmonicida subsp. salmonicida isolates tested, belonged to group 1. The PCR primer-sets separated A. salmonicida from other reference strains of Aeromonas species and related bacteria with the exception of Aeromonas hydrophila. The results indicated that PCR typing is a useful framework for...

  8. Polymerase chain reaction (PCR)-based typing analysis of atypical isolates of the fish pathogen Aeromonas salmonicida

    DEFF Research Database (Denmark)

    Høie, S.; Dalsgaard, Inger; Aase, I.L.;

    1999-01-01

    Two hundred and five isolates of atypical Aeromonas salmonicida, recovered from a wide range of hosts and countries were characterized by polymerase chain reaction (PCR) targeting four genes. The chosen genes were those encoding the extracellular A-layer protein (AP), the serine protease (Sprot......), the glycerophospholipid:cholestrol acetyltransferase protein (GCAT), and the 16S rRNA (16S rDNA). All the atypical A. salmonicida isolates could be assigned to 4 PCR groups. Group 1 comprised 45 strains which rested positive for PCR amplification, using the 16S rDNA, GCAT2, Sprot2, and AP primer......-sets only. A. salmonicida subsp. salmonicida isolates tested, belonged to group 1. The PCR primer-sets separated A. salmonicida from other reference strains of Aeromonas species and related bacteria with the exception of Aeromonas hydrophila. The results indicated that PCR typing is a useful framework for...

  9. Polymerase chain reaction

    OpenAIRE

    Gaurav Solanki

    2015-01-01

    The polymerase chain reaction (PCR) is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation...

  10. Vpliv glivnih in rastlinskih sekundarnih metabolitov na verižno reakcijo s polimerazo (PCR): Effect of fungal and plant secondary metabolites on polimerase chain reaction (PCR):

    OpenAIRE

    Bajc, Marko; Thaler, Nejc

    2013-01-01

    Secondary metabolites are organic compounds that can be found in both fungi and plants, where they play an important role as defensive and signal molecules, or provide other kinds of advantage in natural selection, but are not directly involved in normal growth, development and reproduction of an organism. When working with DNA techniques, it is the secondary metabolites that most often affect the efficiency of polymerase chain reaction (PCR), either by hindering cell lysis, causing decomposi...

  11. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    OpenAIRE

    Krøjgaard Louise H; Krogfelt Karen A; Albrechtsen Hans-Jørgen; Uldum Søren A

    2011-01-01

    Abstract Background Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the useful...

  12. Detection of Adenoviruses from clinical samples in bone marrow transplant patients by nested PCR (polymerase chain reaction)

    OpenAIRE

    Fatemeh Sabagh; Michael Roggendorf

    2012-01-01

    Adenoviruses are recognized as common human pathogens that are responsible for a wide variety of infectious syndromes. Bone marrow transplant patients are prone to life threatening opportunistic infections like adenoviruses. The nested polymerase chain reaction has provided an alternative, sensitive diagnostic method for detection of Adenoviruses. In this study we developed PCR from hexon genes as rapid diagnostic method of Advs infections on different clinical samples. Adenovirus infections ...

  13. Detection of hepatitis C virus RNA: comparison of one-stage polymerase chain reaction (PCR) with nested-set PCR.

    OpenAIRE

    Gretch, D R; Wilson, J. J; Carithers, R L; dela Rosa, C; Han, J. H.; Corey, L

    1993-01-01

    We evaluated a new hepatitis C virus RNA assay based on one-stage PCR followed by liquid hybridization with an oligonucleotide probe and compared it with nested-set PCR. The one-stage and nested-set PCR assays had identical sensitivities in analytical experiments and showed 100% concordance when clinical specimens were used. One-stage PCR may be less prone to contamination than nested-set PCR.

  14. Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

    DEFF Research Database (Denmark)

    Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen; Uldum, Søren A.

    2011-01-01

    samples without any background information regarding treatment, timing, etc is dubious. However, the rapid detection by qPCR of high concentrations of Legionella - especially Legionella pneumophila - is valuable as an indicator of risk, although it may be false positive compared to culture results. On the......Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...

  15. KONSTRUKSI MUTAN PROTEIN FOSFATASE ptc2D Saccharomyces cerevisiae DENGAN METODE PENGGANTIAN GEN TARGET DENGAN POLYMERASE CHAIN REACTION (PCR

    Directory of Open Access Journals (Sweden)

    Hermansyah

    2011-05-01

    Full Text Available Yeast Saccharomyces cerevisiae is an excellent model to studi genes function of eukarotic cells such as study of gene encoding protein phosphatase PTC2. Novel phenotypic caused by mutated gene is an important step to study function of gene. In this study constructed mutant of PTC2 gene encoding protein phosphatase. Method that used in this construction was replacement of target gene (PTC2 with auxotroph marker Candida albicans HIS3 by Polymer Chain Reaction (PCR or called by PCR-mediated disruption. Mutant colonies which grew in selective medium SC without histidine were confirmed by PCR amplification. By using 1% Agarose gel electrophoresis the result showed that size of ptc2D::CgHIS3 transformant was 3.52 kb while wild type strain was 2.9 kb, indicated that ptc2D::CgHIS3 has integrated on chromosome V replacing PTC2 wild type.

  16. Leptospira spp detection by Polymerase Chain Reaction (PCR in clinical samples of captive black-capped Capuchin monkey (Cebus apella

    Directory of Open Access Journals (Sweden)

    Scarcelli Eliana

    2003-01-01

    Full Text Available Leptospirosis is a widely distributed zoonosis that affects domestic and wild animals, and that has the man as the end point of its epidemiological chain. Leptospirosis diagnosis in primates is more difficult than in other animal species, as clinical signs and lesions are less evident and antibody response is detected only for short periods. The aim of this article was to describe the detection of Leptospira spp using polymerase chain reaction (PCR, in clinical samples from one captive black-capped Capuchin monkey (Cebus apella, which presented characteristics compatible with leptospirosis (jaundice and haemorrhagic kdney in the macroscopic post-mortem examination. A friable kidney fragment and urine sample were cultured and submitted to experimental inoculation in guinea pigs and PCR using genus specific primer pair targeting the 16S rRNA region from Leptospira interrogans serovar canicola. Isolation of the agent was negative both in culture and experimental inoculation. The PCR amplification of the clinical samples showed a 330 pb amplified fragment that corresponds to the Leptospira genus. Based on these results PCR was considered an important tool for leptospira detection in nonhumam primates, more sensitive and specific than other techniques, especially considering that the viability of the pathogen was not possible. These advantages enable the detection of the leptospiras in urine and kidney, even when autolysed, frozen or badly conserved, which prevented the isolation and experimental inoculation from positive results.

  17. Isolation and identification of Mycoplasma agalactiae by culture and polymerase chain reaction (PCR from sheep of Qom province, Iran

    Directory of Open Access Journals (Sweden)

    Abtin, A.R.

    2013-05-01

    Full Text Available Contagious agalactia (C.A is an infectious syndrome of sheep that is characterized by mastitis andsubsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. Mycoplasma agalactiae(M. agalactiae is the main cause of the disease in sheep. The aim of this study was isolation andidentification of M. agalactiae with culture and polymerase chain reaction (PCR assay from sheep of Qomprovince in Iran. A total of 102 samples were collected from milk secretion, eye, ear and joint exudates ofsheep. All samples were cultured in PPLO broth supplemented for M. agalaciae isolation. The bacteriaDNAs were extracted by phenol/chloroform method and the PCR assay was applied for detecting ofMycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment oflipoprotein gene from culture as same as in clinical samples. Out of the 102 samples, 19(18.63% cultureswere shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and59(57.8% were scored positive by Mycoplasma genus PCR, 19(18.62% of the samples were scoredpositive by using M. agalactiae PCR as diagnostic method. Out of the 102 samples, 19 samples wereshown both positive in the culture and PCR, 42 samples were shown both negative in the culture and PCR.40 samples were negative in the culture and positive in PCR whereas only one sample was positive inculture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from milk and less in joint samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Qom province.

  18. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    International Nuclear Information System (INIS)

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  19. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    Science.gov (United States)

    Shen, Cenchao; Yang, Wenjuan; Ji, Qiaoli; Maki, Hisaji; Dong, Anjie; Zhang, Zhizhou

    2009-11-01

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  20. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP for rapid diagnosis of neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Anusha Rohit

    2016-01-01

    Full Text Available Background & objectives: The difficulties in diagnosis of neonatal sepsis are due to varied clinical presentation, low sensitivity of blood culture which is considered the gold standard and empirical antibiotic usage affecting the outcome of results. Though polymerase chain reaction (PCR based detection of bacterial 16S rRNA gene has been reported earlier, this does not provide identification of the causative agent. In this study, we used restriction fragment length polymorphism (RFLP of amplified 16S rRNA gene to identify the organisms involved in neonatal sepsis and compared the findings with blood culture. Methods: Blood samples from 97 neonates were evaluated for diagnosis of neonatal sepsis using BacT/Alert (automated blood culture and PCR-RFLP. Results: Bacterial DNA was detected by 16S rRNA gene PCR in 55 cases, while BacT/Alert culture was positive in 34 cases. Staphylococcus aureus was the most common organism detected with both methods. Klebsiella spp. was isolated from four samples by culture but was detected by PCR-RFLP in five cases while Acinetobacter spp. was isolated from one case but detected in eight cases by PCR-RFLP. The sensitivity of PCR was found to be 82.3 per cent with a negative predictive value of 85.7 per cent. Eighty of the 97 neonates had prior exposure to antibiotics. Interpretation & conclusions:The results of our study demonstrate that PCR-RFLP having a rapid turnaround time may be useful for the early diagnosis of culture negative neonatal sepsis.

  1. Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Gaurav Solanki

    2012-10-01

    Full Text Available The polymerase chain reaction (PCR is a technique in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. PCR is now a common and often indispensable technique used in medical and biological research labs for a variety of applications. There are three major steps involved in the PCR technique: denaturation, annealing and extension. PCR is useful in the investigation and diagnosis of a growing number of diseases. PCR is also used in forensics laboratories. PCR can identify genes that have been implicated in the development of cancer. The present paper is an attempt to review basics of PCR in relation to its methods, application and use.

  2. Detection of Legionella by quantitative-polymerase chain reaction (qPCR for monitoring and risk assessment

    Directory of Open Access Journals (Sweden)

    Krøjgaard Louise H

    2011-11-01

    Full Text Available Abstract Background Culture and quantitative polymerase chain reaction (qPCR assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a circulation water b water from empty apartments c water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool for risk assessment. Results In water collected from the apartments Legionella spp were detected by qPCR in the concentration range from LOQ to 9.6*105GU/L while L. pneumophila were detected in a range from LOQ to 6.8*105 GU/L. By culturing, the legionellae were detected in the range from below detection limit (> 10 CFU/L to 1.6*106 CFU/L. In circulating water and in first flush water from shower hoses, culture and qPCR showed the same tendencies. The overall correlation between the bacteria number detected by culture and the two developed qPCR assays (L. spp and L. pneumophila was relatively poor (r2 = 0.31 for culture and Legionella spp. assay, r2 = 0.20 for culture and L. pneumophila assay. Conclusion Detection by qPCR was suitable for monitoring changes in the concentration of Legionella but the precise determination of bacteria is difficult. Risk assessment by qPCR only on samples without any background information regarding treatment, timing, etc is dubious. However, the rapid detection by qPCR of high concentrations of Legionella - especially Legionella pneumophila - is valuable as an indicator of risk, although it may be false positive compared to culture results. On the other hand, the detection of a low number of bacteria by qPCR is a strong indication for the absence of risk.

  3. Use of Polymerase Chain Reaction Enzyme Linked Oligonucleotide Sorbent Assay (Pcr-Elosa for Detection of Disease Agents

    Directory of Open Access Journals (Sweden)

    Simson Tarigan

    2016-03-01

    Full Text Available Diagnostic tool comprises one of the vital components in the control of infectious diseases. One of the most common techniques in the diagnosis of infectious disease currently available is the polymerase chain reaction (PCR because this technique is very sensitive, specific, and rapid. This technique requires an adjunct technique to indicate the formation of the right reaction product. Agarose gel electrophoresis has been the most common technique to visualise the PCR product or amplicon. Enzyme linked oligonucleotide sorbent assay (ELOSA is an alternative technique which is more sensitive and gives more important identity of the amplicon. This technique can be more than 100 times as sensitive as a gel agarose electrophoresis, and very specific since confirmation of the amplicon is carried out by DNA hibridisation. The capacity of the ELOSA can also be extended to the detection of disease-causal agent at subtype level, or detection of mutation at particular location in a gene. Since the equipment used for ELOSA is similar to that for ELISA (enzyme linked immunosorbent assay, a large number of samples can be accomplished rapidly. As in ELISA, a number of variation can be made in ELOSA depend on the requirement. Nucleotide can be immobilised on the microwell plate either by passive adsorbtion, by first conjugation of nucleotide with biotin then immobilisation on streptavidin-coated microwell plate, or immobilisaion by covalent bonding. The PCR and ELOSA can be performed at separate or in a single tube by first immobilising the PCR primers on the surface of microwell plates.

  4. Screening of Transformed Bacteriial Colonies By Using Polymerase Chain Reaction (Pcr-screening)

    OpenAIRE

    ÖZDARENDELİ, Aykut; TORAMAN, Zülal Aşçı; Kuk, Salih; TONBAK, Şükrü; Bulut, Yasemin; Kalkan, Ahmet

    2003-01-01

    Aim: In this study, it was investigated that bacterial colonies obtained after transformation were tested whether they contained positive recombinant colonies by using PCR screening method. Material and method: For this aim, Fasciola hepatica cathepsin L1 gene and Rinderpest virus matrix gene were cloned into three different vector systems and transformed into E. coli. It was determined some bacterial colonies which had the right size band after PCR screening. Plasmid DNA of those bacterial...

  5. Statistical Models for the Analysis and Design of Digital Polymerase Chain Reaction (dPCR) Experiments.

    Science.gov (United States)

    Dorazio, Robert M; Hunter, Margaret E

    2015-11-01

    Statistical methods for the analysis and design of experiments using digital PCR (dPCR) have received only limited attention and have been misused in many instances. To address this issue and to provide a more general approach to the analysis of dPCR data, we describe a class of statistical models for the analysis and design of experiments that require quantification of nucleic acids. These models are mathematically equivalent to generalized linear models of binomial responses that include a complementary, log-log link function and an offset that is dependent on the dPCR partition volume. These models are both versatile and easy to fit using conventional statistical software. Covariates can be used to specify different sources of variation in nucleic acid concentration, and a model's parameters can be used to quantify the effects of these covariates. For purposes of illustration, we analyzed dPCR data from different types of experiments, including serial dilution, evaluation of copy number variation, and quantification of gene expression. We also showed how these models can be used to help design dPCR experiments, as in selection of sample sizes needed to achieve desired levels of precision in estimates of nucleic acid concentration or to detect differences in concentration among treatments with prescribed levels of statistical power. PMID:26436653

  6. Implementation and Evaluation of a Tutor-Supported Computer-Based Practical Biochemistry Course "Polymerase Chain Reaction (PCR)" in Preclinical Education

    OpenAIRE

    Kröncke, KD; Becher, T

    2008-01-01

    Background: The polymerase chain reaction (PCR) is an example of a technology that for many medical students is not easy to understand. We investigated whether a tutor-supported e-learning teaching unit is suitable to teach undergraduate medical students the PCR. Methods: We developed a computer-based practical course (attendance is compulsory) that uses an open source-based system as a learning platform. The students learned to search in scientific medical databases to find PCR-releva...

  7. Chain reaction

    International Nuclear Information System (INIS)

    Chain Reaction is a work of recent American political history. It seeks to explain how and why America came to depend so heavily on its experts after World War II, how those experts translated that authority into political clout, and why that authority and political discretion declined in the 1970s. The author's research into the internal memoranda of the Atomic Energy Commission substantiates his argument in historical detail. It was not the ravages of American anti-intellectualism, as so many scholars have argued, that brought the experts back down to earth. Rather, their decline can be traced to the very roots of their success after World War II. The need to over-state anticipated results in order to garner public support, incessant professional and bureaucratic specialization, and the sheer proliferation of expertise pushed arcane and insulated debates between experts into public forums at the same time that a broad cross section of political participants found it easier to gain access to their own expertise. These tendencies ultimately undermined the political influence of all experts. (author)

  8. A polymerase chain reaction (PCR) system to detect Babesia equi in blood of Italian horses

    International Nuclear Information System (INIS)

    The aim was to develop a new and more sensitive diagnostic alternative to detect Babesia equi infection in horses. A PCR system, which amplified a 664bp region of the 16S-like rRNA coding region, was designed and validated by comparing its diagnostic performance with those of the complement fixation test (CFT) and the microscopic examination

  9. Opisthorchis viverrini: Detection by polymerase chain reaction (PCR) in human stool samples

    Digital Repository Service at National Institute of Oceanography (India)

    Umesha, K.R.; SanathKumar; Parvathi, A.; Duenngai, K.; Sithithaworn, P.; Karunasagar, Indrani; Karunasagar, Iddya

    /ml ethidium bromide and the gel was analyzed using the Gel doc System (Herolab, Germany). 2.3. Determination of sensitivity of detection in stool specimens artificially spiked with O. viverrini eggs To determine the sensitivity of primers for detection... of different numbers of O. viverrini eggs in human stool, 1 g of a PCR negative stool specimen was artificially spiked with different numbers (1, 5, 10, 50, 100, 250 and 500) of O. viverrini eggs. The total DNA was extracted by CTAB method as described...

  10. Molecular characterization of Trichinella genotypes by inter-simple sequence repeat polymerase chain reaction (ISSR-PCR).

    Science.gov (United States)

    Fonseca-Salamanca, F; Nogal-Ruiz, J J; Benito, C; Camachot, M V; Martínez-Fernández, A R

    2006-06-01

    A bulk analysis of inter-simple sequence repeat-polymerase chain reaction (ISSR-PCR) provides a quick, reliable, and highly informative system for DNA banding patterns that permit species identification. The present study evaluates the applicability of this system to Trichinella species identification. After a single amplification carried out on a single larva with the primer 816([CA]nRY) under high stringency conditions, which provide high reproducibility, we were able to identify by consistent banding patterns 5 sibling species: Trichinella spiralis (ISS48), 2 Trichinella britovi isolates (ISS11 and ISS86), Trichinella murrelli (ISS35), Trichinella nativa (ISS71), Trichinella nelsoni (ISS29); 3 additional Trichinella genotypes: T8 (ISS149), T9 (ISS408 and ISS409), and T6 (ISS34); and the nonencapsulated species Trichinella pseudospiralis (ISS13). Moreover, 33 new Trichinella isolates from 2 zoogeographical regions were unequivocally identified. All Trichinella isolates have shown an identical pattern with those produced by the reference strain. According to these data, we have demonstrated that ISSR-PCR is a robust technique that emerges as a useful new application for the molecular identification of Trichinella isolates in epidemiological studies. PMID:16884006

  11. Molecular typing of Paenibacillus larvae strains isolated from Bulgarian apiaries based on repetitive element polymerase chain reaction (Rep-PCR).

    Science.gov (United States)

    Rusenova, Nikolina; Parvanov, Parvan; Stanilova, Spaska

    2013-06-01

    The aim of the present study was to perform molecular typing of Paenibacillus larvae (P. larvae) isolates from Bulgarian apiaries with repetitive element polymerase chain reaction (rep-PCR) using BOX A1R, MBO REP1, and ERIC primers. A total of 96 isolates collected from brood combs with clinical symptoms of American foulbrood originating from apiaries located in different geographical regions of Bulgaria, a reference strain P. larvae NBIMCC 8478 and 30 commercial honey samples with Bulgarian origin were included in the study. Rep-PCR fingerprinting analysis revealed two genotypes ab and AB of P. larvae isolates from brood combs and honey samples. A combination of genotypes ab/AB was detected in one apiary and honey sample. The prevailing genotype ab was found in 78.1 % of brood combs isolates as well as in the reference strain whereas genotype AB was determined in 21.9 % of isolates. The examination of honey samples confirmed the preponderance of ab genotype which was demonstrated in 20 of 30 samples analyzed. In conclusion, the genetic epidemiology of P. larvae revealed two genotypes--ab and AB for Bulgarian strains. Developed protocols for molecular typing of P. larvae are reliable and may be used to trace the source of infection. PMID:23361165

  12. PCR (Polymerase Chain Reaction) Assay On Antibiotics Resistant Clinical Isolates Of Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    To detect to DNA of 9 drug-resistant isolates of m. tuberculosis such as isoniazid, streptomycin, isoniazid + streptomycin and isoniazid + rifampisin- resistant isolates, the DNA amplification by using PCR assay was carried out after lysing the bacterial cells. Two primer pairs for amplification used were Pt8 and Pt9 and Pt3 and Pt6. The amplified DNA taeget of 8 drug-resistant isolates and 1 drug-resistant isolate by means Pt8 8 Pt9 primer, gave the positive and negative result, respectively. Presence of amplified DNA target fragmens/bands on agarose gel, showed the positive result and vice verse. PCR process by using Pt3 and Pt6 primer revealed the positive results on 2 drug-resistant islates, whereas there was no amplified DNA bands from the other 7 isolates. DNA amplification by using either Pt8 and Pt9 or Pt3 and Pt6 primers occurred on H sub.37Rv strain DNA. Size of the amplified DNA products with Pt8 and Pt9 and Pt3 and Pt6 primers were 541 bp and 188 bp, respectively

  13. Implementierung und Evaluierung eines tutoriell betreuten elektronischen Biochemie-Praktikumsversuchs "Polymerase-Kettenreaktion (PCR)" im vorklinischen Studienabschnitt [Implementation and Evaluation of a Tutor-Supported Computer-Based Practical Biochemistry Course "Polymerase Chain Reaction (PCR)" in Preclinical Education

    OpenAIRE

    Kröncke, Klaus-Dietrich; Becher, Thomas

    2008-01-01

    [english] Background: The polymerase chain reaction (PCR) is an example of a technology that for many medical students is not easy to understand. We investigated whether a tutor-supported e-learning teaching unit is suitable to teach undergraduate medical students the PCR. Methods: We developed a computer-based practical course (attendance is compulsory) that uses an open source-based system as a learning platform. The students learned to search in scientific medical databases to find PCR-r...

  14. Quantitative polymerase chain reaction (PCR) assays for a bacterial thiaminase I gene and the thiaminase-producing bacterium Paenibacillus thiaminolyticus.

    Science.gov (United States)

    Richter, C.A.; Wright-Osment, Maureen K.; Zajicek, J.L.; Honeyfield, D.C.; Tillitt, D.E.

    2009-01-01

    The thiaminase I enzyme produced by the gram-positive bacterium Paenibacillus thiaminolyticus isolated from the viscera of Lake Michigan alewives Alosa pseudoharengus is currently the only defined source of the thiaminase activity linked to thiamine (vitamin B1) deficiency in early mortality syndrome (EMS) in the larvae of Great Lakes salmonines. Diets of alewife or isolated strains of P. thiaminolyticus mixed in a semipurified diet and fed to lake trout Salvelinus namaycush have been shown to produce EMS in fry. We utilized quantitative polymerase chain reaction (Q-PCR) to aid in studies of the sources of P. thiaminolyticus and thiaminase I. Quantitative PCR assays were established to detect the thiaminase I gene of P. thiaminolyticus, the 16S rRNA gene from most species of bacteria, and the 16S rRNA gene specifically from P. thiaminolyticus and a few closely related taxa. The Q-PCR assays are linear over at least six orders of magnitude and can detect the thiaminase I gene of P. thiaminolyticus from as few as 1,000 P. thiaminolyticus cells/g of sample or the Paenibacillus 16S rRNA gene from as few as 100 P. thiaminolyticus cells/g of sample. The initial results from alewife viscera samples with high thiaminase activity yielded unexpectedly low densities of P. thiaminolyticus cells; Paenibacillus thiaminolyticus was detectable in 2 of 6 alewife viscera tested at densities on the order of 100 cells/g out of 100,000,000 total bacterial cells/g. The low numbers of P. thiaminolyticus detected suggest that alewives contain additional non-P. thiaminolyticus sources of thiaminase activity.

  15. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

    OpenAIRE

    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

    2014-01-01

    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients.

  16. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp

    OpenAIRE

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Díez Baños, Pablo; Píriz, Ana; Fickel, Joerns; Sánchez, Antonio

    2011-01-01

    The present study aimed to establish a fluorescence- based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus- specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were an...

  17. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    DEFF Research Database (Denmark)

    Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte;

    2013-01-01

    We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

  18. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter;

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the...

  19. Loop mediated isothermal amplification assay using hydroxy naphthol blue, conventional polymerase chain reaction and real-time PCR in the diagnosis of intraocular tuberculosis

    Directory of Open Access Journals (Sweden)

    P K Balne

    2015-01-01

    Full Text Available This study is a comparative evaluation (Chi-square test of a closed tube loop mediated isothermal amplification assay using hydroxy naphthol blue dye (HNB-LAMP, real-time polymerase chain reaction (PCR and conventional PCR in the diagnosis of intraocular tuberculosis. Considering clinical presentation as the gold standard in 33 patients, the sensitivity of HNB-LAMP assay (75.8% was higher (not significant, P value 0.2 than conventional PCR (57.6% and lower than real-time PCR (90.9%. Specificity was 100% by all three methods. No amplification was observed in negative controls (n = 20 by all three methods. The cost of the HNB-LAMP assay was Rs. 500.00 and it does not require thermocycler, therefore, it can be used as an alternative to conventional PCR in resource-poor settings.

  20. Detection of Phakopsora pachyrhizi fungus by Polymerase Chain Reaction technique (PCR) after soy grains treatment by electron beams

    International Nuclear Information System (INIS)

    Today Brazil, as the largest soy exporter in the world, has undergone the consequences of the contamination of these crops by the Asian dust fungus, being harmed since the plantation up to the harvest, with losses in its productivity ranging 10-80%. As it is a new disease in the Americas, there are not any resistant species to this fungus attack. The grains contamination harms the exportation for countries which do not want to have their crops contaminated, affecting therefore the international commerce and agro-business relationship with those countries Brazil has trade with. The Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is of difficult control, since occurs through the wind dispersion. The P. pachyrhizi is an Asian fungus and was recently found in South Africa, Paraguay, Argentina and Brazil. As an alternative process to minimize these losses is the process to preserve the grains by radiation, the use of the electron accelerator was indicated, since its advantage for the grains exportation industry is fundamental. Besides the possibility of being disconnected when not in use, this source does not need to be recharged, is easily available and has high dose rate, streamlining the process and reducing logistics costs. The present work aims to identify, by the Polymerase Chain Reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soy grains, at doses 1 and 2 kGy, at the IPEN-CNEN electron Accelerator, a Dynamitron Machine (Radiation Dynamics Co. model JOB, New York, USA), with 1.5 MeV power and 2.5 mA electrical current. (author)

  1. A Rapid and Sensitive Detection of Aflatoxin-producing Fungus Using an Optimized Polymerase Chain Reaction (PCR)

    Science.gov (United States)

    Bintvihok, Anong; Treebonmuang, Supitchaya; Srisakwattana, Kitiya; Nuanchun, Wisut; Patthanachai, Koranis; Usawang, Sungworn

    2016-01-01

    Aflatoxin B1 (AFB1) is produced by Aspergillus flavus growing in feedstuffs. Early detection of maize contamination by aflatoxigenic fungi is advantageous since aflatoxins exert adverse health effects. In this study, we report the development of an optimized conventional PCR for AFB1 detection and a rapid, sensitive and simple screening Real-time PCR (qPCR) with SYBR Green and two pairs of primers targeting the aflR genes which involved aflatoxin biosynthesis. AFB1 contaminated maize samples were divided into three groups by the toxin concentration. Genomic DNA was extracted from those samples. The target genes for A. flavus were tested by conventional PCR and the PCR products were analyzed by electrophoresis. A conventional PCR was carried out as nested PCR to verify the gene amplicon sizes. PCR-RFLP patterns, obtained with Hinc II and Pvu II enzyme analysis showed the differences to distinguish aflatoxin-producing fungi. However, they are not quantitative and need a separation of the products on gel and their visualization under UV light. On the other hand, qPCR facilitates the monitoring of the reaction as it progresses. It does not require post-PCR handling, which reduces the risk of cross-contamination and handling errors. It results in a much faster throughout. We found that the optimal primer annealing temperature was 65°C. The optimized template and primer concentration were 1.5 μL (50 ng/μL) and 3 μL (10 μM/μL) respectively. SYBR Green qPCR of four genes demonstrated amplification curves and melting peaks for tub1, afIM, afIR, and afID genes are at 88.0°C, 87.5°C, 83.5°C, and 89.5°C respectively. Consequently, it was found that the four primers had elevated annealing temperatures, nevertheless it is desirable since it enhances the DNA binding specificity of the dye. New qPCR protocol could be employed for the determination of aflatoxin content in feedstuff samples. PMID:26977262

  2. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    Science.gov (United States)

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. PMID:26880717

  3. Polymerase chain reaction and nested-PCR approaches for detecting Cryptosporidium in water catchments of water treatment plants in Curitiba, State of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Silvia Cristina Osaki

    2013-06-01

    Full Text Available Introduction Cryptosporidium is an important protozoan cause of waterborne disease worldwide of concern to public health authorities. To prevent outbreaks of cryptosporidiosis, the monitoring of this parasite in drinking water is necessary. In the present work, the polymerase chain reaction (PCR and nested-PCR techniques were used to detect Cryptosporidium in raw water from catchment points of four water treatment plants (WTP in Curitiba, Paraná, Brazil. Methods First, DNA extraction techniques were tested in samples containing decreasing amount of oocysts in reagent water, and PCR and nested-PCR with specific primers for 18SSU rDNA of Cryptosporidium were conducted to determine their sensitivity. In reagent water, a commercial extraction kit provided the best analytical sensitivity, and PCR and nested-PCR allowed the detection of five and two oocysts, respectively, with the primers XIAOR/XIAOF and XIAO1F/XIAO2R. Results In the spiking experiments, only the PCR with the primers AWA995F/AWA1206R was successful at detecting concentrations of 0.1 oocysts/mL. Two catchments samples of raw water and/or water sludge from four WTPs were contaminated with Cryptosporidium. Conclusions The application of the techniques to monitor Cryptosporidium in water and detect contamination in water catchments of WTPs in Curitiba are discussed in the present work.

  4. A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

    International Nuclear Information System (INIS)

    We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence signal from Rhodamine B. The method was validated with the PCR amplification of mecA gene (162 bp) from methicillin-resistant Staphylococcus aureus bacterium (MRSA), where the time for 30 cycles was reduced from 50 min (without over- and undershooting) to 20 min. (paper)

  5. A Comparative Analysis of Routine Techniques: Reverse Transcriptase Polymerase Chain Reaction (RT-PCR and Five Cell Lines for Detection of Enteroviruses in Stool Specimens

    Directory of Open Access Journals (Sweden)

    F Abbasian

    2011-06-01

    Full Text Available Background and objectives: Each year, Enteroviruses infect millions of people and cause different diseases. The agents are usually detected using cell culture. RD (Rhabdomyosarcoma and L20B (L cells are among the recommended cells by the World Health Organisation (WHO for this purpose. Even though cell culture is the most common method used in diagnosing Enteroviruses in stool specimens, this particular method poses some problems, which include false positive or negative results, lack of a unique cell line for diagnosing all Enterovirus types in addition to being time consuming. For these reasons, an attempt was made to find better techniques of Enterovirus detection. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction is a technique used in place of the cell culture method. In this study, the cell culture method was compared with RT-PCR for detection of Enteroviruses in stool specimens.Material and method: First, the chloroform treated stool samples were inoculated onto five cell lines, including RD, L20B, Hep-2 (Human Epidermoid carcinoma cell line, Vero (Verde Reno and GMK (Green Monkey Kidney. The results were then compared with data from Enterovirus detection using the RT-PCR technique.Results and conclusion: The difference between RT-PCR and cell culture results was significant. Enteroviruses were detected in 24% of specimens using RT-PCR while cell lines could isolate Enteroviruses in just 14.4% of the samples.

  6. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4.

    Science.gov (United States)

    Lin, Ying-Hong; Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda

    2016-01-01

    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  7. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4

    Science.gov (United States)

    Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda

    2016-01-01

    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  8. Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

    International Nuclear Information System (INIS)

    Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α32P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

  9. Isolation and identification of Mycoplasma agalactiae by culture and polymerase chain reaction (PCR from affected sheep to Contagious agalactia of Khuzestan province, Iran

    Directory of Open Access Journals (Sweden)

    Pooladgar, A.R.

    2015-04-01

    Full Text Available Mycoplasma agalactiae (M. agalactiae is one of the main causes of contagious agalactia, an infectious syndrome of sheep and goats in Khuzestan province –southwest of Iran that is characterized by mastitis and subsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. This study was carried out to isolation and identification of M. agalactiae with culture and polymerase chain reaction (PCR method from sheep in Khuzestan province, Iran. A total of 91 samples were collected from milk secretion, eye, ear, nose and joint exudates of sheep. All samples were cultured in PPLO broth supplemented for isolation of M. agalaciae. Extraction of the DNA of bacteria was done by phenol/chloroform method and the PCR assay was applied for detection of Mycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment of lipoprotein gene from culture as same as in clinical samples. Out of the 91 samples, 34(37.36% cultures were shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and 47(51.65% were scored positive by Mycoplasma genus PCR, 8(8.79% of the samples were scored positive by using M. agalactiae PCR as diagnostic method. Out of the 91 samples, 26 samples were shown both positive in the culture and PCR, 5 samples were shown both positive in the culture, MPCR and MAPCR. 15 samples were negative in the culture and positive in PCR whereas only 3 samples were positive in culture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from eye and less in ear and nose samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Khuzestan province.

  10. The first identification of a blood-sucking abomasal nematode Ashworthius sidemi in cattle (Bos taurus) using simple polymerase chain reaction (PCR).

    Science.gov (United States)

    Moskwa, Bożena; Bień, Justyna; Cybulska, Aleksandra; Kornacka, Aleksandra; Krzysiak, Michał; Cencek, Tomasz; Cabaj, Władysław

    2015-06-30

    A simple polymerase chain reaction (PCR) test was used to identify Ashworthius sidemi, a blood-sucking gastrointestinal nematode that commonly infects bison, red and roe deer, and moose in Poland. The present study uses this technique to confirm the possibility of transmission of A. sidemi infection from wildlife to domestic animals, such as cattle and sheep, grazing on the same natural pastures. A 406 bp fragment of genomic A. sidemi DNA was actually detected in DNA isolated from larval cultures derived from feces from cattle. A. sidemi DNA has been detected in cattle which represent a new host for this parasite. This is the first evidence of A. sidemi in cattle. The results reveal that a PCR test based on DNA from L3 larvae can be used for in vivo detection of A. sidemi invasions in breeding animals. In conclusion, the transfer of A. sidemi infection from wildlife to the farm animals sharing the same pastures appears possible. PMID:25981105

  11. Application of culture and polymerase chain reaction (PCR methods for isolation and identification ofMycoplasma synoviae on broiler chicken farms

    Directory of Open Access Journals (Sweden)

    Abtin, A.R.

    2011-12-01

    Full Text Available Mycoplasma synoviae (M. synoviae is a major worldwide poultry pathogen that causes serious economiclosses in the poultry industry. This study was designed to detect M. synoviae through culture isolation andpolymerase chain reaction (PCR assay to demonstrated the involvement of M. synoviae infection in tracheaand the lung/air sac samples taken from commercial broiler chicken farms in 3 main provinces of Iran(Tehran, Markazi and Qazvin, with clinical signs of the disease. Total of 43 samples were cultured inPPLO broth media supplemented for M. synoviae isolation. The bacteria DNAs were extracted byphenol/chloroform method and the PCR assay amplifying the conserved region of 16S rRNA gene wasapplied for the detection of Mycoplasma genus in 163bp fragment and M. synoviae in 207bp fragment fromculture as same as in clinical samples. Of the 43 swabs 28(65.1% yielded one of the potentially pathogenicmycoplasmas evaluated for using PPLO agar culture diagnostic method, and 33(76.8% yielded one of thepotentially pathogenic Mycoplasmas evaluated for using Mycoplasma genus PCR as diagnostic method, and24(55.9% of the swabs yielded M. synoviae for using M. synoviae PCR as diagnostic method. In this studywe had observed the highest quantity of M. synoviae infections in broiler chicken with PCR test. In conclusion, PCR is a more rapid, effective, sensitive and inexpensive method than the standard culture technique, that could be used as an alternative method for traditional culture and showed the real number of the M. synoviae contaminated broiler chicken farms.

  12. "Use of Random Amplified Polymorphic DNA Polymerase Chain Reaction (RAPD-PCR and ITS2 PCR assays for differentiation of populations and putative sibling species of Anopheles fluviatilis (Diptera: Culicidae in Iran"

    Directory of Open Access Journals (Sweden)

    SR Naddaf Dezfouli

    2002-09-01

    Full Text Available Anopheles fluviatilis complex is known to be a vector of malaria in Iran. Since mosquitoes of this species cover a wide geographical range in Iran, they might have evolved into different separated populations. Random amplified polymorphic DNA polymerase chain reaction (RAPD-PCR assay was used to differentiate geographic populations of this species. DNA was extracted from individual mosquitoes from 8 localities in 4 south and southeast provinces and amplified in PCR reactions using 18 single primers of arbitrary nucleotide sequence. Results of RAPD-PCR showed that Kazeroun populations could simply be differentiated from other populations using a diagnostic fragment amplified with primer UBC-306. But other populations could not be differentiated either visually or by means of statistical analysis. Moreover ITS2 fragments of some selected specimens were amplified using a pair of universal primer and sequenced as a key standard for detection of putative sibling species. Sequence analysis of the ITS2 fragments revealed a very high (100% homology among the populations. These findings are crucial in epidemiological studies concerning relatedness of geographic populations and vector movement in the region. Results of RAPD-PCR and ITS2 analysis suggest that this taxon in Iran comprises of only one species with a low genetic variation among geographic populations.

  13. 仅采用 PCR 进行分子克隆的方法探索%An efficient method of molecular cloning only by polymerase chain reaction

    Institute of Scientific and Technical Information of China (English)

    薛奋勤; 许晴; 魏华; 李华; 薛冰

    2014-01-01

    Objective Due to the high cost in both time and money in gene cloning, a simple molecular cloning method based on polymerase chain reaction(PCR) is presented. Methods The vector and insert are amplified by PCR separately. After DpnI digestion of the mixture of the amplified vector and insert to eliminate the DNA templates used in PCR reactions, the mixture is directly transformed into competent E. coli DH5 cells to obtain the desired clones. Results Here we report a highly simplified,reliable and efficient PCR-based cloning technique to subclone total α-synuclein gene(cDNA) from vector pET into vector pGEX-4T-1, and place total nAChRβ2 gene from vector pCDNA3. 1 into vector pGEMHE. Conclusion This technique has many advantages over other cloning methods. First, we can insert any interested DNA sequences into a vector anywhere by primer designation, and it does not need to consider the restriction of multiple cloning site. Second, there is no need for any specialized enzyme digestion, gel purification of PCR product and linearized vector and enzyme ligation.%目的:针对目前各种费时且易失败的克隆方法和价格昂贵的试剂盒等问题,对一种仅采用聚合酶链反应(polymerase chain reaction,PCR)分子克隆方法进行了探索。方法利用高保真的 DNA 聚合酶具有3'-核酸外切酶活性的特点,采用 PCR 把载体和插入片段扩增出来,二者的扩增产物先加限制性内切酶 DpnI 后再按一定比例混合来消化甲基化的 DNA 模板,最后把DpnI 消化产物直接转化到感受态细胞来得到克隆基因。结果是一种简单、高效、可靠、且仅采用 PCR 的分子克隆方法,并利用此方法成功地把构建在载体 pET 上的α-突触核蛋白全长基因和构建在 pCDNA3.1上的乙酰胆碱受体亚基的全长基因分别重新构建在载体 pGEX-4T-1和 pGEMHE 上。结论在 PCR 扩增时能够通过引物设计来确定克隆位点,所以该方法可以把任何 DNA片段插入到

  14. Detection of Hepatitis B Virus (HBV) in Blood Serum By Means of PCR (Polymerase Chain Reaction) Technique

    International Nuclear Information System (INIS)

    Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer

  15. Real-time polymerase chain reaction (PCR) quantitative detection of Brassica napus using a locked nucleic acid TaqMan probe.

    Science.gov (United States)

    Schmidt, Anna-Mary; Rott, Michael E

    2006-02-22

    Several countries have introduced mandatory labeling requirements on foods derived from genetically modified organisms. Real-time quantitative Polymerase Chain Reaction (PCR) has quickly become the method of choice in support of these regulations and requires the development of separate PCR assays targeting the transgenic sequence as well as a specific endogenous gene sequence. To develop a Brassica napus-specific PCR assay, partial sequences of the acetyl-CoA carboxylase BnACCg8 gene from B. napus and the closely related Brassica rapa were determined and compared, and a region of unique nucleotide sequence was identified. Universal amplification primers were designed to either side of this region, and a locked nucleic acid TaqMan probe was designed to the B. napus-specific sequence. Evaluation of this primer/probe combination indicated a high level of specificity to B. napus: no amplification signal was observed with any other species tested, including five closely related Brassica species. The method was assayed with 14 different B. napus cultivars, and comparable amplification curves were consistently obtained for all. The assay was highly sensitive, with a limit of detection between 1 and 10 haploid copies. Practically, the method was demonstrated to be effective for the detection of processed food samples and for the quantification of Roundup Ready canola content in mixed samples. PMID:16478231

  16. Chain Reaction Polymerization.

    Science.gov (United States)

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  17. Use of PCR-RFLP (Polymerase Chain Reaction - Restricted Fragment Length Polymorphism in the gene of the enzyme Stearoyl-CoA-Desaturase in Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    H. Tonhati

    2010-02-01

    Full Text Available The milk is an important food because it contents Conjugated Linoleic Acids (CLA. These fatty acids are synthesized in mammary gland under action of the enzyme Stearoyl CoA-Desaturase (SCD and have showed some positive effects in human disease prevention and treatments. A variation of CLA in milk fat exists and can be partially explained by the different levels of expression of SCD. The aim was to study part of the encoding regions of SCD´s gene using PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism. Genomic DNA was extracted from lactating Murrah females. After this, PCR reactions were made by using primers Z43D1 that encloses exon I, II and intron I. The fragments amplified are composed by 938 pb. Then, RFLP techniques were applied in the fragments using the restriction enzymes Pst I and Sma I. The enzyme Pst I has generated fragments of 788pb and 150bp and the Sma I has generated fragments of 693pb and 245pb. All the animals showed the same migration standard for both enzymes, characterizing a genetic monomorphism for this region of SCD gene. The analysis determined that there aren’t genetic differences between these animals in the studied regions by using Pst I and Sma I enzymes.

  18. A simple real-time polymerase chain reaction (PCR)-based assay for authentication of the Chinese Panax ginseng cultivar Damaya from a local ginseng population.

    Science.gov (United States)

    Wang, H; Wang, J; Li, G

    2016-01-01

    Panax ginseng is one of the most important medicinal plants in the Orient. Owing to its increasing demand in the world market, cultivated ginseng has become the main source of medicinal material. Among the Chinese ginseng cultivars, Damaya commands higher prices and is grown in significant proportions among the local ginseng population. Due to the lack of rapid and accurate authentication methods, Damaya is distributed among different cultivars in the local ginseng population in China. Here, we identified a unique, Damaya-specific single nucleotide polymorphism (SNP) site present in the second intron of mitochondrial cytochrome c oxidase subunit 2 (cox2). Based on this SNP, a Damaya cultivar-specific primer was designed and an allele-specific polymerase chain reaction (PCR) was optimized for the effective molecular authentication of Damaya. We designed a method by combining a simple DNA isolation method with real-time allele-specific PCR using SYBR Green I fluorescent dye, and proved its efficacy in clearly discriminated Damaya cultivar from other Chinese ginseng cultivars according to the allelic discrimination analysis. Hence, this study provides a simple and rapid assay for the differentiation and conservation of Damaya from the local Chinese ginseng population. PMID:27420983

  19. Assessment of Genotoxic Activity of Para-nitrophenol in Higher Plant Using Arbitrarily Primed- polymerase Chain Reaction (AP-PCR

    Directory of Open Access Journals (Sweden)

    Mohamed R. Enan

    2007-01-01

    Full Text Available Paranitrophenol is a common toxic environmental pollutant; the aim of this study was to evaluate the potential of the DNA fingerprinting by AP-PCR assay to detect the DNA damage in the common bean (Phaseolus vulgaris exposed to different concentrations of paranitrophenol (4.0-720 nM. The changes occurring in the fingerprint patterns were likely to be the result of paranitrophenol-induced DNA damage. These changes include variation in band loss and gain. Paranitrophenol was able to induce DNA damage in concentration-related manner with effectiveness at higher concentrations. A total of 488 bands were clearly identified and 39% markers were polymorphic. Genetic distance between control and exposed plant samples served to produce a dendrogram. The dendrogram comprised three main clusters, one of which including control and plant samples exposed to lower concentrations and the other two clusters included plants exposed to higher concentrations. This study clearly demonstrates that AP-PCR is highly useful for assessing DNA damage in plant exposed to chemicals. To the best of our knowledge, this is the first report of the applicability of paranitrophenol for inducing DNA damage in higher plants.

  20. Characterization of infectious laryngotracheitis virus (ILTV) isolates from commercial poultry by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP).

    Science.gov (United States)

    Oldoni, Ivomar; Rodríguez-Avila, Andrés; Riblet, Sylva; García, Maricarmen

    2008-03-01

    Infectious laryngotracheitis (ILT) is a highly contagious, acute respiratory disease of chickens, of worldwide distribution, that affects growth and egg production and leads to significant economic losses during periodic outbreaks of the disease. Live attenuated vaccines (chicken embryo origin [CEO] and tissue-culture origin [TCO]) have been widely used to control the disease in the United States. It is believed that most of the outbreaks in the United States are caused by vaccine-related isolates that persist in the field and spill over into naïve poultry populations. The objective of this study was to utilize the previously developed polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) analysis to genotype recent ILT virus (ILTV) isolates from commercial poultry. Forty-six samples were collected during January 2006 to April 2007 from five poultry production regions of the United States and were characterized within PCR-RFLP groups III-VI. Sixty-three percent of the samples analyzed were categorized as closely related to the vaccine strains (groups III-V), whereas 33% were categorized as group VI viruses that differed in six and nine PCR-RFLP patterns from the CEO and TCO vaccines; a mixture of group IV and V viruses was detected in two samples (4%). In general, groups V and VI were the most prevalent viruses, found in 52% and 33% of the samples tested respectively. Both types of viruses were detected in vaccinated and nonvaccinated flocks. Although genetically different, both viruses produced severe disease in the field. PMID:18459297

  1. Determining Annealing Temperatures for Polymerase Chain Reaction

    Science.gov (United States)

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  2. Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR for diagnosis of natural infection with canine distemper virus

    Directory of Open Access Journals (Sweden)

    Wong Min-Liang

    2010-06-01

    Full Text Available Abstract Background Canine distemper virus (CDV is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR of the matrix (M gene to the fusion (F gene (designated M-F UTR in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Results Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. Conclusions The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes.

  3. Assessing HER2 amplification by IHC, FISH, and real-time polymerase chain reaction analysis (real-time PCR) following LCM in formalin-fixed paraffin embedded tissue from 40 women with ovarian cancer

    OpenAIRE

    Hillig, Thore; Thode, Jørgen; Breinholt, Marie F; Franzmann, Maria-Benedicte; Pedersen, Carsten; Lund, Flemming; Mygind, Henrik; Sölétormos, György; Rudnicki, Martin

    2012-01-01

    We compare HER2 receptor amplification analysis by immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), and real-time polymerase chain reaction (real-time PCR) DNA copy-number assay following laser capture microdissection (LCM) in formalin-fixed paraffin embedded tissue from 40 women with verified ovarian cancer. We speculate that LCM should result in a more accurate assessment of HER2 amplification in our real-time PCR assay compared with IHC and FISH. HER2 overexpression m...

  4. Assessing HER2 amplification by IHC, FISH, and real-time polymerase chain reaction analysis (real-time PCR) following LCM in formalin-fixed paraffin embedded tissue from 40 women with ovarian cancer

    DEFF Research Database (Denmark)

    Hillig, Thore; Thode, Jørgen; Breinholt, Ellen Marie;

    2012-01-01

    We compare HER2 receptor amplification analysis by immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), and real-time polymerase chain reaction (real-time PCR) DNA copy-number assay following laser capture microdissection (LCM) in formalin-fixed paraffin embedded tissue from 40...

  5. Detection of Phakopsora pachyrhizi by polymerase chain reaction (PCR) and use of germination test and DNA comet assay after e-beam processing in soybean

    International Nuclear Information System (INIS)

    Soybean harvest is the main agribusiness in Brazil, which is the second largest exporter in the world and has a revenue of billions of dollars. Asian dust is caused by the fungus Phakopsora pachyrhizi and its dissemination is difficult to control, since it occurs through wind dispersion. Actually P. pachyrhizi is found in different parts of the world. Electron beam treatment could be an alternative process to minimize these losses, especially for the grains exportation industry. Besides the possibility of being disconnected when not in use, this source does not need to be reloaded, is easily available and, streamlines the process and reduces logistics costs. The present work aims to identify, by the polymerase chain reaction technique (PCR), the P. pachyrhizi fungus presence in the irradiated soybeans and the possibility to use radiation treatment as a sanitary alternative. Doses 0, 1.0, 2.0, 5.0, 6.0, 7.0, 8.0, 9.0 and 10.0 kGy (IPEN-CNEN/SP Electron Accelerator) were applied and two fast-screening methods were performed: DNA comet assay (for the detection of DNA damage) and germination test (for the measurement of roots inhibition). These tests are very easy to carry out and measure damage response depending on radiation dose

  6. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  7. Development of the nested polymerase chain reaction (PCR) for detection of hepatitis C virus RNA in blood derivatives. Final report for the period 15 December 1994 - 15 December 1995

    International Nuclear Information System (INIS)

    Testing for the presence of hepatitis C virus (HCV) in blood derivatives used in clinical medicine is important to ensure the safety of such preparations. A reliable and reproducible method is described for the isolation of HCV RNA, subsequent reverse transcription and nested polymerase chain reaction (PCR) from blood derivatives. Of 17 batches of blood derivatives (14 negative for anti-HCV and 3 of unknown anti-HCV status) five were found to be positive in the nested PCR. (author). 4 refs, 3 figs, 1 tab

  8. Differentiation by random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) of Candida albicans isolated from upper respiratory tract in patients with non-small cell lung cancer.

    Science.gov (United States)

    Biernasiuk, Anna; Korona-Głowniak, Izabela; Grzegorczyk, Agnieszka; Malm, Anna

    2014-01-01

    Cancer patients are predisposed to fungal infections caused by Candida albicans, especially to oral or respiratory tract candidiasis. The aim of this study was to estimate genetic diversity by RAPD-PCR (random amplified polymorphic DNA-polymerase chain reaction) of C. albicans isolated from upper respiratory tract of 100 patients with non-small cell lung cancer. Among 52 strains, 34 genotypes were defined. 10 clusters comprising 28 (53.85%) isolates with similarity coefficient ≥ 80% were formed. The remaining 24 (46.15%) isolates represented individual genotypes. The RAPD-PCR technique revealed genomic variability within C. albicans isolated from upper respiratory tract of the cancer patients. PMID:25371918

  9. Bordetella pertussis diagnosed by polymerase chain reaction

    DEFF Research Database (Denmark)

    Birkebaek, N H; Heron, I; Skjødt, K

    1994-01-01

    The object of this work was to test the polymerase chain reaction (PCR) for demonstration of Bordetella pertussis (BP) in nasopharyngeal secretions. The method was applied to patients with recently diagnosed pertussis, as verified by BP culture. In order to test the sensitivity and specificity of...

  10. Detection of Salmonella Spp., Shigella (Flexneri and Sonnei) and Vibrio Cholerae O1 by Polymerase Chain Reaction (PCR) in Exported Shrimp from the Mexican Northeast Coast

    International Nuclear Information System (INIS)

    The objective of the present work was to use the PCR technique for the simultaneous detection of Salmonella spp and Vibrio cholerae O1 in frozen shrimp for export. The DNA segments located in the gene A [284 pairs of bases (pb)] from Salmonella spp. locus ial (217 and 320 pb) from Shigella flexneri and Shigella sonnei and the gene ctxA and ctxB (777 pb) from Vibrio cholerae O1 were amplified. The different primers that amplify these segments were assayed in a PCR reaction for the simultaneous detection of DNA from the microorganisms. It was not possible to amplify the gene of Shigella sonnei and Shigella flexneri under the assay’s conditions, whilst those of Salmonella spp. and Vibrio cholerae O1 were successfully amplified. The amplification conditions for the PCR were: 94° C, 58° C and 72° C during 30 cycles, allowing a reduction from 15 days test time with the official microbiological methods to 28 hours (24 for the pre-enrichment and four for the PCR). Samples of raw-frozen-headless shrimps were taken from production plants located in the State of Sinaloa, Mexico. A random sampling procedure was used, according to the guidelines described by the International Commission of Microbiological Specifications for Foods (ICMSF, 1999). Five packages per lot per production plant were obtained. From each individual package (5 pounds 80 OZ ≈ 2.27 kg) three samples were taken for the bacteriological assays to search for Salmonella spp. and Vibrio cholerae O1, respectively. The samples were also analyzed by PCR. Results showed that none of the samples were positive by PCR to any of the studied bacteria. Salmonella spp. and Vibrio cholerae O1 were not detected in these samples by the official methods. However, the latter were able to identify other Vibrio species and enterobacteria like Proteus and Acromobacter. These results confirmed PCR’s rapidity, sensitivity and specificity. (author)

  11. Leptospira spp detection by Polymerase Chain Reaction (PCR) in clinical samples of captive black-capped Capuchin monkey (Cebus apella) Detecção de Leptospira spp pela técnica da reação da polimerase em cadeia (PCR) em amostras clínicas de macaco prego (Cebus apella) criado em cativeiro

    OpenAIRE

    Eliana Scarcelli; Rosa Maria Piatti; José Daniel Luzes Fedullo; Faiçal Simon; Maristela Vasconcellos Cardoso; Vanessa Castro; Simone Miyashiro; Margareth Élide Genovez

    2003-01-01

    Leptospirosis is a widely distributed zoonosis that affects domestic and wild animals, and that has the man as the end point of its epidemiological chain. Leptospirosis diagnosis in primates is more difficult than in other animal species, as clinical signs and lesions are less evident and antibody response is detected only for short periods. The aim of this article was to describe the detection of Leptospira spp using polymerase chain reaction (PCR), in clinical samples from one captive black...

  12. Development and evaluation of a reverse transcription-insulated isothermal polymerase chain reaction (RT-iiPCR) assay for detection of equine arteritis virus in equine semen and tissue samples using the POCKIT™ system.

    Science.gov (United States)

    Carossino, Mariano; Lee, Pei-Yu A; Nam, Bora; Skillman, Ashley; Shuck, Kathleen M; Timoney, Peter J; Tsai, Yun-Long; Ma, Li-Juan; Chang, Hsiao-Fen G; Wang, Hwa-Tang T; Balasuriya, Udeni B R

    2016-08-01

    Equine arteritis virus (EAV) is the causative agent of equine viral arteritis (EVA), a respiratory and reproductive disease of horses. Most importantly, EAV induces abortion in pregnant mares and can establish persistent infection in up to 10-70% of the infected stallions, which will continue to shed the virus in their semen. The objective of this study was to develop and evaluate a reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) for the detection of EAV in semen and tissue samples. The newly developed assay had a limit of detection of 10 RNA copies and a 10-fold higher sensitivity than a previously described real-time RT-PCR (RT-qPCR). Evaluation of 125 semen samples revealed a sensitivity and specificity of 98.46% and 100.00%, respectively for the RT-qPCR assay, and 100.00% and 98.33%, respectively for the RT-iiPCR assay. Both assays had the same accuracy (99.2%, k=0.98) compared to virus isolation. Corresponding values derived from testing various tissue samples (n=122) collected from aborted fetuses, foals, and EAV carrier stallions are as follows: relative sensitivity, specificity, and accuracy of 88.14%, 96.83%, and 92.62% (k=0.85), respectively for the RT-qPCR assay, and 98.31%, 92.06%, and 95.08% (k=0.90), respectively for the RT-iiPCR assay. These results indicate that RT-iiPCR is a sensitive, specific, and a robust test enabling detection of EAV in semen and tissue samples with very considerable accuracy. Even though the RT-qPCR assay showed a sensitivity and specificity equal to virus isolation for semen samples, its diagnostic performance was somewhat limited for tissue samples. Thus, this new RT-iiPCR could be considered as an alternative tool in the implementation of EAV control and prevention strategies. PMID:27036504

  13. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    OpenAIRE

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology w...

  14. Development of a polymerase chain reaction (PCR assay targeted to the dnaJ gene of Vibrio harveyi, a bacterial pathogen in Asian seabass, Lates calcarifer

    Directory of Open Access Journals (Sweden)

    Norwell B. Bautista

    2011-10-01

    Full Text Available Partial sequence of the dnaJ gene of Vibrio harveyi, which was isolated from diseased juvenileAsian seabass, Lates calcarifer was identified. The partial sequence of dnaJ gene of V. harveyi was 447 bp and shared at least 77% identity at the nucleotide level with the dnaJ gene of other Vibrios. It was distinct from the dnaJ gene of other Vibrios but was closely related with the dnaJ gene of V. rotiferianus and V. campbellii having at least 90% nucleotide identity. PCR primers targeting this gene were designed to detect the pathogen in Asian seabass. The assay was specific to V. harveyi and the limit of detection was 100 pg of genomic DNA ml-1 or 100 fg of bacterial genomic DNA in a PCR reaction. Thiscorresponded to a sensitivity of approximately 20 genome equivalents (GE of V. harveyi. These resultsindicate that the dnaJ gene is a good candidate to develop primers for the PCR assay in detecting V.harveyi in fish.

  15. A kinetic-based sigmoidal model for the polymerase chain reaction and its application to high-capacity absolute quantitative real-time PCR

    Directory of Open Access Journals (Sweden)

    Stewart Don

    2008-05-01

    Full Text Available Abstract Background Based upon defining a common reference point, current real-time quantitative PCR technologies compare relative differences in amplification profile position. As such, absolute quantification requires construction of target-specific standard curves that are highly resource intensive and prone to introducing quantitative errors. Sigmoidal modeling using nonlinear regression has previously demonstrated that absolute quantification can be accomplished without standard curves; however, quantitative errors caused by distortions within the plateau phase have impeded effective implementation of this alternative approach. Results Recognition that amplification rate is linearly correlated to amplicon quantity led to the derivation of two sigmoid functions that allow target quantification via linear regression analysis. In addition to circumventing quantitative errors produced by plateau distortions, this approach allows the amplification efficiency within individual amplification reactions to be determined. Absolute quantification is accomplished by first converting individual fluorescence readings into target quantity expressed in fluorescence units, followed by conversion into the number of target molecules via optical calibration. Founded upon expressing reaction fluorescence in relation to amplicon DNA mass, a seminal element of this study was to implement optical calibration using lambda gDNA as a universal quantitative standard. Not only does this eliminate the need to prepare target-specific quantitative standards, it relegates establishment of quantitative scale to a single, highly defined entity. The quantitative competency of this approach was assessed by exploiting "limiting dilution assay" for absolute quantification, which provided an independent gold standard from which to verify quantitative accuracy. This yielded substantive corroborating evidence that absolute accuracies of ± 25% can be routinely achieved. Comparison

  16. Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

  17. Analysis of the presence of pathogens which predict the risk of disease at peri-implant sites through polymerase chain reaction (PCR) Análise por reação em cadeia da polimerase (PCR) da presença de patógenos preditores de risco em sítios periimplantares

    OpenAIRE

    Joely Ângela de Oliveira Leitão; José Luiz De Lorenzo; Mario Julio Avila-Campos; Wilson Roberto Sendyk

    2005-01-01

    The presence of DNA of Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, and Prevotella intermedia in the peri-implant sulcus samples of 19 partially edentulous patients was analyzed by polymerase chain reaction (PCR) and related to the depth of the peri-implant sulcus, bleeding on probing, and probable risk of disease. Ten of those patients presented a history of periodontal disease and nine of those did not. The DNA amplification of these pathogens was observed in seven sample...

  18. Supply chain reaction

    International Nuclear Information System (INIS)

    'Logic' (Leading Oil and Gas Industry Competitiveness) is a government-industry supply chain management initiative which aims to improve the competitiveness of the UK's North Sea business by 1 billion UK pounds by 2002 and its export performance by 50% inside 5 years. Much of the article is devoted to the background and views of Logic's chief executive Chris. Freeman. Freeman makes clear that 'unlike Crine, we are not a cost-reduction initiative: that may be one of the outcomes, but we are really focusing on the co-operation side of things'. Logic aims to change the culture of the UK offshore industry through example. Freeman believes that the creation of collaborative success will flag up industry and give credence to Logics objectives

  19. Development of a Polymerase Chain Reaction (PCR Assay for the Detection of Philippine Isolates of the Penaeus monodon-type Baculovirus (MBV

    Directory of Open Access Journals (Sweden)

    Christopher Marlowe A. Caipang

    2011-07-01

    Full Text Available Penaeus monodon-type baculovirus (MBV is a DNA virus that infects postlarvae and early juveniles of shrimp, Penaeus monodon. Several variants of this virus occur through nucleotide analysis of its genomic DNA. In the present study, a one-step PCR method was developed for the detection of the Philippine isolates of MBV by designing PCR primers on the least conserved region of the Philippine MBV. Using genomic DNA of MBV-infected shrimp postlarvae, the PCR assay amplified a 193-bp PCR product. Its sensitivity was comparable to the published PCR assays. The strain-specific primers did not cross-react with other DNA viruses including White Spot Syndrome Virus (WSSV, Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV and hepatopancreatic parvovirus (HPV. This PCR assay could be used for regular monitoring and surveillance of MBV in shrimp as well as tracing the movement of the Philippine MBV in shrimp farms in different geographic regions.

  20. Modification of IgH PCR clonal analysis by the addition of sucrose and cresol red directly to PCR reaction mixes.

    OpenAIRE

    Hodges, E.; Boddy, S. M.; Thomas, S.(Rutgers, The State University of New Jersey, Piscataway, USA); Smith, J L

    1997-01-01

    Diagnostic immunoglobulin (Ig) polymerase chain reaction (PCR) clonality analyses need to be simple, reproducible, and rapid. Sucrose and cresol red (gel loading buffer reagents) were added to a routine IgH PCR reaction mix to obviate the need for adding gel loading buffer separately after PCR amplification. Not only did this decrease the time spent after PCR analysis but also gave similar or enhanced IgH PCR product intensity compared with normal IgH PCR conditions on polyacrylamide gel elec...

  1. Use of automated real-time reverse transcription-polymerase chain reaction (RT-PCR) to monitor experimental swine vesicular disease virus infection in pigs

    DEFF Research Database (Denmark)

    Reid, S.M.; Paton, D.J.; Wilsden, G.; Hutchings, G.H.; King, D. P.; Ferris, N.P.; Alexandersen, Søren

    2004-01-01

    optimization of the template extraction method was required to counteract the effects of RT-PCR inhibitors in faeces. It was concluded that the automated real-time RT-PCR is a useful diagnostic method for SVD in clinically or subclinically affected pigs and contributed to the study of the pathogenesis of SVD......Automated real-time RT-PCR was evaluated as a diagnostic tool for swine vesicular disease virus (SVDV) infection on a range of samples (vesicular epithelium, serum, nasal swabs, faeces) from four inoculated and three in-contact pigs over a period of 28 days. Traditional diagnostic procedures (virus...

  2. Use of Quantitative Fluorescent Polymerase Chain Reaction (QF PCR) in Prenatal Diagnostic of Fetal Aneuploidies in a 17 Month Period in Parallel with Karyotyping

    Science.gov (United States)

    Konjhodzic, Rijad; Dervovic, Edina; Kurtovic-Basic, Ilvana; Stomornjak-Vukadin, Meliha; Muhic, Adis; Baljevic, Sumeja; Pirnat-Gegic, Aida; Basic, Ejub; Bilalovic, Nurija

    2014-01-01

    Introduction: QF PCR has recently entered diagnostic practice as a possible way to bypass culturing of the fetal cells, as well as to provide a rapid response following amniocentesis. Material and methods: The effective value of the QF PCR remains a much debated issue, positions ranging from that it makes classic kayotyping obsolete except in special occasions, to that it is no more than a guideline for a mandatory karyotype. Current practices of the gynecology specialists generates samples in such fashion that kariotyping of samples quickly falls behind to the point of obsoleteness, because, by the time a karyotype has been finished, a window of opportunity for termination of pregnancy has closed. Results: QF PCR provides a rapid response alternative, but it is necessary to establish its reproducibility, as well as an algorithm of its use along classic kariotyping. This study contains samples processed in a period from August 1, 2012 to December 31 2013 in both QF PCR and classic karyotype. Object of this study was compare results obtained by two methods, and establish confidence interval of the QF PCR testing. Overall, 661 amniotic fluid samples were processed and typed with QF PCR, out of which 221 were done in parallel with karyiotyping, as an confirmation of results. PMID:24825930

  3. The normally expressed kappa immunoglobulin light chain gene repertoire and somatic mutations studied by single-sided specific polymerase chain reaction (PCR); frequent occurrence of features often assigned to autoimmunity

    DEFF Research Database (Denmark)

    Juul, L; Hougs, L; Andersen, V; Svejgaard, A; Barington, T

    1997-01-01

    The expressed human kappa light chain gene repertoire utilized by healthy individuals was studied by two different single-sided specific PCR techniques to avoid bias for certain V genes. A total of 103 rearranged kappa sequences from peripheral blood mononuclear cells from healthy individuals were...... cloned from cDNA and assigned to the Vkappa and Jkappa germ-line genes with the closest overall homology. The use of cDNA rather than genomic DNA focused the analysis on activated B cells rich in mRNA. Accordingly, the sequences represented the applied repertoire and almost all were somatically mutated...... agreement with those of previous repertoire studies using potentially V-gene-biased techniques. Thus, it is clear that restricted V-gene usage, common N and P additions, and extended CDR3 regions are normal features and not, as has been claimed, characteristics of pathological autoantibodies....

  4. A novel nested multiplex polymerase chain reaction (PCR assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    Directory of Open Access Journals (Sweden)

    Parija Subhash C

    2007-05-01

    Full Text Available Abstract Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific. The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens.

  5. Actinobaculum suis Detection Using Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cristina Román Amigo

    2012-01-01

    Full Text Available Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0×101 CFU/mL and 1.0×102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192 in sow urine samples and 82.2% (37/45 in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45 of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs.

  6. Molecular identification of dermatophytosis by polymerase chain reaction (PCR and detection of source of infection by restricted fragment length polymorphism (RFLP

    Directory of Open Access Journals (Sweden)

    BK Jha

    2013-09-01

    Full Text Available Introduction Dermatophytes are responsible for most superficial fungal infections and the estimated lifetime risk of acquiring a dermatophyte infection is between 10-20%. These fungi are mainly classified in three major genera Microsporum, Trichophyton and Epidermophyton. Materials and Methods Clinically suspected 200 cases of dermatophyte infected patients from K. R. Hospital Mysore and Mission Hospital Mysore were included in this descriptive study from January 2011 to June 2012. All the culture positive smear- 10% Potassium Hydroxide (KOH and culture in different dermatophytic medium patients were confirmed by PCR and source of infection was detected (n=10 from PCR positive patients and (n=10 from their domestic animals by PCR-RFLP methods targeting 18S rDNA regions of fungi. Results Out of 200 clinically suspected cases KOH mount was positive in 143 (71.5% cases and culture was positive in 132(66% cases. The isolates belonged to three genera and eight species as T.mentagrophytes 52(39.4%, T.rubrum 30(22.7%, T.violacium 18(13.6%, T.verrucosum 11(8.3%, E.floccosum 10(7.6%, M.canis 6(4.5%, T.tonsurans 03(2.3% and T.schollenii 2(1.5%. To identify the source of infection 10 animals ,one each from the houses of 10 patients who were PCR positive were also subjected to PCR and RFLP. The animals and the patients were found to be infected by same organisms T.verrucosum .This indicates that T.verrucosum infection is from animal source. Conclusion Dermatophytic infections are more common infectious disease. Preliminary diagnosis of dermatophytosis can be done by KOH mount and culture, which takes longer time to report and cannot differentiate at the genus and species level. Results indicate that PCR-RFLP may be considered as gold standard for the diagnosis and confirmation of source of infection of dermatophytosis and can aid the clinician in initiating prompt and appropriate antifungal therapy. Journal of College of Medical Sciences-Nepal, 2012, Vol-8

  7. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    OpenAIRE

    2012-01-01

    AIM: To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).

  8. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  9. Effect of gamma radiation on the growth of Aspergillus Flavus aflatoxins producer and on the use of polymerase chain reaction technique (PCR) in samples of maize grains artificially inoculated

    International Nuclear Information System (INIS)

    The aim of this present study was to verify the effects of gamma radiation on the growth of Aspergillus flavus Link aflatoxins producer; to demonstrate the application of Polymerase Chain Reaction (PCR) technique in the diagnostic of A. Flavus, as well to verify the effect of radiation in the profile of DNA bands. Twenty samples of grains maize with 200 g each were individually irradiated with 20 kGy, to eliminate the microbial contamination. In following, the samples were inoculated with an toxigenic A. flavus (1x106 spores/ml), incubated for 15 days at 25 deg C with a relative humidity of around 97,5% and irradiated with 0, 2; 5 and 10 kGy. The samples, 5 to each dose of irradiation, were individually analyzed for the number of fungal cells, water activity, viability test (fluorescein diacetate and ethidium bromide), PCR and aflatoxins (AFB) detection. The results showed that the doses used were effective in reducing the number of Colony Forming Units (CFU/g) mainly the doses of 5 and 10 kGy. In addition, the viability test showed a decrease of viable cells with increase of irradiation doses. The reduction of AFB1 and AFB-2, was more efficient with the use of 2 kGy in comparison with the dose of 5 kGy, while the dose of 10 kGy, degraded the aflatoxins. Thereby, it was observed that AFB2 showed to be more radiosensitive. The use of PCR technique showed the presence of DNA bands, in all samples. (author)

  10. The prevalence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs in Nueva Ecija, Philippines based on multiplex polymerase chain reaction (mPCR) assay.

    Science.gov (United States)

    Corales, Joyce Marielle I; Viloria, Victoria V; Venturina, Virginia M; Mingala, Claro N

    2014-01-01

    The aim of the study was to determine the prevalence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs. It describes the practice of veterinarians in detecting tick-borne diseases in Nueva Ecija, Philippines. Seventy blood samples were collected and were subjected to multiplex PCR for the detection of E. canis, Babesia spp. and A. platys. The prevalence of babesiosis is the highest in Cabanatuan City (2/10), while a 10% prevalence (1/10) was observed in Science City of Muñoz, Talavera and Sta. Rosa. E. canis were only detected in Cabanatuan City. However, no anaplasmosis was detected in any area. The prevalence of babesiosis and ehrlichiosis in Nueva Ecija is 7.14% (5/70) and 2.85% (2/70) respectively. In addition, 70% (7/10) of the Nueva Ecija veterinary practitioners encountered cases of suspected ehrlichiosis in their practice. The diagnosis of ehrlichiosis is based primarily on presented clinical signs and complete blood counts, which include a platelet count. Of the 10 respondents, half utilized test kits while 90% interpreted blood samples. Meanwhile, only 60% of the respondents used an ELISA test kit for ehrlichiosis. For some practitioners, the main reason for not utilizing a kit is the high cost. None of the respondents had previously attended cases of suspected anaplasmosis. Only one respondent diagnosed a case of babesiosis by blood smear microscopy. PMID:25706424

  11. Convective polymerase chain reaction around micro immersion heater

    Science.gov (United States)

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  12. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes

    International Nuclear Information System (INIS)

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement. (paper)

  13. 聚合酶链式反应(PCR)技术在环境监测中的应用%Application of Polymerase Chain Reaction (PCR) Technology in Environmental Monitoring

    Institute of Scientific and Technical Information of China (English)

    高琼

    2014-01-01

    聚合酶链式反应(PCR)技术因其特异性强、灵敏度高以及快速简便等优点,广泛应用于环境监测.综述了改进PCR新技术:逆转录PCR、多重PCR、实时定量PCR、免疫捕捉PCR以及PCR-DGGE的原理及其在环境监测中的应用现状.PCR技术为在分子水平上进行环境微生物监测、污染物的生物损伤作用、群落结构多样性分析提供了有力的试验手段,具有广泛的应用前景.

  14. Enteroviral pharyngitis diagnosed by reverse transcriptase-polymerase chain reaction.

    OpenAIRE

    Sharland, M.; Hodgson, J.; Davies, E G; Booth, J.; Jeffery, S

    1996-01-01

    The role of enteroviruses in childhood pharyngitis was investigated using enteroviral specific reverse transcriptase-polymerase chain reaction (RT-PCR). Viral/bacterial throat swabs were taken from 50 children with acute pharyngitis and 26 controls. A positive culture was identified in only 26% of children with pharyngitis (adenovirus 10%, group A streptococci 2%), and none of the controls. Enteroviral RT-PCR was positive in 8% of the pharyngitis group and none of the controls. Enteroviruses ...

  15. Polymerase Chain Reaction(PCR) Technology and Gene Amplification Analysis Instrument%聚合酶链反应(PCR)技术与基因扩增分析仪器(PCR仪)

    Institute of Scientific and Technical Information of China (English)

    张文超

    2005-01-01

    较为全面地论述了聚合酶链反应(PCR)技术与基因扩增分析仪器(PCR仪).较为详细地阐述了PCR基本原理、PCR结果的检测与分析、实时定量PCR技术、影响PCR效果的因素、PCR技术的应用、PCR仪器的现状及其发展方向.

  16. Effects of upconversion nanoparticles on polymerase chain reaction.

    Directory of Open Access Journals (Sweden)

    Sang-Hyun Hwang

    Full Text Available Nanoparticles (NPs are attractive materials owing to their physical and electrochemical properties, which make them extremely useful in diagnostic applications. Photon upconversion is the phenomenon where high-energy photons are emitted upon excitation of low-energy photons. Nucleic acids detection based on upconversion nanoparticles (UCNPs, which display a high signal-to-noise ratio and no photobleaching, has been widely applied. We evaluated whether UCNPs can improve polymerase chain reaction (PCR specificity and affect PCR amplification. The effects of UCNPs with a diameter size of 40, 70, and 250 nm were evaluated using 3 PCR kits (AccuPower PCR PreMix, AmpliTaq Gold 360 Master Mix, and HotStarTaq Plus Master Mix and 3 real-time PCR kits (AccuPower GreenStar qPCR PreMix, SYBR Green PCR Master Mix, and QuantiTect SYBR Green PCR Kit. Quantum dots were used for comparison with the UCNPs. In the presence of an appropriate concentration of UCNPs, PCR specificity was optimized. UCNPs of 40-nm size improved PCR specificity more effectively than did UCNPs sized 70 or 250 nm. As the size and concentrations of the UCNPs were increased, PCR amplification was more severely inhibited. At lower annealing temperatures (25°C-45°C, addition of the 40 nm UCNP (1 µg/µL to the PCR reagent produced specific PCR products without nonspecific sequence amplification. Therefore, UCNPs of different sizes, with different DNA polymerases used in the commercial kits, showed different inhibitory effects on PCR amplification. These results demonstrate that optimization of UCNPs, added to reaction mixtures at appropriate concentrations, can improve PCR specificity. However, the mechanism underlining UCNPs effect on PCR remains unclear and will require further investigation.

  17. Use of polymerase chain reaction for detection of Chlamydia trachomatis

    DEFF Research Database (Denmark)

    Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

    1990-01-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

  18. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  19. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  20. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    Science.gov (United States)

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  1. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    Directory of Open Access Journals (Sweden)

    Rajendran Maheaswari

    2016-01-01

    Full Text Available This review discusses the principles of polymerase chain reaction (PCR and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  2. Polymerization as a Model Chain Reaction

    Science.gov (United States)

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  3. 牙周牙髓联合病变菌群的PCR-DGGE分析%Bacterial analysis of combined periodontal-endodontic lesions using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE)

    Institute of Scientific and Technical Information of China (English)

    夏明慧; 亓庆国

    2012-01-01

    目的 利用变性梯度凝胶电泳(DGGE)技术观察牙周牙髓联合病变患牙牙周组织和根管中原始菌群分布状况及其异同,并通过克隆测序技术来试图探讨两部位可能存在的优势菌.方法 从13例牙周牙髓联合病变患牙分别采集患牙根尖1/3处牙周细菌和根管牙髓细菌,提取细菌总DNA,扩增16S rRNA基因可变区,再进行变性梯度凝胶电泳.应用SPSS17.0软件和Quantity One软件对DGGE图谱菌种条带进行统计学分析和聚类分析.对DGGE凝胶中有代表性的条带进行回收和克隆测序.结果 两取菌部位的菌种条带数间有明显的统计学差异(P<0.01),但二者之间无正相关性.二者间的相似系数为13.1% ~62.5%.牙周牙髓联合病变患牙根尖区1/3处牙周菌属可能有弯曲菌属(Campylobacter)、梭杆菌属(Fusobacterium)、奈瑟菌属(Neisseria)等,该处对应根管中菌属可能有优杆菌属(Mogibacterium)、棒状杆菌属(Corynebacterium)、放线菌属(Actinomyces)等.结论 牙周牙髓联合病变(牙周来源)中牙周组织和邻近根管牙髓组织中菌种在数目和结构上有明显不同.该病变牙周组织和根管中可能存在目前尚未被认知的优势菌种.%Objective To compare the bacterial community profiles present in periodontium and root canals of the same tooth diagnosed as combined periodontal-endodontic lesions by using denaturing gradient gel electrophoresis (DGGE).Methods Samples were collected from 13 extracted teeth with advanced periodontitis,endodontic samples from root tip 1/3 root canal,and periodontal samples from the corresponding neighboring periodontium.Genomic DNA was collected for the following universal bacterial primersPCR.The PCR products were then loaded on the DGGE gels to gain separate bands.The typical DGGE bands were excised,PCR-cloned and sequenced.Results The number of bands,which was indicative of the number of bacterial species,was compared intra-group (periodontal and

  4. Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Toshiaki Higashi

    2012-04-01

    Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

  5. The chain re-action

    CERN Multimedia

    2009-01-01

    On 18 March, beam commissioning started in the first ‘link’ of the accelerator chain – LINAC 2. This marks the start of what will be the longest period of beam operations in CERN’s history, with the accelerator complex remaining operational throughout the winter to supply the LHC. The Bulletin finds out what is being done to make sure the whole chain is ready for this historic run.

  6. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    1994-01-01

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  7. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    1993-01-01

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial repetiti

  8. APPLICATION OF POLYMERASE CHAIN REACTION FOR DIAGNOSING AMEBIC LIVER ABSCESS

    Institute of Scientific and Technical Information of China (English)

    郭增柱; 王正仪; 安亦军; 祝宏

    1996-01-01

    Polymerase chain reaction (PCR) has been applied in diagnosing amebic liver infection by detecting pathogenic Entamoeba histolytica DNA in liver aspirates. Oligonucleotide primers found to he specific for the gene encoding the 30 kDa molecule of this pathogenic ameba were used in the test. Liver aspirates obtained from 23 patients with amebic liver abscess substantiated by typical clinical rnanifastation or with very high titres of anti-E histtolytica antibodies by ELISA were found to he positive by PCR. Fourteen controlsamples (3 cases of bacterial liver abscess, I of liver cancer and 10 of other abscess) were all found to be negative to this reaction. The results suggested PCR to he a specific and sensitive tool for diagnosing amebic liver abscess infections.

  9. Limitations of clonality analysis of B cell proliferations using CDR3 polymerase chain reaction

    OpenAIRE

    Hoeve, M A; Krol, A D G; Philippo, K; Derksen, P W B; Veenendaal, R. A.; Schuuring, E; Kluin, Ph M; Krieken, J.H.J.M. van

    2000-01-01

    Background/Aims—Detection of clonal immunoglobulin heavy chain (IgH) rearrangements by the polymerase chain reaction (PCR) is an attractive alternative to Southern blotting in lymphoma diagnostics. However, the advantages and limitations of PCR in clonality analysis are still not fully appreciated. In this study, clonality was analysed by means of PCR, focusing in particular on the sample size requirements when studying extremely small samples of polyclonal and monoclonal lesions.

  10. qPCR (quantitative polymerase chain reaction) for the quantification of bacteriophages in stream water samples to investigate hydrological processes: a proof-of-concept study in the Huewelerbach experimental catchment (Luxembourg)

    Science.gov (United States)

    Antonelli, Marta; Narayanan Balasubramanian, Mukundh; Ogorzaly, Leslie; Pfister, Laurent

    2016-04-01

    Albeit recent technological developments (e.g. field deployable instruments operating at high temporal frequencies), experimental hydrology is a discipline that remains measurement limited. From this perspective, trans-disciplinary approaches may create valuable opportunities to enlarge the amount of tools available for investigating hydrological processes. Bacteriophages have been widely used in hydrology as biological tracer for investigating colloid transport and contamination of ground water systems. However, there are only a few studies focusing on the employability of bacteriophages as surface water tracers (i.e. phage transport, system functioning). Here, we present a proof-of-concept study carried out in the Huewelerbach catchment in Luxembourg in December 2015. The aim of this study was to investigate how viral particles can be used to detect hydrological connectivity between the riparian zone/river bank and the stream during rainfall events. Moreover, this study is one of the first attempts for applying the qPCR (quantitative polymerase chain reaction) technique for the quantification of bacteriophages in stream water samples to investigate hydrological processes. This technique is very sensitive and has a large dynamic range - enhancing ease and speed of phage detection. We used two different male-specific coliphages (GA phage, genogroup II and SP phage, genogroup IV). Two litres of GA phage were injected directly in the stream as a slug injection and two litres of SP phage were poured next to the river bank (alluvial deposition) close to the injection point. We also added NaCl (200 g) to both phage suspensions. We collected stream water samples 100 m and 500 m downstream (i.e. catchment outlet) of the injection point for one week. Phages were concentrated through ultracentrifugation of 100 ml of water sample followed by quantification via qPCR. Conductivity in stream water was monitored for the entire duration of the experiment. Discharge was monitored

  11. HIV-associated tuberculous lymphadenitis: the importance of polymerase chain reaction (PCR as a complementary tool for the diagnosis of tuberculosis - a study of 104 patients Linfadenite tuberculosa associada ao HIV: a importância da reação em cadeia de polimerase (PCR como ferramenta complementar para o diagnóstico da tuberculose - estudo de 104 pacientes

    Directory of Open Access Journals (Sweden)

    Marcio Valle Cortez

    2011-10-01

    Full Text Available BACKGROUND: Lymphadenitis is common in HIV-positive patients. Diagnosis of the infections associated with this condition is complex, particularly in the case of tuberculosis. Rapid and specific detection of Mycobacterium tuberculosis (M. tuberculosis is fundamental in ensuring adequate treatment. In addition, frequent causes of lymphadenitis such as those associated with lymphoma and histoplasmosis, among others, must be eliminated as possible causes. OBJECTIVES: To evaluate the accuracy of polymerase chain reaction as a tool for the diagnosis of lymphadenitis resulting from M. tuberculosis. METHODS: In this study, a protocol was developed using the following procedures: direct microscopy using Ziehl-Neelsen staining, culture in Lowenstein-Jensen medium, histology and polymerase chain reaction. RESULTS: A total of 104 patients were included in the study. According to histopathology, 38 patients (36% were found to have nonspecific chronic lymphadenitis, 27 (26% had tuberculous lymphadenitis, 11 patients (10.5% had lymphoma and 9 (8.7% had histoplasmosis. When Lowenstein-Jensen culture was performed, positive tests for tuberculous lymphadenitis increased by 30%. With polymerase chain reaction, M. tuberculosis DNA was detected in 6 out of 38 samples of non-specific chronic lymphadenitis. Three of these patients were followed up, developed symptoms of tuberculosis and were cured following specific treatment. CONCLUSION: The data obtained in this study suggest that all cases of lymphadenopathies should be submitted to histopathology, Lowenstein-Jensen or Ogawa culture and polymerase chain reaction. Polymerase chain reaction may prove to be useful in providing an early and accurate detection of cases of extrapulmonary tuberculosis in HIV-positive patients with lymphadenopathies, avoiding empirical treatment and the possible development of resistant strains.FUNDAMENTOS: A linfadenite é comum em pacientes HIV-positivos. O diagnóstico das infec

  12. Application of polymerase chain reaction to detect rearrangement of immunoglobulin heavy chain genes in lymphoproliferative disease.

    Science.gov (United States)

    Khalil, S H; Siegrist, K; Akhtar, M

    1997-07-01

    As part of our routine work-up in the diagnosis of lymphoproliferative disease, we used a rapid polymerase chain reaction (PCR) assay to amplify the DNA fragments of the framework 3 (FR3) region of the immunoglobulin heavy (IgH) chain genes. The assay does not involve hybridization, nested priming, or sequencing of the amplified PCR product. It was performed on 66 specimens of B-cell lymphoproliferative disease, including acute lymphoblastic leukemia, chronic lymphocytic leukemia, multiple myeloma, hairy cell leukemia and follicular lymphoma. Twenty-six specimens of negative controls, including acute myeloid leukemia, chronic myeloid leukemia in myeloid transformation and idiopathic thrombocytopenic purpura, were also analyzed. The assay was performed with 77% sensitivity and 100% specificity. The standard IgH chain gene rearrangement by Southern blot analysis is reserved for the remaining negative cases if clinically indicated. PMID:17353588

  13. The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

    LENUS (Irish Health Repository)

    Drew, Richard J

    2012-03-01

    Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

  14. Detecting mycoplasma contamination in cell cultures by polymerase chain reaction.

    Science.gov (United States)

    Uphoff, Cord C; Drexler, Hans G

    2011-01-01

    The detection of mycoplasmas in human and animal cell cultures is mandatory for every cell culture laboratory, because these bacteria are common contaminants, persist unrecognized in cell cultures for many years, and affect research results as well as the purity of cell culture products. The reliability of the mycoplasma detection depends on the sensitivity and specificity of the method and should also be convenient to be included in the basic routine of cell culture quality assessment. Polymerase chain reaction (PCR) detection is one of the acknowledged methodologies to detect mycoplasmas in cell cultures and cell culture products. Although the PCR offers a fast and simple technique to detect mycoplasmas, the method is also susceptible to errors and can produce false positive as well as false-negative results. Thus, the establishment and the routine application of the PCR assay require optimization and the inclusion of the appropriate control reactions. The presented protocol describes sample preparation, DNA extraction, PCR run, the analysis of the PCR products, and speciation of the contaminant. It also provides detailed information on how to avoid artifacts produced by the method. Established properly, PCR is a reliable, fast, and sensitive method and should be applied regularly to monitor the contamination status of cell cultures. PMID:21516400

  15. Kinetic characteristics of continuous flow polymerase chain reaction chip: A numerical investigation

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Continuous flow PCR (polymerase chain reaction) chip holds impressive advantages compared to micro chamber PCR chip. In order to have better understanding of kinetic characteristics of continuous flow PCR chip, a comprehensive mathematical model is presented in this paper, including melting, annealing and extension phases of a typical PCR process which has the essence of a convection-diffusion-reaction system. Using this model, we can simulate the PCR process in series of reaction cycles. Numerical results show that the average sample velocity plays a significant role in affecting the amplification efficiency. Also, appropriate combination of the PCR mixture is important for high-quality DNA amplification. Giving a large initial DNA concentration range, the continuous flow PCR scheme holds excellent real-time detection ability theoretically. The present numerical model bridges the temperature distribution to the real DNA amplification, and thereby is able to successfully predict continuous flow PCR properties which are important for the chip design.

  16. Robust quantification of polymerase chain reactions using global fitting.

    Directory of Open Access Journals (Sweden)

    Ana C Carr

    Full Text Available BACKGROUND: Quantitative polymerase chain reactions (qPCR are used to monitor relative changes in very small amounts of DNA. One drawback to qPCR is reproducibility: measuring the same sample multiple times can yield data that is so noisy that important differences can be dismissed. Numerous analytical methods have been employed that can extract the relative template abundance between samples. However, each method is sensitive to baseline assignment and to the unique shape profiles of individual reactions, which gives rise to increased variance stemming from the analytical procedure itself. PRINCIPAL FINDINGS: We developed a simple mathematical model that accurately describes the entire PCR reaction profile using only two reaction variables that depict the maximum capacity of the reaction and feedback inhibition. This model allows quantification that is more accurate than existing methods and takes advantage of the brighter fluorescence signals from later cycles. Because the model describes the entire reaction, the influences of baseline adjustment errors, reaction efficiencies, template abundance, and signal loss per cycle could be formalized. We determined that the common cycle-threshold method of data analysis introduces unnecessary variance because of inappropriate baseline adjustments, a dynamic reaction efficiency, and also a reliance on data with a low signal-to-noise ratio. SIGNIFICANCE: Using our model, fits to raw data can be used to determine template abundance with high precision, even when the data contains baseline and signal loss defects. This improvement reduces the time and cost associated with qPCR and should be applicable in a variety of academic, clinical, and biotechnological settings.

  17. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    Science.gov (United States)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  18. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    International Nuclear Information System (INIS)

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

  19. Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

    Energy Technology Data Exchange (ETDEWEB)

    Liu Jinfeng [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Shen Xingyan [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Zhu Debin [Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2005-04-29

    With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency.

  20. Comparison of a conventional polymerase chain reaction with real-time polymerase chain reaction for the detection of neurotropic viruses in cerebrospinal fluid samples

    OpenAIRE

    M Ramamurthy; Alexander, M; Aaron, S; Kannangai, R.; Ravi, V.; Sridharan, G.; A.M. Abraham

    2011-01-01

    Purpose : To compare a conventional polymerase chain reaction (PCR) and real-time PCR for the detection of neurotropic DNA viruses. Materials and Methods : A total of 147 cerebrospinal fluid (CSF) samples was collected from patients attending a tertiary care hospital in South India for a period from 2005 to 2008. All these samples were tested using a conventional multiplex/uniplex PCR and a real-time multiplex/uniplex PCR. This technique was used to detect a large number of herpes viruses res...

  1. A polymerase chain reaction assay to determine infection of Aedes polynesiensis by Wuchereria bancrofti

    OpenAIRE

    Nicolas, L.; Luquiaud, P.; Lardeux, Frédéric; Mercer, D.R.

    1996-01-01

    The sensitivity of a previously described polymerase chain reaction (PCR) assay was improved to detect a single mosquito, infected by as few as 1-2 microfilariae of #Wuchereria bancrofti$, among 20-50 uninfected mosquitoes. Wild-caught #Aedes polynesiensis$ were used to compare assessment of infection by dissection of individuals with the PCR assay of pools of mosquitoes. The PCR assay was at least as sensitive as dissection for detection of mosquitoes infected with #W. bancrofti$. (Résumé d'...

  2. Identification of Erwinia stewartii by a ligase chain reaction assay.

    OpenAIRE

    Wilson, W.J.; Wiedmann, M; Dillard, H. R.; Batt, C A

    1994-01-01

    A PCR-coupled ligase chain reaction (LCR) assay was developed to distinguish the plant pathogenic bacterium Erwinia stewartii from other erwiniae. This new technique allows discrimination to the species level on the basis of a single-base-pair difference in the 16S rRNA gene which is unique to E. stewartii. Portions of the 16S rRNA genes of E. stewartii and the closely related Erwinia herbicola were sequenced. From comparison of the two 16S rRNA gene regions, two primer pairs were constructed...

  3. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    OpenAIRE

    Liang Gaofeng; Ma Chao; Zhu Yanliang; Li Shuchun; Shao Youhua; Wang Yong; Xiao Zhongdang

    2010-01-01

    Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase ...

  4. Multi-template polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Elena Kalle

    2014-12-01

    Full Text Available PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

  5. Early detection of typhoid by polymerase chain reaction

    International Nuclear Information System (INIS)

    Typhoid is a common problem in developing countries. Cultivation ofbacteria and serology (especially Widal test) gives unacceptable levels offalse-negative and false-positive results respectively. In this study, arecently introduced polymerase chain reaction based technique (which has 100%specificity for Salmonella typhi) was compared with blood culture and Widaltest during the first week of illness of 82 suspected cases of typhoid. Therespective figures of positivity for PCR, blood culture and Widal test were71.95%, 34.1% and 36.5%. A control group of 20 healthy persons gave figuresof 0%, 0% and 33.3%, respectively. We conclude that this PCR-based techniqueis not only absolutely specific, but also very sensitive and therefore muchsuperior to blood culture and, Widal test for the early diagnosis of typhoid.(author)

  6. Modelling of Serpentine Continuous Flow Polymerase Chain Reaction Microfluidics

    Directory of Open Access Journals (Sweden)

    Abubakar Mohammed

    2012-03-01

    Full Text Available The continuous flow Polymerase Chain Reaction (PCR microfluidics DNA amplification device is a recent discovery aimed at eliminating the cyclic hold experienced while using the alternative stationary device.The Application of Computational Fluid Dynamics is increasingly growing and can help achieve optimal designs before actual fabrication. This paper presents a CFD modelling of a continuous flow serpentine PCR device with narrow and wider channels. There are two temperature regions at 950C and 600C for denaturation and annealing respectively. Extension is achieved along the middle of the channel at 720C owing to temperature gradient. The model require a pressure of 42.6KPa for a 30 cycle amplification.

  7. Immunomagnetic Separation Combined with Polymerase Chain Reaction for the Detection of Alicyclobacillus acidoterrestris in Apple Juice

    OpenAIRE

    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen

    2013-01-01

    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agar...

  8. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  9. Transformational leadership: a cascading chain reaction.

    Science.gov (United States)

    Murphy, Lorraine

    2005-03-01

    Historical influences still permeate contemporary nursing practise. These are mirrored in organizational philosophies, transactional and autocratic leadership styles and disempowered staff. Whilst there is disparity amongst the theorists' definitions of leadership, there is consensus pertaining to the attributes necessary to realize effective leadership. Transformational leadership is heralded as new criterion for nurse managers, and can be achieved through training, education and professional development in key leadership competencies. To achieve a chain reaction, charismatic transformational leaders espouse intellectual stimulation and individual consideration to empower staff and enhance patient care. Nurse managers that develop and foster transformational leadership can surmount oppressive traditions and confidently navigate a complex and rapidly changing health care environment. PMID:15720482

  10. Detction of Staph.aureus in Milk By Polymerse Chain Reaction(PCR)%应用PCR技术检测牛奶中金黄色葡萄球菌

    Institute of Scientific and Technical Information of China (English)

    甘黎明; 戴鼎震; 张文亮; 王晓丽; 夏兴霞

    2002-01-01

    Objective According to published Staph. Aureus nucleotide sequences of STAA - Aulgene, a pair of primers were designed and synthesized. 10 DNA samples from milk of mastitis bovines wereused for PCR. 8 DNA products (420 bp) were generated by PCR, but nothing feom negative controlstrain. The nucleotide sequences of two DNA fragments were analysed, both DNA fragments belong toSTAA-Aul gene of 18srRNA.

  11. Standardization of a polymerase chain reaction (Semi Nested–PCR to detect bovine herpesvirus type 1 in aborted fetus and semen from naturally infected cattle/ Otimização da reação em cadeia pela polimerase (Semi Nested-PCR para a detecção do herpesvírus bovino tipo 1 em fragmentos de órgãos fetais e em sêmen de bovinos naturalmente infectados

    Directory of Open Access Journals (Sweden)

    Amauri Alcindo Alfieri

    2003-05-01

    Full Text Available The glycoprotein D gene of bovine herpesvirus type 1 (BHV-1 was detected in clinical samples from naturally infected cattle by semi-nested polymerase chain reaction (SN-PCR. Different protocols were tested to increase the sensitivity and specificity of the technique. An association of DNA extraction methods using phenol/chloroform/isoamyl alcohol followed by silica/guanidine isothiocyanate yield greater concentration and quality of amplified DNA. After optimization of primers and reaction conditions, the genome of BHV-1 (Los Angeles strain was detected by SN-PCR in tissue culture supernatant and artificially infected semen at the 1 and 0.1 TCID50 limit, respectively. When used on clinical specimens from naturally infected cattle, the SN-PCR yield positive results in semen of seropositive bull and in organ fragments of aborted cattle fetus. The SN-PCR was a viable alternative, which was faster, sensitive, specific and less laborious to be used in the routine diagnosis of BHV-1 infection and semen health monitoring.A reação em cadeia pela polimerase (PCR foi empregada para a detecção parcial do gene da glicoproteína D do herpesvírus bovino tipo 1 (BHV-1 em material biológico proveniente de bovinos naturalmente infectados. Para o aumento da sensibilidade e da especificidade da PCR, foram avaliados diferentes protocolos. Para a extração do DNA, a associação dos métodos fenol/clorofórmio/álcool isoamílico e sílica/tiocianato de guanidina, proporcionou a amplificação do DNA em maior concentração e qualidade. Após a otimização dos primers e condições da reação foi possível detectar, por meio da Semi Nested-PCR (SN-PCR, o genoma da estirpe Los Angeles do BHV-1 em sobrenadante de cultura celular, sem processamento prévio, até o limite de 1 TCID50. Em sêmen artificialmente infectado o limite de detecção do BHV-1 foi de 0,1 TCID50. Quando utilizada em material biológico, proveniente de bovinos naturalmente infectados, a SN-PCR

  12. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    Directory of Open Access Journals (Sweden)

    Liang Gaofeng

    2011-01-01

    Full Text Available Abstract Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR. Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA. The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  13. An improved electrochemiluminescence polymerase chain reaction method for the detection of Fusarium wilts

    Institute of Scientific and Technical Information of China (English)

    Jie Wei; Xiao Ming Zhou

    2008-01-01

    An improved electrochemiluminescence polymerase chain reaction (ECL-PCR) method was developed and applied to detect Fusarium wilt. Briefly, the internal transcribed spacer (ITS) sequence of Fusarium oxysporum f. sp Cubense (FOC) was amplified by PCR. Two universal fragments, which were complimentary to Ru(bpy)32+ (TBR) labeled probe and Biotin labeled probe, respectively, were connected to the tail of primers so that all the PCR products got universal sequences. Then biotin labeled probes and TBR labeled probes were hybridized with the PCR products at the same time. Through the specific interaction between biotin and streptavidin, the PCR products were captured by streptavidin coated magnetic bead and then detected by ECL assay. The experiment results showed that the healthy banana samples and infected ones can be discriminated by this ECL-PCR method. This improved ECL-PCR approach is useful in Fusarium wilt detection due to its high sensitivity, simplicity and stability.

  14. The use of real-time polymerase chain reaction with high resolution melting (real-time PCR-HRM) analysis for the detection and discrimination of nematodes Bursaphelenchus xylophilus and Bursaphelenchus mucronatus.

    Science.gov (United States)

    Filipiak, Anna; Hasiów-Jaroszewska, Beata

    2016-04-01

    The real-time PCR-HRM analysis was developed for the detection and discrimination of the quarantine nematode Bursaphelenchus xylophilus and Bursaphelenchus mucronatus. A set of primers was designed to target the ITS region of rDNA. The results have demonstrated that this analysis is a valuable tool for differentiation of these both species. PMID:26880540

  15. Microdissection and polymerase chain reaction amplification of genomic DNA from histological tissue sections.

    OpenAIRE

    Moskaluk, C A; Kern, S.E.

    1997-01-01

    Polymerase chain reaction (PCR)-based assays are being used increasingly to study the molecular genetic changes that occur in minute cellular lesions that are identified in histological sections. It is often desirable to microdissect the cells of interest in a lesion, isolating them from surrounding normal tissue to obtain the purest representation of genomic DNA possible. We present here an optimized microdissection and DNA extraction protocol that reliably produces PCR-amplifiable DNA from ...

  16. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis

    OpenAIRE

    Padmavathy L; Rao L; Veliath A

    2003-01-01

    Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR) is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patien...

  17. Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase chain reaction technology.

    OpenAIRE

    Tzianabos, T; Anderson, B E; McDade, J E

    1989-01-01

    A polymerase chain reaction (PCR) procedure for detecting rickettsial DNA was developed and shown to be specific for Rickettsia rickettsii and R. conorii, the etiologic agents of Rocky Mountain spotted fever (RMSF) and Boutonneuse fever, respectively. Blood clots were obtained from nine confirmed RMSF patients and six controls and analyzed for the presence of rickettsial DNA by the PCR method. A defined region of the rickettsial genome was successfully amplified from seven of the nine clinica...

  18. Chain reaction. History of the atomic bomb

    International Nuclear Information System (INIS)

    Henri becquerel tracked down in 1896 a strange radiation, which was called radioactivity by Marie Curie. In the following centuries German scientists Max Planck, Albert Einstein and Werner Heisenberg presented fundamental contributions to understand processes in the atomic nucleus. At Goettingen, center of the international nuclear physics community, the American student J. Robert Oppenheimer admit to this physical research. In the beginning of 1939 the message of Otto Hahns' nuclear fission electrified researchers. The first step, unleashing atomic energy, was done. A half year later the Second World War begun. And suddenly being friend with and busily communicating physicians were devided into hostile power blocs as bearers of official secrets. The author tells in this exciting book the story of the first atomic bomb as a chain reaction of ideas, discoveries and visions, of friendships, jealousy and intrigues of scientists, adventurers and genius. (orig./GL)

  19. A novel nested multiplex polymerase chain reaction (PCR) assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples

    OpenAIRE

    Parija Subhash C; Khairnar Krishna

    2007-01-01

    Abstract Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii a...

  20. Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

    NARCIS (Netherlands)

    Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

    1999-01-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal sam

  1. Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

    OpenAIRE

    Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

    1993-01-01

    Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

  2. Prompt detection of influenza A and B viruses using the BD Veritor™ System Flu A+B, Quidel® Sofia® Influenza A+B FIA, and Alere BinaxNOW® Influenza A&B compared to real-time reverse transcription-polymerase chain reaction (RT-PCR).

    Science.gov (United States)

    Dunn, Jim; Obuekwe, Joy; Baun, Traci; Rogers, Justin; Patel, Twinkle; Snow, Linda

    2014-05-01

    The performance characteristics of rapid influenza diagnostic tests vary widely. This study evaluated the BD Veritor™ System Flu A+B (Veritor; BD Diagnostics, Sparks, MD, USA), Quidel® Sofia® Influenza A+B FIA (Sofia; Quidel Corp., San Diego, CA, USA), and Alere BinaxNOW® Influenza A&B (Binax; Alere Scarborough, Inc., Scarborough, ME, USA) compared to reverse transcription-polymerase chain reaction (RT-PCR) for detection of influenza viruses in nasal wash specimens from 240 pediatric patients. Positive percent agreements for influenza A and B virus detection were 93.8% and 94.2%, 95.8% and 98.1%, and 79.2% and 80.8% for Veritor, Sofia, and Binax, respectively. The Veritor and Binax tests demonstrated negative percent agreements >97.9% for detection of both influenza viruses, but the negative percent agreement of the Sofia test was 91.1% for influenza A and 70.7% for influenza B virus. Overall, the Veritor and Sofia tests were nearly as sensitive as RT-PCR and considerably more sensitive than Binax for detection of influenza viruses. However, the accuracy of the Sofia test was significantly lower than either Veritor or Binax. PMID:24582581

  3. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and amplification refractory mutation system (ARMS) analyses of medicinally used Rheum species and their application for identification of Rhei Rhizoma.

    Science.gov (United States)

    Yang, Dong-Ye; Fushimi, Hirotoshi; Cai, Shao-Qing; Komatsu, Katsuko

    2004-05-01

    Previously, we have determined marker nucleotides on the chloroplast matK gene to identify Rheum palmatum, R. tanguticum and R. officinale used as Rhei Rhizoma officially. In the present study, we further developed a convenient and efficient identification method on the basis of marker nucleotides with Amplification Refractory Mutation System analysis. On the basis of the nucleotide substitutions at positions 367 and 937 among the three species on the matK gene, at each position two kinds of reverse primers with complementary 3'-terminal nucleotides were designed. Upon PCR amplification using three sets of primers and template DNA from each species, one or two fragments (202 bp or/and 770 bp) were detected. As the resultant three fragment profiles were species-specific, the procedure enabled us to classify the botanic origins of 22 drug samples of Rhei Rhizoma. PMID:15133241

  4. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    Science.gov (United States)

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice. PMID:26458277

  5. Effect of gamma radiation on the growth of Aspergillus Flavus aflatoxins producer and on the use of polymerase chain reaction technique (PCR) in samples of maize grains artificially inoculated; Efeitos da radiacao gama no crescimento de Aspergillus flavus produtor de aflatoxinas e no emprego da tecnica da Reacao em Cadeia da Polimerase (RCP) em amostras de graos de milho inoculadas artificialmente

    Energy Technology Data Exchange (ETDEWEB)

    Aquino, Simone

    2003-07-01

    The aim of this present study was to verify the effects of gamma radiation on the growth of Aspergillus flavus Link aflatoxins producer; to demonstrate the application of Polymerase Chain Reaction (PCR) technique in the diagnostic of A. Flavus, as well to verify the effect of radiation in the profile of DNA bands. Twenty samples of grains maize with 200 g each were individually irradiated with 20 kGy, to eliminate the microbial contamination. In following, the samples were inoculated with an toxigenic A. flavus (1x10{sup 6} spores/ml), incubated for 15 days at 25 deg C with a relative humidity of around 97,5% and irradiated with 0, 2; 5 and 10 kGy. The samples, 5 to each dose of irradiation, were individually analyzed for the number of fungal cells, water activity, viability test (fluorescein diacetate and ethidium bromide), PCR and aflatoxins (AFB) detection. The results showed that the doses used were effective in reducing the number of Colony Forming Units (CFU/g) mainly the doses of 5 and 10 kGy. In addition, the viability test showed a decrease of viable cells with increase of irradiation doses. The reduction of AFB{sub 1} and AFB-2, was more efficient with the use of 2 kGy in comparison with the dose of 5 kGy, while the dose of 10 kGy, degraded the aflatoxins. Thereby, it was observed that AFB2 showed to be more radiosensitive. The use of PCR technique showed the presence of DNA bands, in all samples. (author)

  6. Diagnosis of Dengue by Using Reverse Transcriptase-Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Miagostovich Marize Pereira

    1997-01-01

    Full Text Available A rapid identification of dengue viruses from clinical samples by using a nested reverse transcriptase-polymerase chain reaction (RT-PCR procedure was carried out for diagnostic and epidemiological purposes. RT-PCR identified DEN-1 and DEN-2 viruses in 41% (41/100 of previously confirmed cases and provided an accurate confirmation of DHF in four fatal cases. RT-PCR was also useful for detecting and typing dengue viruses in suspected cases, allowing a rapid identification of new serotypes in endemic areas

  7. Development and validation of a Myxoma virus real-time polymerase chain reaction assay

    OpenAIRE

    Albini, S.; Sigrist, B; Guttinger, R; Schelling, C.; Hoop, R K; Vogtlin, A

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus...

  8. Development and validation of a Myxoma virus real-time polymerase chain reaction assay.

    Science.gov (United States)

    Albini, Sarah; Sigrist, Brigitte; Güttinger, Regula; Schelling, Claude; Hoop, Richard K; Vögtlin, Andrea

    2012-01-01

    To aid in the rapid diagnosis of myxomatosis in rabbits, a real-time polymerase chain reaction (PCR) for the specific detection of Myxoma virus is described. Primers and probe were designed to amplify a 147-bp fragment within the Serp2 gene. The assay was able to detect 23 copies of a synthesized oligo indicating a reliable sensitivity. In addition, the real-time PCR did not detect the Rabbit fibroma virus used in myxomatosis vaccines. The novel PCR was shown to be able to detect Myxoma virus in fresh and paraffin-embedded rabbit tissues originating from myxomatosis cases from various regions in Switzerland. PMID:22362943

  9. Real-Time Polymerase Chain Reaction for Detection of Strongyloides stercoralis in Stool

    OpenAIRE

    Sultana, Yasmin; Jeoffreys, Neisha; Watts, Matthew R.; Gilbert, Gwendolyn L.; Lee, Rogan

    2013-01-01

    The use of real-time polymerase chain reaction (PCR) for detection of Strongyloides stercoralis in stool has recently been described. We compared five DNA extraction methods by using normal human stool spiked with Strongyloides ratti and tested by using a real-time PCR. The PowerSoil kit was found to be the best technique in terms of sensitivity and ease of use. The PCR detected DNA extracted from one spiked S. ratti larva diluted 10−2. The PowerSoil kit was then used to extract DNA from 160 ...

  10. Rapid detection of Helicobacter pylori in gastric biopsy material by polymerase chain reaction.

    OpenAIRE

    Hammar, M.; Tyszkiewicz, T; Wadström, T.; O'Toole, P W

    1992-01-01

    By using primers based on the sequence of a species-specific antigen of Helicobacter pylori (P. O'Toole, S.M. Logan, M. Kostrzynska. T. Wadström, and T.J. Trust, J. Bacteriol. 173:505-513, 1991), a protocol was established for detection of this microorganism in gastric biopsy samples by the polymerase chain reaction (PCR). A single primer pair was used to specifically amplify a 298-bp sequence in a rapid two-step PCR. The primers exhibited the same specificity in PCR as that which we reported...

  11. Direct method for detecting small quantities of hepatitis B virus DNA in serum and plasma using the polymerase chain reaction.

    OpenAIRE

    Zeldis, J B; Lee, J. H.; Mamish, D; Finegold, D J; Sircar, R; Q. Ling; Knudsen, P J; Kuramoto, I K; Mimms, L T

    1989-01-01

    Serum components inhibit DNA polymerase, thereby obviating direct detection of serum viral DNA sequences by the polymerase chain reaction (PCR). This has necessitated extraction of nucleic acid from sera before performing PCR and has resulted in loss of sensitivity. By adsorbing virus to a solid surface (microcentrifuge tubes or antibody coated microparticles) followed by proteinase K digestion, as little as three viruses per 200 microliters serum may be directly detected by PCR without nucle...

  12. Utility of polymerase chain reaction as a diagnostic tool in cutaneous tuberculosis

    Directory of Open Access Journals (Sweden)

    Padmavathy L

    2003-05-01

    Full Text Available Background: Differentiation of cutaneous tuberculosis from other infective granulomas of the skin is difficult due to paucity of the organisms in tissue biopsies. Polymerase chain reaction (PCR is a newer technique to identify the DNA of Mycobacterium tuberculosis in the tissues. Aim: We examined the utility of PCR as a tool for rapid diagnosis of cutaneous tuberculosis especially in cases negative by ZN staining and culture. Material and Methods: Twenty five random skin biopsies from patients with various types of cutaneous tuberculosis were subjected to PCR. Results: An overall positivity of 64% was observed, which is comparable to other series. Seventy five percent of lupus vulgaris cases, 62.2% of tuberculosis verrucosa cutis and 50% of scrofuloderma cases showed PCR positivity. Conclusion: Though useful, the cost and the technique involved limit the use of PCR in developing countries like ours.

  13. Ribosomal RNA-based panbacterial polymerase chain reaction for rapid diagnosis of septicaemia in Intensive Care Unit patients.

    Science.gov (United States)

    Gupta, Mahua Das; Kaur, Harsimran; Ray, Pallab; Gautam, Vikas; Puri, G D

    2016-01-01

    Early diagnosis and treatment of sepsis by appropriate antibiotics is of utmost importance. Therefore, we evaluated 16S rRNA panbacterial polymerase chain reaction (PCR) for rapid diagnosis of sepsis in 49 adult patients in Intensive Care Units (ICUs) and compared it with an automated blood culture. 8 ml of 10 ml blood collected was inoculated into BACTEC® aerobic bottle and the remaining 2 ml was used for DNA extraction and PCR. 109 of 115 (93%) episodes of suspected sepsis showed concordant results between automated culture and PCR. Six episodes were positive by PCR only. Panbacterial PCR reduces turnaround time with rapid differentiation between systemic inflammatory response syndrome and sepsis. PMID:27080778

  14. PCR-STR在肝移植后移植物抗宿主病中的诊断意义%Short tandem repeat loci analysis with polymerase chain reaction in the diagnosis of graft-versus-host disease after liver transplantation

    Institute of Scientific and Technical Information of China (English)

    陈小平; 骆利敏; 罗敏; 肖露露

    2012-01-01

    Objective To assess the value of short tandem repeat (STR) analysis with fluorescence labeling polymerase chain reaction (PCR) in evaluating the status of engraftment and predicting the occurrence of graft-versus-host disease (GVHD) following orthotopic liver transplantation.Methods The method of STR analysis with fluorescence labeling PCR was established.DNA was extracted by monoclonal magnetic beads from the peripheral blood nucleated cells of 23 recipients and labeled with 4 fluorescence dyes before and at 7 days after orthotopic liver transplantation.Results In the 23 patients studied,5 patients showed mixed chimeras after orthotopic liver transplantation.Two of the 5 patients with mixed chimeras developed GVHD and died.The other 18 patients did not show mixed chimeras,and only one of them developed GVHD.The incidence of GVHD was significantly different between the patients with and without mixed chimeras (40% vs 5.6%,P<0.05).Conclusions PCR-STR analysis after orthotopic liver transplantation can be indicative of engraftment and help to predict the occurrence of GVHD following orthotopic liver transplantation.%目的 为了准确地识别肝脏移植物的植入状态,探讨多聚酶链反应-短串联重复序列(PCR-STR)技术在肝移植后移植物抗宿主病中的预测和诊断意义.方法 建立荧光标记PCR-STR等位基因分析技术,采用单克隆磁珠提取DNA,四色荧光标记,于移植前和移植后1周内,采集供、受血液DNA作PCR-STR分析.结果 23例患者中,5例患者供受者HLA完全嵌合表达,其中2例发生移植物抗宿主病(GVHD),均治疗无效死亡,另外3例未发生GVHD,顺利恢复出院,GVHD发生率40%.18例患者术后未发生嵌合表达,其中1例发生GVHD,家属放弃治疗出院,GVHD发生率5.6%,两组有显著差别.结论 基于分子水平的多位点PCR-STR可以提供肝脏移植后供体植入信息,在肝移植后移植物抗宿主病的诊断中具有一定的预测意义.

  15. Immersion-histo polymerase chain reaction: a practical tool for visualization of single-copy genes in tissue sections.

    OpenAIRE

    L. Pan; Diss, T C; Peng, H.; Isaacson, P G

    1997-01-01

    A method, immersion-histo polymerase chain reaction (IH-PCR), was developed for visualization of single-copy DNA sequences in cells in paraffin-embedded tissue sections. Sections were mounted on coverslips, cut into small pieces, and immersed in reaction mixtures in micro-tubes for specific DNA amplification using a conventional thermal cycler. This was followed by in situ hybridization, in micro-tubes, with PCR-generated, digoxigenin-labeled probes. Epstein-Barr virus, chromosomal translocat...

  16. Early diagnosis of primary human herpesvirus 6 infection in childhood: Serology, polymerase chain reaction, and virus load

    OpenAIRE

    Chiu, SS; Peiris, M.; Tse, CYC; Cheung, CY

    1998-01-01

    Qualitative and quantitative polymerase chain reaction (PCR) for human herpesvirus 6 (HHV-6) DNA in whole blood and plasma was correlated with serology and clinical assessment in 143 children hospitalized for undifferentiated febrile illness to evaluate options for diagnosis of primary HHV-6 infection on the acute blood specimen. PCR and serology for HHV-7 were done in parallel to define serologic cross-reactions. Using HHV-6 seroconversion as the reference standard, detection of HHV-6 DNA in...

  17. Hybridization probes for conventional DNA fingerprinting used as single primers in the polymerase chain reaction to distinguish strains of Cryptococcus neoformans.

    OpenAIRE

    Meyer, W.; Mitchell, T G; Freedman, E Z; Vilgalys, R

    1993-01-01

    In conventional DNA fingerprinting, hypervariable and repetitive sequences (minisatellite or microsatellite DNA) are detected with hybridization probes. As demonstrated here, these probes can be used as single primers in the polymerase chain reaction (PCR) to generate individual fingerprints. Several conventional DNA fingerprinting probes were used to prime the PCR, yielding distinctive, hypervariable multifragment profiles for different strains of Cryptococcus neoformans. PCR fingerprinting ...

  18. PCR反应体系的设计及优化%Design and Optimization of PCR Reaction System

    Institute of Scientific and Technical Information of China (English)

    纪朋艳

    2016-01-01

    PCR是分子生物学中常用的实验技术手段,在揭示生命现象规律方面发挥了至关重要的作用。目前在进行PCR实验操作时,因为PCR反应体系设计不合理而导致实验失败的事例较多。因此,从优化PCR反应体系的角度出发,对提高PCR反应效率进行探讨。%Polymerase Chain Reaction (PCR) technology is commonly used in molecular biology experiments, which played a vital role in terms of reveals life phenomenon law. Now in the PCR laboratory procedures, more and more PCR experiment were failure examples because the not reasonable design PCR reaction system. Therefore, this article discussed the perspective of the PCR reaction system to improve the efifciency of the PCR reaction.

  19. Detection of Staphylococcus aureus in Dairy Products by Polymerase Chain Reaction Assay

    Institute of Scientific and Technical Information of China (English)

    YANG Yang; SU Xu-dong; YUAN Yao-wu; KANG Chun-yu; LI Ying-jun; ZHANG wei; ZHONG Xiao-ying

    2007-01-01

    A polymerase chain reaction (PCR) assay was employed for direct detection of Staphylococcus aureus without enrichment in dairy products. A solvent extraction procedure was successfully modified for the extraction of Staphylococcus aureus DNA from artificially contaminated whole milk, skim milk, and cheese. A primer targeting the thermostable nuclease gene (nuc) was used in the PCR. A DNA fragment of 279 bp was amplified. The PCR product was confirmed by DNA sequencing. In this study, the PCR, GB- 4789.10-94, Perifilm RSA.Count Plate, and Baird-Parker + RPF Agar were compared.The sensitivity of the PCR was 10 CFU mL-1 of whole milk, skim milk, and 55 CFU g-1 of cheese. The developed methodology allowed for detection of Staphylococcus aureus in dairy products in less than 6 h. The time taken for the development of this PCR assay was 12-24 h, less than the time taken by the general PCR assay using the enrichment method, and the coincidence rate of this developed PCR was 94.3%, the sensitivity was 100%. It was a rapid, sensitive, and effective method for PCR to detect Staphylococcus aureus in milk and milk products.

  20. Use of the polymerase chain reaction in epizootiological studies of viral diseases

    International Nuclear Information System (INIS)

    The polymerase chain reaction (PCR) has become a powerful diagnostic tool in veterinary virology. The research team at the Department of Virology of the National Veterinary Institute, Uppsala, Sweden, was among the first groups to develop and apply routine diagnostic PCR assays in veterinary virology, to develop PCR diagnostic kits and to introduce assays of molecular epizootiology, based on comparative nucleotide sequence analysis of the PCR products. In the paper the experiences of 10 years of application of these techniques are summarized, with special regard to technical developments, i.e. simplified methods of sample preparation, precautions to avoid false positive or negative results, comparison of standard and nested PCR and simple assays of visualization. The viruses involved in the routine PCR diagnostic work are listed in two tables. Examples are given concerning the problems of routine PCR diagnosis in veterinary virology. The use of the PCR as a basic method of 'molecular epizootiology' is discussed and illustrated with several examples. The approaches of molecular epizootiology are based on direct sequence analysis of the PCR products, comparative analysis of the sequences and construction of phylogenetic trees. By this approach the phylogenetic relations are determined and the viruses are rapidly identified and grouped. The accurate genetic identification of virus variants provides novel means to the epizootiologists to trace the geographic distribution of the viruses and to determine the origin of a given outbreak. (author)

  1. Amplifying genes using the polymerase chain reaction: A promising diagnostic tool

    International Nuclear Information System (INIS)

    The power to amplify genetic material several millionfold using the polymerase chain reaction (PCR) has greatly enhanced the ability of molecular biologists to examine and manipulate genes. We have used the PCR reaction to detect bluetongue virus (BTV) in infected animals and are currently able to serogroup, serotype and determine the geographic origin of a BTV isolate. Similarly, using a combination of hybridization analyses and direct sequencing of the PCR products we can rapidly detect avian influenza virus, Newcastle disease virus and Mycoplasma and predict if we have nucleic acid sequences that are characteristic of a virulent or avirulent isolate. The ability to manipulate genetic information has made it possible to generate proteins containing deletions or create chimeric proteins which contain additions to their sequences. Such studies are important for the understanding of immune responses to various protein epitopes. Besides its sensitivity, PCR has the advantage of speed over some other detection systems. A comprehensive detection and diagnosis can be done in a few hours compared with several weeks previously required for virus isolations. However, there are disadvantages to using PCR. Because of its ability to amplify a sequence several millionfold, contaminants other than the target species may be amplified and since the DNA polymerase used in PCR has no editing or proofreading functions, errors may be quickly incorporated into the final PCR product. 13 refs, 8 figs

  2. Reação em Cadeia da Polimerase (PCR baseada no gene cpx para detecção de Actinobacillus pleuropneumoniae em suínos natural e experimentalmente infectados Polymerase Chain Reaction (PCR based on the cpx gene for detection of Actinobacillus pleuropneumoniae in natural and experimentally infected pigs

    Directory of Open Access Journals (Sweden)

    Karina Koerich de Souza

    2008-10-01

    Full Text Available A pleuropneumonia suína é uma das mais importantes doenças respiratórias dos suínos, estando presente em todos os países produtores. Para o controle e o monitoramento da pleuropneumonia, é necessário o desenvolvimento de métodos rápidos e acurados de diagnóstico. Com o objetivo de validar a técnica da PCR, baseada no gene cpx de Actinobacillus pleuropneumoniae, em suínos sabidamente positivos, primeiramente foi realizada inoculação experimental com amostras de A. pleuropneumoniae sorotipo 5B e coletadas amostras por meio de suabe de tonsila, biópsia de tonsila e sangue para realização da técnica de PCR, isolamento bacteriológico e teste de ELISA, respectivamente. Posteriormente, estas técnicas foram aplicadas em suínos naturalmente infectados, em três rebanhos com diferentes situações sanitárias quanto à apresentação clínica da doença. De cada rebanho, foram analisados cinco grupos de suínos com idades diferentes, sendo coletado de cada animal biópsia de tonsila para isolamento bacteriológico e PCR e sangue para determinação do perfil sorológico. Os resultados obtidos na inoculação experimental confirmaram que, mesmo com o estabelecimento da infecção comprovada pelo isolamento bacteriológico, após o período de 45 dias, não foi possível detectar o agente pela técnica de PCR. Em animais naturalmente infectados, a técnica de PCR apresentou maior sensibilidade quando comparado com o isolamento. A associação entre PCR e ELISA demonstrou ser uma boa alternativa para definir a situação sanitária do rebanho quanto à infecção por A. pleuropneumoniae.Swine pleuropneumonia is one of the most important pig respiratory diseases and has been found in all producer countries. For control and monitoring of pleuropneumonia, it is necessary the development of fast and specific methods of diagnosis. To validate PCR based on the cpx gene of Actinobacillus pleuropneumoniae in positive pigs, an experimental

  3. Repetitive sequence based polymerase chain reaction to differentiate close bacteria strains in acidic sites

    Institute of Scientific and Technical Information of China (English)

    XIE Ming; YIN Hua-qun; LIU Yi; LIU Jie; LIU Xue-duan

    2008-01-01

    To study the diversity of bacteria strains newly isolated from several acid mine drainage(AMD) sites in China,repetitive sequence based polymerase chain reaction (rep-PCR),a well established technology for diversity analysis of closely related bacteria strains,was conducted on 30 strains of bacteria Leptospirillum ferriphilium,8 strains of bacteria Acidithiobacillus ferrooxidans,as well as the Acidithiobacillus ferrooxidans type strain ATCC (American Type Culture Collection) 23270.The results showed that,using ERIC and BOX primer sets,rep-PCR produced highly discriminatory banding patterns.Phylogenetic analysis based on ERIC-PCR banding types was made and the results indicated that rep-PCR could be used as a rapid and highly discriminatory screening technique in studying bacterial diversity,especially in differentiating bacteria within one species in AMD.

  4. Magnetic hydrophilic methacrylate-based polymer microspheres designed for polymerase chain reactions applications.

    Science.gov (United States)

    Spanová, Alena; Horák, Daniel; Soudková, Eva; Rittich, Bohuslav

    2004-02-01

    Magnetic hydrophilic non-porous P(HEMA-co-EDMA), P(HEMA-co-GMA) and PGMA microspheres were prepared by dispersion (co)polymerization of 2-hydroxyethyl methacrylate (HEMA) and ethylene dimethacrylate (EDMA) or glycidyl methacrylate (GMA) in the presence of several kinds of magnetite. It was found that some components used in the preparation of magnetic carriers interfered with polymerase chain reaction (PCR). Influence of non-magnetic and magnetic microspheres, including magnetite nanoparticles and various components used in their synthesis, on the PCR course was thus investigated. DNA isolated from bacterial cells of Bifidobacterium longum was used in PCR evaluation of non-interfering magnetic microspheres. The method enabled verification of the incorporation of magnetite nanoparticles in the particular methacrylate-based polymer microspheres and evaluation of suitability of their application in PCR. Preferably, electrostatically stabilized colloidal magnetite (ferrofluid) should be used in the design of new magnetic methacrylate-based microspheres by dispersion polymerization. PMID:14698232

  5. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  6. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    Science.gov (United States)

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  7. Direct detection of Mycobacterium tuberculosis in sputum by polymerase chain reaction and DNA hybridization.

    OpenAIRE

    Nolte, F S; Metchock, B; McGowan, J. E.; Edwards, A; Okwumabua, O; Thurmond, C; Mitchell, P S; Plikaytis, B; Shinnick, T

    1993-01-01

    A polymerase chain reaction (PCR) assay for the rapid diagnosis of pulmonary tuberculosis was developed by using oligonucleotide primers to amplify a fragment of IS6110, an insertion sequence repeated multiple times in the chromosome of Mycobacterium tuberculosis. Sediment obtained from sputa processed by the N-acetyl-L-cysteine-NaOH method was suspended in a simple lysis buffer and was heated at 100 degrees C for 30 min prior to amplification. A dUTP-uracil N-glycosylase PCR protocol was use...

  8. Characterization of a nested polymerase chain reaction assay for detection of parvovirus B19.

    OpenAIRE

    Patou, G.; Pillay, D.; Myint, S; Pattison, J.

    1993-01-01

    The characterization and application of a nested polymerase chain reaction (PCR) assay for the detection of human parvovirus B19 DNA is described. The assay was evaluated with 149 diagnostic serum samples (collected up to 150 days after the onset of symptoms) previously tested by dot blot hybridization for B19 DNA and by class-specific capture radioimmunoassays for the detection of B19 immunoglobulin M (IgM) and IgG. B19 DNA was detectable by the PCR in 70% of the sera. There was a statistica...

  9. Use of polymerase chain reaction for detection of Listeria monocytogenes in food.

    OpenAIRE

    Niederhauser, C; Candrian, U; Höfelein, C; M. Jermini; Bühler, H P; Lüthy, J

    1992-01-01

    A previously described polymerase chain reaction (PCR) assay (B. Furrer, U. Candrian, C. Höfelein, and J. Lüthy, J. Appl. Bacteriol. 70:372-379, 1991) was used to analyze food for the presence of Listeria monocytogenes. Food samples were artificially contaminated to develop two procedures to detect the organism following enrichment steps. Procedure A was based on dilution of the enrichment broth followed by lysis of the bacteria and direct analysis of the lysate with PCR. With procedure A and...

  10. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    OpenAIRE

    I Nyoman Suartha; I Gusti Ngurah Kade Mahardika; Ida Ayu Sri Candra Dewi; Ni Ketut Dias Nursanty; Yosaphat L.S Kote; Anita Dwi Handayani; I Gusti Agung Ayu Suartini

    2008-01-01

    A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTAC...

  11. Rapid method for separation of bacterial DNA from humic substances in sediments for polymerase chain reaction.

    OpenAIRE

    Tsai, Y L; Olson, B H

    1992-01-01

    The polymerase chain reaction (PCR) was used to amplify an Escherichia coli 16S ribosomal gene fragment from sediments with high contents of humic substances. Total DNA was extracted from 1 g of E. coli seeded or unseeded samples by a rapid freeze-and-thaw method. Several approaches (use of Bio-Gel P-6 and P-30 and Sephadex G-50 and G-200 columns, as well as use of the Stoffel fragment) were used to reduce interference with the PCR. The best results were obtained when crude DNA extracts conta...

  12. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    OpenAIRE

    Ana Lisa do Vale Gomes; Fábio L Melo; Roberto P Werkhauser; Frederico GC Abath

    2006-01-01

    This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR) protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA). Th...

  13. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    Science.gov (United States)

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples. PMID:25197027

  14. Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

    OpenAIRE

    Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

    1991-01-01

    We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions ...

  15. DNA amplification by polymerase chain reaction from brain tissues embedded in paraffin.

    OpenAIRE

    Gall, K; Pavelić, J.; Jadro-Santel, D.; Poljak, M; Pavelić, K.

    1993-01-01

    A method which enables analysis of DNA from archival paraffin embedded normal and malignant brain tissue is described. The demonstration of a 317-bp long beta-actin DNA sequence by the polymerase chain reaction (PCR) was used to identify which fixation procedure, deparaffinization time and DNA extraction procedure would give the best results. Tissue specimens 1-39 years old were included in the experiments. Specimens fixed in either 10% formalin, Carnoy's or AMeX fixative were found to be bes...

  16. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    OpenAIRE

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-01-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate p...

  17. Uji Diagnostik Polymerase Chain Reaction –Restriction Fragment Length Polymorphism Dalam Menegakkan Diagnosis Onikomikosis.

    OpenAIRE

    Lubis, Nova Zairina

    2015-01-01

    Background: Onychomycosis is a fungal infection of one or more units of the nail caused by dermatophytes, or mold and nondermatophytes yeast. Investigations are needed to establish the diagnosis of onychomycosis before starting treatment. Several investigations methods for diagnosing onychomycosis such as microscopic examination with 20% KOH, fungal culture, histopathology examination with PAS staining (Periodic acid Schiff) and PCR (Polymerase Chain Reaction), for culture methods require a l...

  18. Detection of Mycoplasma pneumoniae by polymerase chain reaction and nonradioactive hybridization in microtiter plates.

    OpenAIRE

    Lüneberg, E; Jensen, J S; M. Frosch

    1993-01-01

    In order to improve the diagnosis of a Mycoplasma pneumoniae infection, we developed a polymerase chain reaction (PCR)-based assay. The gene encoding elongation factor Tu (tuf) was selected as the target sequence. Oligonucleotides derived from variable stretches of the tuf gene were able to prime the amplification of a 950-bp fragment exclusively when M. pneumoniae DNA was used as the template. The sensitivity of the assay was increased 10-fold when the amplification products were hybridized ...

  19. Genomic fingerprints of Staphylococcus aureus of bovine origin by polymerase chain reaction-based DNA fingerprinting.

    OpenAIRE

    Matthews, K R; Kumar, S. J.; O'Conner, S. A.; Harmon, R J; Pankey, J W; Fox, L. K.; Oliver, S P

    1994-01-01

    Staphylococcus aureus (n = 75) isolated from mammary secretions of cows with subclinical and clinical mastitis from several geographic locations in the USA were examined using polymerase chain reaction-based DNA fingerprinting. DNA fingerprints were produced using a synthetic oligonucleotide primer (5'GTAACGCC3') to produce a distinct spectrum of amplified DNA fragments facilitating a high degree of resolution for differentiating S. aureus strains. PCR-based DNA fingerprinting grouped the 75 ...

  20. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    OpenAIRE

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  1. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    OpenAIRE

    Li Jiang; Matthew Mancuso; Zhengda Lu; Gunkut Akar; Ethel Cesarman; David Erickson

    2014-01-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics ...

  2. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction.

    OpenAIRE

    Alexander, H S; Key, D.W.; Nagy, E.

    1998-01-01

    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb Ba...

  3. Detection of Toxoplasma gondii in venous blood from AIDS patients by polymerase chain reaction.

    Science.gov (United States)

    Dupouy-Camet, J; de Souza, S L; Maslo, C; Paugam, A; Saimot, A G; Benarous, R; Tourte-Schaefer, C; Derouin, F

    1993-01-01

    Detection of Toxoplasma gondii in blood by means of the polymerase chain reaction (PCR) may facilitate the diagnosis and follow-up of cerebral toxoplasmosis in patients with AIDS. We evaluated this approach with seven patients with tissue culture-proven parasitemia, 14 patients with presumptive cerebral toxoplasmosis, and 17 healthy human immunodeficiency virus-positive controls. Each sample of blood was assayed on three different occasions by a PCR assay based on detection of the gene encoding the P30 surface protein. A positive PCR diagnosis required positivity in at least two of the three PCR tests. None of the controls had a positive PCR diagnosis, but six of the seven patients with parasitemia did. Cerebral toxoplasmosis was confirmed in 13 of the 14 patients with a presumptive diagnosis; diagnosis by PCR was positive before treatment for 9 of these 13 patients, whereas tissue culture was positive for only 1 patient. During treatment, blood samples were taken from 14 patients at regular intervals until day 12. PCR diagnosis became negative on ethidium-stained gels, but persistent signals were observed after hybridization, in some cases, for up to 12 days after initiation of therapy. PCR on venous blood could thus be a sensitive and noninvasive method for the diagnosis of cerebral and disseminated toxoplasmosis in AIDS patients and could be a potential tool for monitoring the effects of treatment. PMID:8349765

  4. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    Science.gov (United States)

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  5. Detection of Francisella tularensis in blood by polymerase chain reaction.

    OpenAIRE

    Long, G W; Oprandy, J J; Narayanan, R. B.; Fortier, A H; Porter, K R; Nacy, C.A.

    1993-01-01

    We developed a polymerase chain reaction-based assay for Francisella tularensis which we evaluated by using spiked blood samples and experimentally infected mice. The assay detected both type A and type B F. tularensis at levels equivalent to one CFU/microliter of spiked blood. Results from polymerase chain reaction-based assay of limiting dilutions of blood from mice infected with the live vaccine strain agreed closely with results from blood culture.

  6. CONVERGENCE OF MARKOV CHAIN APPROXIMATIONS TO STOCHASTIC REACTION DIFFUSION EQUATIONS

    OpenAIRE

    Kouritzin, Michael A.; Hongwei Long

    2001-01-01

    In the context of simulating the transport of a chemical or bacterial contaminant through a moving sheet of water, we extend a well-established method of approximating reaction-diffusion equations with Markov chains by allowing convection, certain Poisson measure driving sources and a larger class of reaction functions. Our alterations also feature dramatically slower Markov chain state change rates often yielding a ten to one-hundred-fold simulation speed increase over the previous version o...

  7. Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

    DEFF Research Database (Denmark)

    Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline;

    2015-01-01

    BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...

  8. Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    JANNOTTI-PASSOS Liana Konovaloff

    2000-01-01

    Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

  9. Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre;

    2013-01-01

    Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

  10. Resultados do exame anátomo-patológico e "Polymerase Chain Reaction (PCR" na forma clinica e subclinica da infecção anal pelo Papilomavirus Humano (HPV: estudo em quatro grupos de pacientes Histopathological and PCR results for clinical and subclinical forms of HPV anal infection: study of four groups of patients

    Directory of Open Access Journals (Sweden)

    João Carlos Magi

    2006-12-01

    Full Text Available O Papilomavírus Humano tem alta incidência na população. O objetivo deste trabalho é o estudo dos resultados encontrados no exame anatomo-patológico e no PCR das formas clínica e subclínica da infecção anal por HPV em quatro grupos de pacientes. MÉTODO: Foram estudados 10 pacientes com prurido anal idiopático, seis com infecção genital pelo HPV, tratada, seis com condiloma anal tratado e oito com condiloma anal. As verrugas foram biopsiadas nos oito pacientes com condiloma e feito exame de anuscopia de alta resolução com biópsia dirigida nos outros 22 pacientes. O material foi encaminhado para exame anátomo-patológico e depois, a partir do mesmo bloco de parafina, foi feito o exame de PCR. Resultados: O anátomo-patológico foi positivo para HPV em todos os pacientes, sendo que nos oito com condiloma confirmou-se a forma clínica e em 22 diagnosticou-se a subclínica com 13 casos de neoplasia intraepitelial associada. O PCR foi positivo em 91,9% dos 22 pacientes da forma subclínica ao anátomo-patológico e em 87,5% dos oito pacientes da forma clínica. O tipo predominante nos casos de HPV anal subclínico foi o 16 e o predominante nas verrugas foi o 11. CONCLUSÕES: O exame anátomo-patológico foi positivo para HPV em todos os pacientes, propiciando também o diagnóstico de 13 casos de neoplasia intraepitelial, sendo dois de carcinoma "in situ". O PCR foi positivo em 91,9% dos pacientes da forma subclínica ao anátomo-patológico e em 87,5% da forma clínica ao anátomo-patológico. O tipo predominante da forma subclinica foi o 16 e das verrugas foi o 11.The purpose of this study is to analyze the results found in the pathological examination and PCR test for clinical and subclinical HPV anal infections in four groups of patients. Methods: The four groups studied were: ten patients with idiopathic anal pruritus, six with treated HPV genital infection, six with treated anal condyloma, and eight with anal condyloma. Eight

  11. Micromachined polymerase chain reaction system for multiple DNA amplification of upper respiratory tract infectious diseases.

    Science.gov (United States)

    Liao, Chia-Sheng; Lee, Gwo-Bin; Wu, Jiunn-Jong; Chang, Chih-Ching; Hsieh, Tsung-Min; Huang, Fu-Chun; Luo, Ching-Hsing

    2005-01-15

    This paper presents a micro polymerase chain reaction (PCR) chip for the DNA-based diagnosis of microorganism genes and the detection of their corresponding antibiotic-resistant genes. The micro PCR chip comprises cheap biocompatible soda-lime glass substrates with integrated thin-film platinum resistors as heating/sensing elements, and is fabricated using micro-electro-mechanical-system (MEMS) techniques in a reliable batch-fabrication process. The heating and temperature sensing elements are made of the same material and are located inside the reaction chamber in order to ensure a uniform temperature distribution. This study performs the detection of several genes associated with upper respiratory tract infection microorganisms, i.e. Streptococcus pneumoniae, Haemopilus influenze, Staphylococcu aureus, Streptococcus pyogenes, and Neisseria meningitides, together with their corresponding antibiotic-resistant genes. The lower thermal inertia of the proposed micro PCR chip relative to conventional bench-top PCR systems enables a more rapid detection operation with reduced sample and reagent consumption. The experimental data reveal that the high heating and cooling rates of the system (20 and 10 degrees C/s, respectively) permit successful DNA amplification within 15 min. The micro PCR chip is also capable of performing multiple DNA amplification, i.e. the simultaneous duplication of multiple genes under different conditions in separate reaction wells. Compared with the large-scale PCR system, it is greatly advantageous for fast diagnosis of multiple infectious diseases. Multiplex PCR amplification of two DNA segments in the same well is also feasible using the proposed micro device. The developed micro PCR chip provides a crucial tool for genetic analysis, molecular biology, infectious disease detection, and many other biomedical applications. PMID:15590288

  12. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    Energy Technology Data Exchange (ETDEWEB)

    Liu Dayu, E-mail: ruark@126.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China); Zhou Xiaomian, E-mail: zhouximi@yahoo.com [Laboratory of Clinical Chemical Technology, Department of Laboratory Medicine, Guangzhou First Municipal People' s Hospital, Affiliated to Guangzhou Medical College, 510180 Guangzhou (China)

    2012-03-09

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil-water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: Black-Right-Pointing-Pointer Droplet formation in a capillary. Black-Right-Pointing-Pointer Transport the droplet using oscillation-flow. Black-Right-Pointing-Pointer Oscillation droplet PCR. Black-Right-Pointing-Pointer Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil-water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 {mu}L) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to

  13. Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

    International Nuclear Information System (INIS)

    Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

  14. Resultados do exame anátomo-patológico e "Polymerase Chain Reaction (PCR)" na forma clinica e subclinica da infecção anal pelo Papilomavirus Humano (HPV): estudo em quatro grupos de pacientes Histopathological and PCR results for clinical and subclinical forms of HPV anal infection: study of four groups of patients

    OpenAIRE

    João Carlos Magi; Marcos Ricardo da Silva Rodrigues; Geanna Mara Lino e Silva de Resende Guerra; Maria Cecília Costa; Anderson da Costa Lino Costa; Luisa Lina Villa; Galdino José Sitonio Formiga

    2006-01-01

    O Papilomavírus Humano tem alta incidência na população. O objetivo deste trabalho é o estudo dos resultados encontrados no exame anatomo-patológico e no PCR das formas clínica e subclínica da infecção anal por HPV em quatro grupos de pacientes. MÉTODO: Foram estudados 10 pacientes com prurido anal idiopático, seis com infecção genital pelo HPV, tratada, seis com condiloma anal tratado e oito com condiloma anal. As verrugas foram biopsiadas nos oito pacientes com condiloma e feito exame de an...

  15. Identification of Entamoeba histolytica and E. dispar cysts in stool by polymerase chain reaction.

    Science.gov (United States)

    Sanuki, J; Asai, T; Okuzawa, E; Kobayashi, S; Takeuchi, T

    1997-01-01

    An attempt to identify cysts of Entamoeba histolytica and E. dispar in human stool was conducted by polymerase chain reaction (PCR) using two sets of primers (p11 plus p12 and p13 plus p14) specific for either species of ameba. The cysts in stool specimens obtained from 12 infected individuals were concentrated, freeze-thawed, and treated with Triton X-100 before their examination by PCR. The results of PCR on the cysts were generally consistent with data obtained by PCR on ameba trophozoites hatched from the cysts, by zymodeme analysis, and by enzyme-linked immunosorbent assay (ELISA) and with clinical findings. This PCR was negative for the stool containing large numbers of cysts of either E. coli, E. hartmanni, or Giardia lamblia as well as for the stool specimens obtained from uninfected individuals. The ameba cyst in stool processed using the present method was effective for the PCR analysis even after 1 month of storage at 4 degrees C. The present PCR was sensitive enough to detect ten cysts of either of the amebae. PMID:9000244

  16. Polymerase chain reaction for detection of herpesvirus simiae (B virus) in clinical specimens.

    Science.gov (United States)

    Slomka, M J; Brown, D W; Clewley, J P; Bennett, A M; Harrington, L; Kelly, D C

    1993-01-01

    A polymerase chain reaction (PCR) was designed which is specific to Macaca fascicularis (cynomolgus monkey) isolates of B virus. The PCR primers produced the expected 188 basepair product from the Cyno 2 strain and seven other cynomolgus monkey isolates of B virus. Oligomer hybridization with a 31-mer oligonucleotide was used to confirm the origin of this product. The PCR failed to amplify DNA of Epstein-Barr virus, cytomegalovirus, varicella-zoster virus, and other alphaherpesviruses (herpes simplex virus types 1 and 2, four SA 8 isolates and three rhesus isolates of B virus). PCR testing of swabs obtained from four orally-infected cynomolgus monkeys confirmed the presence of B virus DNA in samples previously shown to be positive by culture. In addition, PCR detected B virus in several swabs from infected monkeys that were culture negative. Total DNA extracts from the trigeminal and sacral ganglia of these animals were tested by nested PCR and B virus DNA was detected in the trigeminal ganglia of 3 of the 4 orally-infected cynomolgus monkeys. Nested PCR did not detect B virus DNA in total DNA extracts obtained from the brains of the four monkeys. PMID:8392323

  17. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  18. Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

    Directory of Open Access Journals (Sweden)

    PD Andrade

    2013-01-01

    Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

  19. Alteration in sample preparation to increase the yield of multiplex Polymerase Chain Reaction assay for diagnosis of genital ulcer disease

    OpenAIRE

    Rao, G.; A Das; Prabhakar, P.; V Nema; Risbud, A. R.

    2013-01-01

    Purpose: Genital Ulcer Disease (GUD) is common sexually transmitted infection (STI). Multiple studies have shown that GUDs are strongly associated with the transmission and the acquisition of HIV infection. An accurate diagnosis of common etiology of GUD namely Herpes, syphilis and Chancroid is possible using Multiplex PCR (M-PCR). However, frequent presence of Polymerase Chain Reaction inhibitors in the ulcer swab specimen limits the performance of the assay. In order to overcome this proble...

  20. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    OpenAIRE

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have d...

  1. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase

    OpenAIRE

    Diaz, R S; Sabino, E. C.

    1998-01-01

    For certain applications of the polymerase chain reaction (PCR), it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq) DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We use...

  2. A novel polymerase chain reaction method for detection of human immunodeficiency virus in dried blood spots on filter paper.

    OpenAIRE

    Yourno, J; Conroy, J.

    1992-01-01

    A method for detection of proviral human immunodeficiency virus DNA in dried blood spots on filter paper by direct polymerase chain reaction (PCR) has been developed. To develop the method, a standard system was used which was prepared from cells each containing a single integrated provirus and titrated with normal donor blood. This rapid procedure provides virtually quantitative yields of nuclear DNA and exploits most of the standard methodology described for blood specimens. A nested PCR us...

  3. DETEKSI DAN SPESIASI PARASIT MALARIA SAMPEL MONITORING PENGOBATAN DIHYDROARTEMISININ-PIPERAQUINE DI KALIMANTAN DAN SULAWESI: MIKROSKOPIS VS POLYMERASE CHAIN REACTION

    OpenAIRE

    Reni Herman; Endah Ariyanti; Ervi Salwati; Delima -; Emiliana Tjitra

    2012-01-01

    In monitoring the treatment of malaria with Dihydroartemisinin-piperaquine (DHP), microscopic cross check and Polymerase Chain Reaction (PCR) performed to validate the results of laboratory examinations in the field. This study used finger prick samples from subjects with a diagnosis of malaria in monitoring the treatment of malaria with DHP in Kalimantan and Sulawesi. Samples taken at day 0, blood smears made on slides for microscopic and blood spot on filter paper for PCR examination. The P...

  4. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction.

    OpenAIRE

    Lunkenheimer, K; Hufert, F. T.; Schmitz, H.

    1990-01-01

    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specim...

  5. Differentiation of Neisseria gonorrhoeae strains by polymerase chain reaction and restriction fragment length polymorphism of outer membrane protein IB genes.

    OpenAIRE

    Lau, Q C; Chow, V T; Poh, C. L.

    1995-01-01

    OBJECTIVES--To employ polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis for the rapid differentiation of Neisseria gonorrhoeae protein IB (PIB) isolates and to compare its usefulness with the widely accepted auxotype/serovar classification scheme. METHODS--The outer membrane protein IB genes of 47 gonococcal isolates belonging to 10 different serovars were amplified by PCR. The approximately 1 kb DNA products were then digested separately with restri...

  6. Transgenes monitoring in an industrial soybean oil processing by conventional and real-time polymerase chain reaction

    OpenAIRE

    Costa, J; Mafra, I; Amaral, J S; Oliveira, M. B. P. P.

    2009-01-01

    In recent years a great effort has been devoted to the development of new methods for the qualitative and quantitative detection of transgenic sequences in food. Most of the developed analytical methods for GMO detection are DNA-based, since protein-based assays are not suitable for processed food. For that purpose, polimerase chain reaction (PCR) and real-time quantitative PCR have been successfully applied. Since the approval of Roundup Ready (RR) soybean in Europe, the production of soybea...

  7. Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

    OpenAIRE

    Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

    2004-01-01

    We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

  8. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    Science.gov (United States)

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  9. The use of polymerase chain reaction for early diagnosis of tuberculosis in Mycobacterium tuberculosis culture

    Directory of Open Access Journals (Sweden)

    M. Chagas

    2010-06-01

    Full Text Available Early diagnosis plays a vital role in controlling tuberculosis. The conventional methodology is slow, with results taking several weeks, in addition to having low sensitivity, especially in clinical paucibacillary samples. The objective of this study was to evaluate the use of polymerase chain reaction (PCR on solid medium culture for a rapid diagnosis of tuberculosis, mainly in cases of negative sputum smears. Forty sputum samples were collected from inpatients with tuberculosis treated for less than 2 days. Bacilloscopy, PCR for sputum, culture on Löwestein-Jensen (LJ solid medium, and daily PCR from culture were performed on each sample. DNA extracted from the BCG vaccine, which contains attenuated bacillus Calmette-Guérin, was used as the positive control. Smear microscopy showed 68.6% sensitivity, 80% specificity, 96% positive predictive value, and 26.7% negative predictive value, with culture on LJ medium as the gold standard. Culture at day 28 showed 74.3% sensitivity and 100% specificity. PCR of DNA extracted from sputum amplified a 1027-bp fragment of the 16s RNA gene, showing 22.9% sensitivity and 60% specificity. PCR performed with DNA extracted from daily culture showed that, from the 17th to the 40th day, the sensitivity (85.7% and specificity (60% were constant. We conclude that a 17-day culture is a good choice for rapid diagnosis and to interfere with the transmission chain of tuberculosis.

  10. Tissue extraction of DNA and RNA and analysis by the polymerase chain reaction.

    Science.gov (United States)

    Jackson, D P; Lewis, F A; Taylor, G R; Boylston, A W; Quirke, P

    1990-01-01

    Several DNA extraction techniques were quantitatively and qualitatively compared using both fresh and paraffin wax embedded tissue and their suitability investigated for providing DNA and RNA for the polymerase chain reaction (PCR). A one hour incubation with proteinase K was the most efficient DNA extraction procedure for fresh tissue. For paraffin wax embedded tissue a five day incubation with proteinase K was required to produce good yields of DNA. Incubation with sodium dodecyl sulphate produced very poor yields, while boiling produced 20% as much DNA as long enzyme digestion. DNA extracted by these methods was suitable for the PCR amplification of a single copy gene. Proteinase K digestion also produced considerable amounts of RNA which has previously been shown to be suitable for PCR analysis. A delay before fixation had no effect on the amount of DNA obtained while fixation in Carnoy's reagent results in a much better preservation of DNA than formalin fixation, allowing greater yields to be extracted. Images PMID:1696290

  11. Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Radji, M.

    2010-01-01

    Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

  12. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Bell, D.A. (National Inst. of Environmental Health Sciences, Research Triangle Park, NC (United States))

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  13. THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

    Directory of Open Access Journals (Sweden)

    I Nyoman Suartha

    2008-03-01

    Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

  14. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction.

    Science.gov (United States)

    Bell, D A

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes. PMID:1684153

  15. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    Institute of Scientific and Technical Information of China (English)

    Xiao-Mou Peng; Lin Gu; Xue-Juan Chen; Jian-Guo Li; Yang-Su Huang; Zhi-Liang Gao

    2005-01-01

    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation.METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control.To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CDPCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe ndent of the amount of templates and the number of PCRcycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles.

  16. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    Science.gov (United States)

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  17. Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

    DEFF Research Database (Denmark)

    Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2007-01-01

    Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage...

  18. Detection of human immunodeficiency virus DNA in cultured human glial cells by means of the polymerase chain reaction

    DEFF Research Database (Denmark)

    Teglbjærg, Lars Stubbe; Hansen, J-ES; Dalbøge, H;

    1991-01-01

    This report describes the use of the polymerase chain reaction (PCR) for the detection of viral genomic sequences in latently infected cells. Infection with human immunodeficiency virus in cultures of human glial cells was demonstrated, using nucleic acid amplification followed by dot blot hybrid...... where viral replication is absent, or where genomic copies are present at such low numbers that they are otherwise undetectable....

  19. Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Mohammad Rubayet Hasan

    2014-01-01

    Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

  20. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper;

    2007-01-01

    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR-BM). M...

  1. Pooling of porcine fecal samples for quantification of Lawsonia intracellularis by real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Pedersen, Ken Steen; Johansen, Markku; Jorsal, Sven Erik Lind;

    2014-01-01

    obtained by averaging test results from individual fecal samples in relation to a quantitative polymerase chain reaction (qPCR) test for Lawsonia intracellularis. Ten diarrheic and 10 normal fecal samples were submitted from each of 43 Danish swine herds (n = 860 fecal samples). Pools (n = 43), each...

  2. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation.

    Science.gov (United States)

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K

    2016-08-01

    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA. PMID:27393216

  3. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... PCR-ASO technique. The frequencies of the HLA-DPB1 genotypes deduced from the results of PCR-RFLP typing were estimated in 71 healthy Danes.......We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...

  4. The Ripple Effect: Citation Chain Reactions of a Nobel Prize

    DEFF Research Database (Denmark)

    Faber Frandsen, Tove; Nicolaisen, Jeppe

    2013-01-01

    This paper explores the possible citation chain reactions of a Nobel Prize using the mathematician Robert J. Aumann as a case example. The results show that the award of the Nobel Prize in 2005 affected not only the citations to his work, but also affected the citations to the references in his...... scientific oeuvre. The results indicate that the spillover effect is almost as powerful as the effect itself. We are consequently able to document a ripple effect in which the awarding of the Nobel Prize ignites a citation chain reaction to Aumann's scientific ouvre and to the references in its nearest...

  5. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  6. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling. PMID:27407185

  7. Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

    Directory of Open Access Journals (Sweden)

    Ching Giap Tan

    2014-02-01

    Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

  8. Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

    Directory of Open Access Journals (Sweden)

    Carla Bertechini Faria

    2012-03-01

    Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

  9. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine

    Directory of Open Access Journals (Sweden)

    K.R. Caleffi

    2012-02-01

    Full Text Available Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT and dapsone, rifampicin and clofazimine for borderline (BB and lepromatous (LL forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients’ urine samples was successfully amplified by PCR-Pra in 46.6% (34/73 of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306. In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386. PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033. Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

  10. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    Science.gov (United States)

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis. PMID:24712177

  11. The generalised self-sustaining chain reaction theory about ADS

    International Nuclear Information System (INIS)

    The basic connotation of ADS (accelerator driven system) is investigated from the point of view of generalized self-sustaining chain reaction. The ADS is composed of proton accelerator, neutron producing target and the subcritical reactor. This system can be viewed entirely as a generalized self sustaining chain reaction system. In this view of point, the accelerator with target, as a part of ADS, can be viewed as an energy-neutron transformer (energy be fed to accelerator to produce medium energy protons, neutrons be produced in the heavy target as a result of proton-heavy nucleus spallation reaction). In this generalized self-sustaining chain reaction system, the number of neutrons produced after a fission event is not only the fission neutrons but also the neutrons produced by the energy-neutron transformer. That is, the ADS has more effective secondary neutrons after a fission event. It is just these additional neutrons, the ADS can be in state of self-sustaining chain reaction (criticality), although the reactor part of ADS is in state of sub-criticality. The critical equation of the generalized self-sustaining chain reaction system is presented. The relationship between the effective multiplication factors of ADS and subcritical reactor part of ADS is also presented. The power output of ADS is represented by a function of the proton current, the subcritical reactivity of the reactor in ADS, the number of neutrons produced in spallation process per proton and etc. At last, the probable application of ADS in the future is investigated

  12. Direct polymerase chain reaction from blood and tissue samples for rapid diagnosis of bovine leukemia virus infection.

    Science.gov (United States)

    Nishimori, Asami; Konnai, Satoru; Ikebuchi, Ryoyo; Okagawa, Tomohiro; Nakahara, Ayako; Murata, Shiro; Ohashi, Kazuhiko

    2016-06-01

    Bovine leukemia virus (BLV) infection induces bovine leukemia in cattle and causes significant financial harm to farmers and farm management. There is no effective therapy or vaccine; thus, the diagnosis and elimination of BLV-infected cattle are the most effective method to eradicate the infection. Clinical veterinarians need a simpler and more rapid method of diagnosing infection, because both nested polymerase chain reaction (PCR) and real-time PCR are labor intensive, time-consuming, and require specialized molecular biology techniques and expensive equipment. In this study, we describe a novel PCR method for amplifying the BLV provirus from whole blood, thus eliminating the need for DNA extraction. Although the sensitivity of PCR directly from whole blood (PCR-DB) samples as measured in bovine blood containing BLV-infected cell lines was lower than that of nested PCR, the PCR-DB technique showed high specificity and reproducibility. Among 225 clinical samples, 49 samples were positive by nested PCR, and 37 samples were positive by PCR-DB. There were no false positive samples; thus, PCR-DB sensitivity and specificity were 75.51% and 100%, respectively. However, the provirus loads of the samples detected by nested PCR and not PCR-DB were quite low. Moreover, PCR-DB also stably amplified the BLV provirus from tumor tissue samples. PCR-DB method exhibited good reproducibility and excellent specificity and is suitable for screening of thousands of cattle, thus serving as a viable alternative to nested PCR and real-time PCR. PMID:26911373

  13. Direct polymerase chain reaction from blood and tissue samples for rapid diagnosis of bovine leukemia virus infection

    Science.gov (United States)

    NISHIMORI, Asami; KONNAI, Satoru; IKEBUCHI, Ryoyo; OKAGAWA, Tomohiro; NAKAHARA, Ayako; MURATA, Shiro; OHASHI, Kazuhiko

    2016-01-01

    Bovine leukemia virus (BLV) infection induces bovine leukemia in cattle and causes significant financial harm to farmers and farm management. There is no effective therapy or vaccine; thus, the diagnosis and elimination of BLV-infected cattle are the most effective method to eradicate the infection. Clinical veterinarians need a simpler and more rapid method of diagnosing infection, because both nested polymerase chain reaction (PCR) and real-time PCR are labor intensive, time-consuming, and require specialized molecular biology techniques and expensive equipment. In this study, we describe a novel PCR method for amplifying the BLV provirus from whole blood, thus eliminating the need for DNA extraction. Although the sensitivity of PCR directly from whole blood (PCR-DB) samples as measured in bovine blood containing BLV-infected cell lines was lower than that of nested PCR, the PCR-DB technique showed high specificity and reproducibility. Among 225 clinical samples, 49 samples were positive by nested PCR, and 37 samples were positive by PCR-DB. There were no false positive samples; thus, PCR-DB sensitivity and specificity were 75.51% and 100%, respectively. However, the provirus loads of the samples detected by nested PCR and not PCR-DB were quite low. Moreover, PCR-DB also stably amplified the BLV provirus from tumor tissue samples. PCR-DB method exhibited good reproducibility and excellent specificity and is suitable for screening of thousands of cattle, thus serving as a viable alternative to nested PCR and real-time PCR. PMID:26911373

  14. Rapid and inexpensive species differentiation using a multiplex real-time polymerase chain reaction high-resolution melt assay.

    Science.gov (United States)

    Elkins, Kelly M; Perez, Anjelica C U; Sweetin, Katherine C

    2016-05-01

    We demonstrate a method for developing real-time polymerase chain reaction (PCR) high-resolution melt (HRM) assays to identify multiple species present in a mixture simultaneously using LCGreen Plus and melt temperatures. Highly specific PCR primers are designed to yield amplicons with different melt temperatures for simple routine species identification compared with differentiating melt curve kinetics traces or difference plots. This method is robust and automatable, and it leads to savings in time and reagent costs, is easily modified to probe any species of interest, eliminates the need for post-PCR gel or capillary electrophoresis in routine assays, and requires no expensive dye-labeled primers. PMID:26836486

  15. Evaluation of polymerase chain reaction for the detection of Paracoccidioides brasiliensis DNA on serum samples from patients with paracoccidioidomycosis

    Directory of Open Access Journals (Sweden)

    Cecília Eugenia Charbel

    2006-03-01

    Full Text Available The aim of this study was to demonstrate the DNA of Paracoccidioides brasiliensis in human serum samples of patients with paracoccidioidomycosis using the polymerase chain reaction (PCR. The diagnosis of paracoccidioidomycosis (PCM was defined by microscopic observation of the fungus on direct exam or histopathology, culture, and serological positivity. DNA from serum of 33 patients with PCM was extracted and submitted to nested-PCR using primers from the gp 43 gene. Only one sample was positive on nested-PCR. We conclude that the prevalence of fungemia in patients with different clinical forms of PCM is low, limiting the use of serum DNA detection as an alternative diagnostic tool.

  16. Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

    International Nuclear Information System (INIS)

    To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

  17. Detection of Listeria monocytogenes by using the polymerase chain reaction

    International Nuclear Information System (INIS)

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with 32P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains

  18. Characteristics of a chain thermal explosion as a function of the kinetic properties of reaction chains

    Science.gov (United States)

    Azatyan, V. V.; Piloyan, A. A.; Saikova, G. R.; Smirnov, N. N.

    2016-03-01

    Study of the combustion and explosion of hydrogen‒carbon oxide‒air mixtures shows that the sharpness of a chain thermal explosion depends on the frequency of branching in a given branch of a reaction chain. It is established that varying the CO: H2 concentration allows us to observe and eliminate the degeneration of an explosion while maintaining the regimes of ignition and deflagration.

  19. Extração de DNA de materiais de arquivo e fontes escassas para utilização em reação de polimerização em cadeia (PCR Methods of DNA extraction from archived materials and rare sources for utilization in polymer chain reaction

    Directory of Open Access Journals (Sweden)

    Jaqueline A. Barea

    2004-12-01

    Full Text Available Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina, para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da reação de polimerização em cadeia (PCR. Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad; Insta Gene® (BioRad e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb, Factor V Leiden (220 pb e Abelson (106 pb. De acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu.The present work aimed at comparing five different methods of DNA extraction of samples from archived materials (paraffin-embedded tissues, peripheral blood smears - stained or not with Leishman, aspired bone marrow smears and Guthrie card bloodspots and from rare sources (oral cells, one and three capillary bulbs, 2 mL of urine, to evaluate the ease of application and the possibility of amplification of this DNA by the polymerization chain reaction (PCR technique. The methods included proteinase K digestion - followed or not by phenol/chloroform purification, Chelex 100® (BioRad, InstaGene® (BioRad and boiling in the sterile water. The DNA obtained was tested for amplification of three genic fragments: the brain-derived neutrophic factor gene (764 bp

  20. Polymerase chain reaction detection of candidatus liberibacter asiatic associated with citrus huanglonbing

    Directory of Open Access Journals (Sweden)

    G.P. Jagtap

    2012-08-01

    Full Text Available Polymerase chain reaction diagnosis of Candidatus liberibacter asiatic associated with citrus Huanglonbing disease is molecular technique which is used for detection of disease when pathogen present is very low concentration in disease sample. Among these three DNA isolation methods viz., commercial kit method, sodium sulphite method and membrane bard nucleic acid technique, sodium sulphite method is cost effective for commercial use. In nucleic acid membrane method for DNA extraction isolation there is no use of liquid nitrogen. Polymerase chain reaction detection of disease is based on principal of thermal cycling in which PCR instrument allow to run generally 60-65 thermal cycle, during PCR operation it allow different stages of cycle at different temperatures for different period of time i.e. initiation (940C, denaturation (940C, primer annealing (600C, extension/elongation step (720C, final elongation (720C and holding temperature (40C. PCR based diagnosis system is developed for detection of greening bacteria. The comparative cost of detection by various combinations of reagent and sampling time was determined and cost effective technology was standardized and validated.

  1. [The use of polymerase chain reaction in laboratory diagnosis of dermatophytosis].

    Science.gov (United States)

    Tiryaki, Yasin; Gültekin Korkmazgil, Berna; Eyigör, Mete; Aydın, Neriman

    2015-04-01

    Dermatophytes are among the common causes of fungal infections in the community. Classical diagnostic tests for dermatophytosis have some disadvantages such as failure of direct microscopy in species differentiation and culture methods being time consuming and having low sensitivity. The aim of this study was to investigate the performance of polymerase chain reaction (PCR) in the identification of dermatophytes directly from the clinical samples and the cultures. A total of 123 samples that comprise 63 skin and 60 nail scrapings obtained from 110 patients (69 female, 41 male; age range: 4-82 years) who were prediagnosed as dermatophytosis, were included in the study. Samples were examined with routine direct microscopy, culture and two different nested PCR (nPCR) protocols. The first was a pan-dermatophyte nPCR protocol targeting chitin synthase gene (CHS-1) of dermatophytes and the second was a nPCR protocol which targets specific ITS-1 genes of Trichophyton rubrum and T.mentagrophytes. Similar PCR methods were also applied to cultivated strains. Sequence analysis was performed for the samples that yielded positive results in pan-dermatophyte nPCR and negative results in T.rubrum/T.mentagrophytes - specific nPCR. Hyphae and/or spore structures were observed in 62 (50%) samples with direct microscopic examination and dermatophytes were isolated in 30 (24%) samples. Twenty-eight of the isolates grown in culture were identified as T.rubrum, and two as T.mentagrophytes with T.rubrum/T.mentagrophytes-specific nPCR protocol. In direct application, 67 (55%) of the clinical samples were found positive with pan-dermatophyte nPCR and 65 (53%) were positive with T.rubrum/T.mentagrophytes-specific nPCR. Samples which were negative in direct microscopic examination were also negative in culture. Nine of them were found positive with pan-dermatophyte nPCR and eight were positive with T.rubrum/T.mentagrophytes-specific nPCR. Two of the 30 samples which were positive in culture

  2. Differential detection of turkey coronavirus, infectious bronchitis virus, and bovine coronavirus by a multiplex polymerase chain reaction.

    Science.gov (United States)

    Loa, C C; Lin, T L; Wu, C C; Bryan, T A; Hooper, T A; Schrader, D L

    2006-01-01

    The objective of the present study was to develop a multiplex polymerase chain reaction (PCR) method for differential detection of turkey coronavirus (TCoV), infectious bronchitis coronavirus (IBV), and bovine coronavirus (BCoV). Primers were designed from conserved or variable regions of nucleocapsid (N) or spike (S) protein gene among TCoV, IBV, and BCoV and used in the same PCR reaction. Reverse transcription followed by the PCR reaction was used to amplify a portion of N or S gene of the corresponding coronaviruses. The PCR products were detected on agarose gel stained with ethidium bromide. Two PCR products, a 356-bp band corresponding to N gene and a 727-bp band corresponding to S gene, were obtained for TCoV isolates. In contrast, one PCR product of 356 bp corresponding to a fragment of N gene was obtained for IBV strains and one PCR product of 568 bp corresponding to a fragment of S gene was obtained for BCoV. There were no PCR products with the same primers for Newcastle disease virus, Marek's disease virus, turkey pox virus, pigeon pox virus, fowl pox virus, reovirus, infectious bursal disease virus, enterovirus, astrovirus, Salmonella enterica, Escherichia coli, and Mycoplasma gallisepticum. Performance of the assay with serially diluted RNA demonstrated that the multiplex PCR could detect 4.8x10(-3) microg of TCoV RNA, 4.6x10(-4) microg of IBV RNA, and 8.0x10(-2) microg of BCoV RNA. These results indicated that the multiplex PCR as established in the present study is a rapid, sensitive, and specific method for differential detection of TCoV, IBV, and BCoV in a single PCR reaction. PMID:16137773

  3. Detection of PERV by polymerase chain reaction and its safety in bioartificial liver support system

    Institute of Scientific and Technical Information of China (English)

    Hai-Hui Wang; Ying-Jie Wang; Hong-Ling Liu; Jun Liu; Yan-Ping Huang; Hai-Tao Guo; Yu-Ming Wang

    2006-01-01

    AIM: To establish a method detecting porcine endogenous retrovirus (PERV) in China experimental minipigs and to evaluate the safety of PERV in three individuals treated with bioartificial liver support systems based on porcine hepatocytes.METHODS: Porcine hepatocytes were isolated with two-stage perfusion method, then cultured in the bioreactor, which is separated by a semipermeable membrane (0.2μm) from the lumen through which the patients' blood plasma was circulated. After post-hemoperfusion, patients' blood was obtained for screening. Additionally, samples of medium collected from both intraluminal and extraluminal compartments of the laboratory bioreactor and culture supernate in vitro was analyzed. The presence of viral sequences was estimated by polymerase chain reaction (PCR) and reverse transcriptase-polymerase chain reaction (RT-PCR). Finally, the infection of virus in the supernate of common culture was ascertained by exposure to the fetal liver cells.RESULTS: PERV-specific gag sequences were found in the porcine hepatocytes using RT-PCR. and were detected in all samples from the intraluminal,extraluminal samples and culture supernate. However,culture supernatant from primary porcine hepatocytes (cleared of cellular debris) failed to infect human fetal liver cells. Finally, RT-PCR detected no PERV infection was found in the blood samples obtained from three patients at various times post-hemoperfusion.CONCLUSION: The assays used are specific and sensitive, identified by second PCR. PERVs could be released from hepatocytes cultured in bioreactor without the stimulation of mitogen and could not be prevented by the hollow fiber semipermeable membrane, indicating the existence of PERV safety in extracorporeal bioartificial liver support system (EBLSS).

  4. Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)

  5. A comparison of three DNA extractive procedures with Leptospira for polymerase chain reaction analysis

    Directory of Open Access Journals (Sweden)

    Veloso IF

    2000-01-01

    Full Text Available Three DNA extraction methods were evaluated in this study: proteinase K followed by phenol-chloroform; a plant proteinase (E6870 followed by phenol-chloroform; and boiling of leptospires in 0.1 mM Tris, pH 7.0 for 10 min at 100°C, with no phenol treatment. Every strain treated with proteinase K or E6870 afforded positive polymerase chain reaction (PCR reaction. On the other hand, from five strains extracted by the boiling method, three did not feature the 849 bp band characteristic in Leptospira. We also evaluated by RAPD-PCR, DNAs from serovars isolated with proteinase K and proteinase 6870 with primers B11/B12. Each of the DNA samples provided PCR profiles in agreement with previous data. Moreover, the results with E6870 showed less background non-specific amplification, suggesting that removal of nucleases was more efficient with E6870. The limit for detection by PCR using Lep13/Lep14 was determined to be 10(2 leptospira, using the silver stain procedure.

  6. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  7. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction

    Science.gov (United States)

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant

    2004-09-01

    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  8. Series DNA Amplification Using the Continuous-Flow Polymerase Chain Reaction Chip

    Science.gov (United States)

    Joung, Seung-Ryong; Kang, Chi Jung; Kim, Yong-Sang

    2008-02-01

    We proposed a continuous-flow polymerase chain reaction (PCR) chip that can be used for series DNA amplification. The continuous-flow PCR chip has several advantages such as fast thermal cycling, series of amplifications, cost-effective fabrication, portability, and fluorescence detection. The continuous-flow PCR chip is composed of two parts namely poly(dimethylsiloxane) (PDMS) microchannel for sample injection and indium-tin-oxide (ITO) heater/glass chip for thermal cycling. The fabricated microchannel width and depth are 250 and 200 µm, respectively. Also, the total working length of the PDMS microchannel is 1340 mm which is equivalent for 20 cycles of amplification. A 2:2:3 microchannel length ratio for three different temperature zones namely denaturation, annealing, and extension was assigned, respectively. Upon the operation of the fabricated continuous-flow PCR chip, the amplification of plasmid DNA pKS-GFP with 720 base pairs and PG-noswsi with 300 base pairs were found successfully with a total reaction time of 15 min.

  9. Real-time polymerase chain reaction for diagnosis and quantitation of negative strand of chikungunya virus.

    Science.gov (United States)

    Chiam, Chun Wei; Chan, Yoke Fun; Loong, Shih Keng; Yong, Sara Su Jin; Hooi, Poh Sim; Sam, I-Ching

    2013-10-01

    Quantitative real-time polymerase chain reaction (qRT-PCR) is useful for diagnosis and studying virus replication. We developed positive- and negative-strand qRT-PCR assays to detect nsP3 of chikungunya virus (CHIKV), a positive-strand RNA alphavirus that causes epidemic fever, rash, and arthritis. The positive- and negative-strand qRT-PCR assays had limits of quantification of 1 and 3 log10 RNA copies/reaction, respectively. Compared to a published E1 diagnostic assay using 30 laboratory-confirmed clinical samples, the positive-strand nsP3 qRT-PCR assay had higher R(2) and efficiency and detected more positive samples. Peak viral load of 12.9 log(10) RNA copies/mL was reached on day 2 of illness, and RNA was detectable up to day 9, even in the presence of anti-CHIKV IgM. There was no correlation between viral load and persistent arthralgia. The positive-strand nsP3 assay is suitable for diagnosis, while the negative-strand nsP3 assay, which uses tagged primers to increase specificity, is useful for study of active viral replication kinetics. PMID:23886793

  10. Development of a set of multiplex standard polymerase chain reaction assays for the identification of infectious agents from aborted bovine clinical samples.

    Science.gov (United States)

    Tramuta, Clara; Lacerenza, Daniela; Zoppi, Simona; Goria, Mariella; Dondo, Alessandro; Ferroglio, Ezio; Nebbia, Patrizia; Rosati, Sergio

    2011-07-01

    The current study describes the development of a set of 5 multiplex polymerase chain reaction (mPCR) assays for the simultaneous detection of abortive infection agents in bovine fetal tissues, including Brucella spp., Leptospira spp., and Campylobacter fetus (mPCR1); Hammondia heydorni, Neospora caninum, and Toxoplasma gondii (mPCR2); Coxiella burnetii and Chlamydophila psittaci (mPCR3); Mycoplasma bovis, Mycoplasma bovigenitalium, and Ureaplasma diversum (mPCR4); and Bovine viral diarrhea virus (BVDV) and Bovine herpesvirus-1 (BoHV-1; mPCR5). The protocol was tested on different tissue samples collected from 50 aborted bovine fetuses, and it showed that out of the 50 fetuses, 7 (14%, mPCR2) were PCR-positive for N. caninum, 4 (8%, mPCR5) were PCR-positive for BVDV, and 2 (4%, mPCR4) were PCR-positive for U. diversum. The results obtained by using each multiplex PCR were 100% concordant with those obtained by using the respective PCR assays targeting single genes on the same specimens. Moreover, all multiplex PCR assays on clinical samples were compared with reference methods, obtaining a perfect accordance in all samples and confirming the validity of the set of multiplex PCR assays. The proposed set of multiplex PCR assays is, therefore, suitable for the simultaneous detection of the main infectious agents responsible for bovine abortion. PMID:21908306

  11. Improvement of Temperature Uniformity for Polymerase Chain Reaction Chip with Heat Spreader

    Science.gov (United States)

    Chen, Rong-Sheng; Mao, Chao-Yang; Chen, Yung-Shieng

    2007-11-01

    For polymerase chain reaction (PCR) applications, a uniform temperature field in the microreactor is crucial. In this paper, we report on the electrothermal and computational fluid dynamics (CFD) simulations performed with the aim of optimizing the temperature distribution by heat spreaders for PCR application. Firstly, the equivalent resistivity of the microresistor heater is evaluated, and a conformable result is then verified by comparing with the experimental result using a prototype PCR chip. Secondly, the temperature distribution at 94 °C in the PCR chip is investigated. Furthermore, a heat spreader is inserted into the PCR chip to reduce the temperature difference in the DNA sample and thus improve the temperature uniformity effectively. The results demonstrated that the effective volume percentage and the energy consumption in the chamber are positively related to the thickness of the heat spreader, while the temperature difference is inversely related to the thickness of the heat spreader. Finally, the (b)-design is better than the (a)-design in terms of both the increase in effective volume percentage of the DNA sample and the decrease in energy consumption. In other words, the (b)-design is recognized as having better temperature uniformity.

  12. Non-detection of Chlamydia trachomatis infection by polymerase chain reaction in pregnant Iranian women

    Directory of Open Access Journals (Sweden)

    Parvin Hassanzadeh

    2012-03-01

    Full Text Available Chlamydia trachomatis is the most common cause of sexually transmitted infection. In 75% of women and 50% of men infection is asymptomatic. According to World Health Organization reports, the number of new genital infections with Chlamydia trachomatis reaches 100 million annually. The sensitivity and specificity of nacid amplification tests are 95% and 99%, respectively. Urine samples can provide a non-invasive method of testing for the detection of Chlamydia trachomatis by polymerase chain reaction (PCR. The aim of this study was to evaluate the prevalence of Chlamydia trachomatis infection in pregnant women referred to a teaching hospital affiliated to Shiraz University of Medical Sciences. Urine samples were obtained from 210 pregnant women and investigated microscopically and macroscopically by urinalysis. Precipitants were also used for DNA extraction and PCR test for detecting Chlamydia trachomatis. Among 210 urine specimens from women aged 15-39 years, none were positive for Chlamydia trachomatis by PCR. In spite of the high sensitivity and specificity of PCR, and the elimination of inhibitory effects on PCR test, no pregnant woman was positive for Chlamydia trachomatis. Here, we suggest that a larger sample should be studied and other sensitive methods could also be used in the future.

  13. Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

    Directory of Open Access Journals (Sweden)

    Ana Lisa do Vale Gomes

    2006-10-01

    Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

  14. Three sample preparation protocols for polymerase chain reaction based detection of Cryptosporidium parvum in environmental samples.

    Science.gov (United States)

    Kostrzynska, M; Sankey, M; Haack, E; Power, C; Aldom, J E; Chagla, A H; Unger, S; Palmateer, G; Lee, H; Trevors, J T; De Grandis, S A

    1999-02-01

    Cryptosporidium parvum is a protozoan parasite responsible for an increasing number of outbreaks of gastrointestinal illness worldwide. In this report, we describe development of sample preparation protocols for polymerase chain reaction (PCR)-based detection of C. parvum in fecal material and environmental water samples. Two of these methods were found adequate for isolation of Cryptosporidium DNA from filtered water pellet suspensions. The first involved several filtration steps, immunomagnetic separation and freeze-thaw cycles. The second method involved filtration, addition of EnviroAmp lysis reagent, freeze-thaw cycles and precipitation of the DNA with isopropanol. Using nested PCR, we detected 100 oocysts/ml of filtered water pellet suspension, with either of the above sample preparation procedures. Nested PCR increased sensitivity of the assay by two to three orders of magnitude as compared to the primary PCR. The detection limit for seeded fecal samples was 10-fold higher than for filtered environmental water pellet suspension. Nested PCR results showed 62.4 and 91.1% correlation with immunofluorescence assay (IFA) for fecal samples and filtered environmental water pellet suspensions, respectively. This correlation decreased to 47.2% and 44.4%, respectively, when only IFA positive samples were analyzed. However, in fecal samples contaminated with a high number (> 10(5)/g) of C. parvum oocysts, this correlation was 100%. PMID:10076632

  15. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    Energy Technology Data Exchange (ETDEWEB)

    Tang Yabing [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Xing Da [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)]. E-mail: xingda@scnu.edu.cn; Zhu Debin [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China); Liu Jinfeng [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, South China Normal University, Guangzhou 510631 (China)

    2007-01-23

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity.

  16. An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

    International Nuclear Information System (INIS)

    Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

  17. Sex Identification of Red-crowned Crane by the Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    LI Jian-hong; LI Shu-ling; BAO Jun; BAI Xiu-juan

    2004-01-01

    Sex determining gene primers of Oriental White Stork were used to amplify sex-linked gene of the Red-crowned Crane's W chromosome-specific by PCR for sex identification. The sexes of 7 couples of grown Red-crowned Cranes and 15 youngs were identified. Through DNA sequence analysis, the identity is 94.77% between Red-crowned Crane and Oriental White Stork. The results of this study suggest that the application of the polymerase chain reaction technique is practicable for determining sex in the Red-crowned Crane.

  18. Zoster ... "a lmost" ... sine herpete: diagnostic utility of real time-polymerase chain reaction.

    Science.gov (United States)

    Vena, Gino A; Apruzzi, Doriana; Vestita, Michelangelo; Calvario, Agata; Foti, Caterina; Cassano, Nicoletta

    2010-10-01

    Zoster sine herpete is a particular form of varicella zoster virus (VZV) infection characterized by segmental pain and dysesthesia, without any cutaneous lesions ever becoming perceptible. This report describes the case of a female patient, presenting with intercostal pain associated with a single papulo-vesicular lesion localized within the same area. Thanks to such a lesion, real time-polymerase chain reaction (PCR) analysis on vesicle fluid swab was possible, thus revealing a significant number of VZV genome copies. This innovative tool has proven essential to diagnose this abortive form of herpes zoster, which would otherwise have remained unidentified. PMID:21213602

  19. Use of the Polymerase Chain Reaction in the Detection of Bovine Leukosis

    OpenAIRE

    Kelly, Emma Jane

    1992-01-01

    A diagnostic test for bovine leukosis was developed using the polymerase chain reaction (PCR) to amplify a 375 base pair region in the gag gene of the proviral genome. Blood samples were collected from 3 adult Holstein cows shown to be infected with bovine leukosis virus (BLV) by the agar-gel immunodiffusion (AGID) technique. The 3 samples were mixed and the composite blood was used to inoculate 10 cows. Five of the cows were inoculated with 0.1 ml of blood, and the other cows were inocula...

  20. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction

    OpenAIRE

    Alexandrakis, G.; JALALI, S; Gloor, P

    1998-01-01

    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In o...

  1. Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

    Directory of Open Access Journals (Sweden)

    Andriani .

    2013-08-01

    Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

  2. Polimeraz Zincir Reaksiyonu (PCR) Optimizasyonu

    OpenAIRE

    KAHYA, Serpil; BUYUKCANGAZ, Esra; Carli, K. Tayfun

    2013-01-01

    Polymerase chain reaction (PCR), a deoxyribonucleic acid (DNA) that lies between two known chain enzymatically amplify a specific DNA region as an in vitro technique becoming common everyday. PCR method, used for many purposes such as diagnosis, epidemiology and studies to determine the amount of DNA, are still under development. Microbiology is taking a significant proportion in PCR usage, like innovations of application in other fields. Furthermore, PCR is the fundamental molecular method t...

  3. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis.

    Science.gov (United States)

    Chase, Dorothy M; Elliott, Diane G; Pascho, Ronald J

    2006-07-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids. PMID:16921877

  4. Influence of Pichia pastoris cellular material on polymerase chain reaction performance as a synthetic biology standard for genome monitoring.

    Science.gov (United States)

    Templar, Alexander; Woodhouse, Stefan; Keshavarz-Moore, Eli; Nesbeth, Darren N

    2016-08-01

    Advances in synthetic genomics are now well underway in yeasts due to the low cost of synthetic DNA. These new capabilities also bring greater need for quantitating the presence, loss and rearrangement of loci within synthetic yeast genomes. Methods for achieving this will ideally; i) be robust to industrial settings, ii) adhere to a global standard and iii) be sufficiently rapid to enable at-line monitoring during cell growth. The methylotrophic yeast Pichia pastoris (P. pastoris) is increasingly used for industrial production of biotherapeutic proteins so we sought to answer the following questions for this particular yeast species. Is time-consuming DNA purification necessary to obtain accurate end-point polymerase chain reaction (e-pPCR) and quantitative PCR (qPCR) data? Can the novel linear regression of efficiency qPCR method (LRE qPCR), which has properties desirable in a synthetic biology standard, match the accuracy of conventional qPCR? Does cell cultivation scale influence PCR performance? To answer these questions we performed e-pPCR and qPCR in the presence and absence of cellular material disrupted by a mild 30s sonication procedure. The e-pPCR limit of detection (LOD) for a genomic target locus was 50pg (4.91×10(3) copies) of purified genomic DNA (gDNA) but the presence of cellular material reduced this sensitivity sixfold to 300pg gDNA (2.95×10(4) copies). LRE qPCR matched the accuracy of a conventional standard curve qPCR method. The presence of material from bioreactor cultivation of up to OD600=80 did not significantly compromise the accuracy of LRE qPCR. We conclude that a simple and rapid cell disruption step is sufficient to render P. pastoris samples of up to OD600=80 amenable to analysis using LRE qPCR which we propose as a synthetic biology standard. PMID:27211507

  5. Detection of Neisseria Gonorrhoeae from Urine with Ligase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    曹经江; 郑和义; 胡维

    2003-01-01

    Objective: To evaluate the value of ligase chain reaction(LCR) in the diagnosis of diplococcus gonorrhoeae in urine.Methods: LCR detection of the urine for Neisseria gonorrhoeae and bacteria culture of discharge was per-formed simultaneously to 276 patients with urethritis or cervicitis seeking treatment in sex transmitted dis-eases (STDs) outpatient clinic. For specimens with discordant results, polymerase chain reaction was conducted. The purpose was to detect the respective sensitivity and specificity of bacteria culture and LCR. Results: 24 of 276(8.7%) patients had positive LCR results and 21 of 276(7.6%) were positive for culture.5 specimens had discordant results from LCR and bacteria culture. The sensitivity and specificity of LCR in the diagnosis of gonorrhoeae were 92.3% and 100% respectively. Conclusion: This study showed that LCR had a higher sensitivity and specificity for the diagnosis of gonorrhoeae from urine.

  6. The chain gas phase reactions. The present problems

    International Nuclear Information System (INIS)

    The results of investigations of chain gas phase reactions which are directed for solving practically important problems have been carried out. The problem of increasing methanol formation selectivity in the direct natural gas oxidation process is discussed. The peculiarities of cool flame of cyclic hydrocarbons, particularly cyclohexane which are containing in the different kinds of fuel. The influence of cool flame on intensity and full consumption of fuels burning is examined. Conjugated processes of SO2 conversion to SO3 and sulfur under effect of hydrocarbon and hydrogen oxidation chain gas phase reactions are considered. The results of discussed investigations can be served as a basis for the developing of industrial processes for conversion natural hydrocarbon row materials and also the ecological problems of utilization of SO2 gas ejected from thermoelectric power stations and metallurgical plants

  7. Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Cesare Bonacina

    2010-01-01

    Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

  8. Midtrimester fetal herpes simplex-2 diagnosis by serology, culture and quantitative polymerase chain reaction.

    Science.gov (United States)

    Curtin, William M; Menegus, Marilyn A; Patru, Maria-Magdalena; Peterson, C Jeanne; Metlay, Leon A; Mooney, Robert A; Stanwood, Nancy L; Scheible, Amy L; Dorgan, Angela

    2013-01-01

    The acquisition of herpes simplex virus (HSV) in utero comprises a minority of neonatal herpes infections. Prenatal diagnosis is rare. We describe a midtrimester diagnosis of fetal HSV-2 infection. Ultrasound at 20 weeks for elevated maternal serum α-fetoprotein (MSAFP) showed lagging fetal growth, echogenic bowel, echogenic myocardium, and liver with a mottled pattern of echogenicity. Amniocentesis demonstrated normal karyotype, elevated AFP and positive acetylcholinesterase. Culture isolated HSV-2 with an aberrant growth pattern. Maternal serology was positive for HSV-2. Quantitative DNA polymerase chain reaction (PCR) showed 59 million copies/ml. Fetal autopsy demonstrated widespread tissue necrosis but only sparse HSV-2 inclusions. Fetal HSV-2 infection can be suspected when an elevated MSAFP accompanies ultrasound findings suggesting perinatal infection. Maternal HSV serology, amniotic fluid culture and quantitative PCR are recommended for diagnostic certainty and counseling. PMID:23075531

  9. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Raghavendra Prasad Mishra

    2016-08-01

    Full Text Available Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR. Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health.

  10. The polymerase chain reaction and its application to clinical plastic surgery.

    LENUS (Irish Health Repository)

    Rea, S

    2012-02-03

    Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

  11. Two-temperature PCR for Microfluidics

    KAUST Repository

    Kodzius, Rimantas

    2010-05-01

    Since its invention in 1983, polymerase chain reaction (PCR) has been the method of choice for DNA amplification. Successful PCR depends on the optimization of several parameters, which is a cumbersome task due to the many variables (conditions and compon

  12. Reaction chain modeling of denitrification reactions during a push-pull test

    Science.gov (United States)

    Boisson, A.; de Anna, P.; Bour, O.; Le Borgne, T.; Labasque, T.; Aquilina, L.

    2013-05-01

    Field quantitative estimation of reaction kinetics is required to enhance our understanding of biogeochemical reactions in aquifers. We extended the analytical solution developed by Haggerty et al. (1998) to model an entire 1st order reaction chain and estimate the kinetic parameters for each reaction step of the denitrification process. We then assessed the ability of this reaction chain to model biogeochemical reactions by comparing it with experimental results from a push-pull test in a fractured crystalline aquifer (Ploemeur, French Brittany). Nitrates were used as the reactive tracer, since denitrification involves the sequential reduction of nitrates to nitrogen gas through a chain reaction (NO3- → NO2- → NO → N2O → N2) under anaerobic conditions. The kinetics of nitrate consumption and by-product formation (NO2-, N2O) during autotrophic denitrification were quantified by using a reactive tracer (NO3-) and a non-reactive tracer (Br-). The formation of reaction by-products (NO2-, N2O, N2) has not been previously considered using a reaction chain approach. Comparison of Br- and NO3- breakthrough curves showed that 10% of the injected NO3- molar mass was transformed during the 12 h experiment (2% into NO2-, 1% into N2O and the rest into N2 and NO). Similar results, but with slower kinetics, were obtained from laboratory experiments in reactors. The good agreement between the model and the field data shows that the complete denitrification process can be efficiently modeled as a sequence of first order reactions. The 1st order kinetics coefficients obtained through modeling were as follows: k1 = 0.023 h- 1, k2 = 0.59 h- 1, k3 = 16 h- 1, and k4 = 5.5 h- 1. A next step will be to assess the variability of field reactivity using the methodology developed for modeling push-pull tracer tests.

  13. Rapid detection of sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction.

    Science.gov (United States)

    Yoo, Mi-Sun; Thi, Kim Cuc Nguyen; Van Nguyen, Phu; Han, Sang-Hoon; Kwon, Soon-Hwan; Yoon, Byoung-Su

    2012-01-01

    A real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for the fast and highly sensitive detection of the sacbrood virus (SBV) genome and applied to honeybee samples. Using plasmid DNA containing a partial SBV genome and diluted serially, as few as 1×10(2)copies/μl (correlation co-efficiency >0.99) were detected by the qRT-PCR assay, whereas 1×10(3)copies/μl were detected by the conventional RT-PCR assay. As a rapid detection method, ultra-rapid real-time PCR (URRT-PCR) was carried out with a GenSpector TMC-1000 silicon-glass chip-based thermal cycler, which has a 6μl micro-chamber volume and a fast outstandingly heating/cooling rate. Using this method, 10(3)copies of pBX-SBV3.8 clone were detected within 17 min after 40 PCR cycles, including melting point analysis. To reduce the detection time for SBV, synthesis of the cDNA of the SBV genome from a honeybee sample was attempted for different reaction times and the cDNA was used as the template for URRT-PCR assays. The results indicated that a 5 min reaction time was sufficient to synthesize cDNA as the template for the SBV URRT-PCR assay. This study described a novel PCR-based method that is able to detect an RNA virus in environmental samples within 22 min, including reverse transcription, PCR detection and melting point analysis in real-time. PMID:22079620

  14. Detection of clonal B cells in microdissected reactive lymphoproliferations: possible diagnostic pitfalls in PCR analysis of immunoglobulin heavy chain gene rearrangement

    DEFF Research Database (Denmark)

    Zhou, X.G.; Sandvej, K.; Gregersen, Niels;

    1999-01-01

    Aims-To evaluate the specificity of standard and fluorescence based (GENESCAN) polymerase chain reaction (PCR) immunoglobulin heavy chain (IgH) gene rearrangement analysis in complete and microdissected paraffin wax embedded sections from lymphoid proliferations. Methods-PCR IgH gene rearrangement...... analysis of whole sections and microdissected fragments (n = 62) from paraffin wax embedded reactive lymph nodes (n = 6) and tonsils (n = 3). Amplificant analysis used both standard methods and automated high resolution fluorescence based quantification and size determination using GENESCAN software...... rearrangement analysis is a sensitive and specific method for demonstrating B cell clonality in whole paraffin wax embedded sections. However, oligoclonal and monoclonal rearrangement patterns are regularly encountered in small tissue fragments from otherwise unremarkable reactive lymphoproliferations, possibly...

  15. Radioinitiation of Chain Branched Reactions and its Sensitization

    International Nuclear Information System (INIS)

    This paper describes the results of experiments by the writers with radioinitiation of chain branched reactions of the oxidation of organic compounds. The function of radiation as an initiating agent is described with reference to the oxidation of several unsaturated hydrocarbons and butanol. The reaction is self-accelerating and proceeds spontaneously after radiation has ceased. A detailed investigation was made of a process from oxidizing benzene, which has a high radiation resistance. The writers devised a method of sensitizing the radioinitiation of the oxidation of radiation-resistant substances by chemically inert but non-radiation-resistant substances. The main quantitative features of the process for the radiooxidation of benzene are stated to be the accumulation of various reaction products, and the effect of temperature, pressure, power and radiation dosage on the process of such accumulation. Information was obtained about the mechanism of the process. The design of circulating equipment is described. (author)

  16. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples.

    Science.gov (United States)

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.

    1998-03-01

    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  17. DIFFERENTIATION OF PSEUDOCONDYLOMA OF VULVA AND CONDYLOMA ACUMINATA BY DOT BLOT HYBRIDIZATION AND POLYMERASE CHAIN REACTION

    Institute of Scientific and Technical Information of China (English)

    刘跃华; 王家璧; 司静懿

    1996-01-01

    This study differentiated pseudocondyloma of vulva from condyloma acunainata using dot blot hybridization and polymerase chain reaction (PCR). A total of 27 cases o{ pseudocondyloma of vulva and 65 cases of condyloma acuminata were selected for the sttldy. The genital lesions were examined clinically and were biopsled. Each biopsy v-as subjected to histological examination and HPV DNA analysis by dot blot hybridization and PCR. Dot blot analysis detected HPV DNA in 19(82.6%) out of 23 cases of condyloma acuminata and 2(25%) out of 8 cases pseudocondyloma of vulvae(P<0. 05). PCR detected HPV DNA in 51(92.7%) our of 55 cases of eondyloma acuminata, compared with none in 23 cases of pseudocondylorna(P<0. 001). HPV DNA was present in the majority of condyloma acuminata specimens, HPV 6 and 11 were the predominant types. Peudocondyloma is probably not associated with HPV. PCR was the most sensitive and useful techntque for HPV DNA detection.

  18. Analysis of hepcidin expression: In situ hybridization and quantitative polymerase chain reaction from paraffin sections

    Institute of Scientific and Technical Information of China (English)

    Yuhki Sakuraoka; Tokihiko Sawada; Takayuki Shiraki; Kyunghwa Park; Yuhichiro Sakurai; Naohisa Tomosugi; Keiichi Kubota

    2012-01-01

    AIM:TO establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC).METHODS:Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC.Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years.Quantitative PCR was performed.Immunohistochemistry and in situ hybridization for hepcidin were also performed.RESULTS:Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully.The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues.A method of in situ hybridization for hepcidin was established successfully,and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue.CONCLUSION:We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

  19. Evaluation of a rapid polymerase chain reaction based identification technique for Vibrio cholerae isolates.

    Science.gov (United States)

    le Roux, W J; Masoabi, D; de Wet, C M E; Venter, S N

    2004-01-01

    Rapid and accurate identification of waterborne pathogens, such as Vibrio cholerae, in drinking-water sources is important to enable effective resource management and public health protection. Phenotypic systems currently being used for the identification of Vibrio cholerae isolates are time-consuming and the need exists for the development of suitable molecular techniques that can offer both fast and reliable identification. During this study, isolates identified as Vibrio cholerae by means of two different biochemical test systems (API 20E and VITEK 32) were analysed with the polymerase chain reaction (PCR) to compare the reliability of the various identification systems. The selected PCR technique amplified a sequence within the outer membrane protein of Vibrio cholerae, a gene specific for V. cholerae. It was found that out of 243 isolates biochemically identified as V. cholerae with either the API or VITEK system, 21 isolates did not give a positive result with the PCR detection method. Sequencing the 16S rDNA of more than half of these isolates and comparison of the sequences with Internet databases indicated that most of the isolates belonged to the genus Aeromonas. The results indicated that the rapid PCR procedure was more accurate than the API or VITEK systems currently being used for the phenotypic identification of Vibrio cholerae isolates. PMID:15318514

  20. Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

    Directory of Open Access Journals (Sweden)

    Jobin Thomas

    2014-11-01

    Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

  1. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Xu Q

    2015-06-01

    Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

  2. Detection of Listeria monocytogenes in salmon using the Probelia polymerase chain reaction system.

    Science.gov (United States)

    Wan, Jason; King, Kerryn; Forsyth, Santina; Coventry, M John

    2003-03-01

    A validation was conducted on the performance of a commercially available polymerase chain reaction (PCR) kit (Probelia) in comparison with International Organization for Standardization (ISO) method 11290-1 (adopted as an Australian New Zealand Standard Method, AS/NZS 1766.2.16.1:1998) for the detection of Listeria monocytogenes in salmon samples. The validation was conducted following the guidelines of an Australian New Zealand Standard (Guide to Determining the Equivalence of Food Microbiology Test Methods, Part 1, Qualitative Tests, AS/NZS 4659.1:1999), which adopts an approach similar to that recommended by the Association of Analytical Communities Microbiology Method Validation Program for Performance Tested and Peer Verified Methods. The validation study involved the use of five cultures of L. monocytogenes, each challenged at a single level of inoculation into five different types of salmon samples. A total of 60 salmon samples (30 unchallenged and 30 challenged) were tested using both the PCR method and the ISO method. Results from this study indicated that the Probelia PCR method is equivalent to the ISO method. In addition, the detection sensitivity of the Probelia PCR system was determined as approximately 0.5 CFU per PCR assay (equivalent to 20 CFU/ml broth culture) for a pure culture of L. monocytogenes. The Probelia PCR method offers the advantage of detecting L. monocytogenes to genetic specificity within 48 to 50 h, whereas the ISO method requires 5 days for negative results with additional days for confirmed positive results by the use of other biochemical and cultural tests. PMID:12636297

  3. Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Jong Gyun Ahn

    2012-11-01

    Full Text Available &lt;B&gt;Purpose:&lt;/B&gt; Methods for quick and reliable detection of &lt;I&gt;Streptococcus pneumoniae&lt;/I&gt; are needed for the diagnosis of pneumococcal disease and vaccine studies. This study aimed to show that sequential multiplex polymerase chain reaction (PCR is more efficient than conventional culture in achieving &lt;I&gt;S. pneumoniae -positive&lt;/i&gt; results. &lt;B&gt;Methods:&lt;/B&gt; Nasopharyngeal (NP secretions were obtained from 842 pediatric patients admitted with lower respiratory infections at Severance Children’s Hospital in Korea between March 2009 and June 2010. For identification and serotype determination of pneumococci from the NP secretions, the secretions were evaluated via multiplex PCR technique with 35 serotype-specific primers arranged in 8 multiplex PCR sets and conventional bacteriological culture technique. &lt;B&gt;Results:&lt;/B&gt; Among the results for 793 samples that underwent both bacterial culture and PCR analysis for pneumococcal detection, 153 (19.3% results obtained by PCR and 81 (10.2% results obtained by conventional culture technique were positive for S. pneumoniae. The predominant serotypes observed, in order of decreasing frequency, were 19A (23%, 6A/B (16%, 19F (11%, 15B/C (5%, 15A (5%, and 11A (4%; further, 26% of the isolates were non-typeable. &lt;B&gt;Conclusion:&lt;/B&gt; As opposed to conventional bacteriological tests, PCR analysis can accurately and rapidly identify pneumococcal serotypes.

  4. Polymerase chain reaction targeting insertion sequence for the diagnosis of extrapulmonary tuberculosis

    Directory of Open Access Journals (Sweden)

    V Makeshkumar

    2014-01-01

    Full Text Available Background & objectives: Diagnosis of extrapulmonary tuberculosis (EPTB is difficult using conventional diagnostic methods. This study was conducted to evaluate the use of polymerase chain reaction (PCR in diagnosis of definitive and probable extrapulmonary tuberculosis patients, and to assess the performance of insertion sequence (IS 6110 based PCR assay as compared to conventional culture by Lowenstein-Jensen (LJ method for the diagnosis of EPTB. Methods: A total of 178 non repeated clinical specimens were collected from clinically suspected extrapulmonary tuberculosis patients. The specimens included 59 ascitic fluid, 54 pleural fluid, 25 cerebrospinal fluid (CSF, 12 fine needle aspiration (FNA, 8 urine, 7 pus, 6 synovial fluid, 2 skin tissue, one pericardial fluid, one liver abscess, one pancreatic cyst fluid, one omental biopsy and one semen sample. All these clinical samples were subjected to Ziehl-Neelsen staining (ZN for acid fast bacilli (AFB and culture on LJ medium. PCR was performed by targeting 123bp fragment of insertion sequence IS6110 of Mycobacterium tuberculosis (MTB. Results: Of the 178 specimens, 10 (5.61% were ZN smear positive for AFB, six (3.37% were L-J culture positive from 10 AFB smear positive cases and 48 (26.96% were PCR IS 6110 positive for M. tuberculosis. Interpretation & conclusions: PCR using IS6110 primer was able to pick up more EPTB patients compared to conventional L-J culture method for detection of M. tuberculosis. False positive PCR IS6110 in three CSF samples may be due to latent TB infection which was limitation in this study.

  5. Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda

    2014-12-01

    Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

  6. DETEKSI DAN SPESIASI PARASIT MALARIA SAMPEL MONITORING PENGOBATAN DIHYDROARTEMISININ-PIPERAQUINE DI KALIMANTAN DAN SULAWESI: MIKROSKOPIS VS POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Reni Herman

    2012-07-01

    Full Text Available In monitoring the treatment of malaria with Dihydroartemisinin-piperaquine (DHP, microscopic cross check and Polymerase Chain Reaction (PCR performed to validate the results of laboratory examinations in the field. This study used finger prick samples from subjects with a diagnosis of malaria in monitoring the treatment of malaria with DHP in Kalimantan and Sulawesi. Samples taken at day 0, blood smears made on slides for microscopic and blood spot on filter paper for PCR examination. The PCR method used is a single-round multiplex polymerase chain reaction that has been modified, the examination of each species carried out in different tubes to distinguish the species P. falciparum or P. Vivax. Target of DNA amplification is a species-specific gene sequences in the small-subunit ribosomal RNA (SSUrRNA, 300 bp for P. falciparum and 276 bp for P.vivax.  P. falciparum and P.vivax identified in 229 samples of blood smears and blood spots. Microscopic and PCR gave the same results, positive 93.4% and negative 6.6% with a sensitivity of  99% and specificity 93.3%. P.falciparum sensitivity and specificity of 92% and 99%, P.vivax 97% and 94%, PCR as a gold standard. There are differences in the results of examination of 5 samples, ie with microscopic examination identified as P.vivax  while the PCR as P. falciparum. In this study, identification of  the microscopic parasite similar to the results of identification by PCR, but differ in determining the types of parasites. In general, the ability to microscopic diagnosis of malaria is very good, but confirmation by PCR is still needed.AbstrakPada monitoring pengobatan malaria  dengan Dihydroartemisinin-piperaquine (DHP,cek silang mikroskopis dan Polymerase Chain Reaction (PCR dilakukan untuk memvalidasi hasil pemeriksaan di laboratorium lapangan. Penelitian ini menggunakan sediaan darah jari dari subyek dengan diagnosis malaria pada monitoring pengobatan malaria dengan DHP di Kalimantan dan Sulawesi

  7. Implosion chain reaction mitigation in underwater assemblies of photomultiplier tubes

    International Nuclear Information System (INIS)

    Since the accident with a cascade failure of photomultiplier tubes (PMTs) in the Super-Kamiokande experiment in 2001, the mechanical performance of large format semi-hemispherical PMTs has become a critical issue for large water Cherenkov detectors. The subject of this study is the survival of an assembled array of PMTs under significant hydrostatic pressure and subjected to shock waves caused by the failure of a single PMT. This paper details the results of the second stage of a R and D program focused on the design and testing of different PMT assemblies to mitigate the risk of a “chain-reaction” of PMT failures. The initial results show that our PMT assembly design can effectively reduce the magnitude of the shock wave. With the testing results in this paper and the hydrodynamic simulation calculation, we can further improve the design of PMT deployment to mitigate the risk of chain reactions caused by implosion induced shock waves

  8. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    Science.gov (United States)

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products. PMID:16792069

  9. Detection of African swine fever virus from formalin fixed and non-fixed tissues by polymerase chain reaction

    OpenAIRE

    P. D. Luka; A. R. Jambol; B. Yakubu

    2014-01-01

    Aim: Formalin fixing and paraffin embedding of tissue samples is one of the techniques for preserving the structural integrity of cells for a very long time. However, extraction and analysis of genomic material from formalin fixed tissue (FFT) remains a challenge despite numerous attempts to develop a more effective method. The success of polymerase chain reaction (PCR) depends on the quality of DNA extract. Materials and Methods: Here we assessed the conventional method of DNA extraction ...

  10. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

    Directory of Open Access Journals (Sweden)

    Kosuke Nakamura

    2016-06-01

    Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  11. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    OpenAIRE

    T. M. Nabeel Muhammad; Sreedevi, B.

    2015-01-01

    Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR) was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasa...

  12. Knockout confirmation for Hurries: rapid genotype identification of Trypanosoma cruzi transfectants by polymerase chain reaction directly from liquid culture

    OpenAIRE

    2014-01-01

    Gene knockout is a widely used approach to evaluate loss-of-function phenotypes and it can be facilitated by the incorporation of a DNA cassette having a drug-selectable marker. Confirmation of the correct knockout cassette insertion is an important step in gene removal validation and has generally been performed by polymerase chain reaction (PCR) assays following a time-consuming DNA extraction step. Here, we show a rapid procedure for the identification of Trypanosoma cruzi transfectants by...

  13. Viral etiology of respiratory infections in children in southwestern Saudi Arabia using multiplex reverse-transcriptase polymerase chain reaction

    OpenAIRE

    Al-Ayed, Mohamed S.; Asaad, Ahmed M; Qureshi, Mohamed A.; Ameen, Mohammed S.

    2014-01-01

    Objectives: To investigate 15 respiratory viruses in children with acute respiratory tract infections (ARTIs) using multiplex reverse-transcriptase polymerase chain reaction (RT-PCR), and to analyze the clinical and epidemiological features of these viruses. Methods: In a cross-sectional study, 135 children, ≤5 years of age who presented with ARTIs in Najran Maternity and Children Hospital, Najran, Saudi Arabia between October 2012 and July 2013 were included. The clinical and sociodemographi...

  14. Rapid Detection/pathotyping of Newcastle disease virus isolates in clinical samples using real time polymerase chain reaction assay

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Abdul Wajid, Muhammad Wasim, Tahir Yaqub, Shafqat F Rehmani, Tasra Bibi, Nadia Mukhtar, Javed Muhammad, Umar Bacha, Suliman Qadir Afridi, Muhammad Nauman Zahid, Zia u ddin, Muhammad Zubair Shabbir, Kamran Abbas & Muneer Ahmad ### Abstract In the present protocol we describe the real time reverse transcription polymerase chain reaction (rRT-PCR) assay for the rapid detection/pathotyping of Newcastle disease virus (NDV) isoaltes in clinical samples. Fusion gene and matrix ...

  15. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    OpenAIRE

    Camila Ximenes; Eduardo Brandão; Paula Oliveira; Abraham Rocha; Tamisa Rego; Rafael Medeiros; Ana Aguiar-Santos; João Ferraz; Christian Reis; Paulo Araujo; Luiz Carvalho; Melo, Fabio L

    2014-01-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuche...

  16. Diagnosis of human trypanosomiasis, due to Trypanosoma brucei gambiense in central Africa, by the polymerase chain reaction

    OpenAIRE

    Penchenier, Laurent; Simo, G.; Grébaut, Pascal; Nkinin, S.; Laveissière, Claude; Herder, Stéphane

    2000-01-01

    During a mass screening of sleeping sickness conducted in 1998 and 1999, and involving 27,932 persons in Cameroon and the Central African Republic, we tested the polymerase chain reaction (PCR) on whole blood for the diagnosis of human African trypanosomiasis due to #Trypanosoma brucei gambiense$. The 1858 samples obtained were from 4 groups : 155 infected patients, 1432 serological suspects detected by the card agglutination test for trypanosomiasis (CATT), 222 negative controls living in th...

  17. Rapid, simple method for treating clinical specimens containing Mycobacterium tuberculosis to remove DNA for polymerase chain reaction.

    OpenAIRE

    Buck, G E; O'Hara, L C; Summersgill, J T

    1992-01-01

    Several simplified methods for treating mycobacteria to release DNA for amplification by the polymerase chain reaction (PCR) were investigated. The most effective of the methods was sonication. Samples were placed in screw-capped microcentrifuge tubes that were then placed in a plastic rack. The rack was floated in a dish of water next to the ultrasonic probe so that the ultrasonic energy was transmitted through the walls of the tubes. This allowed multiple samples to be processed safely and ...

  18. Value of Candida polymerase chain reaction and vaginal cytokine analysis for the differential diagnosis of women with recurrent vulvovaginitis.

    OpenAIRE

    Stephanie Weissenbacher; Witkin, Steven S.; Vera Tolbert; Paulo Giraldo; Iara Linhares; Andrea Haas; E. Rainer Weissenbacher; Ledger, William J.

    2000-01-01

    Objectives: Recurrent vulvovaginitis remains difficult to diagnose accurately and to treat. The present investigation evaluated the utility of testing vaginal specimens from women with symptomatic recurrent vulvovaginitis for Candida species by polymerase chain reaction (PCR) and for cytokine responses.Methods: Sixty-one consecutive symptomatic women with pruritus, erythema, and/or a thick white discharge and a history of recurrent vulvovaginitis and 31 asymptomatic women with no such history...

  19. Isolation and Identification of Mycoplasma synoviae From Suspected Ostriches by Polymerase Chain Reaction, in Kerman Province, Iran

    OpenAIRE

    Tebyanian, Hamid; Mirhosseiny, Seyed Hanif; Kheirkhah, Babak; Hassanshahian, Mehdi; farhadian, Hamze

    2014-01-01

    Background: Mycoplasma synoviae is an important avian pathogen which can cause both respiratory disease and synovial joint inflammation (synovitis) in poultry. Mycoplasmas spp. may cause the respiratory system infection in ostriches with symptoms such as inflammation of the nose, trachea and also damages of lungs. Objectives: The current study aimed to use the M. synoviae specific Polymerase Chain Reaction (PCR) and microbiological methods in order to isolate and identify M. synoviae from sus...

  20. Detection of colonic cells in peripheral blood of colorectal cancer patients by means of reverse transcriptase and polymerase chain reaction.

    OpenAIRE

    Castells, A.; Boix, L.; Bessa, X; Gargallo, L.; Piqué, J M

    1998-01-01

    Circulating tumour cells play a central role in the metastatic process, but little is known about the relationship between this cellular subpopulation and the development of secondary disease. This study was aimed at assessing the presence of colonic cells in peripheral blood of patients with colorectal cancer in different evolutionary stages, by means of reverse transcriptase polymerase chain reaction (RT-PCR) targeted to carcinoembryonic antigen (CEA) mRNA. In vitro sensitivity was establis...

  1. Use of the Polymerase Chain Reaction to Detect Helicobacter pylori in the Dental Plaque of Healthy and Symptomatic Individuals

    OpenAIRE

    Banatvala, N.; Lopez, C. Romero; Owen, R J; Hurtado, A; Abdi, Y; Davies, G. R.; Hardie, J. M.; Feldman, R A

    2011-01-01

    A polymerase chain reaction (PCR) assay, based on the amplification of a species specific ureA (urease) gene internal sequence, was used to detect Helicobacter pylori. Total DNA extracts were obtained from dental plaque in patients attending an endoscopy clinic and from apparently healthy schoolchildren of Bangladeshi origin. Of the 54 samples of dental plaque from endoscopy patients examined, 39 were positive (72 per cent). There was 63 per cent correlation (34/54) between H. pylori in the s...

  2. Fite-Faraco staining in combination with multiplex polymerase chain reaction: A new approach to leprosy diagnosis

    OpenAIRE

    Abu Hena Hasanoor Reja; Nibir Biswas; Supratik Biswas; Sarbani Dasgupta; Imran Hussain Chowdhury; Surajita Banerjee; Tapas Chakraborty; Pijush Kumar Dutta; Basudev Bhattacharya

    2013-01-01

    Background: Leprosy is not always an easy disease to diagnose, and patients can remain undiagnosed for longtime, not only at the peripheral clinics but also even at places with higher medical facilities, so, there is an urgent need for rapid and definitive modalities for leprosy diagnosis. This prospective study evaluates the ability of Fite-Faraco staining (FF staining) and multiplex polymerase chain reaction (PCR) over hematoxylin and eosin staining (H and E staining) and Ziehl-Neelsen stai...

  3. A chain reaction approach to modelling gene pathways.

    Science.gov (United States)

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By

  4. Detection of DNA from Leishmania (Viannia: accuracy of polymerase chain reaction for the diagnosis of cutaneous leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Herintha Coeto Neitzke-Abreu

    Full Text Available Cutaneous leishmaniasis (CL can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L and blood sample-enriched leukocytes (PCR-B with three conventional diagnostic techniques: parasite direct search (DS, Montenegro skin test (MST, and indirect immunofluorescence reaction (IIF. The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia (minicircle kDNA fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species.

  5. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    Science.gov (United States)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  6. Online exercise for the design and simulation of PCR and PCR-RFLP experiments

    OpenAIRE

    San Millán Gutiérrez, Rosario María; Martínez Ballesteros, Ilargi; Rementeria Ruiz, Aitor Domingo; Garaizar Candina, Javier; Bikandi Bikandi, Joseba

    2013-01-01

    [EN] Background: Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism of PCR products (PCR-RFLP) are extensively used molecular biology techniques. An exercise for the design and simulation of PCR and PCR-RFLP experiments will be a useful educational tool. Findings: An online PCR and PCR-RFLP exercise has been create that requires users to find the target genes,compare them, design primers, search for restriction endonucleases, and finally to simulate the experiment...

  7. PCR thermocycler

    Science.gov (United States)

    Benett, William J.; Richards, James B.

    2003-01-01

    A sleeve-type silicon polymerase chain reaction (PCR) chamber or thermocycler having improved thermal performance. The silicon sleeve reaction chamber is improved in thermal performance by etched features therein that reduce thermal mass and increase the surface area of the sleeve for cooling. This improved thermal performance of the thermocycler enables an increase in speed and efficiency of the reaction chamber. The improvement is accomplished by providing grooves in the faces of the sleeve and a series of grooves on the interior surfaces that connect with grooves on the faces of the sleeve. The grooves can be anisotropically etched in the silicon sleeve simultaneously with formation of the chamber.

  8. DETECTION OF PHENOL DEGRADING BACTERIA AND PSEUDOMONAS PUTIDA IN ACTIVATED SLUDGE BY POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    H. Movahedyan ، H. Khorsandi ، R. Salehi ، M. Nikaeen

    2009-04-01

    Full Text Available Phenol is one of the organic pollutants in various industrial wastewaters especially petrochemical and oil refining. Biological treatment is one of the considerable choices for removing of phenol present in these wastewaters. Identification of effective microbial species is considered as one of the important priorities for production of the biomass in order to achieve desirable kinetic of biological reactions. Basic purpose of this research is identification of phenol-degrading Pseudomonas Putida in activated sludge by polymerase chain reaction (PCR that has high speed and specificity. In this research, 10 various colonies of phenol-degrading bacteria were isolated from municipal activated sludge and the rate of phenol removal and growth rate of these bacteria were assessed in different concentrations of phenol (200 – 900 mg/L. Confirmation of the largest subunit of multicomponent phenol hydroxylase (LmPH gene and gene coding the N fragment in Pseudomonas Putida-derived methyl phenol operon (DmpN gene through PCR were used for general identification of phenol-degrading bacteria and Pseudomonas Putida, respectively. Presence of a 600 bp (base pairs bond in all of isolated strains indicated that they contain phenol hydroxylase gene. 6 of 10 isolated bacteria were Pseudomonas Putida because they produced a 199 bp PCR product by DmpN primers. According to PCR results in this study, the best phenol-degrading bacteria that can utilize 500 – 600 mg/L phenol completely after 48 hours incubation, belong to Pseudomonas Putida strains. It is clear that use of isolated bacteria can lead to considerable decrease of treatment time as well as promotion of phenol removal rate.

  9. Development and application of reverse transcriptase nested polymerase chain reaction test for the detection of exogenous avian leukosis virus.

    Science.gov (United States)

    García, Maricarmen; El-Attrache, John; Riblet, Sylva M; Lunge, Vagner R; Fonseca, André S K; Villegas, Pedro; Ikuta, Nilo

    2003-01-01

    A polymerase chain reaction (PCR) assay that utilizes nested primers to amplify a fragment of the long terminal repeat of exogenous avian leukosis virus (ALV) was developed and evaluated for detection of ALV subgroup J directly from clinical samples. Compilation of sequence data from different endogenous and exogenous ALVs allowed the selection of a conserved set of nested primers specific for the amplification of exogenous ALV subgroups A, B, C, D, and J and excluded amplification of endogenous viruses or endogenous viral sequences within the chicken genome. The nested primers were successfully used in both PCR and reverse transcriptase (RT)-PCR assays to detect genetically diverse ALV-J field isolates. Detection limits of ALV-J isolate ADOL-Hc1 DNA by nested PCR and RNA by RT-nested PCR were superior to detection of group-specific antigen by enzyme-linked immunosorbent assay (ELISA) in cell culture. Detection of ALV-J in cloacal swabs by RT-nested PCR was compared with direct detection by antigen-capture (ac)-ELISA; RT-nested PCR detected fewer positive samples than ac-ELISA, suggesting that RT-nested PCR excluded detection of endogenous virus in clinical samples. Detection of ALV-J in plasma samples by RT-nested PCR was compared with virus isolation in C/E chicken embryo fibroblasts; the level of agreement between both assays as applied to plasma samples ranged from low to moderate. The main disagreement between both assays was observed for a group of plasma samples found positive by RT-nested PCR and negative by virus isolation, suggesting that RT-nested PCR detected ALV-J genome in plasma samples of transiently or intermittently infected birds. ALV-J transient and intermittent infection profiles are characterized by inconsistent virus isolation responses throughout the life of a naturally infected flock. PMID:12713157

  10. Relevance of semen polymerase chain reaction positive for tuberculosis in asymptomatic men undergoing infertility evaluation

    Directory of Open Access Journals (Sweden)

    Subodh Kumar Regmi

    2015-01-01

    Full Text Available OBJECTIVE: Male partners of infertile women with genital tuberculosis (TB are often screened for genital TB. We aimed to evaluate the clinical significance of a positive screening semen polymerase chain reaction (PCR for Mycobacterium tuberculosis test (TB-PCR in asymptomatic men undergoing infertility evaluation and determine the need for a detailed investigation and treatment for TB. MATERIALS AND METHODS: Between March 2012 and January 2013, male partners of 15 infertile women with a diagnosis of genitourinary TB (GUTB as the cause of infertility, tested positive either on semen PCR for TB (13 cases, or Mycobacterium Growth Indicator Tube-960 test (2 cases. These asymptomatic men underwent infertility evaluation along with evaluation for GUTB. Diagnosis of GUTB was based on standard clinical criteria, which included a high index of suspicion along with clinical, laboratory, and/or radiological evidence of GUTB. Men who had no clinical evidence of GUTB were followed up with clinical evaluation, semen analysis, and repeat semen PCR for TB after 6 months. RESULTS: Fourteen subjects consented for inclusion in the study. One had a history of pulmonary TB 20 years earlier. Another patient was found to have mediastinal lymphadenopathy (tubercular. All except one had a normal semen analysis. None of the patients met the standard clinical criteria for GUTB diagnosis. 8 patients followed up at 6 months with repeat semen analysis, which was similar to the baseline values and no clinical evidence of TB. INTERPRETATION AND CONCLUSIONS: Asymptomatic men with positive screening semen PCR for TB do not have clinical evidence of TB. Male partners of women with infertility and GUTB should not be screened if they have no symptoms.

  11. Use of polymerase chain reaction in the diagnosis of Whipple's disease.

    Science.gov (United States)

    Kono, Masanori; Yamamoto, Kei; Nagamatsu, Maki; Kutsuna, Satoshi

    2015-12-01

    Whipple's disease, a systemic, chronic infectious disease caused by Tropheryma whipplei, is extremely rare in Asian populations. A correct diagnosis is necessary due to its high mortality rate. Unfortunately, patients are apt to be misdiagnosed with connective tissue diseases since they typically present with arthritis or arthralgia. There are three diagnostic tools for Whipple's disease using intestinal tissues: 1) periodic acid-Schiff (PAS)-positive macrophages; 2) electron microscopic observation; and 3) polymerase chain reaction (PCR). It is challenging to diagnose this disease in the absence of histological findings, especially in Japan, where the clinical protocol currently used to make the diagnosis needs improvement, although symptomology and PCR results may be sufficient. Herein, we investigated a 24-year-old Japanese woman who had suffered from intermittent fever, migratory arthralgia, and watery diarrhea for several months. Her biopsied intestinal tissue was negative for foamy macrophages and PAS-positive cells, and electron microscopy did not provide diagnostic insight. PCR amplification of the specimens, however, successfully revealed T. whipplei. Whipple's disease was diagnosed based on a positive PCR result and strong clinical suspicion. The patient was treated parenterally with ceftriaxone (2 g daily) for two weeks, followed by oral treatment with 160 mg trimethoprim and 800 mg sulfamethoxazole twice per day. After one month of treatment, her symptoms disappeared and inflammatory markers returned to normal levels. This case illustrates the practicality and effectiveness of a PCR-based diagnostic test in combination with clinical suspicion to correctly diagnose Whipple's disease, especially in cases when a histological examination does not provide insight. PMID:26390825

  12. Application of the polymerase chain reaction and molecular probe technology for the diagnosis of tuberculosis

    International Nuclear Information System (INIS)

    Conventional methods for the diagnosis of tubercolosis based on microscopic examination and in vitro culture is both time consuming and tedious. Molecular methods of diagnosis have been suggested as an alternative which may provide the clinical laboratory with a means for rapid diagnosis. The present study was carried out to determined the feasibility of this approach for the detection of mycobacteria. Clinical specimens received from patients with suspected diagnosis of tuberculous infection were used. All specimens were examined microscopically and those that were smear positive were cultured. An aliquot of each specimen were kept for analysis by in vitro amplification using the polymerase chain reaction (PCR). The primers used for PCR were 20-mers specific for the insertion element IS986, which is restricted to the M. tuberculosis complex group. All specimens were analysed in quintriplicate, with 2 samples unspiked and 3 sampled spiked with M. tuberculosis. Appropriate positive and negative controls were included in all essays. Following amplification, the specimens were analysed by agarose gel electrophoresis (AGE). All specimens were further subject to hybridization studies using a specific radiolabelled probe. The sensitivity of the amplification assay coupled with visualization of the amplified targets using eithidium bromide staining was found to be about 1 fg of DNA. A total of 40 smear positive specimens were analyzed, 29 of which were culture positive. Twenty-eight of the 29 culture positive specimens tested positive by PCR/hybridization analysis. Of the 11 culture negative specimens, 9 were positive by PCR. Overall 37/40 (92.5%) specimens were positive by PCR/hybridization analysis. (author). 13 refs, 1 tab

  13. Enhancing the specificity and efficiency of polymerase chain reaction using polyethyleneimine-based derivatives and hybrid nanocomposites

    Directory of Open Access Journals (Sweden)

    Tong W

    2012-02-01

    Full Text Available Weiwei Tong1,2, Xueyan Cao2, Shihui Wen2, Rui Guo2, Mingwu Shen2, Jianhua Wang3, Xiangyang Shi1,2,41State Key Laboratory for Modification of Chemical Fibers and Polymer Materials, Donghua University, Shanghai, 2College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai, 3Department of Biochemistry and Molecular Cell Biology, School of Medicine, Shanghai Jiao Tong University, Shanghai, People's Republic of China; 4Centro de Química da Madeira, Universidade da Madeira, Funchal, PortugalAbstract: There is a general necessity to improve the specificity and efficiency of the polymerase chain reaction (PCR, and exploring the PCR-enhancing mechanism still remains a great challenge. In this paper we report the use of branched polyethyleneimine (PEI-based derivatives and hybrid nanocomposites as a novel class of enhancers to improve the specificity and efficiency of a nonspecific PCR system. We show that the surface-charge polarity of PEI and PEI derivatives plays a major role in their effectiveness to enhance the PCR. Positively charged amine-terminated pristine PEI, partially (50% acetylated PEI (PEI-Ac50, and completely acetylated PEI (PEI-Ac are able to improve PCR efficiency and specificity with an optimum concentration order of PEI < PEI-Ac50 < PEI-Ac, whereas negatively charged carboxyl-terminated PEI (PEI-SAH; SAH denotes succinamic acid groups and neutralized PEI modified with both polyethylene glycol (PEG and acetyl (Ac groups (PEI-PEG-Ac are unable to improve PCR specificity and efficiency even at concentrations three orders of magnitude higher than that of PEI. Our data clearly suggests that the PCR-enhancing effect is primarily based on the interaction between the PCR components and the PEI derivatives, where electrostatic interaction plays a major role in concentrating the PCR components locally on the backbones of the branched PEI. In addition, multiwalled carbon nanotubes modified with PEI and PEI

  14. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    Science.gov (United States)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  15. Polymerase chain reaction amplification of a GC rich region by adding 1,2 propanediol

    Directory of Open Access Journals (Sweden)

    Zeinab Mousavian

    2014-01-01

    Full Text Available Background : Apolipoprotein E (ApoE is one of the most important carriers of lipids in mammalians. The gene for this lipoprotein (ApoE is located on chromosome 19 which is related with the pathogenesis of some nervous system disease. ApoE gene is identified as a high guanine-cytosine (GC content fragment. Detection and amplification of these templates are extensively laborious and baffling. The aim of this study was to find a practical and feasible method for the amplification of the number of GC rich genes such as ApoE. Materials and Methods: We experimented with simple polymerase chain reaction (PCR, nested PCR and PCR with 1-2 propanediol, dimethylsulfoxide (DMSO, and ethyleneglicol as additive substances to enhance the amplification ApoE gene and used the 40 samples of the human whole blood were collected in test tubes with a pre-treatment of ethylene diaminetetraacetic acid. Results: According to our observations, presence of 1-2 propanediol, DMSO, and ethyleneglicol as additive substances resulted to enhanced amplification of ApoE gene. Addition of 1-2 propanediol showed the best results, caused optimization and revealed more specific and sharp bands. Conclusion: According to our findings 1-2 propanediol are the best organic reagent for improving the amplification of ApoE gene. Optimization procedure for each GC rich sequence is recommended to be performed separately in order to identify which of the additive agent is more efficient and applicable for a particular target.

  16. The utility of the polymerase chain reaction assay for aetiologic definition of unspecified bacterial meningitis cases

    Directory of Open Access Journals (Sweden)

    Mari Tuyama

    2008-03-01

    Full Text Available Most patients with acute suppurative meningitis are otherwise healthy individuals with regard to immune mechanisms against invasive bacterial disease. This medical emergency is among the most dramatic and potentially ravaging diseases that affect humans, particularly young children. The illness often strikes suddenly, and can either result in death or leave the survivors with significant neurological dysfunctions. The demonstration of a bacterial aetiology is necessary for decisions regarding treatment and prophylaxis. Conventional bacteriological methods frequently fail to identify an agent, as a result of administration of antibiotics or delayed lumbar punctures. We investigated the major aetiologic sources of unspecified bacterial meningitis cases (G00.9, ISCD-10 by polymerase chain reaction (PCR-based identification of Neisseria meningitidis (crgA, Streptococcus pneumoniae (ply and Haemophilus influenzae (bexA in cerebrospinal fluid samples. The multiplex PCR detected N. meningitidis in 92%, S. pneumoniae in 4% and H. influenzae in 1% of the 192 clinical samples assayed; 3% were negative for all three DNA targets. Bacterial DNA detection was found to be a valuable adjunct to enhance bacterial meningitis surveillance when the yield of specimens by culture is reduced. The implementation of PCR assays as a diagnostic procedure in Public Health Laboratories is perceived to be a significant advance in the investigation of bacterial meningitis.

  17. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    Science.gov (United States)

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. PMID:25827436

  18. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

    International Nuclear Information System (INIS)

    Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  19. Differentiation of Helicobacter pylori isolates by polymerase chain reaction-restriction fragment length polymorphism

    Institute of Scientific and Technical Information of China (English)

    SHI Li; SUN Yong; ZHANG Ya-li; ZHANG Zhen-shu; ZHOU Dian-yuan

    2002-01-01

    Objective: To investigate the association between the diversity of urease gene and urease activity of clinical isolates of Helicobacter pylori (H. pylori). Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) of urease gene and rapid urease activity test were used to study the urease activity of different clinical isolates of H. pylori. Results: H. pylori clinical isolates were divided into 4types according to their PCR-RFLP results of urease gene and urease activity. Type I , possessing strong urease activity (0. 11) and presented 1 fragment of 1.7 kb by PCR-RFLP, had close relations with gastric ulcer; type Ⅱ , with the weakest urease activity (0. 07) and 2 fragments (1.3 and 0. 4 kb respectively), was associated with duodenal bulb ulcer; type Ⅱ , with the strongest urease activity (0. 12) and 2 fragments (0. 4and 0. 17 kb) with or without 1 fragment (0. 23 or 0. 37 kb) , was responsible for gastritis; type Ⅳ, with weak urease activity (0. 09) and 2 fragments (1.5 and 0. 2 kb), was shown to be related to both gastric and duodenal bulb ulcers. Conclusion: The diversity of urease gene decides different urease activities of different clinical isolates of H. pylori, hence the different possibilities of pathogenesis due to this bacteria.

  20. Real Time PCR: Principles and Application

    OpenAIRE

    Safie Amini; Seyed-Moayed Alavian; Malek Hossein Ahmadipour

    2005-01-01

    The polymerase chain reaction (PCR) has been used as the new golden standard for detecting a wide variety of templates across a range of scientific specialties and also as an essential tool in research laboratories. PCR has completely revolutionized the detection of RNA and DNA viruses(1). Real Time vs. Traditional PCRReal time chemistry allows the detection of PCR amplification during the early phase of the reaction. Measuring the kinetic of the reaction in the early phase of PCR provides a ...

  1. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

    Science.gov (United States)

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-01-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  2. Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

    International Nuclear Information System (INIS)

    Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

  3. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes

    2014-12-01

    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  4. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization. PMID:19446978

  5. Detection and Enumeration of Streptococcus agalactiae from Bovine Milk Samples by Real-Time Polymerase Chain Reaction.

    Science.gov (United States)

    de Carvalho, Nara Ladeira; Gonçalves, Juliano Leonel; Botaro, Bruno Garcia; Silva, Luis Felipe de Prada E; dos Santos, Marcos Veiga

    2015-09-01

    The aim of this study was to evaluate the use of real-time polymerase chain reaction (qPCR) combined with DNA extraction directly from composite milk and bulk tank samples for detection and enumeration of Streptococcus agalactiae (SAG) causing subclinical mastitis. Dilutions of sterile reconstituted skim milk inoculated with SAG ATCC 13813 were used to establish a standard curve (cfu/mL) for the qPCR assay targeting SAG. The analytical sensitivity and repeatability of the qPCR assay were determined. Bulk tank (BTM; n = 38) and composite milk samples (CM; n = 26) collected from lactating cows with positive isolation of SAG were submitted to the qPCR protocol and SAG plate counting, with results from both methods compared. Amplification of DNA was not possible in two out of 64 samples, indicating that qPCR was able to detect SAG in 96 and 97% of BTM and CM samples, respectively. The inter-assay coefficient of variation was <5%, showing that the technique had adequate repeatability. The qPCR protocol can be a high-throughput and rapid diagnostic assay to accurately detect SAG from BTM and CM samples compared with conventional microbiological culture method. However, the evaluated qPCR protocol is not accurate for enumerating SAG in milk samples, probably due to quantification of DNA of non-viable cells. PMID:26134534

  6. Chlamydia trachomatis-specific antibodies in patients with pelvic inflammatory disease: comparison with isolation in tissue culture or detection with polymerase chain reaction.

    OpenAIRE

    Theunissen, J J; Minderhoud-Bassie, W; Wagenvoort, J H; Stolz, E; Michel, M F; Huikeshoven, F.J.

    1994-01-01

    OBJECTIVE--The detection of acute phase antibodies against C trachomatis and its comparison with tissue culture or polymerase chain reaction (PCR) on samples of cervix and urethra obtained from patients with pelvic inflammatory disease (PID). METHODS--In the academic hospital Dijkzigt, Rotterdam, The Netherlands, prospective investigations were performed on 49 consecutive patients who were admitted with the diagnosis of PID. Infections with C trachomatis were traced using tissue culture, PCR ...

  7. Chlamydia trachomatis infection in a high-risk population: comparison of polymerase chain reaction and cell culture for diagnosis and follow-up.

    OpenAIRE

    Vogels, W H; van Voorst Vader, P C; Schröder, F P

    1993-01-01

    A study to compare the polymerase chain reaction (PCR) test with the cell culture method in diagnosing urogenital Chlamydia trachomatis infections was performed. From 497 patients (212 women, 285 men) attending an outpatient clinic for sexually transmitted diseases, a total of 814 samples (female patients, cervix and urethra; male patients, urethra) were collected. This total included follow-up samples from 35 women and 35 men positive for C. trachomatis by cell culture and/or PCR test, which...

  8. [The development of a test-system for the quantitative and qualitative evaluation of DNA content in criminalistic objects by the real-time polymerase chain reaction].

    Science.gov (United States)

    Lapenkov, M I; Plakhina, N V; Alekseev, Ia I; Varlamov, D A

    2011-01-01

    An original test-system for the preliminary quantitative and qualitative evaluation of isolated DNA is proposed by the polymerase chain reaction in real time (PCR-RT) based on the TaqMan technology. This test-system permits to simultaneously measure the amount of DNA in the sample, identify the genetic gender, and detect PCR inhibitors. The method has been approbated in the practical work of forensic medical experts. PMID:21735715

  9. Use of urine polymerase chain reaction to define the prevalence and clinical presentation of Trichomonas vaginalis in men attending an STD clinic

    OpenAIRE

    Wendel, K; Erbelding, E; Gaydos, C.; Rompalo, A.

    2003-01-01

    Methods: Men attending a public STD clinic in Baltimore, Maryland, were evaluated between March and July 2000. Clinicians recorded a standardised history and clinical examination. Urethral swab specimens were collected for Gram stain and Neisseria gonorrhoeae culture. First fraction urine samples were evaluated with TV culture and chlamydia and TV polymerase chain reaction (PCR). True positive TV was defined as a positive TV culture or a positive TV PCR confirmed with a second primer set.

  10. Application of real time polymerase chain reaction targeting kex 1 gene & its comparison with the conventional methods for rapid detection of Pneumocystis jirovecii in clinical specimens

    OpenAIRE

    Mani Revathy; Kulandai Lily Therese; Radhakishnan Bagyalakshmi; Chokaliingam Chandrasekar; Suria Kumar; Madhavan, Hajib N.

    2014-01-01

    Background & objectives: As there are no standard laboratory techniques for the rapid detection of Pneumocystis jirovecii in India, this study was undertaken to evaluate and establish an optimal and rapid technique for the detection of P. jirovecii by comparing three different techniques - staining technique, application of a real time polymerase chain reaction (RT-PCR) targeting kex 1 gene and application of nested PCR targeting mitochondrial large subunit (mtLSU) gene for rapid detection of...

  11. Detection of varicella-zoster virus DNA by polymerase chain reaction in the cerebrospinal fluid of patients suffering from neurological complications associated with chicken pox or herpes zoster.

    OpenAIRE

    Puchhammer-Stöckl, E; Popow-Kraupp, T; Heinz, F X; Mandl, C W; Kunz, C.

    1991-01-01

    The polymerase chain reaction (PCR) was used to detect varicella-zoster virus (VZV) DNA in the cerebrospinal fluid of patients with VZV infection associated with neurological symptoms. Positive results were obtained in three of five children with post-chicken pox cerebellitis and in seven of seven herpes zoster patients with neurological symptoms. The PCR thus provides a useful tool for the early diagnosis of VZV-associated neurological disease.

  12. Evaluation of the polymerase chain reaction in the diagnosis of cutaneous leishmaniasis due to Leishmania major: a comparison with direct microscopy of smears and sections from lesions

    DEFF Research Database (Denmark)

    Andresen, K; Gaafar, A; El-Hassan, A M;

    1996-01-01

    We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....

  13. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

    Science.gov (United States)

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

    2016-05-01

    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. J. Med. Virol. 88:871-876, 2016. © 2015 Wiley Periodicals, Inc. PMID:26455510

  14. Polymerase chain reaction-based gene removal from plasmids

    Directory of Open Access Journals (Sweden)

    Vishnu Vardhan Krishnamurthy

    2015-09-01

    Full Text Available This data article contains supplementary figures and methods to the research article entitled, “Multiplex gene removal by two-step polymerase chain reactions” (Krishnamurthy et al., Anal. Biochem., 2015, doi:http://dx.doi.org/10.1016/j.ab.2015.03.033, which presents a restriction-enzyme free method to remove multiple DNA segments from plasmids. Restriction-free cloning methods have dramatically improved the flexibility and speed of genetic manipulation compared to conventional assays based on restriction enzyme digestion (Lale and Valla, 2014. DNA Cloning and Assembly Methods, vol. 1116. Here, we show the basic scheme and characterize the success rate for single and multiplex gene removal from plasmids. In addition, we optimize experimental conditions, including the amount of template, multiple primers mixing, and buffers for DpnI treatment, used in the one-pot reaction for multiplex gene removal.

  15. Nested methylation-specific polymerase chain reaction cancer detection method

    Science.gov (United States)

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  16. Analysis of infectious laryngotracheitis virus isolates from Ontario and New Brunswick by the polymerase chain reaction.

    Science.gov (United States)

    Alexander, H S; Key, D W; Nagy, E

    1998-01-01

    The polymerase chain reaction (PCR) was used to amplify DNA of infectious laryngotracheitis virus (ILTV) isolates obtained from field specimens. The examined 47 samples included 37 isolates representing 35 cases of infectious laryngotracheitis from Ontario and 10 isolates originating from 10 field cases in New Brunswick. The viruses were grown in either embryonated chicken eggs or cell culture, the DNA extracted and amplified using primers designed from the sequence information of a 1.1 kb BamHI fragment of the Ontario 1598 ILTV strain. Thirty-four of the Ontario isolates and all of the New Brunswick isolates were amplified successfully. This suggests that the selected primers would be useful for the majority of the isolates encountered in outbreaks of ILTV. Images Figure 1. Figure 2. PMID:9442943

  17. Detection of Lassa virus RNA in specimens from patients with Lassa fever by using the polymerase chain reaction.

    Science.gov (United States)

    Lunkenheimer, K; Hufert, F T; Schmitz, H

    1990-01-01

    Suitable oligonucleotide primers and probes were synthesized to amplify Lassa virus (Josiah strain)-specific nucleoprotein and glycoprotein gene fragments by using reverse transcription combined with the polymerase chain reaction (PCR). Our primers did not amplify the related lymphocytic choriomeningitis virus. By using PCR, about 50 50% tissue culture infective doses could be detected in the supernatant of infected cells. Furthermore, in all five serum specimens and four of five urine specimens of patients with acute Lassa fever, viral RNA could be demonstrated. Negative results were obtained with all serum and urine specimens of healthy subjects. Our data suggest that PCR may be applied as an alternative to virus isolation in the rapid diagnosis of Lassa fever. Images PMID:2279999

  18. Quantification of Porcine Follicle-stimulating Hormone Receptor Messenger Ribonucleic Acid by Reverse Transcription-competitive Polymerase Chain Reaction

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    An easy and reliable method was developed for construction and quantification of competitive templates, which shared the same sequence as the amplified target DNA except for a 20-bp insertion in the middle by recombinant polymerase chain reaction (PCR). Among the advantages of competitive PCR is that any predictable or unpredictable variable that affects amplification has the same effect on both target and competitor species and that the final ratio of amplified products reflects exactly the initial targets. The utilization of a thermostable reverse transcriptase in the RT step was proposed to overcome the problem of the efficiency of target cDNA synthesis. In addition, to obtain reliable measurements, it was recommended to perform four PCR with amounts of competitive template flanking the concentration of the target mRNA.

  19. Development of a multiplex polymerase chain reaction to detect five common Gram-negative bacteria of aquatic animals.

    Science.gov (United States)

    Tsai, M-A; Ho, P-Y; Wang, P-C; E, Y-J; Liaw, L-L; Chen, S-C

    2012-07-01

    A multiplex polymerase chain reaction (m-PCR) technique was developed as a rapid and accurate diagnostic tool for identifying five major Gram-negative bacilli -Vibrio vulnificus, V. parahaemolyticus, Aeromonas hydrophila, Chryseobacterium meningosepticum and Edwardsiella tarda- that cause major diseases in cultured aquatic animals in Taiwan. The expected amplicons for V. vulnificus, V. parahaemolyticus, A. hydrophila, C. meningosepticum and E. tarda were 410, 368, 685, 180 and 230bp, respectively. The assay was shown to be specific for the target pathogens. The sensitivities of detection were estimated to be 20.5fg∼200pg of genomic DNA or 10(2) ∼10(4) colony-forming units (cfu) of bacterial isolates when adopted as PCR templates. The m-PCR was capable of simultaneously amplifying target fragments from bacterial genome DNA mixed with the DNA extracted from viscera and tissues taken from fish without affecting the performance of the method. PMID:22571515

  20. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  1. Chip PCR. I. Surface passivation of microfabricated silicon-glass chips for PCR.

    OpenAIRE

    Shoffner, M A; Cheng, J; Hvichia, G E; Kricka, L J; Wilding, P.

    1996-01-01

    The microreaction volumes of PCR chips (a microfabricated silicon chip bonded to a piece of flat glass to form a PCR reaction chamber) create a relatively high surface to volume ratio that increases the significance of the surface chemistry in the polymerase chain reaction (PCR). We investigated several surface passivations in an attempt to identify 'PCR friendly' surfaces and used those surfaces to obtain amplifications comparable with those obtained in conventional PCR amplification systems...

  2. Use of Quantitative Polymerase Chain Reaction for Determining Copy Numbers of Transgenes in Lesquerella fendleri

    Directory of Open Access Journals (Sweden)

    Grace Q. Chen

    2010-01-01

    Full Text Available Problem statement: In transgenic plants, the number of transgene copies could greatly influence the level of expression and genetic stability of the target gene, thus it is important to develop an efficient method for accurate estimation of transgene copies. The quantitative Polymerase Chain Reaction (qPCR technique is becoming more efficient nowadays to determine copy numbers of transgenes in transgenic plants, being used here, for the first time in quantifying copy numbers of transgenes in Lesquerella fendleri. Approach: The system utilized a known one copy gene, LfKCS4/5, from L. fendleri as an endogenous calibrator and the threshold Crossing point (Ct measured by Applied Biosystem 7500 system to calculate the copy numbers of transgenes in primary transgenic lines (T0 generation. Results: The qPCR condition was optimized and each primer set had a PCR efficiency of 0.99 or 1.01. Our data demonstrated unambiguous 2-fold discrimination of the copy number of β-glucuronidase gene (gusA and hygromycine phosphotransferase II (hptII genes in 12 T0 lines. Most of the lines contained one or two copies of each gene. Eight out of 12 samples (66.7% showed more copies of gusA gene than that of hptII gene, suggesting rearrangements of the Transferred (T-DNA. Possible modifications of the T-DNA cassette in L. fendleri are discussed based on main models of T-DNA integration in the plant genome. Conclusion: The qPCR described in this study is an efficient method and it is particularly useful in identification and selection of transgenic plants with desirable copy numbers at early stage.

  3. THE METHOD OF POLYMERASE CHAIN REACTION FOR SEX DETERMINATION IN HUCHEN (HUCHO HUCHO

    Directory of Open Access Journals (Sweden)

    Yu. Rud

    2013-12-01

    Full Text Available Purpose. To analyse the nucleotide sequences of salmonids Y chromosome and to determine the fragment for specific primers selection and also to develop the PCR based method for sex determination in huchen H. hucho. Methodology. Using the ClustalW algorithm in MEGA 5.2, the nucleotide sequences of salmonids Y chromosome were analysed. For developing of method for rapid diagnostic of huchen sex the polymerase chain reaction (PCR assay was used. Tne nucleotide sequences of amplified products were investigated by sequencing. Findings. Using PCR assay the method of sex determination in huchen H. hucho was developed. It was shown that specific PCR products in size of 450 nucleotides were visible in huchen males only. In addition we showed that selected primers can be used in sex determination of rainbow trout Oncorhynchus mykiss and this fact is proved the high rate of sdY locus similarity and its wide destribution in salmonids. Originality. The nucleotide sequences of salmonids Y chromosome were analysed and highly conservative region of sdY locus for specific primers selection, which covers sex-linked marker, was identified. Practical Value. Rapid sex determination in huchen by the developed method will allow to identify reversal males in process of gormonal sex reversion. At the stage of reversal males screening, this method will allow to identify the genotypic males (XY in experimental group and discard them because only phenotypic males with XX genotype (reversal males must be used in the crosses with native femelas for getting of 100 % all-females stock.

  4. Controlling Hybridization Chain Reactions with pH.

    Science.gov (United States)

    Idili, Andrea; Porchetta, Alessandro; Amodio, Alessia; Vallée-Bélisle, Alexis; Ricci, Francesco

    2015-08-12

    By taking inspiration from nature, where self-organization of biomolecular species into complex systems is finely controlled through different stimuli, we propose here a rational approach by which the assembly and disassembly of DNA-based concatemers can be controlled through pH changes. To do so we used the hybridization chain reaction (HCR), a process that, upon the addition of an initiator strand, allows to create DNA-based concatemers in a controlled fashion. We re-engineered the functional units of HCR through the addition of pH-dependent clamp-like triplex-forming domains that can either inhibit or activate the polymerization reaction at different pHs. This allows to finely regulate the HCR-induced assembly and disassembly of DNA concatemers at either basic or acidic pHs in a reversible way. The strategies we present here appear particularly promising as novel tools to achieve better spatiotemporal control of self-assembly processes of DNA-based nanostructures. PMID:26177980

  5. Evaluation of Clearview and Magic Lite tests, polymerase chain reaction, and cell culture for detection of Chlamydia trachomatis in urogenital specimens

    NARCIS (Netherlands)

    J.A.J.W. Kluytmans (Jan); W.H.F. Goessens (Wil); J.W. Mouton (Johan); J.H. van Rijsoort-Vos; H.G.M. Niesters (Bert); W.G.V. Quint (Wim); L. Habbema; E. Stolz (Ernst); J.H. Wagenvoort

    1993-01-01

    textabstractThe Clearview Chlamydia test (CV; Unipath Ltd., Bedford, United Kingdom), the Magic Lite Chlamydia test (ML; CIBA Corning, Medfield, Mass.), a polymerase chain reaction (PCR), and cell culture (CC) were evaluated for detection of Chlamydia trachomatis in urogenital spec

  6. Diagnosis of visceral leishmaniasis by the polymerase chain reaction using blood, bone marrow and lymph node samples from patients from the Sudan

    DEFF Research Database (Denmark)

    Andresen, K; Gasim, S; Elhassan, A M;

    1997-01-01

    We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...

  7. Distinguishing Plasmodium falciparum treatment failures from re-infections by using polymerase chain reaction genotyping in a holoendemic area in northeastern Tanzania

    DEFF Research Database (Denmark)

    Magesa, S M; Mdira, K Y; Farnert, A;

    2001-01-01

    An in vivo drug sensitivity study was conducted in Magoda village in northeastern Tanzania to evaluate the usefulness of polymerase chain reaction (PCR)-based genotyping of Plasmodium falciparum parasites to distinguish between re-infection and treatment failure. The study tested P. falciparum...

  8. Detection and strain differentiation of infectious bronchitis virus in tracheal tissues from experimentally infected chickens by reverse transcription-polymerase chain reaction. Comparison with an immunohistochemical technique

    DEFF Research Database (Denmark)

    Handberg, Kurt; Nielsen, O.L.; Pedersen, M.W.; Jørgensen, Poul Henrik

    1999-01-01

    Oligonucleotide pairs were constructed for priming the amplification of fragments of nucleocapsid (N) protein and spike glycoprotein (S) genes of avian infectious bronchitis virus (IBV) by reverse transcription-polymerase chain reaction (RT-PCR). One oligonucleotide pair amplified a common segment...

  9. Knockout confirmation for Hurries: rapid genotype identification of Trypanosoma cruzi transfectants by polymerase chain reaction directly from liquid culture

    Directory of Open Access Journals (Sweden)

    Monica Visnieski Alcantara

    2014-07-01

    Full Text Available Gene knockout is a widely used approach to evaluate loss-of-function phenotypes and it can be facilitated by the incorporation of a DNA cassette having a drug-selectable marker. Confirmation of the correct knockout cassette insertion is an important step in gene removal validation and has generally been performed by polymerase chain reaction (PCR assays following a time-consuming DNA extraction step. Here, we show a rapid procedure for the identification of Trypanosoma cruzi transfectants by PCR directly from liquid culture - without prior DNA extraction. This simple approach enabled us to generate PCR amplifications from different cultures varying from 106-108 cells/mL. We also show that it is possible to combine different primer pairs in a multiplex detection reaction and even to achieve knockout confirmation with an extremely simple interpretation of a real-time PCR result. Using the “culture PCR” approach, we show for the first time that we can assess different DNA sequence combinations by PCR directly from liquid culture, saving time in several tasks for T. cruzi genotype interrogation.

  10. Real-Time Polymerase Chain Reaction as a Tool for Evaluation of Magnetic Poly(Glycidyl methacrylate)-Based Microspheres in Molecular Diagnostics.

    Science.gov (United States)

    Trachtová, Stepánka; Spanová, Alena; Horák, Daniel; Kozáková, Hana; Rittich, Bohuslav

    2016-01-01

    DNA amplification by real-time polymerase chain reaction (RT-PCR) was used for the evaluation of efficiency of polymer coating of magnetic hydrophilic poly(2-hydroxyethyl methacrylate-co-glycidyl methacrylate) (P(HEMA-co-GMA)) and poly(glycidyl methacrylate) (PGMA) microspheres with/without carboxyl groups. The inhibition effect of magnetic microspheres on real-time polymerase chain reaction (RT-PCR) course was evaluated by regression analysis after the addition of different concentrations of tested microspheres to PCR mixtures. Microspheres mostly did not interfere in RT-PCR till the concentration 50 µg/25 µl PCR mixture. No relationship between Fe content (and microsphere diameter) and inhibition effect was found. Microspheres containing carboxyl groups extinguished the fluorescence at lower concentrations (10-20 µg/25 µl PCR mixture) without inhibition of DNA amplification as PCR products were detected using agarose gel electrophoresis. Negative effect of maghemite on PCR course was partially reduced by coating of magnetic core by silica or polymers. Two inhibition mechanisms of DNA amplification were discussed in this work. PMID:26708828

  11. Multiplex Reverse Transcription-Polymerase Chain Reaction for Simultaneous Screening of 29 Chromosomal Translocation in Hematologic Malignancies

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Multiplex reverse transcription-polymerase chain reaction (M-RT-PCR) has been proved to possess great clinical potential for simultaneous screening of 29 chromosomal translocations in acute leukemia. To evaluate the clinical value of M-RT-PCR in hematologic malignancies, bone marrow samples from 90 patients with various hematologic malignancies, including 25 acute myeloge nous leukemia (AML), 22 acute lymphoblastic leukemia (ALL), 27 chronic myelogenous leukemia (CML), 4 myeloproliferative diseases (MPD), 3 chronic lymphoblastic leukemia (CLL), 3 and 1 malignant histocytosis (MH) were subjected to both M-RT-PCR and chromosome karyotypic analysis. Some of cases were subjected to follow-up examination of M-RT-PCR during the period of ukemia. In our hand, 12 of 29chromosomal translocation transcripts including TEL/PDGFR, DEK/CAN, MLL/AF6, AML1/ETO,F9, BCR/ABL, MLL/MLL, PML/RARα, TLS/ERG, E2A/HLF, EVIl and HOXI1 were detected in 57 cases (63.3 %) of the 90 samples, which were in consistence with the results of karyore, M-RT-PCR had also shown good clinical relevance when used as an approach to detect minimal residual leukemia. We concluded that M-RT-PCR could be used as an effiy in the initial diagnosis of hematologic malignancies but also in subsequent monitor of minimal residual leukemia.

  12. Polymerase chain reaction of peripheral blood as a tool for the diagnosis of visceral leishmaniasis in children

    Directory of Open Access Journals (Sweden)

    Thiago Leite Fraga

    2010-05-01

    Full Text Available The diagnosis of visceral leishmaniasis (VL generally requires the use of invasive tests for the collection of infected tissue (aspirates of bone marrow, spleen, liver or lymph nodes. This difficulty has led to the search for safer and less painful techniques to confirm the occurrence of the disease in children. Polymerase chain reaction (PCR is a method that is advantageous in that it allows the use of peripheral blood samples for diagnosis. This paper reports the utilisation of PCR on peripheral blood samples to diagnose VL in 45 children in Mato Grosso do Sul, Brazil. This technique is compared with methods carried out using tissue collected by invasive procedures, including direct microscopy, culture and detection of Leishmania DNA by PCR in bone marrow aspirates. The results show that PCR of peripheral blood provides great sensitivity (95.6% that is similar to that from the PCR of bone marrow aspirates (91.1% and higher than that achieved with microscopy (80% or culture (26.7% methods. PCR of peripheral blood proved to be a suitable tool for the diagnosis of VL in children because it is highly sensitive and safe, with tissue collection being less invasive than in traditional tests.

  13. Diagnosis of foot-and mouth disease by real time reverse transcription polymerase chain reaction under field conditions in Brazil

    Directory of Open Access Journals (Sweden)

    Clarke Neville P

    2008-12-01

    Full Text Available Abstract Background Foot-and-mouth disease (FMD is an economically important and highly contagious viral disease that affects cloven-hoofed domestic and wild animals. Virus isolation and enzyme-linked immunosorbent assay (ELISA are the gold standard tests for diagnosis of FMD. As these methods are time consuming, assays based on viral nucleic acid amplification have been developed. Results A previously described real-time reverse transcriptase polymerase chain reaction (RT-PCR assay with high sensitivity and specificity under laboratorial and experimental conditions was used in the current study. To verify the applicability of this assay under field conditions in Brazil, 460 oral swabs from cattle were collected in areas free of FMD (n = 200 and from areas with outbreaks of FMD (n = 260. Three samples from areas with outbreaks of FMD were positive by real-time RT-PCR, and 2 of those samples were positive by virus isolation and ELISA. Four other samples were considered inconclusive by real-time RT-PCR (threshold cycle [Ct] > 40; whereas all 200 samples from an area free of FMD were real-time RT-PCR negative. Conclusion real-time RT-PCR is a powerful technique for reliable detection of FMDV in a fraction of the time required for virus isolation and ELISA. However, it is noteworthy that lack of infrastructure in certain areas with high risk of FMD may be a limiting factor for using real-time RT-PCR as a routine diagnostic tool.

  14. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. PMID:23541117

  15. PCR-SBT检测HLA-C座位1-7外显子序列鉴别HLA-C*07:01:01G和C*07:02:01G组等位基因%Discrimination of Alleles in HLA-C * 07:01 :O1G and HLA-C * 07:02 :O1G Groups through Detection Sequences in Exons 1 to 7 of HLA-C Locus by Using Polymerase Chain Reaction Sequence-Based Typing

    Institute of Scientific and Technical Information of China (English)

    吕杭军; 章伟; 可俊俊; 和艳敏; 王炜; 韩浙东; 陈男英; 朱发明; 严力行

    2012-01-01

    This study was aimed to discriminate the alleles in the HLA-C * 07-.01-01G and HLA-C * 07-.02-01G groups and analyze their associations with HLA-B locus. Samples previously typed as HLA-C * 07 -.01 ;01G and HLA-C * 07-.02 -01G were collected. The nucleotide sequences in exons 1 to 7 of the HLA-C locus were sequenced by ploymerase chain reaction sequence-based typing ( PCR-SBT) and HLA-B genotyping was also preformed by PCR-SBT in these samples. The results showed that 4 samples(30. 8% ) were confirmed as HLA-C * 07-.01 -.01 and 9 samples (69. 2% ) were HLA-C* 07-.06 among 13 samples previously typed as HLA-C * 07-.01:01G. Linkage disequilibrium (LD) analysis showed that HLA-C * 07-.06 allele was strongly related with HLA-B * 44 -.03. All samples were typed as C*07'; 02 -.01 among 102 individuals previously typed as C * 07-.02-.01G. LD analysis showed that C * 07-.02 -.01 was strongly related with HLA-B *51:01, B *46:01, B * 39-.01, B *40:01, B * 38-.02, B * 15-.02 alleles. It is concluded that HLA-C * 07-.01:01 and HLA-C * 07-.06 alleles are confirmed in the HLA-C * 07-.01:01G group and HLA-C *07:02:01 is a preferred allele in the HLA-C * 07-.02-.01G.%本研究旨在探讨区分人类白细胞抗原(HLA)-C* 07:01:01G和HLA-C* 07:02:01G组内等位基因,并分析其与HLA-B的连锁情况.通过收集HLA-C* 07:01:01G组和HLA-C* 07:02:01G组标本,采用聚合酶链反应测序分析方法(PCR-SBT)检测HLA-C座位第1-7外显子编码序列,并采用PCR-SBT方法对标本进行HLA-B基因分型.结果表明,13例HLA-C* 07:01:01G组标本中,4例(30.8%)标本为HLA-C* 07:01:01,9例(69.2%)标本为HLA-C* 07:06;连锁分析显示,HLA-C* 07:06与HLA-B* 44:03高度连锁.102例HLA-C* 07:02:01G组标本全部为HLA-C* 07:02:01;连锁分析显示,HLA-C* 07:02:01与HLA-B* 51:01、B*46:01、B*39:01、B*40:01、B* 38:02、B*15:02高度连锁.结论:HLA-C* 07:01:01G组中发现存在HLA-C* 07:01:01和HLA-C* 07:06,而HLA-C* 07:02:01G组中以HLA-C* 07:02:01为主导.

  16. Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

    Directory of Open Access Journals (Sweden)

    Arbefeville S

    2015-09-01

    Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

  17. Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Gusti Ayu Yuniati Kencana

    2013-07-01

    Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

  18. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    OpenAIRE

    Peter McInerney; Paul Adams; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differe...

  19. Typing of Plasmodium falciparum DNA from 2 years old Giemsa-stained dried blood spots using nested polymerase chain reaction assay.

    Science.gov (United States)

    Kumar, D; Dhiman, S; Rabha, B; Goswami, D; Yadav, K; Deka, M; Veer, V; Baruah, I

    2016-01-01

    A panel of 129 Giemsa-stained thick blood spots (TBS) confirmed for Plasmodium falciparum infection having different levels of parasite density were collected from a malaria endemic area. DNA was extracted and nested polymerase chain reaction (PCR) assay was performed to amplify P. falciparum DNA. Nested PCR assay successfully amplified P. falciparum DNA at a very low parasitaemia of ~10 parasites/μl of blood. Current PCR assay is very simple and can be used retrospectively to monitor the invasion and prevalence of different Plasmodium species in endemic areas. PMID:27080775

  20. A coalescent approach to the polymerase chain reaction.

    OpenAIRE

    Weiss, G.; von Haeseler, A

    1997-01-01

    A versatile algorithm is developed to model PCR on a computer. The method is based on a modification of the coalescent process and provides a general framework to analyse data from PCR. It allows for incorporation of the dynamics of the replication process as described in terms of the number of starting template molecules and cycle-dependent PCR efficiency. The simulation method generates, as a first step, the genealogy of a set of sequences sampled from a final PCR product. In a second step ...

  1. Detection of bovine leukemia virus in cattle by the polymerase chain reaction.

    Science.gov (United States)

    Murtaugh, M P; Lin, G F; Haggard, D L; Weber, A F; Meiske, J C

    1991-06-01

    Bovine leukemia virus (BLV) is widely distributed in U.S. cattle herds. It infects B lymphocytes and causes neoplastic disease in 5-10% of infected animals. Direct economic losses are incurred as a result of death, reduced milk production and condemnation at slaughter. Thus the identification of cattle infected with BLV is of significant concern to the U.S. cattle industry. For this reason, polymerase chain reaction (PCR) amplification was used to examine seropositive and seronegative cattle for the presence of BLV DNA in peripheral blood mononuclear cells. Using an amplification protocol able to detect 1 viral genome in 100,000 cells, BLV was not detected in 7 seronegative cattle in an infected herd. BLV sequences were detected in 13 of 18 seropositive animals with various levels of infection as determined by in vitro lymphocyte culture and electron microscopy. An active infection was demonstrated in one animal, based on the presence of viral RNA. These findings indicate that PCR is a sensitive method for the detection of BLV in cattle and provides new information regarding the dynamics of the infection. PMID:1658030

  2. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Science.gov (United States)

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  3. Rapid enumeration of Listeria monocytogenes in artificially contaminated cabbage using real-time polymerase chain reaction.

    Science.gov (United States)

    Hough, Angela J; Harbison, Sally-Ann; Savill, Marion G; Melton, Laurence D; Fletcher, Graham

    2002-08-01

    A quantitative real-time polymerase chain reaction (PCR) detection method specific for Listeria monocytogenes was developed, and studies involving pure culture showed that the response of the assay was linear over 7 log10 (log) cycles. The method was then applied to the detection of L. monocytogenes artificially inoculated onto cabbage, a vegetable chosen because it is a major component of coleslaw, which has been associated with an outbreak of listeriosis. After being allowed to attach to the food, cells were washed from the cabbage leaf surface and recovered by centrifugation. The DNA was purified by an organic solvent extraction technique and analyzed by real-time PCR. In this matrix, the method again produced a linear response over 7 log cycles from 1.4 x 10(2) to 1.4 x 10(9) CFU of L. monocytogenes in 25 g of cabbage, and analysis of the reproducibility of the system showed that log differences in L. monocytogenes numbers added to cabbage could be reliably distinguished. The system allowed quantitative results to be obtained within 8 h and was relatively inexpensive, showing good potential for routine analytical use. PMID:12182489

  4. Optimized Adaptor Polymerase Chain Reaction Method for Efficient Genomic Walking

    Institute of Scientific and Technical Information of China (English)

    Peng XU; Rui-Ying HU; Xiao-Yan DING

    2006-01-01

    Genomic walking is one of the most useful approaches in genome-related research. Three kinds of PCR-based methods are available for this purpose. However, none of them has been generally applied because they are either insensitive or inefficient. Here we present an efficient PCR protocol, an optimized adaptor PCR method for genomic walking. Using a combination of a touchdown PCR program and a special adaptor, the optimized adaptor PCR protocol achieves high sensitivity with low background noise. By applying this protocol, the insertion sites of a gene trap mouse line and two gene promoters from the incompletely sequenced Xenopus laevis genome were successfully identified with high efficiency. The general application of this protocol in genomic walking was promising.

  5. Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

    Directory of Open Access Journals (Sweden)

    Raden Wasito

    2015-05-01

    Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

  6. A clinical comparative study of polymerase chain reaction assay for diagnosis of pneumocystis pneumonia in non-AIDS patients

    Institute of Scientific and Technical Information of China (English)

    MU Xiang-dong; WANG Guang-fa; SU Li

    2011-01-01

    Background Pneurnocystis jirovecii pneumonia (PCP) is one of the most common and fatal infections in non-AIDS immunocompromised patients,which is difficult to diagnose by traditional morphologic methods.This study evaluated polymerase chain reaction (PCR) assays of Pneumocystis jirovecii mitochondrial large subunits ribosomal RNA in sputum and bronchioalveolar lavage fluid (BALF) for diagnosing PCP.Methods Sputum and BALF specimens from two groups were collected:one group (PCP group) included 20 patients definitely diagnosed of PCP by Gomori methenamine silver (GMS) stains of BALF;the other group (non-PCP group) included 40 patients.Each specimen was examined by GMS stains and PCR assays.Results GMS stains of BALF in PCP group were 100% positive (20/20),GMS stains of sputum in PCP group were 35% positive (7/20);GMS stains of BALF in non-PCP group were 100% negative (40/40),GMS stains of sputum in non-PCP group were 100% negative (40/40).PCR assays of BALF in PCP group were 100% positive (20/20),PCR assays of sputum in PCP group were 100% positive (20/20);PCR assays of BALF in non-PCP group were 100% negative (40/40),PCR assays of sputum in non-PCP group were 100% negative (40/40).Sensitivity and specificity of PCR assays of sputum and BALF were both 100%;positive and negative predictive values were also both 100%.Conclusion The diagnostic value of PCR assays of Pneumocystisjirovecii mitochondrial large subunits ribosomal RNA on sputum and BALF for pneumocystis pneumonia are both high and equivalent.

  7. Simultaneous detection of pyrethroid, organophosphate, and cyclodiene target site resistance in Haematobia irritans (Diptera: Muscidae) by multiplex polymerase chain reaction.

    Science.gov (United States)

    Domingues, Luísa N; Guerrero, Felix D; Foil, Lane D

    2014-09-01

    The horn fly, Haematobia irritans irritans (L., 1758) (Diptera: Muscidae), is an important pest that causes significant economic losses to the livestock industry, but insecticide resistance in horn fly populations has made horn fly control increasingly difficult to achieve. In this study, we developed a multiplex polymerase chain reaction (PCR) assay to simultaneously detect target site resistance to pyrethroids (kdr mutation), organophosphates (G262A acetylcholinesterase mutation), and cyclodienes (Rdl mutation) and used the new procedure to follow the progression of these three mutations after exposure to different insecticide pressure. We assayed flies collected at the Macon Ridge research station, Winnsboro, LA, from 2008 to 2012. The multiplex PCR showed robust results in all our assays. The kdr mutation remained at high frequencies during all years, even after 4 yr with no use of pyrethroids. The G262A acetylcholinesterase mutation fluctuated from 7.5 to 23.8% during the studied years, while the Rdl mutation was rare in 2008, 2009, and June 2010, and then significantly increased after the first use of endosulfan. The possibility of screening for all the known target site resistance mutations in a single PCR reaction makes the multiplex PCR a useful and affordable tool that can be used to help diagnose insecticide resistance. PMID:25276924

  8. Detection of Avibacterium paragallinarum by Polymerase chain reaction from outbreaks of Infectious coryza of poultry in Andhra Pradesh

    Directory of Open Access Journals (Sweden)

    T. M. Nabeel Muhammad

    2015-01-01

    Full Text Available Aim: This study was carried out for the detection of Avibacterium paragallinarum from outbreaks of infectious coryza of poultry Materials and Methods: The polymerase chain reaction (PCR was standardized for the diagnosis of infectious coryza by using infectious coryza Killed vaccine, ventri biologicals, Pune as source of DNA of A. paragallinarum. Five outbreaks of infectious coryza from Andhra Pradesh were investigated in the present study. A total of 56 infra orbital sinus swabs and 22 nasal swabs were tested by PCR. Results: PCR analysis showed 56 positives (71.7% for infectious coryza out of total 78 samples tested. Of 56 infra orbital sinus swabs tested, 47 were positive (83.9% and 9 nasal swabs (40.9% out of 22 tested had given positive results for infectious coryza. Samples collected from birds at acute stage of disease and samples collected before treatment with antibiotics were given better results on PCR. Conclusion: For preventing the economic losses associated with the disease, an early, accurate and rapid diagnosis is essential. PCR is a rapid and highly sensitive diagnostic technique which can substitute conventional cultural examination.

  9. Utility of a rapid immunochromatographic strip test in detecting canine parvovirus infection compared with polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sundaran S. Tinky

    2015-04-01

    Full Text Available Aim: The present study was undertaken to detect the presence of canine parvovirus (CPV in fecal samples of diarrheic dogs by conventional polymerase chain reaction (PCR and immunochromatographic (IC strip test and to compare the diagnostic potential of these tests. Materials and Methods: A total of 50 fecal samples collected from diarrheic dogs suspected for CPV infection were subjected to PCR using CPV-555 primer amplifying the gene coding for the VP1 protein. These samples were also tested by IC strip test using a commercial rapid Ag test kit. The results were statistically analyzed using McNemar test. Results: A total of 22 samples (44% were detected as positive by PCR, which yielded a specific amplicon of 583 bp. In IC strip test, 18 (36% samples were found to be positive. The sensitivity of the test as compared to PCR was found to be 72.22% and specificity was 92.86%. Positive predictive value and negative predictive value of IC strip test was found to be 88.89% and 81.25%, respectively. Statistical analysis of the results of PCR and IC assay using McNemar test revealed no significant difference (p>0.05. Conclusion: The IC strip test could be employed as a rapid field level diagnostic tool for the diagnosis of canine parvoviral diarrhea.

  10. Diagnosis of human herpesvirus 6B primary infection by polymerase chain reaction in young children with exanthematic disease

    Directory of Open Access Journals (Sweden)

    Ivna de Melo Magalhães

    2011-06-01

    Full Text Available INTRODUCTION: Exanthem subitum is a classical rash disease of early childhood caused by human herpesvirus 6B (HHV-6B. However, the rash is frequently misdiagnosed as that of either measles or rubella. METHODS: In this study, a nested multiplex polymerase chain reaction (PCR was used to diagnose HHV-6B primary infection, differentiate it from infections caused by HHV-6A and compare it to antibody avidity tests. The samples were separated into case group and control group according to the results of the indirect immunofluorescence assay (IFA technique. RESULTS: From the saliva samples analyzed, HHV-6A DNA was detected in 3.2% of the case group and in 2.6% of the control group. Regarding HHV-6B, PCR detected viral DNA in 4.8% of the case group and in 1.3% of the control group. Among the serum samples studied, a frequency of 1.7% was determined for HHV-6A in the case group and 1.2% in the control group. PCR did not detect HHV-6B DNA in serum samples. The sensitivity and specificity of the PCR technique ranged from 0% to 4.8% and 97.5% to 100%, respectively, compared to IFA. CONCLUSIONS: The PCR technique was not suitable for diagnosing primary infection by HHV-6B in children with exanthematic disease and should not substitute the IFA.

  11. Human papillomavirus infection and anal carcinoma. Retrospective analysis by in situ hybridization and the polymerase chain reaction.

    OpenAIRE

    Zaki, S R; Judd, R.; Coffield, L. M.; Greer, P; Rolston, F.; Evatt, B L

    1992-01-01

    To examine the association of human papillomavirus (HPV) infection with anal squamous cell carcinoma, the authors applied the highly sensitive polymerase chain reaction (PCR) and in situ hybridization (ISH) techniques to detect HPV DNA in formalin-fixed, paraffin-embedded tissues from 18 patients. The presence of HPV types 16/18 in 3 (16.7%) of 18 patients with anal carcinoma was found, using a colorimetric ISH technique for HPV types 6, 11, 16, 18, 31, 35, and 51. Results from one of these t...

  12. Detection of Sphingomonas paucimobilis Infections in Domestic Animals by VITEK ® Compaq 2 and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    S Cengiz

    2015-01-01

    Full Text Available This case report presents the first cases of Sphingomonas paucimobilis in Turkey, which was isolated and identified from two cows, a calf and a lamb by conventional methods, VITEK Compaq® 2 system and Polymerase Chain Reaction (PCR. Compatible findings were reached among clinical history, necropsy findings and bacteriologic results. In conclusion, S. paucimobilis should be considered as a causative agent particularly for respiratory diseases, septicemia and foot infections with resistance to antibiotic treatment. Also, detection methods must be arranged not only for common pathogens but also for S. paucimobilis.

  13. Influence of EDTA and magnesium on DNA extraction from blood samples and specificity of polymerase chain reaction

    OpenAIRE

    H. Khosravinia; Ramesha, KP

    2007-01-01

    This study consisting of two trails conducted to examine the impact of initial EDTA level added to blood samples on quantity and quality of genomic DNA isolated from avian fresh blood and the influence of initial EDTA level with various levels of $MgCl_2$ added to polymerase chain reaction (PCR) final volume on amplification pattern. EDTA level added to collected blood samples had no significant impact on quantity as well as quality of extracted genomic DNA. However, higher levels of EDTA inc...

  14. Diagnosis of. alpha. sub 1 -antitrypsin deficiency by enzymatic amplification of human genomic DNA and direct sequencing of polymerase chain reaction products

    Energy Technology Data Exchange (ETDEWEB)

    Newton, C.R.; Graham, A.; Powell, S.; Gammack, A.; Riley, J.; Markham, A.F. (ICI Diagnostics, Cheshire (England)); Kalsheker, N. (Univ. of Wales, Cardiff (Wales))

    1988-09-12

    The authors have compared sequencing of cloned polymerase chain reaction (PCR) products and the direct sequencing of PCR products in the examination of individuals from six families affected with {alpha}{sub 1}-antitrypsin (AAT) deficiency. In families where paternity was in question they confirmed consanguinity by DNA fingerprinting using a panel of locus-specific minisatellite probes. They demonstrate that direct sequencing of PCR amplification products is the method of choice for the absolutely specific diagnosis of AAT deficiency and can distinguish normals, heterozygotes and homozygotes in a single, rapid and facile assay. Furthermore, they demonstrate the reproducibility of the PCR and a rapid DNA isolation procedure. They have also shown that two loci can be simultaneously amplified and that the PCR product from each locus can be independently examined by direct DNA sequencing.

  15. Molecular diagnosis of strongyloidiasis in tropical areas: a comparison of conventional and real-time polymerase chain reaction with parasitological methods

    Directory of Open Access Journals (Sweden)

    Fabiana Martins de Paula

    2015-04-01

    Full Text Available This study aimed to evaluate the use of conventional polymerase chain reaction (cPCR and real-time quantitative PCR (qPCR in the diagnosis of human strongyloidiasis from stool samples in tropical areas. Stool samples were collected from individuals and were determined to be positive for Strongyloides stercoralis (group I, negative for S. stercoralis (group II and positive for other enteroparasite species (group III. DNA specific to S. stercoralis was found in 76.7% of group I samples by cPCR and in 90% of group I samples by qPCR. The results show that molecular methods can be used as alternative tools for detecting S. stercoralis in human stool samples in tropical areas.

  16. Molecular diagnosis of eosinophilic meningitis due to Angiostrongylus cantonensis (Nematoda: Metastrongyloidea by polymerase chain reaction-DNA sequencing of cerebrospinal fluids of patients

    Directory of Open Access Journals (Sweden)

    Praphathip Eamsobhana

    2013-02-01

    Full Text Available Cerebrospinal fluid (CSF samples from clinically diagnosed patients with detectable Angiostrongylus canto-nensis-specific antibodies (n = 10, patients with clinically suspected cases that tested negative for A. cantonensis-an-tibodies (n = 5 and patients with cerebral gnathostomiasis (n = 2 and neurocysticercosis (n = 2 were examined by a single-step polymerase chain reaction (PCR method using the AC primers for the 66-kDa native protein gene. The PCR method detected A. cantonensis DNA in CSF samples from four of 10 serologically confirmed angiostrongyliasis cases. The PCR results were negative for the remaining CSF samples. The nucleotide sequences of three positive CSF-PCR samples shared 98.8-99.2% similarity with the reference sequence of A. cantonensis. These results indicate the potential application of this PCR assay with clinical CSF samples for additional support in the confirmation of eosinophilic meningitis due to A. cantonensis.

  17. The ligase chain reaction as a primary screening tool for the detection of culture positive tuberculosis.

    LENUS (Irish Health Repository)

    O'Connor, T M

    2012-02-03

    BACKGROUND: The ligase chain reaction Mycobacterium tuberculosis assay uses ligase chain reaction technology to detect tuberculous DNA sequences in clinical specimens. A study was undertaken to determine its sensitivity and specificity as a primary screening tool for the detection of culture positive tuberculosis. METHODS: The study was conducted on 2420 clinical specimens (sputum, bronchoalveolar lavage fluid, pleural fluid, urine) submitted for primary screening for Mycobacterium tuberculosis to a regional medical microbiology laboratory. Specimens were tested in parallel with smear, ligase chain reaction, and culture. RESULTS: Thirty nine patients had specimens testing positive by the ligase chain reaction assay. Thirty two patients had newly diagnosed tuberculosis, one had a tuberculosis relapse, three had tuberculosis (on antituberculous therapy when tested), and three had healed tuberculosis. In the newly diagnosed group specimens were smear positive in 21 cases (66%), ligase chain reaction positive in 30 cases (94%), and culture positive in 32 cases (100%). Using a positive culture to diagnose active tuberculosis, the ligase chain reaction assay had a sensitivity of 93.9%, a specificity of 99.8%, a positive predictive value of 83.8%, and a negative predictive value of 99.9%. CONCLUSIONS: This study is the largest clinical trial to date to report the efficacy of the ligase chain reaction as a primary screening tool to detect Mycobacterium tuberculosis infection. The authors conclude that ligase chain reaction is a useful primary screening test for tuberculosis, offering speed and discrimination in the early stages of diagnosis and complementing traditional smear and culture techniques.

  18. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase.

    Science.gov (United States)

    McInerney, Peter; Adams, Paul; Hadi, Masood Z

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition. PMID:25197572

  19. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Peter McInerney

    2014-01-01

    Full Text Available As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu, Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.

  20. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    Science.gov (United States)

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler. PMID:27271319

  1. Evaluation of gold nanoparticles as the additive in real-time polymerase chain reaction with SYBR Green I dye

    International Nuclear Information System (INIS)

    Gold nanoparticles (AuNPs) have been proven to be able to improve the specificity or increase the efficiency of a polymerase chain reaction (PCR) when a suitable amount of AuNPs was used. However, there is still a lack of systematic evaluation of AuNPs in real-time PCR. In this study, DNA degradation and the fluorescence quenching effect of AuNPs were first tested in real-time PCR. Then two different kinds of Taq DNA polymerase, native and recombinant Taq polymerase, were employed to evaluate the AuNPs' effect on the threshold cycle (CT) values, standard curves and melting curves in real-time PCR. Different ratios of the amount of native Taq DNA polymerase to the amount of AuNPs were also tested. It was found that AuNPs could be applied in real-time PCR with correlation coefficient R2>0.989. The combination of 2.09 nM AuNPs with 3.75 U of native Taq DNA polymerase could make the amplification curves shift to the left and enhance the efficiency of the real-time PCR (0.628 39 without AuNPs compared with 0.717 89 with 2.09 nM AuNPs), thus enabling faster detection in comparison with those of control samples. However, no improvement ability of AuNPs was found in real-time PCR based on recombinant rTaq DNA polymerase. Besides, the results suggest that a complex interaction exists between AuNPs and native Taq DNA polymerase

  2. Alteration in sample preparation to increase the yield of multiplex Polymerase Chain Reaction assay for diagnosis of genital ulcer disease

    Directory of Open Access Journals (Sweden)

    G Rao

    2013-01-01

    Full Text Available Purpose: Genital Ulcer Disease (GUD is common sexually transmitted infection (STI. Multiple studies have shown that GUDs are strongly associated with the transmission and the acquisition of HIV infection. An accurate diagnosis of common etiology of GUD namely Herpes, syphilis and Chancroid is possible using Multiplex PCR (M-PCR. However, frequent presence of Polymerase Chain Reaction inhibitors in the ulcer swab specimen limits the performance of the assay. In order to overcome this problem, alternative specimen preparation method was used. Materials and Methods: To determine the common etiology, GUD specimens obtained under an STI operations research study were tested with M-PCR after the samples were prepared using Roche Amplicor specimen preparation kit. PCR inhibiting samples were identified from that, which showed negative results. These samples were subjected to phenol-chloroform extraction and ethanol precipitation before the conduct of M-PCR on them. Results: Of the 237 GUD specimens tested, in 145 etiologies could be detected, whereas 92 samples were found negative. Further spiking with one of the target DNA, 128 of the negative samples were found to contain the inhibitors. These 126 samples were then subjected to phenol chloroform extraction and ethanol precipitation followed by M-PCR. Using this method for sample preparation, etiology could be determined in 46 (23% additional samples. This success rate of altered sample preparation method has been lower than that has reported. Conclusion: The results indicate that sample preparation using phenol chloroform extraction and ethanol precipitation, prior to M-PCR helps to eliminate the inhibitors and increase the yield of the assay. However, being a laborious procedure, it may be used for samples giving negative results after the screening by Roche Amplicor specimen preparation kit.

  3. Avian haemosporidian parasites (Haemosporida): A comparative analysis of different polymerase chain reaction assays in detection of mixed infections.

    Science.gov (United States)

    Bernotienė, Rasa; Palinauskas, Vaidas; Iezhova, Tatjana; Murauskaitė, Dovilė; Valkiūnas, Gediminas

    2016-04-01

    Mixed infections of different species and genetic lineages of haemosporidian parasites (Haemosporida) predominate in wildlife, and such infections are particularly virulent. However, currently used polymerase chain reaction (PCR)-based detection methods often do not read mixed infections. Sensitivity of different PCR assays in detection of mixed infections has been insufficiently tested, but this knowledge is essential in studies addressing parasite diversity in wildlife. Here, we applied five different PCR assays, which are broadly used in wildlife avian haemosporidian research, and compared their sensitivity in detection of experimentally designed mixed infections of Haemoproteus and Plasmodium parasites. Three of these PCR assays use primer sets that amplify fragments of cytochrome b gene (cyt b), one of cytochrome oxidase subunit I (COI) gene, and one target apicoplast genome. We collected blood from wild-caught birds and, using microscopic and PCR-based methods applied in parallel, identified single infections of ten haemosporidian species with similar parasitemia. Then, we prepared 15 experimental mixes of different haemosporidian parasites, which often are present simultaneously in wild birds. Similar concentration of total DNA was used in each parasite lineage during preparation of mixes. Positive amplifications were sequenced, and the presence of mixed infections was reported by visualising double-base calling in sequence electropherograms. This study shows that the use of each single PCR assay markedly underestimates biodiversity of haemosporidian parasites. The application of at least 3 PCR assays in parallel detected the majority, but still not all lineages present in mixed infections. We determined preferences of different primers in detection of parasites belonging to different genera of haemosporidians during mixed infections. PMID:26821298

  4. Molecular detection of the carriage rate of four intestinal protozoa with real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L;

    2015-01-01

    -Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...... intestinalis, and Cryptosporidium. Questionnaires were administered for epidemiological data collection. E. histolytica was not detected in any of the samples, whereas Giardia (37.2%), E. dispar (18.6%), and Cryptosporidium (1%) were found. Most of the children sourced their drinking water from community wells...... (91%), while the majority disposed of feces in the bush (81.9%). Our study is the first to use real-time PCR to evaluate the epidemiology of E. histolytica, Giardia, and Cryptosporidium in Nigeria where previous studies using traditional diagnostic techniques have suggested higher and lower carriage...

  5. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.

    Science.gov (United States)

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J

    2016-09-01

    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii. PMID:27206968

  6. Analysis of ancient DNA from coprolites: a perspective with random amplified polymorphic DNA-polymerase chain reaction approach

    Directory of Open Access Journals (Sweden)

    Iñiguez Alena M

    2003-01-01

    Full Text Available The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pretreatment was essential to overcome the DNA degradation and the serial dilutions helped with to prevent polymerase chain reaction (PCR inhibitors. Moreover, the random amplified polymorphic DNA-PCR has been shown to be a reliable technique for further experiments to recover specific aDNA sequences.

  7. Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

    International Nuclear Information System (INIS)

    Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

  8. Statistical models for the analysis and design of digital polymerase chain (dPCR) experiments

    Science.gov (United States)

    Dorazio, Robert; Hunter, Margaret

    2015-01-01

    Statistical methods for the analysis and design of experiments using digital PCR (dPCR) have received only limited attention and have been misused in many instances. To address this issue and to provide a more general approach to the analysis of dPCR data, we describe a class of statistical models for the analysis and design of experiments that require quantification of nucleic acids. These models are mathematically equivalent to generalized linear models of binomial responses that include a complementary, log–log link function and an offset that is dependent on the dPCR partition volume. These models are both versatile and easy to fit using conventional statistical software. Covariates can be used to specify different sources of variation in nucleic acid concentration, and a model’s parameters can be used to quantify the effects of these covariates. For purposes of illustration, we analyzed dPCR data from different types of experiments, including serial dilution, evaluation of copy number variation, and quantification of gene expression. We also showed how these models can be used to help design dPCR experiments, as in selection of sample sizes needed to achieve desired levels of precision in estimates of nucleic acid concentration or to detect differences in concentration among treatments with prescribed levels of statistical power.

  9. [Development of a real-time polymerase chain reaction method for the identification of Candida species].

    Science.gov (United States)

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza

    2015-01-01

    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  10. Antiadenoviral effects of N-chlorotaurine in vitro confirmed by quantitative polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    Eiichi Uchio

    2010-11-01

    Full Text Available Eiichi Uchio1, Hirotoshi Inoue1, Kazuaki Kadonosono21Department of Ophthalmology, Fukuoka University School of Medicine, Fukuoka, Japan; 2Department of Ophthalmology, Yokohama City University Medical Center, Yokohama, JapanPurpose: Adenoviral keratoconjunctivitis is recognized as one of the major pathogens of ophthalmological nosocomial infection worldwide. N-Chlorotaurine (Cl–HN–CH2–CH2–SO3H, NCT is the N-chloro derivative of the amino acid taurine, which is an oxidant produced by human granulocytes and monocytes during inflammatory reactions. Using conventional viral plaque assay, it was previously shown that NCT causes inactivation of several human adenovirus (HAdV serotypes. In this study, we evaluated the antiadenoviral effect of NCT by quantitative polymerase chain reaction (PCR methods.Methods: A549 cells were used for viral cell culture, and HAdV serotypes 3, 4, 8, 19, and 37 were used. After calculating 50% cytotoxic concentration (CC50 of NCT by MTS (3-(4,5-dimethylthiazol-2-yl-5-(3-carboxymethoxyphenyl-2-(4-sulfophenyl-2H-tetrazolium method, HAdV was cultured with NCT for 7 days, and extracted adenoviral DNA was quantitatively measured by real-time PCR.Results: A statistically significant (P < 0.05 dose-dependent inhibition was indicated for all serotypes except HAdV type 4 (HAdV4, which was maximally inhibited by only ~50%. Among the serotypes, NCT was particularly effective against HAdV8, HAdV19a, and HAdV37. The 50% effective concentration (EC50 obtained by real-time PCR of NCT ranged between 49 and 256 µM. EC50 of NCT against HAdV3 was slightly higher than that against serotypes of species D. The selective index (CC50/EC50 ranged between 41 and 60 except for HAdV4 (11.5.Conclusions: These results show that NCT has an antiviral effect against most serotypes of human HAdV inducing keratoconjunctivitis, indicating its possible therapeutic use.Keywords: adenovirus, N-chlorotaurine, epidemic keratoconjunctivitis, antiviral

  11. Development of a duplex quantitative polymerase chain reaction assay for detection of bovine herpesvirus 1 and bovine viral diarrhea virus in bovine follicular fluid.

    Science.gov (United States)

    Marley, Mylissa S D; Givens, M Daniel; Galik, Patricia K; Riddell, Kay P; Stringfellow, David A

    2008-07-15

    The objective of this study was to develop a duplex quantitative polymerase chain reaction (qPCR) assay for simultaneous detection of bovine herpesvirus 1 (BoHV-1) and bovine viral diarrhea virus (BVDV) type I and type II. Follicular fluid was collected from a BoHV-1 acutely infected heifer, a BVDV I persistently infected heifer, and from 10 ovaries recovered from an abattoir. Both the BoHV-1 and BVDV contaminated follicular fluid were diluted 1:5 to 1:10(7) using the pooled, abattoir-origin follicular fluid. Each dilution sample was analyzed using the duplex qPCR, virus isolation, reverse transcription-nested PCR (RT-nPCR), and BoHV-1 qPCR. The duplex qPCR was able to simultaneously detect BoHV-1 and BVDV I in the fluid diluted to 1:100 and 1:1000, respectively. These results corresponded with the reverse transcription-nested PCR and BoHV-1 qPCR. Therefore, the duplex qPCR might be used for quality assurance testing to identify these two viruses in cells, fluids and tissues collected from donor animals and used in reproductive technologies. PMID:18452983

  12. Advances in simulation of PCR

    International Nuclear Information System (INIS)

    Polymerase chain reaction (PCR) is an important diagnosis tool in molecular biology, which have been greatly improved by PCR. However, optimizing the experimental conditions is still a problem for PRC. Computer biology can be a solution to this problem. In this paper, developments of the mathematical models for PCA are reviewed. It is believed that this kind of research efforts shall be helpful for optimizing the experimental conditions and providing guidance for the biologists and understanding the mechanism of PCR. (authors)

  13. The effect of chain flexibility and chain mobility on radiation crosslinking reactions of polymers

    International Nuclear Information System (INIS)

    Flexibility of polymer chains is an important factor to effects of radiation crosslinking of the polymer. Polymers with flexible chains are easier to be crosslinked, with lower dose of gelation, than polymers with more rigid chains. And it is known that most polymers with abnormal rigidity can be radiation-crosslinked only at high temperatures when the molecular chains get enough mobility. The flexibility of polymer chains also influences the relationship between degree of degradation and radiation dose. A chain flexibility factor β has been introduced to modify the Charlesby-Pinner equation of sol-fraction and radiation dose. The new relationship equation applies to a wider range of polymers in radiation crosslinking. Studies also show that for flexible polymers with lower Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in H type, whereas for rigid polymers with higher Tg and molecular internal rotating factor, mechanism of radiation crosslinking is mainly in T type

  14. Comparative study of sensitivity, linearity, and resistance to inhibition of digital and nondigital polymerase chain reaction and loop mediated isothermal amplification assays for quantification of human cytomegalovirus.

    Science.gov (United States)

    Nixon, Gavin; Garson, Jeremy A; Grant, Paul; Nastouli, Eleni; Foy, Carole A; Huggett, Jim F

    2014-05-01

    Performing nucleic acid amplification techniques (NAATs) in digital format using limiting dilution provides potential advantages that have recently been demonstrated with digital polymerase chain reaction (dPCR). Key benefits that have been claimed are the ability to quantify nucleic acids without the need of an external calibrator and a greater resistance to inhibitors than real-time quantitative PCR (qPCR). In this study, we evaluated the performance of four NAATs, qPCR, dPCR, real-time quantitative loop mediated isothermal amplification (qLAMP), and digital LAMP (dLAMP), for the detection and quantification of human cytomegalovirus (hCMV). We used various DNA templates and inhibitors to compare the performance of these methods using a conventional real-time thermocycler platform (Bio-Rad CFX96) and a chip based digital platform (Fluidigm Biomark 12.765 Digital Array). dPCR performed well and demonstrated greater resistance to inhibitors than the other methods although this resistance did not apply equally to all inhibitors tested. dLAMP was found to be less sensitive than dPCR, but its quantitative performance was better than qLAMP, the latter being unable to quantify below 1000 copies. dLAMP was also more resistant to inhibitors than qLAMP. Unlike qPCR, both digital methods were able to quantify viral genomes without requiring a calibrator; however, neither can currently compete with the large reaction volumes, and thus the greater absolute sensitivity, of qPCR. With the introduction of digital instrumentation that will enable larger reaction volumes, digital amplification methods such as those evaluated in this study could potentially offer a robust alternative to qPCR for nucleic acid quantification. PMID:24684191

  15. RAPID DETECTION OF Salmonella IN SHRIMP BY POLYMERASE CHAIN REACTION [Deteksi Cepat Salmonella pada Udang dengan Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Ulfah Amalia

    2014-06-01

    Full Text Available Shrimp is an important non-oil commodity for foreign trade in Indonesia. However, rejection of shrimp exports by the importing countries is still commonly encountered. In 2011, the USFDA recorded two cases of Salmonella spp. contamination in shrimp products from two shrimp processing companies in Indonesia. Analysis of Salmonella spp. in seafood is generally performed using a conventional method which takes at least 5 days. The objective of the study is to get a Salmonellae rapid detection method in shrimp by PCR. In this study, optimization of PCR protocol method to detect Salmonella invA gene was conducted using six different annealing temperatures (59, 59.5, 60.8, 62, 64 and 64.5°C. The results showed that 64°C was the optimum annealing temperature to detect the 284 bp fragment of Salmonella invA gene. The PCR based detection method has a DNA detection limit of 27.81ug/mL and 10°CFU/mL of viable salmonellae with 100% specificity. The PCR protocol is capable of detecting six different Salmonella serovars (S. Enteritidis, S. Hadar, S. Heidelberg, S. Kentucky, S. Paratyphi and S. Typhimurium but none of the non salmonellae isolates. Application of the PCR assay on Salmonella in shrimp after the selective enrichment step suggested that all 16 samples were positive for Salmonella. At the same time, the conventional method could only detected 3 samples for Salmonella positive.

  16. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  17. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

    Science.gov (United States)

    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

    2005-11-30

    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate. PMID:16302741

  18. Validation and Identification of Invasive Salmonella Serotypes in Sub-Saharan Africa by Multiplex Polymerase Chain Reaction.

    Science.gov (United States)

    Al-Emran, Hassan M; Krumkamp, Ralf; Dekker, Denise Myriam; Eibach, Daniel; Aaby, Peter; Adu-Sarkodie, Yaw; Ali, Mohammad; Rubach, Mathew P; Bjerregaard-Andersen, Morten; Crump, John A; Cruz Espinoza, Ligia Maria; Løfberg, Sandra Valborg; Gassama Sow, Amy; Hertz, Julian T; Im, Justin; Jaeger, Anna; Kabore, Leon Parfait; Konings, Frank; Meyer, Christian G; Niang, Aissatou; Pak, Gi Deok; Panzner, Ursula; Park, Se Eun; Rabezanahary, Henintsoa; Rakotozandrindrainy, Raphaël; Raminosoa, Tiana Mirana; Razafindrabe, Tsiriniaina Jean Luco; Sampo, Emmanuel; Schütt-Gerowitt, Heidi; Sarpong, Nimako; Soura, Abdramane Bassiahi; Tall, Adama; von Kalckreuth, Vera; Wierzba, Thomas F; May, Jürgen; Marks, Florian

    2016-03-15

    Salmonella enterica serovar Typhi and nontyphoidal Salmonella (NTS) cause the majority of bloodstream infections in sub-Saharan Africa; however, serotyping is rarely performed. We validated a multiplex polymerase chain reaction (PCR) assay with the White-Kauffmann-Le Minor (WKLM) scheme of serotyping using 110 Salmonella isolates from blood cultures of febrile children in Ghana and applied the method in other Typhoid Fever Surveillance in Africa Program study sites. In Ghana, 47 (43%) S. Typhi, 36 (33%) Salmonella enterica serovar Typhimurium, 14 (13%) Salmonella enterica serovar Dublin, and 13 (12%) Salmonella enterica serovar Enteritidis were identified by both multiplex PCR and the WKLM scheme separately. Using the validated multiplex PCR assay, we identified 42 (66%) S. Typhi, 14 (22%) S. Typhimurium, 2 (3%) S. Dublin, 2 (3%) S. Enteritidis, and 4 (6%) other Salmonella species from the febrile patients in Burkina Faso, Guinea-Bissau, Madagascar, Senegal, and Tanzania. Application of this multiplex PCR assay in sub-Saharan Africa could advance the knowledge of serotype distribution of Salmonella. PMID:26933026

  19. Accuracy of replication in the polymerase chain reaction. Comparison between Thermotoga maritima DNA polymerase and Thermus aquaticus DNA polymerase

    Directory of Open Access Journals (Sweden)

    R.S. Diaz

    1998-10-01

    Full Text Available For certain applications of the polymerase chain reaction (PCR, it may be necessary to consider the accuracy of replication. The breakthrough that made PCR user friendly was the commercialization of Thermus aquaticus (Taq DNA polymerase, an enzyme that would survive the high temperatures needed for DNA denaturation. The development of enzymes with an inherent 3' to 5' exonuclease proofreading activity, lacking in Taq polymerase, would be an improvement when higher fidelity is needed. We used the forward mutation assay to compare the fidelity of Taq polymerase and Thermotoga maritima (ULTMA™ DNA polymerase, an enzyme that does have proofreading activity. We did not find significant differences in the fidelity of either enzyme, even when using optimal buffer conditions, thermal cycling parameters, and number of cycles (0.2% and 0.13% error rates for ULTMA™ and Taq, respectively, after reading about 3,000 bases each. We conclude that for sequencing purposes there is no difference in using a DNA polymerase that contains an inherent 3' to 5' exonuclease activity for DNA amplification. Perhaps the specificity and fidelity of PCR are complex issues influenced by the nature of the target sequence, as well as by each PCR component.

  20. Exogenous reference gene normalization for real-time reverse transcription-polymerase chain reaction analysis under dynamic endogenous transcription

    Institute of Scientific and Technical Information of China (English)

    Stephen Johnston; Zachary Gallaher; Krzysztof Czaja

    2012-01-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qPCR) is widely used to investigate transcriptional changes following experimental manipulations to the nervous system. Despite the widespread utilization of qPCR, the interpretation of results is marred by the lack of a suitable reference gene due to the dynamic nature of endogenous transcription. To address this inherent deficiency, we investigated the use of an exogenous spike-in mRNA, luciferase, as an internal reference gene for the 2-ΔΔCt normalization method. To induce dynamic transcription, we systemically administered capsaicin, a neurotoxin selective for C-type sensory neurons expressing the TRPV-1 receptor, to adult male Sprague-Dawley rats. We later isolated nodose ganglia for qPCR analysis with the reference being either exogenous luciferase mRNA or the commonly used endogenous reference β-III tubulin. The exogenous luciferase mRNA reference clearly demonstrated the dynamic expression of the endogenous reference. Furthermore, variability of the endogenous reference would lead to misinterpretation of other genes of interest. In conclusion, traditional reference genes are often unstable under physiologically normal situations, and certainly unstable following the damage to the nervous system. The use of exogenous spike-in reference provides a consistent and easily implemented alternative for the analysis of qPCR data.

  1. Early detection of Toxoplasma gondii by real-time polymerase chain reaction methods in patients with recurrent spontaneous abortions

    Directory of Open Access Journals (Sweden)

    Parviz Saleh

    2014-11-01

    Full Text Available Introduction: One of the causes of recurrent spontaneous abortions (RSA is an infection by the toxoplasmosis Protozoa. In comparison, we present detailed results using real-time polymerase chain reaction (PCR methods of detection. In this study, it was tried to detect Toxoplasma gondii (T. gondii by real-time PCR methods in patients with RSA. Methods: Amniotic fluid sampling was performed in the 16-20th weeks of gestation in 50 pregnant women with a history of RSA. The extracted deoxyribonucleic acid (DNA samples were analyzed using quantitative real-time PCR. Results: In all the cases, the detection of T. gondii was negative in the peripheral blood, and amniotic fluid samples by using the molecular methods (real-time PCR. Using the serological detection methods, 6% of patients were diagnosed as positive for the immunoglobulin M (IgM antibody. In addition, the IgG antibody was positive in 46% of the patients. Conclusion: It can be concluded that the serological methods lack specificity.

  2. A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

    Science.gov (United States)

    Kidd, I M; Clark, D A; Emery, V C

    2000-06-01

    Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed. PMID:10856765

  3. DETECTION OF BREAST CANCER MICROMETASTASES IN BONE MARROW USING REVERSE-TRANSCRIPTASE CHAIN REACTION AND SOUTHERN HYBRIDIZATION

    Institute of Scientific and Technical Information of China (English)

    LI Jin-feng; ZHANG Lei; SUN Su-lian

    1999-01-01

    Objective: The aim of this study was to detect micrometastases in bone marrow of primary breast cancer patients, and compare with other clinical parameters.Methods: Cytokeratin 19 (CK-19) gene mRNA expression was detected by reverse transcriptase-polymerase chain reaction (RT-PCR) and Southern blot hybridization.Human breast cancer cell line T47D was mixed with bone marrow cells in different proportions. The positive detection rate was compared among RT-PCR, Southern blotting and immunohistochemistry (IHC) methods. Results: Cytokeratin 19 gene was expressed in all 6 positive control samples while the expression was not seen in 8 negative control samples. In all 54 patients 14 cases were CK-19 positive (25.9%) by RT-PCR, another positive signal was obtained in 5/54 (9.3%) of bone marrow samples by Southern blotting. The total positive cases are 19/54 (35.2%).CK-19 IHC+ cells were detected at a dilution of one T47D cell in 5×104 bone marrow cells, while the sensitivity detected by PCR and Southern blot hybridization was at 1:5×105 and 1:1×106, respectively. This demonstrates that RT-PCR and Southern blotting was at least 20 times more sensitive than the IHC method. The micrometastases positive rate of the larger tumor size group (>5.0 cm) was significantly (P<0.05) greater than that of the smaller tumor size group (0-2.0 cm). Conclusion: detection of micrometastases in bone marrow by RT-PCR and Southern blotting, using CK-19 as a biological marker, is highly sensitive and it is a method to be used for anticipating the prognosis of breast cancer patients.

  4. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    Science.gov (United States)

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain. PMID:26169291

  5. Quantitative Real-time Polymerase Chain Reaction for Enteropathogenic Escherichia coli: A Tool for Investigation of Asymptomatic Versus Symptomatic Infections

    Science.gov (United States)

    Barletta, Francesca; Mercado, Erik; Ruiz, Joaquim; Ecker, Lucie; Lopez, Giovanni; Mispireta, Monica; Gil, Ana I.; Lanata, Claudio F.; Cleary, Thomas G.

    2011-01-01

    Background. Enteropathogenic Escherichia coli (EPEC) strains are pediatric pathogens commonly isolated from both healthy and sick children with diarrhea in areas of endemicity. The aim of this study was to compare the bacterial load of EPEC isolated from stool samples from children with and without diarrhea to determine whether bacterial load might be a useful tool for further study of this phenomenon. Methods. EPEC was detected by polymerase chain reaction (PCR) of colonies isolated on MacConkey plates from 53 diarrheal and 90 healthy children aged <2 years. DNA was isolated from stool samples by cetyltrimethylammonium bromide extraction. To standardize quantification by quantitative real-time PCR (qRT-PCR), the correlation between fluorescence threshold cycle and copy number of the intimin gene of EPEC E2348/69 was determined. Results. The detection limit of qRT-PCR was 5 bacteria/mg stool. The geometric mean load in diarrhea was 299 bacteria/mg (95% confidence interval [CI], 77–1164 bacteria/mg), compared with 29 bacteria/mg (95% CI, 10–87 bacteria/mg) in control subjects (P = .016). Bacterial load was significantly higher in children with diarrhea than in control subjects among children <12 months of age (178 vs 5 bacteria/mg; P = .006) and among children with EPEC as the sole pathogen (463 vs 24 bacteria/mg; P = .006). Conclusions. EPEC load measured by qRT-PCR is higher in diarrheal than in healthy children. qRT-PCR may be useful to study the relationship between disease and colonization in settings of endemicity. PMID:22028433

  6. Genotypic characterization by polymerase chain reaction of Staphylococcus aureus isolates associated with bovine mastitis.

    Science.gov (United States)

    Ote, Isabelle; Taminiau, Bernard; Duprez, Jean-Noël; Dizier, Isabelle; Mainil, Jacques G

    2011-12-15

    Staphylococcus aureus is recognized worldwide as a pathogen causing many serious diseases in humans and animals, and is the most common aetiological agent of clinical and subclinical bovine mastitis. The importance of evaluating the combination of S. aureus virulence factors has been emphasized both in human and veterinary medicine, and knowledge about the genetic variability within different S. aureus populations would help in the design of efficient treatments. The aim of the present study was to determine the genetic profiles of S. aureus strains isolated from milk of cows suffering from clinical and subclinical mastitis in Belgium. The presence of about forty virulence-associated genes was investigated by specific polymerase chain reaction (PCR) amplification. A high number of genotypic subtypes were observed, demonstrating further the large variation in the presence of virulence genes in S. aureus isolates and the considerable diversity of strains populations that are able to cause mastitis in cows. In accordance with other studies, we showed that some genes are associated with mastitis-causing S. aureus isolates, whereas others are absent or rarely present. We also further highlighted the presence of conserved gene combinations, namely the enterotoxigenic egc-cluster and the bovine pathogenicity island SaPIbov. Importantly, the presence of isolates carrying genes coding for toxins involved in important human infections makes the milk of cows with mastitis a potential reservoir for these toxins, and therefore a potential danger in human health, which strengthens the importance to consider raw milk consumption and its processing very carefully. PMID:21708435

  7. Detection of canine herpesvirus 1 in a wide range of tissues using the polymerase chain reaction.

    Science.gov (United States)

    Burr, P D; Campbell, M E; Nicolson, L; Onions, D E

    1996-12-01

    Canine herpesvirus 1 (CHV-1), a member of the alphaherpesvirus sub-family, is known to cause fatal infections in litters of puppies and may also be involved in infertility, abortion, and stillbirths in adult dogs. The purpose of this study was to determine the presence of CHV-1 DNA using the polymerase chain reaction (PCR) in twelve key sites that have been associated with latency for the other herpesviruses. A 605 base pair portion of the viral glycoprotein B (gB) gene was amplified using degenerate primers, cloned, and sequenced. Conventional 20 mer primers were designed using this sequence information to amplify a 120 bp fragment of gB situated between the original degenerate primers. The specificity of amplification was confirmed by Southern Blot hybridisation using an internal oligonucleotide probe. DNA was extracted from tissue samples taken from twelve dogs at post mortem and from twenty-four blood samples. Nine out of twelve dogs showed evidence of infection with CHV-1; the tissues most commonly affected were lumbo-sacral ganglia (5/12 dogs), tonsil (5/12), parotid salivary gland (4/9), and liver (4/9). No positive results were detected within the twenty-four blood samples. These results indicate that exposure to CHV-1 may be much more common than previously suggested. PMID:9008334

  8. BORRELIA BURGDORFERI DNA IN BIOLOGICAL SAMPLES FROM PATIENTS WITH SARCOIDOSIS USING THE POLYMERASE CHAIN REACTION TECHNIQUE

    Institute of Scientific and Technical Information of China (English)

    连伟; 罗慰慈

    1995-01-01

    Polymerase chain reaction (PCR) was used to detect the presence of Borretia burgdoferi DNA in biological samples from patients with sarcoidcsis. The target DNA sequence was of chromosomal origin. The amplified DNA sequence was analyzed by agarose gel electrophoresis, PAGE with silver staining, and the identity of amplified DNA was confirmed by restriction enzyme cleavage and DNA-DNA hybridlzation with a 32P-labelled probe. The assay was sensitive to fewer than two copies of B. burgdor feri genome, even in the presence of a 104-fold excess of human eukaryotic DNA, and was also specific to different B. burgdorferl strains tested. Sera seroiogieally positive to B. burgdorferi (n=26), broncbemlveolar lavage fluid and supematant of BALF (n=26) and peripheral blood (n=9) from sarcoidosis patients were tested. The positive rate was low (4/26, 2/26, and 0/9, respectively). It was considered that DNA from B. bur gdor feri may be identified in a minority of patients with s,arcoidosis, and it may play a pathogenetic rote in such cases. More studies need to be done before advancing the hypothesis of an etiologic role of B. burgdorferi in sarcoidosis.

  9. Detection of Eperythrozoon wenyoni by PCR assay

    Institute of Scientific and Technical Information of China (English)

    Jian WANG; Yutao ZHU; Jianhua QIN; Fumei ZHANG; Yuelan ZHAO

    2009-01-01

    The objective of this research was to develop a detection method for Eperythrozoon wenyoni infection using polymerase chain reaction (PCR) assay technique. A pair of primers was designed and synthesized according to the conservative sequence 16S rRNA. The PCR assay was performed with the primers. A 985-bp fragment was amplified by using PCR. The amplified fragments with the expected size were identified by EcoR I restriction digestion. The crossing-reaction, specific-reaction and duplicate-reaction indicated that the PCR method is a specific, sensitive, fast and effective method for diagnosing E. Wenyoni infection at group level.

  10. Use of sodC versus ctrA for real-time polymerase chain reaction-based detection of Neisseria meningitidis in sterile body fluids

    Directory of Open Access Journals (Sweden)

    Fábio Takenori Higa

    2013-04-01

    Full Text Available We evaluated the use of a newly described sodC-based real-time-polymerase chain reaction (RT-PCR assay for detecting Neisseria meningitidis in normally sterile sites, such as cerebrospinal fluid and serum. The sodC-based RT-PCR assay has an advantage over ctrA for detecting nongroupable N. meningitidis isolates, which are commonly present in asymptomatic pharyngeal carriage. However, in our study, sodC-based RT-PCR was 7.5% less sensitive than ctrA. Given the public health impact of possible false-negative results due to the use of the sodC target gene alone, sodC-based RT-PCR for the diagnosis of meningococcal meningitis should be used with caution.

  11. Survey of Leptospira spp in pampas deer (Ozotoceros bezoarticus in the Pantanal wetlands of the state of Mato Grosso do Sul, Brazil by serology and polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Anahí Souto Vieira

    2011-09-01

    Full Text Available This work reports a survey of Leptospira spp in pampas deer (Ozotoceros bezoarticus in the Pantanal wetlands of the state of Mato Grosso do Sul, Brazil by serology and polymerase chain reaction (PCR. Seventy pampas deer were captured in the dry season and surveyed using PCR, microscopic agglutination test (MAT (n = 51 and by both techniques (n = 47. PCR detected infections in two pampas deer and MAT detected infections in three. Through sequencing and phylogenetic analyses, the PCR-amplified fragment detected in deer was identified as Leptospira interrogans. Serovars Pomona and Butembo were detected using MAT and the highest titre was 200 for serovar Pomona. Epidemiological aspects of the findings are discussed.

  12. Comparison of a TaqMan real-time polymerase chain reaction assay with a loop-mediated isothermal amplification assay for detection of Gallid herpesvirus 1.

    Science.gov (United States)

    Ou, Shan-Chia; Giambrone, Joseph J; Macklin, Kenneth S

    2012-01-01

    A TaqMan real-time polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) assay were developed to detect Gallid herpesvirus 1 (GaHV-1, formerly Infectious laryngotracheitis virus). The standard curve of real-time PCR was established, and the sensitivity reached 10 copies/μl. In the current study, the conversion between viral titer and GaHV-1 genomic copy number was constructed. Six primers for LAMP assay amplified target gene at 65°C within 45 min, and the detection limit was 60 copies/μl. The 6 primers were highly specific, sensitive, and reproducible for detection of GaHV-1. Although the sensitivity of LAMP was lower than that of real-time PCR, LAMP was faster, less expensive, and did not require a thermocycler. The LAMP assay would be a viable alternative assay in diagnostic laboratories that do not employ real-time PCR technology. PMID:22362944

  13. Sensitive and simultaneous analysis of five transgenic maizes using multiplex polymerase chain reaction, capillary gel electrophoresis, and laser-induced fluorescence

    OpenAIRE

    García-Cañas, Virginia; González García, Ramón; Cifuentes, Alejandro

    2004-01-01

    The benefits of using multiplex polymerase chain reaction (PCR) followed by capillary gel electrophoresis with laser-induced fluorescence (CGE-LIF) for the simultaneous detection of five transgenic maizes (Bt11, T25, MON810, GA21, and Bt176) are demonstrated. The method uses a hexaplex PCR protocol to amplify the five mentioned transgenic amplicons plus the zein gene used as reference, followed by a CGE-LIF method to analyze the six DNA fragments. CGE-LIF was demonstrated very useful and info...

  14. Detection of MDR1 single nucleotide polymorphisms C3435T and G2677T using real-time polymerase chain reaction: MDR1 single nucleotide polymorphism genotyping assay

    OpenAIRE

    Song, Pengfei; Li, Shen; Meibohm, Bernd; Gaber, A. Osama; Honaker, Marsha R.; Kotb, Malak; Yates, Charles R.

    2002-01-01

    The objective of this study was to develop a real-time polymerase chain reaction (PCR) method to detect MDR1 (human multidrug resistance gene) single nucleotide polymorphisms (SNPs) C3435T and G2677T. C3435T and G2677T are linked to MDR1*2, which is associated with enhanced efflux activity in vitro. Using the Smart Cycler, an allele-specific real-time PCR-based genotyping method was developed to detect C3435T and G2677T. The MDR1 genotype of human genomic DNA templates was determined by direc...

  15. Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors

    DEFF Research Database (Denmark)

    Guil-Luna, S.; Stenvang, Jan; Brünner, Nils;

    2014-01-01

    its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...... the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant...

  16. Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

    DEFF Research Database (Denmark)

    Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte;

    2012-01-01

    To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... commercial kits used in the ring trial could identify all different PRRSV strains with an optimal analytical and diagnostic sensitivity. The genetic variability of the PRRSV strains, which is supposed to hinder the diagnostic of the RT-PCR because of mutations at the primer binding sites, was also confirmed...

  17. Measurement of androgen receptor expression in adult liver, fetal liver, and Hep-G2 cells by the polymerase chain reaction.

    OpenAIRE

    Stubbs, A P; Engelman, J L; Walker, J I; Faik, P; Murphy, G M; Wilkinson, M L

    1994-01-01

    Hepatocellular carcinoma is the most commonly fatal malignant tumour worldwide. The role of androgen receptors, which have been found in hepatocellular carcinoma, is controversial. Sequence specific polymerase chain reaction (PCR) was used to quantify, for the first time, the expression of androgen receptor in four adult liver biopsy specimens (HL-A to HL-D), fetal liver, and Hep-G2 cells. The measurement of androgen receptor is expressed as a ratio (androgen receptor: beta-actin) of the valu...

  18. A rapid method for sequencing of rRNA gene(s) amplified by polymerase chain reaction using an automated DNA sequencer

    OpenAIRE

    Dwivedi, P.P.; Patel, B.K.C.; Rees, G.N.; Ollivier, Bernard

    1996-01-01

    A method for DNA sequencing of ribosomal RNA (rRNA) genes, amplified by polymerase chain reaction (PCR), using internal primers, designed on the basis of conserved regions of rRNA genes for determining a near complete sequence (99%) of the gene using an automated DNA sequencer (Applied Biosystem Incorporation, USA) is described. The procedure is extremely rapid as cloning of the gene is not required for sequence determination. In addition time consuming steps such as ethanol precipitation and...

  19. Comparison of subgingival bacterial sampling with oral lavage for detection and quantification of periodontal pathogens by real-time polymerase chain reaction

    OpenAIRE

    Boutaga, Khalil; Savelkoul, Paul H. M.; Winkel, Edwin G.; van Winkelhoff, Arie J.

    2007-01-01

    Background: Saliva has been studied for the presence of subgingival pathogens in periodontitis patients. With the anaerobic culture technique, the discrepancy between salivary recovery and subgingival presence has been significant, which makes this approach not suitable for practical use in the microbial diagnosis of periodontitis patients. The real-time polymerase chain reaction (PCR) technique represents a very sensitive technique to detect and quantify bacterial pathogens. The aim of the s...

  20. Species-specific identification of adulteration in cooked mutton Rista (a Kashmiri Wazwan cuisine product) with beef and buffalo meat through multiplex polymerase chain reaction

    OpenAIRE

    M. Mansoor Bhat; Mir Salahuddin; Imtiyaz A. Mantoo; Sheikh Adil; Henna Jalal; M. Ashraf Pal

    2016-01-01

    Aim: Meat adulteration is a serious problem in the meat industry and needs to be tackled to ensure the authenticity of meat products and protect the consumers from being the victims. In view of such likely problem in indigenous meat products of Kashmiri cuisine (Wazwan), the present work was performed to study the detection of beef and buffalo meat in cooked mutton Rista by mitochondrial DNA (mtDNA) based multiplex polymerase chain reaction (PCR) method under laboratory conditions. Materia...

  1. Determining the Diagnostic Value of Mycobacterium Tuberculosis DNA in the Differentiation of Blood Samples of Patients with Active Pulmonary Tuberculosis and Healthy Controls Using Polymerase Chain Reaction

    OpenAIRE

    Abasali Niazi; Nezarali Muolai; Mosayeb Shahriar; Reza Karimian; Farzaneh Peykfalak

    2013-01-01

    Background: Tuberculosis (TB) is now a major cause of mortality and morbidity in the world. Nowadays, different methods are used to diagnose tuberculosis. Although classical microbiological methods (such as sputum smear) are specific, they have little sensitivity and the culture is also time-consuming. Using Polymerase Chain Reaction (PCR) in blood samples in terms of Mycobacterium tuberculosis DNA, this study examines diagnostic power of this test in the diagnosis of pulmonary tuberculosis c...

  2. Presence of infectious agents and co-infections in diarrheic dogs determined with a real-time polymerase chain reaction-based panel

    OpenAIRE

    Gizzi, Aline Baumann da Rocha; Oliveira, Simone Tostes; Leutenegger, Christian M; Estrada, Marko; Kozemjakin, Denise Adamczyk; Stedile, Rafael; Marcondes, Mary; Biondo, Alexander Welker

    2014-01-01

    Background Infectious diarrhea can be caused by bacteria, viruses, or protozoan organisms, or a combination of these. The identification of co-infections in dogs is important to determine the prognosis and to plan strategies for their treatment and prophylaxis. Although many pathogens have been individually detected with real-time polymerase chain reaction (PCR), a comprehensive panel of agents that cause diarrhea in privately owned dogs has not yet been established. The objective of this stu...

  3. Multiplex polymerase chain reaction to identify and determine the toxigenicity of Corynebacterium spp with zoonotic potential and an overview of human and animal infections

    OpenAIRE

    Luciene de Fátima Costa Torres; Dayana Ribeiro; Raphael Hirata Jr; Luis Gustavo Carvalho Pacheco; Monica Cristina de Souza; Louisy Sanches dos Santos; Cíntia Silva dos Santos; Mohammad Salah; Mateus Matiuzzi da Costa; Marcio Garcia Ribeiro; Selim, Salah A; Vasco Ariston de Carvalho Azevedo; Ana Luiza Mattos-Guaraldi

    2013-01-01

    Corynebacterium diphtheriae, Corynebacterium ulcerans and Corynebacterium pseudotuberculosis constitute a group of potentially toxigenic microorganisms that are related to different infectious processes in animal and human hosts. Currently, there is a lack of information on the prevalence of disease caused by these pathogens, which is partially due to a reduction in the frequency of routine laboratory testing. In this study, a multiplex polymerase chain reaction (mPCR) assay that can simultan...

  4. LOW-LEVEL MALARIA INFECTIONS DETECTED BY A SENSITIVE POLYMERASE CHAIN REACTION ASSAY AND USE OF THIS TECHNIQUE IN THE EVALUATION OF MALARIA VACCINES IN AN ENDEMIC AREA

    OpenAIRE

    Imoukhuede, Egeruan B; Andrews, Laura; Milligan, Paul; Berthoud, Tamara; Bojang, Kalifa; Nwakanma, Davis; Ismaili, Jamila; Buckee, Caroline; Njie, Fanta; KEITA, SAIKOU; Sowe, Maimuna; Lang, Trudie; Gilbert, Sarah C.; Greenwood, Brian M.; Hill, Adrian V. S.

    2007-01-01

    The feasibility of using a sensitive polymerase chain reaction (PCR) to evaluate malaria vaccines in small group sizes was tested in 102 adult Gambian volunteers who received either the malaria vaccine regimen FP9 ME-TRAP/MVA ME-TRAP or rabies vaccine. All volunteers received the antimalarial drugs primaquine and Lapdap plus artesunate to eliminate malaria parasites. Volunteers in a further group received an additional single treatment with sulfadoxine-pyrimethamine (SP) to prevent new infect...

  5. Usability application of multiplex polymerase chain reaction in the diagnosis of microorganisms isolated from urine of patients treated in cancer hospital

    OpenAIRE

    Cybulski, Zefiryn; Schmidt, Katarzyna; Grabiec, Alicja; Talaga, Zofia; Bociąg, Piotr; Wojciechowicz, Jacek; Roszak, Andrzej; Kycler, Witold

    2013-01-01

    Background The objective of this study was: i) to compare the results of urine culture with polymerase chain reaction (PCR) -based detection of microorganisms using two commercially available kits, ii) to assess antimicrobial susceptibility of urine isolates from cancer patients to chosen antimicrobial drugs and, if necessary, to update the recommendation of empirical therapy. Materials and methods. A one-year hospital-based prospective study has been conducted in Greater Poland Cancer Centre...

  6. Novel enzyme immunoassay and optimized DNA extraction for the detection of polymerase-chain-reaction-amplified viral DNA from paraffin-embedded tissue.

    OpenAIRE

    Merkelbach, S.; Gehlen, J.; Handt, S.; Füzesi, L

    1997-01-01

    Four different DNA extraction methods were compared to determine their ability to provide DNA for amplification of viral sequences from paraffin-embedded human tissue samples by polymerase chain reaction (PCR). The suitability of extraction methods was assessed using parameters like DNA yield, length of recovered DNA fragments, and duration. Furthermore, the efficiency of amplifying a human single-copy gene, the beta-globin gene, from DNA samples was tested. The best preservation of DNA molec...

  7. Development of Multiplex Real-Time Polymerase Chain Reaction for Detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in Clinical Specimens

    OpenAIRE

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-01-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolyt...

  8. A Novel, Multi-Parallel, Real-Time Polymerase Chain Reaction Approach for Eight Gastrointestinal Parasites Provides Improved Diagnostic Capabilities to Resource-Limited At-Risk Populations

    OpenAIRE

    Mejia, Rojelio; Vicuña, Yosselin; Broncano, Nely; Sandoval, Carlos; Vaca, Maritza; Chico, Martha; Cooper, Philip J.; Nutman, Thomas B

    2013-01-01

    Diagnosis of gastrointestinal parasites has traditionally relied on stool microscopy, which has low diagnostic sensitivity and specificity. We have developed a novel, rapid, high-throughput quantitative multi-parallel real-time polymerase chain reaction (qPCR) platform. Species-specific primers/probes were used for eight common gastrointestinal parasite pathogens: Ascaris lumbricoides, Necator americanus, Ancylostoma duodenale, Giardia lamblia, Cryptosporidium spp., Entamoeba histolytica, Tri...

  9. Analysis of the rDNA internal transcribed spacer region of the Fusarium species by polymerase chain reaction-restriction fragment length polymorphism

    OpenAIRE

    Zarrin, Majid; GANJ, FARZANEH; FARAMARZI, SAMA

    2016-01-01

    The Fusarium species are a widely spread phytopathogen identified in an extensive variety of hosts. The Fusarium genus is one of the most heterogeneous fungi and is difficult to classify. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis is a useful method in detection of DNA polymorphism in objective sequences. The aim of the present study was to identify the phylogenetic associations and usefulness of the internal transcribed spacer (ITS) region as a gen...

  10. International Ring Trial for the Validation of an Event-Specific Golden Rice 2 Quantitative Real-Time Polymerase Chain Reaction Method

    OpenAIRE

    JACCHIA SARA; NARDINI ELENA; BASSANI NICCOLO; SAVINI Cristian; SHIM Jung-Hyun; TRIJATMIKO Kurniawan; KREYSA JOACHIM; Mazzara, Marco

    2014-01-01

    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3′ junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in...

  11. Diagnostic accuracy of an IgM enzyme-linked immunosorbent assay and comparison with 2 polymerase chain reactions for early diagnosis of human leptospirosis.

    Science.gov (United States)

    Vanasco, N B; Jacob, P; Landolt, N; Chiani, Y; Schmeling, M F; Cudos, C; Tarabla, H; Lottersberger, J

    2016-04-01

    Enzyme-linked immunosorbent assay (ELISA) tests and polymerase chain reaction (PCR) may play a key role for early detection and treatment of human leptospirosis in developing countries. The aims of this study were to develop and validate an IgM ELISA under field conditions and to compare the diagnostic accuracy among IgG, IgM ELISAs, conventional PCR (cPCR), and real-time PCR (rtPCR) for early detection of human leptospirosis. Overall accuracy of IgM ELISA was sensitivity of 87.9%, specificity of 97.0%, and area under the curve of 0.940. When the 4 methods were compared, IgM ELISA showed the greatest diagnostic accuracy (J=0.6) followed by rtPCR (J=0.4), cPCR (J=0.2) and IgG ELISA (J=0.1). Our results support the use of IgM ELISA and rtPCR for early diagnosis of the disease. Moreover, due to their high specificity, they could be also useful to replace or supplement microscopic agglutination test as a confirmatory test, allowing more confirmations. PMID:26867967

  12. Application of semi-nested polymerase chain reaction targeting internal transcribed spacer region for rapid detection of panfungal genome directly from ocular specimens

    Directory of Open Access Journals (Sweden)

    Bagyalakshmi R

    2007-01-01

    Full Text Available Background: The incidence of fungal endophthalmitis has dramatically increased in recent years and rapid detection of fungi using nucleic acid-based amplification techniques is helpful in management. Aim: To evaluate semi-nested polymerase chain reaction (PCR targeting internal transcribed spacer (ITS region for detection of panfungal genome in ocular specimens. Statistical analysis used: Z test for two proportion. Materials and Methods: Standardization of PCR targeting ITS primers was carried out by determining analytical sensitivity and specificity. The sensitivity and specificity of PCR was determined by serial tenfold dilutions of C. albicans (ATCC 24433 DNA and DNA extracts of laboratory isolates of Aspergillus fumigatus , Fusarium lichenicola (4, other fungal and closely related bacterial strains and also human DNA. Semi-nested PCR was applied onto a total of 168 ocular specimens with clinically suspected fungal etiology during 2003-2005. Results and Conclusions: PCR was specific and sensitive to detect 1fg of fungal DNA with ITS primers. PCR detected fungal genome in 90 (53.57% in comparison with the conventional technique, positive in 34 (20.23% by smear examination and in 42 (25% by culture. The increase in clinical sensitivity by 28.57% using PCR was found to be statistically significant { P < 0.001 using Z test for two proportion}. The accuracy of the test was found to be 70.85%. PCR proved to be a rapid diagnostic technique for detection of panfungal genome directly from clinical specimens

  13. Development of TaqMan real-time reverse transcription-polymerase chain reaction for the detection and quantitation of porcine kobuvirus.

    Science.gov (United States)

    Zhu, Xiangdong; Wang, Yufei; Chen, Jianfei; Zhang, Xin; Shi, Hongyan; Shi, Da; Gao, Jing; Feng, Li

    2016-08-01

    Porcine kobuvirus (PKV) is a newly emerging virus that has been detected in diarrheic pigs. Presently, reverse transcription-polymerase chain reaction (RT-PCR) and RT-loop-mediated amplification are the only methods that can be used to detect PKV. To develop a TaqMan real-time RT-PCR for the rapid detection and quantitation of PKV nucleic acid in fecal samples, a pair of primers and a probe were designed to amplify the conserved 3D region of the PKV genome. After optimization, the TaqMan real-time RT-PCR was highly specific and ∼1000 times more sensitive than conventional RT-PCR, and the detection limit was as low as 30 DNA copies. Among the 148 intestinal samples from piglets with diarrhea, 136 and 118 were positive based on the TaqMan and conventional RT-PCR methods, respectively, indicating that the TaqMan RT-PCR was more sensitive than conventional RT-PCR, and the total concordance of the two methods was approximately 87.84%. Thus, the TaqMan real-time RT-PCR should be a useful tool for the early detection and quantitation of PKV. PMID:26912233

  14. Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

    Science.gov (United States)

    Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

    2015-03-01

    Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. PMID:25776549

  15. Nanobarcoding: detecting nanoparticles in biological samples using in situ polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Eustaquio T

    2012-11-01

    Full Text Available Trisha Eustaquio, James F LearyWeldon School of Biomedical Engineering, Purdue University, West Lafayette, IN, USABackground: Determination of the fate of nanoparticles (NPs in a biological system, or NP biodistribution, is critical in evaluating an NP formulation for nanomedicine. Current methods to determine NP biodistribution are greatly inadequate, due to their limited detection thresholds. Herein, proof of concept of a novel method for improved NP detection based on in situ polymerase chain reaction (ISPCR, coined “nanobarcoding,” is demonstrated.Methods: Nanobarcoded superparamagnetic iron oxide nanoparticles (NB-SPIONs were characterized by dynamic light scattering, zeta potential, and hyperspectral imaging measurements. Cellular uptake of Cy5-labeled NB-SPIONs (Cy5-NB-SPIONs was imaged by confocal microscopy. The feasibility of the nanobarcoding method was first validated by solution-phase PCR and “pseudo”-ISPCR before implementation in the model in vitro system of HeLa human cervical adenocarcinoma cells, a cell line commonly used for ISPCR-mediated detection of human papilloma virus (HPV.Results: Dynamic light-scattering measurements showed that NB conjugation stabilized SPION size in different dispersion media compared to that of its precursor, carboxylated SPIONs (COOH-SPIONs, while the zeta potential became more positive after NB conjugation. Hyperspectral imaging confirmed NB conjugation and showed that the NB completely covered the SPION surface. Solution-phase PCR and pseudo-ISPCR showed that the expected amplicons were exclusively generated from the NB-SPIONs in a dose-dependent manner. Although confocal microscopy revealed minimal cellular uptake of Cy5-NB-SPIONs at 50 nM over 24 hours in individual cells, ISPCR detected definitive NB-SPION signals inside HeLa cells over large sample areas.Conclusion: Proof of concept of the nanobarcoding method has been demonstrated in in vitro systems, but the technique needs further

  16. Polymerase chain reaction for the diagnosis of viral hepatitis B and C.

    OpenAIRE

    Bréchot, C

    1993-01-01

    Polymerase chain reaction is a highly sensitive technique for the detection of hepatitis B virus-DNA and hepatitis C virus-RNA in serum, liver tissue, and peripheral mononuclear blood cells. In chronic hepatitis B, it is particularly useful for identification of infectious subjects who are hepatitis B surface antigen positive and anti-hepatitis B e antigen antibody-positive, and for follow up of hepatitis B virus infections in liver transplantation programmes. Polymerase chain reaction detect...

  17. Polymerase chain reaction for detection of the cholera enterotoxin operon of Vibrio cholerae.

    OpenAIRE

    1991-01-01

    We report a set of oligonucleotide primers and amplification conditions for the polymerase chain reaction to detect the ctx operon of Vibrio cholerae. The results of this assay on strains of V. cholerae and related organisms were identical with those obtained by the DNA colony hybridization test with the polynucleotide probe. The detection limit of this system was 1 pg of chromosomal DNA or broth culture containing three viable cells. The polymerase chain reaction method could directly detect...

  18. Real-Time PCR

    Science.gov (United States)

    Evrard, A.; Boulle, N.; Lutfalla, G. S.

    Over the past few years there has been a considerable development of DNA amplification by polymerase chain reaction (PCR), and real-time PCR has now superseded conventional PCR techniques in many areas, e.g., the quantification of nucleic acids and genotyping. This new approach is based on the detection and quantification of a fluorescent signal proportional to the amount of amplicons generated by PCR. Real-time detection is achieved by coupling a thermocycler with a fluorimeter. This chapter discusses the general principles of quantitative real-time PCR, the different steps involved in implementing the technique, and some examples of applications in medicine. The polymerase chain reaction (PCR) provides a way of obtaining a large number of copies of a double-stranded DNA fragment of known sequence. This DNA amplification technique, developed in 1985 by K. Mullis (Cetus Corporation), saw a spectacular development over the space of a few years, revolutionising the methods used up to then in molecular biology. Indeed, PCR has many applications, such as the detection of small amounts of DNA, cloning, and quantitative analysis (assaying), each of which will be discussed further below.

  19. Evaluation of a Homemade SYBR® Green I Reaction Mixture for Real-Time PCR Quantification of Gene Expression

    OpenAIRE

    Karsai, Albert; Müller, Sabine; Platz, Stefan; Hauser, Marie-Theres

    2002-01-01

    Real-time PCR is an accurate method that can be used for the quantification of specific DNA molecules. Here we provide a protocol for SYBR® Green I in real-time PCR applications using plastic reaction tubes. We report that SYBR Green I is alkali labile and once degraded inhibits the PCR. In our optimized protocol, diluted aliquots of SYBR Green I remain stable for at least two weeks. We also evaluated different cDNA synthesis protocols for the quantification of multiple genes from the same cD...

  20. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan); Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki [System Instruments Co., Ltd., 776-2 Komiya-cho, Hachioji, Tokyo 192-0031 (Japan); Noda, Mamoru; Igimi, Shizunobu [Division of Biomedical Food Research, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Ikebukuro, Kazunori, E-mail: ikebu@cc.tuat.ac.jp [Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588 (Japan)

    2013-11-01

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 10{sup 6} copies.

  1. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •Zif268 fused to luciferase was used for E. coli O157, Salmonella and coliform detection. •Artificial zinc finger protein fused to luciferase was constructed for Norovirus detection. •An analyzer that automatically detects PCR products by zinc finger protein fused to luciferase was developed. •Target pathogens were specifically detected by the automatic analyzer with zinc finger protein fused to luciferase. -- Abstract: An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268–luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF–luciferase fusion protein. By means of the automatic analyzer with ZF–luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0 × 10 to 1.0 × 106 copies

  2. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    Science.gov (United States)

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary. PMID:19610365

  3. A quantitative polymerase chain reaction assay for the enumeration of brown tide algae Aureococcusanophagefferens in coastal waters of Qinhuangdao

    Institute of Scientific and Technical Information of China (English)

    GUO Hao; LIU Yongjian; ZHANG Qi; YUAN Xiutang; ZHANG Weiwei; ZHANG Zhifeng

    2015-01-01

    Aureococcus anophagefferens, a small pelagophyte algae, has caused brown tide blooms in coastal waters of Qinhua-ngdao in recent years, presenting significant negative impacts on the shellfish mariculture industry. Under standard light microscopy, it is visually indistinguishable from other small algae in field samples due to its extremely small size. In this study, quantitative polymerase chain reaction (qPCR) based on 18S rDNA sequences was developed and used to detect and enumerate A. anophagefferens. A linear regression (R2=0.91) was generated based on cycle thr-esholds value (Ct) versus known concentrations of A. anophagefferens. Twenty-two field samples collected in coastal waters of Qinhuangdao were subjected to DNA extraction and then analyzed using qPCR. Results showed that A. anophagefferens had a wide distribution in coastal waters along Qinhuangdao. Elevated A. anophagefferens abun-dance, category 3 brown tide blooms (>200 000 cells/mL) occurred at Dongshan Beach and Tiger-stone Beach in August in 2013. In shellfish mariculture areas along coastal waters of Qinhuangdao, 4 stations had category 3 blooms, and 6 stations had category 2 blooms (35 000–200 000 cells/mL) in August and all stations had category 1 blooms (>0 to ≤35 000 cells/mL) in October. Quantitative PCR allows for detection of A. anophagefferens cells at low levels in filed samples, which is essential to effective management and prediction of brown tide blooms.

  4. A quantitative real time polymerase chain reaction approach for estimating processed animal proteins in feed: preliminary data

    Directory of Open Access Journals (Sweden)

    Maria Cesarina Abete

    2013-04-01

    Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.

  5. Automation and integration of polymerase chain reaction with capillary electrophoresis for high throughput genotyping and disease diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, N.

    1999-02-12

    Genotyping is to detect specific loci in the human genome. These loci provide important information for forensic testing, construction of genetic linkage maps, gene related disease diagnosis and pharmacogenetic research. Genotyping is becoming more and more popular after these loci can be easily amplified by polymerase chain reaction (PCR). Capillary electrophoresis has its unique advantages for DNA analysis due to its fast heat dissipation and ease of automation. Four projects are described in which genotyping is performed by capillary electrophoresis emphasizing different aspects. First, the author demonstrates a principle to determine the genotype based on capillary electrophoresis system. VNTR polymorphism in the human D1S80 locus was studied. Second, the separation of four short tandem repeat (STR) loci vWF, THO1, TPOX and CSF1PO (CTTv) by using poly(ethylene oxide) (PEO) was studied in achieving high resolution and preventing rehybridization of the DNA fragments. Separation under denaturing, non-denaturing conditions and at elevated temperature was discussed. Third, a 250 {micro}m i.d., 365 {micro}m o.d. fused silica capillary was used as the microreactor for PCR. Fourth, direct PCR from blood was studied to simplify the sample preparation for genotyping to minimum.

  6. Development of real-time quantitative polymerase chain reaction assays to track treatment response in retinoid resistant acute promyelocytic leukemia

    Directory of Open Access Journals (Sweden)

    Jelena V Jovanovic

    2011-10-01

    Full Text Available Molecular detection of minimal residual disease (MRD has become established to assess remission status and guide therapy in patients with PML-RARA+ acute promyelocytic leukemia (APL. However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF-RARA and STAT5b-RARA. Despite their relative rarity (<1% of APL we identified 6 cases (PLZF-RARA, n=5; STAT5b-RARA, n=1, established the respective breakpoint junction regions and designed real-time quantitative polymerase chain reaction (RQ-PCR assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17-associated APL, affording assay sensitivities of ~1 in 104-105. Serial samples were available from 2 PLZF-RARA APL patients. One showed persistent PCR positivity, predicting subsequent relapse, and remains in CR2, ~11 years post-autograft. The other, achieved molecular remission (CRm with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b-RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RQ-PCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly-defined subsets of acute leukemia.

  7. DETECTION OF Leishmania (Viannia IN Nyssomyia neivai AND Nyssomyia whitmani BY MULTIPLEX POLYMERASE CHAIN REACTION, IN SOUTHERN BRAZIL

    Directory of Open Access Journals (Sweden)

    Herintha Coeto Neitzke-Abreu

    2014-09-01

    Full Text Available Sandflies transmit pathogens of leishmaniasis. The natural infection of sandflies by Leishmania (Viannia was assessed in municipalities, in the state of Paraná, in Southern Brazil. Sandflies were collected with Falcão and Shannon traps. After dissection in search of flagellates in digestive tubes and identification of the species, female sandflies were submitted to the Multiplex Polymerase Chain Reaction (multiplex PCR for detection of the fragment of the kDNA of Leishmania (Viannia and the fragment from the IVS6 cacophony gene region of the phlebotomine insects. The analysis was performed in pools containing seven to 12 guts from females of the same species. A total of 510 female sandflies were analyzed, including nine Migonemyia migonei, 17 Pintomyia fischeri, 216 Nyssomyia neivai, and 268 Nyssomyia whitmani. Although none of the females was found naturally infected by flagellates through dissection, the fragment of DNA from Leishmania (Viannia was shown by multiplex PCR in one sample of Ny. neivai (0.46% and three samples of Ny. whitmani (1.12%. It was concluded that Ny. neivai and Ny. whitmani are susceptible to Leishmania infection, and that multiplex PCR can be used in epidemiological studies to detect the natural infection of the sandfly vector, because of its sensitivity, specificity and feasibility.

  8. Candidate gene biodosimeters of mice and human exposure to ionizing radiation by quantitative reverse transcription polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Hamed Rezaeejam

    2015-01-01

    Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.

  9. Development of a SYBR Green quantitative polymerase chain reaction assay for rapid detection and quantification of infectious laryngotracheitis virus.

    Science.gov (United States)

    Mahmoudian, Alireza; Kirkpatrick, Naomi C; Coppo, Mauricio; Lee, Sang-Won; Devlin, Joanne M; Markham, Philip F; Browning, Glenn F; Noormohammadi, Amir H

    2011-06-01

    Infectious laryngotracheitis is an acute viral respiratory disease of chickens with a worldwide distribution. Sensitive detection of the causative herpesvirus is particularly important because it can persist in the host at a very low copy number and be transmitted to other birds. Quantification of viral genome copy number is also useful for clinical investigations and experimental studies. In the study presented here, a quantitative polymerase chain reaction (qPCR) assay was developed using SYBR Green chemistry and the viral gene UL15a to detect and quantify infectious laryngotracheitis virus (ILTV) in ILTV-inoculated chicken embryos or naturally infected birds. The specificity of the assay was confirmed using a panel of viral and bacterial pathogens of poultry. The sensitivity of the assay was compared with two conventional PCR assays, virus titration and an antigen-detecting enzyme-linked immunosorbent assay. The qPCR developed in this study was highly sensitive and specific, and has potential for quantification of ILTV in tissues from naturally and experimentally infected birds and embryos. PMID:21711182

  10. Prenatal diagnosis of Down syndrome using cell-free fetal DNA in amniotic fluid by quantitative fluorescent polymersase chain reaction

    Institute of Scientific and Technical Information of China (English)

    Wu Dan; Chi Hongbin; Shao Minjie; Wu Yao; Jin Hongyan; Wu Baiyan; Qiao Jie

    2014-01-01

    Backgroud Amniotic fluid (AF) supernatant contains cell-free fetal DNA (cffDNA) fragments.This study attempted to take advantage of cffDNA as a new material for prenatal diagnosis,which could be combined with simple quantitative fluorescent polymerase chain reaction (QF-PCR) to provide an ancillary method for the prenatal diagnosis of trisomy 21 syndrome.Methods AF supernatant samples were obtained from 27 women carrying euploid fetuses and 28 women carrying aneuploid fetuses with known cytogenetic karyotypes.Peripheral blood samples of the parents were collected at the same time.Short tandem repeat (STR) fragments on chromosome 21 were amplified by QF-PCR.Fetal condition and the parental source of the extra chromosome could be determined by the STR peaks.Results The sensitivity of the assay for the aneuploid was 93% (26/28; confidence interval,CI:77%-98%) and the specificity was 100% (26/26; CI:88%-100%).The determination rate of the origin of the extra chromosome was 69%.The sensitivity and the specificity of the assay in the euploid were 100% (27/27).Conclusions Trisomy 21 can be prenatally diagnosed by the QF-PCR method in AF supernatant.This karyotype analysis method greatly reduces the requirement for the specimen size.It will be a benefit for early amniocentesis and could avoid pregnancy complications.The method may become an ancillary method for prenatal diagnosis of trisomy 21.

  11. Investigation on natural diets of larval marine animals using peptide nucleic acid-directed polymerase chain reaction clamping.

    Science.gov (United States)

    Chow, Seinen; Suzuki, Sayaka; Matsunaga, Tadashi; Lavery, Shane; Jeffs, Andrew; Takeyama, Haruko

    2011-04-01

    The stomach contents of the larvae of marine animals are usually very small in quantity and amorphous, especially in invertebrates, making morphological methods of identification very difficult. Nucleotide sequence analysis using polymerase chain reaction (PCR) is a likely approach, but the large quantity of larval (host) DNA present may mask subtle signals from the prey genome. We have adopted peptide nucleic acid (PNA)-directed PCR clamping to selectively inhibit amplification of host DNA for this purpose. The Japanese spiny lobster (Panulirus japonicus) and eel (Anguilla japonica) were used as model host and prey organisms, respectively. A lobster-specific PNA oligomer (20 bases) was designed to anneal to the sequence at the junction of the 18 S rDNA gene and the internal transcribed spacer 1 (ITS1) of the lobster. PCR using eukaryote universal primers for amplifying the ITS1 region used in conjunction with the lobster-specific PNA on a mixed DNA template of lobster and eel demonstrated successful inhibition of lobster ITS1 amplification while allowing efficient amplification of eel ITS1. This method was then applied to wild-caught lobster larvae of P. japonicus and P. longipes bispinosus collected around Ryukyu Archipelago, Japan. ITS1 sequences of a wide variety of animals (Ctenophora, Cnidaria, Crustacea, Teleostei, Mollusca, and Chaetognatha) were detected. PMID:20535520

  12. Comparative efficacy of conventional diagnostic methods and evaluation of polymerase chain reaction for the diagnosis of bovine brucellosis

    Directory of Open Access Journals (Sweden)

    Raheela Akhtar

    2010-04-01

    Full Text Available The comparative efficacy of Rose Bengal Plate Test (RBPT and Milk Ring test (MRT was calculated in terms of sensitivity and specificity for the diagnosis of bovine brucellosis in cows (Group A and buffaloes (Group B from Lahore and Okara districts of Punjab, Pakistan. Using bacterial growth as a gold standard RBPT showed high sensitivity values of 100% in both groups. While its specificity was 96.29% (Group A and 90.62% (Group B. On the other hands MRT showed low sensitivity (80.0% in Group A; 86.6% in Group B while its specificity was 100% in all the animals of both groups. The calculated positive predictive and negative predictive values of both groups were in correspondence with their specificity and sensitivity values respectively. High sensitivity and low specificity of RBPT as compare to high specificity and low sensitivity of MRT in all groups suggested the poor efficacy of both tests used individually as compare to bacterial growth. In the continuation of this study polymerase chain reaction (PCR was evaluated for its diagnostic efficacy of quick Brucella abortus isolation from same samples. PCR conducted on serum samples gave more positive results than on milk samples. Therefore, the combination of both conventional tests alongwith serum PCR can be recommended. [Vet. World 2010; 3(2.000: 53-56

  13. Absolute rate constants for the reaction of hypochlorous acid with protein side chains and peptide bonds

    DEFF Research Database (Denmark)

    Pattison, D I; Davies, Michael Jonathan

    2001-01-01

    , absolute second-order rate constants for the reactions of HOCl with protein side chains, model compounds, and backbone amide (peptide) bonds have been determined at physiological pH values. The reactivity of HOCl with potential reactive sites in proteins is summarized by the series: Met (3.8 x 10(7) M(-1....... Proteins are major targets for this oxidant, and such reaction results in side-chain modification, backbone fragmentation, and cross-linking. Despite a wealth of qualitative data for such reactions, little absolute kinetic data is available to rationalize the in vitro and in vivo data. In this study...

  14. Evaluation of the efficacy of real-time polymerase chain reaction for the routine early detection of Pseudomonas aeruginosa in cystic fibrosis sputum and throat swab specimens.

    LENUS (Irish Health Repository)

    Logan, Catriona

    2012-02-01

    A longitudinal study of 2099 sputa and throat swabs received from 183 pediatric cystic fibrosis patients over a 29-month period was used to evaluate the efficacy of real-time polymerase chain reaction (PCR) for the early detection of Pseudomonas aeruginosa as compared to microbiologic culture. Real-time PCR resulted in an increased number of specimens identified as P. aeruginosa positive. The sensitivity of culture was 82% (373\\/453) and of PCR was 93% (420\\/453) when considering both positive culture and PCR results as true positives. Of the 80 specimens identified as PCR positive\\/culture negative for P. aeruginosa, the subsequent patient sample in 32.5% (26\\/80) of specimens concerned was identified as P. aeruginosa culture positive, suggesting that PCR has the potential to detect P. aeruginosa earlier than the microbiologic culture. Real-time PCR analysis found no evidence of the Liverpool and Manchester epidemic P. aeruginosa strains in the cohort examined. The findings of this study highlight the importance of specimen collection protocols to ensure that adequate samples are received at the laboratory for testing, thereby minimizing the potential for reporting of false-negative P. aeruginosa culture results.

  15. Implementation of polymerase chain reaction (PCR) and Real-Time PCR in quick identification of bovine herpesvirus 1

    OpenAIRE

    Milić Nenad; Nišavić Jakov; Ašanin Ružica; Knežević Aleksandra; Ašanin Jelena; Vidanović D.; Šekler Milanko

    2010-01-01

    Examinations were performed on 65 samples of nasal smeas taken from calves and young cows with clinical symptoms of respiratory infection to determine the presence of the bovine herpes virus 1 using parallel implementation of molecular and standard methods of virological diagnostics. The appearance of a cytopathogenic effect (CPE) was not established in inoculated cell lines 24h, 48h and 72h following inoculation, or after two successive passages of the examined material sample through these ...

  16. Relative efficiency of polymerase chain reaction and enzyme-linked immunosorbant assay in determination of viral etiology in congenital cataract in infants

    Directory of Open Access Journals (Sweden)

    Shyamala G

    2008-01-01

    Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.

  17. Application of real time polymerase chain reaction targeting kex 1 gene & its comparison with the conventional methods for rapid detection of Pneumocystis jirovecii in clinical specimens

    Directory of Open Access Journals (Sweden)

    Mani Revathy

    2014-01-01

    Full Text Available Background & objectives: As there are no standard laboratory techniques for the rapid detection of Pneumocystis jirovecii in India, this study was undertaken to evaluate and establish an optimal and rapid technique for the detection of P. jirovecii by comparing three different techniques - staining technique, application of a real time polymerase chain reaction (RT-PCR targeting kex 1 gene and application of nested PCR targeting mitochondrial large subunit (mtLSU gene for rapid detection of P. jirovecii in HIV positive patients. Methods: One hundred and fifty sputum specimens from HIV positive (n = 75 and HIV negative (n = 75 patients were subjected to three different techniques -KOH/Calcoflour and Grocott methanamine silver staining (GMS, RT-PCR targeting kex1 gene, PCR targeting mtLSU region followed by DNA sequencing and BLAST analysis. Results: Among the 75 HIV positive patients, P. jirovecii was detected in 19 (25.33% patients by the staining techniques, and in 23 (30.65% patients each by PCR targeting mtLSU region and by RT- PCR targeting kex1 gene of P. jirovecii. PCR based DNA sequencing targeting mtLSU region revealed 97-100 per cent sequence homology with P. jirovecii sequences in GenBank. Interpretation & conclusions: Of the three techniques for detection of P. jirovecii evaluated in this study, false negativity was found to be more in staining technique and it also required high technical expertise to interpret the result. Both nested PCR and RT-PCR were reliable and equally sensitive, in rapid detection of P. jirovecii, but RT-PCR technique also generated the copy numbers for knowing the severity of infection.

  18. Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

    DEFF Research Database (Denmark)

    Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard;

    2015-01-01

    reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...

  19. DETECTION OF BORRELIA BURGDOFERI DNA IN GRANULOMATOUS TISSUES FROM PATIENTSWITH SARCOIDOSIS USING POLYMERASE CHAIN REACTION IN SITU TECHNIQUE

    Institute of Scientific and Technical Information of China (English)

    徐作军; 马东来; 罗慰慈; 朱元珏

    1996-01-01

    To investigate the correlation between sarcoidosis and Borrelia burgdorferi (Bb) infection,flagella DNA of Bb were detected in 23 granulomatous tissue specimens from patients with confirmed sarcoidosis usingpolymerase chain reaction in situ technique (in situ PCR) and the antibodies to Bb were examined in 55 serum samples obtained from the patients by indirect immunoflurescence assays. Our data presented that =(1) None of granulomatous tissues was found to have Bb DNA in 23 tissue samples. (2) Thirty of 55(54.6%) patients with sarcoidosis were found antibodies to Bh positive,in contrast,six of 60 (10%) norreal subjects had antibodies against Bb,the positive rate was remarkably higher in patient group than thatin healthy group (P(0. 005). The results suggest that Bb might not be the causative agent of sarcoidosis,the elevated titres of serum antibodies against Bb in patients with sarcoidosis is a nonspecific response.

  20. A new measurement approach of ionizing radiation in irradiated trout (Oncorhynchus mykiss) by Randomly Polymorphic DNA-Polymerase Chain Reaction.

    Science.gov (United States)

    Şakalar, Ergün; Mol, Sühendan

    2016-05-01

    Trout (Oncorhynchus mykiss) were irradiated at doses of 0.250, 0.500, 1, 3, 5, 7 and 9 kGy in gamma cell. DNAs were extracted from the irradiated samples before and after storage. 1ERP primers were designed, and RAPD-PCR (Randomly Polymorphic DNA-Polymerase Chain Reaction) was applied to make randomly amplifications on the DNA of the irradiated samples. Agarose gel profiles of irradiated fish were obtained to determine change of band profiles. In addition, DNA fragmentation occurring in each dose was determined by comet assay for the verification of methodology developed in this study. The molecular methodology was developed to estimate ionizing radiation (IR) level in irradiated fish. This methodology allows the analysis of the trout irradiated up to the dose limit of around 0.5 kGy and stored for a period of three months. PMID:27407216

  1. DCHAIN: A user-friendly computer program for radioactive decay and reaction chain calculations

    International Nuclear Information System (INIS)

    A computer program for calculating the time-dependent daughter populations in radioactive decay and nuclear reaction chains is described. Chain members can have non-zero initial populations and be produced from the preceding chain member as the result of radioactive decay, a nuclear reaction, or both. As presently implemented, chains can contain up to 15 members. Program input can be supplied interactively or read from ASCII data files. Time units for half-lives, etc. can be specified during data entry. Input values are verified and can be modified if necessary, before used in calculations. Output results can be saved in ASCII files in a format suitable for including in reports or other documents. The calculational method, described in some detail, utilizes a generalized form of the Bateman equations. The program is written in the C language in conformance with current ANSI standards and can be used on multiple hardware platforms

  2. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    Science.gov (United States)

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2016-04-01

    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. PMID:26879193

  3. The use of serotype 1-and serotype 3-specific polymerase chain reaction for the detection of Marek's disease virus in chickens

    DEFF Research Database (Denmark)

    Handberg, Kurt; Nielsen, Ole L.; Jørgensen, Poul Henrik

    2001-01-01

    to develop and evaluate a reliable and easy-to-handle method for surveillance of the occurrence of MDV in chicken flocks. We emphasize the development of a method, which can be applied to types of samples conveniently collected in the field, e.g. feather tips and blood samples. In addition, the PCR...... albumen pretreatment. The PCR proved to be a convenient tool for the monitoring of MDV in the poultry population, and feather tips were the most convenient and sensitive samples.......A serotype 1- and serotype 3-specific detection of Marek's disease virus (MDV) by polymerase chain reaction (PCR) was developed. The sensitivity of the method when applied to cell culture grown virus was comparable with that of cultivation. The method was applied to various tissue samples from...

  4. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

    Science.gov (United States)

    Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

  5. Mycobacterium avium restriction fragment lenght polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains

    Directory of Open Access Journals (Sweden)

    Patrícia Carvalho de Sequeira

    2005-11-01

    Full Text Available Simple double repetitive element polymerase chain reaction (MaDRE-PCR and Pvu II-IS1245 restriction fragment length polymorphism (RFLP typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

  6. Quantification of Staphylococcus aureus and Staphylococcus epidermidis on the hands of health-care workers using a real-time polymerase chain reaction method

    DEFF Research Database (Denmark)

    Horn, P; Schouenborg, P Øland; Brandslund, I

    2007-01-01

    OBJECTIVE: The objective of this study was to test a polymerase chain reaction (PCR) assay intended as a tool for monitoring hand hygiene in hospital wards. METHODS: The hands of 20 health-care workers were sampled for 10 days using real-time PCR for quantification of Staphylococcus aureus and S....... aureus and 211% for S. epidermidis. In an intervention study aimed at better hand hygiene in a ward with n participants, the difference before and after intervention is significant at CDI/sqrt[n] per cent. CONCLUSIONS: The PCR assay can be used to detect change in a group mean of S. aureus and S....... epidermidis in a hospital ward, i.e. before and after an intervention to improve hand hygiene. For the individual, the change in bacteria levels needed for significance is compromised by high intra-individual variation....

  7. [Detection of the eggs of Echinococcus multilocularis Leuckart, 1863, in the feces of the fox (Vulpes vulpes Linnaeus, 1758) by the polymerase chain reaction].

    Science.gov (United States)

    Bretagne, S; Guillou, J P; Morand, M; Houin, R

    1992-12-01

    The polymerase chain reaction (PCR) was applied to the identification of eggs of Echinococcus multilocularis in faeces from foxes. The test was positive in three of six faeces samples from foxes which were harbouring adult worms, and in one of four samples from foxes in which no adult E. multilocularis was found in the intestines. These initial results show that it is possible to use PCR to identify E. multilocularis eggs in faeces. PCR can be used to complement examination of intestinal contents, showing that the distribution of eggs in faeces is uneven. The sensitivity of the test was estimated to be 50 eggs in 5 g of faeces. Further work is needed to confirm these initial results before the test can be used more widely. PMID:1305852

  8. Development of cytomegalovirus (CMV) disease may be predicted in HIV-infected patients by CMV polymerase chain reaction and the antigenemia test

    DEFF Research Database (Denmark)

    Dodt, K K; Jacobsen, P H; Hofmann, B;

    1997-01-01

    OBJECTIVE: Cytomegalovirus (CMV) is a frequent opportunistic viral pathogen in patients with AIDS leading to retinitis and other serious manifestations. CMV disease may be successfully treated. Prophylactic antiviral therapy has been shown to reduce the risk of CMV disease if initiated early. We...... evaluated PCR and the antigenemia tests as methods for early detection of CMV disease. METHODS: Two-hundred HIV-seropositive subjects with CD4 T-cell counts below 100 x 10(6)/l were monitored with CMV polymerase chain reaction (PCR), the antigenemia test, blood cultures and CMV immunoglobulin (Ig) G and Ig......M titres every second month for 1 year. RESULTS: Thirty-eight patients (19%) developed CMV disease. The PCR test detected CMV DNA a median of 46 days before onset of disease. This was earlier than the median of 34 for the antigenemia test and a median of 1 day for CMV blood cultures. Univariate analysis...

  9. Successful treatment of toxoplasmic encephalitis diagnosed early by polymerase chain reaction after allogeneic hematopoietic stem cell transplantation: two case reports and review of the literature.

    Science.gov (United States)

    Miyagi, T; Itonaga, H; Aosai, F; Taguchi, J; Norose, K; Mochizuki, K; Fujii, H; Furumoto, A; Ohama, M; Karimata, K; Yamanoha, A; Taniguchi, H; Sato, S; Taira, N; Moriuchi, Y; Fukushima, T; Masuzaki, H; Miyazaki, Y

    2015-08-01

    Toxoplasmic encephalitis represents a rare, but often fatal infection after allogeneic hematopoietic stem cell transplantation. Polymerase chain reaction (PCR)-based preemptive therapy is considered promising for this disease, but is not routinely applied, especially in low seroprevalence countries including Japan. We encountered 2 cases of toxoplasmic encephalitis after transplantation that were successfully treated. The diagnosis of toxoplasmic encephalitis in these cases was confirmed by PCR testing when neurological symptoms were observed. Both patients received pyrimethamine and sulfadiazine treatments within 2 weeks of the development of neurological symptoms, and remained free of recurrence for 32 and 12 months. These results emphasized the importance of the PCR test and immediate treatment after diagnosis for the management of toxoplasmic encephalitis. PMID:25970830

  10. Method of carbon chain extension using novel aldol reaction

    Energy Technology Data Exchange (ETDEWEB)

    Silks, Louis A; Gordon, John C; Wu, Ruilan; Hangson, Susan Kloek

    2013-08-13

    Method of producing C.sub.8-C.sub.15 hydrocarbons comprising providing a ketone starting material; providing an aldol starting material comprising hydroxymethylfurfural; mixing the ketone starting material and the aldol starting material in a reaction in the presence of a proline-containing catalyst selected from the group consisting of Zn(Pro).sub.2, Yb(Pro).sub.2, and combinations thereof, or a catalyst having one of the structures (I), (II) or (III), and in the presence of a solvent, wherein the solvent comprises water and is substantially free of organic solvents, where (I), (II) and (III) respectively are: ##STR00001## where R.sub.1 is a C.sub.1-C.sub.6 alkyl moiety, X=(OH) and n=2. ##STR00002## In (III), X may be CH.sub.2, sulfur or selenium, M may be Zn, Mg, or a lanthanide, and R.sub.1 and R.sub.2 each independently may be a methyl, ethyl, phenyl moiety.

  11. Overcoming RNA inhibition in the fluorescent polymerase chain reaction assay to enhance detection of bovine DNA in cattle feeds.

    Science.gov (United States)

    Sawyer, Mary; Rensen, Gabriel; Smith, Wayne; Yee, Melanie; Wong, Alice; Osburn, Bennie; Cullor, James

    2004-01-01

    The practice of incorporating mammalian protein in ruminant feeds was banned in the United States in 1997 as a measure to avoid transmission of bovine spongiform encephalopathy (BSE). A sensitive means of identifying the banned additives in feeds would be by detection of species-specific DNA using the polymerase chain reaction (PCR). However, problems may arise in the PCR due to the presence of inhibitory substances. Using human DNA as an internal PCR control, inhibitory substances were evident in the DNA extraction products of cattle feeds. The results of heating experiments excluded enzymes as a cause of inhibition, and spectrophotometric calculations suggested the possibility of RNA contamination. Co-electrophoresis of untreated and RNAse digested extracts confirmed the presence of RNA in the undigested product. Seven cattle feeds were spiked with predetermined amounts of bovine meat and bone meal (BMBM). The DNA extracted products were treated with RNAse and the bovine specific mitochondrial DNA (B-mtDNA) was amplified by PCR. The minimum level of detection of B-mtDNA was influenced by RNAse treatment and feed composition. RNAse treatment decreased false-negative results overall by 75%. False-negative results were decreased 100% in the higher BMBM concentrations and 50% in the lower BMBM concentrations. Also, each cattle feed was spiked to attain a 2% wt/wt concentration with each swine, fish, sheep, or poultry product, or cattle dried blood. Amplification of B-mtDNA occurred only with the cattle dried blood and only in three feeds in which B-mtDNA was detected at the only level tested (2%). A commercial immunochromotographic assay (Neogen) detected the spiked BMBM in only one of the seven feeds and only at the upper concentration (1%). PMID:15992269

  12. Optimization and Validation of a Real Time Reverse Transcriptase Polymerase Chain Reaction with RNA Internal Control to Detect Rubella RNA

    Directory of Open Access Journals (Sweden)

    Winny Xie

    2013-12-01

    Full Text Available BACKGROUND: According to a report from WHO, cases of rubella infection in Indonesia has increased up to 10-fold from 2007 to 2011. Despite no data of congenital rubella syndrome in the report, there are approximately 45,000 cases of babies born with heart failure and 0.1-0.3% live births with congenital deafness in Indonesia. Allegedly, rubella infection during pregnancy may play a role in this condition. This study aimed to optimize and validate a real-time reverse transcriptase polymerase chain reaction (RT-qPCR method to detect rubella virus RNA as an aid for the diagnosis of congenital rubella infection. METHODS: Method optimization was conducted using nucleic acids extracted from Trimovax Merieux vaccine with the High Pure Viral Nucleic Acid Kit. One step RT-qPCR was performed with Quantifast Multiplex RTPCR+R Kit. Target synthetic DNA was designed and used to determine the sensitivity of the method. RNA internal control was synthesized to control the process of extraction and amplification. RESULTS: The analytical sensitivity of this method was as low as 5 copies target synthetic DNA/μl. The mean Coefficient of Variation (CV % of the critical threshold (Ct obtained were 2.71%, 1.20%, 1.62%, and 1.59% for within run, between run, between kit lots, and between operators, respectively. Recovery of the target synthetic DNA from amniotic fluid was 100.51% (by the log copies/μl at the concentration of 1,000,000 copies/μl. CONCLUSIONS: RT-qPCR is successfully used for the detection of rubella virus RNA in vaccine and synthetic nucleic acid. With its high sensitivity, good precision and recovery, this method offers a means to improve the diagnosis of congenital rubella infection in developing countries like Indonesia. KEYWORDS: congenital rubella, RT-qPCR, prenatal diagnosis, amniotic fluid.

  13. Differential detection of Entamoeba histolytica from Entamoeba dispar by parasitological and nested multiplex polymerase chain reaction methods

    Directory of Open Access Journals (Sweden)

    esmaiel fallah

    2014-02-01

    Full Text Available Introduction: Amebiasis is an intestinal illness caused by a one-celled parasite (amoeba called Entamoeba (E histolytica. E histolytica and E dispar are morphologicallyundistinguishable but have genetic and functional differences. E. histolytica is invasive andcause amoebiasis, but E dispar cause an asymptomatic colonization which does not need to bemedically treated. We have performed a nested multiplex Polymerase Chain Reaction (PCRtargeting small subunit rRNA (Ribosomal ribonucleic acid gene for differential detection of Ehistolytica and E dispar directly from stool samples. Methods: All the fecal samples collected without preservation and were screened for amebiccells by parasitological methods. Fecal samples that containing amebic cells were stored at -20ºC until DNA extraction. DNA extraction was down by using a DNA extraction kit. Thegenus specific primers were designed using nucleotide sequences of 18S-rRNA gene ofEntamoeba. Results: Thirty one (4.28% stool samples out of 724 samples were positive for E histolytica/E dispar. The nested multiplex PCR illustrated that the size of diagnostic fragments of PCR products was obviously different for two Entamoeba species, the specific product size for Ehistolytica and E dispar was 439 and 174 bp. The nested multiplex PCR was positive in 25 outof 31 stool specimens that 17 (54.8% samples were positive for E dispar and 8 (25.8%samples were positive for E histolytica. Conclusion: Nested multiplex PCR was useful for the specific detection of E histolytica and Edispar in stool samples. In current study we detected that E dispar was more prevalent in our study area.

  14. Testing for Genetically Modified Foods Using PCR

    Science.gov (United States)

    Taylor, Ann; Sajan, Samin

    2005-01-01

    The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…

  15. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    Science.gov (United States)

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  16. Report on waterborne diseases: The polymerase chain reaction for the identification of enteric viruses in water; Rapporto sulle malattie infettive di origine idricamerizzazione a catena per l`identificazione dei virus enterici nell`acqua

    Energy Technology Data Exchange (ETDEWEB)

    Muscillo, M.; La Rosa, G. [Istituto Superiore di Sanita, Rome (Italy). Lab. di Igiene Ambientale

    1995-12-01

    A variety of human infectious diseases are associated with the pollution of water by enteric viruses. The epidemiological data on cases associated with drinking and recreational water show Norwalk, hepatitis A and E viruses, rotavirus and enteroviruses as the etiological agents. The polymerase chain reaction (PCR) is certainly the most reliable technique available for the rapid identification of these viruses in water samples.

  17. Pea (Pisum sativum) genes involved in symbiosis with nitrogen-fixing bacteria.1.Analysis of the expression of the early nodulin gene ENOD12 using the polymerase chain-reaction

    NARCIS (Netherlands)

    Zalenskii, A.O.; Kozik, A.V.; Scheres, B.J.G.; Bisseling, A.; Tikhonovich, I.A.

    1991-01-01

    The polymerase chain reaction (PCR) was used to detect the transcription products of the early nodulin gene in the pea. Single-stranded DNA copies were prepared using a primer corresponding to the terminal part of a previously sequenced cDNA clone and a total RNA isolate. The presence of amplificati

  18. Detection of very low level Plasmodium falciparum infections using the nested polymerase chain reaction and a reassessment of the epidemiology of unstable malaria in Sudan

    DEFF Research Database (Denmark)

    Roper, C; Elhassan, I M; Hviid, L;

    1996-01-01

    We have used the nested polymerase chain reaction (PCR) to assay for low level Plasmodium falciparum infections that were below the threshold of detection of blood film examination. This revealed a substantial group of asymptomatic, submicroscopically patent infections within the population of a...

  19. Rapid detection of cytomegalovirus in bronchoalveolar lavage fluid and serum samples by polymerase chain reaction: correlation of virus isolation and clinical outcome for patients with human immunodeficiency virus infection

    DEFF Research Database (Denmark)

    Hansen, K K; Vestbo, Jørgen; Benfield, T;

    1997-01-01

    Bronchoalveolar lavage (BAL) fluids and serum samples from 153 patients with pulmonary symptoms who were infected with human immunodeficiency virus (HIV) and underwent BAL were examined for the presence of cytomegalovirus (CMV) by conventional culture and by polymerase chain reaction (PCR) for...

  20. A thermostat chip of indium tin oxide glass substrate for static polymerase chain reaction and in situ real time fluorescence monitoring

    International Nuclear Information System (INIS)

    A thermostat chip of indium-tin oxide glass substrate for static chip polymerase chain reaction (PCR) is, for the first time, introduced in this paper. The transparent conductive layer was used as an electro-heating element. Pulse width modulation and fuzzy proportional integration-differentiation algorithm were adopted in the temperature programming of the chip. The temperature distribution was investigated, and a dynamic control precision within ±2 deg. C was achieved. The highest ramping rates were 37 deg. C s-1 for heating and 8 deg. C s-1 for cooling with an electric fan. The PCR reaction vials were constructed with polyethylene tubes or poly(dimethylsiloxane) directly on the thermostat chip; the chip had a typical size of 25 mm x 25 mm and a thickness of 1.1 mm. Static chip PCR was successfully demonstrated either in a single vial or in an up to 8-parallel array vials. In situ real time fluorescence monitoring during PCR of a λ DNA fragments (236 bp) with SYBR Green I was demonstrated using a blue light emission diode as a light source and a photomultiplier as a detector. The method proposed here is characterized by open access, easy fabrication and low cost. This work could be the basis for developing a portable real time PCR system with disposable chips for point of care tests